Armored t cells
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-06-05
- Publication Date
- 2026-04-15
AI Technical Summary
Current engineered immune cell therapies for cancer, such as CAR-T cells, face challenges including variable cell product quality, cytokine release syndrome, extended manufacturing times, high costs, and limited efficacy for solid tumors, with A20 deficiency in CAR-T cells potentially addressing these issues by enhancing T cell survival and anti-tumor activity.
Disrupting the TNF alpha induced protein 3 (A20) gene in CAR-T cells to enhance NF-KB activation and IFNγ secretion, leading to prolonged activation and improved anti-tumor efficacy, while maintaining cell expansion and persistence in the tumor microenvironment.
A20-deficient CAR-T cells exhibit enhanced anti-tumor activity, prolonged tumor control, and increased survival in preclinical models, demonstrating improved efficacy against various cancer types without affecting cell expansion or proliferation.
Smart Images

Figure IB2024055504_12122024_PF_FP_ABST
Abstract
Description
ARMORED T CELLS1 FIELD OF THE DISCLOSURE
[0001] The disclosure relates to methods, cells, and compositions for preparing cell populations and compositions for immune cell therapy. In particular, provided herein is a population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene, and methods of making and use of said populations.
[0002] This application contains a sequence listing which is submitted electronically and is hereby incorporated by reference in its entirety. The sequence listing submitted herewith is contained in the XML file created June 3, 2024 entitled “ARMCART(TNFA20)-100-US-PSP_Sequence-Listing.xml” and is 3,658 bytes in size.2 BACKGROUND
[0003] Engineered immune cell therapies have been transformative for patients with malignancies in recent years. Since 2017, the number of clinical trials investigating adoptive cell therapies such as CAR-T cells, NK and NKT cells, T cell receptor (TCR)-T cells, tumor infiltrating lymphocytes (TILs), tumor-specific antigen-targeting T cells, CAR-NK and CAR-NKT cells, and other cellular therapies has grown rapidly. While there is much potential for engineered immune cell therapies to be curative for patients, a number of factors limit the widespread development and administration of such therapies. Most immune cellular therapies are associated with variable cell product quality, cytokine release syndrome and other toxicities, extended manufacturing times, high costs, and a limited period in which these therapies may be genetically modified to enhance their efficacy and / or effective after administration to a patient [1]. Clinical responses in treating solid tumors are modest, and there is a need for improved engineered immune cell therapies, in particular for solid tumors. This disclosure describes cell populations and methods that address this unmet need.3 SUMMARY
[0004] Provided herein are populations of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene, and methods of making and use of said populations. Such populations effect the tumor microenvironment and can provide many additional benefits described herein that allow for T cell survival in the immunosuppressive tumor microenvironment (TME). The inventors have discovered that A20 deficiency in CAR-T cells can lead to prolonged activation, enhanced efficacy, enhanced NF-KB activation and higher levels of IFNy secretion compared to unarmored CAR-T cells. Further, A20 deficiency in CAR- T cells has been found to delay the onset of dysfunction and preserve CAR-T ability to kill tumor cells longer than unarmored cells.
[0005] In one aspect, this disclosure provides a population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene. In some embodiments, the population of cells further comprises a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR). In some embodiments, the population of cells is an autologous cell population or an allogeneic cell population. In some embodiments, the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor infiltrating lymphocyte population. In some embodiments, the population of cells comprises total T cells. In some embodiments, the population of cells comprises CD8+T cells. In some embodiments, the population of cells comprises CD4+T cells. In some embodiments, the population of cells comprises human primary immune cells.
[0006] In some embodiments, at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells do not express A20. In some embodiments, at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells express the CAR.
[0007] In some embodiments, the population of cells has at least about a 2-fold, at least about a 2.5-fold, at least about a 3-fold, at least about a 4-fold, or at least about a 5-fold enhanced activation of NF-KB pathway. In some embodiments, the population of cells exhibits an anti-tumor activity. In some embodiments, the population of cells exhibits an enhanced anti-tumor activity.
[0008] In some embodiments, this disclosure provides for a pharmaceutical composition comprising the population of cells of as disclosed herein, and a pharmaceutically acceptable carrier.
[0009] In some embodiments, this disclosure provides a method of treating a cancer in a subject in need thereof, comprising administering to the subject the population of cells or the pharmaceutical composition as disclosed herein.
[0010] In some embodiments, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.
[0011] In another aspect, this disclosure provides, a method of treating cancer, comprising administering to a subject in need thereof an effective amount of a population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene and a chimeric antigen receptor (CAR). In some embodiments, the method further comprises inhibiting tumor growth, inducing tumor regression, and / or prolonging survival of the subject. In some embodiments of the method, the population of cells is an autologous cell population or an allogeneic cell population. In some embodiments, the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor infiltrating lymphocyte population. In someembodiments, the population of cells comprises total T cells. In some embodiments, the population of cells comprises CD8+T cells. In some embodiments, the population of cells comprises CD4+T cells. In some embodiments, the population of cells comprises human primary immune cells.
[0012] In some embodiments of the method, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof. In some embodiments, the population of cells exhibits an enhanced anti-tumor activity.
[0013] In another aspect, this disclosure provides for a method for treating cancer: (a) obtaining a population of cells from a donor; (b) genetically modifying the population of cells to disrupt the TNF alpha induced protein 3 (A20; TNFAIP3) gene; (c) expanding the genetically modified population of cells; and (d) administering the expanded genetically modified population of cells to a patient.
[0014] In some embodiments of the method, A20 is disrupted by a Cas / CRISPR system. In some embodiments, the method further comprises introducing a chimeric antigen receptor (CAR) into the population of cells.
[0015] In some embodiments, the method further comprises inhibiting tumor growth, inducing tumor regression, and / or prolonging survival of the subject.
[0016] In some embodiments of the method, the population of cells are an autologous or an allogeneic cell population. In some embodiments, the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor infiltrating lymphocyte population. In some embodiments, the population of cells comprises total T cells. In some embodiments, the population of cells comprises CD8+T cells. In some embodiments, the population of cells comprises CD4+T cells. In some embodiments, the population of cells comprises human primary immune cells.
[0017] In some embodiments of the method, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non- small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof. In some embodiments, the population of cells exhibits an enhanced anti-tumor activity.
[0018] In some embodiments, this disclosure provides for methods of treating a disease or condition in a subject in need thereof, comprising administering to the subject the population of cells orthe pharmaceutical composition as disclosed herein. In some embodiments, the disease or condition comprises a cancer. In some embodiments, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.
[0019] In some embodiments, this disclosure provides for the use of the population of cells as disclosed herein or the pharmaceutical composition as disclosed herein as a medicament in the treatment of a disease or condition in a subject in need thereof. In some embodiments, the disease or condition comprises a cancer. In some embodiments, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.
[0020] In yet another aspect, this disclosure provides for the use of a population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene for the manufacture of a medicament for treating cancer in a patient. In some embodiments of the use, the population of cells further comprises a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR).
[0021] In yet another aspect, this disclosure provides for a population of cells for the treatment of cancer in a patient, wherein the population of cells comprises a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene. In some embodiments, the population of cells further comprises a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR).4 BRIEF DESCRIPTION OF THE DRAWINGSFigure 1: Efficient knock out (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR
[0022] Figure 1A — Figure 1B illustrate the efficient knock out (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR was performed the same day of a CAR transduction. Western blot showsexpression of A20 protein after ? (Figure 1A) or 13 (Figure 1 B) days of expansion. These results indicate that A20 KO is both efficient and stable.Figure 2: The fold expansion and CD4 / CD8 ratio of unarmoured orA20 deficient CAR-T cells
[0023] Figure 2A - Figure 2B illustrate the fold expansion (Figure 2A) and CD4 / CD8 ratio (Figure 2B) of unarmored or A20 deficient CAR-T cells. Results indicate that lack of A20 does not substantially affect CAR-T cell fold expansion (Figure 2A) or CD4 / 8 ratio (Figure 2B).Figure 3: A20 deficiency results in enhanced NF-KB activation upon CAR engagement
[0024] Figure 3A - Figure 3B illustrate A20 deficiency results in enhanced NF-KB activation upon CAR engagement. Data confirm that lack of A20 results in enhanced NF-KB activation in CAR-T cells.Figure 4: A20 deficiency results in enhanced NF-KB activation upon CAR engagement
[0025] Figure 4A -Figure 4B illustrate that A20 deficiency results in enhanced NF-KB activation upon CAR engagement. Unarmored or A20 KO CAR-T were left unstimulated or stimulated for 1 or 6 days with GPC3 positive tumor cells and gene expression was analyzed by Nanostring. Figure 4A - volcano plots depict the fold gene of genes in A20 KO compared to unarmored CAR-T cells. At every time point analyzed more than 50% of upregulated genes are NF-KB target genes. Figure 4B - the heatmap shows the top 20 NF-KB target genes upregulated in A20 deficient CAR-T cells after 6 days. Data confirm that lack of A20 results in enhanced NF-KBa activation in CAR-T cells.Figure 5: Characterization of target CAR-T cell lines
[0026] Figure 5 illustrates the characterization of target CAR-T cell lines. The indicated cell lines were stained for GPC3 expression and analyzed by flow cytometry. Receptor density was calculated using bang beads.Figure 6: A20 deficiency results in higher level of IFNy secretion, at all antigen densities
[0027] Figure 6 illustrates that A20 deficiency results in higher level of IFNy secretion, at all antigen densities. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at a 0.3:1 E:T ratio. After 24 hours, supernatant was collected and IFNy secretion was assessed by MSD.Figure 7: A20 deficiency does not result in increased killing of target cells in an acute, singlechallenge assay
[0028] Figure 7 illustrates that A20 deficiency does not result in increased killing of target cells in an acute, single-challenge assay. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at a 0.3:1 E:T ratio and cytolysis was assessed by xCELLigence.Figure 8- A20 deficient CAR-T cells show increased and prolonged upregulation of activation markers
[0029] Figure 8A - 8B illustrate that A20 deficient CAR-T cells show increased and prolonged upregulation of activation markers. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 8A) or high (Figure 8B) levels of GPC3. After 1 or 6 days, the expression of CD25 and CD69 was analyzed by flow cytometry on CAR+ cells. Dot plots were gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. A20 deficiency results in acute increased expression of the NF-KB dependent activation markers CD25 and CD69 at day 1 (D1). 6 days after incubation, A20 KO cells show higher expression of CD25 and CD69, even in the face of complete killing of target cells. Therefore, lack of A20 results in prolonged activation of CAR-T cells.Figure 9: A20 deficient CAR-T cells show a similar differentiation pattern compared to unarmouredCAR-T cells
[0030] Figure 9A - Figure 9C illustrate that A20 deficient CAR-T cells show a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 9A) or high (Figure 9B) levels of GPC3. After 1 or 6 days, the expression of the differentiation markers CD62L and CD45RO was analyzed by flow cytometry on CAR+ cells. Dot plots were gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. These data show that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers might result in increased differentiation, and therefore decreased sternness and persistence. Figure 9C shows that A20 KO CAR-T cells show a similar expression of sternness and exhaustion genes compared to unarmored CAR-T cells. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing high levels of GPC3. After 6 days, the expression of the indicated genes was analyzed by Nanostring. These data show that A20 deficiency does not result in increased differentiation antigen encounter, corroborating findings in Figure 9A and Figure 9B.Figure 10: Lack ofA20 delays T cell dysfunction in a serial kill assay against GPC3 expressing cells
[0031] Figure 10A - Figure 10C illustrate that a lack of A20 delays T cell dysfunction in a serial kill assay against high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) GPC3 expressing cells. Unarmored or A20 deficient CAR-T cells were incubated with target cells expressing different levels of GPC3 at an effectortarget ratio of 0.3:1 (GPC3 high) or 2:1 (GPC3 medium / low and GPC3 low). After 2-3 days, cell number was assessed by flow cytometry and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first rounds of the assay, unarmored and A20 KO CAR-T cells kill all the tumor cells, regardless of antigen density. However, after a few rounds CAR-T cell efficacy decreases as cells becomes dysfunctional. A20 deficiency delays the onset of dysfunction and preserves CAR-T abilityto kill tumor cells longer than unarmored cells. Notably, this is true even when the target cells express very low levels of GPC3.Figure 11: Enhanced tumour control in serial kill assay does not correlate with enhanced expansion
[0032] Figure 11A - Figure 11C illustrate that enhanced tumor control in serial kill assay does not correlate with enhanced expansion. GPC3 expressing cells - high (Figure 11 A), medium / low (Figure 11 B), and low (Figure 11 C) were treated as in Figure 10. Fold expansion was calculated based on the number of CAR+ cells counted after each round of killing. Data show that A20 KO cells did not expand more compared to unarmored cells, therefore enhanced tumor control was the result of intrinsic enhanced effector capacity.Figure 12: Lack of A20 delays effector cytokine production decrease in a serial kill assay against high GPC3 expressing cells
[0033] Figure 12A - Figure 12C illustrate that a lack of A20 delays effector cytokine production decrease in a serial kill assay against high GPC3 expressing cells. Unarmored or A20 deficient CAR-T cells were incubated with target cells expressing high levels of GPC3 at an effectortarget ratio of 0.3:1 (GPC3 high) or 2:1 (GPC3 medium / low and GPC3 low) and serial kill assay was performed as previously described (Figure 10). IFNy (Figure 12A), IL2 (Figure 12B), and TNFa (Figure 12C) were analyzed in the supernatant after 3, 5, or 6 rounds of serial kill. A20 KO CAR-T cells produce more effector cytokines compared to unarmored CAR-T cells even after multiple rounds of stimulation, confirming an enhanced activation status.Figure 13: Lack ofA20 enhances CAR-T cell efficacy against high GPC3 expressing tumours
[0034] Figure 13A - Figure 13D illustrate that a lack of A20 enhances CAR-T cell efficacy against high GPC3 expressing tumors. Hep3B were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Figure 13A - graphs show tumor volume for individual mice in the study infused with 0.5e6 CAR-T cells or UT. UT cells were not able to control tumor growth. Mice infused with unarmored CAR-T cells experienced partial tumor control, with only 3 out of 9 mice able to maintain tumor volume below 500mm3for an extended period of time. In contrast, 6 out of 9 mice infused with A20 KO CAR-T cells were able to maintain tumor volume below 500 mm3for approximately 10 days. Mice infused with 2e6 CAR-T cells experienced in general more profound and durable tumor control compared to mice infused with a lower dose of cells (Figure 13B). Unarmored CAR- T cells induced complete regression (CR) in 3 out of 7 mice (42%), in contrast A20 KO CAR-T cells induced CR in 7 out of 8 mice (87%) (Figure 13B). Four A20 KO-infused mice were already in CR at day 17 (D17) post-infusion, compared to only 1 mouse receiving unarmored CAR-T cells. A20 KO CAR-T cells were able to mediate prolonged tumor control (Figure 13C), as reflected by a statistically significant difference insurvival (Figure 13D). These data show that A20 KO CAR-T cells have superior efficacy against high- GPC3 expressing tumors compared to unarmored CAR-T cells.Figure 14: A20 KO CAR-T cells produce more IFNy in vivo
[0035] Figure 14 illustrates that A20 KO CAR-T cells produce more IFN y in vivo. Mice treated as in Figure 12 were bled 7 days after T cell infusion and IFNy was analyzed in the serum. A higher level of IFNy is present in the serum of A20 KO mice, in line with the in vitro findings (Figure 6) demonstrating that lack of A20 results in enhanced CAR-T cell activation in vivo.Figure 15: A lack of A20 enhances CAR-T cell efficacy against medium / low-GPC3 expressing tumours
[0036] Figure 15A - Figure 15C illustrate that a lack of A20 enhances CAR-T cell efficacy against medium / low-GPC3 expressing tumors. PLC / PRF / 5 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Figure 15A - infusion of a low dose CAR-T cell (0.5e6 / mouse) can partially control tumor growth. A20 KO CAR-T cells provide a slightly longer control. Figure 15B. 2e6 unarmored CAR-T cells induced delay in tumor growth, in contrast, the same dose of A20 KO CAR-T cells induced CR in all the mice treated and a prolonged tumor control resulting in increased survival (Figure 15C). These data show that A20 KO CAR-T cells have superior efficacy against medium / low-GPC3 expressing tumors compared to unarmored CAR-T cells.Figure 16: A lack of A20 enhances CAR-T efficacy without affecting cell number.
[0037] Figure 16A - Figure 16C illustrate that a lack of A20 enhances CAR-T efficacy without affecting cell number. PLC / PRF / 5 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or Luciferase expressing CAR-T cells were infused intravenously at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figure 16B and Figure 16C) were assessed biweekly. These data demonstrate that the lack of A20 enhances CAR-T cell efficacy without affecting proliferation.Figure 17: A20 KO CAR-T cells maintain higher ability to produce IFN upon tumour relapse
[0038] Figure 17 illustrates A20 KO CAR-T cells maintain higher ability to produce IFN upon tumor relapse. Upon relapse, tumors were collected from unarmored or A20 KO-infused mice when the tumor reached a volume of approximately 300 mm3. Tumors were homogenized and cell suspension was plated and stimulated with PMA (10 ng / mL) and lonomycin (500 ng / mL) overnight. Supernatants were collected and IFNy analyzed by MSD. A fraction of cells was analyzed by flow cytometry before the stimulation to determine the frequency and number of T cells per sample. IFNy secreted was normalized by number of T cells / well. Data show that A20 KO CAR-T cells isolated from relapsed tumors have a higher intrinsic activation potential compared to unarmored CAR-T cells, in line with the in vitro data.Figure 18: Lack ofA20 enhances CAR-T cell efficacy against low-GPC3 expressing tumours
[0039] Figure 18 illustrates that a lack of A20 enhances CAR-T cell efficacy against low-GPC3 expressing tumors. PLC / PRF / 5 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Left panel: Infusion of a low dose CAR-T cell (0.5e6 / mouse) can slightly delay tumor growth. A20 KO CAR-T cells achieve increased tumor control. Similar advantage is shown in the right panel at a dose of 2e6 CAR+ / mouse. These data show that A20 KO CAR-T have superior efficacy against low-GPC3 expressing tumors compared to unarmored CAR-T cells.Figure 19: A20 KO CAR-T cells produce more IFNy in vivo in GPC3 low tumours
[0040] Figure 19 illustrates that A20 KO CAR-T cells produce more IFNy in vivo in GPC3 low tumors. Mice treated as in Figure 17 were sacrificed 7 days after T cell infusion and IFNy was analyzed in the tumor infiltrating CAR-T cells by intracellular staining. A20 KO CAR-T cells infiltrating the tumor express higher levels of IFNy, in line with the in vitro findings (Figure 6) demonstrating that lack of A20 results in enhanced CAR-T cell activation in vivo.Figure 20: A20 KO HER2 CAR-T cells produce more IFNy upon incubation with HER2+ target cells
[0041] Figure 20 illustrates that A20 KO HER2 CAR-T cells produce more IFNy upon incubation with HER2+ target cells. This result shows that lack of A20 results in similar effects, independently on the CAR expressed by the cell. Therefore, KO of A20 is an armoring strategy that can be applied across multiple projects.Figure 21: Characterization of target HER2 CAR-T cell lines
[0042] Figure 21 illustrates the characterization of target CAR-T cell lines. The indicated cell lines were stained for HER2 expression and analyzed by flow cytometry.Figure 22: Efficient knock out of A20 in HER2 CAR-T cells using CRISPR
[0043] Figure 22A - Figure 22B illustrate the efficient knock out of A20 in HER2 CAR-T cells using CRISPR. Knock out of the A20 gene by CRISPR was performed the same day of CAR transduction. Western blot shows expression of A20 protein after 10 days of expansion (Figure 22A). Relative A20 protein expression was quantified by densitometry (Figure 22B). A20 expression was normalized to -Actin expression. These results indicate that A20 knock out is both efficient and stable.Figure 23: The fold expansion (and CD4 / CD8 ratio of untransduced (UT), unarmoured and A20 deficient HER2 CAR-T
[0044] Figure 23A - Figure 23B illustrate the fold expansion (Figure 23A) and CD4 / CD8 ratio (Figure 23B) of untransduced (UT), unarmored and A20 deficient HER2 CAR-T. Proportions of CD4 and CD8 inUT are gated in the CD45+ population, while proportions of CD4 and CD8 in unarmored and A20KO CAR- T are gated in CAR+ cells. Results indicate that lack of A20 does not substantially affect CAR-T fold expansion (Figure 23A) or CD4 / 8 ratio (Figure 23B).Figure 24: A20 deficiency does not result in increased killing of target cells in an acute, singlechallenge assay
[0045] Figure 24 illustrates that A20 deficiency does not result in increased killing of target cells in an acute, single-challenge assay. UT, unarmored or A20KO HER2 CAR-T were incubated with JIMT1 tumor cells at a 1 :1 E:T ratio and cytolysis was assessed by xCELLigence.Figure 25: A20 deficient CAR-T cells show increased and prolonged upregulation of activation markers
[0046] Figure 25 illustrates that A20 deficient CAR-T cells show increased and prolonged upregulation of activation markers. Unarmored or A20KO HER2 CAR-T were incubated with JIMT1 tumor cells. After 1 or 4 days, the expression of CD25 and CD70 was analyzed by flow cytometry on CAR+ cells. A20 deficiency results in acute increased expression of activation marker CD70 at D1. 4 days after incubation, A20KO cells show a higher expression of CD25 and CD70, even in the face of complete killing of target cells. Therefore, lack of A20 results in prolonged activation of CAR-T cells.Figure 26: A20 deficient CAR-T cells show a similar differentiation pattern compared to unarmoured CAR-T cells
[0047] Figure 26A - Figure 26B illustrate that A20 deficient CAR-T cells show a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20KO HER2 CAR-T were incubated with JIMT1 (Figure 26A) or MDA-MB-231 (Figure 26B) tumor cells. After 1 or 4 days, the expression of the differentiation markers CD62L and CD45RO was analyzed by flow cytometry on CAR+ cells. This is particularly relevant because increased and prolonged expression of activation markers might result in increased differentiation. These data show that A20 deficiency does not result in increased differentiation before or after antigen encounter.Figure 27: Lack ofA20 delays HER2 CAR-T dysfunction in vitro
[0048] Figure 27A - Figure 27C illustrate that lack of A20 delays HER2 CAR-T dysfunction in vitro. Figure 27A: A20 deficiency delays the onset of dysfunction and preserves CAR-T ability to kill tumor cells longer than unarmored cells. This assay also showed that A20 KO HER2 CAR-T cells achieve more antigen mediated proliferation than their unarmored counterpart, suggesting CAR-intrinsic effect of A20 KO armoring (Figure 27B). Figure 27C: a lack of A20 delays effector cytokine production decrease after multiple rechallenges.Figure 28: Successful A20 KO in Universal effector T cells (UEC)
[0049] Figure 28 illustrates successful A20 KO in Universal effector T cells (UEC). UEC were generated by performing a CAR-KI in the B2m locus of CD8 cells KO for the genes of the Trex module as described in WO 2023 / 025862 A1 .Figure 29: Acute killing functionality ofA20 KO or unarmoured Her2-UECs
[0050] Figure 29 illustrates acute killing functionality of A20 KO or unarmoured Her2-UECs tested in an xCelligence killing assay using JIMT-1 target cells.Figure 30: Assessment of activation markers CD25 and CD69 by flow cytometry in unarmoured and A20 KO Her2-UECs
[0051] Figure 30 illustrates assessment of activation markers CD25 and CD69 by flow cytometry in unarmoured and A20 KO Her2-UECs either in resting state or following 3 days of co-culture with JIMT-1 target cells at an E:T ratio of 1 :1 .Figure 31: Expression of activation marker CD70 as measured by flow cytometry in Her2-UECs either unarmoured orA20 KO co-culture with JIMT-1 target cells
[0052] Figure 31 illustrates expression of activation marker CD70 as measured by flow cytometry in Her2- UECs either unarmored or A20 KO co-culture with JIMT-1 target cells for up to 3 days at a E:T ratio of 1 :1 . A20 KO UECs express CD70 at a higher level than unarmored UECs, suggesting a higher activation status. MFI = median fluorescence intensity.Figure 32: Production of IFNy by Her2 UECs co-cultured with Her2-expressing target cells
[0053] Figure 32 illustrates the production of IFNy by Her2 UECs co-cultured with Her2-expressing target cells. The effector cells were co-cultured with either JIMT-1 or MDA-MB-231 target cells at an E:T ratio of 1 :1 and the supernatant was analyzed after an overnight incubation. IFNy was quantified using an ELLA assay (Bio-techne). This figure shows that A20 KO UECs produce more IFNy than their unarmored counterpart. Additionally, this data shows that A20 KO does not induce non-specific release of IFNy as the cytokine was not detectable in the absence of target cells.5 DETAILED DESCRIPTION
[0054] The disclosure relates to methods, cells, and compositions for preparing cell populations and compositions for immune cell therapy. In particular, provided herein is a population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene, and methods of making and use of said populations.
[0055] As utilized in accordance with the present disclosure, unless otherwise indicated, all technical and scientific terms shall be understood to have the same meaning as commonly understood by one of ordinary skill in the art. The following references provide one of skill with a general definition of many of the termsused in this disclosure: Singleton, et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger, et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.
[0056] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0057] As used herein, the terms "comprise" and "include" and variations thereof (e.g., "comprises," "comprising," "includes," and "including") will be understood to indicate the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other component, feature, element, or step or group of components, features, elements, or steps. Any of the terms “comprising,” “consisting essentially of,” and “consisting of’ may be replaced with either of the other two terms, while retaining their ordinary meanings.
[0058] As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly indicates otherwise.
[0059] As used herein, ranges and amounts can be expressed as "about" a particular value or range. The term "about" also includes the exact amount. For example, "about 5%" means "about 5%" and also "5%." The term "about" can also refer to ± 10% of a given value or range of values. Therefore, about 5% also means 4.5% - 5.5%, for example. Unless otherwise clear from context, all numerical values provided herein are modified by the term “about.”
[0060] Percentages disclosed herein can vary in amount by ±10, 20, or 30% from values disclosed and remain within the scope of the contemplated disclosure.
[0061] Unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values herein that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0062] As used herein, the terms "or" and "and / or" can describe multiple components in combination or exclusive of one another. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z," "(x and y) or z," "x or (y and z)," or "x or y or z."
[0063] In one aspect, this disclosure provides for a population of cells comprising a disrupted TNF alpha induced protein 3 (A20 or TNFAIP3) gene. TNF alpha induced protein 3 can also be referred to as TNFAIP3; A20; AISBL; AIFBL1 ; OTUD7C; or TNFA1 P2. The TNFAIP3 gene (NCBI Reference Sequence: NM_006290.4) encodes an ubiquitin-editing enzyme (NCBI Reference Sequence: NP_006281.1) with a critical function in the inhibition of proinflammatory molecules to negatively regulate inflammation and theimmune response. TNFAIP3 (A20) is a cytoplasmic zinc finger protein that inhibits nuclear factor kappa-B (NF-KB) activity and tumor necrosis factor (TNF)-mediated programmed cell death. Disruption of the TNFAIP3 (A20) gene in CAR T cells has the potential to improve T cell survival, efficacy and persistence in the immunosuppressive tumor microenvironment (TME).
[0064] In some embodiments, the population of cells comprising a disruption of the TNFAIP3 (A20) gene has enhanced activation of NF-KB pathway. In some embodiments, the population of cells comprising a disruption of the TNFAIP3 (A20) gene has at least about a 2-fold, at least about a 2.5-fold, at least about a 3-fold, at least about a 4-fold, or at least about a 5-fold enhanced activation of NF-KB pathway quantified by using an NF-KB reporter assay (e.g., see Example 2).
[0065] In some embodiments, the population of cells comprising a disruption of the TNFAIP3 (A20) gene exhibits an anti-tumor activity and / or exhibits an enhanced anti-tumor activity, for example when compared to a population of cells expressing A20 quantified by number of complete responses (CR) achieved (e.g., see Example 5) or TGI (e.g., see Examples 6 and 7).
[0066] In certain embodiments, the TNFAIP3 (A20) gene can be knocked out (KO) or its expression effectively eliminated by any suitable method or technique known in the art. In some embodiments, the TNFAIP3 (A20) gene can be knocked out or its expression effectively eliminated using a CRISPR / Cas system, Transcription activator-like effector nucleases (TALENs), zinc fingers, site-specific nucleases, meganucleases, neutralizing antibodies, small molecule inhibitors, chemical inhibitors blocking downstream signaling pathways, and the like. In some embodiments, the TNFAIP3 (A20) is knocked out or its expression effectively eliminated using a CRISPR / Cas system comprising the sequence of SEQ ID NO: 1 (CUUUGUAUUUGAGCAAUAUG), SEQ ID NO: 2 (AACCAUGCACCGAUACACAC), and / or SEQ ID NO: 3 (UGGAUGAUCUCCCGAAACUG). In some embodiments, the TNFAIP3 (A20) gene can have its expression effectively eliminated using antisense technology, for example, by using antisense oligonucleotides (ASOs), microRNA, shRNA, siRNA, or RNAi.
[0067] In some embodiments, disruption of the A20 (TNFAIP3) gene can result in gene expression that is reduced by between about 75%-100% ( / .e., 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%). In some embodiments, disruption of the A20 (TNFAIP3) gene can result in reduced A20 protein levels by between about 75%-100% ( / .e., 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%). In certain embodiments, at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells do not express A20. TNFAIP3 gene expression and / or TNFAIP3 protein levels can be measured by any suitable method or technique known in the art, for example, in situ hybridization techniques, RNase protection assays, Northern blotting, reverse transcription (RT)-PCR, Western blotting or sequencing.5.1 Cells
[0068] The population of cells comprising a disrupted A20 gene can comprise a variety of cell types, such as lymphocytes. Particular types of cells that can be used include T cells, Natural Killer (NK) cells, NaturalKiller T (NKT) cells, Invariant Natural Killer T (iNKT) cells, alpha beta T cells, gamma delta T cells, viral- specific T (VST) cells, cytotoxic T lymphocytes (CTLs), tumor infiltrating lymphocytes, and regulatory T cells (Tregs). In some embodiments, the cells are autologous. In certain embodiments, the cells are allogeneic. In other embodiments, the cells may be from a genetically similar, but non-identical donor (allogeneic).
[0069] In some embodiments, the population of cells can also include expanded populations, and / or the engineered T cells. In some embodiments, the population of cells can comprise total T cells, CD4-positive T cells, CD8-positive T cells, regulatory T cells, gamma-delta T cells, mucosal associated invariant T (MAIT) T cells, natural killer (NK) cells, or natural killer T (NKT) cells. T cells are broadly divided into cells expressing CD4 on their surface (also referred to as CD4-positive cells) and cells expressing CD8 on their surface (also referred to as CD8-positive cells). T cells appropriate for use according to the methods provided herein are mononuclear lymphocytes derived from bone marrow (BM), peripheral blood (PB), or cord blood (CB) of a human donor. These cells could be collected directly from BM, PB, or CB or after mobilization or stimulation via administration of growth factors and / or cytokines such as granulocyte-colony stimulating factor (G-CSF) or granulocyte-macrophage colony-stimulating factor (GM-CSF) to allogeneic or autologous donors. Those skilled in the art would appreciate that there are many established protocols for isolating peripheral blood mononuclear cells (PBMC) from peripheral blood. Isolation of PBMC can be aided by density-gradient separation protocols, usually employing a density-gradient centrifugation technique using FicollO-Hypaque or Histopaque® for separating lymphocytes from other elements in the blood. Preferably, PBMC isolation is performed under sterile conditions. Isolation of PBMC can also use negative selection kits. Alternatively, cell elutriation methods may be employed to separate mononuclear cell populations. In some embodiments, the population of cells are human cells. In certain embodiments, the population of cells are human primary immune cells.
[0070] In some embodiments, the cell compositions and methods of this disclosure further include populations of cells comprising a genetically engineered or chimeric antigen receptor. Chimeric antigen receptors (CARs), also known as chimeric T cell receptors, artificial T cell receptors, and chimeric immunoreceptors, are engineered receptors, which graft specificity onto an immune effector cell. In some embodiments, at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells express the CAR. In general, a chimeric antigen receptor is a transmembrane protein having a targetantigen binding domain that is fused via a spacer and a transmembrane domain to a signaling endodomain. When the CAR binds its target antigen, an activating signal is transmitted to the T cell. In one embodiment, a polynucleotide that encodes a chimeric antigen receptor is introduced to the population of cells with a disrupted A20 gene. In one embodiment, a nucleic acid vector encoding the chimeric antigen receptor or genetically engineered receptor is introduced into the population of cells whereby the T cells express the chimeric antigen receptor. In some embodiments, the CAR binds glypican 3 (GPC3), human epidermal growth factor receptor 2 ((HER2); also known as Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2)), or CD19. In certain embodiments, the CAR can bind any target for use in immunotherapy.5.2 CAR construct design
[0071] CAR constructs of the present disclosure can have several components, many of which can be selected based upon a desired or refined function of the resultant CAR construct. In addition to an antigen binding domain, CAR constructs can have a spacer domain, a hinge domain, a signal peptide domain, a transmembrane domain, and one or more costimulatory domains. Selection of one component over another ( / .e., selection of a specific co-stimulatory domain from one receptor versus a co-stimulatory domain from a different receptor) can influence clinical efficacy and safety profiles.5.2.1 Antigen binding domain
[0072] Antigen binding domains contemplated herein can include antibodies or one or more antigenbinding fragments thereof. In an embodiment, a CAR construct targets GPC3. In an embodiment, a CAR construct targets HER2. In an embodiment, a CAR construct targets CD19. In an embodiment, a CAR construct targets any molecule useful in an immunotherapy. In certain embodiments, the antigen binding domain comprises a single chain variable fragment (scFv) containing light and heavy chain variable regions from one or more antibodies specific for GPC3 or HER2 or CD19 that are either directly linked together or linked together via a flexible linker (e.g., a repeat of G4S having 1 , 2, 3 or more repeats).5.2.2 Spacer domain
[0073] A CAR construct can have a spacer domain to provide conformational freedom to facilitate binding to the target antigen on the target cell. The optimal length of a spacer domain may depend on the proximity of the binding epitope to the target cell surface. For example, proximal epitopes can require longer spacers and distal epitopes can require shorter ones. Besides promoting binding of the CAR to the target antigen, achieving an optimal distance between a CAR cell and a cancer cell may also help to sterically occlude large inhibitory molecules from the immunological synapse formed between the CAR cell and the target cancer cell. A CAR can have a long spacer, an intermediate spacer, or a shorter spacer. Long spacers can include a CH2CH3 domain (-220 amino acids) of immunoglobulin G1 (lgG1) or lgG4 (either native or with modifications common in therapeutic antibodies, such as a S228P mutation), whereas the CH3 region can be used on its own to construct an intermediate spacer (-120 amino acids). Shorter spacers can be derived from segments (< 60 amino acids) of CD28, CD8a, CD3 or CD4. Short spacers can also be derived from the hinge regions of IgG molecules. These hinge regions may be derived from any IgG isotype and may or may not contain mutations common in therapeutic antibodies such as the S228P mutation mentioned above.5.2.3 Hinge domain
[0074] A CAR can also have a hinge domain. The flexible hinge domain is a short peptide fragment that provides conformational freedom to facilitate binding to the target antigen on the tumor cell. It may be used alone or in conjunction with a spacer sequence. The terms “hinge” and “spacer” are often usedinterchangeably - for example, lgG4 sequences can be considered both “hinge” and “spacer” sequences ( / .e., hinge / spacer sequences).5.2.4 Signal peptide
[0075] A CAR construct can further include a sequence comprising a signal peptide. Signal peptides function to prompt a cell to translocate the CAR to the cellular membrane. Examples include an IgG 1 heavy chain signal polypeptide, Ig kappa or lambda light chain signal peptides, granulocyte-macrophage colony stimulating factor receptor 2 (GM-CSFR2 or CSFR2) signal peptide, a CD8a signal polypeptide, or a CD33 signal peptide.
[0076] Transmembrane domain-. A CAR construct can further include a sequence comprising a transmembrane domain. The transmembrane domain can include a hydrophobic a helix that spans the cell membrane. The properties of the transmembrane domain have not been as meticulously studied as other aspects of CAR constructs, but they can potentially affect CAR expression and association with endogenous membrane proteins. Transmembrane domains can be derived, for example, from CD4, CD8a, or CD28.5.2.5 Costimulatory domain
[0077] A CAR construct can further include one or more sequences that form a co-stimulatory domain. A co-stimulatory domain is a domain capable of potentiating or modulating the response of immune effector cells. Co-stimulatory domains can include sequences, for example, from one or more of CD3zeta (or CD3z), CD28, 4-1 BB, OX-40, ICOS, CD27, GITR, CD2, IL-2R and MyD88 / CD40. The choice of co- stimulatory domain influences the phenotype and metabolic signature of CAR cells. For example, CD28 co-stimulation yields a potent, yet short-lived, effector-like phenotype, with high levels of cytolytic capacity, interleukin-2 (IL-2) secretion, and glycolysis. By contrast, T cells modified with CARs bearing 4-1 BB costimulatory domains tend to expand and persist longer in vivo, have increased oxidative metabolism, are less prone to exhaustion, and have an increased capacity to generate central memory T cells.5.3 Methods of Treatment
[0078] In some embodiments, the population of cells as described herein are used in methods of treating a cancer in a subject in need thereof. In some embodiments, the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof. However, the cancers listed herein are not intended to be limiting.
[0079] The terms "treatment" or "treat," as used herein, refer to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include subjects having cancer as well as those prone to having cancer orthose in cancer is to be prevented. In some embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of cancer. In other embodiments, those in need of treatment include subjects having a tumor as well as those prone to have a tumor or those in which a tumor is to be prevented. In certain embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of tumors. In certain embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of solid tumors. In other embodiments, treatment of a tumor includes inhibiting tumor growth, promoting tumor reduction, or both inhibiting tumor growth and promoting tumor reduction.
[0080] In some embodiments, the populations of cells provided herein can be administered as a pharmaceutical composition comprising a therapeutically effective amount of population of cells as a therapeutic agent ( / .e., for therapeutic applications).
[0081] In some embodiments, the populations of cells provided herein are CAR-modified cells of, such as CAR T cells, and may be administered alone or as a pharmaceutical composition with a diluent and / or other components associated with cytokines or cell populations. Briefly, pharmaceutical compositions of the disclosure can include, for example CAR T cells comprising a disrupted A20 gene as described herein, with one or more pharmaceutically or physiologically acceptable carrier, diluent, or excipient. Such compositions can comprise buffers such as neutral buffered saline, buffered saline, and the like; sulfates; carbohydrates such as glucose, mannose, sucrose, or dextrans, mannitol; proteins, polypeptides, or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The pharmaceutical compositions of the disclosure may be adapted to the treatment (or prophylaxis).
[0082] The terms "pharmaceutical composition" or "therapeutic composition," as used herein, refer to a compound or composition capable of inducing a desired therapeutic effect when properly administered to a subject. In some embodiments, the disclosure provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of the population of cells of the disclosure.
[0083] The terms "pharmaceutically acceptable carrier" or "physiologically acceptable carrier," as used herein, refer to one or more formulation materials suitable for accomplishing or enhancing the delivery of one or more populations of cells the disclosure.
[0084] The term "subject" is intended to include human and non-human animals, particularly mammals. In certain embodiments, the subject is a human patient.
[0085] The terms "administration" or "administering," as used herein, refer to providing, contacting, and / or delivering a compound or compounds by any appropriate route to achieve the desired effect. Anyacceptable route of administration is contemplated, such as, without limitation, administration intravenous (e.g., intravenous infusion), parenteral, or subcutaneous routes of administration. Administration may include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, or intracranial injection), transdermal, topical, buccal, rectal, vaginal, nasal, ophthalmic, via inhalation, and implants.
[0086] The number of cells in the population of cells administered per dose, the number of doses, and frequency of dosing will depend on various parameters such as the patient's age, weight, clinical assessment, tumor type, tumor burden, and / or other factors, including the judgment of the attending physician. The number of cells can vary for each patient considerably, based on the number of cells obtained initially and at what rate the modified cells grow in the laboratory.
[0087] In a particular embodiment, the methods of treating as disclosed herein can also include one or more therapeutic components, such as an anticancer antibody and / or a chemotherapeutic component. For example, it is contemplated that a treatment regimen can additionally include additional therapeutics (e.g., chemotherapies and / or biologies). Contemplated additional therapeutics can include without limitation: cisplatin / gemcitabine or methotrexate, vinblastine, ADRIAMYCIN™ (doxorubicin), cisplatin (MVAC), carboplatin-based regimen, or single-agent taxane or gemcitabine, temozolomide, or dacarbazine, vinflunine, docetaxel, paclitaxel, nab-paclitaxel, Vemurafenib, Erlotinib, Afatinib, Cetuximab, Bevacizumab, Erlotinib, Gefitinib, and / or Pemetrexed. Further examples include drugs targeting DNA damage repair systems, such as poly (ADP-ribose) polymerase 1 (PARP1) inhibitors and therapeutics inhibiting WEE1 protein kinase activity, ATR protein kinase activity, ATM protein kinase activity, Aurora B protein kinase activity, and DNA-PK activity. Additional therapeutic options may also include, but are not limited to: 1) combination regimens such as: AD (doxorubicin, dacarbazine); AIM (doxorubicin, ifosfamide, mesna); MAID (mesna, doxorubicin, ifosfamide, dacarbazine); ifosfamide, epirubicin, mesna; gemcitabine and docetaxel; gemcitabine and vinorelbine; gemcitabine and dacarbazine; doxorubicin and olaratumab; methotrexate and vinblastine; tamoxifen and sulindac; vincristine, dactinomycin, cylclophosphamide; vincristine, doxorubicin, cyclophosphamide; vincristine, doxorubicin, cyclophosphamide with ifosfamide and etoposide; vincristine, doxorubicin, ifosfamide; cyclophosphamide topotecan; or ifosfamide, doxorubicin; and / or 2) single agents, such as: cisplatin or other metallic compounds, 5-FU / capecitabine (Xeloda®), cetuximab (Erbitux®), cemiplimab (Libtayo®), pembrolizumab (MK-3475), panitumumab (Vectibix®), dacomitinib (PF-00299804), gefitinib (ZD1839, Iressa), doxorubicin, ifosfamide, epirubicin, gemcitabine, dacarbazine, temozolomide, vinorelbine, eribulin, trabectedin, pazopanib, imatinib, sunitinib, regorafenib, sorafenib, nilotinib, dasatinib, interferon, toremifene, methotrexate, irinotecan, topotecan, paclitaxel, nab- paclitaxel (abraxane), docetaxel, bevacizumab, temozolomide, sirolimus (Rapamune®), everolimus, temsirolimus, crizotinib, ceritinib, or palbociclib. Examples of additional immunotherapies can include, for example, MEDI-0680, durvalumab (Imfinzi®; MEDI-4736), pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), atezolizumab (Tecentriq®) and avelaumab (Bavencio®). CTLA-4 inhibitors (for example, tremelimumab (Imjudo®); ipilimumab (Yervoy®)) are another class of drugs thatcan boost the immune response. In some instances, cytokine therapy (such as, interferon-alpha and interleukin-2) can be used to boost the immune system. Examples of interferon and interleukin-based treatments can include, but are not limited to, aldesleukin (proleukin®), interferon alpha-2b (INTRON®), and PEGylated interferon alpha-2b (Sylvatron®; PEG-INTRON®, PEGASYS).
[0088] In some embodiments, this disclosure provides a method for treating cancer comprising: (a) obtaining a population of cells from a donor; (b) genetically modifying the population of cells to disrupt the TNF alpha induced protein 3 (A20; TNFAIP3) gene; (c) expanding the genetically modified population of cells; and (d) administering the expanded genetically modified population of cells to a patient.
[0089] In particular embodiments, the genetically modified population of cells undergoes at least about a 50-fold expansion, at least about a 500-fold expansion, at least about a 5000-fold expansion, at least about a 250,000-fold expansion, at least about a 500,000-fold expansion, at least about a 106fold expansion, at least about a 107fold expansion, at least about a 108 fold expansion, at least about a 109fold expansion, or at least about a 1010fold expansion during culturing. In particular embodiments, the population of expanded cells is resistant to replicative senescence. Furthermore, these cells are not functionally exhausted following long-term expansion and can be directed to carry out cytotoxic function through engagement of their TCRs by a T cell engager antibody or through engagement of a chimeric antigen receptor (CAR), or through a natural or genetically-introduced TCR.
[0090] In some embodiments, the population of cells is cultured in a culture medium that includes supportive cytokine(s), but does not include a primary immune cell stimulus. In certain embodiments, the primary immune cells undergo expansion during culturing in the absence of feeder cells or stimulation through CD3 and / or their antigen receptor. The ability of the disclosed methods to generate immune cells in the absence of extensive T cell re-stimulation or feeder cells advantageously eliminates the issues of scaling up the methods and producing dysfunctional populations of immune cells.
[0091] In some embodiments, the methods disclosed herein provide populations of expanded cells (including human CD8+ T cells, human CD4+ T cells, or human natural killer T cells) with disrupted A20 gene that have the ability to proliferate for substantial periods of time in the absence of re-stimulation through their T cell receptors (TCRs), expanding millions of fold in long-term culture. In particular embodiments, the population of cells is cultured for at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, at least 100 days, at least 150 days, at least 200 days, at least 300 days, or at least 400 days.6 Embodiments:The following clauses define embodiments of the disclosure.Embodiment 1) A population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene.Embodiment 2) The population of cells of embodiment 1 further comprising a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR).Embodiment 3) The population of cells of either embodiment 1 or embodiment 2, wherein the population of cells is an autologous cell population or an allogeneic cell population.Embodiment 4) The population of cells of any one of embodiments 1 to 3, wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumour infiltrating lymphocyte population.Embodiment 5) The population of cells of any one of embodiments 1 to 4, wherein the population of cells comprises total T cells.Embodiment 6) The population of cells of any one of embodiments 1 to 5, wherein the population of cells comprises CD8+ T cells.Embodiment 7) The population of cells of any one of embodiments 1 to 5, wherein the population of cells comprises CD4+ T cells.Embodiment 8) The population of cells of any one of embodiments 1 to 7, wherein the population of cells comprises human primary immune cells.Embodiment 9) The population of cells of any one of embodiments 1 to 8, wherein at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells do not express A20.Embodiment 10) The population of cells of any one of embodiments 1 to 9, wherein at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells express the CAR.Embodiment 11 ) The population of cells of any one of embodiments 1 to 10, wherein the population of cells has at least about a 2-fold, at least about a 2.5-fold, at least about a 3-fold, at least about a 4- fold, or at least about a 5-fold enhanced activation of NF-KB pathway.Embodiment 12) The population of cells of any one of embodiments 1 to 11 , wherein the population of cells exhibits anti-tumour activity.Embodiment 13) The population of cells of any one of embodiments 1 to 12, wherein the population of cells exhibits enhanced anti-tumour activity.Embodiment 14) A pharmaceutical composition comprising the population of cells of any one of embodiments 1 to 13 and a pharmaceutically acceptable carrier.Embodiment 15) A method of treating a cancer in a subject in need thereof, comprising administering to the subject the population of cells of any one of embodiments 1 to 13, or the pharmaceutical composition of embodiment 14.Embodiment 16) The method of embodiment 15, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.Embodiment 17) The method of embodiment 15 or embodiment 16, further comprising inhibiting tumour growth, inducing tumour regression, and / or prolonging survival of the subject.Embodiment 18) A method for treating cancer:(a) obtaining a population of cells from a donor;(b) genetically modifying the population of cells to disrupt the TNF alpha induced protein 3 (A20; TNFAIP3) gene;(c) expanding the genetically modified population of cells; and(d) administering the expanded genetically modified population of cells to a patient.Embodiment 19) The method of embodiment 18, wherein A20 is disrupted by a Cas / CRISPR system.Embodiment 20) The method of either embodiment 18 or embodiment 19 further comprising introducing a chimeric antigen receptor (CAR) into the population of cells.Embodiment 21 ) The method of any one of embodiments 18 to 20, wherein the population of cells are an autologous or an allogeneic cell population.Embodiment 22) The method of any one of embodiments 18 to 21 , wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumour infiltrating lymphocyte population.Embodiment 23) The method of any one of embodiments 18 to 22, wherein the population of cells comprises total T cells.Embodiment 24) The method of any one of embodiments 18 to 23, wherein the population of cells comprises CD8+ T cells.Embodiment 25) The method of any one of embodiments 18 to 24, wherein the population of cells comprises CD4+ T cells.Embodiment 26) The method of any one of embodiments 18 to 25, wherein the population of cells comprises human primary immune cells.Embodiment 27) The method of any one of embodiments 18 to 26, wherein the population of cells exhibits an enhanced anti-tumour activity.Embodiment 28) Use of the population of cells of any one of embodiments 1 to 13 or the pharmaceutical composition of embodiment 14, for the manufacture of a medicament for the treatment of a disease or condition.Embodiment 29) The use of embodiment 28, wherein the disease or condition is cancer.Embodiment 30) The use of embodiment 29, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.Embodiment 31) The population of cells of any one of embodiments 1 to 13 or the pharmaceutical composition of embodiment 14, for use as a medicament.Embodiment 32) The population of cells of any one of embodiments 1 to 13 or the pharmaceutical composition of embodiment 14, for use in the treatment of cancer.Embodiment 33) The population of cells for use of embodiment 32, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.7 EXAMPLES
[0092] It is to be understood that the particular aspects of the specification are described herein are not limited to specific embodiments presented and can vary. It also will be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting. Moreover, particular embodiments disclosed herein can be combined with other embodiments disclosed herein, as would be recognized by a skilled person, without limitation. The Examples that follow are illustrative of specific embodiments of the disclosure, and various uses thereof.They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any ay.
[0093] The embodiments described herein can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the embodiments claimed. Thus, it should be understood that although the present description has been specifically disclosed by embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of these embodiments as defined by the description and the appended claims. Although some aspects of the present disclosure can be identified herein as particularly advantageous, it is contemplated that the present disclosure is not limited to these particular aspects of the disclosure.
[0094] Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0095] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group.
[0096] It should it be understood that, in general, where the disclosure, or aspects of the disclosure, is / are referred to as comprising particular elements and / or features, certain embodiments of the disclosure or aspects of the disclosure consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein.7.7 Example 1. Efficient CRISPR KO ofA20 in CAR-T cells.
[0097] In order to determine whether efficient KO of A20 could be achieved in CAR-T cells, we performed western blot of A20 protein at different times upon A20 CRISPR KO. Knock out of the A20 gene by CRISPR was performed the same day of a CAR transduction. Upon transduction, cells were cultured in IL-2containing media and maintained at a concentration of 0.2-0.5 million / cells / mL. Cell concentrations and viabilities were measured every 2-3 days and cells were diluted with media to achieve 0.2-0.5 million / cells / mL standardized concentration. To assess the expression of A20, cells were lysed and protein content was analyzed by western blot after 7 (Figure 1A) or 13 (Figure 1 B) days of expansion. A20 expression was abolished at day 7 and 13.
[0098] Given the broad effect of A20 in regulating NF-KB signaling pathway, we asked if KO of this gene would affect CAR-T in vitro expansion or CD4 / CD8 ratio. Incremental fold changes were calculated by dividing each new concentration measurement with the previous standardized concentration. Cumulative fold change was calculated by multiplying all incremental fold changes. Graph represents cumulative fold expansion for each construct. Knock out of the A20 gene did not substantially affect fold expansion (Figure 2A) and CD4 / CD8 ratio (Figure 2B) of unarmored or A20 deficient CAR-T cells.7.2 Example 2. A20 deficiency results in enhanced NF-KB activation upon CAR engagement.
[0099] A20 is a key negative regulator of the NF-KB pathway activated upon T cell receptor (TCR) engagement ( [2]). It has not yet been clarified if A20 negatively regulates NF-KB signaling downstream CAR engagement. To answer this question, we performed a reporter assay using Jurkat cells transfected with a Luciferase-expressing NF-KB responsive construct. These NF-KB luciferase reporter Jurkat cells were either untransduced, lacking CAR, or expressing GPC3 (Figure 3A) or CD19 (Figure 3B) CARs, and sufficient or KO for A20. Untransduced cells did not show activation of NF-KB when unstimulated or when stimulated with the GPC3-expressing cell line PLC / PRF / 5. Cells expressing the GPC3 CAR showed a slightly higher luciferase signal at baseline due to 4-1 BB tonic signaling, that increased 3.6-fold upon stimulation with GPC3+ cells, as expected. The level of NF-KB activation in unstimulated A20 KO CAR-T cells was 2.6-fold higher compared to unstimulated unarmored CAR-T cells, and it was strongly induced upon incubation with PLC / PRF / 5, 2.3-fold more compared to stimulated unarmored CAR-T cells (Figure 3A). A similar pattern was shown when cells expressed the CD19 CAR and were stimulated with the CD19 - cell line NALM6. Data confirm that lack of A20 results in enhanced NF-KBa activation in CAR-T cells.
[0100] To better characterize the biological impact of enhanced NF-KBa activation downstream of CAR, we performed a gene expression array on unarmored or A20 KO armored CAR-T cells, stimulated or not with target-expressing cells. As shown in Figure 4A -Figure 4, A20 deficiency results in enhanced NF-KB activation upon CAR engagement. Unarmored or A20 KO CAR-T cells were left unstimulated or stimulated for 1 or 6 days with GPC3 positive tumor cells and gene expression was analyzed by Nanostring. Figure 4A - volcano plots depict the fold gene of genes in A20 KO compared to unarmored CAR-T cells. At every time point analyzed more than 50% of upregulated genes are NF-KB target genes. Figure 4B - the heatmap shows top 20 NF-KB target genes upregulated genes in A20 deficient CAR-T cells after 6 days. Data confirm that lack of A20 results in enhanced NF-KB activation, downstream classic TNF pathway and downstream CAR-T cells.7.3 Example 3. A20 deficient CAR-T cells show increased and prolonged upregulation of activation markers.
[0101] It has been shown that tumor antigen expression and receptor density can regulate CAR-T effector function [3]. To evaluate whether the KO of A20 would impact CAR-T cell sensitivity to different level of target expression, we co-cultured unarmored or armored CAR-T cells with cell lines expressing different level of target. To quantify target expression, we stained cell lines for GPC3 expression and calculated receptor density by flow cytometry using bang beads. Figure 5 shows the characterization of target cell lines expressing high (Hep3B), medium / low (PLC / PRF / 5), or low (PLC / PRF / 5|OW) expression of GPC3. The cell line SNU-182 is GPC3 negative and was used as a negative control (Figure 5). We employed these cell lines in downstream in vitro and in vivo assays to characterize A20 KO armored CAR-T cells.
[0102] CAR-T cell activation results in release of effector cytokines, among these IFNy is one of the most well characterized. To evaluate if the KO of A20 would affect the release of IFNy, unarmored or A20KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high level of GPC3 at a 0.3:1 E:T ratio. After 24 hours supernatant was collected and IFNy secretion was assessed by MSD. Figure 6 illustrates that A20 deficiency results in an approximately 3-fold higher level of IFNy secretion, at all antigen densities.
[0103] To evaluate the effect of A20 KO on CAR-T cell cytotoxic ability, unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high level of GPC3 at a 0.3:1 E:T ratio and cytolysis was assessed by xCELLigence. Figure 7 illustrates that A20 deficiency does not result in increased killing of target cells in an acute, single-challenge assay.
[0104] Engagement of the CAR results in upregulation of T-cell activation markers and differentiation to an effector phenotype. To evaluate if A20 KO could affect T cell activation, unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 8A) or high (Figure 8B) levels of GPC3. After 1 or 6 days the expression of CD25 and CD69 was analyzed by flow cytometry on CAR+ cells. Figure 8A - Figure 8B illustrate that unstimulated A20 KO cells express similar level of CD25 and CD69 compared to unarmored CAR-T cells. Activation markers were strongly upregulated after 1 day of incubation with GPC3 low (Figure 8A) or high (Figure 8B) expressing cells and were downregulated after 6 days on unarmored cells. A20 deficiency results in acute, increased expression of the NF-KB dependent activation markers CD25 and CD69 at day 1 (D1). This phenomenon was more evident upon incubation with GPC3- low target cells, that resulted in a frequency A20 KO CD25 / CD69 double-positive (DP) cells approximately 1.4-fold higher compared to unarmored cells. 6 days after incubation, unarmored cells almost completely downregulated CD25 and CD69, while A20 KO cells were still showing a higher expression of CD25 and CD69 (approximately 1.4-fold), even in the face of complete killing of target cells. Incubation with GPC3- high target cells also resulted in a higher expression of CD25 and CD69, albeit this phenomenon was less prominent due to a higher expression of the two markers at day 6 on unarmored cells. Therefore, lack ofA20 results in prolonged activation of CAR-T cells. Dot plots are gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells.7.4 Example 4. A20 KO CAR-T cells show a similar expression of sternness and exhaustion genes compared to unarmoured CAR-T cells.
[0105] T Cell activation results in differentiation to an effector phenotype that can efficiently support cytokine secretion and killing of target cells. Cells that are more differentiated, however, can undergo faster senescence and dysfunction, leading to poor persistence. We asked if higher expression of activation markers was associated to a more differentiated phenotype of the A20KO armored CAR-T cells. Unarmored or A20KO CAR-T cells were incubated with tumor cells expressing low (Figure 9A) or high (Figure 9B) level of GPC3 as in Figure 8. After 1 or 6 days the expression of the differentiation markers CD62L and CD45RO was analyzed by flow cytometry on CAR+ cells to discriminate between naive (CD62Lhi CD45ROIo), central memory (CD62Lhi CD45ROhi), and effector memory (CD62LloCD45ROhi). Dot plots were gated in the CD4+ population, similar results were obtained for CD8 CAR-T cells. Figure 9A - Figure 9C illustrate that A20 deficient CAR-T cells show a similar differentiation pattern compared to unarmored CAR-T cells. These data show that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers might result in increased differentiation, and therefore decreased sternness and persistence. Figure 9C shows that A20 KO CAR-T cells show a similar expression of sternness and exhaustion genes compared to unarmored CAR-T cells. Unarmored or A20KO CAR-T cells were incubated with tumor cells high level of GPC3. After 6 days, the expression of the indicated genes was analyzed by Nanostring. These data show that A20 deficiency does not result in increased differentiation antigen encounter, corroborating findings in Figure 9A and Figure 9B.7.5 Example 5. Lack ofA20 delays CAR-T dysfunction in vitro.
[0106] The differentiation stage of T cells is strictly connected with their proliferative, survival, and cytotoxic abilities. The persisting antigenic stimulation of CAR-T cells in cancer induces terminal differentiation of CAR-T cells, resulting in a progressive dysfunction and T cell exhaustion. Classic hallmarks of exhaustion are low proliferative capacity, reduced secretion of effector cytokines, and reduced cytotoxic ability [4]. To test the effect of A20 KO on T cell dysfunction, we developed a serial kill assay where we repetitively stimulated CAR-T cells with antigen expressing cells, mimicking the chronic antigen exposure that CAR-T cells would receive in the TME.
[0107] Unarmored or A20 deficient CAR-T cells were incubated with target cells expressing high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) level of GPC3 at an effector:target ratio of 0.3:1 (GPC3 high) or 2:1 (GPC3 medium / low and GPC3 low). After 2-3 days, cell number was assessed by flow cytometry and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first rounds of the assay, unarmored and A20 KO CAR-T cells kill all the tumor cells, regardless of antigendensity. However, after a few rounds CAR-T cell efficacy decreases as cells becomes dysfunctional. A20 deficiency delays the onset of dysfunction and preserves CAR-T cells ability to kill tumor cells longer than unarmored cells. Notably, this is true even when the target cells express very low level of GPC3.
[0108] As shown in Figure 11A - Figure 11C, enhanced tumor control in serial kill assay does not correlate with enhanced expansion. GPC3 expressing cells - high (Figure 11 A), medium / low (Figure 11 B), and low (Figure 11 C) were treated as in Figure 10. Fold expansion was calculated based on the number of CAR+ cells counted after each round of killing. Data show that A20 KO cells did not expand more compared to unarmored cells, therefore enhanced tumor control was the result of intrinsic enhanced effector capacity.
[0109] As shown in Figure 12A - Figure 12C, a lack of A20 delays effector cytokine production decrease in a serial kill assay against high GPC3 expressing cells. Unarmored or A20 deficient CAR-T cells were incubated with target cells expressing high level of GPC3 at an effector:target ratio of 0.3:1 (GPC3 high) or 2:1 (GPC3 medium / low and GPC3 low) and serial kill assay was performed as previously described (Figure 10). IFNy (Figure 12A), IL2 (Figure 12B), and TNFa (Figure 12C) were analyzed in the supernatant after 3, 5, or6 rounds of serial kill. A20 KO CAR-T cells produce more effector cytokines compared to unarmored CAR-T cells even after multiple rounds of stimulation, confirming an enhanced activation status.7.6 Example 6. Lack ofA20 enhances CAR-T efficacy against high GPC3 expressing tumours.
[0110] To test the effect of the in vivo efficacy of A20 KO CAR-T cells, we employed a xenograft model using as a target the GPC3-high expressing HCC cell line Hep3B and monitored the ability of CAR-T cells to control tumor growth as well as the release of IFNy as a marker of effector function.
[0111] As shown in Figure 13A - Figure 13D, Hep3B were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Figure 13A shows tumor volume for individual mice in the study infused with 0.5e6 CAR-T cells or UT cells. UT cells were not able to control tumor growth. Mice infused with unarmored CAR-T cells experienced partial tumor control, with only 3 out of 9 mice able to maintain tumor volume below 500mm3for an extended period of time. In contrast, 6 out of 9 mice infused with A20 KO CAR-T cells were able to maintain tumor volume below 500 mm3for approximately 10 days. Mice infused with 2e6 CAR-T cells experienced in general more profound and durable tumor control compared to mice infused with a lower dose of cells (Figure 13B). Unarmored CAR-T cells induced complete regression (CR) in 3 out of 7 mice (42%), in contrast A20 KO CAR-T cells induced CR in 7 out of 8 mice (87%) (Figure 13B). Four A20 KO-infused mice were already in CR at D17 post-infusion, compared to only 1 mouse receiving unarmored CAR-T cells. A20 KO CAR-T cells were able to mediate prolonged tumor control (Figure 13C), as reflected by a statistically significant difference in survival (Figure 13D). These data show that A20 KO CAR-T cells have a superior efficacy against high-GPC3 expressing tumors compared to unarmored CAR-T cells.
[0112] As shown in Figure 14, A20 KO CAR-T cells produce more IFNy in vivo. Mice treated as in Figure 12 were bled 7 days after T cell infusion and IFNy was analyzed in the serum. A higher level of IFNy is present in the serum of A20 KO mice, in line with the in vitro findings (Figure 6) demonstrating that lack of A20 results in enhanced CAR-T cells activation in vivo.7.7 Example 7. Lack of A20 enhances CAR-T efficacy against medium-low GPC3 expressing tumours.
[0113] Data shown in the Example 6 demonstrate the lack of A20 enhances CAR-T activation against high-GPC3 expressing tumors. To explore if a similar enhancement in in vivo efficacy would be achieved also against low / medium target-expressing cells, we employed a xenograft model utilizing PLC / PRF / 5 cells and monitored the effect of CAR-T cells on tumor growth, as well as their in vivo proliferation and IFNy production.
[0114] As shown in Figure 15A - Figure 15C, PLC / PRF / 5 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Figure 15A shows that infusion of a low dose CAR-T (0.5e6 / mouse) can partially control tumor growth. A20 KO CAR-T cells provided a slightly longer control. As shown in Figure 15B, 2e6 unarmored CAR-T cells induced delay in tumor growth, in contrast the same dose of A20 KO CAR-T cells induced CR in all the mice treated and a prolonged tumor control resulting in increased survival (Figure 15C). These data show that A20 KO CAR-T cells have a superior efficacy against medium / low-GPC3 expressing tumors compared to unarmored CAR-T cells.
[0115] We asked if enhanced in vivo efficacy correlated to higher number of CAR-T cells in the tumor. To answer this question, we infused PLC / PRF / 5 tumor-bearing mice with unarmored or A20KO CAR-T cells expressing Luciferase under the control of the CAR promoter, to track the distribution and expansion of the cells. Luc+-A20 KO CAR-T cells were more efficacious than unarmored (A), similarly to Figure 15B. The amount of BLI in the tumor calculated as fold change over the day of infusion (DO) shows that CAR-T cells undergo rapid expansion followed by a profound contraction that correlates with decrease in tumor volume, with a similar kinetic for both unarmored and A20 KO CAR-T cells. The fold change in BLI was not higher for A20 KO CAR-T cells compared to unarmored, indicating a similar number of tumor-infiltrating cells. In contrast, the density of A20 KO CAR-T cells per mm3of tumor was much higher compared to unarmored CAR-T (C) cells, in line with a smaller tumor volume due to increased efficacy. Figure 16A - Figure 16C illustrate that a lack of A20 enhances CAR-T cell efficacy without affecting cell number. PLC / PRF / 5 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200mm3, untransduced T cells (UT) or Luciferase expressing CAR-T cells were infused intravenously at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figure 16B and Figure 16C) were assessed biweekly. These data demonstrate the lack of A20 enhances CAR-T cell efficacy without affecting the proliferation.
[0116] As shown in Figure 17, A20 KO CAR-T cells maintain higher ability to produce IFN upon tumor relapse. Upon relapse, tumors were collected from unarmored or A20 KO-infused mice when the tumor reached a volume of approximately 300 mm3. Tumors were homogenized and cell suspension was plated and stimulated with PMA (10 ng / mL) and lonomycin (500 ng / mL) for overnight. Supernatants were collected and IFNy analyzed by MSD. A fraction of cells was analyzed by flow cytometry before the stimulation to determine the frequency and number of T cells per sample. IFNy secreted was normalized by number of T cells / well. Data show that A20 KO CAR-T cells isolated from relapsed tumors have a higher intrinsic activation potential compared to unarmored CAR-T, in line with the in vitro data.7.8 Example 8. Lack of A20 enhances CAR-T efficacy against low GPC3 expressing tumours.
[0117] Low expression of tumor-associated antigen as a result of tumor escape or heterogeneity is one of the main causes of failure of cell therapy in solid tumors. We explored whether the deficiency of A20 confers enhanced in vivo efficacy against tumors expressing low level of GPC3.
[0118] As demonstrated in Figure 18, PLC / PRF / 5 expressing low level of GPC3 were implanted subcutaneously in the flank of NSG mice. When tumors reached a volume of 200 mm3, untransduced T cells (UT) or CAR-T cells were infused intravenously at a dose of 0.5 or 2e6 cells / mouse. Tumor volume was measured biweekly. Left panel: Infusion of a low dose CAR-T (0.5e6 / mouse) can slightly delay tumor growth. A20 KO CAR-T cells achieve increased tumor control. Similar advantage is shown in panel Right panel: at a dose of 2e6 CAR+ / mouse. These data show that A20 KO CAR-T cells have a superior efficacy against low-GPC3 expressing tumors compared to unarmored CAR-T cells.
[0119] Figure 19 illustrates that A20 KO CAR-T cells produce more IFNy in vivo in GPC3 low tumors. Mice treated as in Figure 17 were sacrificed 7 days after T cell infusion and IFNy was analyzed in the tumor infiltrating CAR-T cells by intracellular staining. A20 KO CAR-T cells infiltrating the tumor express higher level of IFNy, in line with the in vitro findings (Figure 6) demonstrating that lack of A20 results in enhanced CAR-T cell activation in vivo.7.9 Example 9. Knock-out of A20 results in enhanced production of IFNy in a CAR-independent way.
[0120] To characterize the effect of lack of A20 on CAR-T cell effector function, we employed the GPC3- CAR as a benchmark. To investigate if KO of A20 results in a similar phenotype using different CARs, we analyzed the production of the effector cytokine IFNy in HER2 CAR-T cells sufficient or KO for A20.
[0121] HER2 CAR-T cells were generated by methods known in the art. The indicated cell lines were stained for HER2 expression and analyzed by flow cytometry (Figure 21). Knock out of the A20 gene by CRISPR was performed the same day of HER2 CAR transduction. Western blot was used to assess A20 protein expression after 10 days of cell expansion (Figure 22A). Relative A20 protein expression was quantified by densitometry (Figure 22B). A20 expression was normalized to -Actin expression. These results indicate that A20 knock out was both efficient and stable in HER2 CAR-T cells.
[0122] As shown in Figure 20, IFNy was undetectable upon incubation of HER2+target cell line with UT T cells. In contrast, incubation of HER2-CART cells resulted in robust production of IFNy, which was approximately 2-fold higher when CAR-T cells were A20 KO (Figure 20), similar to what we observed using GPC3 CAR-T cells (Figure 6). This result shows that lack of A20 results in similar effects independently on the CAR expressed by the cell. Therefore, KO of A20 is an armoring strategy that can be applied across multiple projects.
[0123] Proportions of CD4 and CD8 in UT were gated in the CD45+ population, while proportions of CD4 and CD8 in unarmoured and A20KO CAR-T were gated in CAR+ cells. Lack of A20 did not substantially affect CAR-T fold expansion (Figure 23A) or CD4 / 8 ratio (Figure 23B).
[0124] A20 deficiency also did not result in increased killing of target cells in an acute, single-challenge assay (Figure 24). A20 deficient HER2 CAR-T cells show increased and prolonged upregulation of activation markers (Figure 25). Unarmoured or A20KO HER2 CAR-T were incubated with JIMT1 tumour cells. After 1 or 4 days, the expression of CD25 and CD70 was analyzed by flow cytometry on CAR+ cells. A20 deficiency results in acute increased expression of activation marker CD70 at D1. 4 days after incubation, A20KO cells show a higher expression of CD25 and CD70, even in the face of complete killing of target cells. Therefore, lack of A20 resulted in prolonged activation of CAR-T cells.
[0125] A20 deficient HER2 CAR-T cells showed a similar differentiation pattern compared to unarmoured CAR-T cells. Unarmoured or A20KO HER2 CAR-T were incubated with JIMT1 (Figure 26A) or MDA-MB- 231 (Figure 26B) tumour cells. After 1 or 4 days, the expression of the differentiation markers CD62L and CD45RO was analyzed by flow cytometry on CAR+ cells. This is particularly relevant because increased and prolonged expression of activation markers might result in increased differentiation. These data show that A20 deficiency did not result in increased differentiation before or after antigen encounter.
[0126] To test the effect of A20 KO on HER2 CART cell dysfunction, we developed a serial kill assay where we repetitively stimulated CAR-T cells with antigen expressing cells, mimicking the chronic antigen exposure that CAR-T would receive in the TME. Unarmoured or A20 deficient HER2 CAR-T were incubated with HER2 expressing target cells (MDA-MB-231). After 3-4 days, cell number was assessed by flow cytometry and fresh tumour cells were added to the culture to maintain the initial E:T ratio. During the first rounds of the assay, unarmoured and A20KO CAR-T cells kill all the tumour cells. However, after a couple of rounds CAR-T cell efficacy decreases as cells become dysfunctional. As shown in Figure 27, A20 deficiency delays the onset of dysfunction and preserves CAR-T ability to kill tumour cells longer than unarmoured cells. This assay also showed that A20 KO HER2 CAR-T cells achieve more antigen mediated proliferation than their unarmoured counterpart, suggesting CAR-intrinsic effect of A20 KO armouring (Figure 27B). Fold expansion was calculated based on the number of CAR+ cells counted after each round of killing. As shown in Figure 27C, a lack of A20 delays effector cytokine production decrease after multiple rechallenges. A20KO HER2 CAR-T produce more IFNy compared to unarmoured CAR-T even after multiple rounds of stimulation, confirming an enhanced activation status.7.10 Example 11: Lack ofA20 enhances allogenic CAR-T efficiency
[0127] Universal effect T cells (UEC) have been previously described (WO 2023 / 025862 A1). To assess the effect of A20 KO in an cell suitable for allogenic cell therapy, UEC expressing an anti-Her2 CAR were stimulated overnight with plate-bound Her2 protein or PBS only as a control. Cells were lysed the following day and protein extract were analysed by Wester Blotting. A20 was upregulated in unarmoured UECs following stimulation of the CAR, confirming successful KO of A20 at the protein level in armoured UECs and lack of A20 upregulation in stimulated cells (Figure 28).
[0128] Acute killing functionality of A20 KO or unarmoured Her2-UECs was tested in an xCelligence killing assay using JIMT-1 target cells. A20 KO did not improve acute killing of tumours cells in UECs (Figure 29), similarly to autologous CAR-T (Figure 7). Activation markers CD25 and CD69 were assessed by flow cytometry in unarmoured and A20 KO Her2-UECs either in resting state or following 3 days of co-culture with JIMT-1 target cells at an E:T ratio of 1 :1. A20 KO UEC retained a more activated phenotype than their unarmoured counterpart (Figure 30). Expression of activation marker CD70 was measured by flow cytometry in Her2-UECs either unarmoured or A20 KO co-culture with JIMT-1 target cells for up to 3 days at a E:T ratio of 1 :1. A20 KO UECs expressed CD70 at a higher level than unarmoured UECs, demonstrating a higher activation status (Figure 31). The effector cells were co-cultured with either JIMT- 1 or MDA-MB-231 target cells at an E:T ratio of 1 :1 and the supernatant was analyzed after an overnight incubation. IFNy was quantified using an ELLA assay (Bio-techne). A20 KO UECs produced more IFNy than their unarmored counterpart (Figure 32). Additionally, this data shows that A20 KO does not induce non-specific release of IFNy as the cytokine was not detectable in the absence of target cells.8 REFERENCES
[0129] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference. Citation or identification of any reference in any section of this application shall not be construed as an admission that such reference is available as prior art to the present disclosure.[1] R. C. Larson and M. V. Maus, Nat. Rev. Cancer 21 , 145 (2021).[2] S. Paul and B. C. Schaefer, Trends Immunol. 34, 269 (2013).[3] A. J. Walker et a / ., Mol. Ther. J. Am. Soc. Gene Ther. 25, 2189 (2017).[4] G. Lopez-Cantillo et al., Front. Immunol. 13, 878209 (2022).
Claims
CLAIMS1. A population of cells comprising a disrupted TNF alpha induced protein 3 (A20; TNFAIP3) gene.
2. The population of cells of claim 1 further comprising a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR).
3. The population of cells of either claim 1 or claim 2, wherein the population of cells is an autologous cell population or an allogeneic cell population.
4. The population of cells of any one of claims 1 to 3, wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumour infiltrating lymphocyte population.
5. The population of cells of any one of claims 1 to 4, wherein the population of cells comprises total T cells.
6. The population of cells of any one of claims 1 to 5, wherein the population of cells comprises CD8+ T cells.
7. The population of cells of any one of claims 1 to 5, wherein the population of cells comprises CD4+ T cells.
8. The population of cells of any one of claims 1 to 7, wherein the population of cells comprises human primary immune cells.
9. The population of cells of any one of claims 1 to 8, wherein at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells do not express A20.
10. The population of cells of any one of claims 1 to 9, wherein at least about 90%, at least about 95%, or at least about 99% of cells in the population of cells express the CAR.
11. The population of cells of any one of claims 1 to 10, wherein the population of cells has at least about a 2-fold, at least about a 2.5-fold, at least about a 3-fold, at least about a 4-fold, or at least about a 5-fold enhanced activation of NF-KB pathway.
12. The population of cells of any one of claims 1 to 11 , wherein the population of cells exhibits antitumour activity.
13. The population of cells of any one of claims 1 to 12, wherein the population of cells exhibits enhanced anti-tumour activity.
14. A pharmaceutical composition comprising the population of cells of any one of claims 1 to 13 and a pharmaceutically acceptable carrier.
15. A method of treating a cancer in a subject in need thereof, comprising administering to the subject the population of cells of any one of claims 1 to 13, or the pharmaceutical composition of claim 14.
16. The method of claim 15, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.
17. The method of claim 15 or claim 16, further comprising inhibiting tumour growth, inducing tumour regression, and / or prolonging survival of the subject.
18. A method for treating cancer: a) obtaining a population of cells from a donor; b) genetically modifying the population of cells to disrupt the TNF alpha induced protein 3 (A20; TNFAIP3) gene; c) expanding the genetically modified population of cells; and d) administering the expanded genetically modified population of cells to a patient.
19. The method of claim 18, wherein A20 is disrupted by a Cas / CRISPR system.
20. The method of either claim 18 or claim 19 further comprising introducing a chimeric antigen receptor (CAR) into the population of cells.21 . The method of any one of claims 18 to 20, wherein the population of cells are an autologous or an allogeneic cell population.
22. The method of any one of claims 18 to 21 , wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumour infiltrating lymphocyte population.
23. The method of any one of claims 18 to 22, wherein the population of cells comprises total T cells.
24. The method of any one of claims 18 to 23, wherein the population of cells comprises CD8+ T cells.
25. The method of any one of claims 18 to 24, wherein the population of cells comprises CD4+ T cells.
26. The method of any one of claims 18 to 25, wherein the population of cells comprises human primary immune cells.
27. The method of any one of claims 18 to 26, wherein the population of cells exhibits an enhanced anti-tumour activity.
28. Use of the population of cells of any one of claims 1 to 13 or the pharmaceutical composition of claim 14, for the manufacture of a medicament for the treatment of a disease or condition.
29. The use of claim 28, wherein the disease or condition is cancer.
30. The use of claim 29, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.
31. The population of cells of any one of claims 1 to 13 or the pharmaceutical composition of claim 14, for use as a medicament.
32. The population of cells of any one of claims 1 to 13 or the pharmaceutical composition of claim 14, for use in the treatment of cancer.
33. The population of cells for use of claim 32, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.