Grna for targeting mutant allele and uses thereof
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-31
- Publication Date
- 2026-04-08
AI Technical Summary
Current gene therapies face challenges in effectively silencing pathogenic alleles while preserving wild-type genes, particularly in treating inherited human diseases caused by gene mutations, insertions/deletions, and SNPs, which requires precise targeting of mutant alleles.
Development of guide RNA (gRNA) sequences that target mutant alleles within specific nucleotide proximity to the PAM sequence, allowing for precise modulation of mutant genes without affecting wild-type alleles, using CRISPR-Cas systems to edit genes associated with disorders like IBMPFD and AD-HIES.
The gRNA sequences enable targeted editing of mutant alleles, potentially treating genetic disorders by allowing healthy alleles to be expressed while silencing the pathogenic ones, thus addressing the challenge of dominant-negative mutations.
Smart Images

Figure 000037 
Figure 000038 
Figure 000039
Abstract
Description
GRNA FOR TARGETING MUTANT ALLELE AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION
[0001] This PCT application claims the benefit of, U.S. Provisional Patent Application No. 63 / 470,307, filed June 1, 2023, entitled “GRNA FOR TARGETING MUTANT ALLELES AND USES THEREOF,” which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] The sequence listing submitted on May 31, 2024, as an .XML file entitled “10935- 029WOl_ST26” created on May 31, 2024, and having a file size of 101,894 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).BACKGROUND
[0003] Inherited human diseases are caused by different types of gene mutations, insertions / deletions (indels), genomic structural variations, as well as pathogenic single nucleotide polymorphisms (SNPs). The treatment strategy for diseases with dominant-negative mutations typically involves the silence of the pathogenic alleles in an allele-specific manner, without affecting the wild-type ones. This presents a great challenge for conducting gene -therapies. What are needed are new compositions and methods for treating genetic disorders.SUMMARY
[0004] The present disclosure relates to system, compositions, and kits for modulating a mutant allele of a gene.
[0005] In one aspect, disclosed herein are systems, compositions, and kits for modulating a mutant allele of a gene, said system comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more mutations, wherein at least one of the one or more mutations is within 7 nucleotides (for example, within 6, 5, 4, 3, 2, or 1 nucleotides) upstream the 5’ end of a protospacer adjacent motif (PAM) sequence. In some examples, the gRNA does not target the wildtype allele of the gene. The mutant allele can comprise a target strand and a non-target strand complementary to the target strand, and wherein the gRNA is complementary to target strand. The one or more mutations can be point mutations, insertions, deletions, or translocations.
[0006] Also disclosed herein are systems, compositions, and kits for modulating a mutant allele of a gene of any preceding aspect, wherein the subject in need comprises a mutant allele of a VCP gene,a STAT3 gene, a D0CK8 gene, a TBCD gene, or a KCNT1 gene. In some embodiments, the mutant allele of the VCP gene comprises SEQ ID NO: 10, or a fragment thereof.
[0007] In one aspect, disclosed herein are systems, compositions, and kits for modulating a mutant allele of a gene of any preceding aspect, wherein the non-target strand comprises one or more mutations, and wherein at least one of the one or more mutations is within 7 nucleotides upstream the 5’ end of the PAM sequence. In some embodiments, the system or method of any preceding aspect further comprises a Cas nuclease. In some embodiments, the PAM sequence comprises NGG, NNGRR, NNGRRT, or NNNNGATT. In some embodiments, the PAM sequence comprises AAGAA, TGGGAT, GGG, or TGG.
[0008] Also disclosed herein are systems, compositions, and kits for modulating a mutant allele of a gene of any preceding aspect, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof.
[0009] In some aspects, the mutant allele is associated with a genetic disorder. Accordingly, in some aspects, the system of any preceding aspect is for treatment of a genetic disorder in a subject in need. The genetic disorder can be, but limited to, inclusion body myopathy associated with Paget’s disease of bone and frontotemporal dementia (IBMPFD) or autosomal dominant hyper-IgE syndrome (AD- HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy. In some embodiments, the subject in need comprises a mutant allele of a VCP gene, a STAT3 gene, a DOCK8 gene, a TBCD gene, or a KCNT1 gene. In some embodiments, the mutant allele of the VCP gene comprises SEQ ID NO: 10 or a fragment thereof.
[0010] Also disclosed herein is a method of treating a genetic disorder (such as, for example, inclusion body myopathy associated with Paget’s disease of bone and frontotemporal dementia (IBMPFD) or autosomal dominant hyper-IgE syndrome (AD-HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy) in a subject in need, comprising administering to the subject the system or composition of any preceding aspect.BRIEF DESCRIPTION OF FIGURES
[0011] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain examples of the present disclosure and together with the description, serve to explain, without limitation, the principles of the disclosure. Like numbers represent the sameelements throughout the figures.
[0012] FIG. 1 shows design of gRNAs for targeting mutant allele in IBMPFD patients.
[0013] FIG. 2 shows analysis results of human SpCas9 gRNAs in wildtype and mutant allele.
[0014] FIG. 3 shows analysis results of SpCas9 gRNAs on mouse myoblast VCP NeoCassette.
[0015] FIG. 4 shows analysis result of SpCas9 gRNAs on healthy mouse fibroblast.
[0016] FIG. 5 displays schematic showing targeting autosomal dominant genetic disorders using gRNAs recognizing only the mutant allele.
[0017] FIG. 6 shows design of gRNA.DETAILED DESCRIPTION
[0018] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment. To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.Terminology
[0019] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.
[0020] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value isdisclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10” as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0021] “Administration” or “administering” to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. “Systemic administration” refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g., greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject’s body. Administration includes self-administration and the administration by another.
[0022] A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."
[0023] “Complementary” or “substantially complementary” refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T / U, or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98% to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary. See Kanehisa (1984) Nucl. Acids Res. 12:203.
[0024] The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed.
[0025] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
[0026] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a "non-coding" RNA (ncRNA), a guide RNA, etc.).
[0027] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. Anexpression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.)
[0028] The “fragments,” whether attached to other sequences or not, can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified peptide or protein. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the fragment must possess a bioactive property, such as regulating the transcription of the target gene.
[0029] The term "gene" or "gene sequence" refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term "gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site).
[0030] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) nucleotide sequence identity isdefined as the percentage of amino acids in a candidate sequence that are identical to the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.
[0031] For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0032] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of11, an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0033] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01.
[0034] The term "naturally-occurring" or "unmodified" or "wild type" as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature, and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring).
[0035] The term “increased” or “increase” as used herein generally means an increase by a statically significant amount; for the avoidance of any doubt, “increased” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level so long as the increase is statistically significant.
[0036] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.
[0037] The term "nucleic acid" as used herein means a polymer composed of nucleotides, e.g., deoxyribonucleotides (DNA) or ribonucleotides (RNA). The terms "ribonucleic acid" and "RNA" as used herein mean a polymer composed of ribonucleotides. The terms "deoxyribonucleic acid" and "DNA" as used herein mean a polymer composed of deoxyribonucleo tides.
[0038] “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0039] As used herein, "operatively linked" can indicate that the regulatory sequences useful for expression of the coding sequences of a nucleic acid are placed in the nucleic acid molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of coding sequences and / or transcription control elements (e.g. promoters, enhancers, and termination elements), and / or selectable markers in an expression vector. The term "operatively linked" can also refer to the arrangement of polypeptide segments within a single polypeptide chain, where the individual polypeptide segments can be, without limitation, a protein, fragments thereof, linking peptides, and / or signal peptides. The term operatively linked can refer to direct fusion of different individual polypeptides within the single polypeptides or fragments thereof where there are no intervening amino acids between the different segments as well as when the individual polypeptides are connected to one another via one or more intervening amino acids.
[0040] The term "polynucleotide" refers to a single or double stranded polymer composed of nucleotide monomers.
[0041] "Pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.
[0042] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as anoil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
[0043] As used herein, by a “subject” means an individual. Thus, the “subject” can include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, chickens, ducks, geese, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), and birds. “Subject” can also include a mammal, such as a primate or a human. Thus, the subject can be a human or veterinary patient.
[0044] The terms “treat,” “treating,” “treatment,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating, or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively, or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of a genetic disorder), during early onset (e.g., upon initial signs and symptoms of a genetic disorder), or after an established development of a genetic disorder. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of a genetic disorder.
[0045] As used herein, the term, “deletion”, also called gene deletion, deficiency, or deletion mutation, refers to part of a chromosome or a sequence of DNA being left out during DNA replication. Deletion, or gene deletions can cause any number of nucleotides to be deleted from a single base to an entire piece of chromosome.
[0046] “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent, or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0047] “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a genetic disorder). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
[0048] “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g., a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of cancer. In some embodiments, a desired therapeutic result is the control of metastasis. In some embodiments, a desired therapeutic result is the reduction of tumor size. In some embodiments, a desired therapeutic result is the prevention and / or treatment of relapse. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.
[0049] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; W02007025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes.
[0050] As used herein, an “effector” or “effector protein” is a protein that encompasses an activity including recognizing, binding to, and / or cleaving or nicking a polynucleotide target. An effector, oreffector protein, may also be an endonuclease. The “effector complex” of a CRISPR system includes Cas proteins involved in crRNA and target recognition and binding. Some of the component Cas proteins may additionally comprise domains involved in target polynucleotide cleavage.
[0051] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. Contemplated herein are any Cas molecules that comprise a Rec3 clamp, as described below.
[0052] As used herein, the term "Cas9 protein" refers to, but is not limited to, Cas9 proteins, Cas9- type proteins encoded by Cas9 orthologs, and synthetic proteins of Cas9. The term "Cas9 protein" as used herein refers to a wild type Cas9 protein from CRISPR-Cas9 type II B systems, Cas9 protein modifications, Cas9 protein variants, Cas9 orthologs and combinations of the same. The term "dCas9" as used herein refers to Cas9 protein variants that are Cas9 proteins deactivated by nuclease, also referred to as "catalytically inactive Cas9 protein", or "enzymatically inactive Cas9". Various Cas9s and their relationship with each other can be found in Gasiunas, et al. (Gasiunas G., Young, J.K., Karvelis, T. et al. A catalogue of biochemically diverse CRISPR-Cas9 orthologs. Nat Commun 11, 5512 2020, hereby incorporated by reference in its entirety for its discussion concerning Cas9 molecules).
[0053] A Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 30%, between 30% and 35%, at least 35%, between 35% and 40%, at least 40%, between 40% and 45%, at least 45%, between 45% and 50%, at least 50%, between 50% and 55%, at least 55%, between 55% and 60%, at least 60%, between 60% and 65%, at least 65%, between 65% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 85%, at least 85%, between 85% and 90%, at least 90%, between 90% and 95%, at least 95%, between 95% and 96%, at least 96%, between 96% and 97%, at least 97%, between 97% and 98%, at least 98%, between 98% and 99%, at least 99%, between 99% and 100%, or 100% sequence identity with at least 50, between 50 and 100, at least 100, between 100 and 150, at least 150, between 150 and 200, at least 200, between 200 and 250, at least 250, between 250 and 300, at least 300, between 300 and 350, at least 350, between 350 and 400, at least 400, between 400 and 450, at least 500, or greater than 500 contiguous amino acids of a native Cas protein, and retains at least partial activity of the native sequence.
[0054] A Cas endonuclease may also include a multifunctional Cas endonuclease. The term “multifunctional Cas endonuclease” and “multifunctional Cas endonuclease polypeptide” are usedinterchangeably herein and includes reference to a single polypeptide that has Cas endonuclease functionality (comprising at least one protein domain that can act as a Cas endonuclease) and at least one other functionality, such as but not limited to, the functionality to form a complex (comprises at least a second protein domain that can form a complex with other proteins). In one aspect, the multifunctional Cas endonuclease comprises at least one additional protein domain relative (either internally, upstream (5’), downstream (3’), or both internally 5’ and 3’, or any combination thereof) to those domains typical of a Cas endonuclease.
[0055] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).
[0056] The terms “target site”, “target sequence”, “target site sequence,” target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick orcleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature.
[0057] A “protospacer adjacent motif’ (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein or a non-target sequence that is complementary to the target sequence. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.
[0058] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.Systems and Methods of Use
[0059] Disclosed herein are system comprising gRNAs targeting only mutant allele in autosomal dominant genetic disorders and to allow healthy allele to being expressed. In this technology, the mutated sequence of the mutant allele within 7 nucleotides (e.g., within 6, 5, 4, 3, 2, or 1 nucleotides) at 5' side of the PAM sequence is included in the gRNA. This enables targeting the mutant allele but not the healthy allele in cells or a subject in need (for example, a subject having a genetic disorder). This strategy can be used for any autosomal dominant inheritance disorders.
[0060] Accordingly, in some aspects, disclosed herein is a system, a composition, or a kit for modulating a mutant allele of a gene, said system comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more mutations, wherein at least one of the one or more mutations is within 7 nucleotides (e.g., within 6, 5, 4, 3, 2, or 1 nucleotides) upstream the 5’ end of a protospacer adjacent motif (PAM) sequence. It should be understood and herein contemplated that the mutant allele comprises a target strand and a non-target strand complementary to the target strand, and wherein the gRNA is complementary to the target strand. Accordingly, the non-target strand comprises one or more mutations, and wherein at least one of the one or more mutations is within 7 nucleotides upstream the 5’ end of the PAM sequence.
[0061] As noted above, the mutated sequence (e.g., on the non-target strand) of the mutant allele within 7 nucleotides (e.g., within 6, 5, 4, 3, 2, or 1 nucleotides) at 5' side of the PAM sequence is included in the gRNA. Accordingly, in some aspects, disclosed herein is a method of creating a gRNA for modulating a mutant allele of a gene, said method comprising determining a mutated sequence of the mutant allele that comprises one or more mutations upstream of the 5’ end of a PAM sequence; and obtaining an RNA comprising the mutated sequence thereby creating the gRNA for the mutant allele.
[0062] The one or more mutations of any preceding aspect can be point mutations, insertions, deletions, or translocations. In some embodiments, the one or more mutations are point mutations. Accordingly, in some aspects, disclosed herein is a composition, system, or kit for modulating a mutant allele of a gene, said composition, system, or kit comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more point mutations, wherein at least one of the one or more point mutations is within 7 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence.
[0063] In some embodiments, the PAM sequence comprises NGG, NNGRR, NNGRRT, or NNNNGATT. In some embodiments, the PAM sequence comprises AAGAA, TGGGAT, GGG, or TGG. Accordingly, in some aspects, disclosed herein is a composition, system, or kit for modulating a mutant allele of a gene, said composition, system, or kit comprising a guide RNA (gRNA) sequencetargeting the mutant allele of the gene comprising one or more point mutations, wherein at least one of the one or more point mutations is within 7 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence, and wherein the PAM sequence comprises AAGAA, TGGGAT, GGG, or TGG.
[0064] In some embodiments, the system, composition, or kit of any preceding aspect further comprises a Cas nuclease.
[0065] As noted above, the mutant allele can be associated with a genetic disorder (e.g., a dominantnegative disorder). Accordingly, in some aspects, disclosed herein is a composition, system, or kit for modulating a mutant allele of a gene associated with a genetic disorder, said composition, system, or kit comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more point mutations, wherein at least one of the one or more point mutations is within 7 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence, and wherein the gRNA does not target the wild-type allele of the gene. Also disclosed herein is a composition, system, or kit for treating a genetic disorder in a subject in need, said composition, system, or kit comprising a guide RNA (gRNA) sequence targeting a mutant allele of a gene associated with the genetic disorder, wherein the mutant allele comprises one or more point mutations, wherein at least one of the one or more point mutations is within 7 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence, and wherein the gRNA does not target the wild-type allele of the gene.
[0066] In some embodiments, the genetic disorder is a dominant- negative disorder. In some embodiments, the genetic disorder comprises inclusion body myopathy associated with Paget’s disease of bone and frontotemporal dementia (IBMPFD) or autosomal dominant hyper- IgE syndrome (AD-HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy. IBMPFD is related to a mutated VCP gene and AD- HIES is related to a mutated STAT3 gene and / or a mutated DOCK8 gene. Accordingly, in some examples, the composition, system, or kit for treatment of IBMPFD can comprise a gRNA that targets a mutated VCP gene. In some examples, the composition, system, or kit for treatment of AD-HIES comprise one or more gRNAs that target a mutated STAT3 gene and / or a mutated DOCK8 gene.
[0067] In some embodiments, the mutant allele of the VCP gene comprises SEQ ID NO: 10 or a fragment thereof. In some embodiments, the gRNA of the composition, system, or kit disclosed comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof.
[0068] Accordingly, in some aspects, disclosed herein is a composition, system, or kit for modulating a mutant allele of a VCP gene in a cell or a subject in need, said composition, system, or kitcomprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more point mutations, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof. Also disclosed herein is a composition, system, or kit for treating IBMPFD in a subject in need, said composition, system, or kit comprising a guide RNA (gRNA) sequence targeting a mutant allele of a VCP gene, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof. In some embodiments, the system, composition, or kit of any preceding aspect further comprises a Cas nuclease.
[0069] In some aspects, disclosed herein is a method of treating a genetic disorder in subject in need, comprising administering to the subject an effective amount of a composition comprising a guide RNA (gRNA) sequence targeting a mutant allele of a gene associated with the genetic disorder, wherein the mutant allele comprises one or more mutations within 7 (e.g., within 6, 5, 4, 3, 2, or 1 nucleotides) nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence. In some embodiments, the composition further comprises a Cas endonuclease. In some embodiments, the one or more mutations are point mutations, insertions, deletions, or translocations. In some embodiments, the PAM sequence comprises NGG, NNGRR, NNGRRT, or NNNNGATT. In some embodiments, the PAM sequence comprises AAGAA, TGGGAT, GGG, or TGG. In some embodiments, the genetic disorder is a dominant-negative disorder (for example, body myopathy associated with Paget’s disease of bone and frontotemporal dementia (IBMPFD) or autosomal dominant hyper-IgE syndrome (AD-HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy). The TBCD associated diseases can be, for example, encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum and seborrhea-like dermatitis with psoriasiform elements. In some embodiments, the mutant allele is of VCP gene, STAT3 gene, or DOCK8. KCNT1, TC gene. In some embodiments, the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof. In some embodiments, the gRNA targets SEQ ID NO: 10 or a fragment thereof.
[0070] In some embodiments, the composition is formulated within a pharmaceutically acceptable carrier.Route of Administration
[0071] Genome editing systems, or cells altered or manipulated using such systems, which include the Cas9 variants disclosed herein, can be administered to subjects by any suitable mode or route, whether local or systemic. Systemic modes of administration include oral and parenteral routes. Parenteral routes include, by way of example, intravenous, intramarrow, intrarterial, intramuscular, intradermal, subcutaneous, intranasal, intrathecal, and intraperitoneal routes. Components administered systemically may be modified or formulated to target.
[0072] Local modes of administration include, by way of example, intramarrow injection into the trabecular bone or intrafemoral injection into the marrow space, and infusion into the portal vein. In an embodiment, significantly smaller amounts of the components (compared with systemic approaches) may exert an effect when administered locally (for example, directly into the bone marrow) compared to when administered systemically (for example, intravenously). Local modes of administration can reduce or eliminate the incidence of potentially toxic side effects that may occur when therapeutically effective amounts of a component are administered systemically.
[0073] Administration may be provided as a periodic bolus (for example, intravenously) or as continuous infusion from an internal reservoir or from an external reservoir (for example, from an intravenous bag or implantable pump). Components may be administered locally, for example, by continuous release from a sustained release drug delivery device.
[0074] In addition, components may be formulated to permit release over a prolonged period of time. A release system can include a matrix of a biodegradable material or a material which releases the incorporated components by diffusion. The components can be homogeneously or heterogeneously distributed within the release system. A variety of release systems may be useful, however, the choice of the appropriate system will depend upon rate of release required by a particular application. Both non-degradable and degradable release systems can be used. Suitable release systems include polymers and polymeric matrices, non-polymeric matrices, or inorganic and organic excipients and diluents such as, but not limited to, calcium carbonate and sugar (for example, trehalose). Release systems may be natural or synthetic. However, synthetic release systems are preferred because generally they are more reliable, more reproducible and produce more defined release profiles. The release system material can be selected so that components having different molecular weights are released by diffusion through or degradation of the material.
[0075] Representative synthetic, biodegradable polymers include, for example: polyamides such as poly(amino acids) and poly (peptides); polyesters such as poly(lactic acid), poly(glycolic acid), poly(lactic-co-glycolic acid), and poly (caprolactone); poly(anhydrides); polyorthoesters; polycarbonates; and chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made bythose skilled in the art), copolymers and mixtures thereof. Representative synthetic, non-degradable polymers include, for example: polyethers such as poly(ethylene oxide), poly(ethylene glycol), and poly(tetramethylene oxide); vinyl polymers-poly acrylates and polymethacrylates such as methyl, ethyl, other alkyl, hydroxyethyl methacrylate, acrylic and methacrylic acids, and others such as poly(vinyl alcohol), poly( vinyl pyrolidone), and poly(vinyl acetate); poly(urethanes); cellulose and its derivatives such as alkyl, hydroxyalkyl, ethers, esters, nitrocellulose, and various cellulose acetates; poly siloxanes; and any chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), copolymers and mixtures thereof.
[0076] Poly(lactide-co-glycolide) microsphere can also be used. Typically the microspheres are composed of a polymer of lactic acid and glycolic acid, which are structured to form hollow spheres. The spheres can be approximately 15-30 microns in diameter and can be loaded with components described herein.
[0077] Skilled artisans will appreciate that different components of genome editing systems can be delivered together or separately and simultaneously or nonsimultaneously. Separate and / or asynchronous delivery of genome editing system components may be particularly desirable to provide temporal or spatial control over the function of genome editing systems and to limit certain effects caused by their activity.
[0078] Different or differential modes as used herein refer to modes of delivery that confer different pharmacodynamic or pharmacokinetic properties on the subject component molecule, e.g., a RNA- guided nuclease molecule, gRNA, template nucleic acid, or payload. For example, the modes of delivery can result in different tissue distribution, different half-life, or different temporal distribution, e.g., in a selected compartment, tissue, or organ.
[0079] Some modes of delivery, e.g., delivery by a nucleic acid vector that persists in a cell, or in progeny of a cell, e.g., by autonomous replication or insertion into cellular nucleic acid, result in more persistent expression of and presence of a component. Examples include viral, e.g., AAV or lentivirus, delivery.Delivery of the compositions to cells
[0080] There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. For example, the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationicliposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described by, for example, Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815- 818, (1991). Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein. In certain cases, the methods will be modified to specifically function with large DNA molecules. Further, these methods can be used to target certain diseases and cell populations by using the targeting characteristics of the carrier.Nucleic acid based delivery systems
[0081] Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
[0082] As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as the gRNA and the nucleic acids encoding the Cas endonuclease, into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. In some embodiments, the gRNA and the nucleic acids encoding the Cas endonuclease are derived from either a virus or a retrovirus. Viral vectors are, for example, Adenovirus, Adeno- associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic pay load, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells. Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens. Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
[0083] Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genesremoved and a gene or gene / promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.A) Retroviral Vectors
[0084] A retrovirus is an animal virus belonging to the virus family of Retroviridae, including any types, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer.
[0085] A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome, contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3’ LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert.
[0086] Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.B) Adenoviral Vectors
[0087] The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61 :1213-1220 (1987); Massie et al., Mol. Cell. Biol. 6:2872-2883 (1986); Haj-Ahmad et al., J. Virology 57:267-274 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis" BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92: 1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest. 92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73: 1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386- 396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650- 655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)).
[0088] A viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the El and E3 genes are removed from the adenovirus genome.C) Adeno-asscociated viral vectors
[0089] Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and / or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
[0090] In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus.
[0091] Typically the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No. 6,261,834 is herein incorproated by reference for material related to the AAV vector.
[0092] The disclosed vectors thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
[0093] The inserted genes in viral and retroviral usually contain promoters, and / or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.D) Large payload viral vectors
[0094] Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,. Curr Opin Mol Ther 5: 633-644, 1999). These large DNA viruses (herpes simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable The maintenance of these episomes requires a specific EBV nuclear protein, EBNA1, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes.
[0095] Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors.E) Non-nucleic acid based systems
[0096] The disclosed compositions can be delivered to the target cells in a variety of ways. For example, the compositions can be delivered through electroporation, or through lipofection, orthrough calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro.
[0097] Thus, the compositions can comprise, in addition to the disclosed compositions or vectors for example, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract. Regarding liposomes, see, e.g., Brigham et al. Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Pat. No.4, 897, 355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage.
[0098] In the methods described above which include the administration and uptake of exogenous DNA into the cells of a subject (i.e., gene transduction or transfection), delivery of the compositions to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO- BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the disclosed nucleic acid or vector can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson, AZ).
[0099] The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). These techniques can be used for a variety of other speciifc cell types. Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of thistechnology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor- level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
[0100] Nucleic acids that are delivered to cells which are to be integrated into the host cell genome, typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral integration systems can also be incorporated into nucleic acids which are to be delivered using a non-nucleic acid based system of deliver, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
[0101] Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art.F) In vivo / ex vivo
[0102] As described above, the compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject=s cells in vivo and / or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
[0103] If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then beinfused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
[0104] A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
[0105] By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below.
[0106] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.SEQUENCES1) SEQ ID NO: 1 - GCACGCATCCCACCATGGAC2) SEQ ID NO: 2 - GACATTTTTCTTGTCCATGG3) SEQ ID NO: 3 - ACATTTTTCTTGTCCATGGT4) SEQ ID NO: 4 - GACATTTTTCTTGTCCGTGG5) SEQ ID NO: 5 - GGAGACATTTTTCTTGTCCA6) SEQ ID NO: 6 - CCACAGCACGCATCCCACCA7) SEQ ID NO: 7 - GGAGATATTTTTCTTGTCCA8) SEQ ID NO: 8 - GATATTTTTCTTGTCCATGG9) SEQ ID NO: 9 - ATATTTTTCTTGTCCATGGT10) SEQ ID NO: 10 - GDIFLVHGGMRAVEF11) SEQ ID NO: 11 -TTGCTCTCGCAGGAGACATTTTTCTTGTCCATGGTGGGTGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCCCTT12) SEQ ID NO: 12 -AACGAGAGCGTCCTCTGTAAAAAGAACAGGTACCACCCTACGCACGACACCTCAAGTTCACCACCTTTGTCTAGGATCGGGAA13) SEQ ID NO: 13 - GDIFLVHGGMRAVEFKVVETDPSP14) SEQ ID NO: 14 -CGCAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCCC15) SEQ ID NO: 15 -CGCAGGAGACATTTTTCTTGTCCGTNGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCC16) SEQ ID NO: 16 -TGTTTGCTCTCGCAGGAGACATTTTTCTTGTCCATGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG17) SEQ ID NO: 17 -TGTTTGCTCTCGCAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG18) SEQ ID NO: 18 -AACGAGAGCGTCCTCTGTAAAAAGAACAGGTACCACCCTACGCACGACACCTCAAGTTCACCACCTTTGTCTAGGATCGGGAA19) SEQ ID NO: 19 - GGAGACATTTTTCTTGTCCG) SEQ ID NO: 20 - ACATTTTTCTTGTCCGTGGT ) SEQ ID NO: 21 - GCACGCATCCCACCACGGAC ) SEQ ID NO: 22 -ATTATAGGAGATATTTTTCTTGTCCATGGTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTTAG ) SEQ ID NO: 23 - GGAGATATTTTTCTTGTCCG ) SEQ ID NO: 24- GATATTTTTCTTGTCCGGGG ) SEQ ID NO: 25 - ATATTTTTCTTGTCCGGGGT ) SEQ ID NO: 26 - CCACAGCACGCATCCCACCC ) SEQ ID NO: 27 - NNNNNNNNNNNNNNNNNNNNMPAM ) SEQ ID NO: 28 - NNNNNNNNNNNNNNNNNNNMNPAM ) SEQ ID NO: 29 - NNNNNNNNNNNNNNNNNNMNNPAM ) SEQ ID NO: 30 - NNNNNNNNNNNNNNNNNMNNNPAM ) SEQ ID NO: 31 - NNNNNNNNNNNNNNNNMNNNNPAM ) SEQ ID NO: 32 - NNNNNNNNNNNNNNNMNNNNNPAM ) SEQ ID NO: 33 -TGAACTCCACAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTA ) SEQ ID NO: 34 -TGAACTCCACAGCACGCATCCCACCNACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTT ) SEQ ID NO: 35 -TCCACCACTTTGAACTCCACAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCA ) SEQ ID NO: 36 -TCGCAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCC ) SEQ ID NO: 37 -GAACTCCACAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTAG ) SEQ ID NO: 38 -CTCTCGCAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA) SEQ ID NO: 39 -CTCTCGCAAGGAGACATTTTTCTTGTNCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCT ) SEQ ID NO: 40 -CTCTCGCAAGGAGACATTTTTCTTGTCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA ) SEQ ID NO: 41 -CTCTCGCAAGGAGACATTTTTCTTGCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA ) SEQ ID NO: 42 -CTCTCGCAAGGAGACATTTTTCTTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA ) SEQ ID NO: 43 -CTCTCGCAAGGAGACATTTTTCTTGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA ) SEQ ID NO: 44 -CTCTCGCAAGGAGACATTTTTCTTGCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTA ) SEQ ID NO: 45 -GTACTGTTTGCTCTCGCAGGAGACATTTTTCTTGTCCGTGGGGGGATGGGTGGTGGGGAGTTCAAA ) SEQ ID NO: 46 -GTACTGTTTGCTCTCGCAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAA ) SEQ ID NO: 47 -CTCCACAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTAGAGG ) SEQ ID NO: 48 -CTCCACAGCACGCATCCCACCACGGNACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTAGAG ) SEQ ID NO: 49 -CCACTTTGAACTCCACAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAAAGCAAACA) SEQ ID NO: 50 -CTCCAGAGCACGCATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTAGAGG ) SEQ ID NO: 51 -ACTCCACAGCAGCGATCCCACCACGGACAAGAAAAATGTCTCCTGCGAGAGCAAACAGTACAAGCACAGTTAGAG ) SEQ ID NO: 52 -TAATATCCTCTATAAAAAGAACAGGTACCACCCTACGCACGACACCTCAAGTTTCAACATCTCTGTCTAGGGTCGGGAATC ) SEQ ID NO: 53 - GDIFLVHGGMRAVEFKVVETDPSPY ) SEQ ID NO: 54 -CTCCACAGCACGCATCCCACCCCGGACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTAGAGG ) SEQ ID NO: 55 -CTCCACAGCACGCATCCCACCCCGGNNACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTAGA ) SEQ ID NO: 56 -CAACTTTGAACTCCACAGCACGCATCCCACCCCGGACAAGAAAAATATCTCCTATAATACAAAGCA ) SEQ ID NO: 57 -GAACTCCACAGCACGCATCCCACCCCGGACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTAG ) SEQ ID NO: 58 -GAACTCCACAGCACGCATCCCACCCNCGGACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTA ) SEQ ID NO: 59 -CTACAACTTTGAACTCCACAGCACGCATCCCACCCCGGACAAAAAAAATATCTCCTATAATACAAA ) SEQ ID NO: 60-TGAACTCCACAGCACGCATCCCACCCCGGACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTA ) SEQ ID NO: 61 -TGAACTCCACAGCACGCATCCCACCNCCGGACAAGAAAAATATCTCCTATAATACAAAGCAATACAAGTGCAATTA) SEQ ID NO: 62 -TCTACAACTTTGAACTCCACAGCACGCATCCCACCCCGGACAAAAAAAATATCTCCTATAATACAA ) SEQ ID NO: 63 -TAGGAGATATTTTTCTTGTCCGGGGGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 64 -TAGGAGATATTTTTCTTGTCCGGGGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 65 -TAGGAGATATTTTTCTTGTCCGGGGNTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 66 -TAGGAGATATTTTTCTTGTCCGGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 67 -TAGGAGATATTTTTCTTGTCCGGGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 68 -TAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 69 -TAGGAGATATTTTTCTTGTCCTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCCTT ) SEQ ID NO: 70 -CTTTGTATTATAGGAGATATTTTTCTTGTCCGGGGGGGATGCGTGTTGTGGAGTTCAAAGTTGAAA ) SEQ ID NO: 71 -CTTTGTATTATAGGAGATATTTTTCTTGTCCGGGGTGGATGCGTGTTGTGGAGTTCAAAGTTGAAA ) SEQ ID NO: 72 -GTATTATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCA) SEQ ID NO: 73 -GTATTGCTTTGTATTATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAA ) SEQ ID NO: 74 -TTATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCC ) SEQ ID NO: 75 -TTGCTTTGTATTATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTT ) SEQ ID NO: 76 -TATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTTGTAGAGACAGATCCCAGCCC ) SEQ ID NO: 77 -TGCTTTGTATTATAGGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGGAGTTCAAAGTTG ) SEQ ID NO: 78 -ACACAGTGATCCACTGCGAAGGGGAGCCTATCAAACGAGAGGTGAGTTTTCTCCCTGA ) SEQ ID NO: 79 -TGTGTCACTAGGTGACGCTTCCCCTCGGATAGTTTGCTCTCCACTCAAAAGAGGGAC ) SEQ ID NO: 80 - DTVIHCEGEPIKRE
Claims
CLAIMSWhat is claimed is:1) A system for modulating a mutant allele of a gene, said system comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more mutations, wherein at least one of the one or more mutations is within 7 nucleotides upstream the 5 ’ end of a protospacer adjacent motif (PAM) sequence.2) The system of claim 1, wherein the mutant allele comprises a target strand and a non-target strand complementary to the target strand.3) The system of claim 1 or 2, wherein the gRNA is complementary to the target strand.4) The system of claim 2, wherein the non-target strand comprises one or more mutations, and wherein at least one of the one or more mutations is within 7 nucleotides upstream the 5 ’ end of the PAM sequence.5) The system of any one of claims 1 -4, wherein at least one of the one or more mutations is within 6, 5, 4, 3, 2, or 1 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence.6) The system of any one of claims 1-5, wherein the one or more mutations are point mutations, insertions, deletions, or translocations.7) The system of any one of claims 1-6, wherein the gRNA does not target the wild-type allele of the gene.8) The system of any one of claims 1-7, further comprising a Cas nuclease.9) The system of any one of claims 1-8, wherein the PAM sequence comprises NGG, NNGRR, NNGRRT, or NNNNGATT.10) The system of claim 9, wherein the PAM sequence comprises AAGAA, TGGGAT, GGG, or TGG.11) The system of any one of claims 1-10, wherein the mutant allele is associated with a genetic disorder.12) The system of claim 11, wherein the genetic disorder is a dominant- negative disorder.13) The system of claim 11 or 12, wherein the genetic disorder comprises inclusion body myopathy associated with Paget’s disease of bone and frontotemporal dementia (1BMPFD) or autosomal dominant hyper-IgE syndrome (AD-HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy.14) The system of any one of claims 1-13, wherein the mutant allele is of a VCP gene, a STAT3 gene, a DOCK8 gene, a TBCD gene, or a KCNT1 gene.15) The system of claim 14, wherein the mutant allele of the VCP gene comprises SEQ ID NO: 10 or a fragment thereof.16) The system of any one of claims 1-15, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof.17) A method of treating a genetic disorder in a subject in need, comprising administering to the subject a system for modulating a mutant allele of a gene, said system comprising a guide RNA (gRNA) sequence targeting the mutant allele of the gene comprising one or more mutations, wherein at least one of the one or more mutations is within 7 nucleotides upstream the 5 ’ end of a protospacer adjacent motif (PAM) sequence.18) The method of claim 17, wherein the mutant allele comprises a target strand and a non-target strand.19) The method of claim 17 or 18, wherein the gRNA is complementary to the target strand.20) The method of claim 17, wherein the non-target strand comprises one or more mutations, and wherein at least one of the one or more mutations is within 7 nucleotides upstream of the 5 ’ end of the PAM sequence.21) The method of any one of claims 17-20, wherein at least one of the one or more mutations is within 6, 5, 4, 3, 2, or 1 nucleotides upstream the 5’ end of a protospacer adjacent motif (PAM) sequence.22) The method of any one of claims 17-21, wherein the one or more mutations are point mutations, insertions, deletions, or translocations.23) The method of any one of claims 17-22, wherein the gRNA does not target the wild-type allele of the gene.24) The method of any one of claims 17-23, further comprising a Cas nuclease.25) The method of any one of claims 17-24, wherein the PAM sequence comprises NGG, NNGRR, SEQ ID NO: 12, or SEQ ID NO: 13.26) The method of claim 25, wherein the PAM sequence comprises AAGAA, SEQ ID NO: 11, GGG, or TGG.27) The method of any one of claims 17-26, wherein the mutant allele is associated with a genetic disorder.28) The method of claim 27, wherein the genetic disorder is a dominant-negative disorder.29) The method of claim 27 or 28, wherein the genetic disorder comprises inclusion body myopathy associated with Paget’s disease of bone and frontotemporal dementia (IBMPFD) or autosomal dominant hyper-IgE syndrome (AD-HIES), tubulin folding cofactor D (TBCD) associated diseases, or KCNTl-related developmental and epileptic encephalopathy.30) The method of any one of claims 27-29, wherein genetic disorder is associated with a mutant allele of a VCP gene, a STAT3 gene, a DOCK8 gene, a TBCD gene, or a KCNT1 gene.31) The method of claim 30, wherein the mutant allele of the VCP gene comprises SEQ ID NO: 10 or a fragment thereof.32) The method of any one of claims 17-31, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 , or a fragment thereof.