Use of a mir-27-5p mimic for treating chronic inflammatory bowel diseases (IBD)

Abstract

The present inventors have found that a molecule mimicking miR-27a-5p is capable of strongly modulating the inflammatory response in a well-known animal model of inflammatory bowel disease (IBD). Therefore they propose incorporating this mimic into a pharmaceutical composition for treating patients suffering from this disease. Advantageously, this mimic can be linked to a matrix, incorporated into particles, or conveyed by a vector.

Description

[0001] Use of a miR-27-5p mimic to treat chronic inflammatory bowel disease (IBD)

[0002] Description of the prior art

[0003] Inflammatory bowel diseases (or IBD) include Crohn's disease (CD) and ulcerative colitis (UC). Both are characterized by inflammation of the lining of a part of the digestive tract. In CD, this inflammation can be located at any level of the digestive system, from the mouth to the anus, although it is most often found in the small intestine. In UC, it is located in the rectum and colon. IBD is most often diagnosed in young people, aged 20 to 30. However, it can occur at any age, and 15% of cases occur in children.

[0004] These diseases progress through inflammatory flare-ups of extremely variable duration and frequency depending on the patient. These flare-ups alternate with phases of remission. In approximately 20% of patients, the attacks are severe: their intensity can require hospitalization, stopping food and treatment with an infusion for a few days. In addition, the progression of the disease can lead to complications requiring surgery.

[0005] There is no cure for IBD. Currently available anti-inflammatory drugs provide partial control, the goal being to prevent flare-ups and prolong remission phases by promoting the healing of lesions in the digestive tract. Biotherapies currently used for the treatment of IBD have improved patients' quality of life and reduced hospitalization and side effects compared to corticosteroids. However, this use is not without risks.Indeed, many unexpected toxicity problems have occurred and have been recognized as being related to biotherapies, such as anti-TNFs that cause worsening of heart failure as well as reactivation of mycobacterial infections; or anti-integrin antibodies including natalizumab, with rare cases of lethal viral encephalitis or even excessive cytokine release syndrome, observed in healthy volunteers treated with a monoclonal antibody directed against CD28. In addition, the use of certain biotherapies could also be associated with long-term toxicity, including the development of lymphomas in patients treated with infliximab (anti-TNF).

[0006] On the other hand, most biologic agents are immunogenic and therefore might lose their effect over time. Furthermore, most patients treated with biologic agents require induction and maintenance therapy and the cost of these agents is likely to remain high. Thus, a balance between efficacy and safety must be carefully considered for each patient [1],

[0007] Despite the numerous therapeutic approaches developed to date for the management of intestinal inflammation in IBD, medical needs remain unmet:

[0008] 1) loss of activity of molecules over time, requiring the change of molecule,

[0009] 2) medium and long-term side effects, including immune disruption, development of cancers, especially colon cancers, 3) lack of response in refractory forms.

[0010] There is therefore an urgent need to identify more effective treatments to treat patients suffering from IBD, with the best possible tolerance or with the fewest possible adverse effects.

[0011] Several teams have reported the beneficial role that miRNA could have in regulating inflammation associated with IBD [2]. MicroRNAs (miRNAs or miRs) are non-coding RNA sequences of 21 to 24 nucleotides, responsible for the post-transcriptional regulation of genes through their specific action on mRNAs. They can modulate the innate response by regulating different signaling pathways [3]. The fine regulation exerted by miRNAs through their action on several effector and / or regulatory molecules of the same signaling pathway represents a major advantage of this therapeutic approach since it allows a less drastic reduction in the level of expression of one or more target genes without completely inhibiting them, unlike direct molecular approaches (e.g., small molecules, biotherapies by monoclonal antibodies or others) which act on their direct and universal target by strongly blocking their activity.This aspect is very important in the case of drugs intended for the treatment of inflammation in IBDs, since, in patients suffering from these diseases, the inflammatory response is a universal physiological response whose actors, whether effectors of signaling pathways, regulators or end products including cytokines, are ubiquitous and present in different tissues. Thus, a fine and targeted regulation of the expression of these genes by a given miRNA allows a less significant reduction of the corresponding effector proteins without completely annihilating them, which consequently limits the significant adverse effects observed during the use of conventional anti-inflammatory treatments.

[0012] Unfortunately, there are still many gray areas in the understanding of the modulation networks linked to each miRNA. Their non-specificity (each miRNA targeting a multitude of genes) could also induce side effects in the individual to whom it is administered. The identification of a miRNA of interest to treat a disease as complex as Crohn's disease is still not easy, as the validation of candidates is cumbersome. In addition, it is impossible to predict the effect of a miRNA on this type of disease without carrying out rigorous preclinical or animal experiments, advantageously on different models [2],

[0013] In this context, the present inventors have obtained very satisfactory results by administering to model animals a mimic of miRNA 27a-5p (miR-27a-5p). It is interesting that such a molecule has an effect in IBD model animals, because this particular miRNA has never been implicated in these diseases (unlike other miRNAs, see for example those listed in Table 2 of Suri et al (2021) [2],

[0014] This miR-27a-5p mimic molecule has been proposed in the past to treat a mouse model of Clostridioides difficile infection (CDI) (W02020 / 094865). However, the therapeutic effect of this miRNA was intrinsically linked to the effect of flagellins allowing the C. difficile bacterium to induce a strong intestinal inflammatory response. Indeed, the results presented in this patent application showed that the C. difficile flagellin FliC induces a pro-inflammatory response in intestinal epithelial cells and in the mouse cecum (mouse model of C. difficile infection or CDI), and that the NF-kB signaling pathway plays a predominant role via the activation of the innate response receptor TRL5, which is specific for flagellin [4,5]. In this very particular context, the miR-27a-5p mimic would mainly inhibit the pro-inflammatory NF-kB signaling pathway induced specifically by C. difficile flagellin.difficile, inducing a strong inhibition of the expression of the genes of the cytokines TNFa and interleukin IL-8.

[0015] However, it is now well known that the same miRNA can have a given role in given conditions and in a given cell type and a completely opposite role in another cell type. For example, it is known that miR-146a has opposite effects depending on the cells studied: a pro-inflammatory effect in endothelial cells stimulated by LPS-activated monocyte supernatants [6] or an anti-inflammatory effect in LPS-stimulated vascular endothelial cells [7]. Furthermore, miR-27a itself may have an oncogenic role in breast cancer, but, conversely, a tumor suppressor role in prostate cancers [8,9]. Thus, existing results on models other than M ICI, and in particular on cells infected with C. difficile, could not be transposed to mouse models of intestinal inflammation (M ICI).

[0016] In 2005, Fichtner-Feigl et al

[0010] proposed that decoy oligonucleotides (double-stranded DNA) targeting NF-kB in a mouse model of TNBS-induced colitis could reduce such intestinal inflammation. However, these results have never been confirmed since. On the contrary, in 2020, the phase 2 study by Danes et al

[0011] found no effect of indirect inhibition of NF-kB in intestinal inflammation. Moreover, numerous publications have since shown that signaling pathways other than NF-kB play a much more important role in the development of IBD. Indeed, the pathophysiological mechanisms of IBD are complex and multifactorial (immune, genetic, environmental, etc.). It is now well established that the immune response, both the innate and the adaptive response, plays an important role in the development and maintenance of IBD.Indeed, the differentiation of CD4 T lymphocyte populations towards Thl7 cells occupies a central place in the pathogenesis of IBD with the activation of different complex signaling pathways leading to the synthesis of different proinflammatory cytokines

[0012] . This differentiation of CD4 T cells into Thl7 induced by TGFP and IL-6 (not shown in the case of inflammation during C. difficile infection) leads to the activation of the signaling pathways of STAT3, JAK1 and the transcription factors STAT3, BATF, SMAD2 and IRF4, resulting in the production of the cytokines IL-17, IL-21 and TNFa. However, the central transcription factor NF-kB does not play any direct role in these pathways. Thus, it is now well established that the adaptive immune response through the activation of Thl7 promotes inflammation in the intestines, without a direct link to the NF-kB pathway.

[0017] Furthermore, therapeutic molecules used and under development in the context of IBD target signaling pathways other than that of NF-kB. For example, we can cite: anti-TNFa monoclonal antibodies such as adalizumab (on the market), anti-integrin monoclonal antibodies such as vedolizumab (on the market), etrolizumab (in phase II), abrilumab (phase IIb); MAdCAM-1 anti-adhesion molecules such as entavalimab (phase III), anti-IL23 antibodies such as ustekinumab (on the market), mirikizumab (in phase II), rizankizumab (in phase II), and brazikumab (in phase III), as well as kinase inhibitor molecules (JAK1 inhibitors) such as filgotinib (in phase III), upadacitinib (in phase III)

[0013] , Other targets are also in clinical phase studies (TLR9 ​​agonists, sphingosine-1-phosphate receptor modulators).These molecules target pro-inflammatory factors but none directly affect the NF-kB pathway.

[0018] In this context, it could not be envisaged that inhibition of the NF-kB pathway (directly or indirectly) could reduce the strong inflammatory response found in murine models of intestinal inflammation (M ICI) not infected with C. difficile.

[0019] Furthermore, recently, several studies have evaluated the involvement of miRNAs in the pathogenesis of ICI and colitis-associated cancers. In particular, many miRNAs have been implicated in inflammatory pathways and in the fibrogenesis of ICI; therefore, their use as diagnostic biomarkers of inflammation and / or fibrosis has been proposed. In light of these results in the diagnostic field, however, it was not obvious that any of these miRNAs could act effectively as a therapeutic agent.

[0020] Furthermore, it is well known in the art that the same miRNA can have a given role in certain conditions and in a certain cell type and a completely opposite role in another cell type. For example, miR-146a has opposite effects depending on the cells considered (pro-inflammatory effect in endothelial cells stimulated by LPS-activated monocyte supernatants [6] or anti-inflammatory effect in LPS-stimulated vascular endothelial cells [7]).

[0021] Moreover, unlike the present inventors, the team of Xie et al showed that miR-27a increased the inflammatory response mediated by IL-10, in activated macrophages

[0014] , In this complex and contradictory technical context, it could not be envisaged that the administration of a miRNA mimic of miR-27a could reduce the strong inflammatory response found in murine models of intestinal inflammation (M ICI) not infected with C. difficile.

[0022] The technical challenge posed by the inventors was to identify a new treatment for Chronic Inflammatory Bowel Disease (IBD). The inventors identified an unexpected anti-inflammatory effect of miR-27a in animal models of this disease, the molecular mechanisms of which remain to be elucidated.

[0023] As mentioned above, this is the first study revealing the role of miR-27a-5p in the intestinal inflammatory process of IBD, this miRNA having never been proposed in the context of the diagnosis or treatment of this disease.

[0024] Detailed description of the invention

[0025] As explained in the examples below, the present inventors studied the effect of the miR-27a-5p mimic in a murine model of colitis commonly used for the study of IBD. In this model, dextran sulfate sodium (DSS), a sulfated polysaccharide that is directly toxic to the colonic epithelium, induced a highly reproducible acute inflammation limited to the colon and characterized by erosions / ulcers, crypt loss and granulocyte infiltration, indicating that effector cytokines produced by effectors of the innate response are sufficient to cause inflammation.On this basis, DSS colitis has become a useful model for the study of immune mechanisms involved in the development of intestinal inflammation [2]. The inventors were able to demonstrate that intravenous injection of a lipid formulation of a miR-27a-5p mimic in C57BL / 6 mice treated with DSS in drinking water and suffering from severe colitis, improves clinical signs with a strong reduction in diarrhea and rectal bleeding as early as 24 hours after the start of treatment, as well as stopping colonic narrowing.

[0026] In a first aspect, the present invention therefore relates to a pharmaceutical composition containing a miR-27a-5p mimic, for use in treating a subject suffering from a chronic inflammatory bowel disease.

[0027] In the context of this application, the term "miRNA" is used to designate indifferently a micro-RNA (or miRNA). These are short non-coding RNAs having between 20 and 25 nucleotides, binding to target mRNAs and thus inhibiting their translation. Micro-RNAs bind to the target mRNA by 5 to 8 consecutive nucleotides at the level of the 3'UTR region of the target mRNA, this recognition sequence being called "seed" carried by the strand called "guide" of the molecule [3]. Each micro-RNA is therefore capable of recognizing and modulating a large number of mRNAs (in practice, all mRNAs containing these 5 to 8 nucleotides of the 3'UTR region of the target mRNA, which potentially code for different genes). These miRNAs can be in double-stranded form (precursor or duplex) or single-stranded form (mature form, ready to bind to the target mRNA).

[0028] The miRNA known as "miR-27a-5p" is a single-stranded RNA (in its mature form) having in mice and humans the same sequence SEQ. ID NO: 1 (AGGGCUUAGCUGCUUGUGAGCA). It was identified in 2001

[0015] and has been implicated in the NF-KB pathway in aortic cells

[0016] , and in cancer

[0017] , It has also been identified in mitral valve interstitial cells

[0018] ,

[0029] By "miR-27a-5p mimic" is meant here any synthetic double-stranded RNA molecule that has the same or similar sequence as the natural miR-27a-5p microRNA (miRNA), and that can modulate the same genetic target(s) (these genes are described in: Romay et al

[0016] ,

[0030] This "mimic" molecule is synthesized artificially. It ideally contains the 5 to 8 consecutive "seed" nucleotides in the "guide" strand of the natural microRNA known to bind to the target mRNA, but could, for example, advantageously present nucleotide differences at its ends, in order to more specifically target target genes among those known to be modulated by the natural microRNA. The literature explains precisely how to choose the sequence of microRNA mimics, so as to optimize its biological effects

[0019] . "MicroRNA mimics" can therefore be more specific than the natural microRNAs from which they are derived (only mRNAs containing precisely the complementary sequence of this precise succession of nucleotides will therefore be affected by the mimic, which limits the number of modulated genes).

[0031] In the context of the present invention, the expression "miR-27a-5p mimic" therefore denotes a synthetic double-stranded RNA molecule which contains at least 5, 6, 7 or 8 of the 8 consecutive nucleotides AGGGCUUA which constitute the "seed" part in the "guide" strand of miR-27a-5p [5' part which binds to the target mRNA]. It is therefore a molecule which contains at least 5 consecutive nucleotides of the sequence AGGGCUUA, i.e. which contains AGGGC or GGGCU or GGCUU or GCUUA, or at least 6 consecutive nucleotides of this sequence, i.e. which contains AGGGCU or GGGCUU or GGCUUA, or at least 7 consecutive nucleotides of this sequence, i.e. which contains AGGGCUU or GGGCUUA. The remainder of the oligonucleotide sequence of the mimic of the invention may then be similar to the remainder of the natural molecule of miR-27a-5p of SEQ ID NO: 1, Le., be similar with SEQ ID NO: 4 (representing the 3' part of the sequence SEQ ID NO: 1, without the 8 nucleotides AGGGCUUA constituting the "seed" part). Therefore, the present invention therefore relates to a pharmaceutical composition containing a miR-27a-5p mimic, for its use in treating a subject suffering from a chronic inflammatory bowel disease and in which said miR-27a-5p mimic RNA contains at least 5, 6, 7 or 8 of the 8 consecutive nucleotides AGGGCUUA. Preferably, said miR-27a-5p mimic RNA contains the sequence AGGGCUUA.

[0032] By "similar sequence" is meant here a nucleic acid sequence having a percentage identity greater than or equal to 70%, preferably greater than or equal to 80%, even more preferably greater than or equal to 90%, with the 3' part of the known natural miR-27a-5p sequence (SEQ ID NO: 4). By "percentage identity" between two nucleic acid sequences is meant a percentage of identical nucleotides between the two sequences to be compared, obtained after the best alignment (optimal alignment), this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length.

[0033] This percentage identity can be calculated by any sequence analysis method well known to those skilled in the art. The percentage identity can be determined after global alignment of the sequences to be compared taken in their entirety. In addition to manually, it is possible to determine it using the algorithm of Needleman and Wunsch (1970). For nucleotide sequences, the comparison of the sequences can be carried out using any software well known to those skilled in the art, such as the Needle software. The parameters used may include the following: "Gap Open" equal to 10.0, "Gap Extend" equal to 0.5 and the EDNAFULL matrix (EMBOSS version of NCBI NUC4.4). This percentage can also be determined after local alignment of the sequences to be compared. In addition to manually, it is possible to use the algorithm of Smith and Waterman (1981) to determine this percentage.Preferably, the percentage of identity defined within the framework of the present invention is determined by means of a global alignment of the sequences to be compared over their entire length.

[0034] For example, the “miR-27a-5p mimic” used in the context of the invention may be the double-stranded RNA having the sequence (“guide” strand) SEQ ID NO: 2 (5'-AGGGCUUAGCUGCUUGUGACCCC-3') and having the accompanying sequence (“passenger” strand) SEQ ID NO: 3 (5'-GGGGGUCACAAGCAGCUAAGCCCU-3') (or its complement). It may in particular be supplied by companies such as RIBOXX or Axolabs.

[0035] Furthermore, this synthetic molecule also differs advantageously from natural miRNAs in that it has undergone chemical modifications on both the guide strand and the "passenger" strand aimed at increasing its stability, in particular with regard to RNases and proteins of the RISC complex ("RNA-induced silencing complex").Said chemical modifications are for example methylation, the addition of thioate groups (replacement of the non-binding oxygen of the phosphate group by a sulfur atom), the addition of methyl groups (for example 2'-O-methyl or 2'-O-methoxyethyl) on different bases of the sequence [20,21], In addition, it is possible to modify the bases of the RNA mimics of the invention by adding 2'Fluoro (2'F) groups on different bases of the sequence of the two strands

[0022] , S-thioate internucleotide bonds can also be added between the U bases at 3' of the "guide" strand

[0023] , These chemical modifications make it possible to improve the stability of this "guide" strand.

[0036] Within the scope of the present invention, chemically modified mimic molecules preferably chosen to exhibit in vivo anti-inflammatory activity similar to or greater than that of the miRNA-27a-5p mimic may be tested.

[0037] It is also possible to modify the miR-27a-5p mimic of the invention by any known means allowing it to be stabilized or made more effective, in particular those described in Bernardo et al. [3],

[0038] In the pharmaceutical composition of the invention, the mimic miRNA (double stranded) may be naked. It may also be complexed with positively charged chemical molecules or nanoparticles (i.e., particles with a diameter of less than 1 pm), or be wrapped in protective materials, for example capsules, liposomes, etc., so as to promote its stability and transfectability (entry into target cells).

[0039] Any stabilizing means known to promote the transport and targeting of siRNAs may be used to facilitate the administration of the mimic of the invention, since these molecules have the same structure. These means are known in the art [23,24],

[0040] In a preferred embodiment, said miR-27a-5p mimic is therefore associated with (or included in) a vector, a matrix or particles promoting its stability and transfectability.

[0041] If it is carried by a vector, said vector is preferably a recombinant virus chosen from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses (AAV), herpes viruses, cytomegaloviruses (CMV), vaccinia viruses, etc.

[0042] Advantageously, said recombinant virus is a defective virus, for example a defective AAV. The term "defective virus" herein refers to a virus incapable of replicating in a target cell. Generally, the genome of defective viruses lacks at least one of the sequences necessary for the replication of said virus in the infected cell. These regions can either be eliminated, or rendered non-functional or even substituted by other sequences and in particular by the nucleic acid which codes for the peptide of interest. Nevertheless, preferably, the defective virus nevertheless retains the sequences of its genome which are necessary for the encapsulation of the viral particles.

[0043] This vector can also be a bacteriophage, these having already been used successfully to carry siRNAs. Bacteriophages such as MS2, Ph i 29, etc. can be used in the context of the present invention.

[0044] If said miR-27a-5p mimic is associated with particles, these may be those already proposed for the transport of siRNAs

[0023] , These may be, for example, liposomes (DOPC), lipid nanoparticles, nanocells (EnGenelC EDV type), silica nanoparticles, exosomes, etc. More specifically, these particles may be poly(alkylcyanoacrylate) nanoparticles, preferably coated with chitosan. The miRNA mimic of the invention may be easily adsorbed thereon by formation of an ion pair, as previously demonstrated for siRNAs

[0025] ,

[0045] If said miR-27a-5p mimic is included in a matrix, said matrix may be neutral lipid emulsion (NLE), polyethylenimine (PEI), poly(lactide-co-glycolide) (PLGA), etc.

[0046] Particularly preferably, said miR-27a-5p mimic may be complexed in a cationic polymer such as “in vivo-jet PEI®”, well known for efficiently transporting any type of nucleic acids in vivo into different organs, without eliciting an inflammatory response

[0026] ,

[0047] It is also possible to administer the mimic of the invention conjugated with a protein or a chemical molecule of interest, for example chosen from: lipids, cholesterol, PEG, cyclodextrin, chitosan, dendrimers (of poly(amidoamine) or poly(propylenimine), N-acetyl-D-galactosamine (GalNAc), etc.

[0048] The present invention also provides methods for treating subjects suffering from chronic inflammatory bowel disease. These methods include a step of administering the pharmaceutical composition of the invention to patients suffering from chronic inflammatory bowel disease.

[0049] The present invention finally relates to the use of the mimic of the invention, as defined above, for manufacturing a medicament intended to treat patients suffering from chronic inflammatory bowel disease.

[0050] These subjects / patients may be animals (domestic or not, e.g., cats, dogs, equines) or humans. Preferably, these subjects are not young children.

[0051] The subjects / patients to be treated within the scope of the present invention suffer from chronic inflammatory bowel disease (“IBD”), in particular Crohn’s disease (CD) or ulcerative colitis (UC). These diseases are characterized by inflammation of the wall of a part of the digestive tract, due to deregulation of the intestinal immune system. This uncontrolled inflammation is responsible for tissue damage and the chronicity of the disease. Its origin appears to result from the complex combination of environmental factors, associated with a genetic susceptibility of the patient and the particular reactivity of his or her immune system. IBD develops through inflammatory flare-ups, of extremely variable duration and frequency depending on the patient, which alternate with phases of remission.They are distinguished by the location and nature of the inflammation in the digestive tract, complications, risk factors, symptoms, or even responses to treatments.

[0052] In Crohn's disease, inflammation can affect all segments of the digestive tract (from the mouth to the anus), but is most often located in the intestine and frequently affects the terminal ileum, with or without colonic involvement. In ulcerative colitis, inflammation always affects the lower part of the rectum and extends more or less into the colon. The intestine is never affected. The diagnosis of IBD is based on several clinical, biological, and medical imaging criteria. When clinical symptoms suggest IBD, a biological assessment is performed first. It allows the detection of an inflammatory syndrome by measuring the CRP protein in the blood and by looking for the presence of calprotectin in the stool.Indeed, the latter is found in the stool only in cases of severe inflammation of the intestine (this leads to destruction of the intestinal epithelium which allows the passage of the molecule through the intestinal wall). If the increase in the calprotectin level is not specific to IBD, it makes it possible to discriminate between IBD and a functional intestinal disorder. This indicator is also used to monitor the disease and evaluate the effectiveness of the treatment implemented. The reference examination for diagnosis is nevertheless digestive endoscopy. It makes it possible to look for the presence and location of lesions in the digestive tract, as well as to take samples. This examination consists of introducing a probe equipped with a camera into the patient's digestive system. If necessary, an entero-MRI (or abdominal MRI) can complete the examination to study the small intestine more closely.The use of a video capsule, a swallowable capsule equipped with a mini-camera, also allows observation of the small intestine inaccessible to the endoscope. In ulcerative colitis, the inflammation affects exclusively the rectum and colon. There is continuous involvement with a red, fragile, easily bleeding mucosa, with micro-ulcerations and pus. In Crohn's disease, the involvement is discontinuous: segments of affected mucosa alternate with healthy mucosa. The examination may also reveal narrowing of the intestinal lumen (stenosis) or a fistula, particularly in the anoperineal region. The entire digestive tract may be affected.

[0053] ICIs are most often diagnosed between the ages of 20 and 30. However, they can occur at any age and 15% of cases occur in children.

[0054] There is a genetic susceptibility to IBD, and the risk of developing it increases by 6 to 10% in the case of a family history. Analysis of the genome of affected patients has led to the identification of more than 170 genes predisposing to these diseases. Some are common to both pathologies and others specific to one of them. With rare exceptions, their impact on the occurrence of IBD is, however, moderate. However, the presence of a particular polymorphism affecting the NOD2 / CARD15 gene would multiply by 40 the risk of developing Crohn's disease, certainly in the presence of other triggering factors that remain to be discovered. This gene encodes a cellular receptor for a bacterial agent.

[0055] Preferably, the subjects / patients to be treated within the scope of the present invention are not infected with the Clostridioides difficile bacterium. In other words, they do not suffer from CDI.

[0056] Within the scope of the invention, it is possible to use the treatment of the invention also to prevent or treat colon cancers which are caused by IBD, and therefore associated with colitis. More specifically, said miR-27a-5p mimic RNA can be advantageously administered to a subject suffering from IBD, to prevent the development of colon cancer, or to a subject suffering from colon cancer induced by IBD.

[0057] By "treatment" here, we mean curative treatment (aimed at at least spacing out or even preventing symptomatic inflammatory flare-ups of IBD or slowing down or even stopping the development of intestinal or gastric lesions in patients suffering from IBD) or prophylactic treatment (aimed at reducing the risk of these lesions appearing in the event of genetic susceptibility, for example).

[0058] The drug of the invention is particularly used to alleviate abdominal pain, reduce the frequency and quantity of diarrhea, prevent rectal bleeding, and limit weight loss in patients with ICI.

[0059] The pharmaceutical composition used in the invention contains, as active ingredient, the nucleic acid described above (optionally associated or protected by particles, vectors, lipids, etc.). It also preferably contains a pharmaceutically acceptable excipient.

[0060] In the present description, the term "pharmaceutically acceptable excipient" is intended to mean a compound (or a combination of compounds) included in a pharmaceutical composition, but which does not cause side reactions and which allows, for example, the facilitation of the administration of the active compound(s), the increase in its lifespan and / or its effectiveness in the body, the increase in its solubility in solution or even the improvement of its preservation. These pharmaceutically acceptable excipients are well known and will be adapted by those skilled in the art according to the nature and method of administration of the active compound(s) chosen.

[0061] Preferably, the mimic of the invention will be administered systemically, in particular intravenously, intramuscularly, intradermally, intraperitoneally or subcutaneously, or orally. More preferably, it will be administered parenterally, in hospital or at home. Its administration by subcutaneous route is envisaged and preferable.

[0062] The mimic of the invention can be administered several times, spread out over time.

[0063] Its optimal mode of administration, dosages and galenic forms can be determined according to the criteria generally taken into account in establishing a treatment adapted to a patient such as for example the age or body weight of the patient, the severity of his general condition, tolerance to the treatment and the side effects observed.

[0064] The mimic of the invention may also be formulated in the form of microcapsules, optionally with one or more additive carriers. For the preparation of these microcapsules, the mimic of the invention is generally combined with suitable diluents, suitable stabilizers, agents promoting the prolonged release of the active substances or any other type of additive for the formation of a central core which is then coated with a suitable polymer (for example a water-soluble resin or a water-insoluble resin). Techniques known to those skilled in the art will be used for this purpose. The microcapsules thus obtained are then optionally formulated in suitable dosage units.

[0065] The mimic of the invention can also be formulated in liposomes. Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form concentric multilamellar bilayer vesicles. These vesicles generally have a diameter of 25 nm to 4 pm and can be sonicated, leading to the formation of smaller unilamellar vesicles, with a diameter of 200 to 500 Å, containing an aqueous solution at their core. Liposomes will be particularly advantageous for delivering the drug to a specific cellular or tissue target. For this, the lipids can be chemically coupled to targeting molecules, such as targeting peptides (e.g., hormones), or antibodies.

[0066] The dosage naturally depends on the vector / complex considered, the mode of administration, the stage of the disease, the patient's age and condition. Some authors have used miRNA doses of 10 mg / kg intravenously. Lower doses can also be used (e.g., between 3 and 5 mg / kg per day).

[0067] When the mimic of the invention is associated with a cationic polymer or another vector, it is possible to use higher doses (25 mg / kg), in one dose, or in several doses, by repeating the injections.

[0068] Legend of the figures

[0069] Figure 1 demonstrates the anti-inflammatory effect of the invention miRNA in a DSS mouse model of M ICI. Evaluation of the length of the large intestine, from the cecum to the rectum, in mice without treatment (DSS, left) and in mice treated with the miR-27a-5p-mimic (right).

[0070] Figure 2 demonstrates the effect of the miRNA of the invention on reducing the occurrence of recto-colonic tumors in a DSS mouse model of chronic M ICI / cancer (induced by azoxymethane: AOM). A. Evaluation of the number of colon and rectal tumors in mice that received a harmless miR molecule (miR-nc, without clinical effect) (DSS / AOM, squares) and in mice treated with miR-27a-5p-mimic (triangles). B. Histological evaluation of the presence of tumors (arrows) in a mouse without treatment (DSS / AOM, left) and a mouse treated with miR-27a-5p-mimic (right).

[0071] Examples

[0072] The miR-27a-5p mimic used in these examples is a double-stranded RNA having the sequence (guide strand) SEQ ID NO: 2 (5'-AGGGCUUAGCUGCUUGUGACCCCC-3') and having the accompanying sequence (passenger strand) SEQ ID NO: 3 (5'-

[0073] GGGGGUCACAAGCAGCUAAGCCCU-3') (or its complement) provided by the company Axolabs. It will be called "miR-27a-5p-mimic" for the purposes of these examples.

[0074] The anodyne molecule used as a negative control in these examples has the sequence (guide strand) SEQ ID NO: 5 (5'-AAGGCAAGCUGACCCUGAAGUU-3') and the accompanying sequence (passenger strand) SEQ ID NO: 6 (5'-AACUUCAGGGUCAGCUUGCCUU-3').

[0075] Example 1: Evaluation of the anti-inflammatory effect of miR-27a-5p-mimic in a mouse model treated with dextran sodium sulfate (DSS)

[0076] C57BL / 6 mice were treated with DSS in their drinking water for 7 days. Upon the onset of colitis symptoms (diarrhea, rectal bleeding, weight loss), on day 5 of the start of DSS treatment, a group of mice (n = 6) was treated with an intravenous (IV) suspension of miR-27a-5p-mimic associated with the in vivo-jetPEl® vehicle (Polyplus company), with a second injection at 24-hour intervals (day 6 post-DSS treatment). On day 7 (24 hours after the second dose of miR-27a-5p-mimic), the intestines (cecum and colon) were analyzed for their macroscopic and histological appearance as well as for the expression of proinflammatory cytokine genes. As expected, all DSS-treated mice (n = 12) developed manifestations of colitis (diarrhea, rectal bleeding, weight loss) from day 5 of DSS treatment.Animals with colitis treated with IV miR-27a-5p-mimic (n = 6) showed improvement in clinical signs with a significant decrease in diarrhea and rectal bleeding as early as 24 h after the first dose and after 48 h of miR-27a-mimic treatment.

[0077] [Table 1]

[0078] Macroscopic analysis of the intestines (cecum and colon) of mice not treated with miR-27a-5p-mimic compared to that of animals treated with this miRNA (48h after treatment) showed the presence of hemorrhagic intestinal content and a decrease in the length of the large intestine (cecum, colon and rectum) (Figure 1).

[0079] These results were confirmed by analyzing the intestinal inflammatory response (histological analysis, detection of pro-inflammatory cytokine mRNA by qRT-PCR) in both groups of animals tested (data not shown).

[0080] Example 2: Evaluation of the anti-inflammatory effect of miR-27a-5p-mimic on a human intestinal epithelial cell model

[0081] Caco-2 cells were transfected with miR-27a-5p-mimic for 24 hours and then treated with 1% DSS for 24 hours. Activation of pro-inflammatory signaling pathways was analyzed by Western blotting, expression of pro-inflammatory cytokine genes by qRT-PCR, and synthesis of pro-inflammatory cytokines in the supernatant by ELISA.

[0082] Example 3: Evaluation of the effect of miR-27a-5p-mimic on reducing the occurrence of colonic tumors in a mouse model of chronic IBD DSS / cancer (induced by azoxymethane: AOM)

[0083] C57BL / 6 mice were treated with an intraperitoneal injection of AOM (100 μl of a 2 μg / μl solution) for the induction of colonic tumors. Seven days later, two 20-day cycles were performed, each cycle comprising 6 days of DSS in the drinking water followed by two weeks of water without DSS. During the AOM injection, one group of mice (n = 8) received an intravenous injection of 0.1 ml of a solution of miR-27a-5p-mimic (100 μg) associated with the in vivo-jetPEl® vehicle (Polyplus company). This injection was repeated for this group of animals every seven days. A control group of mice (n = 8) received a harmless miR molecule (miR-nc, without clinical effect; supplied by Axolabs) also associated with the in vivo-jetPEl® vehicle.At the end of both cycles, the colons of each mouse were removed and analyzed macroscopically to quantify tumors (especially in the rectum), and histologically to confirm the presence of tumors. As expected, all mice developed manifestations of colitis during the DSS cycles (diarrhea, rectal bleeding, weight loss) with periods of remission during the DSS-free periods. Animals with colitis treated with IV miR-27a-5p-mimic (n = 8) showed improvement in clinical signs with a significant decrease in diarrhea and rectal bleeding as early as 24 hours after the first dose and throughout the miR-27a-mimic treatment.

[0084] Macroscopic analysis of the intestines (colon and rectum) of mice treated with miR-27a-5p-mimic compared to that of animals not treated with this miRNA showed a clear decrease in the number of tumors in the large intestine (especially the rectum) (Figure 2A; one mouse in the control group died during the experiment).

[0085] These results were confirmed by analyzing the presence of intestinal tumors on histological sections (Figure 2B).

[0086] Bibliographic references

[0087] 1. D’Haens, G., Risks and benefits of biological therapy for inflammatory bowel diseases. Gut, 2007. 56(5): p. 725-32.

[0088] 2. Suri, K., et al., Role of MicroRNA in Inflammatory Bowel Disease: Clinical Evidence and the Development of Preclinical Animal Models. Cells, 2021. 10(9).

[0089] 3. Bernardo, B.C., et al., miRNA therapeutics: a new class of drugs with potential therapeutic applications in the heart. Future Med Chem, 2015. 7(13): p. 1771-92.

[0090] 4. Batah, J., et al., Clostridium difficile flagella predominantly activate TLR5-linked NF- kappaB pathway in epithelial cells. Anaerobe, 2016. 38: p. 116-124.

[0091] 5. Batah, J., et al., Clostridium difficile flagella induce a pro-inflammatory response in intestinal epithelium of mice in cooperation with toxins. Sci Rep, 2017. 7(1): p. 3256.

[0092] 6. Pfeiffer, D., et al., miR-146a, miR-146b, and miR-155 increase expression of IL-6 and IL- 8 and support HSP10 in an In vitro sepsis model. PLoS One, 2017. 12(6): p. e0179850.

[0093] 7. Gao, N. and L. Dong, MicroRNA-146 regulates the inflammatory cytokines expression in vascular endothelial cells during sepsis. Pharmazie, 2017. 72(11): p. 700-704.

[0094] 8. Barros-Silva, D., et al., MicroRNA-27a-5p regulation by promoter methylation and MYC signaling in prostate carcinogenesis. Cell Death Dis, 2018. 9(2): p. 167.

[0095] 9. Mertens-Talcott, S.U., et al., The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res, 2007. 67(22): p. 11001-11.

[0096] 10. Fichtner-Feigl, S., et al., Treatment of murine Thl- and Th2-mediated inflammatory bowel disease with NF-kappa B decoy oligonucleotides. J Clin Invest, 2005. 115(11): p. 3057-71.

[0097] 11. Danese, S., et al., Effects of Apremilast, an Oral Inhibitor of Phosphodiesterase 4, in a Randomized Trial of Patients With Active Ulcerative Colitis. Clin Gastroenterol Hepatol, 2020. 18(11): p. 2526-2534 e9.

[0098] 12. Jiang, P., et al., The involvement of TH17 cells in the pathogenesis of IBD. Cytokine Growth Factor Rev, 2023. 69: p. 28-42.

[0099] 13. Cohen, N.A. and D.T. Rubin, New targets in inflammatory bowel disease therapy: 2021. Curr Opin Gastroenterol, 2021. 37(4): p. 357-363.

[0100] 14. Xie, N., et al., miR-27a regulates inflammatory response of macrophages by targeting IL- 10. J Immunol, 2014. 193(1): p. 327-334.

[0101] 15. Lagos-Quintana, M., et al., Identification of novel genes coding for small expressed RNAs. Science, 2001. 294(5543): p. 853-8.

[0102] 16. Romay, M.C., et al., Regulation of NF-kappaB signaling by oxidized glycerophospholipid and IL-lbeta induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res, 2015. 56(1): p. 38-50. 17. Wu, X., et al., Coordinated targeting of the EGFR signaling axis by microRNA-27a*. Oncotarget, 2013. 4(9): p. 1388-98.

[0103] 18. Chen, H., et al., miR-27a protects human mitral valve interstitial cell from TNF-alpha- induced inflammatory injury via up-regulation of NELL-1. Braz J Med Biol Res, 2018. 51(6): p. e6997.

[0104] 19. Wang, Z., The guideline of the design and validation of MiRNA mimics. Methods Mol Biol, 2011. 676: p. 211-23.

[0105] 20. Geary, R.S., et al., Pharmacokinetic properties of 2'-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J Pharmacol Exp Ther, 2001. 296(3): p. 890-7.

[0106] 21. Koizumi, M., et al., Design of 2'-O-methyl RNA and DNA double-stranded oligonucleotides: naturally-occurring nucleotide components with strong RNA interference gene expression inhibitory activity. Nucleosides Nucleotides Nucleic Acids, 2020. 39(1-3): p. 292-309.

[0107] 22. van Rooij, E. and S. Kauppinen, Development of microRNA therapeutics is coming of age. EMBO Mol Med, 2014. 6(7): p. 851-64.

[0108] 23. Baumann, V. and J. Winkler, miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med Chem, 2014. 6(17): p. 1967-84.

[0109] 24. Rupaimoole, R. and FJ. Slack, MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov, 2017. 16(3): p. 203-222.

[0110] 25. de Martimprey, H., et al., New core-shell nanoparticules for the intravenous delivery of siRNA to experimental thyroid papillary carcinoma. Pharm Res, 2010. 27(3): p. 498-509.

[0111] 26. Pandey, A.P. and K.K. Sawant, Polyethylenimine: A versatile, multifunctional non-viral vector for nucleic acid delivery. Mater Sci Eng C Mater Biol Appl, 2016. 68: p. 904-918.

Claims

CLAIMS 1. A pharmaceutical composition containing a double-stranded miR-27a-5p mimic RNA for use in treating a subject suffering from chronic inflammatory bowel disease (CIBD), and wherein said miR-27a-5p mimic RNA contains at least 5, 6, 7 or 8 of the 8 consecutive nucleotides AGGGCUUA.

2. Pharmaceutical composition for use according to claim 1, wherein said miR-27a-5p mimic RNA contains the sequence AGGGCUUA.

3. Pharmaceutical composition for use according to claim 1 or 2, wherein said miR-27a-5p mimic RNA contains two strands of RNA of respective sequences SEQ ID NO: 2 and SEQ ID NO:

3.

4. Pharmaceutical composition for its use according to one of claims 1 to 3, further comprising a pharmaceutically acceptable excipient.

5. Pharmaceutical composition for its use according to one of claims 1 to 4, in which said miR-27a-5p mimic RNA is associated with or included in a vector, a matrix or particles promoting its stability and / or its transfection.

6. Pharmaceutical composition for use according to claim 5, wherein said vector is chosen from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses (AAV), herpes viruses, cytomegaloviruses (CMV), and vaccinia viruses.

7. Pharmaceutical composition for its use according to claim 5, in which said particles are chosen from: liposomes (DOPC), lipid nanoparticles, nanocells, silica nanoparticles, exosomes.

8. Pharmaceutical composition for use according to claim 5, wherein said matrix is chosen from neutral lipid emulsion (NLE), polyethylenimine (PEI), poly(lactide-co-glycolide) (PLGA).

9. Pharmaceutical composition for its use according to one of claims 1 to 4, for preventing or treating colon cancer induced by an M ICI.

10. Pharmaceutical composition for use according to one of claims 1 to 9, characterized in that the pharmaceutical composition is in a form suitable for intravenous administration.

Images