Antisense treatment

EP4735596A2Pending Publication Date: 2026-05-06THE UNIV COURT OF THE UNIV OF EDINBURGH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
THE UNIV COURT OF THE UNIV OF EDINBURGH
Filing Date
2024-06-26
Publication Date
2026-05-06

AI Technical Summary

Technical Problem

Current therapeutic options for neurodegenerative diseases associated with TDP-43 pathology, such as ALS, are limited, and the mechanism of TDP-43 contribution to these diseases remains elusive, with existing treatments only providing symptomatic relief and not addressing the underlying molecular mechanisms effectively.

Method used

Development of molecules and compounds, specifically antisense oligonucleotides, that target and correct the mis-splicing events in genes like ATG4B and RANBP1, which are downstream targets of TDP-43, to restore normal protein expression and function, thereby addressing the root cause of TDP-43 mediated pathology.

Benefits of technology

The proposed solution effectively prevents mis-splicing events, restores protein levels, and potentially stalls or reverses the disease phenotype of neurodegenerative diseases by targeting the earliest molecular events underlying TDP-43 pathology, offering a unified treatment approach for a range of diseases including ALS and other TDP-43 proteinopathies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2024051634_02012025_PF_FP_ABST
    Figure GB2024051634_02012025_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure provides methods, compounds (molecules) and / or compositions for the treatment and / or prevention of diseases and / or conditions caused or contributed to by TAR DNA-binding protein 43 (TDP-43) dependent mis-splicing of its downstream target genes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ANTISENSE TREATMENT

[0002] FIELD

[0003] The present disclosure provides molecules and compounds for use in medicine and for the treatment or prevention of proteinopathies.

[0004] BACKGROUND

[0005] Amyotrophic lateral sclerosis (ALS) is a rapidly progressing and fatal disease with 1 :400 lifetime risk, and it is the most common motor neuron disease (MND). At present, there are limited therapeutic options approved for ALS treatment; of those that are available, Riluzole (the only drug approved for ALS in the UK) provides symptomatic relief and extends life expectancy by approximately 3 months. Over 95% of all ALS cases display TDP-43 pathology, where TDP-43 loss of function and / or gain in TDP-43-mediated toxicity are widely believed to be pathogenic.

[0006] In addition to ALS, TDP-43 pathology has been reported in approximately 50% of frontotemporal dementia cases, in approximately 57% of Alzheimer’s disease cases, and all limbic-predominant age-related TDP-43 encephalopathy cases. Further, it is seen in Parkinson’s disease, primary lateral sclerosis, progressive muscular atrophy, facial onset sensory and motor neuronopathy, cerebral age-related TDP-43 with sclerosis, inclusion body myopathy and Perry disease. Despite the relevance of TDP-43 in the pathology of various diseases, the mechanism by which TDP-43 contributes to the pathogenesis of such diseases remains elusive.

[0007] It is amongst the objectives of the present disclosure to develop a novel approach to prevent and / or treat neurodegenerative diseases and other TDP-43 proteinopathies.

[0008] SUMMARY

[0009] The present disclosure is based in part on the finding that TAR DNA-binding protein 43 (TDP-43) dependent mis-splicing of certain downstream target genes may result in, or contribute to, a variety of different disease and / or conditions.

[0010] Accordingly, this disclosure provides methods, compounds (molecules) and / or compositions for the treatment and / or prevention of those diseases and / or conditions. In this regard, the term ‘diseases’ and / or ‘conditions’ may embrace any one or more of the following:

[0011] (i) diseases or conditions with TDP-43 pathology (ii) TDP-43 proteinopathies;

[0012] (iii) Neurodegenerative diseases;

[0013] (iv) Motor neurone disease;

[0014] (v) Amyotrophic Lateral Sclerosis; (ALS)

[0015] (vi) frontotemporal dementia; (FTD)

[0016] (vii) Alzheimer’s disease;

[0017] (viii) primary lateral sclerosis,

[0018] (ix) progressive muscular atrophy,

[0019] (x) facial onset sensory and motor neuronopathy,

[0020] (xi) limbic-predominant age-related TDP-43 encephalopathy,

[0021] (xii) cerebral age-related TDP-43 with sclerosis,

[0022] (xiii) inclusion body myopathy

[0023] (xiv) Perry disease; and

[0024] (xv) Parkinson’s disease.

[0025] It should be noted that the terms “comprise”, “comprising” and / or “comprises” is / are used to de-note that aspects and embodiments of this invention “comprise” a particular feature or features. It should be understood that this / these terms may also encompass aspects and / or embodiments which “consist essentially of” or “consist of” the relevant feature or features.

[0026] The disclosure provides molecules, compounds and / or compositions disclosed herein for use in treating or preventing of any one or more of the diseases or conditions listed above as (i)-(xv).

[0027] The disclosure further provides use of any the disclosed molecules, compounds and / or compositions in the manufacture of a medicament for treating or preventing of any one or more of the diseases or conditions listed above as (i)-(xv).

[0028] Moreover, the disclosure provides a method of treating or preventing of any one or more of the disease or conditions listed above as (i)-(xv), the method comprising administering a subject in need thereof, a molecule, compound or composition of this disclosure.

[0029] Without wishing to be bound by theory, it is suggested that loss of TDP-43 (or loss of TDP- 43 function) is associated with a reduction in the expression of certain proteins, including proteins involved in autophagy and nucleo-cytoplasmic transport. Moreover, it has been shown that dysfunction of these proteins (via the mechanisms described herein) may impact TDP-43 homeostasis, driving a ‘toxic loop’ that promotes further TDP-43 associated pathology.

[0030] Again, without wishing to be bound by theory, loss of TDP-43 or loss of TDP-43 function, may lead to certain pre-messenger RNAs (pre-mRNAs) being mis-processed such that they are subject to the inclusion of cryptic exons. Whereas cryptic exons are considered part of an intron (as they usually remain excluded from host transcripts), under certain pathological circumstances they can become incorporated into the mRNA. Under normal conditions, cryptic exons may be directly repressed from being included in mRNA by TDP-43. However, when TDP-43 repression is lost, their inclusion can result in defective mRNA molecules that are, for example, truncated and / or degraded. This in turn leads to a reduction in the level of the corresponding protein.

[0031] By way of specific example, normal function and / or expression of TDP-43 prevents missplicing events in the ATG4B and RANBP1 genes. However, when TDP-43 function / activity is lost or impaired, these genes become susceptible to mis-splicing events (namely cryptic exon incorporation: i.e. an additional sequence incorporated in (i) the ATG4B transcript between exons 10 and 11 , and (ii) the RANBP1 transcript between exons 3 and 4). These mis-splicing events result in a reduction in the cellular levels of the respective proteins affecting the molecular pathways in which they are contained, and overall cellular function. Further, dysfunction of these proteins and molecular pathways impacts TDP-43 homeostasis promoting further TDP-43 pathology.

[0032] The present disclosure provides molecules, compounds and compositions which overcome the problems associated with loss of TDP-43 function or activity. In particular, the molecules, compounds and / or compositions of the disclosure may be used or exploited to overcome the loss of the cryptic exon repression function of TDP-43.

[0033] In one teaching, the disclosure provides molecules, compounds and / or compositions which may be used to restore (wild-type) ATG4B and / or RANBP1 function or to prevent mis- splicing events in the ATG4B and / or RANBP1 genes, which compounds may be for use in the treatment or prevention of any one the diseases listed as (i)-(xv) above.

[0034] The disclosure, further provides a method of treating or preventing any one of the diseases listed as (i)-(xv) above, said method comprising administering a subject in need thereof a molecule, compound and / or composition of this disclosure. In such a method, the compound, molecule or composition may prevent mis-splicing events in the ATG4B and / or RANBP1 genes. A molecule or compound of this disclosure may overcome, obviate, prevent, inhibit and / or suppress the effects or problems of (or associated with) reduced, aberrant or defective TDP- 43 expression, function and / or activity. The term ‘TDP-43 function / activity’ may embrace the cryptic exon repressing effect attributed to TDP-43.

[0035] A molecule or compound of this disclosure may overcome, obviate, prevent, inhibit and / or suppress the effects or problems of (or associated with) reduced, aberrant or defective ATG4B and / or RANBP1 expression, function and / or activity. The term ‘ATG4B and / or RANBP1 expression, function and / or activity’ may embrace any loss of ATG4B and / or RANBP1 function attributed to the effect of reduced TDP-43 expression, function and / or activity and / or cryptic exon inclusion as explained herein.

[0036] A molecule or compound of this disclosure may overcome, obviate, prevent, inhibit and / or suppress mis-processing or mis-splicing of a target gene. The term ‘target gene’ may embrace genes which are themselves downstream target(s) of TDP-43 and which (in the presence of aberrant or defective TDP-43 function or activity) may be vulnerable to mis- processing or mis-splicing events.

[0037] In one teaching, the various compounds or molecules of this disclosure may block the inclusion of cryptic exons in gene transcripts, even when TDP-43 function / activity is suppressed, aberrant or inhibited and / or TDP-43 expression is (in the nucleus) is reduced.

[0038] A compound or molecule of this disclosure may be derived or obtained from the gene sequence encoding the ATG4B gene or its protein product. A compound or molecule of this disclosure may comprise a functional fragment of the ATG4B gene or its protein product. The term ‘functional fragment’ may embrace any gene fragment which encodes an ATG4B protein which retains some, all or substantially all of the function(s) of the wild-type ATG4B gene. The term ‘functional fragment’ may embrace any ATG4B fragment which retains some, all or substantially all of the function(s) of the wild-type ATG4B protein.

[0039] A compound or molecule of this disclosure may be derived or obtained from the gene sequence encoding the RANBP1 gene or its protein product. A compound or molecule of this disclosure may comprise a functional fragment of the RANBP1 gene or its protein product. The term ‘functional fragment’ may embrace any gene fragment which encodes a RANBP1 protein which retains some, all or substantially all of the function(s) of the wild-type RANBP1 gene. The term ‘functional fragment’ may embrace any RANBP1 fragment which retains some, all or substantially all of the function(s) of the wild-type RANBP1 protein.

[0040] A compound or molecule of this disclosure may comprise a nucleic acid. A compound or molecule of this disclosure may comprise an antisense oligonucleotide (also referred to as AON or ASO).

[0041] An antisense oligonucleotide of this disclosure may bind or sequester an mRNA, a pre- mRNA and / or a nascent RNA molecule derived from one or more target genes (i.e. a gene which is normally a downstream target of TDP-43). In one teaching, an antisense oligonucleotide of this disclosure may bind a target transcript - the target transcript being generated from a target gene.

[0042] Accordingly, an antisense oligonucleotide of the present disclosure may comprise a sequence complementary to at least a portion of an RNA molecule (e.g. a mRNA transcript) derived from one or more downstream target genes of TDP-43.

[0043] An antisense oligonucleotide of this disclosure may be designed to be specific to all or part of the complementary mRNA sequence (or transcript) generated from a target gene (such an mRNA may be referred to as a ‘target transcript’). An antisense oligonucleotide of this disclosure may have a sequence which binds to a target transcript to overlap with splicemodulating cis-elements of a cryptic exon by either:

[0044] (1) fully or partially overlapping with the cis-elements regulating the splicing process; or

[0045] (2) binding to the transcript at a position sufficiently close to the cis-element to disrupt the binding and function of the splicing factors that would normally mediate a particular splicing reaction which occurs at that element.

[0046] The antisense oligonucleotides of this disclosure may be effective against mis-spliced transcripts including cryptic exons from either or both of the ATG4B and RANBP1 genes. These antisense oligonucleotides repress the inclusion of the cryptic exon in the mRNA and restore ATG4B and RANBP1 protein abundance towards normal levels. An antisense oligonucleotide of this disclosure may also direct RNase H mediated target degradation. In this case, an antisense oligonucleotide may target (bind to) a specific transcript containing a cryptic exon; this may initiate its degradation.

[0047] As stated, this disclosure is at least partly based on the finding that dysfunction or loss of TDP-43 leads to mis-splicing of its downstream targets, ATG4B and RANBP1, the inclusion of cryptic exons in the transcripts of these genes and eventually their reduced expression because of pre-mRNA degradation. As such, an antisense oligonucleotide of this disclosure may comprise a sequence directed to transcripts and / or mis-processed (or mis-spliced) transcripts generated from either or the following genes: (i) ATG4B (Ensembl: ENSG00000168397); or

[0048] (ii) RANBP1 (Ensembl: ENSG00000099901).

[0049] As stated, a mis-processed or mis-spliced transcript from either of these genes may be the result of aberrant TDP-43 function or activity (where normal TDP-43 function or activity would have prevented the mis-processing / splicing event). Moreover, a mis-processed or mis-spliced transcript may comprise one or more cryptic exons.

[0050] In one example, the antisense oligonucleotides directed to one or more downstream target genes of TDP-43 may be directed to:

[0051] (i) a sequence complementary to a region in exon 10 and / or 11 of A TG4B, or a region between exons 10 and 11 of A TG4B and / or

[0052] (ii) a sequence complementary to a region in exon 3 and / or 4 of ATG4B, or a region between exons 3 and 4 of RANBP1.

[0053] By way of example, an antisense oligonucleotide sequence directed to one or more downstream target genes of TDP-43 may comprise a sequence provided below:

[0054] SEQ ID NO: 1

[0055] GUACUUAUCCCAACAUGCUG

[0056] SEQ ID NO: 2

[0057] AUCCAUGCACACUCAGCACG

[0058] SEQ ID NO: 3

[0059] UCACCAUGGCUCACACUCAU

[0060] SEQ ID NO: 4

[0061] GAGGCACGUCUGAAAAACGU

[0062] SEQ ID NO: 5

[0063] CUGCAGCACUCACUCCUCGU

[0064] Without wishing to be bound by theory, it is stated that in contrast to prior art therapies which target later stages of the disease cycle, the antisense oligonucleotides described herein, target the earliest molecular events from which other disease relevant mechanisms are predicted to cascade. Moreover, the molecules and various therapeutic options described herein are relevant to >95% of ALS cases, including the C9orf72 cases; this makes the disclosed approach a unified treatment that targets a molecular mechanism underpinning a range of diseases.

[0065] The antisense oligonucleotides of the present disclosure may comprise five or more (for example 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55 or 60) nucleotides that are complementary to a portion of the selected target. The term ‘antisense oligonucleotide’ further embraces any functional variant and / or derivative of any of the antisense oligonucleotides described herein. A functional variant or derivative may comprise, an antisense oligonucleotide sequence which retains substantially all of the functional attributes and / or properties of an antisense oligonucleotide of this disclosure (from which it is derived) and / or an antisense oligonucleotide which shares a degree of identity or homology to any of the antisense oligonucleotides described herein (which may be referred to as reference sequences). For example, a functional variant or derivative may comprise a sequence which is at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical or homologous to all or part (e.g. a functional part) of any of the antisense oligonucleotides described herein.

[0066] A functional variant of any of the antisense molecules of the present disclosure may comprise one or more modifications relative to the sequence of an antisense oligonucleotide of this disclosure. Such functional variants and / or derivatives should retain substantially all of the functional properties of the described antisense oligonucleotides.

[0067] In view of the above, the present disclosure provides any one of SEQ ID NOS: 1-5 or variants or derivatives thereof for use as follows:

[0068] (i) for use in medicine; and / or

[0069] (ii) for use as a medicament; and / or

[0070] (iii) for use in the treatment or prevention of diseases or conditions with TDP-43 pathology;

[0071] (iv) for use in the treatment or prevention of a TDP-43 (dependent) proteinopathy;

[0072] (v) for use in the treatment or prevention of a motor neuron disease;

[0073] (vi) for use in the treatment or prevention of a neurodegenerative disease;

[0074] (vii) for use in the treatment or prevention of amyotrophic lateral sclerosis (ALS);

[0075] (viii) for use in the treatment or prevention of frontotemporal dementia, Alzheimer’s disease, Parkinson’s disease, limbic-predominant age-related TDP-43 encephalopathy, primary lateral sclerosis, progressive muscular atrophy, facial onset sensory and motor neuronopathy, cerebral age-related TDP-43 with sclerosis, inclusion body myopathy or Perry disease.

[0076] The disclosure further provides compositions comprising any of the molecules or compounds, for example antisense oligonucleotides, disclosed herein.

[0077] A composition of this disclosure may be a pharmaceutical composition.

[0078] A composition of this disclosure may be sterile and may further comprise one or more (pharmaceutically acceptable) excipients, diluents and / or carriers.

[0079] A composition of this disclosure may also be used as follows:

[0080] (i) for use in medicine; and / or

[0081] (ii) for use as a medicament; and / or

[0082] (iii) for use in the treatment or prevention of diseases or conditions with TDP-43 pathology;

[0083] (iv) for use in the treatment or prevention of a TDP-43 (dependent) proteinopathy;

[0084] (v) for use in the treatment or prevention of a motor neuron disease;

[0085] (vi) for use in the treatment or prevention of a neurodegenerative disease;

[0086] (vii) for use in the treatment or prevention of amyotrophic lateral sclerosis (ALS);

[0087] (viii) for use in the treatment or prevention of frontotemporal dementia, Alzheimer’s disease, Parkinson’s disease, limbic-predominant age-related TDP-43 encephalopathy, primary lateral sclerosis, progressive muscular atrophy, facial onset sensory and motor neuronopathy, cerebral age-related TDP-43 with sclerosis, inclusion body myopathy or Perry disease.

[0088] The antisense oligonucleotides provided herein are capable of preventing TDP-43 mediated defective cellular events, and therefore have the potential to stall or reverse the disease phenotype of neurodegenerative diseases and / or other TDP-43-mediated diseases.

[0089] The disclosure may provide a vector comprising or for the expression of any of the molecules or compounds described herein. For example, a vector of this disclosure may comprise a nucleic acid which encodes any of the compounds or molecules described herein. A vector of this disclosure may comprise a nucleic acid which expresses (in a cell, for example a mammalian or human cell): (i) an antisense oligonucleotide of this disclosure; and / or

[0090] (ii) the ATG4B and / or RANBP1 proteins; and / or

[0091] (iii) a functional fragment of the ATG4B and / or RANBP1 proteins. The disclosure also provides a host cell transformed with a vector according to this disclosure.

[0092] The disclosure also provides a vector according to this disclosure:

[0093] (i) for use in medicine; and / or

[0094] (ii) for use as a medicament; and / or

[0095] (iii) for use in the treatment or prevention of diseases or conditions with TDP-43 pathology;

[0096] (iv) for use in the treatment or prevention of a TDP-43 (dependent) proteinopathy;

[0097] (v) for use in the treatment or prevention of a motor neuron disease;

[0098] (vi) for use in the treatment or prevention of a neurodegenerative disease;

[0099] (vii) for use in the treatment or prevention of amyotrophic lateral sclerosis (ALS);

[0100] (viii) for use in the treatment or prevention of frontotemporal dementia, Alzheimer’s disease, Parkinson’s disease, limbic-predominant age-related TDP-43 encephalopathy, primary lateral sclerosis, progressive muscular atrophy, facial onset sensory and motor neuronopathy, cerebral age-related TDP-43 with sclerosis, inclusion body myopathy or Perry disease.

[0101] DETAILED DESCRIPTION

[0102] The present disclosure will now be described in detail by reference to the following figures which show:

[0103] Figure 1 : TDP-43 aggregation is a pathological hallmark of ALS. Micrograph images of TDP-43 immunoreactivity reveal TDP-43 is mislocalized from the nucleus to the cytoplasm in ALS post-mortem tissue. This leads to formation of dot-like (arrow, A) or skein-like inclusions (arrow, B) in the spinal cord motor neurons that are shown. Unaffected neurons have a nuclear localization of TDP-43 (arrowheads, A; arrowheads, B). Further, p-TDP-43 immunohistochemistry is used to specifically detect pathologic inclusions (arrow, C) but not normal TDP-43 with its’ nuclear expression. ALS-associated TDP-43 inclusions are immunoreactive for ubiquitin arrow, (D). Figure and adapted legend from Riku, Neuropathology 2020; Oct;40(5):426-435. doi: 10.1111 / neup.12644; PMID: 32157757. Figure 2: RNA sequencing reveals increased inclusion of cryptic exons in the ATG4B and RANBP1 genes following TDP-43 depletion. The inventors carried out a computational re-analysis of publicly available RNA sequencing datasets. Accordingly, splice junction analysis following TDP-43 depletion by siRNA in human embryonic stem cells that had been differentiated to lower spinal motor neurons (Klim et al. Nat Neuroscience. 2019), or by CRISPR gene editing in human induced pluripotent stem cell (hiPSC) derived cortical-like Neurons (Brown et al. Nature. 2022) revealed cryptic exon inclusion in the A) ATG4B and B) RANBP1 genes that had previously gone un-reported within these studies. Shown are RNA sequencing read coverage tracks with splice junction counts indicated. Data analysed in each track comes from references indicated. Zoomed-in panels highlight local splicing variation around cryptic exons.

[0104] Figure 3: CLIP reveals TDP-43 binding sites around ATG4B and RANBP1 cryptic exons.

[0105] A) UV crosslinking and immunoprecipitation (CLIP) involves UV cross-linking cells or tissue samples to initiate covalent bonds between RNA-binding proteins and their interacting RNA targets. RNA-binding proteins of interest are then immuno-precipitated from lysates together with their bound cargo. The protein is then digested and the purified RNA converted into a cDNA library for next generation sequencing. Mapping of sequencing reads can identify the regions of the transcriptome where the RNA-binding protein was interacting. B) CLIP profiles of TDP-43 binding activity in the ATG4B gene in HEK293 cells, SHSY-5Y cells, HeLa cells and hIPSC-derived motor neurons reveals consistent and extensive crosslinking of TDP-43 in the vicinity of a TDP-43 regulated cryptic exon. Vertical bar height represents the number of unique transcripts that were found crosslinked at the indicated nucleotide coordinate. Zoomed in panel indicates termini of cryptic exon. C) CLIP profile of TDP-43 binding activity in the RANBP1 gene in HEK293 cells, SHSY-5Y cells, HeLa cells and hIPSC-derived motor neurons reveals consistent and extensive crosslinking of TDP-43 in the vicinity of a TDP-43 regulated cryptic exon. Vertical bar height represents the number of unique transcripts that were crosslinked at the indicated nucleotide coordinate. Zoomed in panel indicates termini of cryptic exon.

[0106] Figure 4: RT-PCR validates the sensitivity of A TG4B and RANBP1 cryptic exons to TDP- 43 abundance. A) Western blot verification of TDP-43 knockdown in HEK-293 cells by siRNA.

[0107] B) Western blot timeline of TDP-43 knockdown in HEK-293 cells by siRNA together with associated quantification of n=3 replicates per time-point. C) Dot blot verification of TDP-43 knockdown in terminally differentiating lower spinal cord motor neurons derived from hiPSCs by siRNA. D) Upper panel: Predicted local splicing outcomes around the ATG4B cryptic exon, with RT-PCR primer design and product lengths indicated. Lower panel: RT-PCR determined splicing patterns around the ATG4B cryptic exon in HEK293 cells (HEK293) and in terminally differentiating lower spinal cord motor neurons derived from hiPSCs (MN) following TDP-43 knockdown with siRNA. E) Upper panel: Predicted local splicing outcomes around the RANBP1 cryptic exon, with RT-PCR primer design and product lengths indicated. Lower panel: RT-PCR determined splicing patterns around the RANBP1 cryptic exon in HEK293 cells (HEK293) and in terminally differentiating lower spinal cord motor neurons derived from hiPSCs (MN) following TDP-43 knockdown with siRNA

[0108] Figure 5: TDP-43 depletion leads to reduced levels of the ATG4B and RANBP1 proteins.

[0109] A) Schematic revealing location of ATG4B cryptic exon within gene structure. Upper panel: pre-mRNA of ATG4B with splicing patterns indicated. Lower panel: Predicted mRNA transcripts in which the cryptic exon is skipped or included. A premature termination codon is introduced in cryptic exon included mRNAs to make the transcript sensitive to degradation via the nonsense mediated decay (NMD) pathway. B) Schematic revealing location of RANBP1 cryptic exon within gene structure. Upper panel: pre-mRNA of RANBP1 with splicing patterns indicated. Lower panel: Predicted mRNA transcripts in which the cryptic exon is skipped or included. A premature termination codon is introduced in cryptic exon included mRNAs to make the transcript sensitive to degradation via the NMD pathway. C) Western blot analysis and quantification of ATG4B protein abundance following the depletion of TDP-43 with siRNAs for various durations of time. D) Western blot analysis and quantification of RANBP1 protein abundance following the depletion of TDP-43 with siRNAs for various durations of time. The experimental data demonstrates that upon TDP-43 loss-of-function, cells reduce the protein levels of ATG4B and RANBP1 , as a consequence of a reduction of their protein encoding transcripts.

[0110] Figure 6: The nucleocytoplasmic transport pathway and autophagy pathway are disrupted upon TDP-43 depletion. A) Western blot analysis and B) quantification of indicated proteins in different cellular fractions following TDP-43 depletion in HEK293 cells with siRNA. * = p<0.05 relative to protein abundance following GAPDH silencing with siRNA (n=3). This panel demonstrates that in cells with reduced TDP-43 protein levels: (i) ATG4B and RANBP1 protein levels are decreased both in nucleus and cytoplasm; (ii) Markers for autophagy (SQSTM1 and NF-kB) are reduced, mostly in cytoplasm, suggesting defects in autophagy related to the decrease in ATG4B protein; (iii) Nuclear transport proteins (KPNA2 and CRM1) show a shift in nucleus / cytoplasm localization, suggesting defects in nuclear transport related to the decrease in RANBP1 protein. C) Western blot analysis (left panel) and quantification (right panel) of indicated proteins following ATG4B, TDP-43 or GAPDH depletion in HEK293 cells with siRNA. The panel demonstrates that like ATG4B depletion, TDP-43 depletion leads to a change in LC3 processing. Notably, LC3 processing represents a quantitative index of autophagy flux and autophagosome formation, and is the ATG4B dependent step in the autophagy pathway. In contrast, GAPDH silencing has no impact on LC3 processing.

[0111] Figure 7: Reduced levels of the ATG4B or RANBP1 proteins leads to pTDP-43 inclusion formation. A) Western blot analysis of ATG4B silencing with siRNA in HEK293 cells at indicated time-points following transfection. B) Western blot analysis of RANBP1 silencing with siRNA in HEK293 cells at indicated time-points following transfection. C) Immunocytochemistry of phosphorylated TDP-43 following ATG4B silencing in HEK293 cells. Arrowheads indicate micronuclei and dot-like inclusions of pTDP-43 immuno-reactivity. D) Immunocytochemistry of phosphorylated TDP-43 following RANBP1 silencing in HEK293 cells. Arrowheads indicate skein-like inclusions of pTDP-43 immuno-reactivity. E) Proposed model in which initial TDP-43 mis-splicing of cryptic exons in the ATG4B and RANBP1 leads to the initiation of a self-propagating and vicious feed-forward cycle driving TDP-43 mislocalisation to the cytosol and aggregate formation. Cryptic exon inclusion leads to reduced abundance of the ATG4B and RANBP1 proteins and the subsequent dysfunction of the autophagy and nucleocytoplasmic transport pathways. As TDP-43 is itself a target of both pathways, this leads to a failure of TDP-43 to enter the nucleus, TDP-43 accumulation in the cytosol, and a failure to clear excess and misfolding TDP-43. In addition to promoting further mis-splicing of the ATG4B and RANBP1 cryptic exons to drive the cycle further, increased accumulation of TDP-43 is expected to lead to liquid-liquid phase separation that eventually progresses to inclusion formation and hallmark ALS pathology.

[0112] Figure 8: Antisense oligonucleotides targeting cryptic exons in ATG4B and RANBP1 compensate molecular signatures of TDP-43 depletion. A) Design of antisense oligonucleotides (ASG’s) around the ATG4B cryptic exon. B) Design of ASG’s around the RANBP1 cryptic exon. C) RT-PCR evaluation of cryptic exon splicing patterns in the ATG4B gene following TDP-43 depletion, and the co-transfection of indicated ASG’s. D) RT-PCR evaluation of cryptic exon splicing patterns in the RANBP1 gene following TDP-43 depletion, and the co-transfection of indicated ASG’s. E) Western blot analysis and quantification of ATG4B and TDP-43 protein abundance following the depletion of TDP-43 or GAPDH with siRNAs, and the co-transfection of indicated ASG’s directed against the ATG4B cryptic exon. * = p<0.05 (n=3). F) Western blot analysis and quantification of RANBP1 and TDP-43 protein abundance following the depletion of TDP-43 or GAPDH with siRNAs, and the co-transfection of indicated ASG’s directed against the RANBP1 cryptic exon. * = p<0.05 (n=3). The experimental data demonstrates that treatment of cultured cells with this compound promotes correct splicing of its targets. Upon TDP-43 loss-of-function, cells express transcript variants of ATG4B and RANBP1 with an additional exon (cryptic exon) and a reduction of the canonical transcript that encodes the functional protein. Such aberrant transcripts are reduced upon treatment with specific Antisense Oligonucleotides (ASOs) against each target, but not with a random ASO nor an ASO targeting other transcripts. Moreover, the canonical transcript variant expression is also restored to similar levels of control cells. The experimental data also demonstrates that treatment of cultured cells with this compound promotes compensation of reduced protein levels of the targets. Specifically, treatment with specific Antisense Oligonucleotides (ASOs) against each target, but not with a random ASO nor an ASO targeting other transcripts promotes higher protein levels than those without treatment.

[0113] Figure 9: Overlap of up- and down-regulated genes between HEK-293, SH-SY5Y, and differentiating motor neurons (MNs). A) Venn diagrams comparing upregulated and downregulated differentially expressed genes among HEK293 cells, SHSY-5Y cells and differentiating iPSC-derived Ms depleted of TDP-43. Genes shared between all cell-types and between MN and SH-SY5Y cells only are highlighted. B Normalised read counts of the RANBP1 gene between the three cell-types following non-specific siRNA treatment and TDP-43 siRNA treatment.

[0114] Figure 10: Distinction of the different types of alternative splicing (AS) event in HEK-293, SH-SY5Y, and differentiating MN cells, and their novelty. A) Split barplot presenting showing the total number of different types of AS events and the proportion of these that were called as novel by rMATS-turbo (absolute change in relative inclusion between conditions (|dPSI|>0.1 , FDR<0.1 , p<0.05). Novel events are ones for which the splice sites have not been previously annotated. B - D Representation of the data in A as doughnut charts of the different splicing event types and their novelty in B HEK-293, C SH-SY5Y, D differentiating MNs.

[0115] Figure 11 : Overlap of the different types of AS event between HEK-293, SH-SY5Y, and differentiating MNs. A - E) Venn diagrams of the number of identical AS events identified between HEK-293, SH-SY5Y, and differentiating MNs: A SE events, B A3SS events, C A5SS events, D MXE events, E Rl events (|dPSI|>0.1 , FDR<0.1 , p<0.05). Canonical events are in black and novel events are in grey. F-G Tables showing the genes in which there were identical AS events detected in F all three cell-types and G two out of the three cell-types. Genes are arranged by the type of AS event they contain and by their difference in inclusion as a result of TDP-43 knockdown. Canonical events are in black, novel events are in grey, *** indicates opposing inclusion change directions in different cell-types, (#) indicates distinct AS events in the same gene.

[0116] Figure 12: RNA-seq profiles of the ATG4B gene following TDP-43 silencing in HEK293 cells. Zoomed in region covers locus of cryptic splicing events.

[0117] Figure 13: RNA-seq profiles of the RANBP1 gene following TDP-43 silencing in HEK293 cells. Zoomed in region covers locus of cryptic splicing events. Figure 14: ATG4B cryptic splicing event quantification: A) Quantification of cryptic exon splicing in the ATG4B gene from HEK-293, SH-SY5Y, and differentiating MNs (left), and genome browser images from the Integrative Genome Browser of the event locus in each cell-type and condition (right). The shaded area highlights the AS event, with the values on the left representing the peak read coverage of this area. Triangle shows stop codon in the region spliced in / out. B) Quantification of differential cryptic exon inclusion at the ATG4B locus upon TDP-43 knockdown for both variants of the ATG4B cryptic exon.

[0118] Figure 15: TDP-43 binds around the cryptic exons in ATG4B & RANBP1 transcripts in HEK293 cells: Streamlined individual nucleotide resolution UV crosslinking & immunoprecipitation (siCLIP) profiles of TDP-43 binding in the A) ATG4B & B) RANBP1 genes confirms strong recruitment to loci around their respective cryptic exon in HEK293 cells.

[0119] Figure 16: TDP-43 depletion in HEK-293 cells and differentiating MNs depletes expression of ATG4B. A) Protein expression of TDP-43, ATG4B and GAPDH from HEK-293 cells treated with either 10nM NS siRNA or 10nM TDP-43 siRNA and analysed at 72h. B) Volcano plot summarising mass spectrometry analysis of iPSC derived and differentiating MNs that have been depleted of TDP-43 vs. mock treated cells.

[0120] Figure 17: TDP-43 depletion disrupts autophagosome processing in HEK-293 cells. A) Dual fluorescent reporter design of LC3 construct used to monitor autophagosome formation and turnover. B) Confocal images of HEK-239 cells transfected with the mEGFP-mCh-LC3B plasmid and DAPI stain. Cells were starved with HBSS for 4 hours before fixation and imaging. Dark arrowheads indicate autophagosome-localised LC3B. Light arrowheads indicate lysosome localised LC3B.

[0121] Figure 18: ASO treatment in TDP-43 depleted HEK-293 cells can repress cryptic exon inclusion in ATG4B and RANBP1. A-B. Sashimi plot of RNA-seq datasets showing cryptic exon inclusion at ATG4B between exon 10 and 11 (A) and in RANBP1 between exon 3 and exon 4 (B) upon TDP-43 knockdown and indicated ASO treatment. The respective cryptic exon is highlighted in shaded region. The ASO ID is indicated on the right of the image.

[0122] Methodology

[0123] Cell Culture

[0124] HEK-293 cell line was cultured in DMEM Media supplemented with Fetal Bovine Serum and Penicillin-Streptomycin. For experiments where transfections were required, DMEM Media was supplemented with Fetal Bovine Serum only.

[0125] Terminally differentiating lower spinal cord motor neurons derived from hiPSCs were generated following an established protocol (Hall et al. 2017). Briefly, hiPSC were propagated in an adherent monolayer with mTeSR medium in plates coated with Gel-trex. Neural Maintenance Media (NMM; DMEM / F-12 Glutamax, N2 supplement, Neurobasal media, B-27 supplement, 5ug / ml insulin, 1mM L-glutamine, 100 uM nonessential amino acids, 100 urn 2-mercaptoethanol, 50 II ml penicillin, 50 mg ml streptomycin) was then supplemented with different components to promote lower spinal cord motor neurons specification. Initially, hiPSC were expanded until reaching confluency, then media changed to Neural Induction Media (NMM supplemented with 3 compounds; 2uM SB431542 (Tocris Bioscience), 1uM dorsomorphin (Millipore) and 3.3uM CHIR99021 (Miltenyi)). On day 5, cells are split using dispase and further cultured with neural induction media supplemented with 10 uM ROCK inhibitor. On day 8, media was replaced with Neural Patterning Media 1 (NMM supplemented with two compounds; 1uM Purmorphamine (Sigma) and 0.5uM retinoic acid (Sigma)). On day 11 , the neural epithelial sheet was lifted with dispase and cultured another 3 days in Neural Patterning Media 1 supplemented with 10 uM ROCK inhibitor. On day 15, media was changed to Neural Patterning Media 2 (NMM supplemented with 0.1 uM Purmorphamine) for an additional 4 days. For terminal differentiation, cultures were split using accustase to promote a single cell suspension, plated onto pre-coated plates with Geltrex and Poly-L-ornithine (Sigma), and cultured with Neural Differentiation Media (NMM supplemented with 0.1 uM compound E (Enzo life sciences)) for 14 days. All cell cultures were maintained at 37°C and 5% CO2.

[0126] T ransfections

[0127] Cells were transfected with either siRNAs against a specific target or with Antisense Oligonucleotides using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) and Opti-MEM (Thermo Fisher Scientific). All siRNAs from Thermo Fisher Scientific: TDP-43 id: S530935; ATG4B id: S23246; RANBP1 id: S11772. Transfections of siRNA were done at a concentration of 5nM unless otherwise specified. Transfections of Antisense Oligonucleotides were done at a concentration of 0.6uM unless otherwise specified. H EK-293 cells were transfected with mCherry-GFP-LC3 (Saleeb et al. 2019) using Lipofectamine 2000 according to the manufacturers’ instructions. Cell media was removed and replaced with Hank’s Salt Based Solution (HBSS) to create nutrient starvation and imitate autophagy. Cells were incubated for 4 hours before fixation with 4% formaldehyde and co-staining with DAPI. Cells were then imaged using the Nikon AR1 confocal microscope.

[0128] For iPSC-derived motor neuron transfections, lower spinal motor neuron precursor cells were plated onto pre-coated plates with Geltrex and Poly-L-ornithine. After 24 hours, cells were transfected with siRNAs against a specific target using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific), Opti-MEM (Thermo Fisher Scientific) and aforementioned siRNAs. Subsequently the media was changed to neural differentiation media for 5 days when samples were processed.

[0129] Western Blot

[0130] For protein extracts, cells were lysed with RIPA buffer supplemented with Proteinase inhibitors. For samples stained with P-TDP-43, lysis buffer was supplemented with Phosphatase inhibitor. Lysates were then cleared by spinning at 20,000g for 10min at 4°C. Protein concentration of each sample was measured using a Qubit Fluorometer (Thermo Fisher Scientific) with Qubit Protein BR Assay (Thermo Fisher Scientific). A total of 30ug of protein per sample was loaded onto a NuPAGE™ 4-12%, Bis-Tris gel (Thermo Fisher Scientific). Proteins were separated on the gel for 50-60min with either MOPS or MES buffers (Thermo Fisher Scientific). Samples were transferred to a Nitrocellulose membrane. After transfer, the membrane, or a section of it, was used for total protein quantification using Revert™ 700 Total Protein Stain (Licor) and following the manufacturer’s instructions. Membranes were blocked with 5% milk in TBST for either 1 hour at room temperature or overnight at 4°C. Washes were performed using TBST in agitation at room temperature. Primary antibodies were diluted in TBST and the incubation was done either 2 hours at room temperature or overnight at 4°C. After primary antibody incubation, the membrane was washed 3 times of at least 10 minutes, followed by incubation with the corresponding secondary antibodies, also diluted in TSBT. Incubation with secondary antibodies was done for 1 hour at room temperature. Before detection, the membrane was washed at 2 times for at least 5 minutes. Detection was done with a Licor Odyssey Fc Instrument.

[0131] List of primary antibodies used: TDP-43 (ProteinTech), GAPDH (Cell Signaling), ATG4B (Cell Signaling), RANBP (ProteinTech), CRM1 (ProteinTech), KPNA2 (ProteinTech), Lamin B1 (Santa Cruz), Tubulin, SQSTM1 (Cell Signalling), NF-kB (Proteintech), pTDP-43 (Proteintech). List of secondary antibodies used: IRDye® 680RD Goat anti-Rabbit, IRDye® 680RD Goat anti-Mouse, I RDye® 800CW Goat anti-Rabbit, IRDye® 800CW Goat anti-Mouse, all from Licor.

[0132] Reverse Transcription

[0133] For RNA extracts, RNeasy Plus Mini Kit (Qiagen) was used following the manufacturer’s instructions. RNA concentration of each sample was measured using a Qubit Fluorometer (Thermo Fisher Scientific) with Qubit™ RNA Broad Range (BR) Kit (Q10211 , Thermo Fisher Scientific). cDNA was generated from 500ng of total RNA with Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific) and Random Primers. PCR

[0134] PCR was used to detect expression of cryptic exons in ATG4B and RANBP1. Phusion enzyme was used following the manufacturer’s instructions. PCR products were loaded onto a 2% agarose gel with SyberGreen and imaged using a Licor D-Digit machine.

[0135] List of primers for PCR

[0136] ATG4B-F: TGTGTCTGGATGTGAGCGTG

[0137] ATG4B-R: CTAGGGACAGGTTCAGGACG

[0138] RANBP1-F: CCAGAATGGAAGGAGCGAGG

[0139] RANBP1-R: TGACTGGGGAATGGATTTTCTG

[0140] Data analysis

[0141] RNA sequencing datasets from iPSC-derived Motor Neurons (Klim et al. 2019) and iNeurons (Brown et al. 2022) with reduced TDP-43 and controls were analysed using Majiq pipeline (Vaquero-Garcia et al. 2016) or rMATs-turbo (Wang et al. 2024) for detection of cryptic exon expression. Visualization of the results and generation of the sashimi plots was done using I GV (https: / / lgv.org).

[0142] To explore CLIP data from public datasets, Genialis database (https: / / imaps.genialis.com / iclip) was used to search for TDP-43 Crosslink Immunoprecipitation (CLIP) datasets from human cell culture experiments. Bedgraph files from each sample were downloaded. To analyses siCLIP datasets generated from TDP-43 immunoprecipitations from HEK-293 cells, Flow pipeline was used using standard parameters and Bedgraph files downloaded. Visualization of crosslink sites on regions of interest was done on the UCSC Genome Browser (http: / / geno »;y csc.edu).

[0143] Nucleus / cytoplasm fractionation

[0144] HEK-293 cells were cultured as usual. After appropriate treatment, cells were washed and collected in PBS. After spinning and removing the wash buffer, pellets were resuspended in cytoplasmic buffer (50mM Tris, 10mM NaCL, 0.5% Igepal, 1mM EDTA, Protease inhibitors) and incubated 10min on ice. Lysates were spun down and the supernatant was collected as cytoplasmic fraction. The pellet was further resuspended in nuclei buffer (5mM Tris, 300mM NaCL, 0.28mM EDTA and Protease inhibitors) for 30min on ice. Lysates were spun down and the supernatant was collected as nuclear fraction.

[0145] Immunocytochemistry HEK293 cells were grown on glass coverslips for the immunocytochemistry experiments. After appropriate treatment, cells were fixed in 4% paraformaldehyde solution in PBS for 15 mins and washed once in PBS. Next, cells were permeabilised in PBS, 0.2% Triton X-100 for 5 minutes, washed once in PBS and blocked in 5% normal goat serum for 10 minutes. Staining’s were done by incubating the cells in the specific primary antibody diluted in PBS for 1 hour at room temperature. After 3 washes with PBS, cells were incubated with secondary antibody for 1 hours in the dark. Cells were again washed 3 times with PBS. Finally, coverslips were mounted with Fluoroshield with DAPI. Samples were images using a Leica SP8 Confocal Microscope.

[0146] Results and Discussion

[0147] Example 1 : Misregulation of TDP-43 repressed cryptic splicing drives autophagy and nucleocytoplasmic transport defects driving ALS pathology

[0148] ALS is a universally fatal condition caused by the selective death of the upper and lower motor neurons essential for all movement. Association studies have now linked >30 genes to ALS (Goutman et al. 2022), and disturbances to molecular pathways such nucleocytoplasmic transport, RNA metabolism and protein quality control have been identified amongst others (Taylor et al. 2016). However, convergent molecular mechanisms underlying the rapidly progressing neural cell biology which is seen across diverse genetic backgrounds in ALS have remained elusive.

[0149] TAR DNA binding protein 43 (TDP-43) is a ubiquitously expressed RNA binding protein (RBP) that has rare ALS-associated genetic variants. Irrespective of genetic variation, nuclear depletion and cytoplasmic aggregation of hyperphosphorylated and ubiquitinated TDP-43 cytoplasmic represents the core pathology that unifies -95% of ALS cases (Neumann et al. 2006) (Figure 1). Further, mislocalisation and / or aggregation of TDP-43 is similarly seen in -45% of frontotemporal dementia cases, and has been observed in Alzheimer’s disease, Parkinson’s disease, primary lateral sclerosis, progressive muscular atrophy, facial onset sensory and motor neuronopathy, limbic-predominant age-related TDP-43 encephalopathy, cerebral age-related TDP-43 with sclerosis, inclusion body myopathy and Perry disease. Collectively these diseases can be referred to as TDP-43 proteinopathies (de Boer et al. 2020), and together they suggest that aberrations in TDP-43 homeostasis are associated with neurodegenerative processes.

[0150] TDP-43 has diverse roles in RNA metabolism that includes the regulation of splicing, polyadenylation, RNA transport, and micro RNA (miRNA) biogenesis (de Boer et al. 2020). It’s mislocalisation and aggregation has accordingly led to suggestion of two non-mutually exclusive disease mechanisms; nuclear loss-of-function and cytoplasmic gain-of-function. Loss of nuclear function leads to disrupted autoregulation of TDP-43 abundance (Ayala et al. 2011), the mis-processing of key genes associated with disease-relevant cellular phenotypes (Melamed et al. 2019, Brown et al. 2022), compromised spliceosome integrity (Tsuiji et al. 2013), and elevated DNA damage (Guerrero et al. 2019). In particular, loss of TDP-43’s normal repressive regulation of so-called cryptic exons (i.e. unannotated cassette exons) has garnered recent interest. The inclusion of cryptic exons has now been reported in several genes in ALS post-mortem tissue, with one in STMN2 responsible for compromised axonal regenerative capacity (Melamed et al. 2019), and another leading to reduced synthesis of the key synaptic protein, LINC13A (Brown et al. 2022). Notably, restoring TDP-43’s repression of cryptic exon splicing using antisense oligonucleotides (ASO’s) has also been demonstrated to resolve compromised neural cell biology of the STMN2 cryptic exon (Baughn et al. 2023). Meanwhile, toxic gain-of-function following cytoplasmic TDP-43 aggregation includes a block of intracellular transport (Ward et al. 2014, Stalekar et al. 2015), and both reduced proteosome and autophagy activity (Riemenschneider et al. 2022, Bose et al. 2011). Addressing the cause and / or consequence of TDP-43 pathology has thus been proposed as a potential translational strategy for TDP-43 proteinopathies including ALS. When cytoplasmic concentration of TDP- 43 is artificially increased it leads to liquid-liquid phase separation and the formation of liquid droplets that have potential to progress to gel and solid states (Gasset-Rosa et al. 2019). This provides an explanation as to how TDP-43 aggregates can initiate and progress when certain cytosolic conditions are met, but leaves unresolved how TDP-43 initially mislocalises to act as a trigger.

[0151] Here we show that TDP-43 directly represses inclusion of cryptic exons in the ATG4B and RANBP1 genes (Figures 2-4), and that their inclusion upon TDP-43 depletion leads to the reduced abundance of the corresponding protein products (Figure 5). Specifically, a reanalysis of publicly available RNA sequencing datasets in which TDP-43 was depleted across multiple cellular models (Klim et al. 2019, Brown et al. 2022) revealed a previously unreported increase in the inclusion of cryptic exons in the ATG4B and RANBP1 genes following TDP-43 depletion (Figure 2), whilst UV crosslinking and immunoprecipitation analysis (CLIP) from multiple cellular models reveals extensive TDP-43 binding around these regulated cryptic exons in the ATG4B and RANBP1 genes (Figure 3). Reverse transcription PCR subsequently shows that the inclusion of cryptic exons in the ATG4B and RANBP1 transcripts is sensitive to the abundance of TDP-43 in both HEK293 cells and terminally differentiating lower spinal cord motor neurons derived from induced pluripotent stem cells (iPSCs, Figure 4). Further, western blotting reveals the TDP-43 sensitive inclusion of these cryptic exons manifests as reduced levels of the ATG4B and RANBP1 protein products (Figure 5). Indeed, these cryptic exons introduce premature termination codons into the ATG4B and RANBP1 transcripts to make them targets for the nonsense mediated decay pathway.

[0152] Subsequently western blot analysis reveals altered cellular distributions of known targets of the autophagy (i.e. NF-kB and SQSTM1) and nucleocytoplasmic transport (i.e. CRM1 and KPNA2) pathways following TDP-43 depletion with siRNA in HEK293 cells. This implies that the reduced levels of ATG4B and RANBP1 following the TDP-43 dependent inclusion of their cryptic exons is sufficient to compromise both the autophagy and nucleocytoplasmic transport pathways, respectively (Figure 6A-B). Notably, these pathways have previously also been reported as dysfunctional in ALS (Taylor et al. 2016). Meanwhile western blot analysis reveals that like ATG4B depletion, TDP-43 depletion leads to a change in processing of the precursor protein of microtuble-associated protein light chain 3 (LC3), a marker of autophagy and autophagosome formation (Figure 6C). Notably, processing of LC3 is the ATG4B dependent step in the autophagy pathway, and ATG4B inhibition prevents autophagosome formation altogether (Maruyama and Noda, 2017).

[0153] Moreover, as TDP-43 is a target of each pathway (Nishimura et al. 2010, Scotter et al 2014), reducing levels of ATG4B or RANBP1 with short interfering RNAs (siRNAs) leads to phosphorylated TDP-43 (pTDP-43) aggregate formation as the cytoplasmic TDP-43 load is increased (Figure 7). Specifically, pTDP-43 aggregate-containing micronuclei are observed following ATG4B knockout, whilst skein-like pTDP-43 inclusions are seen following RANBP1 knockout. Collectively our results imply a self-propagating, vicious cycle is initiated following the mis-splicing of these two TDP-43 dependent cryptic exons that then drives progressive TDP-43 mislocalisation and aggregate formation via defective autophagy and nucleocytoplasmic transport (Figure 7C).

[0154] ASOs can be used to prevent spliceosome recruitment to influence splicing decisions. By designing ASOs that target the ATG4B and RANBP1 cryptic exons (Figure 8A-B), we have crucially seen that molecular signatures of this cycle, namely the mis-splicing of the ATG4B and RANBP'l genes (Figure 8C-D), and the protein abundance of ATG4B or RANBP1 (Figure 8E-F), can be corrected. This suggests ASO targeting of cryptic splicing in ATG4B and RANBP1 is a promising new translatable strategy for TDP-43 proteinopathies.

[0155] Example 2: data presented in Figures 9-18:

[0156] TDP-43 pathology is seen in 98% of ALS cases in addition to ~15 other TDP-43 proteinopathies. With this in consideration, it was hypothesised that mechanisms underlying TDP-43 aggregation might be conserved across diverse cell populations. To address this, three cell models were analysed in which TDP-43 was depleted. This included H EK-293 cells, neuroblastoma SHSY-5Y cells (PMID: 30643298), and iPSC-derived neural precursor cells that were then terminally differentiated towards motor neurons (MNs). Intersection of the differentially expressed genes revealed a number of both shared and cell-type specific targets (Figure 9A). Notably, RANBP1 was identified as one of the most down-regulated genes across all three cell models (Figure 9B). Alternative splicing analysis of the same datasets then revealed widespread changes at both annotated (i.e. canonical) and un-annotated (i.e. novel) sites of the transcript (Figure 10). Intersection of alternative splicing changes revealed a number of both shared and cell-type specific events comprising all different patterns of alternative splicing (Figure 11A-E). Notably, change in inclusion levels of a novel ATG4B cassette exon was identified as one of the most up-regulated events across all three cell models (Figure 11 F).

[0157] RNA-seq profiles from HEK-293 cells treated with siRNAs against TDP-43 confirmed the detected ATG4B novel exon changes (Figure 12), and revealed the differential gene expression of RANBP1 was likely due to increased inclusion of a novel exon that contained a premature stop codon (Figure 13). RNA-seq changes were also confirmed in SHSY-5Y cells (Figure 14A), whilst two variants of the ATG4B cryptic exon that used subtly different splice sites were confirmed to have increased inclusion levels (Figure 14B).

[0158] We used the streamlined iCLIP (siCLIP) approach to confirm that TDP-43 protein normally binds around the regulated events in HEK-293 cells (Figure 15). Meanwhile, complementing previous data, western blotting showed that siRNA depletion of TDP-43 was paralleled by a near complete reduction of the ATG4B protein in HEK-293 cells (Figure 16A). Further, mass spectrometry analysis of terminally differentiating MNs depleted of TDP-43 revealed that ATG4B was also heavily depleted in this clinically relevant model system (Figure 17B).

[0159] Given ATG4Bs role in processing of the LC3 in the formation of autophagosomes, we cotransfected a LC3 dual fluorescent construct (Figure 18A) into HEK-293 cells that had been depleted of TDP-43 or ATG4B. Unlike the non-specific siRNA treatment that saw largely yellow puncta indicative of both autophagosome formation and subsequent fusion to lysosomes, TDP-43 and ATG4B silencing lead to dominance of red puncta to suggest a problem with autophagosome formation or fusion with the lysosomes (Figure 18B).

[0160] Last, following prevention correction of RNA and protein levels with ASOs targeting the ATG4B and RANBP1 cryptic exon, RNA-seq was used to confirm RNA mis-splicing correction at both sites (Figure 19). Notably we saw that SEQ IDs. 1-3 were only capable of repressing cryptic splicing of the ATG4B locus and not RANBP1 , whilst SEQ IDs. 4-5 were only capable of repressing cryptic splicing of the RANBP1 locus and not ATG4B. Thus, ASOs displayed selectivity for their intended targets. REFERENCES

[0161] Goutman SA, Hardiman O, Al-Chalabi A, Chio A, Savelieff MG, Kiernan MC, Feldman EL. Emerging insights into the complex genetics and pathophysiology of amyotrophic lateral sclerosis. Lancet Neurol. 2022 May;21 (5):465-479. doi: 10.1016 / S1474-4422(21)00414-2. Epub 2022 Mar 22. PMID: 35334234; PMCID: PMC9513754.

[0162] Taylor JP, Brown RH Jr, Cleveland DW. Decoding ALS: from genes to mechanism. Nature. 2016 Nov 10;539(7628): 197-206. doi: 10.1038 / nature20413. PMID: 27830784; PMCID: PMC5585017.

[0163] Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science. 2006 Oct 6;314(5796):130-3. doi: 10.1126 / science.1134108. PMID: 17023659. de Boer EMJ, Orie VK, Williams T, Baker MR, De Oliveira HM, Polvikoski T, Silsby M, Menon P, van den Bos M, Halliday GM, van den Berg LH, Van Den Bosch L, van Damme P, Kiernan MC, van Es MA, Vucic S. TDP-43 proteinopathies: a new wave of neurodegenerative diseases. J Neurol Neurosurg Psychiatry. 2020 Nov 11 ;92(1):86-95. doi: 10.1136 / jnnp-2020- 322983. Epub ahead of print. PMID: 33177049; PMCID: PMC7803890.

[0164] Ayala YM, De Conti L, Avendano-Vazquez SE, Dhir A, Romano M, D'Ambrogio A, Tollervey J, Ule J, Baralle M, Buratti E, Baralle FE. TDP-43 regulates its mRNA levels through a negative feedback loop. EMBO J. 2011 Jan 19;30(2):277-88. doi: 10.1038 / emboj.2010.310. Epub 2010 Dec 3. PMID: 21131904; PMCID: PMC3025456.

[0165] Melamed Z, Lopez-Erauskin J, Baughn MW, Zhang O, Drenner K, Sun Y, Freyermuth F, McMahon MA, Beccari MS, Artates JW, Ohkubo T, Rodriguez M, Lin N, Wu D, Bennett CF, Rigo F, Da Cruz S, Ravits J, Lagier-Tourenne C, Cleveland DW. Premature polyadenylation- mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration. Nat Neurosci. 2019 Feb;22(2): 180-190. doi: 10.1038 / s41593-018-0293-z. Epub 2019 Jan 14. PMID: 30643298; PMCID: PMC6348009.

[0166] Brown AL, Wilkins OG, Keuss MJ, Hill SE, Zanovello M, Lee WC, Bampton A, Lee FCY, Masino L, Qi YA, Bryce-Smith S, Gatt A, Hallegger M, Fagegaltier D, Phatnani H; NYGC ALS Consortium; Newcombe J, Gustavsson EK, Seddighi S, Reyes JF, Coon SL, Ramos D, Schiavo G, Fisher EMC, Raj T, Secrier M, Lashley T, Ule J, Buratti E, Humphrey J, Ward ME, Fratta P. TDP-43 loss and ALS-risk SNPs drive mis-splicing and depletion of UNC13A. Nature. 2022 Mar;603(7899):131-137. doi: 10.1038 / s41586-022-04436-3. Epub 2022 Feb 23. PMID: 35197628; PMCID: PMC8891020.

[0167] Guerrero EN, Mitra J, Wang H, Rangaswamy S, Hegde PM, Basu P, Rao KS, Hegde ML. Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331 K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis. Hum Mol Genet. 2019 Sep 15;28(18):3161-3162. doi: 10.1093 / hmg / ddz141. Erratum for: Hum Mol Genet. 2019 Apr 01 ;: PMID: 31504503; PMCID: PMC6867871.

[0168] Tsuiji H, Iguchi Y, Furuya A, Kataoka A, Hatsuta H, Atsuta N, Tanaka F, Hashizume Y, Akatsu H, Murayama S, Sobue G, Yamanaka K. Spliceosome integrity is defective in the motor neuron diseases ALS and SMA. EMBO Mol Med. 2013 Feb;5(2):221-34. doi: 10.1002 / emmm.201202303. Epub 2013 Jan 25. PMID: 23255347; PMCID: PMC3569639. Baughn MW, Melamed Z, Lopez-Erauskin J, Beccari MS, Ling K, Zuberi A, Presa M, Gonzalo- Gil E, Maimon R, Vazquez-Sanchez S, Chaturvedi S, Bravo-Hernandez M, Taupin V, Moore S, Artates JW, Acks E, Ndayambaje IS, Agra de Almeida Quadros AR, Jafar-Nejad P, Rigo F, Bennett CF, Lutz C, Lagier-Tourenne C, Cleveland DW. Mechanism of STMN2 cryptic splice- polyadenylation and its correction for TDP-43 proteinopathies. Science. 2023 Mar 17; 379(6637) :1140-1149. doi: 10.1126 / science.abq5622. Epub 2023 Mar 16. PMID: 36927019; PMCID: PMC10148063.

[0169] Ward ME, Taubes A, Chen R, Miller BL, Sephton CF, Gelfand JM, Minami S, Boscardin J, Martens LH, Seeley WW, Yu G, Herz J, Filiano AJ, Arrant AE, Roberson ED, Kraft TW, Farese RV Jr, Green A, Gan L. Early retinal neurodegeneration and impaired Ran-mediated nuclear import of TDP-43 in progranulin-deficient FTLD. J Exp Med. 2014 Sep 22;211(10): 1937-45. doi: 10.1084 / jem.20140214. Epub 2014 Aug 25. PMID: 25155018; PMCID: PMC4172214.

[0170] Stalekar M, Yin X, Rebolj K, Darovic S, Troakes C, Mayr M, Shaw CE, Rogelj B. Proteomic analyses reveal that loss of TDP-43 affects RNA processing and intracellular transport. Neuroscience. 2015 May 7;293:157-70. doi: 10.1016 / j. neuroscience.2015.02.046. Epub 2015 Mar 2. PMID: 25743254.

[0171] Riemenschneider H, Guo Q, Bader J, Frottin F, Farny D, Kleinberger G, Haass C, Mann M, Hartl FU, Baumeister W, Hipp MS, Meissner F, Fernandez-Busnadiego R, Edbauer D. Gellike inclusions of C-terminal fragments of TDP-43 sequester stalled proteasomes in neurons. EMBO Rep. 2022 Jun 7;23(6):e53890. doi: 10.15252 / embr.202153890. PMID: 35438230; PMCID: PMC9171420

[0172] Bose JK, Huang CC, Shen CK. Regulation of autophagy by neuropathological protein TDP- 43. J Biol Chem. 2011 Dec 30;286(52):44441-8. doi: 10.1074 / jbc.M111.237115. Epub 2011 Nov 3. PMID: 22052911 ; PMCID: PMC3247982.

[0173] Gasset-Rosa F, Lu S, Yu H, Chen C, Melamed Z, Guo L, Shorter J, Da Cruz S, Cleveland DW. Cytoplasmic TDP-43 De-mixing Independent of Stress Granules Drives Inhibition of Nuclear Import, Loss of Nuclear TDP-43, and Cell Death. Neuron. 2019 Apr 17;102(2):339- 357. e7. doi: 10.1016 / j.neuron.2019.02.038. Epub 2019 Mar 7. PMID: 30853299; PMCID: PMC6548321.

[0174] Klim JR, Williams LA, Limone F, Guerra San Juan I, Davis-Dusenbery BN, Mordes DA, Burberry A, Steinbaugh MJ, Gamage KK, Kirchner R, Moccia R, Cassel SH, Chen K, Wainger BJ, Woolf CJ, Eggan K. ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nat Neurosci. 2019 Feb;22(2): 167-179. doi: 10.1038 / S41593-018-0300-4. Epub 2019 Jan 14. PMID: 30643292; PMCID: PMC7153761.

[0175] Maruyama T, Noda, NN. Autophagy-regulating protease Atg4: structure, function, regulation and inhibition. J Antibiot (Tokyo). 2017 Sep 13;71 (1):72-8. doi: 10.1038 / ja.2017.104. PMID: 28901328; PMCID: PMC5799747

[0176] Nishimura AL, Zupunski V, Troakes C, Kathe C, Fratta P, Howell M, Gallo JM, Hortobagyi T, Shaw CE, Rogelj B. Nuclear import impairment causes cytoplasmic trans-activation response DNA-binding protein accumulation and is associated with frontotemporal lobar degeneration. Brain. 2010 Jun;133(Pt 6):1763-71. doi: 10.1093 / brain / awq111. PMID: 20472655;

[0177] Scotter EL, Vance C, Nishimura AL, Lee YB, Chen HJ, Urwin H, Sardone V, Mitchell JC, Rogelj B, Rubinsztein DC, Shaw CE. Differntial roles of the ubiquitin proteasome system and autophagy in the clearance of soluble and aggregated TDP-43 species. J Cell Sci. 2014 Mar 15;127(Pt 6):1263-78. doi: 10.1242 / jcs.140087. Epub 2014 Jan 14.PMID: 24424030; PMCID: PMC3953816

[0178] Hall CE, Yao Z, Choi M, Tyzack GE, Serio A, Luisier R, Harley J, Preza E, Arber C, Crisp SJ, Watson PMD, Kullmann DM, Abramov AY, Wray S, Burley R, Loh SHY, Martins LM, Stevens MM, Luscombe NM, Sibley CR, Lakatos A, Ule J, Gandhi S, Patani R. Progressive Motor Neuron Pathology and the Role of Astrocytes in a Human Stem Cell Model of VCP- Related ALS. Cell Rep. 2017 May 30; 19(9): 1739-1749. doi: 10.1016 / j.celrep.2017.05.024. PMID: 28564594; PMCID: PMC5464993.

[0179] A VPS33A-binding motif on syntaxin 17 controls autophagy completion in mammalian cells. Saleeb RS, Kavanagh DM, Dun AR, Dalgarno PA, Duncan RR. J Biol Chem. 2019 Mar 15;294(11):4188-4201. doi: 10.1074 / jbc.RA118.005947. PMID: PMID: 30655294;

[0180] PMCID: PMC6422071

[0181] Vaquero-Garcia J, Barrera A, G azzara MR, Gonzalez-Vallinas J, Lahens NF, Hoqenesch JB, Lynch KW, Barash Y. A new view of transcriptome complexity and regulation through the lens of local splicing variations Elife. 2016 Feb 1 ;5:e11752. doi: 10.7554 / eLife.11752.

[0182] PMID: 26829591 ; PMCID: PMC4801060

[0183] Wang Y, Xie Z, Kutschera E, Adams JI, Kadash-Edmondson KE, Xing Y. rMATS-turbo: an efficient and flexible computational tool for alternative splicing analysis of large-scale RNA- seq data Nat Protoc. 2024 Apr; 19(4): 1083-1104. doi: 10.1038 / s41596-023-00944-2. Epub 2024 Feb 23. PM ID: 38396040

[0184] Riku Y. Reappraisal of the anatomical spreading and propagation hypothesis about TDP-43 aggregation in amyotrophic lateral sclerosis and frontotemporal lobar degeneration.

[0185] Neuropathology 2020; Oct;40(5):426-435. doi: 10.1111 / neup.12644; PMID: 32157757

Claims

CLAIMS1 . A compound for use in the treatment or prevention of(i) diseases or conditions with TDP-43 pathology;(ii) TDP-43 proteinopathies;(iii) Neurodegenerative diseases;(iv) Motor neurone disease;(v) Amyotrophic Lateral Sclerosis (ALS);(vi) frontotemporal dementia (FTD);(vii) Alzheimer’s disease;(viii) primary lateral sclerosis;(ix) progressive muscular atrophy;(x) facial onset sensory and motor neuronopathy;(xi) limbic-predominant age-related TDP-43 encephalopathy;(xii) cerebral age-related TDP-43 with sclerosis;(xiii) inclusion body myopathy;(xiv) Perry disease; or(xv) Parkinson’s disease wherein said compound prevents the mis-processing or mis-splicing of genes which are downstream targets of TDP-43.

2. The compound for use of claim 1 , wherein the compound is an antisense oligonucleotide.

3. The compound for use of claim 2, wherein the antisense oligonucleotide comprises a sequence complementary to a mis-spliced or mis-processed gene transcript.

4. The compound for use of claim 3, wherein the mis-spliced or mis-processed transcript is derived from a gene which is a downstream target of TDP-43.

5. The compound for use of claims 3 or 4, wherein the transcript comprises a cryptic exon6. The compound for use of claims 3-5, wherein said antisense oligonucleotide partially overlaps with, or is in close proximity to, a splicing-modulating cis-element of one or more cryptic exons present in the transcript.

7. The compound for use of any preceding claim, wherein the one or more downstream target genes of TDP-43 is ATG4B and / or RANBP1.

8. The compound for use of claims 3-6, wherein the transcript is derived from ATG4B and / or RANBP1.

9. The molecule for use of any one of claims 2-8, wherein said compound comprises a sequence selected from SEQ ID NO: 1 to 5.

10. An antisense oligonucleotide molecule comprising a sequence selected from the group consisting of:SEQ ID NO: 1 ;SEQ ID NO: 2;SEQ ID NO: 3;SEQ ID NO: 4; andSEQ ID NO: 5.

11. The antisense oligonucleotides of claim 10, for use in medicine or for use as a medicament.

12. A method of preventing and / or modulating aberrant TDP-43 activity in a cell, said method comprising contacting a cell with an antisense oligonucleotide according to claim 10.

13. The method of claim 12, wherein said aberrant TDP-43 activity comprises mis-splicing or mis-processing of one or more downstream target genes of TDP-43, mislocalisation of TDP-43 and / or aggregation of TDP-43.

14. The antisense oligonucleotide of any of claims 10 to 13 further comprising one or more modifications to prevent cellular degradation, to provide greater stability and / or to improve solubility.

15. A composition comprising the antisense oligonucleotide of any of claims 10 to 14.

16. The composition of claim 15, wherein said composition is a pharmaceutical composition.

17. The composition of claims 15 to 16 further comprising one or more pharmaceutically acceptable excipients, diluents and / or carriers.

8. The antisense oligonucleotide of any of claims 10 to 14 or the composition of any of claims15 to 17 for use in the treatment or prevention of:(i) diseases or conditions with TDP-43 pathology;(ii) TDP-43 proteinopathies;(iii) Neurodegenerative diseases;(iv) Motor neurone disease;(v) Amyotrophic Lateral Sclerosis (ALS);(vi) frontotemporal dementia (FTD);(vii) Alzheimer’s disease;(viii) primary lateral sclerosis;(ix) progressive muscular atrophy;(x) facial onset sensory and motor neuronopathy;(xi) limbic-predominant age-related TDP-43 encephalopathy;(xii) cerebral age-related TDP-43 with sclerosis;(xiii) inclusion body myopathy;(xiv) Perry disease; or(xv) Parkinson’s disease.

19. ATG4B and / or RANBP1 or a functional fragment thereof, for use in medicine or for use as a medicament.

20. An ATG4B and / or RANBP1 transcript for use in medicine or for use as a medicament.

21. A nucleic acid encoding ATG4B and / or RANBP1 or a functional fragment thereof, for use in medicine or for use as a medicament.

22. ATG4B or a functional fragment thereof, RANBP1 or a functional fragment thereof, an ATG4B transcript, an RANBP1 transcript, a nucleic acid encoding ATG4B or a functional fragment thereof or a nucleic acid encoding RANBP1 or a functional fragment thereof, for use in treating or preventing:(i) diseases or conditions with TDP-43 pathology;(ii) TDP-43 proteinopathies;(iii) Neurodegenerative diseases;(iv) Motor neurone disease;(v) Amyotrophic Lateral Sclerosis (ALS);(vi) frontotemporal dementia (FTD);(vii) Alzheimer’s disease;(viii) primary lateral sclerosis;(ix) progressive muscular atrophy;(x) facial onset sensory and motor neuronopathy;(xi) limbic-predominant age-related TDP-43 encephalopathy;(xii) cerebral age-related TDP-43 with sclerosis;(xiii) inclusion body myopathy;(xiv) Perry disease; or(xv) Parkinson’s disease.

23. A vector comprising, or capable of expressing, an antisense oligonucleotide according to claim 10.

24. The vector of claim 22, for use in medicine or for use as a medicament.

25. The vector of claim 22, for use in treating or preventing:(i) diseases or conditions with TDP-43 pathology;(ii) TDP-43 proteinopathies;(iii) Neurodegenerative diseases;(iv) Motor neurone disease;(v) Amyotrophic Lateral Sclerosis (ALS);(vi) frontotemporal dementia (FTD);(vii) Alzheimer’s disease;(viii) primary lateral sclerosis;(ix) progressive muscular atrophy;(x) facial onset sensory and motor neuronopathy;(xi) limbic-predominant age-related TDP-43 encephalopathy;(xii) cerebral age-related TDP-43 with sclerosis;(xiii) inclusion body myopathy;(xiv) Perry disease; or(xv) Parkinson’s disease.