Oligonucleotides for treating neuromuscular diseases

EP4735595A1Pending Publication Date: 2026-05-06HOSPITAL SANT JOAN DE DEU
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
HOSPITAL SANT JOAN DE DEU
Filing Date
2024-06-26
Publication Date
2026-05-06

AI Technical Summary

Technical Problem

Current treatments for collagen VI-related dystrophies, such as Ullrich congenital muscular dystrophy and Bethlem myopathy, are limited, with most patients receiving only supportive care, and there is a need for effective genetic therapeutic approaches to address the underlying mutations causing these diseases.

Method used

Development of oligonucleotides that specifically downregulate the expression of the COL6A1 allele carrying the c.877G>A mutation by hybridizing to the RNA transcript at the site of the mutation, using delivery agents to facilitate cellular uptake, and forming pharmaceutical compositions for therapeutic use.

Benefits of technology

The oligonucleotides effectively reduce the expression of the mutant allele by 40-55%, potentially ameliorating the pathogenic effects and providing a therapeutic option for collagen VI-related dystrophies, specifically targeting the COL6A1 gene mutation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000035_0001
    Figure IMGF000035_0001
  • Figure IMGF000033_0001
    Figure IMGF000033_0001
  • Figure IMGF000034_0001
    Figure IMGF000034_0001
Patent Text Reader

Abstract

The present invention relates to oligonucleotides that downregulate the expression of an allele carrying a dominant mutation in the COL6A1, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele at the site of the dominant mutation, and which either does not suppress the expression of the wild-type allele or does downregulate the expression of the wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the dominant mutation. It is also related to the use of compositions to treat patients with muscular dystrophies, in particular collagen-VI related dystrophies.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Oligonucleotides for treating neuromuscular diseases

[0002] This application claims the benefit of European Patent Application 23382654.4 filed June 27th, 2023.

[0003] Technical Field

[0004] The present disclosure pertains to the field of medical treatment, in particular it refers to the treatment of neuromuscular diseases by gene therapy.

[0005] Background Art

[0006] Neuromuscular diseases are a heterogeneous group of rare disorders with prevalence between 1 and 10 per 100.000 in the population. There are several genes involved in these diseases, a fact that complicates the diagnosis. In addition, as there is a high variability in the phenotypes, the research and healthcare of the patients are complex. Congenital muscular dystrophies are a group of neuromuscular diseases caused by genetic alterations that occur at birth or in infancy. Among the different types of congenital muscular dystrophies, the collagen Vl-rel ated dystrophies (COL6-RDs) are one of the most common disorders, with prevalence below 1 per 100.000.

[0007] Collagen type VI is a microfibrillar component of the extracellular matrix, synthesized in the interstitial fibroblasts (Zou, Zhang, Sabatelli, Chu, & Bbnnemann, 2008) and found in different tissues such as muscle, skin, tendon, cartilage, internal organs, and blood vessels. Collagen VI is involved in the structural and mechanical stabilization of the tissues, as well as in the interactions between the cells and the extracellular matrix; it links different components of the basement membranes and participates in cell adhesion and proliferation; and it stimulates the DNA synthesis of mesenchymal cells and the migration of the neural crest cells.

[0008] In humans, there are three genes that encode for the three o-chains that compound the collagen VI: COL6A1 (MIM*120220), COL6A2 (MIM*120240), which are found in chromosome 21 and COL6A3 (MIM*120250) in chromosome 2.

[0009] Collagen Vl-related dystrophies are congenital muscular dystrophies caused by mutations in the COL6A1, COL6A2 and COL6A3 genes. These patients present very variable phenotypes. The most severe is the Ullrich congenital muscular dystrophy and the milder is Bethlem myopathy.

[0010] In between, there are intermediate clinical phenotypes. The clinical presentations of patients with intermediate clinical phenotypes are a mix between features of Ullrich Congenital Muscular Dystrophy and Bethlem myopathy, such as significant weakness in early childhood, distal laxity of the most distal interphalangeal joins, or contractures of the long finger flexors. Patients achieve ambulation, but they may lose it in the late teenage or early adult years. A typical feature of these patients is also progressive respiratory impairment.

[0011] Curative treatments for the COL6-RDs are still in development and for the moment most of the patients only receive treatments to support the orthopedic and respiratory symptoms. Pharmacological treatments were first investigated, based on the cascade of events known to degenerate the myofibers in the collagen VI deficient skeletal muscle. Currently, as the causal mutations of the diseases have become better known over time, treatments based on genetic therapeutic approaches such as therapies focused on silencing gene expression are being investigated.

[0012] The mutation (CO / _6A / )het.c.877G<A, p.Gly293Arg causes a COL6-RD with an intermediate phenotype. It is found in the position 19 of the exon 10 and it has a dominant negative effect, because it is a missense mutation that causes the substitution of a glycine from the triple helix domain by an arginine. Presently there is no treatment that can modify the course of the COL6-RD caused by this mutation, therefore there is a need in the art to provide therapeutical approaches for this disease.

[0013] Summary of Invention

[0014] Inventors have successfully developed a gene therapy that effectively downregulates the expression of the mutant allele (CO / _6A1)c.877G>A, which only presents a single mutation compared to the COL6A1 wild-type allele, without influencing the translation of this wild-type allele.

[0015] Thus, a first aspect of the invention is an oligonucleotide that downregulates the expression of an allele carrying a mutation at position 877 in the COL6A1 coding sequence (CDS), wherein G is mutated to A compared to wild-type COL6A1..

[0016] In order to interact with the RNA targets, the oligonucleotides have to reach the intracellular space and, to that effect, delivery agents may be used to assist entering the cells. Thus, the invention also provides, as a second aspect, a composition comprising a delivery agent and an oligonucleotide as defined in the first aspect, wherein the oligonucleotide is associated to the delivery agent.

[0017] As a third aspect, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotides as defined in the first aspect, and / or the composition as defined in the second aspect, and a pharmaceutically acceptable excipient or carrier.

[0018] A fourth aspect of the invention is an oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, and / or the pharmaceutical composition as defined in the third aspect, for use as a medicament. In other words, they are for use in therapy.

[0019] The fourth aspect can also be formulated as the use of the oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, an / or the pharmaceutical composition as defined in the third aspect, for the manufacture of a medicament. This aspect can also be formulated as a method for the prevention and / or treatment of a disease, the method comprising administering a therapeutically effective amount of the oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, and / or the pharmaceutical composition as defined in the third aspect, in a subject in need thereof.

[0020] A fifth aspect provided by the invention is an oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, and / or the composition as defined in the third aspect, for use in the treatment of a condition associated to the mutation (CO / _6A / )c.877G>A. In particular, the condition is a neuromuscular disease, more in particular it is a muscular dystrophy.

[0021] The fifth aspect can also be formulated as the use of the oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, an / or the pharmaceutical composition as defined in the third aspect, for the treatment of a condition associated to the mutation (CO / _6A / )c.877G>A. In particular, the condition is a neuromuscular disease, more in particular it is a muscular dystrophy. This aspect can also be formulated as a method for the prevention and / or treatment of a condition associated to the mutation (CO / _6A / )c.877G>A. In particular, the condition is a neuromuscular disease, more in particular it is a muscular dystrophy, the method comprising administering a therapeutically effective amount of the oligonucleotide as defined in the first aspect, and / or the composition as defined in the second aspect, and / or the pharmaceutical composition as defined in the third aspect, in a subject in need thereof.

[0022] Brief Description of Drawings

[0023] Figure 1 shows chromatogram of the sequences of exon 10 of COL6A1 showing the heterozygous c.877G>A mutation (in the position of the circled nucleotide (G)).

[0024] Figure 2 shows: (A) ddPCR showing the abundance (%) of wild-type (in white) and mutant transcripts (in black) in the healthy control fibroblasts and patient's primary fibroblasts, the y-axis represents the abundance in percentage (%); (B) ddPCR for total COL6A1 expression (copies of the transcript / pL) of the healthy control, and patient's primary fibroblasts, the y-axis represents the concentration (copies / pL). Data are represented as mean ± SD. The x-axis is ordered showing the healthy control's data in the left, and the patient's data in the right.

[0025] Figure 3. shows in the x-axis and ordered from left to right, allele specific transcriptional analysis using ddPCR of the patients' primary fibroblasts non-treated (P NT), treated with a scrambled oligonucleotide (P Scr), or treated with the tested oligonucleotide at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM (n = 5). Data were normalized to the P NT, represented as mean ± SD, and were statistically analysed using two- way ANOVA (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). The y-axis represents the relative expression. Figure 4 shows immunofluorescence of patient's fibroblasts non-treated and treated with the tested oligonucleotide at 150 nM: (A) HyVolution analysis of the patient's non treated fibroblasts (images above) and after the treatment with the tested oligonucleotide at 150 nM (images below). Scale bar: 10 pm.; (B) 3D reconstructions of the patient's non treated fibroblasts (image above) and after the treatment with the tested oligonucleotide at 150 nM (image below). Scale bar: 5pm.

[0026] Figure 5. shows the percentage of mutant and wild type transcripts derived from the allele specific transcriptional analysis using ddPCR of the patient fibroblasts (P) treated with AON 1 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM. Results are compared with untreated (NT) and Scrambled (Negative Control). Data are presented as the mean ± SD of the abundance in percentage of each allele. Mutant (black), wild type (white). Y axis represents Abundance (A) in percentage (%)

[0027] Figure 6. Concentration of copies of the mutant allele for the patient fibroblasts (P) treated with AON 3 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM. Results are compared with P untreated (NT) and P Scrambled (Negative Control). Y axis represents Concentration (copies / piL): “C” stands for Concentration; “c.” stands for copies.

[0028] Figure 7. Concentration of copies of the mutant allele for the patient fibroblasts (P) treated with AON 4 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM. Results are compared with P untreated (NT) and P Scrambled (Negative Control). Y axis represents Concentration (copies / piL): “C” stands for Concentration; “c.” stands for copies.

[0029] Figure 8. shows in the x-axis and ordered from left to right, allele specific transcription analysis using ddPCR of the patients' primary fibroblasts non-treated (NT), AON 2, AON 5, AON 6 and AON 7 at a concentration of 150 nM. Ratio between the WT and MUT allele was calculated and normalized to the non-treated, represented as mean ± SD, and were statistically analysed using one-way ANOVA and Dunnett's multiple comparison test (**p < 0,01; *** p< 0,001; **** p<0,0001). The y-axis represents the relative expression, in other words: the radio between mutated allele (MUT) and wild type allele (WT).

[0030] Detailed description of the invention

[0031] All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly through-out the specification and claims unless an otherwise expressly set out definition provides a broader definition.

[0032] As used herein, the indefinite articles "a” and "an” are synonymous with "at least one” or "one or more.” Unless indicated otherwise, definite articles used herein, such as "the” also include the plural of the noun. Oligonucleotides

[0033] As previously stated the first aspect provided by the invention is an oligonucleotide that downregulates the expression an allele carrying a mutation (COL6A1)c.877G> / \.

[0034] In a particular embodiment of the first aspect, the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele, at the site of the mutation. More in particular, which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.

[0035] Thus, in a more particular embodiment, the oligonucleotide of the first aspect downregulates the expression of an allele carrying a mutation at position 877 in the COL6A1 coding sequence (CDS), wherein G is mutated to A compared to wild-type COL6A1, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele, at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.

[0036] The term "wild-type allele” refers in the present disclosure to both a COL6A1 allele with the reference sequence (NM_001848 version NM_001848.3 of August 31, 2019). The skilled person would also understand from the present disclosure that the oligonucleotide of the first aspect would also not downregulate the expression of a COL6A1 allele different than the COL6A1 wild type allele and not carrying the mutation (CO / _6A1)c.877G>A mutation or would downregulate this allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.

[0037] The term “COL6A1" refers both to the collagen type VI alpha 1 chain gene, with genomic NCBI reference NG_008674 version NG_008674.1 of May 4, 2006, and its mRNA transcript with NCBI reference NM_001848 version NM_001848.3 of August 31, 2019. The COL6A1 encodes for one of the three o-chains that compound the collagen VI in humans and it is found in chromosome 21 . The encoded peptide is the alpha 1 subunit of type VI collagen, with protein NCBI reference NP_001839.2 (of February 11, 2006) or UniProt KB accession number P12109, version 3 of February 6th, 2007, and version 222 of the database release. The encoded peptide is a short o-chain domain flanked by N-terminal and C-terminal globular domains of the type "factor von Willebrand A”. It presents a beaded filament structure. The central domain is a triple helix (TH) formed by conserved Gly-X-Y repeats. These Glycine residues are essential for the correct assembly of the collagen VI chains. The union of the three o-chains (o1, o2 and o3) through the Glycine residues of the triple helix domain forms heterotrimeric o1 [VI]o2[VI]o3[VI] monomers which join in antiparallel dimers and two of them associate, forming a tetramer. After the assembly, tetramers are secreted to the extracellular space and the higher-order structure is formed due to associations between them, giving rise to the functional collagen VI.

[0038] The term “ COL6A )c.877 G> A’ refers, in the standard nomenclature format established by the Human Genome Variation Society (HGVS) (Ogino, S., et al. (2007)), to the mutation in the position 877 of the COL6A1 CDS in which a guanine (G) nucleotide present in the reference nucleotide sequence (NCBI Reference Sequence: NM_001848, version NM_001848.3 of August 31, 2019) is substituted by an adenine (A). The preferred name in NCBI for the mutation or single nucleotide variant is NM_001848.3(CO / _6A1):c.877G>A (p. Gly293Arg). This can also be worded to as that the term (CO _6A1)c.877G>A refers to the mutation in which the guanine (G) in the position 877 in the COL6A1 CDS reference nucleotide sequence (SEQ ID NO: 24) is substituted by an adenine (A). The nucleotide in position 877 of the COL6A1 CDS corresponds to the nucleotide in position 958 of the full sequence of the COL6A1 mRNA transcript (with NCBI reference NM_001848.3), which is also be a reference. The (CO / _6A1)c.877G>A mutated gene comprise a CDS that consists of the sequence SEQ ID NO: 25. Accordingly, the mRNA transcript of the (CO / _6A1)c.877G>A mutated gene comprises the CDS with sequence SEQ ID NO: 25. This mutation causes the substitution of a glycine from the triple helix domain by an arginine (p.Gly293Arg), thus affecting the correct assembly of the collagen VI chains. The mutation is one of the two identified in the single nucleotide polymorphism with reference rs398123643 (build 156, released on September 21, 2022) in the position ch r21 :45989626 (GRCh38.p14) of the Homo sapiens.

[0039] By "downregulating'' the expression of a gene it is meant that the expression is reduced, such that the encoded protein by the gene is produced in lower levels, in comparison to basal expression (in the present invention i.e. not treating with the oligonucleotide). In particular embodiments, expression of the encoded protein(s) is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%. In more particular embodiments, expression of the encoded protein(s) is reduced by from around 10% to around 60%, from around 20% to around 50%, or from around 30 to around 40%. In more particular embodiments, expression of the encoded protein(s) is reduced by at least 40%, at least 50%, at least 55% or at least 60%. In a more particular embodiment, it is reduced by at least 55%. In a more particular embodiment, it is reduced by at least 60%. Hence, by employing the oligonucleotide of the present disclosure, the pathogenic effect of an overexpression of the mutated allele is ameliorated.

[0040] In a particular embodiment, the oligonucleotide of the invention downregulates the expression by at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least

[0041] 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least

[0042] 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least

[0043] 44%, or at least 45% of an allele carrying a mutation (COL6A1)c.877G>A, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele, at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation. In a more particular embodiment, the oligonucleotide downregulates the expression by at least 20%. More in particular by at least 25%. In a more particular embodiment, the oligonucleotide of the invention downregulates the expression by at least 30% of an allele carrying a mutation (COL6A1)c.877G>A, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele, at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation. In a more particular embodiment, the oligonucleotide downregulates the expression by at least 40% of an allele carrying a mutation (COL6A1)c.877G>A, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele, at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation. More in particular, by at least 45%.

[0044] Reduction of the expression of the encoded protein(s) can be measured by any suitable technique known in the art. For example, reverse transcription, Sanger sequencing and / or quantitative real-time PCR are frequently used techniques. The examples below describe a method to determine the expression of the genes in greater detail.

[0045] In the context of this disclosure, the term "oligonucleotide" refers to an oligomer of nucleotide. Nucleotides consist of a naturally occurring nitrogenous base or nucleobase (purines (adenine and guanine) and pyrimidines (cytosine, uracil, and thymine)) which is covalently bond to the T position of a 5-carbon sugar (deoxyribose or ribose) which is in turn covalently bond at its 5' position to a phosphate. Oligonucleotides are generally classified as deoxyribooligonucleotides or ribooligonucleotides, which are respectively oligomers of "deoxyribonucleotides” or "ribonucleotides”. An oligonucleotide formed by deoxyribonucleotides may be referred as "DNA oligonucleotide”, "DNA molecules” or simply as "DNA”; and an oligonucleotide formed by ribonucleotides may be referred as "RNA oligonucleotide”, "RNA molecules” or simply "RNA”. A deoxyribooligonucleotide consists of a deoxyribonucleotide (containing adenine or guanine as purines, or cytosine or thymine as pyrimidines) repeating structure wherein the phosphate of a deoxyribonucleotide covalently bonds to the 3' carbon of the deoxyribose of another deoxyribonucleotide, form an alternating, unbranched polymer. A ribooligonucleotide (containing adenine or guanine as purines, or cytosine or uracil as pyrimidines) consists of a similar repeating structure where the 5-carbon sugar is ribose. The structure created by the union of phosphates and sugars of the different nucleotides of an oligonucleotide is called the sugar-phosphate backbone, i.e. the oligonucleotide contains a sugar-phosphate backbone or phosphate backbone. In the context of this disclosure a "thymine nucleotide”, an "uracil nucleotide”, a "guanine nucleotide”, a "cytosine nucleotide” or an "adenine nucleotide” refer to the nucleotide that contains the correspondent nitrogenous base, in particular the nucleotides that contain these bases and that are part of the DNA or RNA.

[0046] In the context of this disclosure, oligonucleotide sequences are represented by strand in the 5' to 3' direction from left to right, and the first nucleotide presented in the sequence is residue position number 1 . The term "oligonucleotide” also includes oligomers comprising monomers other than deoxy adenosine 3'- monophosphate, deoxyguanosine 3'-monophosphate, deoxycytidine 3'-monophosphate, deoxythymidine 3'- monophosphate, adenosine 3'-monophosphate, guanosine 3'-monophosphate, cytidine 3'-monophosphate, or uridine 3'-monophosphate, but are functionally and structurally similar thereto. These are also referred to as oligonucleotide analogues, modified oligonucleotides, or DNA / RNA-like oligonucleotides. Such oligonucleotides may be naturally-occurring or not and are sometimes preferred over native forms because of properties such as, for example, enhanced binding ability, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases.

[0047] An oligonucleotide analogue is indeed composed by nucleotide analogues (or modified nucleotides, or RNA / DNA-like nucleotides), which may have one or more of the three parts of it (phosphate, pentose sugar or nucleobase) altered compared to the above-mentioned "standard” nucleotides. The following paragraphs describe non-limiting modifications to the oligonucleotide of the first aspect of the invention.

[0048] The backbone of an oligonucleotide can be modified. A common modification is the substitution of the phosphate backbone for a phosphoroti ated backbone. In some embodiments, the oligonucleotide contains a phosphorothioated backbone (i.e. modifying the phosphodiester linkage to phosphorothioate of a sugarphosphate backbone). In a particular embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or all of the oligonucleotide bases have a phosphorothioated backbone. In particular embodiments, from 1 to 31, 2 to 30, 3 to 29, 4 to 28, 5 to 27, 6 to 26, 7 to 25, 8 to 24, 9 to 23, 10 to 22, 11 to 21, 12 to 20, 13 to 19, 14 to 18, or 15 to 17 bases have a phosphorothioated backbone. In a more particular embodiment 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides have a phosphorotioated backbone. More in particular 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides have a phosphorothioated backbone. More in particular all the deoxyribonucleotides have a phosphororthioated backbone. Oligonucleotides that contain phosphorothioated backbones provide an increased resistance to nucleases compared to unmodified oligonucleotides (containing 100% phosphodiester backbone).

[0049] In some embodiments, the oligonucleotide comprises modifications to help enhance their properties. Hence, in some embodiments the oligonucleotide may be modified by the substitution of at least one nucleotide with at least one modified nucleotide, ideally so that the in vivo and in vitro stability of the oligonucleotide is enhanced as compared to a corresponding unmodified oligonucleotide. In some embodiments, the oligonucleotide comprises 2'-deoxy guanosine, 2'-deoxy adenosine, 2'-0-methylguanosine, 2'-0-methyl (e.g., 2'-O-methylcytidine, 2'-0-methylpseudouridine, 2'-0-methyluridine, 2'-0-methyladenosine (2prime-O- methyladenosine as referred in the sequence listing), 2'-0-methylguanosine) ribonucleotide, 2'- amino, 2'-thio and 2'-fluoro modified ribonucleotide, 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'- fluoro-guanosine, 2'-fluoro- adenosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino- adenosine, 2'-amino-guanosine, 2'-amino-butyryl- pyrene-uridine, 2'-amino-adenosine, 5-iodo-uridine, ribo- thymidine, 5-bromo-uridine, 2-aminopurine, 5- methyl-cytidine , 5-fluoro-cytidine, and 5- fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino- allyl-uridine.

[0050] In some embodiments, the oligonucleotide includes derivatization of the 5 position, for instance being selected from 5-(2-amino) propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine; derivatization of the 6 position, for instance 6-(2-amino)propyl uridine; derivatization of the 8-position for adenosine and / or guanosines, for instance 8- bromo guanosine, 8-chloro guanosine, or 8-fluoroguanosine. In other embodiments, the oligonucleotide comprises nucleotide analogs such as deaza nucleotides, e.g., 7-deaza- adenosine; 0- and N-modified (for instance alkylated, such as N6-methyl adenosine) nucleotides; and other heterocyclically modified nucleotide analogs.

[0051] In other embodiments, the oligonucleotide comprises a modified sugar portion. Examples of modifications to the sugar portion of the nucleotides which may be employed include the 2' OH-group being replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, H2, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted 01-06 alkyl, alkenyl, alkynyl, aryl and so on. The phosphate group of the nucleotide may also be modified, such as by substituting one or more of the oxygens of the phosphate group with sulfur (for instance by employing phosphorothioates). Modifications may decrease the rate of hydrolysis of polynucleotides comprising the modified bases, for example by inhibiting degradation by exonucleases. In one preferred instance, the oligonucleotide is resistant to ribonucleases. Oligonucleotide which may be employed includes those with modifications to promote such resistance, for instance an oligonucleotide of the invention may have particularly been modified with a 2'- O-methyl group (e.g., 2'-0-methylcytidine, 2'-0- methylpseudouridine, 2'-0- methylguanosine, 2'-0-methyluridine, 2'-0-methyladenosine, 2'-0-methyl). In certain embodiments, the oligonucleotide contains a modification to increase resistance to ribonucleases and a phosphorothioate backbone.

[0052] In other embodiments, the oligonucleotide contains peptide nucleic acid (PNA), Morpholino nucleic acid, glycol nucleic acid (GNA), threose nucleic acid (TNA), hexitol nucleic acids (HNA). In other embodiments, the oligonucleotide contains locked nucleic acids (LNA) (an oligonucleotide comprising at least one 2'-C,4'-C-oxy- methylene-linked bicyclic ribonucleotide monomer), 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5- carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1- methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'- methoxycarboxymethyluraci 1, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3- amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. In some embodiments, the oligonucleotide includes modifications to the phosphate backbone such as methyl phosphonates, methyl phosphonothioates, phosphoromorpholidates, phosphoropiperazidates and phosphoramidates. In some embodiments, the oligonucleotide contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1- propenyl, 2- propenyl, and isopropyl).

[0053] The oligonucleotide of the invention is complementary to (and thus hybridize with) a region of the RNA transcript from the genes, in particular to the mRNA. In one embodiment, it is provided an oligonucleotide that is complementary to a target sequence of a COL6A1 transcript mRNA with the (COL6A1)c.877G>A mutation. In particular embodiments, the targeted mRNA transcript is the NM_001848.3 (NCBI reference) with the (CO / _6A1)c.877G>A mutation. In another embodiment, the targeted mRNA transcript comprises a CDS which is of SEQ ID NO: 25. By hybridizing with the target transcripts, the oligonucleotide of the present disclosure is able to reduce the expression of the encoded gene.

[0054] In one embodiment, the oligonucleotide is complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides of the target sequence within the transcript; in particular it is complementary to at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides; more particularly it is complementary to at least 13, 14, 15, 16, 17, 18 or 19 nucleotides; and even more particularly it is complementary to at least 17 nucleotides of the target transcript.

[0055] In one embodiment, the oligonucleotide is complementary to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides of the target sequence within the transcript; in particular it is complementary to 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides; more particularly it is complementary to 13, 14, 15, 16, 17, 18 or 19 nucleotides; and even more particularly it is complementary to 17 nucleotides of the target transcript.

[0056] In one embodiment, the oligonucleotide is complementary to from 9 to 31, 10 to 30, 11 to 29, 12 to 28, 13 to 27, 14 to 26, 15 to 25, 16 to 24, or from 17 to 23 nucleotides of the target sequence within the transcript, more in particular from 13 to 31 ; in particular it is complementary to from 13 to 25, 14 to 24, 15 to 23, 16 to 22 or 17 to 21 nucleotides; more particularly it is complementary to from 13 to 19, 14 to 18, or 15 to 17 nucleotides of the target transcript.

[0057] In more particular embodiments, the target sequence comprises the sequence delimited by the nucleotides in position 862 to 892 of the SEQ ID NO:25; more in particular in position 865 to 889 of the SEQ ID NO:25; more in particular in position 868 to 886 of the SEQ ID NO:25; more in particular in position 869 to 885 of the SEQ ID NO:25.

[0058] In another particular embodiments, the target sequence consists of the sequence delimited by the nucleotides in position 862 to 892 of the SEQ ID NO:25; more in particular in position 865 to 889 of the SEQ ID NO:25; more in particular in position 868 to 886 of the SEQ ID NO:25; more in particular in position 869 to 885 of the SEQ ID NO:25.

[0059] In one embodiment, the oligonucleotide is from 9 to 31, 10 to 30, 11 to 29, 12 to 28, 13 to 27, 14 to 26, 15 to 25, 16 to 24, 17 to 23, 18 to 22, or 19 to 21 nucleotides in length, particularly from 13 to 31, more in particular from 13 to 19 nucleotides in length, more particularly it is from 15 to 19, or from 16 to 18 nucleotides in length. In a particular embodiment, the oligonucleotide is 17 to 25 nucleotides in length. In another particular embodiment, the oligonucleotide is 17 to 20 nucleotides in length.

[0060] It may be that the region of the oligonucleotide capable of hybridizing to the target transcript has a length as described herein, or at least that length, but there are also additional nucleotides at the 5' and / or 3' ends of the oligonucleotide (overhangs), though in other instances no overhangs are present and the whole length of the oligonucleotide hybridizes with the target. In general, oligonucleotide sequences which are 100% complementary to a portion of the target RNA may particularly be employed. In some instances, though, sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence may be present. For example, oligonucleotide sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for reducing the target gene expression. In some embodiments the oligonucleotide is at least around 80%, around 81%, around 82%, around 83%, around 84%, around 85%, around 86%, around 87%, around 88%, around 89%, around 90%, around 91%, around 92%, around 93%, around 94%, around 95%, around 96%, around 97%, around 98%, around 99% or even around 100% complementary to the target sequence within the mRNA transcript. In particular embodiments, the oligonucleotide is at least around 94%, around 95%, around 96%, around 97%, around 98%, around 99% complementary to the target sequence. In more particular embodiments, the oligonucleotide is around 100% complementary to the target sequence.

[0061] In one embodiment, the oligonucleotide is at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides in length, particularly at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. In a more particular embodiment, the oligonucleotide is at least 13 nucleotides in length. In a more particular embodiment, the oligonucleotide is at least 17 nucleotides in length.

[0062] In one embodiment, the oligonucleotide is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides in length, particularly 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, more particularly 13, 14, 15, 16, 17, 18 or 19, more in particular 16, 17 or 18 nucleotides in length. More in particular the oligonucleotide is 17 nucleotides in length.

[0063] The terms "hybridizes," "hybridization," "hybridize to," and the like, are terms of art that refer to the pairing of nucleobases in complementary strands of oligonucleotides (e.g., an antisense oligomer and a selected / target sequence in a pre-mRNA molecule). While embodiments of this disclosure are not limited to a particular pairing mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases or nitrogenous bases. For example, the natural nucleobase adenine is complementary to the natural nucleobases thymidine and uracil, which pair through the formation of hydrogen bonds. Similarly, the natural base guanine is complementary to the natural nucleobases cytosine and 5-methyl cytosine. An oligonucleotide complementary to a certain target sequence is understood as an oligonucleotide having a sequence that will bind to the target sequence. Complementarity can be 100%, when all of the nucleotides bind to the target sequence, or less that 100%. Thus, the above embodiments can be alternatively expressed as an oligonucleotide that comprises a sequence that has identity with respect to the reverse complimentary of a target sequence within a transcript mRNA. Identity is of 100% or, alternatively, at least around 80%, around 81%, around 82%, around 83%, around 84%, around 85%, around 86%, around 87%, around 88%, around 89%, around 90%, around 91%, around 92%, around 93%, around 94%, around 95%, around 96%, around 97%, around 98%, or around 99% with respect to the reverse complimentary of the target sequence within the transcript mRNA.

[0064] Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the field. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = # of identical positions / total # of positions* 100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non- limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264- 68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0065] The skilled person may determine whether an oligonucleotide downregulates the expression of an allele carrying the mutation at position 877 in the COL6A1 coding sequence (CDS), and does not downregulate the expression of a COL6A1 wild-type allele (or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation), by methods well known in the state of the art. For example, this may be done or this is achieved by Droplet Digital PCT (ddPCR) technique, as shown in the examples.

[0066] The oligonucleotides described herein can be single-stranded or double-stranded. In some embodiments the oligonucleotide of the first aspect is double stranded. Examples of double-stranded RNA include, e.g., siRNA, short hairpin RNA (shRNA) and other RNAi agents such as pre-miRNA.

[0067] In one embodiment, the oligonucleotide is a small interfering RNA (siRNA). An siRNA acts by activating the RNAi-induced suppression complex. Once the siRNA molecules according to the present disclosure enter into the cell it gets incorporated into other proteins to form the RISC complex, and once the siRNA is part of said complex, the siRNA is unwond to form single stranded siRNA (the strand that is thermodynamically less stable due to its base pairing at the 5' end is chosen to remain part of the RISC complex). The single stranded siRNA which is part of the RISC complex can now scan and find a complementary mRNA, hybridize to it, and induce its cleavage and posterior degradation, and thus silencing the gene that encodes that mRNA. Therefore, the siRNAs according to the present invention indeed downregulates the expression of an allele carrying a mutation (COL6A1)c.877G>A by hybridizing to its mRNA. Therefore, it is herein considered that the siRNAs of the present invention downregulate the expression of the mutant allele by hybridization to the target mRNA. The siRNA sequences may have overhangs or blunt ends. In a particular embodiment, the siRNA sequences have overhangs. Suitable siRNA sequences can be identified using any means known in the art.

[0068] In other embodiments, the oligonucleotide as defined in the first aspect is single-stranded. Single-stranded oligonucleotides include, e.g., ribozymes, mature miRNA, guide RNA, and triplex-forming oligonucleotides and antisense oligonucleotides (AONs or ASOs) such as gapmers.

[0069] In one embodiment, the oligonucleotide is a miRNA. miRNAs are involved in RNA silencing and post- transcriptional regulation of gene expression. miRNAs base-pair to complementary sequences in mRNA molecules, then gene silence said mRNA molecules by one or more of the processes of cleavage of mRNA strand into two pieces, destabilization of mRNA by shortening its poly(A) tail, or translation of mRNA into proteins. Thus, in a particular embodiment, the sequence of the miRNA comprises a portion that corresponds with that of a portion of the mRNA transcript. In particular, the portion will usually be 100% complementary to the target portion within the allele comprising the mutation but lower levels of complementarity (e.g. 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more) may also be used. In a particular embodiment, MicroRNA (miRNA) are from 16 to 27 nucleotides, more in particular from 20 to 24 nucleotides, even more in particular from 21 to 23 nucleotides. In a particular embodiment, the oligonucleotide as defined in the first aspect is an antisense oligonucleotide (AON or ASO).

[0070] The AONs act by binding to target pre-mRNA or mRNA via Watson-Crick base pairing and inducing downregulation of gene expression by different mechanisms such as through mRNA cleavage, RNase H- mediated mRNA degradation or steric hindrance.

[0071] The oligonucleotide of the present invention may contain deoxyribonucleotides or ribonucleotides. In some embodiments, the oligonucleotide comprises DNA or RNA. In a more particular embodiments, the oligonucleotide consists of DNA or RNA.

[0072] The oligonucleotide of the present invention can also contain both deoxyribonucleotides and ribonucleotides. Thus, in particular embodiments, the oligonucleotide is a DNA-RNA chimera. In other words, the oligonucleotide comprises deoxyribonucleotides and ribonucleotides. More particularly, the oligonucleotide consists of deoxyribonucleotides and ribonucleotides.

[0073] In a more particular embodiment, the oligonucleotide of the first aspect comprises a sequence GTCTGAG of deoxyribonucleotides. In an even more particular embodiment, the oligonucleotide consists of a sequence GTCTGAG of deoxyribonucleotides. In a more particular embodiment, the oligonucleotide consists of a sequence GTCTGAG of deoxyribonucleotides and one or more ribonucleotides.

[0074] Gapmers are chimerical single-stranded AONs that are compounded by a central block of DNA nucleotides (DNA gap), flanked by strands of RNA. Thus in a particular embodiment the oligonucleotide is a gapmer. In other words, the oligonucleotide of the first aspect consists of nucleotides arranged in the structure 5’-A-B-C- 3', wherein “B” is a DNA gap of deoxyribonucleotides, and "A” and “C” are flanking RNA blocks of ribonucleotides.

[0075] The RNase H is an enzyme family which in almost all organisms degrades DNA-RNA hybrids as a defense against viral infection. Gapmers mechanism of gene-silencing action relies on the degradation through the action of Rnase-H in the protein synthesis process: the DNA sequence of a gene is first transcribed into mRNA, the gapmer binds to the mRNA target, and the "gapmer DNA”-“mRNA” duplex is degraded by the Rnase H1, which avoids the translation to protein (i.e. silencing the expression of the correspondent gene).

[0076] The inventors found that gapmer oligonucleotides with a DNA gap of least 7 nucleotides and two flanking RNA blocks each of at least 5 nucleotides long surprisingly reduced the expression of the pathogenic allele (COL6A1)c.877G> / \ as detailed in Example 1 and 2, downregulating in a lesser extent the expression of the wild-type allele.

[0077] In one embodiment, the oligonucleotide consists of a structure 5'-A-B-C-3', wherein “B” is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides long, and "A” and “C” are each at least 1, 2, 3, 4, 5, 6, 7, 8 or 9 ribonucleotides long. In a more particular embodiment, “B” is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides long, and "A” and “C” are each at least 3, 4, 5, or 6 ribonucleotides long. In a more particular embodiment, “B” is 7 deoxyribonucleotides, and "A” and “C” are each at least 3 ribonucleotides long. In a more particular embodiment, “B” is 7 deoxyribonucleotides long, and "A” and “C” are each at least 4 ribonucleotides long. More in particular, “B” is 7 deoxyribonucleotides long, and "A” and “C” are each at least 5 ribonucleotides long.

[0078] In an embodiment, the oligonucleotide consists of a structure 5'-A-B-C-3', wherein “B” is from 7 to 13, or 6 to 12 deoxyribonucleotides long, and "A” and “C” are each from 1 to 9, 2 to 8, 3 to 7, or 4 to 6 ribonucleotides long. In a more particular embodiment, “B” is from 7 to 13 deoxyribonucleotides long, and "A” and “C” are each from 3 to 6 ribonucleotides long. In a more particular embodiment, “B” is from 7 to 8 deoxyribonucleotides long, and "A” and “C” are each from 4 to 5 ribonucleotides long.

[0079] In one embodiment, the oligonucleotide consists of a structure 5'-A-B-C-3', wherein “B” is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides long, and "A” and “C” are each 1, 2, 3, 4, 5, 6, 7, 8 or 9 ribonucleotides long. In a more particular embodiment, “B” is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides long, and "A” and “C” are each 3, 4, 5, or 6 ribonucleotides long. In a more particular embodiment, “B” is 7 deoxyribonucleotides, and "A” and “C” are each 3 ribonucleotides long. In a more particular embodiment, “B” is 7 deoxyribonucleotides long, and "A” and “C” are each 4 ribonucleotides long. More in particular, “B” is 7 deoxyribonucleotides long, and "A” and “C” are each 5 ribonucleotides long.

[0080] In another particular embodiment, the oligonucleotide is arranged in a structure 5'-A-B-C-3', wherein

[0081] - “B” is from 7 to 13 deoxyribonucleotides long, and

[0082] - "A” and “C” are each from 3 to 9 ribonucleotides long; and wherein the oligonucleotide consists of:

[0083] (a) a sequence {GGT}[ACCCAACAG](GTCTGAG)[GT*CCCCGGG]{TCT} (SEQ ID NO: 1), wherein

[0084] - the nucleotides in brackets ( ) are deoxyribonucleotides,

[0085] - the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, wherein T* is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and

[0086] - the nucleotides in curly brackets { } are ribonucleotides; or

[0087] (b) a fragment of (a) lacking from 1 to 9 nucleotides from the 5'end and / or from 1 to 9 nucleotides from the 3'end.

[0088] That is, the oligonucleotide consists of a sequence (a), or of a fragment of this sequence (a) that are lacking certain nucleotides from the ends. In other words, the oligonucleotide can consist of fragments of sequence (a) which lack consecutive nucleotides starting to delete them from the ends (5' and / or 3') of the sequence (a). As an example, an oligonucleotide can consist of a sequence (a) "123456”, or of fragments of (a) such as "23456”, "12345”, "2345”, "345”, among other; but the oligonucleotide does not consist of fragments of (a) such as "13456”, "12346”, "246”, "135”, "36”, "16”, "14”, among other. All of this, provided that the oligonucleotide is arranged in the structure A-B-C described in the embodiment.

[0089] The previous embodiment can also be worded as: the oligonucleotide consists of:

[0090] (a) a sequence GGTACCCAACAGGTCTGAGGTCCCCGGGTCT (SEQ ID NO: 1), wherein

[0091] - the nucleotides in the positions 13 to 20 are deoxyribonucleotides,

[0092] - the nucleotides in the positions 4 to 12 and 20 to 28 are deoxyribonucleotides or ribonucleotides, wherein the nucleotide in the position 21 is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and

[0093] - the nucleotides in the positions 1 to 3 and 29 to 31 are ribonucleotides; or

[0094] (b) a fragment of (a) lacking from 1 to 9 consecutive nucleotides from the 5'end and / or from 1 to 9 consecutive nucleotides from the 3'end.

[0095] In a more particular embodiment, the oligonucleotide is arranged in a structure 5'-A-B-C-3', wherein

[0096] - “B” is from 7 to 13 deoxyribonucleotides long, and

[0097] - "A” and “C” are each from 3 to 6 ribonucleotides long; and wherein the oligonucleotide consists of

[0098] (a) a sequence {ACC}[CAACAG](GTCTGAG)[GT*CCCC]{GGG} (SEQ ID NO: 2), wherein

[0099] - the nucleotides in brackets ( ) are deoxyribonucleotides,

[0100] - the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, wherein T* is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and

[0101] - the nucleotides in curly brackets { } are ribonucleotides; or

[0102] (b) a fragment of (a) lacking from 1 to 6 consecutive nucleotides from the 5'end and / or from 1 to 6 consecutive nucleotides from the 3'end.

[0103] The previous embodiment can also be worded as: the oligonucleotide consists of:

[0104] (a) a sequence ACCCAACAGGTCTGAGGTCCCCGGG (SEQ ID NO: 2), wherein

[0105] - the nucleotides in the positions 10 to 16 are deoxyribonucleotides,

[0106] - the nucleotides in the positions 4 to 9 and 17 to 22 are deoxyribonucleotides or ribonucleotides, wherein the nucleotide in the position 18 is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and

[0107] - the nucleotides in the positions 1 to 3 and 23 to 25 are ribonucleotides; or

[0108] (b) a fragment of (a) lacking from 1 to 6 consecutive nucleotides from the 5'end and / or from 1 to 6 consecutive nucleotides from 3'end.

[0109] In a more particular embodiment, the oligonucleotide is of sequence [ACCCAAC](AGGTCTGAGGT)[CCCCGGG] (SEQ ID NO: 3), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence ACCCAACAGGTCTGAGGTCCCCGGG (SEQ ID NO: 3), wherein the nucleotides in positions 8 to 18 are deoxyribonucleotides and nucleotides in positions 1 to 7 and 19 to 25 are ribonucleotides.

[0110] In another particular embodiment, the oligonucleotide is of sequence [ACCCAACA](GGTCTGAGG)[UCCCCGGG] (SEQ ID NO: 4), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence ACCCAACAGGTCTGAGGUCCCCGGG (SEQ ID NO: 4), wherein the nucleotides in positions 9 to 17 are deoxyribonucleotides and nucleotides in positions 1 to 8 and 18 to 25 are ribonucleotides.

[0111] In another particular embodiment, the oligonucleotide is of sequence [CCAACA](GGTCTGAGG)[UCCCCG] (SEQ ID NO: 5), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CCAACAGGTCTGAGGUCCCCG (SEQ ID NO: 5), wherein the nucleotides in positions 7 to 15 are deoxyribonucleotides and nucleotides in positions 1 to 6 and 16 to 21 are ribonucleotides.

[0112] In a more particular embodiment, the oligonucleotide is arranged in a structure 5'-A-B-C-3', wherein

[0113] - “B” is from 7 to 10 deoxyribonucleotides long, and

[0114] - "A” and “C” are each 5 ribonucleotides long; and wherein the oligonucleotide consists of

[0115] (a) a sequence {CCAAC}[AG](GTCTGAG)[G]{UCCCC} (SEQ ID NO: 41), wherein

[0116] - the nucleotides in brackets ( ) are deoxyribonucleotides,

[0117] - the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, and

[0118] - the nucleotides in curly brackets { } are ribonucleotides; or

[0119] (b) a fragment of (a) lacking from 1 to 2 consecutive nucleotides from the 5'end and / or 1 nucleotide from the 3'end.

[0120] The previous embodiment can also be worded as: the oligonucleotide consists of:

[0121] (a) a sequence CCAACAGGTCTGAGGUCCCC (SEQ ID NO: 41), wherein

[0122] - the nucleotides in the positions 8 to 14 are deoxyribonucleotides,

[0123] - the nucleotides in the positions 6 to 7 and 15 are deoxyribonucleotides or ribonucleotides, and

[0124] - the nucleotides in the positions 1 to 5 and 16 to 20 are ribonucleotides; or

[0125] (b) a fragment of (a) lacking from 1 to 2 consecutive nucleotides from the 5'end and / or 1 nucleotide from 3'end.

[0126] In another particular embodiment, the oligonucleotide is of sequence [CCAAC](AGGTCTGAGG)[UCCCC] (SEQ ID NO: 37), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CCAACAGGTCTGAGGUCCCC (SEQ ID NO: 37), wherein the nucleotides in positions 6 to 15 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 16 to 20 are ribonucleotides.

[0127] In another particular embodiment, the oligonucleotide is of sequence [CAACA](GGTCTGAGG)[UCCCC] (SEQ ID NO: 6), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CAACAGGTCTGAGGUCCCC (SEQ ID NO: 6), wherein the nucleotides in positions 6 to 14 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 15 to 19 are ribonucleotides.

[0128] In another particular embodiment, the oligonucleotide is of sequence [CAACA](GGTCTGAG)[GUCCC] (SEQ ID NO: 30), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CAACAGGTCTGAGGUCCC (SEQ ID NO: 30), wherein the nucleotides in positions 6 to 13 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 14 to 18 are ribonucleotides.

[0129] In a more particular embodiment, the oligonucleotide is arranged in a structure 5'-A-B-C-3', wherein

[0130] - “B” is 7 deoxyribonucleotides long, and

[0131] - "A” and "C” are each from 5 to 9 ribonucleotides long; and wherein the oligonucleotide consists of

[0132] (a) a sequence [ACCCAACAG](GTCTGAG)[GUCCCCGGG] (SEQ ID NO: 7), wherein

[0133] - the nucleotides in brackets ( ) are deoxyribonucleotides, and

[0134] - the nucleotides in square brackets [ ] are ribonucleotides; or

[0135] (b) a fragment of (a) lacking from 1 to 4 consecutive nucleotides from the 5'end and / or from 1 to 4 consecutive nucleotides from the 3'end.

[0136] The previous embodiment can also be worded as: the oligonucleotide consists of:

[0137] (a) a sequence ACCCAACAGGTCTGAGGUCCCCGGG (SEQ ID NO: 7), wherein

[0138] - the nucleotides in the positions 10 to 16 are deoxyribonucleotides, and

[0139] - the nucleotides in the positions 1 to 9 and 17 to 25 are ribonucleotides; or

[0140] (b) a fragment of (a) lacking from 1 to 4 consecutive nucleotides from 5'end and / or from 1 to 4 consecutive nucleotides from the 3'end.

[0141] In a more particular embodiment, the oligonucleotide is of sequence SEQ ID NO: 7.

[0142] In another particular embodiment, the oligonucleotide is of sequence [CAACAG](GTCTGAG)[GUCCCC] (SEQ ID NO: 8), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CAACAGGTCTGAGGUCCCC (SEQ ID NO: 8), wherein the nucleotides in positions 7 to 13 are deoxyribonucleotides and nucleotides in positions 1 to 6 and 14 to 19 are ribonucleotides.

[0143] In another particular embodiment, the oligonucleotide is of sequence [AACAG](GTCTGAG)[GUCCCC] (SEQ ID NO: 9), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence AACAGGTCTGAGGUCCCC (SEQ ID NO: 9), wherein the nucleotides in positions 6 to 12 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 13 to 18 are ribonucleotides. In another particular embodiment, the oligonucleotide is of sequence [CAACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 10), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence CAACAGGTCTGAGGUCCC (SEQ ID NO: 10), wherein the nucleotides in positions 7 to 13 are deoxyribonucleotides and nucleotides in positions 1 to 6 and 14 to 18 are ribonucleotides.

[0144] In another particular embodiment, the oligonucleotide is of sequence [ACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 11), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence ACAGGTCTGAGGUCCC (SEQ ID NO: 11), wherein the nucleotides in positions 5 to 11 are deoxyribonucleotides and nucleotides in positions 1 to 4 and 12 to 16 are ribonucleotides.

[0145] In another particular embodiment, the oligonucleotide is of sequence [AACAG](GTCTGAG)[GUCC] (SEQ ID NO: 12), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence AACAGGTCTGAGGUCC (SEQ ID NO: 12), wherein the nucleotides in positions 6 to 12 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 13 to 16 are ribonucleotides.

[0146] In another particular embodiment, the oligonucleotide is of sequence [ACAG](GTCTGAG)[GUCC] (SEQ ID NO: 13), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence ACAGGTCTGAGGUCC (SEQ ID NO: 13), wherein the nucleotides in positions 5 to 11 are deoxyribonucleotides and nucleotides in positions 1 to 4 and 12 to 15 are ribonucleotides.

[0147] In another particular embodiment, the oligonucleotide is of sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 14), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of sequence AACAGGTCTGAGGUCCC (SEQ ID NO: 14), wherein the nucleotides in positions 6 to 12 are deoxyribonucleotides and nucleotides in positions 1 to 5 and 13 to 17 are ribonucleotides.

[0148] In a particular embodiment, the oligonucleotide of the invention is of sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 30, SEQ ID NO: 6 and SEQ ID NO: 37. More in particular, it is of SEQ ID NO: 14.

[0149] In particular embodiments, the gapmer disclosed herein preferably contain modified nucleotides (nucleotide analogues). In particular, the DNA gap of the gapmer is usually modified with deoxyribonucleotides with phosphorothioated backbones which provide an increased resistance to nucleases. Thus, in certain embodiments some or all of the deoxyribonucleotides of the oligonucleotide as defined in the first aspect have a phosphorothioated backbone. In a more particular embodiment, all of the deoxyribonucleotides of the oligonucleotide as defined in the first aspect have a phosphorothioated backbone.

[0150] Regarding the flanking RNA segments of the gapmers the most common nucleotide modifications are at the 2'-0 position of the ribose moiety, aiming to protect the oligonucleotide from degradation and specially aiming to protect the internal DNA gap from nuclease degradation, as well as to increase the binding affinity to the RNA target sequence. In a particular embodiment, the oligonucleotide comprises modifications to help enhance the properties of the oligonucleotide. The most typical modified nucleotides used are 2'-0-Methyl (2’0-Me), locked nucleic acid (LNA) bases or 2'deoxy-2'-fluorobeta-D-arabinonucleic acid (2’FANA). 2'-0- Methyl, 2’0-Me, or 2'-O-methylation is a nucleoside modification of RNA, where a methyl group is added to the 2' hydroxyl of the ribose moiety of a nucleoside, producing a methoxy group. Other modified ribonucleotides used are 2'-MOE (2'-Methoxyethy I). Thus, in a particular embodiment, some or all of the ribonucleotides of the oligonucleotide as defined in the first aspect are 2'-0-Methyl (2’0-Me), locked nucleic acid (LNA) bases, 2'deoxy-2'-fluorobeta-D-arabinonucleic acid (2'FANA) or 2'-Methoxyethyl (2’-MOE) RNA nucleotides. In a more particular embodiment, some or all of the ribonucleotides are selected from the group consisting of 2'-0-Methyl (2’0-Me) RNA nucleotides, 2’-Methoxyethy I (2'-MOE) RNA nucleotides and combinations thereof. In an even more particular embodiment, all of the ribonucleotides are 2'-0-Methyl (2’0- Me) RNA nucleotides. In particular, adenine ribonucleotides contain a 2'0-Methyladenosine nucleoside, guanine ribonucleotides contain a 2'0-Methylguanosine nucleoside, cytosine ribonucleotides contain a 2'0- Methylcytidine nucleoside, uracil ribonucleotides contain a 2'0-Methyluridine nucleoside. In another particular embodiment, all of the ribonucleotides are 2'-Methoxyethyl (2'-MOE) RNA nucleotides. In particular, adenine ribonucleotides contain a 2'-MOE-Adenosine nucleoside, guanine ribonucleotides contain a 2'-MOE- guanosine nucleoside, cytosine ribonucleotides contain a 2'-M0E-cytidine nucleoside, uracil ribonucleotides contain a 2'-M0E-uridine nucleoside

[0151] In a particular embodiment, the deoxyribonucleotides of the oligonucleotide as defined in the first aspect are deoxyribonucleotides linked by phosphorothioate linkages.

[0152] In another particular embodiment, the ribonucleotides of the oligonucleotide as defined in the first aspect are modified at the 2'-0 position of the ribose moiety. In a more particular embodiment, the ribonucleotides are selected from the group consisting of 2'-0-Methyl RNA nucleotides, 2’-Methoxyethy I (2'-MOE) RNA nucleotides, and combinations thereof.

[0153] In another particular embodiment, the oligonucleotide as definde in the first aspect comprises ribonucleotides of modified at the 2'-0 position of the ribose moiety and deoxyribonucleotides with phosphorothioate linkages. In a more particular embodiment, the oligonucleotide comprises ribonucleotides selected from the group consisting of 2'-0-Methyl RNA nucleotides, 2'-Methoxyethyl (2'-MOE) RNA nucleotides, and combinations thereof; and deoxyribonucleotides with phosphorothioate linkages. More in particular the oligonucleotide comprises 2'-0-Methyl RNA nucleotides and deoxyribonucleotides with phosphorothioate linkages. In another particular embodiment, the oligonucleotide comprises 2'-Methoxyethyl (2'-MOE) RNA nucleotides and deoxyribonucleotides with phosphorothioate linkages.

[0154] In another particular embodiment, the oligonucleotide as definde in the first aspect consists of ribonucleotides of modified at the 2'-0 position of the ribose moiety and deoxyribonucleotides with phosphorothioate linkages. In a more particular embodiment, the oligonucleotide consists of ribonucleotides selected from the group consisting of 2'-0-Methyl RNA nucleotides, 2'-Methoxyethyl (2’-M0E) RNA nucleotides, and combinations thereof; and deoxyribonucleotides with phosphorothioate linkages. More in particular the oligonucleotide consists of 2'-0-Methyl RNA nucleotides and deoxyribonucleotides with phosphorothioate linkages. In another particular embodiment, the oligonucleotide consists of 2'-Methoxyethy I (2’-MOE) RNA nucleotides and deoxyribonucleotides with phosphorothioate linkages.

[0155] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence AACAG(GTCTGAG)GUCCC (SEQ ID NO: 15), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages.

[0156] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [AACAG]GTCTGAG[GUCCC] (SEQ ID NO: 16), wherein the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications.

[0157] In a more particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 17), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages and the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications.

[0158] In other words, in a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence AACAGGTCTGAGGUCCC SEQ ID NO: 15, wherein the nucleotides in positions 6 to 12 are deoxyribonucleotides with phosphorothioate linkages.

[0159] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence AACAGGTCTGAGGUCCC SEQ ID NO: 16, wherein the nucleotides in positions 1 to 5 and 13 to 17 are ribonucleotides with 2'-0-Methyl modifications.

[0160] In a more particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence AACAGGTCTGAGGUCCC SEQ ID NO: 17, wherein the nucleotides in positions 6 to 12 are deoxyribonucleotides with phosphorothioate linkages and the nucleotides in positions 1 to 5 and 13 to 17 are ribonucleotides with 2'-0-Methyl modifications.

[0161] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence CAACA(GGTCTGAG)GUCCC (SEQ ID NO: 31), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages. In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CAACA]GGTCTGAG[GUCCC] (SEQ ID NO: 32), wherein the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications. In a more particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CAACA](GGTCTGAG)[GUCCC] (SEQ ID NO: 33), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages and the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications.

[0162] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence CAACA(GGTCTGAGG)UCCCC (SEQ ID NO: 34), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages. In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CAACA]GGTCTGAGG[UCCCC] (SEQ ID NO: 35), wherein the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications. In a more particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CAACA](GGTCTGAGG)[UCCCC] (SEQ ID NO: 36), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages and the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications.

[0163] In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence CCAAC(AGGTCTGAGG)UCCCC (SEQ ID NO: 38), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages. In a particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CCAAC]AGGTCTGAGG[UCCCC] (SEQ ID NO: 39), wherein the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications. In a more particular embodiment, the oligonucleotide as defined in the first aspect comprises or consists of a sequence [CCAAC](AGGTCTGAGG)[UCCCC] (SEQ ID NO: 40), wherein the nucleotides in brackets ( ) are deoxyribonucleotides with phosphorothioate linkages and the nucleotides in square brackets [ ] are ribonucleotides with 2'-0-Methyl modifications.

[0164] Alternative wordings as above shown can be equivalently drafted for these embodiments.

[0165] In a particular embodiment, the oligonucleotide of the invention is of sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 31, SEQ ID NO: 34 and SEQ ID NO: 38. More in particular, it is of SEQ ID NO: 17.

[0166] In another particular embodiment, the oligonucleotide of the invention is of sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 35 and SEQ ID NO: 39. More in particular, it is of SEQ ID NO: 16.

[0167] In another particular embodiment, the oligonucleotide of the invention is of sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 33, SEQ ID NO: 36 and SEQ ID NO: 40. More in particular, it is of SEQ ID NO: 17.

[0168] The oligonucleotides of the disclosure can be produced by any technique known to one of ordinary skill in the art, such as chemical synthesis, enzymatic production or biological production. In a particular embodiment, the oligonucleotide of the invetion is made by chemical synthesis. Non- limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques or via deoxynucleoside H- phosphonate intermediate.

[0169] Double stranded oligonucleotides, such as siRNA molecules, can be assembled from two distinct single stranded oligonucleotides, wherein one oligonucleotide comprises the sense strand and the other comprises the antisense strand of the siRNA. For example, each strand can be synthesized separately and joined together by hybridization or ligation following synthesis and / or deprotection. In certain other instances, siRNA molecules can be synthesized as a single continuous oligonucleotide fragment, where the self-complementary sense and antisense regions hybridize to form an siRNA duplex having hairpin secondary structure.

[0170] Compositions comprising a delivery agent and an oligonucleotide

[0171] The oligonucleotide described herein may be provided on its own or together with a delivery agent, or together with other molecules which contribute to the desired therapeutic effect. The inclusion of the oligonucleotide disclosed herein within a delivery agent may be convenient, for example, in order to target the desired cells or tissues, and to enter into them an interact with its target, to increase the transfection efficiency and / or to improve degradation resistance.

[0172] Thus, the invention also provides as a second aspect, a composition comprising a delivery agent and an oligonucleotide as defined in the first aspect, wherein the oligonucleotide is associated to the delivery agent. All embodiments described above for the oligonucleotide also apply to the composition of the second aspect.

[0173] The term "delivery agent" is to be understood as a pharmaceutically acceptable vehicle. The delivery agent can be organic, inorganic, or both. Suitable delivery agents are well known to those of skill in the art and include, without limitation, large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes) and inactive virus particles. Delivery agents may also include, saline, buffer, dextrose, water, glycerol, ethanol, and the combinations thereof. In particular embodiments, the delivery agent may be a polycationic polymer, a vesicle, a liposome, or a nanoparticle.

[0174] In order to effect expression of sense or antisense gene constructs, the expression construct must be delivered into a cell.

[0175] Several methods for the delivery of oligonucleotides are contemplated by the present disclosure. These include calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, cell sonication, gene bombardment using high velocity microprojectiles, receptor-mediated transfection, as well as the use of delivery agents such as nanoparticles, vesicles or nanovesicles, polymers, viral particles. Some of these techniques may be successfully adapted for in vivo or ex vivo use.

[0176] In a particular embodiment of the disclosure, the delivery agent of the second aspect is a vesicle. In another particular embodiment the vesicle is a nanovesicle.

[0177] In some embodiments, the nanovesicle is an extracellular vesicle. "Extracellular vesicles” and "EVs” are cell- derived and cell-secreted vesicles which, as a class, include exosomes, exosome-like vesicles, ectosomes (which result from budding of vesicles directly from the plasma membrane). Within the class of extracellular vesicles, important components are "exosomes". In a particular embodiment, the nanovesicle is an exosome. In a more particular embodiment, the exosome size ranges from 30 to 500 nm, in particular from 40 to 120 nm, more in particular from 50 to 100 nm in diameter. Exosomes are secreted by all types of cells and are also found abundantly in the body fluids such as: saliva, blood, urine and milk. The major role of exosomes is in cell-cell communication via the functional ly-active cargo (such as miRNA, mRNA, DNA and proteins). Exosomes may be isolated from biological sources, such as milk (milk exosomes), in particular bovine milk is an abundant source for isolating bovine milk exosomes.

[0178] In a more particular embodiment, the nanovesicle is a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. A reagent known as Lipofectamine 2000™, which forms liposomes in an aqueous environment that entrap the transfection payload, is widely used and commercially available.

[0179] In another particular embodiment, the delivery agent is a nanovesicle comprising a sterol and a non-lipid cationic surfactant such as those described in WO2020229469A1 (Nanovesicles and its use for nucleic acid delivery), which is herein incorporated by reference. More in particular, the delivery agent is a quatsome, as described in the same WO2020229469A1 .

[0180] More in particular, the sterol comprises DC-cholesterol (DC-Chol) and the non-lipid cationic surfactant comprises Benzyldimethyltetradecylammonium chloride (MKC). More in particular, the sterol consists of DC- cholesterol (DC-Chol) and the non-lipid cationic surfactant consists of Benzyldimethyltetradecylammonium chloride (MKC).

[0181] An additional aspect of the invention refers to the oligonucleotide of the first aspect associated to a delivery agent. In other words, it refers to a delivery agent containing the oligonucleotide of the first aspect. All the embodiments described for the second aspect, accordingly apply to this additional aspect.

[0182] Pharmaceutical compositions

[0183] A third aspect of this disclosure refers to a composition comprising the oligonucleotide as defined above. All embodiments described above for the oligonucleotide and the composition comprising the oligonucleotide and a delivery agent also apply to the composition of the third aspect.

[0184] In some embodiments, the composition is a pharmaceutical composition comprising a therapeutically effective amount of oligonucleotides of the first aspect and / or the composition of the second aspect together with pharmaceutically acceptable excipients and / or carriers.

[0185] The expression "pharmaceutically acceptable excipients or carriers" refers to pharmaceutically acceptable materials, compositions or vehicles. Each component must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the pharmaceutical composition. It must also be suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0186] The election of the pharmaceutical formulation will depend upon the nature of the active compound and its route of administration. Any route of administration may be used. In some embodiments, the route of administration is parenteral, and the composition is then appropriate for parenteral administration. In a particular embodiment, the route of administration is by injection. In a more particular embodiment, the route of administration is systemic, for example, by intramuscular, intravenous, intraarterial, intraperitoneal, subcutaneous, or transdermal injection. In a particular embodiment, the route of administration is local, for example, intratumoral injection. Topical administration is also contemplated, such that the pharmaceutical composition may be a topical composition.

[0187] The pharmaceutical compositions may be in any form, including, among others, tablets, pellets, capsules, aqueous or oily solutions, suspensions, emulsions, aerosols, or dry powdered forms suitable for reconstitution with water or other suitable liquid medium before use, for immediate or retarded release.

[0188] The appropriate excipients and / or carriers, and their amounts, can readily be determined by those skilled in the art according to the type of formulation being prepared. Examples of suitable pharmaceutically acceptable excipients are solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like. Except insofar as any conventional excipient medium is incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition, its use is contemplated to be within the scope of this disclosure.

[0189] In one particular embodiment, the pharmaceutical composition is a sterile injectable solution. This may be prepared, for instance, by incorporating the oligonucleotides in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0190] Usually, the pharmaceutical composition comprises a therapeutically effective amount of oligonucleotides. The expression "therapeutically effective amount" as used herein, refers to the amount of a compound that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disease which is addressed. The particular dose of oligonucleotide or compositions comprising a delivery agent and an oligonucleotide administered according to this disclosure will of course be determined by the particular circumstances surrounding the case, including the compound administered, the route of administration, the particular condition being treated, and the similar considerations. In a particular embodiment, the oligonucleotides or compositions comprising a delivery agent and an oligonucleotide of the present disclosure are used with other therapeutic agents.

[0191] In another particular embodiment, the oligonucleotides or compositions comprising a delivery agent and an oligonucleotide are used in a combined treatment. In particular the oligonucleotides or compositions comprising a delivery agent and an oligonucleotide are used in combined treatment with palliative treatments. More in particular, the palliative treatments are physiological and / or pneumological treatments.

[0192] Herein disclosed is also a kit of parts that comprises at least one oligonucleotide as defined above. In particular embodiments the kit comprises more than one oligonucleotide as defined above. In a more particular embodiment, the kit comprises at least two oligonucleotides, one as defined above (which reduces the expression of a pathogenic allele of COL6A1) and the other one reducing the expression of another congenital muscular dystrophy related genes. In a more particular embodiment, the kit comprises at least two oligonucleotides, one as defined above (which reduces the expression of a pathogenic allele of COL6A1) and the other one reducing the expression of another COL-RDs related genes. In a more particular embodiment, the kit comprises at least two oligonucleotides, one as defined above reducing the expression of COL6A1 and the other one reducing the expression of COL6A1, COL6A2 and / or COL6A3. All embodiments defined above for the oligonucleotide also apply to the kits. The kits may further comprise delivery agents, excipients, carriers, means of administration, and / or instruction for use.

[0193] Medical use

[0194] A third aspect of the present disclosure is directed to an oligonucleotides, a compositions comprising a delivery agent and an oligonucleotide and a kit, as defined above, for use as a medicament, in particular, for treating a condition associated, or caused by, the (CO / _6A / )c.877G>A mutation. All embodiments defined above for the oligonucleotide, the composition comprising a delivery agent and an oligonucleotide, and the kit also apply to their uses.

[0195] "Treatment” or "treating” conditions associated or caused by the (CO / _6A / )c.877G>A mutation and related diseases or disorders includes a prophylactic treatment before the clinical onset of the disease or a therapeutic treatment after the clinical onset of the disease and may be achieved by arresting the development or reversing the symptom of any of these conditions, disorders or diseases.

[0196] Thus, as used herein, the terms "treatment” and "treating” include any of following: the prevention of the disease or disorder or of one or more symptoms associated with the disease or disorder; a reduction or prevention of the development or progression of the disease or disorder or symptoms; and the reduction or elimination of an existing disease or disorder or symptoms. According to the present disclosure, the treatment of conditions associated to the (CO / _6A1)c.877G>A mutation may be achieved by downregulating the expression of an allele carrying a (CO / _6A1)c.877G>A mutation. Thus, in one embodiment the oligonucleotide or compositions as defined above are for use in downregulating the expression of an allele carrying a (CO / _6A1)c.877G>A mutation.

[0197] In a particular embodiments, the oligonucleotide or compositions as defined above are for use in patients presenting the mutation (COL6A1)c.877G>A. In a more particular embodiment, they are for use in patients presenting the mutation (COL6A1)c.877G>A in heterozygosis ((CO / _6A1)het.c.877G>A).

[0198] In another particular embodiment the condition associated to the (CO / _6A1)c.877G>A mutation is a neuromuscular disease. More in particular it is a muscular dystrophy. In a more particular embodiment, the disease is a congenital muscular dystrophy. In a more particular embodiment, the disease is a collagen-VI related dystrophy (COL6-RD). In a more particular embodiment, the disease is selected from Ullrich Congenital Muscular Dystrophy, Bethlem myopathy and / or a COL6-RD with intermediate phenotype. In a more particular embodiment, the disease is a COL6-RD with intermediate phenotype.

[0199] Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise” encompasses the case of "consisting of”. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration, and they are not intended to be limiting of the present invention. Reference signs related to drawings and placed in parentheses in a claim, are solely for attempting to increase the intelligibility of the claim, and shall not be construed as limiting the scope of the claim. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

[0200] Clauses

[0201] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:

[0202] 1 .- An oligonucleotide that downregulates the expression by at least 40% of a COL6A1 allele carrying a (CO / _6A1)c.877G>A mutation, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.

[0203] 2.- The oligonucleotide according to clause 1, which downregulates the expression by at least 55%.

[0204] 3.- The oligonucleotide according to any one of clauses 1-2, which is from 13 to 31 nucleotides long.

[0205] 4.- The oligonucleotide according to any one of clauses 1-3, which is a single stranded oligonucleotide.

[0206] 5.- The oligonucleotide according to any one of clauses 1-4, which comprises both deoxyribonucleotides and ribonucleotides.

[0207] 6.- The oligonucleotide according to any one of clauses 1-5, which comprises a sequence GTCTGAG of deoxy ribonucleotides.

[0208] 7.- The oligonucleotide according to any one of clauses 1-6, which is arranged in a structure 5'-A-B-C-3', wherein

[0209] “B” is from 7 to 13 deoxyribonucleotides long, and

[0210] "A” and “C” are each from 3 to 9 ribonucleotides long; and wherein the oligonucleotide consists of:

[0211] (a) a sequence {GGT}[ACCCAACAG](GTCTGAG)[GT*CCCCGGG]{TCT} (SEQ ID NO: 1), wherein

[0212] - the nucleotides in brackets ( ) are deoxyribonucleotides,

[0213] - the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, wherein T* is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and

[0214] - the nucleotides in curly brackets { } are ribonucleotides, or

[0215] (b) a fragment thereof lacking from 1 to 9 consecutive nucleotides from the 5'end and / or from 1 to 9 consecutive nucleotides from the 3'end.

[0216] 8. The oligonucleotide according to any one of clauses 1-7, which comprises a sequence [AACAG] (GTCTGAG) [GUCCC] (SEQ ID NO: 14), wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides.

[0217] Clause 9.- The oligonucleotide according to any one of clauses 1-8, wherein some or all of the deoxyribonucleotides have a phosphorothioated backbone and / or some or all of the ribonucleotides are 2'-O- Methyl (2'0-Me), locked nucleic acid (LNA) bases or 2'deoxy-2'-fluorobeta-D-arabinonucleic acid (2'FANA) RNA nucleotides.

[0218] 10.- The oligonucleotide according to any one of clauses 1-9 wherein all the deoxyribonucleotides have a phosphorothioated backbone and all the ribonucleotides are 2'-0-Methyl (2'0-Me) modified.

[0219] 11.- A composition comprising a delivery agent and an oligonucleotide as defined in any one of clauses 1-10, wherein the oligonucleotide is associated to the delivery agent, in particular wherein the delivery agent is a nanovesicle that comprises a sterol and a non-lipid cationic surfactant, wherein the sterol comprises DC- cholesterol.

[0220] 12.- A pharmaceutical composition comprising a therapeutically effective amount of one or more oligonucleotides as defined in any one of clauses 1-10, or the composition as defined in clause 11, together with a pharmaceutically acceptable excipient or carrier.

[0221] 13.- An oligonucleotide as defined in any one of clauses 1-10, the composition as defined in clause 11, or the pharmaceutical composition as defined in clause 12, for use as a medicament.

[0222] 14.- An oligonucleotide as defined in any one of clauses 1-10, the composition as defined in clause 11, or the pharmaceutical composition as defined in clause 12, for use in the treatment of a condition associated to the (CO / _6A / )c.877G>A mutation.

[0223] 15.- An oligonucleotide as defined in any one of clauses 1-10, the composition as defined in clause 11, or the pharmaceutical composition as defined in clause 12, for use according to clause 14, wherein the condition is a collagen-VI related dystrophy.

[0224] Examples

[0225] Example 1

[0226] Cell culture

[0227] Dermal fibroblasts were obtained from patients and a healthy aged matched control. Cells were cultured in Dulbecco's modified Eagle medium (DMEM) with high glucose, L-Glutamine 1 :100, Fetal Bovine Serum (FBS) 10% and Penicillin-streptomycin and fungizone (PSF) 1 :100.

[0228] All cells were maintained in incubators at 37°C and 5% CO2. This part of the study was approved by the Ethical Committee at Sant Joan de Deu Hospital. All experiments concerning human cells were carried out in accordance with the approved protocol.

[0229] COL6A1 Pathogenic Mutation and oligonucleotide

[0230] The COL6A1 mutation of interest is found in heterozygosis in the exon 10 ((CO _6A1)c.877 G>A) in our cohort of patients, causing the missense mutation p.Gly293Arg.

[0231] The gapmer tested, with sequence SEQ ID NO: 17, was designed to silence the mutant allele at the mRNA and to have resistance to nucleases. In particular, the gapmer design presents a central gap of 7 deoxynucleotides with sequence GTCTGAG linked by phosphorotioated linkages, and two flanking regions of 5 ribonucleotides with 2'OMe modifications, with sequences AACAG and GUCCC, at the 5'end and the 3'end of the DNA gap respectively.

[0232] Transfection

[0233] Patient's fibroblasts were seeded in a six-well plate at a concentration of 2x105cells / well in growth medium for 24 hours. After this time, the medium was changed for Opti-MEM (1x) Gibco (Thermofisher®). Cells were treated with the oligonucleotide at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM, and the negative control scramble oligonucleotide at 100 nM. The dilutions were prepared at a final volume of 100 pL, using Opti-MEM as the diluent. Invitrogen Lipofectamine 2000 (Thermo Fisher Scientific) was the transfection reagent and 5pL of it and also 100 pL of Opti-MEM were added to the oligonucleotide dilutions. After 20 minutes of incubation, the medium of the wells was removed, 1 mL of every mix was added to the corresponding well, and the samples were incubated for 24 hours at 37°C and 5% CO2.

[0234] Genomic DNA extraction, PCR, and sequencing

[0235] Genomic DNA was extracted, using the Kit DNeasy® Blood and Tissue Kit (QIAGEN) following the manufacturer's instructions, and amplified by a polymerase chain reaction (PCR). The components of the PCR were the buffer 1 X, MgSO42 mM, dNTPs 0.2 mM, the primers forward and reverse 0.2 pM, Taq, 200 ng of DNA and water up to 25 pl. The primers used were of sequence CTCCTTGGCCCAAATCCTATC (SEQ ID NO: 18) (primer forward) and of sequence GGACAACATCACTGCTGAGAA (SEQ ID NO: 19) (primer reverse). The PCR was run in the following conditions: 35 cycles at 95°C for 5 minutes (initial denaturation), 98°C for 20 seconds (denaturation), 55°C for 30 seconds (annealing) and 72°C at 55 seconds (elongation) and finally, a post amplification at 72°C for 5 minutes.

[0236] The agarose gel electrophoresis, composed of 2% of agarose in TBE buffer 1 X, was used to confirm the presence of amplified DNA and it was revealed using the IBright®CL1000 (Thermofisher®). Once proved, it was purified using the QIAquick® PCR purification kit (QIAGEN) following the manufacturer's instructions and sent for Sanger sequencing to Macrogen.

[0237] RNA extraction and reverse transcription (RT)

[0238] RNA was extracted after 24 hours of transfection by using the RNeasy® Mini Kit Fibrous Tissue kit (QIAGEN) following the manufacturer's instructions. The total RNA concentration and quality was measured using the NanoDrop-1000 UV spectrophotometer (NanodropThechnologies®). A volume between 200 ng and 300 ng of RNA was reverse-transcripted. The RT consisted on a first reaction to denaturalize the RNA, prepared with the RNA, Oligo(dT) 25 pg / mL, random primers 25 pg / mL and adjusted with water to 7 pL of final volume. The mix was placed into the thermoblock at 70°C for 5 minutes. The second reaction carried out was composed by water, Buffer Go Script 5x, MgCI2 2 mM, PCR nucleotide mix 0.5 mM, RNasin Ribonuclease Inhibitors and Go Script Reverse Transcriptase. The conditions of the termoblock for this reaction were 5 minutes at 25°C, 45 minutes at 42°C and 15 minutes at 70°C.

[0239] Droplet Digital PCR

[0240] Droplet DigitalTM PCR (ddPCR) was used to quantify the wild-type and mutant allele expression of the exon 10 of COL6A1 and also the whole COL6A1 expression. The allele specific ddPCR was composed of 11 pL ddPCR Supermix for Probes (no dUTP) (Bio-Rad, United States), 450 nM of the forward primer of sequence CCGGAGATCCTGGAAGA (SEQ ID NO: 20), 450 nM of the reverse primer of sequence TTTTTCTCCCTTCATTCCCT (SEQ ID NO: 21), 250 nM of the wild-type allele probe of sequence CGGGGACCTCGGACC, 5’ HEX-labeled (SEQ ID NO: 22) 250 nM of the mutated allele probe of sequence CGGGGACCTCAGACC, 5’ FAM-labeled (SEQ ID NO: 23) and water up to a final volume of 18 pL. 0.025 ng of the cDNA was added to the mix. For the total COL6A1 expression, the ddPCR was carried out with 11 pL ddPCR Supermix for Probes (no dUTP), 450 nM of the forward primer, 450 nM of the reverse primer, the probe (reference: Hs01095585_m1 of Thermo Fished Scientific) and water up to a final volume of 17 pL. 2 ng of the cDNA was added. A volume of 20 pL of every mix was placed to the wells of a BioRad cartridge. Also, 70 pL of the droplet generator oil were added. The droplets were generated using the QX200 droplet generator (Bio-Rad, United States) and were transferred to a 96-well PCR plate. The PCR plate was placed in the thermocycle. The conditions of the allele specific PCR were 95°C for 10 minutes, followed by 39 cycles at 95°C for 30 seconds and 50°C for 1 minute and finally 10 minutes at 98°C. For the total COL6A1, the conditions were 95°C for 10 minutes, followed by 39 cycles at 94°C for 30 seconds and at 60°C for 1 minute, and finally 10 minutes at 98°C. The plate was placed into the WX200 droplet reader (Bio-Rad, United States) and the concentrations of the mutant and wild-type allele or the total COL6A1 were analysed using Bio-Rad QuantaSoftTM software (v1 .7.4). Results

[0241] Patient's primary fibroblasts presented the het. c.877G<A, p.Gly293Arg COL6A1 mutation

[0242] Primary dermal fibroblasts from the patient were sequenced to confirm the presence of the c.877G<A mutation in the exon 10 of COL6A1 that it was detected in the patient during its genetic diagnosis. Exon 10 of COL6A1 was sequenced by Sanger method using specific primers. The double pick observed in the chromatogram (Figure 1) represented the heterozygosis of the mutation carried by the patient. The guanine of one of the alleles was changed to an adenine, causing the missense mutation. Figure 1 shows SEQ ID NO: 26.

[0243] In order to characterize the cell lines derived from the patient, the specific expression of each of the alleles was analysed, as well as the total COL6A1 expression. It was clearly observed that the healthy control presented a 100% of the wild-type transcripts, while the patient presented approximately 53% of the mutant transcripts and 47% of the wild-type (Figure 2.A). The comparison of the COL6A1 expression between the healthy control and the patient's primary fibroblasts showed that the healthy control had less expression of COL6A1 compared to the patient's primary fibroblasts (Figure 2.B).

[0244] The treatment with the oligonucleotide downregulated significantly the mutant allele expression in patient's primary fibroblasts

[0245] A dose-response analysis of the oligonucleotide was carried out, in five different concentrations between 25 nM and 200 nM, and the relative expression in a transcriptional level of the alleles was studied in order to determine how the treatments affect them. The treatment with the oligonucleotide presented surprising efficacy at 50 nM, 150 nM and 200 nM (p <0.0001), without silencing the wild-type allele (Figure 3).

[0246] Extracellular collagen VI in primary patient's fibroblasts is recovered significantly after the treatment with the oligonucleotide at 150nM

[0247] The expression and organization of collagen VI in the ECM of primary patient's fibroblasts before and after the treatments were analysed by immunofluorescence staining and confocal microscopy. Unlike the healthy control fibroblasts, which presented a collagen VI pattern of linear fibrils, in the patient's fibroblasts the ECM adopted a discontinuous, disorganized and speckled structure due to the secretion of non-functional tetramers. After the oligonucleotide treatments, a recovery of the pattern in the primary fibroblasts could be detected, especially at 150 nM. The ECM achieved a fibrillary lineal arrangement and an increase in the collagen VI intensity, similar to the healthy fibroblasts was detected (Figure 4.A and Figure 4.B).

[0248] Example 2

[0249] Silencing results of the pathogenic variant COL6A1 c.877G>A transfected with alternative AONs with modifications in the length of the DNA core and the total number of nucleotides.

[0250] As for the oligonucleotide of Example 1 (namely AON 2), AONs 1, 3, 4, 5, 6 and 7 are gapmers designed with a central core of deoxynucleotides linked by phosphorotioated linkages, and two flanking regions of 5 ribonucleotides with 2'OMe modifications.

[0251] Lipofectamine transfections of the different AONs were carried out in fibroblasts obtained from dermal biopsies of patients carrying the pathogenic variant COL6A1 c.877G>A. Total RNA was then extracted from these cells, and retrotranscription and subsequent digital droplet PCR were performed to detect the specific expression of the mutant and wild type transcript. The methodologies followed to carry out Example 2 are described in Example 1, except that the oligonucleotides tested are different.

[0252] Table 1

[0253] AON 1

[0254] Cells were transfected with AON 1 (SEQ ID NO: 27) at concentrations of 25 nM, 50 nM, 100 nM, 150 nM and 200 nM. AON 1 differs from the gapmer tested in Example 1 in a two deoxyribonucleotides shorter DNA core.

[0255] The results showed that AON 1 does not significantly reduce the expression of the mutant allele (Figure 5).

[0256] AON 3 and AON 4

[0257] Cells were treated with AON 3 (SEQ ID NO: 28) and AON 4 (SEQ ID NO: 29) at the same concentrations than those tested for AON 1 . AON 3 and AON 3 differs from AON 2 in a one deoxyribonucleotide shorter DNA core.

[0258] The results showed that neither AON 3 nor AON 4 significantly diminishes the expression of the mutant allele (Figure 6 and Figure 7).

[0259] AON 5, AON 6 and AON 7

[0260] Fibroblasts derived from patients were also transfected with alternative AONs that, both in their total length and the length of the DNA core, were longer than AON 2. Specifically, AON 5 (SEQ ID NO: 33), AON 6 (SEQ ID NO: 36) and AON 7 (SEQ ID NO: 40), have a DNA core longer than AON 2 by one, two and three oligonucleotides, respectively. An allele specific transcriptional analysis using ddPCR of the patient's primary fibroblasts non-treated (NP) and treated with AON 2, AON 5, AON 6 and AON 7, at a concentration of 150 nM, was performed.

[0261] The results showed a significant reduction in the expression of the mutant allele (MUT) versus over the wild type (WT) when treated with the different AONs (Figure 8).

[0262] Following methodologies above mentioned, the mean downregulation of the COL6A1 allele carrying a (CO / _6A1)c.877G>A mutation was calculated for each of the AONs 1-7, and is shown in the following Table 2.

[0263] Table 2

[0264] Citation List

[0265] Patent Literature

[0266] WO2020229469A1- Nanovesicles and its use for nucleic acid delivery

[0267] Non Patent Literature

[0268] Karlin S, Altschul SF. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci U S A. 1990 Mar;87(6):2264-8. doi: 10.1073 / pnas.87.6.2264. PMID: 2315319; PMCID: PMC53667.

[0269] Karlin S and Altschul SF. Applications and statistics for multiple high-scoring segments in molecular sequences. Proc Natl Acad Sci U S A. 1993 Jun 15;90(12):5873-7. doi: 10.1073 / pnas.90.12.5873. PMID: 8390686; PMCID: PMC46825.

[0270] Altschul, et al. Basic local alignment search tool. Journal of Molecular Biology, Volume 215, Issue 3, 1990, Pages 403-410, ISSN 0022-2836, doi.org / 10.1016 / S0022-2836(05)80360-2

[0271] Altschul SF, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997 Sep 1 ;25(17):3389-402. doi: 10.1093 / nar / 25.17.3389. PMID: 9254694; PMCID: PMC146917.

[0272] Konermann S, et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 2015 Jan 29;517(7536):583-8. doi: 10.1038 / nature14136. Epub 2014 Dec 10. PMID: 25494202;

[0273] PMCID: PMC4420636.

[0274] Ogino, S., Gulley, M. L, den Dunnen, J. T., Wilson, R. B., & Association for Molecular Patholpogy Training and Education Committtee (2007). Standard mutation nomenclature in molecular diagnostics: practical and educational challenges. The Journal of molecular diagnostics: JMD, 9(1), 1-6.

Claims

ClaimsClaim 1.- An oligonucleotide that downregulates the expression of a COL6A1 allele carrying a (CO / _6A1)c.877G>A mutation, wherein the oligonucleotide: is from 13 to 31 nucleotides long; is single-stranded; comprises both deoxyribonucleotides and ribonucleotides; and comprises a sequence CTCTGAG of deoxyribonucleotides.Claim 2.- The oligonucleotide according to claim 1, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele at the site of the mutation.Claim 3.- The oligonucleotide according to any one of claims 1-2, wherein the downregulation takes place through hybridization of said oligonucleotide to an RNA transcript of said allele at the site of the mutation, and which either does not downregulate the expression of a COL6A1 wild-type allele or does downregulate the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.Claim 4.- The oligonucleotide according to any one of claims 1-3, which downregulates the expression by at least 25%.Claim 5.- The oligonucleotide according to any one of claims 1-4, which downregulates the expression by at least 30%.Claim 6.- The oligonucleotide according to any one of claims 1-5, which downregulates the expression by at least 40%.Claim 7.- The oligonucleotide according to any one of claims 1-6, which is arranged in a structure 5'-A-B-C-3', wherein“B” is from 7 to 13 deoxyribonucleotides long, and"A” and “C” are each from 3 to 9 ribonucleotides long; and wherein the oligonucleotide consists of:(a) a sequence {GGT}[ACCCAACAG](GTCTGAG)[GT*CCCCGGG]{TCT} (SEQ ID NO: 1), wherein- the nucleotides in brackets ( ) are deoxyribonucleotides,- the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, wherein T* is a thymine nucleotide when the nucleotide is a deoxyribonucleotide or an uracil nucleotide when the nucleotide is a ribonucleotide, and- the nucleotides in curly brackets { } are ribonucleotides, or(b) a fragment thereof lacking from 1 to 9 consecutive nucleotides from the 5'end and / or from 1 to 9consecutive nucleotides from the 3'end.Claim 8.- The oligonucleotide according to any one of claims 1-7, which is from 17 to 20 nucleotides long.Claim 9.- The oligonucleotide according to any one of claims 1-8, which is arranged in a structure 5'-A-B-C-3', wherein- “B” is from 7 to 10 deoxyribonucleotides long, and- "A” and “C” are each 5 ribonucleotides long; and wherein the oligonucleotide consists of(a) a sequence {CCAAC}[AG](GTCTGAG)[G]{UCCCC} (SEQ ID NO: 41), wherein- the nucleotides in brackets ( ) are deoxyribonucleotides,- the nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, and- the nucleotides in curly brackets { } are ribonucleotides; or(b) a fragment of (a) lacking from 1 to 2 consecutive nucleotides from the 5'end and / or 1 nucleotide from the 3'end.Claim 10. The oligonucleotide according to any one of claims 1-9, which comprises a sequence selected from the group consisting of a sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 14), a sequence [CAACA](GGTCTGAG)[GUCCC] (SEQ ID NO: 30), a sequence [CAACA](GGTCTGAGG)[UCCCC] (SEQ ID NO: 6) and a sequence [CCAAC](AGGTCTGAGG)[UCCCC] (SEQ ID NO: 37); wherein the nucleotides in brackets ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides.Claim 11. The oligonucleotide according to any one of claims 1-10, which comprises a sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 14).Claim 12.- The oligonucleotide according to any one of claims 1-11, wherein some or all of the deoxyribonucleotides have a phosphorothioated backbone and / or some or all of the ribonucleotides are 2'-O- Methyl (2'0-Me), 2'-MOE, locked nucleic acid (LNA) bases or 2'deoxy-2'-fluorobeta-D-arabinonucleic acid (2'FANA) RNA nucleotides.Claim 13.- The oligonucleotide according to any one of claims 1-12 wherein all the deoxyribonucleotides have a phosphorothioated backbone and all the ribonucleotides are selected from the group consisting of 2'-O- Methyl (2'0-Me) ribonucleotides and 2'-MOE ribonucleotides.Claim 14.- A composition comprising a delivery agent and an oligonucleotide as defined in any one of claims 1-13, wherein the oligonucleotide is associated to the delivery agent, in particular wherein the delivery agent is a nanovesicle that comprises a sterol and a non-lipid cationic surfactant, wherein the sterol comprises DC- cholesterol.Claim 15.- A pharmaceutical composition comprising a therapeutically effective amount of one or more oligonucleotides as defined in any one of claims 1-13, or the composition as defined in claim 14, together with a pharmaceutically acceptable excipient or carrier. Claim 16.- An oligonucleotide as defined in any one of claims 1-13, the composition as defined in claim 14, or the pharmaceutical composition as defined in claim 15, for use as a medicament.Claim 17.- An oligonucleotide as defined in any one of claims 1-13, the composition as defined in claim 14, or the pharmaceutical composition as defined in claim 15, for use in the treatment of a condition associated to the (CO / _6A1)c.877G>A mutation, wherein the condition is a collagen-VI related dystrophy.