Antisense oligomer treatment for bone loss

Abstract

An isolated or purified antisense oligomer and combinations and cocktails for modifying pre- mRNA splicing or mRNA translation in the SOST gene transcript or part thereof to induce downregulation of the production of functional SOST protein.

Description

Antisense oligomer treatment for bone lossTECHNICAL FIELD

[0001] The present disclosure relates to antisense oligomers for downregulating the expression of functional SOST proteins. The disclosure further provides compositions comprising such antisense oligomers and methods of using the same for the treatment of bone diseases such as osteoporosis.BACKGROUND ART

[0002] Osteoporosis, which is characterized by bone loss, is one of the most common disorders affecting ageing population. Given the role of sclerostin in inhibiting bone formation, an antibody against sclerostin named romosozumab (AMG 785, Amgen) has been approved by the U.S. FDA in April 2019 for the treatment of osteoporosis. Although its clinical outcome showed promising efficacy, adverse effects (including increased cardiovascular and cerebrovascular events) have been commonly reported. In addition, the production and purification of antibodies is expensive, which leads to the high cost for monthly injection associated with the use of romosozumab.

[0003] Sclerostin, encoded by SOST gene, is a protein mainly produced in bone. As an endogenous inhibitor of canonical Wnt signalling which plays a role in maintaining bone homeostasis, increasing sclerostin contributes to the pathogenesis of various skeletal diseases, such as bone loss.

[0004] There is a need for novel methods to modulate and regulate SOST production; or at least the provision of methods to compliment the previously known methods. The present disclosure seeks to provide an improved or alternative method to modulate and regulate functional SOST protein production, through manipulation of the expression of SOST.

[0005] The previous discussion of the background art is intended to facilitate an understanding of the present disclosure only. The discussion is not an acknowledgement or admission that any of the material referred to is or was part of the common general knowledge as at the priority date of the application.SUMMARY OF INVENTION

[0006] Broadly, according to one aspect of the disclosure, there is provided an isolated or purified antisense oligomer (ASO) for modifying pre-mRNA splicing or mRNA translation in the SOST gene to induce downregulation of the production of functional SOST protein.

[0007] Optionally, there is provided an isolated or purified antisense oligomer for inducing the production of proteins with retained introns or partial introns, the production of truncated proteins,the production of proteins lacking functional regions, or a reduction in the total amount of protein produced.

[0008] Optionally, the antisense oligomer is a phosphorodiamidate morpholino oligomer (PMO) or a 2'-O-methyl phosphorothioate oligomer (2'-OMePS).

[0009] Optionally, the antisense oligomer is selected from the group comprising the sequences set forth in Table 1. Optionally, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1 -11. In one example, the antisense oligomer used in the present disclosure is SEQ ID NO: 3-7.

[0010] The disclosure extends, according to a still further aspect thereof, to cDNA or cloned copies of the antisense oligomer sequences of the disclosure, as well as to vectors containing the antisense oligomer sequences of the disclosure. The disclosure extends further also to cells containing such sequences and / or vectors.

[0011] There is also provided a method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: providing one or more of the antisense oligomers as described herein and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional SOST protein.

[0012] There is also provided a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of dysregulation of SOST in a subject, the composition comprising: one or more antisense oligomers as described herein; and one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional SOST protein.

[0013] Optionally, the bone disease is associated with bone loss in the subject. Optionally, the bone disease is chosen from: osteoporosis, postmenopausal osteoporosis, osteogenesis imperfecta and bone loss associated with cancer.

[0014] The subject with bone disease may be a mammal, including a human.

[0015] There is also provided a method to treat, prevent or ameliorate the effects of bone disease in a subject, comprising the step of: administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers as described hereinto induce downregulation of the production of functional SOST protein.

[0016] There is also provided the use of purified and isolated antisense oligomers as described herein, for the manufacture of a medicament to treat, prevent or ameliorate the effects of bone disease in a subject.

[0017] There is also provided a kit to treat, prevent or ameliorate the effects of bone disease in a subject, which kit comprises at least an antisense oligomer as described herein and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Further features of the present disclosure are more fully described in the following description of several non-limiting embodiments thereof. This description is included solely for the purposes of exemplifying the present disclosure. It should not be understood as a restriction on the broad summary, disclosure or description of the disclosure as set out above. The description will be made with reference to the accompanying drawings in which:Figure 1 shows the characterization of SOST gene and its gene expression in Saos2 cell line. Fig 1 A: SOST expression in Saos 2 cells by Real-time polymerase chain reaction (RT-PCR). Fig 1 B: Sequence of mut1 -SOST in human patients (DOI: 10.1086 / 31881 1 ). Fig 1 C: DNA sequence of SOST gene in Saos2 cell line.Figure 2 shows the downregulation of SOST gene expression by ASOs (SEQ ID NO: 1 -11 ) in a dose-dependent manner. Fig 2A: A DNA gel showed that SOST-ASOs (SEQ ID NO: 1 and 3) can greatly reduce the gene expression of SOST, as shown by RT-PCR. Fig 2B: Intensity of SOST and ACTS bands were quantified by image J and presented by Graphpad. Relative SOST expression of each sample was compared by normalizing with ACTS expression. Fig 2C: NC: transfection reagent.Figure 3 shows that 75-80% transfection efficiency can be achieved by Neon NxT electroporation at 25, 50 and 100 pM.Figure 4 shows downregulation of SOST gene expression by 2’-OMePS modified ASOs (SEQ ID NO: 1 -1 1 ) in a dose-dependent manner (0.2-20pM). A DNA gel showed that SEQ ID NO: 1 and 3), but not SEQ ID NO: 2 can greatly reduce the gene expression of SOST, as shown by RT- PCR. ACTB: beta actin housekeeping gene, C: cell alone with transfection reagent, SC: standard control oligo, Scr: scramble ASO.Figure 5 shows reduced SOST protein levels secreted by Saos2 cells after transfection of PMO- modified ASOs (SEQ ID NO: 1 and 3). Fig 5A: Ponceau R staining of protein gel showed protein integrity in each sample. Fig 5B: Reduction of SOST protein in cells transfected with ASOs (SEQID NO: 1 and 3) in a dose dependent manner. Fig 5C: cell alone with transfection reagent, SC standard control oligo, Scr: scramble ASO.Figure 6 shows reduced SOST gene expression levels after transfection of ASOs at 5pM. SEQ ID NOs: 3, 4, 6 and 7 showed the highest downregulation of SOSTby RT-PCR.Figure 7 shows the Sanger sequencing analysis of the upper band in the DNA gel shown in figure 4. Exon 1 , retained intronic sequence and exon 2 are labelled by underlines of orange and blue colours. The result showed that retention of part of intron 1 ( grey underline) occurred after the treatment of SOST-ASO.Figure 8 shows the in vitro functional analysis of SOST-ASO on human osteoblast cells Saos2 under osteoblastic differentiation medium at concentration of 0, 1 and 10pM. 8a. Timeline demonstrating the treatment of SOST-ASO (transfection), and osteoblastic differentiation and osteogenesis analysis at different timepoints. 8b, 8c. Alizarin red S staining (ARS) and quantification of Saos2 cells during osteoblastic differentiation. The results showed enhanced ARS which represented higher bone mineralisation (a major procedure of bone formation) following ASO administration. 8d. Alkaline phosphatase (ALP) analysis showed increasing ALP production following ASO administration, indicating enhanced bone formation. 8e. Expression of osteogenic marker genes (Osteocalcin OCN, Osteoprotegerin OPG and Runt-related transcription factor 2 RUNX2) was higher in ASO treated group than control group at different time points in a dose-dependent manner measured by RT-PCR.DESCRIPTION OF INVENTIONDetailed Description of the Invention

[0019] As a promising alternative for the treatment of osteoporosis, SOST -ASOs may overcome the concerns related with romosozumab usage. The production cost for oligonucleotides is a lot cheaper than antibody production. Moreover, through combination with bone specific delivery systems, antisense oligonucleotides can specially target SOST transcripts in bone, raising the possibility of not affecting SOST involvement in cardiovascular and cerebrovascular systems.

[0020] So far there are no agents targeting the intracellular mRNA encoding SOST. Previously, there have been attempts to generate effective ASOs against SOST (PhD Thesis 2014; M Moester “Orchestration of bone remodeling” Universiteit Leiden); however, in these studies no downregulation of the SOST gene was observed in any ASOs when compared to the nontransfected controls.

[0021] Some progress has been made in developing SOST-aptamers to target the sclerostin loop 3 region, which is involved in bone formation. However, aptamer specificity remains unknown due to sequence variations in human Ioop3, and possible post-translational modifications that mayintervene in SOST-aptamer binding. In addition, unbound aptamer is easily cleared by renal clearance. Compared with monoclonal antibody and aptamer technology, SOST-ASOs can not only inhibit bone-derived sclerostin production, but also has the advantage of higher stability after delivery into human body.

[0022] It is known that a mutation (mut1 -SOST A+3T) at the donor splicing site of SOST can cause a splicing shift by using the cryptic site donor located 214bp downstream of the authentic site, leading to partial intron retention which further leads to premature in-frame non-sense codon (DOI: 10.1086 / 31881 1 ). Conversely, a mutation near the splicing acceptor site (mut2-SOST A+2692C) uses the same splice donor and acceptor site, leading to expression of mRNA remaining unaffected.Antisense Oligomers

[0023] The present disclosure has found that targeting the SOST (mut1 ) region to cause intron retention (instead of exon skipping as ASOs are more commonly used for), results in efficient and sustained splicing modification and protein isoform expression of the SOST protein.

[0024] The present disclosure provides the ASOs in Table 1 for regulating the expression of functional SOST transcript or / and SOST protein. Particularly preferred sequences are SEQ ID NOs: 3-7, which showed greatest reduction of SOST expression.Table 1 : Antisense oligomers of the present disclosure for downregulation of functional SOST transcript and SOST protein (bold letters - exon, non-bold letters - intron, italics - SOST (mut1 ) region)Down Regulation

[0025] Down regulation of the protein of the present disclosure may be achieved by:i. induced intron retention (leading to the production of extended, nonsense or prematurely terminated proteins, such as proteins with pre-mature stop codons); ii. translational blocking; iii. inducing exon-skipping (via the increased the production of extended, truncated, nonsense or prematurely terminated proteins, such as proteins with pre-mature stop codons); and / or iv. down regulation of the expression of the gene through RNase-H dependent cleavage of the target mRNA.

[0026] Any of these techniques leads to a reduction in production of functional target proteins.

[0027] Down regulation may be achieved by retention of part or all of an intron in the RNA, leading to production of a protein with additional amino acids. The additional sequence may lead to generation of a premature termination codon, nonsense sequence (coding for a different let of amino acids that are not normally present in the SOST protein), non-functional SOST protein, or other protein modification that results in non-functional SOST protein.

[0028] Down regulation may also be achieved by inducing exon skipping such that the mature protein lacks a transmembrane domain, thus converting the membrane form of the protein to a soluble form of the protein. This strategy may result in the soluble form of the protein forming a decoy receptor.

[0029] The present disclosure may not affect the overall expression of the target protein, for example by blocking or removing all RNA transcripts. Rather, it may seek to increase the production of extended, truncated, nonsense or prematurely terminated proteins. The overall production of target protein RNA molecules may not change significantly (although some change may occur). Optionally, the extended, truncated, nonsense or prematurely terminated proteins are lacking one or more functional domains involved in the activity of the target protein.

[0030] The presence of internally truncated proteins (i.e. proteins lacking the amino acids encoded by one or more exons) is preferable. If the target protein is knocked out, there may be problems with elevation of target protein RNA transcription as the body tries to compensate for the reduction in the total amount of target protein. In contrast, the presence of an internally truncated protein (which may be lacking one or more of the features of the complete target protein), should be sufficient to prevent elevated transcription, but still provide a therapeutic advantage due to a reduction in the total amount of functional target protein.

[0031] The antisense oligomer induced exon skipping of the present disclosure need not completely or even substantially ablate the function of the target protein. Optionally, the intron retention process results in a reduced or compromised functionality of the target protein.

[0032] Optionally, the antisense oligomers cover splicing sites in the SOST transcript. The target site may also include some flanking sequences around the splicing sites. Optionally, the target site is covering the SOST (mut1 ) region.

[0033] The antisense oligomers may also or alternatively bind to the polyadenylation site. The target site may also be near, but not overlapping the polyadenylation site, i.e. it may instead cover sequences upstream or downstream of the polyadenylation site and in these instances the antisense oligomer may not specifically cover the polyadenylation site. Localisation to near the polyadenylation site may be sufficient to disrupt the ability of cleavage factors to bind the polyadenylation site.

[0034] According to a first aspect of the disclosure, there is provided antisense oligomers capable of binding to a selected target on a target protein gene transcript to modify pre-mRNA splicing in a target protein gene transcript or part thereof.

[0035] For example, in one aspect of the disclosure, there is provided an antisense oligomer of 10 to 50 nucleotides comprising a targeting sequence complementary to a region near or within the splicing sites and / or the polyadenylation site of the target protein pre-mRNA.

[0036] Alternatively, the present disclosure may induce increased degradation of RNA via recruitment of RNase H, wherein the RNase H preferentially binds and degrades RNA bound in duplex to the DNA of the target protein gene. RNase-H recognises the DNA-RNA heteroduplex generated between mRNA and genomic DNA and cleaves the RNA strand. Antisense oligomers designed to serve as substrates for RNase-H are inhibitors of the intermediary metabolism of pre- and spliced mRNAs.

[0037] The terms "antisense oligomer" and "antisense compound" and "antisense oligonucleotide" “AON” and “ASO” are used interchangeably and refer to a sequence of cyclic subunits, each bearing a base-pairing moiety, linked by inter-subunit linkages that allow the basepairing moieties to hybridize to a target sequence in a nucleic acid (typically an RNA) by Watson- Crick base pairing, to form a nucleic acid:oligomer heteroduplex within the target sequence. The cyclic subunits are based on ribose or another pentose sugar or, in a preferred embodiment, a morpholino group (see description of morpholino oligomers below). The oligomer may have exact or near sequence complementarity to the target sequence; variations in sequence near the termini of an oligomer are generally preferable to variations in the interior. The terms “pre-RNA” and “pre- mRNA” are used interchangeably.

[0038] By “isolated” is meant material that is substantially or essentially free from components that normally accompany it in its native state. For example, an “isolated polynucleotide” or “isolated oligonucleotide,” as used herein, may refer to a polynucleotide that has been purified or removed from the sequences that flank it in a naturally occurring state, e.g., a DNA fragment thatis removed from the sequences that are adjacent to the fragment in the genome. The term “isolating” as it relates to cells refers to the purification of cells (e.g., fibroblasts, lymphoblasts) from a source subject (e.g., a subject with bone disease). In the context of mRNA or protein, “isolating” refers to the recovery of mRNA or protein from a source, e.g., cells.

[0039] An antisense oligomer can be said to be “directed to” or “targeted against” a target sequence with which it hybridizes. In certain embodiments, the target sequence includes a region including splicing sites and / or the polyadenylation site and surrounding regions. The target sequence is typically a region including an AUG start codon of an mRNA, a Translation Suppressing Oligomer, or splice site of a pre-processed mRNA, a Splice Suppressing Oligomer (SSO). The target sequence for a splice site may include an mRNA sequence having its 5' end 1 to about 25 base pairs downstream of a normal splice acceptor junction in a pre-processed mRNA. A preferred target sequence is any region of a pre-processed mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site. An oligomer is more generally said to be "targeted against" a biologically relevant target, such as a protein, virus, or bacteria, when it is targeted against the nucleic acid of the target in the manner described above.

[0040] As used herein, "sufficient length" refers to an antisense oligonucleotide that is complementary to at least 8, more typically 8-30, contiguous nucleobases in a target protein pre- mRNA. In some embodiments, an antisense of sufficient length includes at least 8, 9, 10, 1 1 , 12, 13, 14, or 15 contiguous nucleobases in the target protein pre-mRNA. In other embodiments an antisense of sufficient length includes at least 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 contiguous nucleobases in the target protein pre-mRNA. An antisense oligonucleotide of sufficient length has at least a minimal number of nucleotides to be capable of specifically hybridizing to exon 2. Optionally, an oligonucleotide of sufficient length is from about 10 to about 50 nucleotides in length, including oligonucleotides of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39 and 40 or more nucleotides. In one embodiment, an oligonucleotide of sufficient length is from 10 to about 30 nucleotides in length. In another embodiment, an oligonucleotide of sufficient length is from 15 to about 25 nucleotides in length. In yet another embodiment, an oligonucleotide of sufficient length is from 20 to 30, or 20 to 50, nucleotides in length. In yet another embodiment, an oligonucleotide of sufficient length is from 22 to 28, 25 to 28, 24 to 29 or 25 to 30 nucleotides in length.

[0041] In certain embodiments, the antisense oligomer has sufficient sequence complementarity to a target RNA (i.e., the RNA for which splicing factor binding site selection is modulated) to block a region of a target RNA (e.g., pre-mRNA) in an effective manner. In exemplary embodiments, such blocking of target protein pre-mRNA serves to modulate or modify splicing, either by masking a binding site for a native protein that would otherwise modulate splicing and / or by altering thestructure of the targeted RNA. In some embodiments, the target RNA is target pre-mRNA (e.g., target protein gene pre-mRNA).

[0042] An antisense oligomer having a sufficient sequence complementarity to a target RNA sequence to modulate splicing factor binding of the target RNA means that the antisense oligomer has a sequence sufficient to trigger the masking of a binding site for a native protein that would otherwise cause truncation of the target protein and / or alters the three-dimensional structure of the targeted RNA.

[0043] Selected antisense oligomers can be made shorter, e.g., about 12 bases, or longer, e.g., about 50 bases, and include a small number of mismatches, as long as the sequence is sufficiently complementary to effect splicing factor binding modulation upon hybridization to the target sequence, and optionally forms with the RNA antisense oligomer heteroduplex having a Tm of 45°C or greater.

[0044] Optionally, the antisense oligomer is selected from the group comprising the sequences set forth in Table 1. Optionally, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1 -11. Optionally, the antisense oligomer induced manipulation of protein expression of the present disclosure results in downregulation of the production of functional SOST protein.

[0045] In certain embodiments, the degree of complementarity between the target sequence and antisense oligomer is sufficient to form a stable duplex. The region of complementarity of the antisense oligomers with the target RNA sequence may be as short as 8-1 1 bases, but can be 12-15 bases or more, e.g., 10-50 bases, 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20 bases, including all integers in between these ranges. An antisense oligomer of about 16-17 bases is generally long enough to have a unique complementary sequence. In certain embodiments, a minimum length of complementary bases may be required to achieve the requisite binding Tm, as discussed herein.

[0046] In certain embodiments, oligonucleotides as long as 50 bases may be suitable, where at least a minimum number of bases, e.g., 10-12 bases, are complementary to the target sequence. In general, however, facilitated or active uptake in cells is optimized at oligonucleotide lengths of less than about 30 bases. For phosphorodiamidate morpholino oligomer (PMO) antisense oligomers described further herein, an optimum balance of binding stability and uptake generally occurs at lengths of 18-25 bases. Included are antisense oligomers (e.g., PMOs, PMO-X, PNAs, LNAs, 2’-OMe) that consist of about 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases.

[0047] In certain embodiments, antisense oligomers may be 100% complementary to the target sequence, or may include mismatches, e.g., to accommodate variants, as long as a heteroduplexformed between the antisense oligomer and target sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation which may occur in vivo. Hence, certain oligonucleotides may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity, between the oligonucleotide and the target sequence.

[0048] Mismatches, if present, are typically less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the antisense oligomer, the percentage of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability. Although such an antisense oligomer is not necessarily 100% complementary to the target sequence, it is effective to stably and specifically bind to the target sequence, such that splicing of the target pre- mRNA is modulated.

[0049] The stability of the duplex formed between an antisense oligomer and a target sequence is a function of the binding Tm and the susceptibility of the duplex to cellular enzymatic cleavage. The Tm of an oligonucleotide with respect to complementary-sequence RNA may be measured by conventional methods, such as those described by Hames et aL, Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108 or as described in Miyada C. G. and Wallace R. B., 1987, Oligonucleotide Hybridization Techniques, Methods Enzymol. Vol. 154 pp. 94-107. In certain embodiments, antisense oligomers may have a binding Tm, with respect to a complementary- sequence RNA, of greater than body temperature and optionally greater than about 45°C or 50°C. Tm’s in the range 60-80°C or greater are also included.

[0050] Additional examples of variants include antisense oligomers having about or at least about 70% sequence identity or homology, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology, over the entire length of any of SEQ ID NOs: 1 -11.

[0051] More specifically, there is provided an antisense oligomer capable of binding to a selected target site to modulate or modify splicing in a target protein gene transcript or part thereof. The antisense oligomer may be selected from those provided in Table 1. Optionally, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1 -1 1.

[0052] The antisense oligomer induced splicing factor blockage of the present disclosure need not completely or even substantially reduce the amount of target protein produced.

[0053] The length of an antisense oligomer may vary, as long as it is capable of binding selectively to the intended location within the pre-mRNA molecule. The length of such sequencescan be determined in accordance with selection procedures described herein. Generally, the antisense oligomer will be from about 10 nucleotides in length, up to about 50 nucleotides in length. It will be appreciated, however, that any length of nucleotides within this range may be used in the method. Optionally, the length of the antisense oligomer is between 10 and 40, 10 and 35, 15 to 30 nucleotides in length or 20 to 30 nucleotides in length, for example about 25 to 30 nucleotides in length. For example, the oligomer may be 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0054] As used herein, an “antisense oligomer”, “AON” or “ASO” refers to a linear sequence of nucleotides, or nucleotide analogues, that allows the nucleobase to hybridize to a target sequence in an RNA by Watson-Crick base pairing, to form an oligonucleotide:RNA heteroduplex within the target sequence. The cyclic subunits may be based on ribose or another pentose sugar or, in certain embodiments, a morpholino group (see description of morpholino oligonucleotides below). Also contemplated are phosphoramidate or phosphorodiamidate morpholino oligomer (PMO); PMO-X; PPMO; thiophosphoramidate morpholinos (TMO); peptide nucleic acid (PNA); a locked nucleic acid (LNA) and derivatives including alpha-L-LNA, 2’-amino LNA, 4’-methyl LNA and 4’- O-methyl LNA; ethylene bridged nucleic acids (ENA) and their derivatives; phosphorothioate oligomer; tricyclo-DNA oligomer (tcDNA); tricyclophosphorothioate oligomer; 2’0-Methyl-modified oligomer (2’-OMe); 2’-O-methoxy ethyl (2’-MOE); 2'-O-methyl phosphorothioate oligomer (2'- OMePS); 2’-fluoro, 2’-fluroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2’-amino (2’-NH2); 2’-O-ethyleneamine or any combination of the foregoing as mixmers or as gapmers, among other antisense agents known in the art.

[0055] In some embodiments, the antisense oligonucleotides have the chemical composition of a naturally occurring nucleic acid molecule, i.e., the antisense oligonucleotides do not include a modified or substituted base, sugar, or inter-subunit linkage.

[0056] In a preferred embodiment, the antisense oligonucleotides of the present disclosure are non-naturally occurring nucleic acid molecules, or “oligonucleotide analogues”. For example, non- naturally occurring nucleic acids can include one or more non-natural base, sugar, and / or intersubunit linkage, e.g., a base, sugar, and / or linkage that has been modified or substituted with respect to that found in a naturally occurring nucleic acid molecule. Exemplary modifications are described below. In some embodiments, non-naturally occurring nucleic acids include more than one type of modification, e.g. sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications. For example, in some embodiments, the antisense oligonucleotides contain a non-natural (e.g. modified or substituted) base. In some embodiments, the antisense oligonucleotides contain a non-natural (e.g. modified or substituted) sugar. In some embodiments, the antisense oligonucleotides contain a non-natural(e.g. modified or substituted) inter-subunit linkage. In some embodiments, the antisense oligonucleotides contain more than one type of modification or substitution, e.g. a non-natural base and / or a non- natural sugar, and / or a non-natural inter-subunit linkage.

[0057] The present disclosure includes non-naturally-occurring antisense oligomers having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in naturally-occurring oligo- and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Oligonucleotide analogues support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analogue backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the oligonucleotide analogue molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). Preferred analogues are those having a substantially uncharged, phosphorus containing backbone.

[0058] One method for producing antisense oligomers is the methylation of the 2' hydroxyribose position and the incorporation of a phosphorothioate backbone produces molecules that superficially resemble RNA but that are much more resistant to nuclease degradation, although persons skilled in the art of the disclosure will be aware of other forms of suitable backbones that may be useable in the objectives of the disclosure.

[0059] To avoid degradation of pre-RNA during duplex formation with the antisense oligomers, the antisense oligomers used in the method may be adapted to minimise or prevent cleavage by endogenous RNase H. Antisense molecules that do not activate RNase H can be made in accordance with known techniques (see, e.g., U.S. Pat. No. 5,149,797). Such antisense molecules, which may be deoxyribonucleotide or ribonucleotide sequences, simply contain any structural modification which sterically hinders or prevents binding of RNase H to a duplex molecule containing the oligonucleotide as one member thereof, which structural modification does not substantially hinder or disrupt duplex formation. Because the portions of the oligonucleotide involved in duplex formation are substantially different from those portions involved in RNase H binding thereto, numerous antisense molecules that do not activate RNase H are available. This property is highly preferred, as the treatment of the RNA with the unmethylated oligomers, either intracellular or in crude extracts that contain RNase H, leads to degradation of the pre-mRNA:antisense oligomer duplexes. Any form of modified antisense oligomers that is capable of by-passing or not inducing such degradation may be used in the present method. The nuclease resistance may be achieved by modifying the antisense oligomers of the disclosure so that it comprises partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.

[0060] An example of antisense oligomers which when duplexed with RNA are not cleaved by cellular RNase H is 2'-O-methyl derivatives. Such 2'-0-methyl-oligoribonucleotides are stable in a cellular environment and in animal tissues, and their duplexes with RNA have higher Tm values than their ribo- or deoxyribo- counterparts. Alternatively, the nuclease resistant antisense oligomers of the disclosure may have at least one of the last 3'-terminus nucleotides fluoridated. Still alternatively, the nuclease resistant antisense oligomers of the disclosure have phosphorothioate bonds linking between at least two of the last 3-terminus nucleotide bases, for example having phosphorothioate bonds linking between the last four 3'-terminal nucleotide bases.

[0061] Modified or modulated RNA splicing may also be achieved with alternative oligonucleotide chemistry (see, e.g., U.S. Pat. No. 5,149,797). For example, the antisense oligomer may be chosen from the list comprising: phosphoramidate or phosphorodiamidate morpholinos (PMO); protein-phosphoramidate or protein-phosphorodiamidate morpholinos (PPMO); thiophosphoramidate morpholinos (TMO); peptide nucleic acid (PNA); locked nucleic acids (LNA) and derivatives including alpha-L-LNA, 2’-amino LNA, 4’-methyl LNA and 4’-O-methyl LNA; ethylene bridged nucleic acids (ENA) and their derivatives; phosphorothioates; tricyclo-DNAs (tcDNA); tricyclophosphorothioates; 2’0-Methyl-modified (2’-OMe); 2’-O-methoxy ethyl (2’-MOE); 2’-fluoro, 2’-fluroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2’-amino (2’-NH2); 2’-O-ethyleneamine oligomers or any combination of the foregoing oligomers as mixmers or as gapmers.

[0062] To further improve the delivery efficacy, the abovementioned modified nucleotides may be conjugated with fatty acids / lipids / cholesterol, amino acids, carbohydrates / polysaccharides, nanoparticles etc. to the sugar or nucleobase moieties. These conjugated nucleotide derivatives can also be used to construct antisense oligomers to modify cleavage factor binding. Antisense oligomer-induced splicing factor binding modification of the target protein gene transcripts have generally used either oligoribonucleotides, PNAs, 2’OMe or MOE modified bases on a phosphorothioate backbone. Although 2’OMe ASOs are used for oligo design, due to their efficient uptake in vitro when delivered as cationic lipoplexes, these compounds are susceptible to nuclease degradation and are not considered ideal for in vivo or clinical applications. When alternative chemistries are used to generate the antisense oligomers of the present disclosure, the uracil (U) of the sequences provided herein may be replaced by a thymine (T).

[0063] For example, such antisense molecules may be oligonucleotides wherein at least one, or all, of the inter-nucleotide bridging phosphate residues are modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphor amidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such antisensemolecules are molecules wherein at least one, or all, of the nucleotides contain a 2' lower alkyl moiety (e.g., Ci-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1 -propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

[0064] Specific examples of antisense oligonucleotides useful in this disclosure include oligonucleotides containing modified backbones or non-natural inter-subunit linkages.

[0065] Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in their inter-nucleoside backbone can also be considered to be oligonucleosides.

[0066] In other antisense oligomers, both the sugar and the inter-nucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleo-bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0067] Modified antisense oligomers may also contain one or more substituted sugar moieties. Antisense oligomers may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. Antisense oligomers containing a modified or substituted base include nucleic acid sequences in which one or more purine or pyrimidine bases most commonly found in nucleic acids are replaced with less common or non-natural bases.

[0068] Purine bases comprise a pyrimidine ring fused to an imidazole ring; adenine and guanine are the two purine nucleobases most commonly found in nucleic acids. These may be substituted with other naturally-occurring purines, including but not limited to Ne-methyladenine, N2- methylguanine, hypoxanthine, and 7-methylguanine.

[0069] Pyrimidine bases comprise a six-membered pyrimidine ring; cytosine, uracil, and thymine are the pyrimidine bases most commonly found in nucleic acids. These may be substituted with other naturally-occurring pyrimidines, including but not limited to 5-methylcytosine, 5- hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the oligonucleotides described herein contain thymine bases in place of uracil.

[0070] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8- aza- 7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4- ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2- aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1 ,2- dideoxyribose, 1 -deoxy-2-0-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent 6,683, 173 (Epoch Biosciences). cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011 , 133, 9200). Pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N- glycoside as in uridine. Pseudouridine -containing synthetic mRNA may have an improved safety profile compared to uridine-containing mPvNA (see WO 2009127230).

[0071] Certain modified or substituted nucleobases are particularly useful for increasing the binding affinity of the antisense oligonucleotides of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.

[0072] In some embodiments, modified or substituted nucleobases are useful for facilitating purification of antisense oligonucleotides. For example, in certain embodiments, antisense oligonucleotides may contain three or more (e.g., 3, 4, 5, 6 or more) consecutive guanine bases. In certain antisense oligonucleotides, a string of three or more consecutive guanine bases can result in aggregation of the oligonucleotides, complicating purification. In such antisense oligonucleotides, one or more of the consecutive guanines can be substituted with inosine. The substitution of inosine for one or more guanines in a string of three or more consecutive guanine bases can reduce aggregation of the antisense oligonucleotide, thereby facilitating purification.

[0073] In one embodiment, another modification of the antisense oligonucleotides involves chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyls’ tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

[0074] In another non-limiting example, such antisense oligomers are molecules wherein at least one, or all, of the nucleotides contain a 2’ lower alkyl moiety (such as, for example, C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1 -propenyl, 2- propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

[0075] While the antisense oligomers described above are a preferred form of the antisense oligomers of the present disclosure, the present disclosure includes other oligomeric antisense molecules, including but not limited to oligomer mimetics such as are described below.

[0076] Another preferred chemistry is the phosphorodiamidate morpholino oligomer (PMO) oligomeric compounds, which are not degraded by any known nuclease or protease. These compounds are uncharged, do not activate RNase H activity when bound to a RNA strand and have been shown to exert sustained cleavage factor binding modulation after in vivo administration (Summerton and Weller, Antisense Nucleic Acid Drug Development, 7, 187-197).

[0077] Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include 5-substituted pyrimidines, 6- azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. In one embodiment, at least one pyrimidine base of the oligonucleotide comprises a 5-substituted pyrimidine base, wherein the pyrimidine base is selected from the group consisting of cytosine, thymine and uracil. In one embodiment, the 5- substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the oligonucleotide comprises an N-2, N-6 substituted purine base. In one embodiment, the N- 2, N-6 substituted purine base is 2, 6-diaminopurine.

[0078] In one embodiment, the antisense oligonucleotide includes one or more 5-methylcytosine substitutions alone or in combination with another modification, such as 2'-0-methoxyethyl sugar modifications. In yet another embodiment, the antisense oligonucleotide includes one or more 2, 6-diaminopurine substitutions alone or in combination with another modification.

[0079] In some embodiments, the antisense oligonucleotide is chemically linked to one or more moieties, such as a polyethylene glycol moiety, or conjugates, such as an arginine-rich cell penetrating peptide that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide. In one exemplary embodiment, the arginine-rich polypeptide is covalently coupled at its N-terminal or C-terminal residue to the 3' or 5' end of the antisensecompound. Also in an exemplary embodiment, the antisense compound is composed of morpholino subunits and phosphorus-containing inter-subunit linkages joining a morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit.

[0080] Another modification of the oligomers of the disclosure involves chemically linking to the oligomer one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligomer. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl- rac-glycerol or triethylammonium 1 ,2-di-0-hexadecyl-rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, myristyl, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

[0081] Intranuclear oligomer delivery is a major challenge for antisense oligomers. Cell penetrating peptides (CPP) have been added to antisense oligomers, including phosphorodiamidate morpholino oligomers, to enhance cellular uptake and nuclear localization. The terms CPP or “a peptide moiety which enhances cellular uptake” are used interchangeably and refer to cationic cell penetrating peptides, also called “transport peptides”, “carrier peptides”, or “peptide transduction domains”. Different peptide tags have been shown to influence efficiency of uptake and target tissue specificity, as shown in Jearawiriyapaisarn et al. (2008), Mol. Ther. 16 9, 1624-1629. The terms "cell penetrating peptide" and "CPP" are used interchangeably and refer to cationic cell penetrating peptides, also called transport peptides, carrier peptides, or peptide transduction domains. The peptides, as shown herein, have the capability of inducing cell penetration within 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration.

[0082] The CPPs used in the present disclosure may have the capability to induce cell penetration within about or at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. CPPs are well-known in the art and are disclosed, for example in US 20100016215, which is incorporated by reference in its entirety.

[0083] The present disclosure therefore provides antisense oligomers of the present disclosure in combination with cell-penetrating peptides for manufacturing therapeutic pharmaceutical compositions.

[0084] It is not necessary for all positions in a given antisense oligomer to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated at a single nucleoside within an oligomer.

[0085] The present disclosure also includes antisense oligomers that are chimeric compounds. "Chimeric" antisense oligomers or "chimeras," in the context of this disclosure, are antisense oligomers which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligomer compound. These oligomers typically contain at least one region wherein the oligomer is modified so as to confer upon the oligomer or antisense oligomer increased resistance to nuclease degradation, increased cellular uptake, and an additional region for increased binding affinity for the target nucleic acid.

[0086] Designing antisense oligomers to completely mask mutation sites, splicing sites and / or the polyadenylation site may not be necessary to generate a change in the proportion of extended, nonsense or prematurely terminated proteins. Furthermore, the inventors have discovered that size or length of the antisense oligomer itself is not always a primary factor when designing antisense oligomers. With some targets, antisense oligomers as short as 20 bases were able to induce cleavage modification, in certain cases more efficiently than other longer (eg 25 bases) oligomers directed to the same region.

[0087] More specifically, the antisense oligomer may be selected from those set forth in Table 1 . The sequences may be selected from the group consisting of any one or more of any one or more of SEQ ID NOs: 1 -1 1 , and combinations or cocktails thereof. This includes sequences which can hybridise to such sequences under stringent hybridisation conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof which possess or modulate RNA processing activity in a target protein gene transcript.

[0088] The antisense oligomer and the DNA, cDNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridisable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or pairing such that stable and specific binding occurs between the oligomer and the DNA, cDNA or RNA target. It is understood in the art that the sequence of an antisense oligomer need not be 100% complementary to that of its target sequence to be specifically hybridisable. An antisense oligomer is specifically hybridisable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA product, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligomer to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.

[0089] Selective hybridisation may be under low, moderate or high stringency conditions, but is preferably under high stringency. Those skilled in the art will recognise that the stringency ofhybridisation will be affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands and the number of nucleotide base mismatches between the hybridising nucleic acids. Stringent temperature conditions will generally include temperatures in excess of 30eC, typically in excess of 37eC, for example in excess of 45eC, or at least 50°C, and typically 60°C-80°C or higher. Stringent salt conditions will ordinarily be less than 1000 mM, typically less than 500 mM, for example less than 200 mM. However, the combination of parameters is much more important than the measure of any single parameter. An example of stringent hybridisation conditions is 65eC and 0.1 x SSC (1 x SSC = 0.15 M NaCI, 0.015 M sodium citrate pH 7.0). Thus, the antisense oligomers of the present disclosure may include oligomers that selectively hybridise to the sequences, SEQ ID NOs: 1 -11 provided in Table 1.

[0090] At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Such hybridization may occur with “near” or “substantial” complementarity of the antisense oligomer to the target sequence, as well as with exact complementarity.

[0091] Typically, selective hybridisation will occur when there is at least about 55% identity over a stretch of at least about 14 nucleotides, for example at least about 65%, at least about 75% or at least about 90%, 95%, 98% or 99% identity with the nucleotides of the antisense oligomer. The length of homology comparison, as described, may be over longer stretches and in certain embodiments will often be over a stretch of at least about nine nucleotides, usually at least about 12 nucleotides, more usually at least about 20, often at least about 21 , 22, 23 or 24 nucleotides, at least about 25, 26, 27 or 28 nucleotides, at least about 29, 30, 31 or 32 nucleotides, at least about 36 or more nucleotides.

[0092] Thus, the antisense oligomer sequences of the disclosure may have at least 75%, at least 85%, or at least 86, 87, 88, 89 or 90% homology to the sequences shown in the sequence listings herein. For example, there may be at least 91 , 92, 93 94, or 95%, or at least 96, 97, 98% or 99%, homology. Generally, the shorter the length of the antisense oligomer, the greater the homology required to obtain selective hybridisation. Consequently, where an antisense oligomer of the disclosure consists of less than about 30 nucleotides, it is preferred that the percentage identity is greater than 75%, or greater than 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95%, 96, 97, 98% or 99% compared with the antisense oligomers set out in the sequence listings herein. Nucleotide homology comparisons may be conducted by sequence comparison programs such as the GCG Wisconsin Bestfit program or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0093] The antisense oligomer of the present disclosure may have regions of reduced homology, and regions of exact homology with the target sequence. It is not necessary for an oligomer to have exact homology for its entire length. For example, the oligomer may have continuous stretches of at least 4 or 5 bases that are identical to the target sequence, for example continuous stretches of at least 6 or 7 bases that are identical to the target sequence, or continuous stretches of at least 8 or 9 bases that are identical to the target sequence. The oligomer may have stretches of at least 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or 26 bases that are identical to the target sequence. The remaining stretches of oligomer sequence may be intermittently identical with the target sequence; for example, the remaining sequence may have an identical base, followed by a non-identical base, followed by an identical base. Alternatively (or as well) the oligomer sequence may have several stretches of identical sequence (for example 3, 4, 5 or 6 bases) interspersed with stretches of less than perfect homology. Such sequence mismatches will preferably have no or very little loss of cleavage modifying activity.

[0094] In another aspect, the disclosure provides expression vectors that incorporate the antisense oligonucleotides described above, e.g., the antisense oligonucleotides of SEQ ID NOs: 1 -1 1 . In some embodiments, the expression vector is a modified retrovirus or non-retroviral vector, such as an adeno-associated viral vector.

[0095] Bone specific delivery of SOST-ASO can be used to achieve decreased expression of SOST in bone without affecting the normal production of sclerostin in other organ systems. To specifically deliver the ASOs to bone tissue, a number of delivery methods including bisphosphonates, (ASP)8 / (Asp)6 oligopeptides, (AspSerSer)6 oligopeptides or CH6 aptamers can be used. The bisphosphonates, (ASP)8 / (Asp)6 oligopeptides, (AspSerSer)6 oligopeptides and CH6 aptamers can be physically or chemically associated with the ASOs and administered to achieve bone specific delivery of SOST-ASO, resulting in decreased expression of SOST in bone.Method of Use

[0096] The disclosure further provides a method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: providing one or more of the antisense oligomers as described herein and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional SOST protein.

[0097] According to yet another aspect of the disclosure, there is provided a splicing factor binding modification target nucleic acid sequence for the target protein gene comprising the DNA equivalents of the nucleic acid sequences selected from the group consisting of SEQ ID NO: 1 - 1 1 , and sequences complementary thereto. Optionally, the antisense oligomer inducedmanipulation of protein expression of the present disclosure results in the retention of one or more introns or partial introns to increase the production of extended, nonsense or prematurely terminated proteins.

[0098] The term “modulate” or “modulates” includes to “increase” or “decrease” one or more quantifiable parameters, optionally by a defined and / or statistically significant amount. The terms “increase” or “increasing,” “enhance” or “enhancing,” or “stimulate” or “stimulating” refer generally to the ability of one or antisense oligomers or compositions to produce or cause a greater physiological response (i.e., downstream effects) in a cell or a subject relative to the response caused by either no antisense oligomer or a control compound.

[0099] By "enhance" or "enhancing," or "increase" or "increasing," or "stimulate" or "stimulating," refers generally to the ability of one or nucleic acid sequences or compositions to produce or cause a greater physiological response (i.e., downstream effects) in a cell or a subject, as compared to the response caused by either no nucleic acid sequence transfer or a control compound. A measurable physiological response may include increased expression of a functional form of a target protein, among other responses apparent from the understanding in the art and the description herein. An "increased" or "enhanced" amount is typically a "statistically significant" amount, and may include an increase that is 1.1 , 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) or a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% increase (including all integers and decimal points in between) in the amount produced by no nucleic acid sequence transfer (the absence of an agent) or a control compound.

[0100] The terms “decreasing” or “decrease” refer generally to the ability of one or more nucleic acid sequences or compositions to produce or cause a reduced physiological response (i.e., downstream effects) in a cell or a subject relative to the response caused by either no nucleic acid sequence or a control compound. The term "reduce" or "inhibit" may relate generally to the ability of one or more nucleic acid sequences of the disclosure to "decrease" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic art. Relevant physiological or cellular responses ( / n vivo or in vitro) will be apparent to persons skilled in the art, and may include reductions in the symptoms or pathology of malignant disease. A "decrease" in a response may be statistically significant as compared to the response produced by no nucleic acid sequence transfer or a control composition, and may include a decrease that is 1 .1 , 1 .2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) or a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease (includingall integers and decimal points in between) in the amount produced by no nucleic acid sequence transfer (the absence of an agent) or a control compound.

[0101] The activity of antisense oligomers and variants thereof can be assayed according to routine techniques in the art. For example, isoform forms and expression levels of surveyed RNAs and proteins may be assessed by any of a wide variety of well-known methods for detecting isoforms and / or expression of a transcribed nucleic acid or protein. Non-limiting examples of such methods include RT-PCR of isoforms of RNA followed by size separation of PCR products, nucleic acid hybridization methods e.g., Northern blots and / or use of nucleic acid arrays; fluorescent in situ hybridization to detect RNA transcripts inside cells; nucleic acid amplification methods; immunological methods for detection of proteins; protein purification methods; and protein function or activity assays.

[0102] RNA expression levels can be assessed by preparing RNA / cDNA (i.e., a transcribed polynucleotide) from a cell, tissue or organism, and by hybridizing the RNA / cDNA with a reference polynucleotide, which is a complement of the assayed nucleic acid, or a fragment thereof. cDNA can, optionally, be amplified using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; in one embodiment it is not amplified. Expression of one or more transcripts can also be detected using quantitative PCR to assess the level of expression of the transcript(s).

[0103] The present disclosure provides antisense oligomer modified splicing of the target protein gene transcript, clinically relevant oligomer chemistries and delivery systems to direct reduction of full-length target protein gene transcript to therapeutic levels. Substantial changes in the amount of target protein RNA are achieved by: a) oligomer refinement in vitro using cell lines, through experimental assessment of (i) modification of splicing factor binding target motifs, (ii) antisense oligomer length and development of oligomer cocktails, (iii) choice of chemistry, and (iv) the addition of cellpenetrating peptides (CPP) to enhance oligomer delivery; and b) detailed evaluation of a novel approach to decrease target protein gene transcripts.

[0104] As such, it is demonstrated herein that processing of target protein RNA can be manipulated with specific antisense oligomers. In this way functionally significant decreases in the amount of the target protein can be obtained, thereby reducing the pathology of bone disease.

[0105] The antisense oligomers used in accordance with this disclosure may be conveniently made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesising oligomers on a modified solid support is described in U.S. Pat. No. 4,458,066.

[0106] Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligomers such as the phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl- phosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et aL, (1981 ) Tetrahedron Letters, 22:1859-1862.

[0107] The antisense oligomers of the disclosure are synthesised in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense oligomers. The molecules of the disclosure may also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and / or absorption.

[0108] Also included are vector delivery systems that are capable of expressing the oligomeric, targeting sequences of the present disclosure, such as vectors that express a polynucleotide sequence comprising any one or more of SEQ ID NOs: 1 -1 1 , as described herein. By "vector" or "nucleic acid construct" is meant a polynucleotide molecule, for example a DNA molecule derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector may contain one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector can be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector can contain any means for assuring self-replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.Method of Treatment

[0109] The antisense oligomers of the present disclosure also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of treatment of a bone disease. Accordingly, in one embodiment the present disclosure provides antisense oligomers that bind to a selected target in the target protein RNA to modify splicing of the RNA as described herein, in a therapeutically effective amount, admixed with a pharmaceutically acceptable carrier, diluent, or excipient.[001 10] An "effective amount" or "therapeutically effective amount" refers to an amount of therapeutic compound, such as an antisense oligomer, administered to a mammalian subject,either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect.[001 11 ] The disclosure therefore provides a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of bone disease in a subject, the composition comprising: i) one or more antisense oligomers as described herein, and ii) one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional SOST protein.[001 12] Optionally, the antisense oligomer used in the present disclosure is chosen from SEQ ID NO: 1 -11.[001 13] Optionally, the antisense oligomer induced manipulation of protein expression of the present disclosure results in the downregulation of the production of functional SOST protein.[001 14] Optionally, the bone disease is associated with bone loss. Optionally, the bone disease is chosen from: osteoporosis, postmenopausal osteoporosis, osteogenesis imperfecta and bone loss associated with cancer.[001 15] The composition may comprise about 1 nM to 1000 nM of each of the desired antisense oligomer(s) of the disclosure. Optionally, the composition may comprise about 1 nM to 500 nM, 10 nM to 500 nM, 50 nM to 750 nM, 10 nM to 500 nM, 1 nM to 100 nM, 1 nM to 50 nM, 1 nM to 40 nM, 1 nM to 30 nM, 1 nM to 20 nM, for example between 1 nM and 10 nM of each of the antisense oligomer(s) of the disclosure.[001 16] The composition may comprise about 1 nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 550nm, 600nm, 650nm, 700nm, 750nm, 800nm, 850nm, 900nm, 950nm or 1000nm of each of the desired antisense oligomer(s) of the disclosure.[001 17] The present disclosure further provides one or more antisense oligomers adapted to aid in the prophylactic or therapeutic treatment, prevention or amelioration of symptoms of bone disease in a form suitable for delivery to a subject.[001 18] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to a subject. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybeanoil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions may be employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).Pharmaceutical Compositions[001 19] In a form of the disclosure there are provided pharmaceutical compositions comprising therapeutically effective amounts of one or more antisense oligomers of the disclosure together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such compositions include diluents of various buffer content (e.g. Tris- HCI, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g. Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g. Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, for example, Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435- 1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as a lyophilised form.

[0120] It will be appreciated that pharmaceutical compositions provided according to the present disclosure may be administered by any means known in the art. Optionally, the pharmaceutical compositions for administration are administered by injection, orally, topically or by the pulmonary or nasal route. The antisense oligomers may be delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous routes of administration. The appropriate route may be determined by one of skill in the art, as appropriate to the condition of the subject under treatment. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are some non-limiting sites where the antisense oligomer may be introduced. Direct CNS delivery may be employed, for instance, intracerebral ventricular or intrathecal administration may be used as routes of administration.

[0121] As the present ASOs are used for the treatment of bone disease, an injectable, nasal delivery or oral delivery route is preferred.

[0122] The antisense oligomers described herein may also be delivered via an implantable device. Design of such a device is an art-recognized process, with, e.g., synthetic implant design described in, e.g., U.S. Pat. No. 6,969,400.

[0123] Nasal delivery may be a preferred choice as actives delivered via this route move quickly into the blood. Furthermore, nasally delivered actives are not subject to first pass metabolism. Formulations for nasal administration include those in which the oligomers of the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). For nasal or other administration, oligomers of the disclosure may be encapsulated within liposomes or may form complexes thereto, to cationic liposomes. Alternatively, oligomers may be complexed to lipids, to cationic lipids. Fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860 and / or U.S. patent application Ser. No. 09 / 315,298 filed on May 20, 1999.

[0124] For ease of delivery and subject compliance, orally delivered compositions may be preferred. Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavouring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Oral formulations are those in which oligomers of the disclosure are administered in conjunction with one or more penetration enhancers surfactants and chelators. Surfactants include fatty acids and / or esters or salts thereof, bile acids and / or salts thereof. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860. In some embodiments, the present disclosure provides combinations of penetration enhancers, for example, fatty acids / salts in combination with bile acids / salts. An exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligomers of the disclosure may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligomer complexing agents and their uses are further described in U.S. Pat. No. 6,287,860. Oral formulations for oligomers and their preparation are described in detail in US 6,887,906 and / or US 20030027780.

[0125] Delivery by injection may be a preferred choice as actives delivered via this route do not undergo first pass metabolism. Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0126] The delivery of a therapeutically useful amount of antisense oligomers may be achieved by methods previously published. For example, intracellular delivery of the antisenseoligomer may be via a composition comprising an admixture of the antisense oligomer and an effective amount of a block copolymer. An example of this method is described in US patent application US20040248833. Other methods of delivery of antisense oligomers to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98(1 ) 42-47, and in Gebski et al. (2003) Human Molecular Genetics, 12(15): 1801 -181 1. A method for introducing a nucleic acid molecule into a cell by way of an expression vector either as naked DNA or complexed to lipid carriers, is described in US 6,806,084.

[0127] It may be desirable to deliver the antisense oligomer in a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes or liposome formulations. These colloidal dispersion systems can be used in the manufacture of therapeutic pharmaceutical compositions.

[0128] Liposomes are artificial membrane vesicles, which are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic, or neutral charge characteristics and have useful characteristics for in vitro, in vivo and ex vivo delivery methods. It has been shown that large unilamellar vesicles can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci. 6:77, 1981).

[0129] In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1 ) encapsulation of the antisense oligomer of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988). The composition of the liposome is usually a combination of phospholipids, particularly high phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

[0130] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specializedlipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. 6,287,860.

[0131] Antisense oligomers can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymeric particles and viral and non-viral vectors as well as other means known in the art). The method of delivery selected will depend at least on the cells to be treated and the location of the cells and will be apparent to the skilled artisan. For instance, localization can be achieved by liposomes with specific markers on the surface to direct the liposome, direct injection into tissue containing target cells, specific receptor-mediated uptake, or the like.

[0132] As known in the art, antisense oligomers may be delivered using, for example, methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non- endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-0 permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).

[0133] The antisense oligomer may also be combined with other pharmaceutically acceptable carriers or diluents to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral, or transdermal administration.

[0134] The routes of administration described are intended only as a guide since a skilled practitioner will be able to readily determine the optimum route of administration and any dosage for any particular subject animal (including humans) and condition.

[0135] Multiple approaches for introducing functional new genetic material into cells, both in vitro and in vivo have been attempted (Friedmann (1989) Science, 244:1275-1280). These approaches include integration of the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991 ) Cancer Research 51 (18), suppL: 5074S-5079S); integration into non-retrovirus vectors (Rosenfeld, et al. (1992) Cell, 68:143-155; Rosenfeld, et al. (1991) Science, 252:431 -434); or delivery of a transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989), supra; Brigham, et al. (1989) Am. J. Med. Sci., 298:278-281 ; Nabel, et al. (1990) Science, 249:1285-1288; Hazinski, et al. (1991 ) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84:7851 -7855);coupled to ligand-specific, cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263:14621 -14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra); Wolff et al. (1990) Science, 247:1465-1468). The Brigham et al. group (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991 ) 39 (abstract)) have reported in vivo transfection only of lungs of mice following either intravenous or intratracheal administration of a DNA liposome complex. An example of a review article of human gene therapy procedures is: Anderson, Science (1992) 256:808-813; Barteau et al. (2008), Curr Gene Ther; 8(5):313-23; Mueller et al. (2008). Clin Rev Allergy Immunol; 35(3):164-78; Li et al. (2006) Gene Ther., 13(18):1313-9; Simoes et al. (2005) Expert Opin Drug Deliv; 2(2):237-54.

[0136] The antisense oligomers of the disclosure encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, as an example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the disclosure, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

[0137] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the disclosure: i.e. salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligomers, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and mucous membranes, as well as rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligomers with at least one 2'-0-methoxyethyl modification are believed to be particularly useful for oral administration. Optionally, the antisense oligomer is delivered via the subcutaneous or intravenous route.

[0138] The pharmaceutical formulations of the present disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.Administration

[0139] The antisense oligomer may be administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, in some cases the oligomer is administered intermittently over a longer period of time. Administration may be followed by, or concurrent with, administration of an antibiotic or other therapeutic treatment. The treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment.

[0140] Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the subject. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosages may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered in maintenance doses, once or more daily, to once every 20 years.

[0141] An effective in vivo treatment regimen using the antisense oligomers of the disclosure may vary according to the duration, dose, frequency and route of administration, as well as the condition of the subject under treatment (i.e., prophylactic administration versus administration in response to localized or systemic infection). Accordingly, such in vivo therapy will often require monitoring by tests appropriate to the particular type of disorder under treatment, and corresponding adjustments in the dose or treatment regimen, in order to achieve an optimal therapeutic outcome.

[0142] Treatment may be monitored, e.g., by general indicators of disease known in the art. As used herein, “treatment” of a subject (e.g. a mammal, such as a human) or a cell is any type of intervention used in an attempt to alter the natural course of the individual or cell. T reatment includes, but is not limited to, administration of a pharmaceutical composition, and may be performed either prophylactically or subsequent to the initiation of a pathologic event or contact with an etiologic agent. Treatment includes any desirable effect on the symptoms or pathology of bone disease, and may include, for example, minimal changes or improvements in one or more measurable markers of the bone disease being treated. Also included are “prophylactic” treatments, which can be directed to reducing the rate of progression of the bone disease being treated, delaying the onset of the bone disease, or reducing the severity of its onset. “Treatment” or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.

[0143] A "subject," as used herein, includes any animal that exhibits a symptom, or is at risk for exhibiting a symptom, which can be treated with an antisense compound of the disclosure, or any of the symptoms associated with the condition (e.g. bone disease). Suitable subjects include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals, and domestic animals or pets (such as a cat or dog). Non-human primates, such as human subjects, are included.

[0144] The efficacy of an in vivo administered antisense oligomers of the disclosure may be determined from biological samples (tissue, blood, urine etc.) taken from a subject prior to, during and subsequent to administration of the antisense oligomer. Assays of such samples include (1 ) monitoring the presence or absence of heteroduplex formation with target and nontarget sequences, using procedures known to those skilled in the art, e.g., an electrophoretic gel mobility assay; (2) monitoring the amount of a mutant RNA in relation to a reference normal RNA or protein as determined by standard techniques such as RT-PCR, Northern blotting, ELISA or Western blotting.

[0145] According to a still further aspect of the disclosure, there is provided one or more antisense oligomers as described herein for use in an antisense oligomer-based therapy. Optionally, the therapy is for bone disease.

[0146] More specifically, the antisense oligomer may be selected from the group consisting of any one or more of SEQ ID NOs: 1 -11 , and combinations or cocktails thereof. This includes sequences which can hybridise to such sequences under stringent hybridisation conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof which possess or modulate pre-RNA processing activity in a target protein gene transcript.

[0147] Optionally, the antisense oligomer induced manipulation of protein expression of the present disclosure results in downregulation of the production of functional SOST protein.

[0148] The disclosure extends also to a combination of two or more antisense oligomers capable of binding to a selected target to modify splicing of a target protein gene transcript. The combination may be a cocktail of two or more antisense oligomers, a construct comprising two or more or two or more antisense oligomers joined together for use in an antisense oligomer-based therapy.

[0149] The disclosure provides a method to treat, prevent or ameliorate the effects of bone disease, comprising the step of: administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers as described herein to induce downregulation of the production of functional SOST protein.

[0150] The therapy may be used to develop non-functional, extended, truncated or nonsense target proteins, or to reduce target protein expression. The decrease in levels of target protein may be achieved by decreasing the amount of normal native SOST RNA through intron retention.

[0151] Alternatively, the present disclosure may induce increased degradation of RNA via recruitment of RNase H, wherein the RNase H preferentially binds and degrades RNA bound in duplex to the DNA of the target protein gene.

[0152] The reduction in target protein may lead to a reduction in the quantity, duration or severity of the symptoms of bone disease.

[0153] According to another aspect of the disclosure there is provided the use of one or more antisense oligomers as described herein in the manufacture of a medicament for the modulation or control of bone disease.

[0154] The disclosure also provides for the use of purified and isolated antisense oligomers as described herein, for the manufacture of a medicament for treatment of bone disease.

[0155] There is provided the use of purified and isolated antisense oligomers as described herein for the manufacture of a medicament to treat, prevent or ameliorate the effects of bone disease.

[0156] Optionally, the antisense oligomer used in the present disclosure is chosen from SEQ ID NO: 1-11.

[0157] Optionally, the antisense oligomer induced manipulation of protein expression of the present disclosure results in downregulation of the production of functional SOST protein.

[0158] The disclosure extends, according to a still further aspect thereof, to cDNA or cloned copies of the antisense oligomer sequences of the disclosure, as well as to vectors containing the antisense oligomer sequences of the disclosure. The disclosure extends further also to cells containing such sequences and / or vectors.

[0159] The disclosure also provides kits to treat, prevent or ameliorate bone disease in a subject, which kit comprises at least an isolated or purified antisense oligomer for modifying pre-mRNA splicing or mRNA translation in a target protein gene transcript or part thereof, packaged in a suitable container, together with instructions for its use.

[0160] In a preferred embodiment, the kits will contain at least one antisense oligomer as described herein or as shown in Table 1 or SEQ ID NOs: 1 -1 1 , or a cocktail of the same, as described herein. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

[0161] There is therefore provided a kit to treat, prevent or ameliorate bone disease in a subject, which kit comprises at least an antisense oligomer described herein as SEQ ID NOs: 1 - 1 1 , the antisense oligomers of Table 1 and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.

[0162] There is also provided a kit to treat, prevent or ameliorate bone disease in a subject which kit comprises at least an antisense oligomer selected from the group consisting of any one or more of SEQ ID NOs: 1 -1 1 , and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.

[0163] The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. The kit can additionally contain a suitable solvent for reconstitution of the lyophilized components. Individual components of the kit may be packaged in separate containers. Irrespective of the number or type of containers, the kits of the disclosure also may comprise, or be packaged with, an instrument for assisting with the injection / administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.

[0164] Notices in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, may be provided in the kit, such notices reflecting approval by the agency of manufacture, use or sale for human administration.

[0165] When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an affected area of the animal, such as the skin, injected into an animal, or even applied to and mixed with the other components of the kit.

[0166] The antisense oligomers of the present disclosure may also be used in conjunction with alternative therapies, such as drug therapies.

[0167] The present disclosure therefore provides a method of treating, preventing or ameliorating the effects of bone disease, wherein the antisense oligomers of the present disclosure and administered sequentially or concurrently with another alternative therapy associated with treating, preventing or ameliorating bone disease.

[0168] The alternative therapy may be chosen from the list comprising: bisphosphonates (alendronate, risedronate, ibandronate, zoledronic acid); denosumab; romosozumab; teriparatide and abaloparatide; raloxifene; calcitonin; calcium supplementation; dietary modifications; regular weight bearing exercise.General

[0169] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variation and modifications. The invention also includes all of the steps, features, formulations and compounds referred to or indicated in the specification, individually or collectively and any and all combinations or any two or more of the steps or features.

[0170] Each document, reference, patent application or patent cited in this text is expressly incorporated herein in their entirety by reference, which means that it should be read and considered by the reader as part of this text. That the document, reference, patent application or patent cited in this text is not repeated in this text is merely for reasons of conciseness.

[0171] Any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.

[0172] The present invention is not to be limited in scope by any of the specific embodiments described herein. These embodiments are intended for the purpose ofexemplification only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention as described herein.

[0173] The invention described herein may include one or more range of values (eg. Size, displacement and field strength etc). A range of values will be understood to include all values within the range, including the values defining the range, and values adjacent to the range which lead to the same or substantially the same outcome as the values immediately adjacent to that value which defines the boundary to the range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. Hence “about 80 %” means “about 80 %” and also “80 %”. At the very least, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.

[0174] Throughout this specification, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. It is also noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of’ and “consists essentially of’ have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0175] Other definitions for selected terms used herein may be found within the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the invention belongs. The term “active agent” may mean one active agent, or may encompass two or more active agents.

[0176] The following examples serve to more fully describe the manner of using the abovedescribed invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention. It is understood that these methods in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes.EXAMPLES

[0177] Further features of the present invention are more fully described in the following nonlimiting Examples. This description is included solely for the purposes of exemplifying the present invention. It should not be understood as a restriction on the broad description of the invention as set out above.Example 1Design and synthesis of antisense oligonucleotides

[0178] Eleven ASOs targeting the SOST (mut1 ) region transcript were designed and synthesised as shown in Table 1 . The ASOs were ordered from commercial suppliers.Characterization of SOST gene and gene expression in Saos2 cell line

[0179] To test the efficiency of ASOs (Table 1 ), a bone-related cell line expressing SOST is desired. RNA and DNA were extracted from Saos2 (human osteoblastic cell) cell line by PureLink RNA Mini Kit (ThermoFisher) and Genomic DNA Kit Mini (QIAGEN).

[0180] SOSTis expressed in Saos2 (human osteoblastic) cell line, but not in neuronal cell line, as determined by RT-PCR using SOST and ACTB primers (Figure 1A):SOST Forward primer GTGCTACTGGAAGGTGGCGT [SEQ ID NO: 12]SOST Reverse primer ACCAGCTCGGTGACCGGCTT [SEQ ID NO: 13]ACTB Forward primer AGAGCTACGAGCTGCCTGAC [SEQ ID NO: 14]ACTB Reverse primer AGCACTGTGTTGGCGTACAG [SEQ ID NO: 15]

[0181] Mut1 -SOST (A+3T) marks the human mutation at position +3 with change from A to T near the exon / intron junction shown by the bracket (Figure 1 B) in human patient (DOI: 10.1086 / 31881 1 ). As any mutation near the mut1 region may affect the assay on ASO efficiency, we further sequenced the region of SOST gene by DNA sequencing and showed that no mutation was found at the mut1 -SOST region in SOST gene in Saos2 cell line (Figure 1 C).Downregulation of SOST by ASOs with 2'OMe chemistry in a dose-dependent manner

[0182] We tested ASOs (SEQ ID NO: 1-3) in Saos2 cells using 2'OMe chemistry (SynGenis, Australia) (Table 2) by transfecting ASOs at different concentrations (25 nM, 50 nM, 100 nM, 200 nM and 400 nM) into the Saos2 cell line using Oligofectamine (ThermoFisher). After 24 hours of transfection, RNA was extracted from the transfected cells and analysed by RT-PCR using the SOST and ACTB primers. We found downregulation of SOSTby all ASOs (SEQ ID NO: 1 -3) in a dose-dependent manner (Figure 2A and 2B).Table 2: ASOs (SEQ ID NO: 1 -3) in DNA sequence and converted ASO sequence in 2'OMe chemistry (bold letters - exon, non-bold letters - intron, italics - SOST (mut1 ) region)Downregulation of SOST by ASOs with PMO chemistry in dose-dependent manner

[0183] The transfection efficiency of ASOs was tested using a negative control PMO- modified oligo with 3’ fluorescein (CCTCTTACCTCAGTTACAATTTATA [SEQ ID NO: 16], Gene Tools) at 25pM, 50 pM and 100 pM by Neon NxT electroporation (ThermoFisher) (Pulse voltage 1200V, Pulse Width 40ms and Pulse number 1 ) and found that 75-80% of transfection efficiency can be achieved (Figure 3).

[0184] ASOs (SEQ ID NO: 1 -3) as phosphorodiamidate morpholino oligomers (PMO, Gene Tools) (Table 1 ) were tested in Saos2 cells by Neon NxT Electroporation. The RNA was extracted from the transfected cells and analyzed by RT-PCR using the SOST and ACTB primers. A dramatic downregulation of SOST gene expression in Saos2 cell lines in a dose dependent manner was detected by RT-PCR after transfection of ASOs SEQ ID NO: 1 and 3 (Figure 4).

[0185] ELISA results (Human SOST / Sclerostin Quantikine ELISA Kit, R&D SYSTEMS #DSST00) also showed the reduction of SOST in culture medium after transfection of ASOs (SEQ ID NO: 1 and 3) in a dose dependent manner (Figure 5).Micro-walking ASOs with PMO chemistry in dose-dependent manner

[0186] To fine map the region most susceptible for PMO steric blockage, we designed more ASOs in PMO chemistry by micro-walking between ASO SEQ ID NO: 2 and 3 (Table 1 ) and tested in Saos2 cell line. The RNA was extracted from the transfected cells and analyzed by RT- PCR using the SOST and ACTB primers.

[0187] SEQ ID NOs: 3, 4, 6, 7 showed highest downregulation of SOST at 5pM (Figure 6). They are microwalked (Table 1 ), highlighting that the overlapping region among these ASOs is the most susceptible to PMO steric hindrance. Furthermore, the switching of the usage of splicing site to the cryptic donor site is evidenced by the presence of additional upper DNA bands (marked by the upper black arrow in Figure 6). This shift will result in a frameshift non-sense mutation (DOI: 10.1086 / 318811 ).Example 2Sequencing data supports the intron retention after treatment of SOST-ASO

[0188] The results of Sanger sequencing of the upper band (Figure 4) demonstrated the retained intronic part between exon 1 and exon 2 after SOST-ASO treatment (Figure 7). This abnormal splicing event leads to the nonsense expression of SOST gene and decreasing sclerostin production confirmed by enzyme-linked immunosorbent assay.Example 3In vitro functional Analysis of SOST-ASO on osteogenesis

[0189] To test the effects of SOST-ASO (NO. 13) on osteogenesis, the ASO was transfected into human osteoblast cells Saos2 under osteoblastic differentiation condition at concentration of 0, 1 , 10 pM (Figure 8a). The results showed that SOST-ASO was able to enhance osteogenesis activity and osteogenic marker genes expression in a dosage dependent manner. Alizarin red S staining intensity was greatly increased at D3 and D7 after treatment of SOST-ASO (No.13) at 1 and 10 pM (Figures 8b and 8c). Consistently, the activity of alkaline phosphase, an enzyme critical for bone formation, was higher after treatment of SOST-ASO (No.13) at 1 and 10 pM (Figure 8d). In addition, the expression of osteogenic marker genes (Osteocalcin OCN, Osteoprotegerin OPG and Runt-related transcription factor 2 RUNX2) was elevated after treatment of SOST-ASO (No.13) at 1 and 10 pM by quantitative polymerase chain reaction (Figure 8e). All of these results supported that administration of SOST-ASO can facilitate bone formation of human osteoblasts in culture dish.

Claims

CLAIMS1 . An isolated or purified antisense oligomer and combinations and cocktails for modifying pre- mRNA splicing or mRNA translation in the SOST gene transcript or part thereof to induce downregulation of the production of functional SOST protein.

2. The antisense oligomer of claim 1 for inducing the production of truncated proteins, the production of proteins lacking functional regions or a reduction in the total amount of protein produced.

3. The antisense oligomer of claim 1 that is a phosphorodiamidate morpholino oligomer (PMO) or a 2'-O-methyl phosphorothioate oligomer (2'-OMePS).

4. The antisense oligomer of claim 1 that is selected from the group comprising: i) the sequences set forth in Table 1 ; or ii) SEQ ID NO: 1 -11.

5. A cDNA copy of the antisense oligomer sequences of claim 1 .

6. A vector containing the antisense oligomer sequences of claim 1 or cDNA of claim 5.

7. Cells containing the antisense oligomer sequences of claim 1 , the cDNA of claim 5 or the vector of claim 6.

8. A method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: a) providing one or more of the antisense oligomers of claim 1 and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional SOST protein.

9. A pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of dysregulation of leptin in a subject, the composition comprising: a) one or more antisense oligomers of claim 1 ; and b) one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional SOST protein.

10. The method of claim 8 or composition of claim 9 wherein the bone disease is associated with bone loss in the subject.11 . The method of claim 8 or composition of claim 9 wherein the bone disease is chosen from: osteoporosis, postmenopausal osteoporosis, osteogenesis imperfecta and bone loss associated with cancer.

12. A method to treat, prevent or ameliorate the effects of bone disease in a subject, comprising the step of: a) administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers of claim 1 to induce downregulation of the production of functional SOST protein.

13. The use of purified and isolated antisense oligomers of claim 1 , for the manufacture of a medicament to treat, prevent or ameliorate the effects of bone disease in a subject.

14. A kit to treat, prevent or ameliorate the effects of bone disease in a subject, which kit comprises at least an antisense oligomer of claim 1 , packaged in a suitable container, together with instructions for its use.

Images