Metabolites for trna modification
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIVERSITY OF CHICAGO
- Filing Date
- 2024-07-11
- Publication Date
- 2026-05-20
AI Technical Summary
The effect of pre-queuosine 1 (preQi) on mammalian cellular function, particularly its impact on tRNA abundance and cell proliferation, has not been fully explored, and existing methods do not effectively address its role in cancer treatment or cellular regulation.
Administering preQi to patients to reduce cell proliferation, including cancer cell growth, by modulating tRNA levels and translation, with queuine serving as a counteracting agent to restore proliferation when necessary, and incorporating preQi into tRNA through the QTRT1/QTRT2 enzyme complex.
PreQi effectively reduces tRNA levels and translation, particularly of ribosomal proteins, thereby inhibiting cell proliferation, and its effects can be reversed by queuine, demonstrating a therapeutic potential in cancer treatment and cellular regulation.
Smart Images

Figure IMGF000030_0001 
Figure 00000062_0000 
Figure 00000062_0001
Abstract
Description
METABOLITES FOR TRNA MODIFICATIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority ofEuropean Application No. 23306191.0, filed July 11, 2023, which is hereby incorporated by reference in its entirety.BACKGROUND OF THE INVENTION
[0002] This invention was made with government support under RM1HGOO8935 and R33CA272357 awarded by the National Institute of Health. The government has certain rights in the invention.I. Field of the Invention
[0003] This invention relates to the field of microbiology, cell biology, and medicine.IL Background
[0004] Among the ~40 modifications in mammalian tRNAs, queuosine (Q) is unique in that its installation requires an extracellular metabolite from the gut microbiome or diet. Queuosine is a 7-deaza-derivatived nucleoside in bacterial tRNA that is produced de novo by microbes using GTP in an eight-step biosynthesis pathway (Fergus et al., 2015). The nucleobase of queuosine is called queuine, a catabolic product from bacterial Q-modified tRNA (Hung et al., 2023; Patel et al., 2022; Sarid et al., 2022; Yuan et al., 2019). Queuine is taken up by mammalian cells and is the substrate of a mammalian genome encoded enzyme complex composed of QTRT1 and QTRT2 (aka QTRTD1) proteins that produce Q-tRNA modification in mammalian cells (Boland et al., 2009a; Fergus et al., 2015; Hegedusova et al., 2019; Kessler et al., 2018). Q modification occurs in the wobble anticodon position of tRNAs that read codons of Tyr / His / Asn / Asp (position 34 in the tRNA nomenclature), whereas the corresponding unmodified tRNAs contain G34 (Harada and Nishimura, 1972; Nishimura, 1983). tRNA anticodon loop modifications can influence translation speed and fidelity (Smith et al., 2022; Blanchet et al., 2018). Codons of the amino acids read by Q-modified tRNAs have the consensus sequence of NAY where N is A / C / G / U and Y is C / U. Therefore, the Q-nucleotide in tRNA directly pairs with U or C in the third codon position and alters the decoding efficiency and fidelity in a codon dependent manner. For decoding efficiency, the unmodified G34-tRNA prefers the C-ending codons, whereas the Q34-tRNA reads the C and U-ending codons more equally (Meier et al., 1985). Q-modification in tRNA can also affect decoding speed andaccuracy (Kulkami et al., 2021; Muller et al., 2019; Tuorto et al., 2018; Zaborske et al., 2014). Q-modification also reduces tRNA fragment (tRF) biogenesis through enhancing additional anticodon loop modifications (Muller et al., 2015; Schaefer et al., 2010) or inhibition of angiogenin cleavage (Wang et al., 2018).
[0005] An intermediate product of the biosynthesis pathway of Q-modified tRNA in bacteria is pre-queuosine 1 (preQi, FIG. 1A). In bacteria, preQi is the substrate of the modification enzyme tRNA-guanine transglycosylase (Zgt) that incorporates preQi into the cognate tRNATyr / Hls / Asn / Asp. The preQi -tRNA is further modified to Q-modified tRNA by additional enzymes. In contrast to queuine biogenesis which requires the catabolism of the Q- modified tRNA (Fergus et al., 2015; Hung et al., 2023; Patel et al., 2022; Sarid et al., 2022; Yuan et al., 2019), preQi is constantly present in a bacterial cell, and could become readily available upon bacterial turnover in the gut or elsewhere. In the test tube, preQi can also be incorporated into the cognate tRNAs by the same human enzyme, QTRT1 / QTRT2 (Bessler et al., 2022; Fergus et al., 2021). Even though two available metabolites from the same bacterial metabolic pathway are long known, however, the effect of preQi on mammalian cell biology and the associated molecular mechanism has not been explored.SUMMARY OF THE INVENTION
[0006] In general, the current disclosure relates to the discovery that pre-queuosine 1 (preQi) can affect mammalian cellular function, including affecting proliferation of the mammalian cell. Aspects herein further show that preQ 1 can affect tRNA abundance, including the abundance of tRNAs in which queuine is incorporated, such as tRNAs with tyrosine, histidine, asparagine, or aspartic acid cognate amino acids.
[0007] Disclosed herein are methods of treating a patient, including a cancer patient; methods of treating cancer in a patient; methods of reducing, preventing, or treating neoplasms in a patient; and methods of inhibiting cell growth, including cancer cell growth, in a patient. Any of the methods can comprise 1, 2, 3, 4, 5 or more of any of the following steps: administering an effective amount of preQi to the patient, administering an effective amount of a therapeutic composition comprising preQi to the patient, administering to the patient an additional therapeutic intervention to the patient, monitoring the patient for symptoms, measuring levels of biomarkers in the patient.
[0008] The effective amount of the preQi may produce a concentration sufficient to elicit a biological response, such as a reduction of cell proliferation. The effective amount of thetherapeutic composition comprising preQi may produce a concentration sufficient to elicit a biological response, such as a reduction of cell proliferation. The effective amount can produce a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136,137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174,175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193,194, 195, 196, 197, 198, 199, 200, or any range derivable therein, nM or pM of preQi in the patient. The concentration may be a blood concentration, a plasma concentration, a concentration in a tumor microenvironment, and / or cellular concentration. The cellular concentration may include a concentration present in a tumor cell. The tumor microenvironment can include tumor cells, infiltrated cells, tumor vasculature, and / or extracellular matrix.
[0009] The effective amount may increase an amount of preQ 1 in the patient. The amount may be a baseline level, which may be an amount of preQi typically found in the patient. The baseline level may be a concentration, such as a blood concentration, plasma concentration, tumor microenvironment concentration, and / or cellular concentration, of preQi in the patient before the administering of preQi. The baseline level may be a concentration, such as a blood concentration, plasma concentration, tumor microenvironment concentration, and / or cellular concentration, of preQi present in a healthy individual. The baseline level may be an average concentration, such as a blood concentration, plasma concentration, tumor microenvironment concentration, and / or cellular concentration, of preQi present in a population of individuals, including a population of healthy individuals. A healthy individual may be an individual who does not have cancer, has not been diagnosed with cancer, and / or is known to not have cancer.
[0010] The effective amount can comprise at least, at most, or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg of preQi, or any range derivable therein. The effective amount can comprise at least, at most, or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg / kg of preQi, or any range derivable therein.
[0011] Also disclosed are aspects where queuine is not provided to the patient. Queuine can reverse the effects of preQi, and therefore is specifically excluded in certain aspects. In certain aspects, the patient has not received an administration of queuine. In certain aspects, the therapeutic composition does not comprise queuine.
[0012] Disclosed are methods for treating and / or preventing a disease cancer. The disease can be a disease that is sensitive to tRNA depletion. The cancer can be any cancer type. The cancer can be melanoma.
[0013] In certain aspects, the patient is a mammal. In certain aspects, the patient is a human, mouse, rat, rabbit, pig, cat, dog, or non-human primate.
[0014] Also disclosed are methods of reducing tRNA, including tRNA with a tyrosine, histidine, asparagine, or aspartic acid cognate amino acid, in a cell; methods of inhibiting proliferation of a cell; and methods of reducing protein translation. Any of the methods can comprise 1, 2, 3, or more of any of the following steps: introducing preQi to a cell, removing queuine from the cell, culturing a cell with preQi, delivering preQi to an environment around a cell, measuring proliferation in a cell, and measuring biomarkers in a cell.
[0015] The cell can be any cell, including any cell sensitive to tRNA depletion. The cell can be a proliferating cell. The cell can be a neoplastic cell. The cell can be a cancer cell.
[0016] In certain aspects, the effective amount produces a concentration of about 100 nM to 1 pM of preQi in the cell. In certain aspects, the effective amount produces a concentration of about 100 nM to 1 pM of preQi around the cell. In certain aspects, the effective amount increases the amount of preQi in the cell.
[0017] Throughout this application, the term “about” is used according to its plain and ordinary meaning in the area of cell and molecular biology to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
[0018] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Any term used in singular form also comprise plural form and vice versa.
[0019] As used herein, the terms “or” and “and / or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y orz.” It is specifically contemplated that x, y, or z may be specifically excluded from an aspect or aspect.
[0020] The words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), “characterized by” (and any form of including, such as “characterized as”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0021] The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of’ any of the ingredients or steps disclosed throughout the specification. The phrase “consisting of’ excludes any element, step, or ingredient not specified. The phrase “consisting essentially of’ limits the scope of described subject matter to the specified materials or steps and those that do not materially affect its basic and novel characteristics. It is contemplated that embodiments and aspects described in the context of the term “comprising” may also be implemented in the context of the term “consisting of’ or “consisting essentially of.”
[0022] It is contemplated that any aspect discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.
[0023] Any method in the context of a therapeutic, diagnostic, or physiologic purpose or effect may also be described in “use” claim language such as “Use of’ any compound, composition, or agent discussed herein for achieving or implementing a described therapeutic, diagnostic, or physiologic purpose or effect.
[0024] Use of the one or more sequences or compositions may be employed based on any of the methods described herein. Other aspects and embodiments are discussed throughout this application. Any embodiment or aspect discussed with respect to one aspect of the disclosure applies to other aspects of the disclosure as well and vice versa.
[0025] It is specifically contemplated that any limitation discussed with respect to one embodiment or aspect of the invention may apply to any other embodiment or aspect of the invention. Furthermore, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or to utilize any composition of the invention. Aspects of an embodiment set forth in the Examples are also aspects that may be implemented in the context of aspects discussed elsewhere in a differentExample or elsewhere in the application, such as in the Summary of Invention, Detailed Description of the Embodiments, Claims, and description of Figure Legends.
[0026] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific aspects of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0028] FIGs. 1A-1L preQi represses cell proliferation and is counteracted by queuine. ns: not significant, * p<0.05, ** p<0.01, *** p<10'3, **** p<10'4. Mann-Whitney U test, two sided. (A) Bacterial biosynthesis pathway of preQi and queuine. The pathway starts with GTP. PreQi is made after 5 steps and is the substrate of the bacterial tgt enzyme for tRNA (G-tRNA = unmodified tRNA). Additional reactions produce queuosine (Q) modified tRNA. Queuine is produced after catabolic reactions of Q-modified tRNA (thick arrow). (B) LC-MS / MS measurements of preQi, queuine, and queuosine (Q) in mouse plasma. The Y axis represents the ratio of the target area to that of the internal heavy standard (queuineN15) in the experiment. n = 3 individual mouse. (C) PAQS-seq of human stool showing presence of tRNA Q- modification in multiple bacterial classes in the same sample: 1 : Bacteroidia, 2: Actinobacteria, 3: Bacilli, 4: Clostridia. (D) Normalized cell count or proliferation of HEK293T cells under indicated preQi and queuine concentrations. All started as 0Q cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (E) Ability of preQi treated HEK293T cells to resume proliferation. 0Q cells were treated with 1 pM preQi in the medium for 24, 48 or 72h. Proliferation was measured upon replacing the medium with fresh media at different times, n = 3 biological replicates for each time point. (F) Normalized cell count or proliferation of HEK293T cells under varying queuine concentrations and 1 pM preQi. 0Q cells were treated with 1 pM preQi for 48h, queuine was then added to the medium at indicated concentration. All data normalized to the average of 1000,0 condition at 48h. n =8 biological replicates for each condition. (G) Normalized cell count or proliferation of HEK293T cells with different ratios of OQ and 100Q starting cells at 1 pM preQi. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (H) Normalized cell count or proliferation of mouse embryonic fibroblast (MEF) cells under indicated preQi and queuine concentrations. All started as OQ cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (I) Normalized cell count or proliferation of mouse BMDC cells under indicated preQi and queuine concentrations. All started as cells freshly isolated from mouse bone marrow. All data normalized to the average of 0,0 condition at day 1. n = 5 replicates for each condition.
[0029] FIGs. 2A-2F. preQi effect is dependent on QTRT1 and QTRT2 and preQi is incorporated into tRNA. ns: not significant, * p<0.05, ** p<0.01, *** p<10'3, **** p<10'4. Mann-Whitney U test, two sided. (A) Western blot of HEK293T cells upon QTRT1 knockdown. GAPDH is the loading control. (B) Normalized cell count or proliferation of QTRT1 knockdown cells under indicated preQi and queuine concentrations. All started as 0Q cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (C) Normalized cell count or proliferation of QTRT2 knockdown cells under indicated preQi and queuine concentrations. All started as 0Q cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (D) LC-MS / MS of preQi sine calibration. The area of the MS signal (y-axis) as a function of preQi sine concentration (x-axis) shows a linear response. (E) LC-MS / MS measurements of queuosine (Q) and preQi sine (£) in queuine treated (left) or preQi treated (right) HEK293T cells under indicated conditions, n = 3 biological replicates for each condition. (F) PreQi sine detection of cognate tRNAs by chemical tagging (PEG-NHS) and Northern blots. The larger gel shifts in tRNAAsnand tRNATyrare derived from the known acp3U modification in those tRNAs that also reacts with the chemical tag.
[0030] FIGs. 3A-3F. preQi is present in mouse tissues, can be incorporated into mouse tRNA, and reduces xenograft tumor growth, ns not significant, * p<0.05, ** p<0.01, *** p<10'3, **** p<10'4. Mann-Whitney U test, two sided. (A) LC-MS / MS measurements of preQi and queuine metabolites in mouse tissues. Fourteen tissues from C57BL / 6 mice were surgically collected immediately after sacrifice: bone marrow (BN), cerebellum (CB), colon (CL), cortex (CO), heart (HE), kidney (KI), liver (LI), lymph nodes (LN), lung (LU), mesenteric lymph nodes (MLN), small intestine (SI), spleen (SP), stomach (ST), thymus (TH). Metabolites were extracted and analyzed by LC-MS / MS for queuine and preQi . As in Figure IB, data were normalized to the area of the internal heavy standard, queuineN15. n = 3 individual mouse. (B)LC-MS / MS measurements of queuosine (Q) and preQi sine (£) nucleosides in the same mouse tissues as (A). Data were normalized to the area of the internal heavy standard, queuineN15. n = 3 individual mouse. (C) LC-MS / MS measurements of Q (left) and preQi sine (right) nucleosides in mouse liver, kidney, heart, and lung with and without preQi injection, n = 4 mice for each group. (D) Northern blots of APB gels of total RNA samples from mouse liver and kidney with and without preQi injection using tRNAHlsor tRNAAsnprobes. 5S rRNA is the loading control, OQ, 100Q HEK293T RNAs are positive controls, n = 4 mice for each group. (E) Normalized cell count or proliferation of mouse B 16 melanoma cells under indicated preQ 1 and queuine concentrations. All started as OQ cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (F) Tumor volume measurements of B16 cells 9 and 11 days after implantation and under mock or preQi treatment, n = 6 mice for control group and n = 9 mice for preQi group.
[0031] FIGs. 4A-4E. preQi selectively reduces the level of cognate tR\.Al'l llls As"Asp. (A) All tRNA abundance change relative to OQ samples without preQi treatment at the isoacceptor level measured by high throughput sequencing. Top: nuclear-encoded (cytosolic) tRNAs, bottom: mitochondrial -encoded tRNAs. (B) Heatmap of expression of individual tRNA isoacceptors showing selective decrease of cognate tRNA abundance indicated by arrows. All tRNA normalized to OQ samples without preQi treatment. (C) Northern blot validation of nuclear-encoded tRNAHlsand tRNAAsplevel reduction. 5S rRNA is the loading control. (D) Northern blot of nuclear-encoded tRNATyrusing acid denaturing gels to measure charging levels. Deacylated samples are positive controls. (E) 5’ tRNATyrfragment levels relative to full- length tRNATyrmeasured by MSR-seq under indicated conditions.
[0032] FIGs. 5A-5H. preQi drastically reduces translation of ribosomal proteins and at A / T-ending codons. (A)Sucrose gradient polysome profiles of HEK293T cells in mock and 1 pM treated preQi . mRNAs from disome and above (underlined) were collected for polysome mRNA sequencing. (B) PreQi versus 0Q input mRNA (left) and polysome mRNA (right). The 117 ribosomal protein genes (named RPL / RPS) are highlighted in dark grey. (C) Translation efficiency (TE) of preQi treated and control samples, 0Q versus preQi. Highlighted are transcripts whose TE differs by >5-fold between mock and preQi -treated cells. (D) TE of preQi treated over untreated cells versus mRNA abundance of input (left) and polysome (right) under mock conditions. The 117 ribosomal protein genes are highlighted. (E) Gene ontology (GO) terms of genes whose translation was drastically reduced (transcripts with 0Q / preQl>2 in panel C) or increased (transcripts preQl / 0Q>2) upon preQi treatment. (F) Comparing codon usage of the 4 amino acids decoded by Q-modifiable tRNAs affected by preQi treatment. (G)Comparing codon usage of all amino acids. (H) Difference in codon usage between genes with much higher TE in preQi over OQ and genes with much higher TE in OQ over preQi.
[0033] FIGs. 6A-6I. Crispr screen identifies new cellular pathways in preQi effects on proliferation, ns: not significant, * p<0.05, ** p<0.01, *** p<10'3, **** p<10'4. Mann- Whitney U test, two sided. (A) Integrated differential sgRNA expression by STARS. Genes with Ti value > 2.4503 and STARS p < 0.05 are highlighted in red; their depletion enhances proliferation compared to controls upon preQi treatment. Genes with p < 10'7are manually set to 7. QTRT1 and QTRT2 have TI scores of 66.99 and 104.58 respectively and are not shown here. (B) Heatmap of sgRNA enrichment of the 40 genes in panel (A). Enrichment is normalized to the average of the four controls. (C) Enrichment of sgRNA of QTRT1 and QTRT2, relative to actin sgRNA as control. Each dot is a different sgRNA. FC: fold change. (D) Gene ontology analysis of cellular component of the 40 genes in panel (A). (E) Clusters of protein-protein interaction analysis by STRING of the 40 genes in panel (A). Proteins in the same pathway are grouped and annotated with colored shadows. Filled colored dots indicate genes selected for validation. (F) Enrichment of sgRNA of SCAP, MB TPS 1 and MBTPS2 in the cholesterol metabolism pathway, relative to actin sgRNA as control. Each dot is a different sgRNA. FC: fold change. (G) Enrichment of sgRNA of ACSL3, AC AC A and ACLY in the fatty acid metabolism pathway, relative to actin sgRNA as control. Each dot is a different sgRNA. (H) Enrichment of sgRNA of NBAS, USE1 and COG3 in the ER-Golgi trafficking pathway, relative to actin sgRNA as control. Each dot is a different sgRNA. (I) Enrichment of sgRNA of ATP6V0B, ATP6V0D1 and ATP6V1B2 in the V-ATPase complex, relative to actin sgRNA as control. Each dot is a different sgRNA.
[0034] FIGs. 7A-7K. Validation of multiple pathways in preQi effects and functional model, ns: not significant, * p<0.05, ** p<0.01, *** p<10'3, **** p<10'4. Mann-Whitney U test, two sided. (A) Western blot of si-CTRL and si-SCAP protein. GAPDH is the loading control. (B) Normalized cell count or proliferation of si-CTRL and si-SCAP cells without and with preQi treatment. All started as 0Q cells. All data normalized to the average of si-CTRL, no preQi condition at 24h. n = 8 biological replicates for each condition. (C) Western blot of si-CTRL and si-ACSL3 protein. GAPDH is the loading control. (D) Normalized cell count or proliferation of si-CTRL and si-ACSL3 cells without and with preQi treatment. All started as 0Q cells. All data normalized to the average of si-CTRL, no preQi condition at 24h. n = 8 biological replicates for each condition. (E) qRT-PCR result of NBAS mRNA of si-CTRL and si-NBAS cells, relative to actin mRNA as control. (F) Normalized cell count or proliferation of si-CTRL and si-NBAS cells without and with preQi treatment. All started as 0Q cells. Alldata normalized to the average of si-CTRL, no preQi condition at 24h. n = 8 biological replicates for each condition. (G) Northern blot of si-CTRL and si-SCAP cells for tRNATyr. 5S rRNA is the loading control. (H) tRNATyr / 'Hls / Asn / Asplevel change of si-CTRL and si-SCAP without and with preQi treatment by Northern blot, normalized to 5S rRNA. All 4 tRNAs are represented at n = 4 biological replicates for each condition. (I) tRNAlvr Hls sil splevel change of si-CTRL and si-ACSL3 without and with preQi treatment by Northern blot, normalized to 5S rRNA. All 4 tRNAs are represented at n = 4 biological replicates for each condition. (J) tRNATyr / Hls / Asn / Asplevel change of si-CTRL and si-NBAS without and with preQi treatment by Northern blot, normalized to 5S rRNA. All 4 tRNAs are represented at n = 4 biological replicates for each condition. (K) Model of preQi effect on proliferation (created with BioRender.com). tRNAlvr Hls sil spcan be modified to queuosine (Q) or preQi sine (pQ) by the QTRT1 enzyme. Q-modifi cation blocks pQ-modification. PreQi -modified tRNAs are deficient in charging, decoding and prone to degradation, all contribute to reduced translation of ribosomal proteins and strongly decreases proliferation. The preQi effect is mediated by specific proteins in cholesterol metabolism (SCAP, MBTPS1 and MBTPS2), fatty acid metabolism (ACSL3, ACACA and ACLY), and ER-Golgi trafficking (NBAS, USE1 and C0G3).
[0035] FIGs. 8A-8I. preQi represses cell proliferation and is counteracted by queuine. (A) Queuine, preQ 1 , queuosine (Q) and N 15-labeled q (queuineN15) MS calibration curves with linear fits of the logio values. (B) Short retrosynthetic chemical description of the different synthetic routes that led to the MS standard compounds used in this work. (C) Deletion rate of PAQS-seq of Q-modifiable tRNAs of genus roseburia in the human stool sample with and without periodate (IO) treatment. (D) Proliferation measurement by absorbance at 460 nm, HEK293T cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. (E) Proliferation measurement by absorbance at 460 nm, HEK293T cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. preQi was added at t = 0 and queuine added at t = 48h. (F) Proliferation measurement by absorbance at 460 nm, HEK293T cells. The starting cells were mixtures of OQ and 100Q cells. Arrow indicates the time of addition of preQi . Error bar corresponds to the range of n = 8 biological replicates. (G) Proliferation measurement by absorbance at 460 nm, MEF cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. (H) Relative cell count of proliferation measurement, BMDC cells. Arrow indicates the time of addition of preQi and / or queuine. Cell counts are normalized to 0Q cells at t = 0.All started as cells freshly isolated from mouse bone marrow, n = 5 replicates for each condition. (I) Murine BMDCs were stained with DAPI for flow cytometry and analyzed on the NovoCyte Penteon using FlowJo software. From left to right: the myeloid cell population is identified by forward and side scatter, doublets are excluded, and live cells are quantified by selecting the DAPIlow population. Each figure is representative of one of five replicates.
[0036] FIGs. 9A-9D. preQi is incorporated into tRNA dependent on QTRT1 and QTRT2. (A) Proliferation measurement by absorbance at 460 nm, shRNA-QTRTl knockdown and control HEK293T cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. (B) Western blot showing shRN A knockdown of the QTRT2 protein. CycB is the loading control. (C) Same set up as Fig. S2A, except for shRNA-QTRT2 and control cells. (D) Reaction scheme of the preQi -modified tRNA for Northern blot analysis.
[0037] FIGs. 10A-10C. preQi metabolite is present in mouse tissues, can be incorporated into tRNA, and preQi treatment reduces xenograft tumor growth. (A) LC- MS / MS of mouse feces showing queuine and preQi metabolites and queuosine and preQi sine nucleosides. (B) Quantitation of Q-modification levels from Northern blot results of preQi injected liver and kidney tRNAHlsand tRNAAsn. (C) Proliferation measurement by absorbance at 460 nm, B16 cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates.
[0038] FIGs. 11A-11B. preQi selectively reduced the expression of Q-modified tRNAs. (A) Comparing the fraction tRNA reads for the biological replicates under different preQi and queuine treatments. Pearson’s r = 0.9981 (0Q), 0.9868 (preQi), 0.9986 (preQl lnM Q), 0.9952 (preQl lOnM Q), 0.9963 (100Q). (B) MEF cells, Northern blots for Q-modifiable tRNAs. 5S rRNA is the loading control.
[0039] FIGs. 12A-12E. preQi reduces translation in a codon dependent manner. (A) mRNA-seq replications of input and polysome samples. Pearson’s r = 0.9683 (0Q, input), 0.9485 (preQi input), 0.8867 (0Q, polysome), 0.9663 (preQi, polysome). (B) Gene ontology (GO) analysis for biological process and molecular function of genes with significant change in TE. (C) mRNA expression heatmap of 98 genes where TE<5 in preQl / OQ, normalized to 0Q input sample. (D) mRNA expression heatmap of 154 genes where TE>5 in preQl / OQ, normalized to 0Q input sample. (E) Codon usage of genes.
[0040] FIGs. 13A-13D. CRISPR screen for preQl-dependent proliferation. (A) Experimental set up. (B) Differential expression of individual sgRNAs of the “red’ genes inFig. 6A. (C) Gene ontology (GO) analysis for biological process of the “red” genes in Fig. 6A. (D) GO analysis of molecular function of the “red” genes in Fig. 6A.
[0041] FIGs. 14A-14H. Cell proliferation results of CRISPR screen validation. (A) Proliferation measurement by absorbance at 460 nm, si-SCAP and si-Ctrl cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. (B) Normalized cell number of si -MB TPS 1 and si-Ctrl cells under conditions of indicated preQi concentration. All started as 0Q cells. All data normalized to the average of 0,0 condition at 24h. n = 8 biological replicates for each condition. (Lower right inset) Proliferation measurement by absorbance at 460 nm, si-MBTPSl and si-Ctrl cells. Arrow indicates the time of addition of preQi and / or queuine. Error bar corresponds to the range of n = 8 biological replicates. (C) Same as Fig. 14B, but for si-MBTPS2 and si-Ctrl cells. (D) Same as Fig. 14A, but for si-ACSL3 and si-Ctrl cells. (E) Same as Fig. 14A, but for si-NBAS and si- Ctrl cells. (F) Same as Fig. 14B, but for si-ATP6V0Dl and si-Ctrl cells. (G) Same as Fig. 14B, but for si-ATP6VlB2 and si-Ctrl cells. (H) Same as Fig. 14B, but for si-ATP6V0B and si-Ctrl cells.DETAILED DESCRIPTION OF THE INVENTION
[0042] The microbiome can interact with the eukaryotic host through various metabolites, which can affect cell physiology. One direct molecular pathway of microbial-host interaction is the incorporation of the microbial metabolite queuine at the wobble anticodon nucleotide of host tRNAs by a host enzyme that regulates host cell translation. Microbes can also produce the intermediary metabolite pre-queuosinel (preQi) in the queuine pathway. The affect of preQi on host cell biology has not been explored prior to this disclosure. Aspects herein show that preQi strongly represses eukaryotic, including human and mouse, cell proliferation. In certain aspects, this effect is suppressed or reversible with queuine and depends on the same host enzyme that installs queuosine tRNA modification. PreQi and queuine are present in plasma and mouse tissues and incorporated into tRNA in cells and in mice, and preQi treatment reduces tumor growth in a mouse model of cancer. Mechanistically, preQi reduces cognate tRNA levels specifically and translation of house-keeping genes in a highly codon dependent manner. Genomic-wide CRISPR screen and validation identify pathways in cholesterol biosynthesis regulation, fatty acid metabolism, and Golgi-ER transport that mitigate the preQi proliferation effects through modulation of cognate tRNA levels. Aspects herein show an inter-dependent relationship of microbial metabolites that can regulate host cell proliferation, which may integrate lipid metabolism with RNA biology.I. Therapeutic Compositions
[0043] Disclosed herein are therapeutic compositions comprising preQi. The therapeutic composition may comprise an effective amount of the preQi, including a unit dose of the preQi. The therapeutic composition may be specifically formulated to effectively deliver preQi to a patient, a specific tissue in the patient, and / or a specific cell type in the patient.
[0044] In certain aspects, the compositions or agents for use in the methods, such as preQi, are suitably contained in a pharmaceutically acceptable carrier, making a therapeutic composition. The carrier can be non-toxic, biocompatible and is selected so as not to detrimentally affect the biological activity of the agent. The agents in some aspects of the disclosure may be formulated into preparations for local delivery (i.e. to a specific location of the body, such as a tumor or other tissue) or systemic delivery, in solid, semi-solid, gel, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, depositories, inhalants and injections allowing for oral, parenteral or surgical administration. Certain aspects of the disclosure also contemplate local administration of the compositions by coating medical devices and the like.
[0045] Suitable carriers for parenteral delivery via injectable, infusion or irrigation and topical delivery include distilled water, physiological phosphate-buffered saline, normal or lactated Ringer's solutions, dextrose solution, Hank's solution, or propanediol. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any biocompatible oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. The carrier and agent may be compounded as a liquid, suspension, polymerizable or non-polymerizable gel, paste or salve.
[0046] The carrier may also comprise a delivery vehicle to sustain (i.e., extend, delay or regulate) the delivery of the agent(s) or to enhance the delivery, uptake, stability or pharmacokinetics of the therapeutic agent(s). Such a delivery vehicle may include, by way of non-limiting examples, microparticles, microspheres, nanospheres or nanoparticles composed of proteins, liposomes, carbohydrates, synthetic organic compounds, inorganic compounds, polymeric or copolymeric hydrogels and polymeric micelles.
[0047] In certain aspects, the actual dosage amount of a composition administered to a patient or subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0048] Solutions of pharmaceutical compositions can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[0049] In certain aspects, the pharmaceutical compositions are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable or solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified. A typical composition for such purpose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain 10 mg or less, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like.
[0050] Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic / aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, antgifungal agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well-known parameters.
[0051] Additional formulations are suitable for oral administration. Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
[0052] In further aspects, the pharmaceutical compositions may include classic pharmaceutical preparations. Administration of pharmaceutical compositions according to certain aspects may be via any common route so long as the target tissue is available via that route. This may include oral, nasal, buccal, rectal, vaginal or topical. Alternatively,administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients. For treatment of conditions of the lungs, aerosol delivery can be used. Volume of the aerosol may be between about 0.01 ml and 0.5 ml, for example.
[0053] An effective amount of the pharmaceutical composition is determined based on the intended goal. The term “unit dose” or “dosage” refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity of the pharmaceutical composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the protection or effect desired.
[0054] Precise amounts of the pharmaceutical composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment (e.g., alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance.
[0055] It is contemplated that other agents may be used in combination with certain aspects of the present aspects to improve the therapeutic efficacy of treatment.II. Administration of Therapeutic Compositions
[0056] Certain therapies provided herein may comprise administration of one or a combination of therapeutic agents. The therapeutic agent can comprise pre-queuosinel (preQi). In certain aspects, the therapy comprises a first therapy, which may be preQi, and a second therapy, such as any additional anti-cancer agent and / or anti-cancer intervention. The therapies may be administered in any suitable manner known in the art. For example, the first and second therapy may be administered sequentially (at different times) or concurrently (at the same time). In some aspects, the first and second therapy are administered in a separate composition. In some aspects, the first and second therapy are in the same composition.
[0057] In some aspects, the first and second therapy are administered substantially simultaneously. In some aspects, the first and second therapy are administered sequentially
[0058] Aspects of the disclosure relate to compositions and methods comprising therapeutic compositions. The different therapies may be administered in one composition orin more than one composition, such as 2 compositions, 3 compositions, or 4 compositions. Various combinations of the agents may be employed.
[0059] The therapeutic agents of the disclosure may be administered by the same route of administration or by different routes of administration. In some aspects, the therapy is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In some aspects, the antibiotic is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. The appropriate dosage may be determined based on the type of disease to be treated, severity and course of the disease, the clinical condition of the individual, the individual's clinical history and response to the treatment, and the discretion of the attending physician.
[0060] The treatments may include various “unit doses.” Unit dose is defined as containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, is within the skill of determination of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. In some aspects, a unit dose comprises a single administrable dose.
[0061] In some aspects, the first therapy, which may be preQi, is administered at a dose of between 1 mg / kg and 5000 mg / kg. In some aspects, the first therapy is administered at a dose of at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287,288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306,307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325,326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344,345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363,364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382,383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401,402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439,440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458,459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477,478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496,497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515,516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534,535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553,554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572,600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, or 5000 mg / kg.
[0062] In some aspects, a single dose of the second therapy is administered. In some aspects, multiple doses of the second therapy are administered. In some aspects, the second therapy is administered at a dose of between 1 mg / kg and 5000 mg / kg. In some aspects, the second therapy is administered at a dose of at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202,203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221,222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240,241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259,260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278,279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297,298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316,317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335,336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354,355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373,374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392,393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411,412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430,431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449,450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468,469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487,488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506,507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525,526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544,545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563,564, 565, 566, 567, 568, 569, 570, 571, 572, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, or 5000 mg / kg.
[0063] The quantity to be administered, both according to number of treatments and unit dose, depends on the treatment effect desired. An effective dose is understood to refer to an amount necessary to achieve a particular effect. In the practice in certain aspects, it is contemplated that doses in the range from 10 mg / kg to 200 mg / kg can affect the protective capability of these agents. Thus, it is contemplated that doses include doses of about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 pg / kg, mg / kg, pg / day, or mg / day or any range derivable therein. Furthermore, such doses can be administered at multiple times during a day, and / or on multiple days, weeks, or months.
[0064] In certain aspects, the effective dose of the pharmaceutical composition is one which can provide a blood level of about 1 pM to 150 pM. In another aspect, the effective dose provides a blood level of about 4 pM to 100 pM.; or about 1 pM to 100 pM; or about 1pM to 50 pM; or about 1 pM to 40 pM; or about 1 pM to 30 pM; or about 1 pM to 20 pM; or about 1 pM to 10 pM; or about 10 pM to 150 pM; or about 10 pM to 100 pM; or about 10 pM to 50 pM; or about 25 pM to 150 pM; or about 25 pM to 100 pM; or about 25 pM to 50 pM; or about 50 pM to 150 pM; or about 50 pM to 100 pM (or any range derivable therein). In other aspects, the dose can provide the following blood level of the agent that results from a therapeutic agent being administered to a subject: about, at least about, or at most about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 pM or any range derivable therein. In certain aspects, the therapeutic agent that is administered to a subject is metabolized in the body to a metabolized therapeutic agent, in which case the blood levels may refer to the amount of that agent. Alternatively, to the extent the therapeutic agent is not metabolized by a subject, the blood levels discussed herein may refer to the unmetabolized therapeutic agent.
[0065] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment (alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance or other therapies a subject may be undergoing.
[0066] It will be understood by those skilled in the art and made aware that dosage units of pg / kg or mg / kg of body weight can be converted and expressed in comparable concentration units of pg / ml or mM (blood levels). It is also understood that uptake is species and organ / tissue dependent. The applicable conversion factors and physiological assumptions to be made concerning uptake and concentration measurement are well-known and would permit those of skill in the art to convert one concentration measurement to another and make reasonable comparisons and conclusions regarding the doses, efficacies and results described herein.
[0067] In certain instances, it will be desirable to have multiple administrations of the composition, e.g., 2, 3, 4, 5, 6 or more administrations. The administrations can be at 1, 2, 3,4, 5, 6, 7, 8, to 5, 6, 7, 8, 9, 10, 11, or 12 week intervals, including all ranges there between.
[0068] The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal or human. As used herein,“pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, anti-bacterial and anti-fungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in immunogenic and therapeutic compositions is contemplated. Supplementary active ingredients, such as other anti-infective agents and vaccines, can also be incorporated into the compositions.
[0069] The active compounds can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or intraperitoneal routes. Typically, such compositions can be prepared as either liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and, the preparations can also be emulsified.
[0070] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including, for example, aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
[0071] The proteinaceous compositions may be formulated into a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
[0072] A pharmaceutical composition can include a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various anti-bacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugarsor sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0073] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization or an equivalent procedure. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0074] Administration of the compositions will typically be via any common route. This includes, but is not limited to oral, or intravenous administration. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal, or intranasal administration. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
[0075] Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above.A. Cancer Therapy
[0076] In some aspects, the method further comprises administering a cancer therapy to the patient. The cancer therapy may be chosen based on the expression level measurements, alone or in combination with the clinical risk score calculated for the patient. In some aspects, the cancer therapy comprises a local cancer therapy. In some aspects, the cancer therapy excludes a systemic cancer therapy. In some aspects, the cancer therapy excludes a local therapy. In some aspects, the cancer therapy comprises a local cancer therapy without the administration of a system cancer therapy. In some aspects, the cancer therapy comprises an immunotherapy, which may be an immune checkpoint therapy. Any of these cancer therapies may also be excluded. Combinations of these therapies may also be administered.
[0077] The term “cancer,” as used herein, may be used to describe a solid tumor, metastatic cancer, or non-metastatic cancer. In certain aspects, the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus. In some aspects, the cancer is recurrent cancer. In some aspects, the cancer is Stage I cancer. In some aspects, the cancer is Stage II cancer. In some aspects, the cancer is Stage III cancer. In some aspects, the cancer is Stage IV cancer.
[0078] The cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget’s disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolarrhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi’s sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; hodgkin’s disease; hodgkin’s; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin’s lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.B. Surgery
[0079] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electro surgery, and microscopically-controlled surgery (Mohs’ surgery).
[0080] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti -cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.III. Kits
[0081] Certain aspects of the present disclosure also concern kits containing compositions of the disclosure or compositions to implement methods disclosed herein. Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.
[0082] Individual components may also be provided in a kit in concentrated amounts; in some aspects, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as lx, 2x, 5x, lOx, or 20x or more.
[0083] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different aspects may be combined. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.Examples
[0084] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1: ResultsPreQl strongly reduces cell proliferation but is attenuated and reversed by queuine
[0085] Queuine and preQi are both derived from the same bacterial metabolic pathway and may affect host cell properties. The inventors measured the presence of both queuine and preQi in the plasma of specific pathogen-free (SPF) mice by mass spectrometry and foundappreciable amounts of both, suggesting that mouse tissues could indeed be exposed to both metabolites (FIGs. IB, 8A, 8B). The inventors performed PAQS-seq (Katanski et al., 2022) of human stools and identified the presence of Q-tRNA modification in multiple bacterial classes (FIGs. 1C, 8C), indicating that queuine and preQi can come from many taxa of gut bacteria.
[0086] To test the effect of preQi on cell proliferation, the inventors generated HEK293T cells depleted of Q-tRNA modification (0Q cells)(Wang et al., 2018; Zhang et al., 2020b) and added queuine, preQi, or both together to the culture medium (FIGs. ID, 8D). The addition of queuine alone slightly increased cell proliferation. However, the addition of preQi alone strongly reduced cell proliferation. Strikingly, the reduction of cell proliferation with preQi was fully reversed when queuine was also present.
[0087] To further evaluate the preQi effects on proliferation the inventors performed cell proliferation experiments with preQi and queuine added at different times and with cell mixtures with different starting Q-tRNA modification levels. The inventors first treated cells with preQi for up to 72 hours, then measured cell proliferation upon addition of queuine at different times and concentrations after preQi pretreatment. Cells pre-exposed to preQi up to 72 hours proliferated equally well (Fig. IE). The addition of 10 nM to 1 pM queuine, but not 1 nM queuine to cells pre-exposed 48h to preQi fully rescued proliferation (FIGs. IF, 8E). The above experiments were carried out with 0Q cells before preQl / queuine addition. To test whether the Q-tRNA modification status of the starting cells mattered in preQi -dependent reduction in proliferation, the inventors added preQi to cell mixtures at varying proportions of 0Q and fully Q-modified tRNA (100Q cells)(Wang et al., 2018; Zhang et al., 2020b). PreQi had the same effect on proliferation regardless of the Q-tRNA modification status of the starting mixture (FIGs. 1G, 8F).
[0088] The inventors further tested whether the preQi effect on cell proliferation went beyond transformed human cells. For mouse embryonic fibroblast (MEF) cells (FIGs. 1H, 8G), the addition of queuine had no effect on proliferation. The addition of preQi strongly reduced proliferation, and the addition of queuine in the presence of preQi partially restored proliferation. The inventors also measured queuine and preQi effect on the proliferation of primary mouse bone marrow-derived dendritic cells (BMDCs, FIGs. II, 8H, 81). The addition of queuine alone had only a small effect on proliferation, but preQi strongly inhibited proliferation. For BMDCs, up to 100 nM queuine was needed to fully restore proliferation in the presence of 100 nM preQi.
[0089] Taken together, these results indicate that preQi strongly represses cell proliferation of transformed cells, non-transformed cells, and primary immune cells, butqueuine can overcome the preQi effect. PreQi does not reduce the ability of cells to proliferate, rather, cells are poised to uptake queuine to resume growth, and preQi effect is independent on the Q-tRNA modification level of the starting cells. The sensitivity of the preQi and queuine effects on proliferation depends on the cell type: preQi effect varies from 100 nM to 1 pM, and queuine rescue varies from 10 nM to 100 nM in the medium.PreQl effect is dependent on QTRT1 / 2 and is incorporated into tRNA in cells
[0090] Mammalian Q-tRNA modification is installed by the QTRT1 / QTRT2 complex in which QTRT1 is the catalytic subunit. The recombinant QTRT1 / QTRT2 complex can use both queuine and preQi to modify tRNA in the test tube (Bessler et al., 2022; Fergus et al., 2021). The inventors knocked down QTRT1 (FIG. 2A) and measured the effect of preQi on cell proliferation (FIGs. 2B, 9A). The addition of queuine had little effect on the proliferation of the QTRT1-KD cells. However, the addition of preQi reduced the proliferation of QTRT1-KD cells to a much smaller extent than that of the wild-type control cells. Knocking down QTRT2 also alleviated the preQi effect on proliferation (FIGs. 2C, 9B, 9C).
[0091] The inventors applied two independent methods to show that preQi was incorporated into human tRNA in cells. First, the inventors established a mass spectrometry method to measure the preQi nucleoside (preQi sine, £) by LC-MS / MS (FIGs. 2D, Fig. 8B). The inventors employed Multiple Reaction Monitoring (MRM) mode, a specific and sensitive mass spectrometry technique for quantifying selective compounds within complex mixtures. In MRM, preQi sine was selected, then fragmented in the collision cell, and specific products of fragmentation were detected. The inventors employed custom made preQi sine dichlorohydrate as a standard to calibrate the method. The inventors measured the queuosine and preQi sine levels after digestion of total RNA from queuine or preQi treated cells (FIG. 2E). As expected, a high level of queuosine was present in the queuine, but not in preQ 1 treated cells. Conversely, a high level of preQ 1 sine was present in the preQ 1 , but not in queuine treated cells. Second, the inventors took advantage of the chemical structure of preQi sine containing a primary amine group absent in queuosine. The inventors devised a chemical tagging strategy that required primary amine reaction with a large chemical group which would result in a gel shift (FIG. 9D). Q-modified tRNAs could be detected by N-acryloyl-3-aminophenylboronic acid (APB) or acid gel electrophoresis (Zhang et al., 2020b), but the inventors did not observe a gel shift from preQi -modified tRNA on these gels without chemical tagging, likely due to the smaller size of the preQi sine moiety compared to queuosine (FIG. 2F). After reacting with the chemical tag, tRNATyr / Hls / Asn / Aspfrom preQi treated cells showed significantly retarded migration (FIG. 2F). Unexpectedly, the addition of just 1 nM queuine in the presence of preQiincreased the abundance and preQi -tRNA fraction of tRNAAsn / Tyr, even though this low queuine concentration only very moderately rescued proliferation (FIG. IF).
[0092] Taken together, these results indicate that the preQi effect is mediated by QTRT1 and QTRT2, the same enzyme complex that installs Q-tRNA modification. PreQi is incorporated into tRNAs in cells, however, the addition of a low level of queuine can increase preQi levels in the low affinity Q-modification substrates of tRNATyr / Asn(Zhang et al., 2020b), suggesting a complex interplay between preQi and queuine in the installation of preQl / Q- tRNA modifications.PreQl incorporation in tRNA in mouse tissues and effect on xenograft tumor growth
[0093] To further explore the relationship of queuine and preQi and their tRNA modifications, the inventors measured the presence of queuine and preQi metabolites in SPF mouse tissues (FIG. 3A). Queuine was readily detectable at varying amounts in all tissues examined. PreQl was detectable in cerebellum, cortex, colon, kidney, liver, lymph nodes, mesenteric lymph nodes, spleen, thymus, sometimes in stomach and small intestine, but not in bone marrow, heart, lung. The inventors also measured the presence of queuosine (Q) and preQi sine (£) nucleotides in these tissues (FIG. 3B). Q was present at varying levels in all tissues, and the variation could be derived from the tRNA Q-modification and / or tissuedependent tRNA expression levels. £ was not detected in any tissue. As a control, queuine, preQi, Q and £ were all detected in feces (FIG. 10A) which contained mostly bacteria.
[0094] The inventors injected preQi into SPF mice to determine whether preQi sine could be detected upon a sudden influx of preQi metabolite. Using mass spectrometry, the inventors readily detected a reduction of queuosine levels and simultaneously a substantial level of preQi sine nucleotide in the total RNA of liver, kidney, heart, and lung, the four tissues examined in this experiment harvested after three days of injecting preQi every 24 hours (FIG. 3C). Using APB gel electrophoresis which could measure the Q-modification levels in tRNAHls / Asn, the inventors validated that preQi injection corresponded to a substantial reduction of Q-modification levels in these tRNAs, consistent with preQi sine replacing queuosine in these tRNAs (FIGs. 3D, 10B).
[0095] To identify a physiological effect of preQi treatment in mice, the inventors used ovalbumin-expressing mouse melanoma B16 cells (B16-OVA) as xenograft tumors. The inventors determined first that preQ 1 also strongly reduced the proliferation ofB16-OVA cells, and queuine addition restored proliferation in vitro (FIGs. 3E, 10C). Both control and preQi - treated cells were implanted in mouse skin and tumor growth was measured over time. PreQltreatment significantly reduced the tumor volume at 9- and 11 -days post-implantation of Bl 6- OVA cells (Fig. 3F).
[0096] Taken together, the results indicate that queuine and preQi metabolites are present in many mouse tissues under steady-state condition. Mouse tissues are poised to take up preQi to incorporate into their cognate tRNAs upon an influx of preQ 1. Furthermore, preQ 1 treatment can result in long-term consequences in a mouse model of cancer.PreQl reduces cognate tRNA levels and translation in a pathway and codon dependent manner
[0097] To determine the effect of preQi treatment on tRNA, the inventors performed multiplex small RNA sequencing (Watkins et al., 2022) to measure tRNA abundance change (FIG. 11A). For the nucl ear-encoded tRNAs, preQi alone significantly reduced the levels only of the 4 cognate tR.NATvr Hls Asil Aspthat could be Q- or preQi -modified (FIG. 4A). In the presence of preQi, the level of these tRNAs started to recover upon the addition of 1 nM of queuine, and recovery was complete for tRNATyr / Asp / Asnat 10 nM queuine (FIG. 4B). The inventors validated the preQi -dependent depletion of cognate tRNAs by Northern blots (FIG. 4C). The inventors also observed depletions of cognate tRNAs in MEF cells (Fig. S4B). The human mitochondrial fRNATyr / Hls / Asp / Asnare also Q-modified (Randerath et al., 1984; Suzuki et al., 2020). PreQl alone also depleted the cognate mitochondrial tRNAs, but the recovery of the mitochondrial tRNATvr Hls Asp As11levels required more than 10 nM queuine (FIGs. 4A, 4B).
[0098] PreQl -dependent cognate tRNA depletion could be related to deficiency in tRNA charging and / or elevated cleavage by cellular ribonucleases. For nuclear-encoded tRNATyr, preQi treatment resulted in significantly decreased charging levels (FIG. 4D). At the same time, more 5’ tRNATyrfragments (tRFTyr) were present, consistent with increased degradation of tRNATyr(FIG. 4E). The addition of queuine decreased the tRFTyrlevel, consistent with the restoration of full-length tRNATyrlevel under these conditions.
[0099] To determine the preQi effect on translation, the inventors performed polysome profiling of preQi treated and control cells. PreQl substantially reduced global translation, consistent with its severe reduction of cell proliferation (FIGs. 5A, 12A). In the input and polysome samples, 1098 and 590 transcripts were increased, 1307 and 491 transcripts decreased by 2-fold in preQi treated compared to untreated cells, respectively (Fig. 5B). Analysis of translation efficiency (TE, Fig. 5C) of transcripts changed by >5-fold showed that many highly expressed transcripts corresponding to house-keeping genes such as the ribosomal proteins were enriched in input but depleted in the polysome (Fig. 5D). Gene ontology analysis (FIGs. 5E, 12B) showed that the major cellular pathways reduced in translation were structural components of cytosolic ribosomes, which corresponded to the highly expressed transcripts(FIG. 12C). PreQi -dependent increase in translation of major cellular pathways involved intracellular organelles (FIG. 12D).
[0100] The inventors analyzed the preQi effect on the codon context in translation. For the amino acid codons read by the cognatepreQi treatment substantially reduced the translation of the U-ending, but not the C-ending codons (FIG. 5F). Furthermore, preQi exerted a clear difference on translation based on the third codon sequence (FIGs.. 5G, 12E). Translation on all A / U-ending codons were reduced and comparably translation on nearly all C / G ending codons were enhanced in the presence of preQi. The only major exception to this third codon sequence trend was lysine AAG which was however accompanied by an even stronger reduction in translation of lysine AAA codon. Hence, for all codon pairs that end with A / G or C / U, preQi reduced translation of A-ending over G-ending codons and U-ending over C-ending codons in every instance (FIG. 5H). Decoding of the four cognate amino acids by Q / preQlsine modified tRNAs followed this trend, but their effect was not among the strongest.
[0101] Taken together, the results show that preQi strongly and specifically reduces the levels of cognate tRNATyr / Hls / Asn / Asp, and queuine counteracts this reduction. PreQi -dependent tRNA reduction may be derived from their lower charging levels and preQi -modified tRNAs could be more prone for degradation. PreQi also specifically reduces the level of cognate mitochondrial tRNAs, although their queuine rescue effect is complex. PreQi strongly and selectively reduces the translation of highly abundant mRNAs such as those of ribosomal proteins, consistent with its detrimental effect on proliferation. Finally, preQi -dependent reduction on translation is not restricted to the codons read directly by the cognate tRNAs, rather, it is highly selective for A / U-ending codons, suggesting a global consequence on decoding of all amino acids.Genome-wide CRISPR screen identifies new cellular pathways in preQ 1 -dependent cell proliferation
[0102] To identify additional cellular pathways involved in preQi -dependent cell proliferation, the inventors performed genome-wide CRISPR screen. The screen used Brunello genome-wide CRISPR library that contains four sgRNAs for each annotated human gene for a total of 77,441 sgRNAs in the library (Doench et al., 2016). The inventors collected lentivirus infected cells in the absence and presence of preQi after 5 days and sequenced their sgRNA libraries that were integrated into the genomic DNA (FIG. 13A). The inventors first generated single clonal HEK293T cells that stably expressed Cas9 protein (Cas9 stable cells). Two hundred million Cas9 stable cells were infected with lentivirus packaged sgRNA library toensure average coverage of over 500 copies of each sgRNA. Infected cells after puromycin selection were separated into two groups for mock or preQi treatment. The inventors amplified sgRNAs in genomic DNA from over 40 million cells for each condition to ensure appropriate coverage and performed next-generation sequencing.
[0103] The inventors analyzed the enriched sgRNAs in preQi treated versus untreated cells using STARS (Doench et al., 2016) and found 40 genes enhancing and 11 genes reducing proliferation (FIG. 6A). For the 40 genes, at least 2, and for many all 4 sgRNAs (FIG. 13B) as well as the average fold change showed significant enrichment (FIG. 6B). The sgRNAs for the Q-modification writer complex QTRT1 and QTRT2 were the most enriched (FIG. 6C). This positive control corresponded to the QTRT1 and QTRT2 knockdown results (FIG. 2) and validated the CRISPR approach for the positive identification of new genes and pathways involved in preQi effect on proliferation.
[0104] The inventors carried out gene ontology analysis of the genes whose depletion alleviated the preQi effect on proliferation (FIGs. 6D, 13C, 13D). Top hits were subunits of vacuolar ATPases (V-ATPase) that acidifies intracellular organelles, vesicles, and endosome using ATP hydrolysis (Abbas et al., 2020; Collins and Forgac, 2020; Vasanthakumar and Rubinstein, 2020; Wang et al., 2020) followed by proteins localized in cellular organelles and trans-organelle transport between endoplasmic reticulum (ER) and Golgi (Aoki et al., 2009; Cui et al., 2022; Garcia-Cazorla et al., 2022; Tagaya et al., 2014). The inventors performed clusters of protein-protein interaction enrichment analysis using STRING (Szklarczyk et al., 2021) and found several major complexes or multiple components involved in the same cellular pathway (FIG. 6E). Aside from the obvious QTRT1 / QTRT2 complex, new pathways with significant enrichment in corresponding sgRNAs included regulation of cholesterol biosynthesis (FIG. 6F, SCAP, MBTPS1, MBTPS2)(Brown and Goldstein, 1999; Hua et al., 1996; Lee et al., 2020; Rawson et al., 1997; Sakai et al., 1998), fatty acid synthesis (FIG. 6G, ACSL3, ACACA, ACLY)(Nakahara et al., 2012; Yang et al., 2022; Yao and Ye, 2008; Yoon et al., 2021), Golgi-ER trafficking (FIG. 6H, NBAS, USE1, COG3)(Aoki et al., 2009; Cui et al., 2022; Garcia-Cazorla et al., 2022; Tagaya et al., 2014), and the V-ATPase (FIG. 61).
[0105] Taken together, the genome-wide CRISPR screen identifies the expected QTRT1 / QTRT2 genes, as well as many genes involved in the pathways of V-ATPase function, cholesterol biosynthesis regulation, fatty acid metabolism, and organelle trafficking. These pathways have not been associated with RNA biology previously, suggesting a vast extent of cellular crosstalk in facilitating and mitigating preQi effects.Multiple pathways mediate preQl effect on tRNA depletion and proliferation
[0106] The inventors followed up the CRISPR screen results by knocking down individual gene products and testing for effects on cell proliferation and tRNA levels. The inventors selected 8 genes that had the lowest p and FDR values in the screen aside from QTRT1 and QTRT2, representing four cellular pathways of cholesterol biosynthesis (SCAP, MB TPS 1, MBTPS2), fatty acid biosynthesis (ACSL3), Golgi-ER trafficking (NBAS), and vacuolar ATPase (ATP6V0D1, ATP6V1B2, ATP6V0B). Knocking down SCAP (FIG. 7A) resulted in a small reduction in proliferation in mock treatment, but the reduction in proliferation upon preQi treatment was significantly diminished compared to si-CTRL (FIGs. 7B, 14A). Knocking down MB TPS 1 had little effect on proliferation without preQi, and preQi treatment resulted in much smaller reduction (FIG. 14B). Knocking down MBTPS2 had a large effect on proliferation without preQi, and the reduction of preQi treatment was less severe compared to si-CTRL (FIG. 14C). Knocking down ACLS3 (FIG. 7C) slightly increased proliferation without preQi, and preQi treatment produced a smaller differential effect compared to si- CTRL (FIGs. 7D, 14D). Knocking down NBAS (FIG. 7E) had little effect on proliferation without preQi, whereas the differential proliferation effect was smaller with preQi (FIGs. 7F, 14E). For the V-ATPase subunits ATP6V0D1, ATP6V1B2, and ATP6V0B (FIGs. S7F, 14G, 14H), their knockdown effect on proliferation was variable without preQi, and the differential effect on proliferation with and without preQi was smaller in each knock-down. These results were consistent with the expectations of the CRISPR screen for these individual genes.
[0107] To understand how these genes were involved in mediating preQi -dependent proliferation, the inventors performed Northern blots for the four cognate tRNAs upon individual knock-down of SCAP, ACSL3, and NBAS. As exemplar, tRNATyrwas significantly reduced upon preQi treatment in si-CTRL, whereas its level was largely maintained upon SCAP knock-down (FIG. 7G). Similar findings could be found for all four cognate tRNAs (FIG. 7H) which exhibited varying magnitudes of reduction for individual tRNAs with preQi in control cells (FIG. 4B). The same type of analysis showed that ACSL3 knock-down (FIG. 71) and NBAS knock-down (FIG. 7 J) desensitized the preQi -dependent reduction of cognate tRNA levels compared to si-CTRL. These results indicate that these new pathway proteins facilitated preQi -dependent cognate tRNA reduction in the wild-type cells.
[0108] FIG. 7K summarizes a functional model of certain aspects herein. PreQi and queuine compete for the modification of tRNATyr / Hls / Asn / Aspby the same enzyme. Q- modification blocks preQi -modification of the same tRNA. PreQi modified tRNA is defective in charging, decoding, and undergoes more rapid degradation. These tRNA property changes cumulatively decrease cell proliferation by impacting the translation of ribosomal proteinsrequired for proliferation. tRNA depletion is enhanced by genes in the cellular pathways of regulation of cholesterol biosynthesis, fatty acid synthesis, and Golgi-ER trafficking.Example 2: Two microbiome metabolites competing for tRNA modification impact mammalian cell proliferation
[0109] In this work, the inventors expand the microbiome-mammalian host interaction through tRNA and translation into two metabolites that act on cell proliferation in opposing directions. The first metabolite queuine is derived from the catabolic product of bacterial queuosine tRNA modification and is taken up by mammalian cells to generate their own Q- tRNA modifications. The mammalian Q-tRNA modification has been studied for decades, and yet, this tRNA modification seems to only confer subtle phenotypes in cells and whole organisms (Dixit et al., 2021; Hayes et al., 2020; Huber et al., 2022; Johannsson et al., 2018; Kulkami et al., 2021; Marks and Farkas, 1997; Meier et al., 1985; Muller et al., 2015; Muller et al., 2019; Nagaraja et al., 2021; Rakovich et al., 2011; Schaefer et al., 2010; Tuorto et al., 2018; Wang et al., 2018; Zaborske et al., 2014; Zhang et al., 2020a). PreQi is an upstream metabolite in the same pathway that produces bacterial Q-tRNA modification. PreQi has been shown to be a substrate for the mammalian Q-modification writer enzyme in the test tube (Bessler et al., 2022; Fergus et al., 2021). The inventors found that preQi has a profound effect on mammalian cells, and can reduce cell proliferation, but maintains the ability of cells to proliferate. The preQi -dependent proliferation effect is blocked or rescued by queuine, but the amount of queuine needed to fully overcome the preQi effect is cell type dependent, ranging from 1 : 100 in HEK293T cells to 1 :1 in BMDC cells. The demonstration that both preQi and queuine circulate in the mouse blood and are detectable in many mouse tissues indicate that proliferating mammalian cells are poised to respond to the fluctuating preQi and queuine levels derived from microbiome components and activity or diet.
[0110] PreQi specifically reduces tRNA levels for the cognate tRNAs, and this reduction in specific tRNA levels results in translational repression of ribosomal protein genes. Since preQi is incorporated directly into tRNAs, the preQi modified tRNAs seem to be the target of more rapid degradation by yet to be identified cellular ribonucleases. PreQi nucleotide has a positive charge which is not present in any known mammalian wobble anticodon tRNA modifications (Boccaletto et al., 2022; Lei et al., 2023). The anticodon loop is a hotspot of tRNA degradation (Lyons et al., 2018); therefore, this extra positive charge at the wobble anticodon position may mark these tRNAs for accelerated degradation. Unexpectedly, the translation effect of preQi -dependent tRNA depletion is not restricted to the decoding of justthe codons of the four amino acids read by the cognate tRNAs, rather, preQi exerts a global reduction of translation of all A / T-ending codons. Ribosome takes longer to read A / T-ending codons (Chevance et al., 2014; Stadler and Fire, 2011). PreQi -dependent tRNA depletion may exacerbate this and disproportionally affect translation of highly abundant mRNAs such as ribosomal proteins that must be translated at high levels for proliferation.[oni] The inventors also expand the cellular pathways involved in preQi and Q biology beyond the two mammalian genes of QTRT1 and QTRT2 that form the enzymatic complex for Q- and preQi -tRNA modification. The CRISPR screen and validation identify multiple genes in other cellular pathways that can partially rescue the preQi effects on proliferation upon knockdown, like that exerted by queuine or QTRT1 or QTRT2 knockdown. These new genes and pathways encompass the V-ATPase complex that acidifies intracellular vesicles, organelles, and endosomes (Abbas et al., 2020; Collins and Forgac, 2020; Vasanthakumar and Rubinstein, 2020; Wang et al., 2020), ER and Golgi-localized proteases and accessory factor that regulate cholesterol biosynthesis (Brown and Goldstein, 1999; Hua et al., 1996; Lee et al., 2020; Rawson et al., 1997; Sakai et al., 1998), enzymes required for fatty acid synthesis (Nakahara et al., 2012; Yang et al., 2022; Yao and Ye, 2008; Yoon et al., 2021), and genes involved in Golgi-ER trafficking (Aoki et al., 2009; Cui et al., 2022; Garcia-Cazorla et al., 2022; Tagaya et al., 2014). Therefore, the microbiome-host interaction shown herein on tRNA modification has identified connections of RNA biology to new cellular pathways that center around cholesterol and fatty acid, and intracellular vesicle trafficking.
[0112] Many crucial components and mechanism of Q and preQi biology remain unknown. These include the queuine and preQi transporters in eukaryotes (Fergus et al., 2015; Yuan et al., 2019), the biological reason for localizing the QTRT1 / QTRT2 enzyme on the mitochondrial membrane (Boland et al., 2009b), glycosylation of Q-modified tRNATyrand tRNAAsp(Kasai et al., 1975; Kasai et al., 1976), the function of mitochondrial Q-tRNA modifications (Randerath et al., 1984; Suzuki et al., 2020), to name a few.
[0113] The combinatory action of preQ 1 and queuine provides the opportunity to examine the host cell and tissue response to microbiome dynamics at the organismal level. Upon bacterial turnover in the gut, preQi would be immediately available, whereas the availability of queuine requires additional enzymatic reactions and likely takes longer to enter the blood stream. This differential timing may prime certain cells, such as immune cells that must respond to these circulating metabolites and others to undergo rapid proliferation. Intriguingly, a strong preQi effect observed herein is for BMDC cells that respond fully at 100 nM preQi and require an equal molar queuine to fully restore its proliferation. This is in line with thetremendous effects of gut microbiome on the cellular immunity (Belkaid and Hand, 2014; Lazar et al., 2018; Liu et al., 2021; Wu and Wu, 2012; Zheng et al., 2020), and preQi and queuine may make a significant contribution to tuning the immune response.
[0114] In certain aspects, the inventor show here that two metabolites from the same pathway in the gut bacteria can act on mammalian host cell proliferation in opposing ways. Mechanistically, preQi incorporation in cognate tRNAs leads to their depletion with the consequence of reducing translation of house-keeping genes required for proliferation. Genome-wide CRISPR screen identifies genes in multiple new pathways that have not been associated previously with RNA biology. Future work will define how these pathways are involved in the regulation of cell proliferation through tRNA modification, and how these microbiome-derived metabolites affect physiology in different mammalian cell types and tissues.Example 3: Experimental Model And Subject DetailsCells:
[0115] HEK293T cells were cultured in 37 °C incubator with 5% CO2 using complete DMEM medium without pyruvate (Cytiva) containing 10% FBS (ThermoFisher) and 1% Pen / Strep (ThermoFisher). HEK293T cells depleted from queuosine tRNA modification (0Q) were obtained by culturing cells using complete DMEM medium containing 10% dialyzed FBS (ThermoFisher) and 1% Pen / Strep for 2-3 weeks. Queuosine modification levels were measured by Acrylamidophenylboronic acid (APB, Frontier Scientific)-gel based Northern blot (Zhang et al., 2020b).
[0116] MEF cells were cultured in 37 °C incubator with 5% CO2 using complete DMEM medium with pyruvate (ATCC) containing 10% FBS and 1% Pen / Strep. 0Q MEF cells were obtained in the same way as HEK293T cells by culturing MEF cells with dialyzed medium for 2-3 weeks and verified as above.
[0117] B16-OVA cells were cultured in 37 °C incubator with 5% CO2 using DMEM medium with pyruvate (ThermoFisher). 0Q B16-OVA cells were obtained and verified as described for HEK293T cells.
[0118] Bone marrow-derived dendritic cells (BMDCs) were generated from 6-8 week old female C57BL / 6 mice. Bone marrow cells were collected from femora and tibiae and plated at IxlO5cells per well in a flat-bottom, non-tissue culture treated 96-well plate (GenClone) in 150 pL of complete RPMI-1640 (ThermoFisher) supplemented with 10% volume / volume (v / v) dialyzed fetal bovine serum (ThermoFisher), L-glutamine (2 mM ThermoFisher), penicillin-streptomycin (ThermoFisher), MEM non-essential amino acids (Coming), HEPES (10 mM; ThermoFisher), sodium pyruvate (1 mM; Coming), and P-mercaptoethanol (55 pM ThermoFisher). Recombinant murine GM-CSF (15 ng / mL Peprotech) was added to the complete RPMI medium.Mice:
[0119] Female C57BL / 6J mice (wild-type) were obtained from the Jackson Laboratories. Animals were housed in specific pathogen-free conditions at The University of Chicago, and all experiments were performed in accordance with the US National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by The University of Chicago Institutional Animal Care and Use Committee.LC / MS / MS measurements of preQl, queuine, queuosine and preQlsine:
[0120] Queuine, Queuine N15, queuosine, PreQlsine standards'. Queuine dihydrochloride was synthesized by Synthenova SAS using the protocol from Brooks et al. (Brooks et al., 2010). Its purity was determined at 99% by HPLC analysis. PreQl dihydrochloride was purchased from Sigma-Aldrich (SML0807).
[0121] Synthesis scheme shown in Fig. SIB: preQi was synthesized by catalytic reduction of the nitrile function1of compound I2in presence of ammonia under hydrogen pressure before being deprotected in an acid medium. Nitrile 1 was formed in two stages: before being tritylated in position 2, the pyrrolopyrimidinone bicycle was performed by reacting methyl 2-cyano-2- formyl acetate 2 and 2,6-diaminopyrimidin-4-one 3 according to the work of Migawa et al.3. The Queuine itself was obtained by deprotection in an acid medium of compound 4 resulting from a reductive amination reaction between amine 5 and aldehyde 62. Aldehyde 6 was produced by reduction of nitrile 1 with Dibal-H. The modified nucleosides Queuosine and PreQlsine were obtained after several deprotection steps following the reductive amination reactions of the respective amines 5 and benzylamine with aldehyde 8. This later was synthesized by glycosylation of aldehyde 6 using l-acetyl-2,3,5-tribenzoyl-ribose. Finally, the inventors synthesized "heavy queuine" by introducing three15N isotopes into its formula. The heavy queuine was isolated after a final deprotection step that followed a type 2 nucleophilic substitution of brominated compound 94by the heavy amine PreQi5. Heavy PreQi was formed in several steps from15N3-2,6-diaminopyrimidin-4-one 10 by an intermolecular cyclisation reaction between methyl 2-cyanoacetate 11 and commercial15N3-guanidinium chloride 12.Metabolites extraction
[0122] Each mouse tissue was crushed with 1 * PBS. 100 pL of homogenized mixture were taken to process to extraction of metabolites. 450 pL of methanol / water buffer (ratio 8 / 1) previously cooled to -20°C and 1 pL of 10 pM queuine-N15 were added. The samples were incubated with orbital agitation at 4°C for 20 minutes, then centrifuged at 16000 / g at 4°C for 5 minutes. The supernatants were filtered with Captiva EMR-Lipid plate (Agilent) to remove phospholipids. The samples were dried in vacuum and resuspended in 5 mM ammonium acetate pH 5.3 before LC-MS / MS analysis.Nucleoside mass-spectrometry analysis: (LC-method)
[0123] 5 pL samples were separated by reverse phase ultra-performance liquid chromatography (Nexera LC-40 system, Shimadzu) on a C18 column (Synergi™ Fusion-RP; 4 pm particle size, 250 mm x 2 mm, 80 A, Phenomenex). The mobile phases consisted of 5 mM ammonium acetate pH 5.3 (solvent A) and pure acetonitrile (solvent B). The 30-minute elution gradient started with 100% phase A followed by a linear gradient to 8% solvent B at 13 min. Solvent B was increased further to 40% over 10 minutes. After 2 minutes, solvent B was decreased back to 0% at 25.5 minutes. Initial conditions were regenerated by rinsing with 100% solvent A for additional 4.5 minutes. The flow rate was 0.4 mL / min and the column temperature was 35 °C.
[0124] (MRM method) Nucleoside detection was performed using a Shimadzu TripleQuad NX8060 in positive ion mode. The ESI source settings were set as described in Extraction of total RNA from gut microbiome and RNA sequencing:
[0125] RNA was extracted from human stool samples and prepared for MSR-seq as previously described (Alexander and Raicht, 1998; Watkins et al., 2022; Zoetendal et al., 2006). Briefly, samples were deacylated without periodate. After the first ligation reaction, samples were split into two parts. One aliquot was treated with AlkB demethylase and the other was treated with same solutions without AlkB (mock). Both samples were again split into two equal parts, one set of aliquots were treated with sodium periodate as previously described for PAQS-seq (Katanski et al., 2022), the other set of aliquots was untreated. These 4 samples were then used in reverse transcription following the usual MSR-seq protocol. MS was operated in dynamic MRM mode with a retention time window of 3 min and a maximum cycle time set at 297 ms.Extraction of total RNA from gut microbiome and RNA sequencing:
[0126] RNA was extracted from human stool samples and prepared for MSR-seq as previously described (Alexander and Raicht, 1998; Watkins et al., 2022; Zoetendal et al., 2006). Briefly, samples were deacylated without periodate. After the first ligation reaction,samples were split into two parts. One aliquot was treated with AlkB demethylase and the other was treated with same solutions without AlkB (mock). Both samples were again split into two equal parts, one set of aliquots were treated with sodium periodate as previously described for PAQS-seq (Katanski et al., 2022), the other set of aliquots was untreated. These 4 samples were then used in reverse transcription following the usual MSR-seq protocol.Cell proliferation assay with queuine preO 1 treatment:
[0127] 0Q HEK293T, MEF, or B16-OVA cells in 10-cm / 15-cm plates were grown to 80% confluency and collected using 0.25% trypsin (Trypsin). Cells were counted using trypan blue stain (ThermoFisher) and cell counter (ThermoFisher Countess II). Equal amount of trypan blue and cell mixture was mixed. 10 pl mixture was loaded onto each side of the chamber slide and counted using cell counter. Live cell concentration and percentage were recorded. For each queuine (Toronto Research Chemicals) and / or preQi (Cayman Chemical) treatment, six milliliters of 5 * 104cells / ml mixture in 15-ml conical tubes were prepared. Queuine and / or preQi were added to final concentrations as indicated. 8 replicates of 100 pl cell mixture from each condition were then transferred into 96-well plates. Control (ctrl) wells with only medium were also prepared. 6 plates of cells were prepared for 6-day measurements (day 0 to day 5). All cells were incubated at 37 °C for 2 hours to allow cells to adhere to the bottom. 10 pl CCK- 8 reagent (Dojindo) was then added to each well of the “day 0” plates using multichannel pipets followed by incubation at 37 °C for 2 hours. Absorbance at 450 nm were measured using Synergy Neo microplate reader (BioTek). On day 1 to day 5, absorbance at 450nm was measured at the same time of each day.
[0128] For cell’s ability to proliferate-measurement after preQi treatment,_HEK293T cells depleted from queuosine modification (0Q cells) were cultured in 37 °C incubator with 5% CO2 using complete DMEM medium (10% dialyzed FBS and 1% Pen / Strep). PreQi was added to the medium 72 h, 48 h, 24 h, and 0 h to a final concentration of 1 pM before collection of cells. Cells were then collected at the same time using 0.25% trypsin and counted using trypan blue stain and cell counter. Cell concentration and percentage of live cells were recorded.
[0129] For proliferation rescue experiment with variable queuine concentrations, 0Q HEK293T cells were cultured to 60-70% confluency and then treated with 1 pM preQi for 24 h. Cell mixture at 5 * 104cells / ml with 1 pM preQi were prepared and transferred into 96-well plates as above. Absorbance at 450 nm was measured as above on day 0 to day 2. Queuine was added to the day 3 to day 5 96-well plates on day 2 to final concentrations of 0 nM, 1 nM, 10 nM, 100 nM, and 1000 nM. Absorbance at 450 nm was then measured as above on day 3 to day 5.
[0130] For proliferation with different percentage of fully Q-modified cells, two plates of 0Q HEK293T cells were cultured to 60-70% confluency followed by treatment with sterile H2O or 1 pM queuine for 24 hours to get 0Q cells or fully Q-modified (100Q) cells. 0Q and 100Q cells were collected using 0.25% trypsin and counted using Trypan blue stain. 0Q cells and 100Q cells were then mixed to get 0%, 25%, 50%, 75%, and 100% 100Q cells. The mixed cells were then used to perform cell proliferation assay as above under 1 pM preQi. 0Q cells without any treatment were used as control.BMDC Cell proliferation with preQ 1 / queuine treatment:
[0131] BMDC cells were obtained and cultured as described above. All treatment conditions were plated in quintuplicate in 96-well plate. Cells were fed at days 2 and 4 with 50 pL of complete RPMI medium (ThermoFisher) containing GM-CSF (Peprotech). Queuine and / or preQi were added as required to maintain the initial treatment concentration.
[0132] Live Cells were counted each day at the same time. Cells were resuspended and transferred into a 96-well V-bottom plate (Sarstedt). To loosen adherent cells, 100 pM of 10 mM EDTA (ThermoFisher) in l x dPBS (ThermoFisher) was added to the flat-bottom plate, which was then warmed at 37°C for 10 minutes. Following incubation, cells were resuspended and transferred to the corresponding well of the V-bottom plate. A final wash using 50 pL 1 x dPBS was used to transfer any remaining cells from the flat-bottom plate to the corresponding wells in the V-bottom plate. Immediately before data acquisition, the V-bottom plate was centrifuged at 1500 rpm (4°C) for 5 minutes, supernatant was removed, and pellets were resuspended in 130 pL MACS buffer (Miltenyi Biotec) with 0. 1 mg / mL DAPI (Biotium). Flow cytometry was completed using the NovoCyte Penteon (Agilent) and data analysis was completed using Flow Jo.
[0133] Flow cytometry was performed at the Cytometry and Antibody Technology Facility at University of Chicago.Proliferation measurements of QTRT1 and QTRT2 knockdown cells:
[0134] QTRT1, QTRT2, and Control shRNA lentiviral particles were obtained from Santa Cruz Biotechnology. The manufacturer’s manual was followed to obtain QTRT1 and QTRT2 stable knockdown cell lines. Briefly, lx105HEK29T 0Q cells were plated into each well of 12-well plate 24 hours prior to viral infection. After 24 hours of incubation, the medium was replaced with complete medium containing 8 pg / ml Polybrene (Santa Cruz). Lentiviral particles were thawed at room temperature and used promptly. Corresponding amount of QTRT1 or QTRT2 lentiviral particles were added to each well to infect the cells at Multiplicity of infection (MOI) 1, 5, and 10. The infected cells were continued incubated for 48-72 hours.Then, the culture medium was replaced with complete DMEM containing 5 pg / ml puromycin to select stable clones expressing the shRNAs. The transduced cells were continuously incubated with puromycin (Santa Cruz) containing medium for a few days and split 1 :3 to 1 :5 when it was necessary until the cells without virus transduction were completely dead. Stable knockdown cells were stocked and harvested for protein expression test by Western blot after the cells had been sufficiently expanded.
[0135] Proliferation assays with QTRT1 and QTRT2 stable knockdown cells were performed as above using 0Q QTRT1 or QTRT2 and shRNA control knockdown cells. Proliferation was done under queuine and preQi concentrations indicated in Fig. 2.Western blot:
[0136] Western blot was performed as previously reported (Mahmood and Yang, 2012; Towbin et al., 1979). Briefly, equal amounts of total protein lysate from each sample were boiled and reduced at 95 °C for 5 mins and loaded onto SDS-PAGE gel (ThermoFisher). The samples were then transferred to PVDF membrane (Millipore) using Bio-Rad semi-dry transfer system (Trans-Blot Turbo Transfer System) or wet transfer cell (Mini Trans-Blot Electrophoretic Transfer Cell). The membrane was then blocked using 5% (w / v) non-fat dry milk (Bio-Rad) in 1 * TBST (National Diagnostics) overnight at 4 °C. The membrane was then washed three times with l x TBST for 10 min each. The membrane was then sliced into several strips to blot target proteins at different molecular weights. The membrane strips were incubated with control or target antibodies in 1 x TBST with 5% (w / v) non-fat dry milk at 4 °C overnight. After primary antibody incubation, each membrane strip was incubated with corresponding secondary antibodies in l x TBST with 5% (w / v) non-fat dry milk at room temperature for 30 min. The membrane strips were washed three times for 10 min each and detected using ECL substrate (Bio-Rad) and Bio-Rad ChemiDoc.
[0137] Blot stripping and reprobing were performed using low pH protocol as previously reported(Alegria-Schaffer et al., 2009). Briefly, the membrane strips were incubated with stripping buffer (0.2 M glycine-HCl, 0.1% SDS, 1% Tween 20, pH 2.2) for 30 min at room temperature. The membrane strips were then washed three times with agitation for 10 minutes each in l x TBST buffer. The membrane strips were blocked with 5% (w / v) non-fat dry milk in 1 x TBST buffer prior to reprobing.PreQlsine detection of cognate tRNAs by chemical tagging and Northern blots:
[0138] PreQlsine has a primary amine that can react with NHS esters. 0Q HEK293T cells were cultured to -80% confluency and treated with preQi and / or queuine at indicated concentrations for 24 hours. Cells were then collected, and total RNA were extracted usingTRIzol reagent (ThermoFisher) according to manufacturer’s manual. Northern blot was performed as previously described (Zhang et al., 2020b). Briefly, 6 pg of total RNA from each sample was deacylated in 20 pl 100 mM NaHCO3 / Na2CO3buffer (pH 9) at 37 °C for 30 min. Deacylated RNA was purified using Zymo RNA Clean & Concentrator Kit (Zymo) and eluted in 8 pl sterile H2O. Each deacylated sample was then split into two equal parts (4 pl each). 1 pl 1 M NaHCO3 / Na2CO3(pH 9) buffer and 1 pl 250 mM NHS ester, m(dPEG)24-NHS (ThermoFisher) or 1 pl DMSO (untreated control) was added to each sample, respectively. The reaction mixture was then incubated at room temperature for 30 minutes. Equal amount (6 pl) of 2* acidic denaturing RNA loading buffer (7M urea, 0.03% (w / v) Bromophenol blue, 0.03% (w / v) Xylene cyanol, 12% (w / v) Ficoll, 2* TBE, O. lM NaOAc / HOAc, pH 4.8) was added to each sample. All samples were loaded onto a pre-run 10% acidic urea-denaturing PAGE gel containing 100 mM NaOAc / HOAc, pH 4.8 for electrophoresis separation. The gel was run at constant power until the Xylene cyanol band was ~4 cm to the bottom of the gel. The gel was then stained with 1 x SYBR gold (ThermoFisher) in 1 x TBE buffer to check RNA quality. The RNA was then transferred to positively charged Nylon membrane (Cytiva Hybond-XL membrane) using gel dryer (Bio-Rad) under vacuum or using semi-dry transfer system (BioRad). The gel-membrane assembly was then soaked in deionized water to separate the gel and membrane. The RNA was crosslinked to membrane under 254 nm UV twice with 120 mJ / cm2each time. The membrane was then blocked with hybridization buffer (20 mM phosphate, pH 7, 300 mM NaCl, 1% SDS) at room temperature for 30 min followed by incubation with 200 pmol biotinylated DNA probe (Table S3) against Q-modified tRNA in 50 ml hybridization buffer in 60 °C hybridization oven (UVP) with rotation overnight. The membrane was washed with washing buffer solution (20 mM phosphate (pH 7.2), 300 mM NaCl, 2 mM EDTA, and 0.1% SDS) twice for 30 min each in 60 °C hybridization oven. The membrane was incubated with streptavidin-HRP (Genscript, 1 :5000 - 1 :1000 dilution) in 30 mL hybridization buffer for 30 min at room temperature. The membrane was washed three times for 10 min each in 30 ml washing buffer. The signal was detected using ECL substrate (Bio-Rad) and Bio-Rad ChemiDoc. The membrane was then stripped by incubation with boiling 1% SDS solution for 30 second followed by incubation at room temperature for 15 min twice. The stripped membrane was then incubated with Northern blot probes of other tRNA.Detection of queuosine modification levels using APB gel based Northern blot:
[0139] The APB gel based Northern blots were performed as previously reported (Zhang et al., 2020b). Briefly, 3 pg of cellular or mouse tissue total RNA with different preQl / queuine treatment was deacylated in 10 pl 100 mM Tris-HCl buffer (pH 9) at 37 °C for 30 min. Equalamount (10 pl) of 2 / denaturing RNA loading buffer (7M urea, 0.03% (w / v) Bromophenol blue, 0.03% (w / v) Xylene cyanol, 12% (w / v) Ficoll, 2* TBE) was added to each sample. All samples were loaded onto a pre-run 10% denaturing PAGE gel with 0.5% (w / v) APB (Frontier Scientific). The gel was run at constant power in the cold room (4 °C) for ~2 hours until the Bromophenol blue bands came out. The gel was then stained with 1 x SYBR gold, and the subsequent Northern blot steps were performed as above.PreQl Injection and mouse tissue harvest:
[0140] Mice were injected intraperitoneally with 100 pL of either sterile saline or 10 mg / mL preQi in sterile saline every 24 hours for three consecutive days. After 24 hours following the final injection, mouse tissues (liver, lung, kidney, heart) were harvested, frozen and stored as previously described (Kadoki et al., 2017; Pandey et al., 2020). Mice were anesthetized with 2,2,2-tribromoethanol (250-500 mg / kg) (ThermoFisher) and perfused transcardially with PBS containing 10 mM EDTA. Immediately after perfusion and dissection, tissues were placed in RNA-preserving solution (5.3 M ammonium sulfate, 25 mM sodium citrate, 20 mM EDTA) and kept at 4°C overnight prior to transfer at -80°C for storage.Mouse whole-tissue RNA extraction:
[0141] Whole-tissue RNA extraction was performed as previously described (Pandey et al., 2020). Briefly, tissues stored in RNA-preserving solution were thawed and transferred to 2 mL tubes containing 700-1500 pL (depending on tissue) of PureZOL (Bio-Rad). Tissues were lysed by adding 2.8-mm ceramic beads (OMNI International) and running 1-3 cycles of 5-45 s at 3500 rpm on the PowerLyzer 24 (Qiagen). For liver, brain, and small intestine samples, tissues were lysed with 3-5 mL using M tubes (Miltenyi biotec) and running 1-4 cycles of the RNA_02.01 program on the gentleMACS Octo Dissociator (Miltenyi biotec). Next, lysates were processed in deep 96-well plates (USA Scientific) by adding chloroform for phase separation by centrifugation, followed by precipitation of total RNA in the aqueous phase using magnetic beads coated with silane (Dynabeads MyOne Silane, ThermoFisher), buffer RLT (Qiagen), and ethanol. Genomic DNA contamination was removed by on-bead DNase I (ThermoFisher) treatment at 37°C for 20 min. After washing steps with 80% ethanol, RNA was eluted from beads. This RNA extraction protocol was performed on the Bravo Automated Liquid Handling Platform (Agilent)(Pandey et al., 2020). Sample concentrations were measured using a Nanodrop One (Thermo Scientific). RNA quality was confirmed using a Tapestation 4200 (Agilent).Mouse Tumor Xenograft Model:
[0142] The abdomen of mice used for experiments were shaved using a pet trimmer (Wahl Bravmini) on the day before tumor cell inj ections. Ovalbumin-expressing B 16.F 10 (B 16-OVA) cell lines were cultured with complete DMEM medium with 10% dialyzed FBS at 37°C. For consistency across experiments, tumor cells were thawed from liquid nitrogen stocks frozen in 90% FBS and 10% DMSO two days prior to injections and passaged twice in total. For preQi treated Bl 6-OVA cells, additional preQi -spiked complete DMEM media was added such that the final preQi concentration was 10 pM for 12 hours. Mice were injected with 100,000 B16- OVA cells resuspended in 100 pL of sterile saline in the flank. Mice were injected intraperitoneally every other day beginning on day 2 with 100 pL of sterile saline or 100 pL of 2.5 mg / mL preQi in sterile saline. Tumor volumes were calculated using the formula 1 / 2 x D x d2, where D is the major axis and d the minor axis (in mm). Mice were sacrificed when tumors reached 1000 mm3or upon ulceration.MSR-seq ofpreOl and / or queuine treated total RNA samples:
[0143] 0Q HEK293T cells were cultured to 80% confhiency and treated with preQ 1 and / or queuine at concentrations as indicated in Fig. 4A for 24 hours. Total RNA was extracted using TRIzol reagent. 1 pg total RNA from each sample was used to build MSR-seq sequencing libraries as previously reported (Watkins et al., 2022). tRNA abundance and chargins level measurements by Northern blot:
[0144] The measurement of tRNA abundance by Northern blot was similar to the Q modification measurement described above. To measure charging, 3 pg of total RNA in 5 pl from different preQl / queuine treatment condition was mixed with 5 pl 2 acidic denaturing RNA loading buffer. ±Deacylated total RNA samples were prepared with ± 100 mM Tris-HCl buffer (pH 9) treatment as above and used as controls. All samples were loaded onto a pre-run 10% acidic denaturing sequencing PAGE gel containing 0.1 M NaOAc / HOAc, pH 4.8. The gel was run in cold room (4 °C) for ~24 hours using l x TAE buffer containing 0.1 M NaOAc / HOAc, pH 4.8. The gel was then transferred and blotted as described above.Sucrose gradient polysome profiles ofHEK293T cells in mock and 1 qM treated preQl:
[0145] Polysome profiling was derived from previously reported protocol with modifications (Ingolia et al., 2012). Briefly, 4x 15-cm plates (5x l06cells / plate) of 0Q HEK293T cells per sample were seeded 3 days before collection. PreQl was added to half of the plates to 1 pM final at the time of seeding cells and incubated for 3 days, 1 x PBS was added to the other half of the plates. On the day of collection, 5%-50% sucrose gradient was prepared in ultra-centrifuge tolerant tube (Seton) by combining 5% sucrose buffer (20 mM HEPES (pH 7.6), 100 mMKCl, 5 mM MgCh, 5% sucrose, 100 pg / ml CHX, 1% protease inhibitor (Roche),1% RNase inhibitor (ThermoFisher)) with 50% sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KC1, 5 mM MgCl2, 50% sucrose, 100 pg / ml CHX, 1% protease inhibitor, 1% RNase inhibitor) using Gradient Station (Biocomp). The sucrose gradient for all samples was stored in cold room (4 °C) before use. Cells were then treated with 100 pg / ml cycloheximide (CHX, Fisher Scientific) in complete medium for 7 min at 37 °C followed by immediate wash with ice-cold PBS buffer containing 100 pg / ml CHX twice. The cells were collected in 10 ml ice- cold PBS buffer containing 100 pg / ml CHX and pelleted by centrifugation at 500* g for 5 min. Cells from 4* 15-cm plates were combined as one sample. 4* volumes of lysis buffer (20 mM HEPES (pH 7.6), 100 mM KC1, 5 mM MgCl2, 1% Triton X-100, 100 pg / ml CHX, 1% protease inhibitor, 1% RNase inhibitor) were added to the combined cell pellet and the cells were lysed on ice for 20 min with periodic perturbation (or rotating at 4 °C). Supernatant lysate of each sample was collected after centrifugation at 16,000* g for 15 min. 4 pl Turbo DNase (ThermoFisher) was added to the lysate and incubated at room temperature for 15 min. The lysate samples were centrifuged at 16,000* g for 15 min after DNase treatment to remove any debris. OD260 of each lysate sample was measured using Nanodrop (ThermoFisher). The OD260 values of all samples were adjusted to the same using lysis buffer. 20 pl of the lysate was saved for Western blot validation. One-fifth of the lysate was saved as the input and the total RNA was extracted using TRIzol reagent (ThermoFisher). All the sucrose gradient tubes were weighed and balanced and 500 pl gradient solution was slowly removed from the top before loading. Equal amount (-500 pl) of the leftover 4 / 5 lysate was slowly and horizontally added to the top of the gradient while gently rotating the tube. The gradient tubes were then centrifuged at 28,000 rpm and 4 °C under vacuum for 3 hours using ultracentrifuge (Beckman Coulter Optima L-100XP, SW28.1 rotor). The sucrose gradient fractions (30 fractions, 590 pl each) were collected automatically using Sucrose Gradient Station and fraction collector (Gilson). All fractions were flash frozen using liquid nitrogen before RNA extraction and Western blot validation. 400 pl aliquot from disome and above (polysome) fractions were used to extract total RNA. Total RNA from these fractions were combined for polysome mRNA extraction using polyA+ RNA extraction kit (Promega) and sequencing.Polysome mRNA sequencing by MSR-seq:
[0146] Polysome mRNA sequencing libraries were constructed using MSR-seq protocol as described (Watkins et al., 2022). Briefly, 400 ng input and polysome polyA+ RNA was fragmented at 94 °C for 3 min using Magnesium fragmentation buffer (NEB) to get -300 nt fragment RNA. Fragment RNA larger than 200 nt was then purified using RNA clean and concentrator kit (Zymo) and eluted in 8 pl sterile H2O. 1 pl T4 PNK buffer and 1 pl 10 U / plT4 PNK (NEB) were added to the fragment RNA and incubated at 37°C for 30 min. T4 PNK was inactivated by incubation at 75 °C for 10 minutes followed by immediately incubation on ice. The entire reaction mixture (~10 pl) was used as the RNA input for MSR-seq. The MSR- seq libraries after PCR amplification were purified using AMPure XP beads or gel.Generation of OQ HEK293T cells that stably express Cas9 (Cas9 stable cells):
[0147] LentiCas9-Blast lentiviral prep (Addgene viral prep # 52962-LV) was used to generate Cas9 stable cells as previously reported (Sanjana et al., 2014). Briefly, several LentiCas9-Blast lentiviral prep dilutions were prepared using complete DMEM containing 8 pg / ml polybrene and added to 12-well plate together with no virus control medium. 1000 0Q HEK293T cells in 500 pl were added to each well to perform reverse transduction (Final MOIs were 0, 1, 5, 10) followed by incubation at 37 °C for 48-72 hours. The transduced cells were then treated with 5 pg / ml Blasticidin (ThermoFisher) in complete DMEM for several days until the cells without virus transduction were all dead. The resulting Cas9 stable cells (polyclonal) were then expanded for cell stock preparation, Cas9 expression validation and Cas9 stable single clone generation. Cas9 monoclonal cells were selected by limiting dilution. Briefly, the stable polyclonal Cas9 cells were treated with trypsin and separated into individual cells by passing through a serological pipet several times or by passing through a 40 pm cell strainer mesh (Coming). The cell concentration was then measured using cell counter. A serial dilution of the cells was done to get a final concentration of 5 cells / ml. 100 pl of the diluted cell solution was transferred to each well of the 96-well plate (average density was 0.5 cells / well). The cells were then incubated in 37 °C cell incubator without disturbance for 7-14 days. After 7 days, cell growth in each well was checked and wells with single colony were identified and recorded. The single clonal cells were transferred to larger tissue culture plates after they have sufficiently expanded. Cell stocks were prepared and Cas9 expression were checked by Western blot after enough cells were obtained. Single clonal Cas9 stable cell line with the highest Cas9 expression was selected for CRISPR screen.Genome-wide CRISPR screen for proteins that mediate preQl effect on cell proliferation:
[0148] Brunello sgRNA library lentiviral prep (Addgene #73178-LV) and Cas9 stable single clone were used to perform CRISPR screen as previously reported (Doench et al., 2016; Joung et al., 2017). Briefly, Cas9 stable single clone cells were treated with different concentrations of puromycin to determine the appropriate concentration of puromycin that killed the cells within 2-3 days. Then the Cas9 stable single clone cells were transduced with Brunello sgRNA library lentiviral prep at different MOIs to determine the condition that yields 20-30% infection efficiency. Ten 15-cm plates of Cas9 stable cells were cultured to 80-90%confluency and collected by centrifugation to pellet cells. Cells from all plates were then resuspended in complete DMEM containing 8 pg / ml polybrene and combined in 50-ml conical tube. Cell concentration was determined by cell counter. On average, over 500 copies of each sgRNA (~40 million infected cells) were maintained throughout the screen. 2* 108cells were aliquoted into new 50-ml conical tubes and diluted to 40 ml using complete DMEM containing 8 pg / ml polybrene. Corresponding amount of sgRNA library according to the MOI determined above was added to the cells and mixed well to get ~40 million infected cells. The cells and virus mixture were split equally into 12x 15-cm plates (~1.6>< 107cell s / pl ate). 48 hours after infection, the culture medium was replaced by compete DMEM without polybrene followed by incubation overnight. Three days after infection, the medium was replaced with complete DMEM containing 4 pg / ml puromycin to select stable cells expressing the sgRNA. Cells were treated with puromycin until cells without virus infection were all dead. Cells at confluency were collected and combined before subculture. When enough stable cells were obtained (~7 days after infection), cells were mixed and split for 500 nM preQi or control PBS treatments. At least 40 million infected cells were used for each replicate to keep the sgRNA coverage. Cells were treated with 500 nM preQi or PBS for 5 days before collection. Cells from each condition (~8* 15-cm plates) were collected and genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega).Next-seneration sequencing (NGS) library construction for CRISP R screen:
[0149] CRISPR screen NGS libraries were constructed in two PCR steps as previously reported (Webster et al., 2019). Briefly, 30* first PCR reactions with 10 pg genomic DNA each were performed using Ex Taq (TaKaRa) for each sample in 100 pl reaction. The sgRNA sequences were amplified for 18 cycles using primers CRISPR-F1 : 5’AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG (SEQ ID NO:1) and CRISPR-R1 : 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTATTATG (SEQ ID N0:2). All the first PCR reactions for each sample were pooled and mixed. 125 pl of the pooled first PCR reactions was cleaned using DNA clean and concentrator-25 (Zymo) and eluted in 100 pl sterile H2O. Secondary PCR reaction with 5 pl of the purified first PCR reaction mix was amplified for 15-18 more cycles in 100 pl using Ex Taq to add sequencing adapters and indices (See Table S4 for primer sequences). The PCR products were purified using DNA clean and concentrator-25 followed by gel purification with 5% or 6% TBE PAGE gel (Bio-Rad). The resulting libraries (372-379 bp) was quality checked by Bioanalyzer (Agilent) before sequencing on Illumina NextSeq platform with 75 bp flowcell using single end mode. On average, ~40 million reads were obtained for each sample.RT-gPCR:
[0150] Real-time quantitative PCR (qPCR) was performed using Superscript IV (SSIV, ThermoFisher) and LightCycler 480 SYBR Green I Master (Roche Diagnostics). Briefly, for cDNA synthesis, 2 pl 100-200 ng total RNA was mixed with 1 pl 50 pM Poly-d(T) primer (IDT, sequence in Table S5), 1 pl 10 mM dNTP mix (Promega), and 10.5 pl sterile H2O in PCR tubes. The RNA-primer mixture was incubated at 65 °C for 5 min on a thermocycler (Eppendorf) followed by incubation on ice / 4 °C for > 1 min. Superscript IV master mix containing 4 pl 5* SSIV Buffer, 1 pl 100 mM DTT, 0.25 pl RNaseOut RNase inhibitor (ThermoFisher), and 0.25 pl SSIV reverse transcriptase for each reverse transcription reaction was prepared. 5.5 pl of the master mix were then added to the annealed RNA-primer mix. Reverse transcription (RT) was carried out in the thermocycler at 55 °C for 60 min and the SSIV reverse transcriptase was inactivated by incubation at 85 °C for 10 min followed by immediately incubation at 4 °C. The RT mix was diluted with 20 pl sterile H2O and 2 pl RT mix was used for each qPCR reaction. Master mix containing 5 pl LightCycler 480 SYBR Green I Master and 3 pl primers mix (1.5 pM each) for each qPCR reaction was prepared and 8 pl aliquot was added to each well of the qPCR plate. 2 pl diluted RT mix was then added to each well. qPCR reactions were then carried out on Bio-Rad CFX qPCR instrument. Actin mRNA level was used as control. Target gene expression was evaluated by analyzing the qPCR results with AACT method.CRISPR candidate senes knockdown followed by cell proliferation:
[0151] Eight candidate genes were chosen for cell proliferation rescue validation. SiRNAs for the 8 genes were obtained from Sigma Mission predesigned siRNA collections (Sigma, sequences in Table S6). MISSION siRNA Universal Negative Control #1 was used as siRNA control (sequence proprietary to Sigma). siRNAs were transfected into the cells by Lipofectamine RNAiMax (ThermoFisher) using the reverse transfection method. Briefly, 120 pmol siRNA was diluted in 2 ml Opti-MEM I reduced serum medium (ThermoFisher) in 10- cm tissue culture plate. 20 pl of Lipofectamine RNAiMax was then added to each plate and mixed followed by incubation at room temperature for 10-15 min. 0Q HEK293T cells were collected and resuspended in complete DMEM without antibiotics at the same time. Cells were then counted, and 1.5 x 106cells were added to each plate. Complete DMEM without antibiotics were then added to each plate to 10 ml. Cells were incubated in 37 °C cell incubator for 3-4 days. The initial siRNA knockdown steps depleted the target genes at the beginning of the proliferation assay. Cells for each siRNA knockdown were collected and resuspended in DMEM without antibiotics. Cell concentrations were determined using cell counter. To checkthe effect of target gene knockdown on preQi inhibition effect, cells from each siRNA knockdown were treated with 0 nM, 100 nM, and 500 nM preQi. Six ml 5* 104cells / ml initial knockdown cells were prepared for each siRNA and each preQi condition. At the same time, transfection mix for each siRNA and each condition was prepared by diluting 12 pmol siRNA and 2 pl Lipofectamine RNAiMax in 200 pl Opti-MEM I reduced serum medium followed by incubation at room temperature for 10-15 min. Reduced amount of siRNA and Lipofectamine RNAiMax were used for each well of 96-well transfection to reduce cell death. The transfection mix was then added to the corresponding 6 ml 5* 104cells / ml cell mixture and mixed. 100 pl of the siRNA and cell mixture was then transferred to each well of the 96-well plate using multi-channel pipet (8 replicates per condition). The subsequent cell proliferation assay steps were then performed as described above. The leftover cells from each initial siRNA knockdown in 10-cm plates were collected and total RNA and lysate was extracted for qPCR and Western blot validation.CRISPR candidate senes knockdown Northern blot experiments:
[0152] Initial candidate gene knockdown in 10-cm plates was performed as above. After 3-4 days incubation of the siRNA, cells from initial knockdown were collected and resuspended in complete DMEM without antibiotics. Cell concentrations for each siRNA knockdown were measured. At the same time, 30 pmol siRNA was diluted in 500 pl Opti- MEM I reduced serum medium in each well of 6-well plate. 5 pl of Lipofectamine RNAiMax was then added to each well followed by incubation at room temperature for 10-15 min. 3.75 x 105cells in 2.5 ml complete DMEM without antibiotics from each initial knockdown experiment were added to corresponding wells of 6-well plates. Cells were then treated with PBS or 100 nM preQi for 4 days before collection (3 or 4 replicates for each condition). Total RNA and lysate were extracted from the collected cells and qPCR, or Western blot was performed to validate target gene knockdown. Northern blot was then performed as above mentioned using the extracted total RNA to check Q-modified tRNAs level changes after candidate gene knockdown.Example 4: Data AnalysisPAQS-seq of microbiome tRNA modification:
[0153] MSR-seq reads were first mapped to a reference genome composed of bacterial 5S rRNA sequences. Reference sequences for 5S rRNA were downloaded from the 5S rRNA database (http: / / combio.pl / rma / ). Sequences were combined from Bacteria (n = 7291), Archaea (n = 319), Eukaryota (n = 2861), mitochondria (n = 110), and plastids (n = 838). Full lineageswere assigned to each reference using the ETE3 NCBI Taxa toolkit in python (Huerta-Cepas et al., 2016). From here, tRNA reference genomes were retrieved from gtRNAdB (Chan and Lowe, 2016) for microbes from the most abundant class taxon: Lachnoclostridium_phytofermentans_ISDg, Erysipelothrix rhusiopathiae S Y 1027,Camobacterium maltaromaticum, Faecalibacterium_prausnitzii, Bacteroides dorei, Bifidobacterium_longum_subsp_longum_BBMN68, Clostridium beijerinckii,Roseburia_intestinalis_XB6B4, Ruminococcus_bromii_L2-63. These reference tRNA genomes were combined into a single reference fasta and tRNA-seq reads were mapped to this combine reference. Q-tRNA modification was detected by its characteristic deletion signatures(Katanski et al., 2022). Further analysis was performed with custom R scripts available on Github (https: / / github.com / ckatanski / PreQl).MSR-seq data analysis for tRNA:
[0154] Data analysis was performed as described previously (Watkins et al., 2022). Briefly, starting from index demultiplexed fastq data, paired end reads were split by internal barcode sequence using Je (Girardot et al., 2016) demultiplex with options BPOS = BOTHBM = READ 1 LEN = 4:6 FORCE = true C = false 6. Barcode sequences are available on Github at https: / / github.eom / ckatanski / Q paper (Katanski et al., 2022). Next read 2 files were used to map with bowtie2 (Langmead and Salzberg, 2012) with the following parameters: -q -p 10 - local — no-unal. Reads were mapped to curated list of non-redundant tRNA mature genes with tRNAScane score > 40 from hgl9. Bowtie2 output sam files were converted to bam files, then sorted using samtools. Next, IGV (Robinson et al., 2011) was used to collapse reads into 1 nt window. IGV output. wig files were reformatted using custom python scripts (available on GitHub at https: / / github.eom / ckatanski / Q paper). The bowtie2 output Sam files were also used as input for a custom python script using PySam, a python wrapper for SAMTools (Li et al., 2009) to sum all reads that mapped to each gene. For tRNA fragment analysis, related custom scripts were used to divide reads based on which 10 nt window the 3' end mapped to for each tRNA. Data were visualized with custom R scripts. All custom scripts are available on GitHub (https: / / github.com / ckatanski / CHRIS-seq). R script for the present analysis is available on Github (https: / / github.com / ckatanski / PreQl). Relative tRNA expression levels were calculated as the ratio of reads of a tRNA divided by the total number of reads. The expression level of an iso-acceptor is the sum of expression levels of all iso-decoders. The mean expression level of the two replicates were used when visualization.MSR-seq data analysis for mRNA:
[0155] Paired end reads were split by internal barcode sequence using Je demultiplex with options BPOS = BOTH BM = READ 1 LEN = 4:6 FORCE = true C = false 6. Barcode sequences are available on Github at https: / / github.eom / ckatanski / Q paper (Katanski et al., 2022). The quality of reads were checked by fastqc vO.11.9 (2015) and the reads were aligned to human hg38 genome (GRCh38.pl3. genome. fa) by STAR 2.7.9a (Dobin et al., 2013) with the human annotation file (gencode. v39. annotation. gtf) from GENCODE database (https: / / www.gencodegenes.org). Then the expression levels were counted and collected by RSEM vl.3.3(Li and Dewey, 2011). Low expressed genes were filtered by filterByExpr function with default parameters in edgeR v3.36.0 (Robinson et al., 2010) and the CPM (Counts Per Million reads mapped) and TPM (Transcripts Per Million) of each gene were calculated. The TPM in visualization was the mean of the two replicates. Translation efficiency (TE) of a gene was calculated as the expression level in the polysome sample divided by that in the input sample. Codon usage of a gene or a group of genes was defined as the ratio of each amino acid within CDS region of a gene or a group of genes. The gene ontology (GO) analysis was performed using the Gene Ontology Resource (http: / / geneontology.org) (Ashburner et al., 2000; Gene Ontology, 2021)CRISPR screen sequencing data analysis
[0156] Sequencing libraries containing Illumina sequencing indices and the raw reads were separated by indices right after sequencing. The raw reads were trimmed from 3’ end to 20-nt long by Cutadapt (Martin, 2011). The resulting sgRNA sequences were mapped to Brunello sgRNA library reference by Bowtie2 (Langmead and Salzberg, 2012). The mapped reads were sorted and indexed by SAMtools program (Danecek et al., 2021). Reads mapped to each sgRNA were counted by SAMtools idxstats function. Low expressed sgRNA were filtered by filterByExpr function with default parameters in edgeR. sgRNA with low replicate consistency (any two replicate expression level ratio > 5 fold) were filtered. The differential sgRNA expression analysis was performed by edgeR. The average difference of sgRNA levels between Ctrl and preQi treated samples were evaluated by STARS vl.3 (Doench et al., 2016) with 100 iterations. Genes with STARS p value < 0.05 and STARS pi score > 2.4503 were selected as significantly affected genes for downstream analysis. The p values in visualization were calculated by two-sided Mann-Whitney U test unless specifically indicated. The gene ontology (GO) analysis was performed using the Gene Ontology Resource (Ashbumer et al., 2000; Gene Ontology, 2021).
[0157] Clustering of protein-protein interaction enrichment analysis was done using STRING program (Szklarczyk et al., 2021) for genes with pi value > 2.4503 and STARS p<0.05. The meaning of network edges (interaction lines) was set to be evidence (medium), which the line thickness indicates the strength of data support. The interaction network was further processed by Inkscape (https: / / inkscape.org) to add more information. Proteins in the same pathway were grouped and annotated with colored shadow. Proteins in each pathway that were chosen for further experimental validation were highlighted with colored dots.* * *
[0158] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.REFERENCESThe following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
[0159] Abbas, Y.M., Wu, D., Bueler, S.A., Robinson, C.V., and Rubinstein, J.L. (2020). Structure of V-ATPase from the mammalian brain. Science 367, 1240-1246.
[0160] Alegria-Schaffer, A., Lodge, A., and Vattem, K. (2009). Performing and optimizing Western blots with an emphasis on chemiluminescent detection. Methods Enzymol 463, 573- 599.
[0161] Alexander, R.J., and Raicht, R.F. (1998). Purification of total RNA from human stool samples. Dig Dis Sci 43, 2652-2658.
[0162] Aoki, T., Ichimura, S., Itoh, A., Kuramoto, M., Shinkawa, T., Isobe, T., and Tagaya, M. (2009). Identification of the neuroblastoma-amplified gene product as a component of the syntaxin 18 complex implicated in Golgi-to-endoplasmic reticulum retrograde transport. Mol Biol Cell 20, 2639-2649.
[0163] Ashbumer, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., Davis, A.P., Dolinski, K., Dwight, S.S., Eppig, J.T., et al. (2000). Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-29.
[0164] Belkaid, Y., and Hand, T.W. (2014). Role of the microbiota in immunity and inflammation. Cell 757, 121-141.
[0165] Bessler, L., Kaur, N., Vogt, L.M., Flemmich, L., Siebenaller, C., Winz, M.L., Tuorto, F., Micura, R., Ehrenhofer-Murray, A.E., and Helm, M. (2022). Functional integration of a semi-synthetic azido-queuosine derivative into translation and a tRNA modification circuit. Nucleic Acids Res 50, 10785-10800.
[0166] Blanchet, S., Cornu, D., Hatin, I., Grosjean, H., Bertin, P., and Namy, O. (2018). Deciphering the reading of the genetic code by near-cognate tRNA. Proc Natl Acad Sci U S A 775, 3018-3023.
[0167] Boccaletto, P., Stefaniak, F., Ray, A., Cappannini, A., Mukherjee, S., Purta, E., Kurkowska, M., Shirvanizadeh, N., Destefanis, E., Groza, P., et al. (2022). MODOMICS: a database of RNA modification pathways. 2021 update. Nucleic Acids Res 50, D231-D235.
[0168] Boland, C., Hayes, P., Santa-Maria, I., Nishimura, S., and Kelly, V.P. (2009a). Queuosine Formation in Eukaryotic tRNA Occurs via a Mitochondria-localized Heteromeric Transglycosylase. J Biol Chem 284, 18218-18227.
[0169] Boland, C., Hayes, P., Santa-Maria, I., Nishimura, S., and Kelly, V.P. (2009b). Queuosine formation in eukaryotic tRNA occurs via a mitochondria-localized heteromeric transglycosylase. J Biol Chem 284, 18218-18227.
[0170] Brooks, A.F., Garcia, G.A., and Showalter, H.D.H. (2010). A short, concise synthesis of queuine. Tetrahedron Lett 57, 4163-4165.
[0171] Brown, M.S., and Goldstein, J.L. (1999). A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci U S A 96, 11041- 11048.
[0172] Chan, P.P., and Lowe, T.M. (2016). GtRNAdb 2.0: an expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic Acids Res 44, DI 84-189.
[0173] Chevance, F.F., Le Guyon, S., and Hughes, K.T. (2014). The effects of codon context on in vivo translation speed. PLoS Genet 10, el004392.
[0174] Collins, M.P., and Forgac, M. (2020). Regulation and function of V-ATPases in physiology and disease. Biochim Biophys Acta Biomembr 1862, 183341.
[0175] Cui, L., Li, H., Xi, Y., Hu, Q., Liu, H, Fan, J., Xiang, Y., Zhang, X., Shui, W., and Lai, Y. (2022). Vesicle trafficking and vesicle fusion: mechanisms, biological functions, and their implications for potential disease therapy. Mol Biomed 3, 29.
[0176] Danecek, P., Bonfield, J.K., Liddle, J., Marshall, J., Ohan, V., Pollard, M.O., Whitwham, A., Keane, T., McCarthy, S.A., Davies, R.M., et al. (2021). Twelve years of SAMtools and BCFtools. Gigascience 10.
[0177] Dixit, S., Kessler, A.C., Henderson, J., Pan, X., Zhao, R., D' Almeida, G.S., Kulkami, S., Rubio, M.A.T., Hegedusova, E., Ross, R.L., et al. (2021). Dynamic queuosine changes in tRNA couple nutrient levels to codon choice in Trypanosoma brucei. Nucleic Acids Res 49, 12986-12999.
[0178] Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21.
[0179] Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 184- 191.
[0180] Fergus, C., ALQasem, M., Cotter, M., McDonnell, C.M., Sorrentino, E., Chevot, F., Hokamp, K., Senge, M.O., Southern, J.M., Connon, S.J., et al. (2021). The human tRNA- guanine transglycosylase displays promiscuous nucleobase preference but strict tRNA specificity. Nucleic Acids Res 49, 4877-4890.
[0181] Fergus, C., Barnes, D., Alqasem, M.A., and Kelly, V.P. (2015). The queuine micronutrient: charting a course from microbe to man. Nutrients 7, 2897-2929.
[0182] Garcia-Cazorla, A., Oyarzabal, A., Saudubray, J.M., Martinelli, D., and Dionisi- Vici, C. (2022). Genetic disorders of cellular trafficking. Trends Genet 38, 724-751.
[0183] Gene Ontology, C. (2021). The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res 49, D325-D334.
[0184] Girardot, C., Scholtalbers, J., Sauer, S., Su, S.Y., and Furlong, E.E. (2016). Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers. BMC Bioinformatics 17, 419.
[0185] Harada, F., and Nishimura, S. (1972). Possible anticodon sequences of tRNA His , tRNA Asm , and tRNA Asp from Escherichia coli B. Universal presence of nucleoside Q in the first postion of the anticondons of these transfer ribonucleic acids. Biochemistry 11, 301- 308.
[0186] Hayes, P., Fergus, C., Ghanim, M., Cirzi, C., Burtnyak, L., McGrenaghan, C.J., Tuorto, F., Nolan, D.P., and Kelly, V.P. (2020). Queuine Micronutrient Deficiency Promotes Warburg Metabolism and Reversal of the Mitochondrial ATP Synthase in Hela Cells. Nutrients 12.
[0187] Hegedusova, E., Kulkarni, S., Burgman, B., Alfonzo, J.D., and Paris, Z. (2019). The general mRNA exporters Mex67 and Mtr2 play distinct roles in nuclear export of tRNAs in Trypanosoma brucei. Nucleic Acids Res 47, 8620-8631.
[0188] Hua, X., Nohturfft, A., Goldstein, J.L., and Brown, M.S. (1996). Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein. Cell 87, 415-426.
[0189] Huber, S.M., Begley, U., Sarkar, A., Gasperi, W., Davis, E.T., Surampudi, V., Lee, M., Melendez, J.A., Dedon, P.C., and Begley, T.J. (2022). Arsenite toxicity is regulated by queuine availability and oxidation-induced reprogramming of the human tRNA epitranscriptome. Proc Natl Acad Sci U S A 119, e2123529119.
[0190] Huerta-Cepas, J., Serra, F., and Bork, P. (2016). ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data. Mol Biol Evol 33, 1635-1638.
[0191] Hung, S.H., Elliott, G.I., Ramkumar, T.R., Burtnyak, L., McGrenaghan, C.J., Alkuzweny, S., Quaiyum, S., Iwata-Reuyl, D., Pan, X., Green, B.D., et al. (2023). Structural basis of Qngl-mediated salvage of the micronutrient queuine from queuosine-5'- monophosphate as the biological substrate. Nucleic Acids Res 51, 935-951.
[0192] Ingolia, N.T., Brar, G.A., Rouskin, S., McGeachy, A.M., and Weissman, J.S. (2012). The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat Protoc 7, 1534-1550.
[0193] Johannsson, S., Neumann, P., Wulf, A., Welp, L.M., Gerber, H.D., Krull, M., Diederichsen, U., Urlaub, H., and Ficner, R. (2018). Structural insights into the stimulation of S. pombe Dnmt2 catalytic efficiency by the tRNA nucleoside queuosine. Sci Rep 8, 8880.
[0194] Joung, J., Konermann, S., Gootenberg, J.S., Abudayyeh, O.O., Platt, R.J., Brigham, M.D., Sanjana, N.E., and Zhang, F. (2017). Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc 12, 828-863.
[0195] Kadoki, M., Patil, A., Thaiss, C.C., Brooks, D.J., Pandey, S., Deep, D., Alvarez, D., von Andrian, U.H., Wagers, A. J., Nakai, K., et al. (2017). Organism-Level Analysis of Vaccination Reveals Networks of Protection across Tissues. Cell 171, 398-413 e321.
[0196] Kasai, H., Kuchino, Y., Nihei, K., and Nishimura, S. (1975). Distribution of the modified nucleoside Q and its derivatives in animal and plant transfer RNA's. Nucleic Acids Res 2, 1931-1939.
[0197] Kasai, H., Nakanishi, K., Macfarlane, R.D., Torgerson, D.F., Ohashi, Z., McCloskey, J. A., Gross, H.J., and Nishimura, S. (1976). Letter: The structure of Q* nucleoside isolated from rabbit liver transfer ribonucleic acid. J Am Chem Soc 98, 5044-5046.
[0198] Katanski, C.D., Watkins, C.P., Zhang, W., Reyer, M., Miller, S., and Pan, T. (2022). Analysis of queuosine and 2-thio tRNA modifications by high throughput sequencing. Nucleic Acids Res 50, e99.
[0199] Kessler, A.C., Kulkami, S.S., Paulines, M.J., Rubio, M.A.T., Limbach, P.A., Paris, Z., and Alfonzo, J.D. (2018). Retrograde nuclear transport from the cytoplasm is required for tRNA(Tyr) maturation in T. brucei. RNA Biol 15, 528-536.
[0200] Kulkami, S., Rubio, M.A.T., Hegedusova, E., Ross, R.L., Limbach, P.A., Alfonzo, J.D., and Paris, Z. (2021). Preferential import of queuosine-modified tRNAs into Trypanosoma brucei mitochondrion is critical for organellar protein synthesis. Nucleic Acids Res 49, 8247- 8260.
[0201] Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359.
[0202] Lazar, V., Ditu, L.M., Pircalabioru, G.G., Gheorghe, I., Curutiu, C., Holban, A.M., Picu, A., Petcu, L., and Chifiriuc, M.C. (2018). Aspects of Gut Microbiota and Immune System Interactions in Infectious Diseases, Immunopathology, and Cancer. Front Immunol 9, 1830.
[0203] Lee, S.H., Lee, J.H., and Im, S.S. (2020). The cellular function of SCAP in metabolic signaling. Exp Mol Med 52, 724-729.
[0204] Lei, H.T., Wang, Z.H., Li, B., Sun, Y., Mei, S.Q., Yang, J.H., Qu, L.H., and Zheng, L.L. (2023). tModBase: deciphering the landscape of tRNA modifications and their dynamic changes from epitranscriptome data. Nucleic Acids Res 51, D315-D327.
[0205] Li, B., and Dewey, C.N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323.
[0206] Li, EL, Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment / Map format and SAMtools. Bioinformatics 25, 2078-2079.
[0207] Liu, Y., Wang, J., and Wu, C. (2021). Modulation of Gut Microbiota and Immune System by Probiotics, Pre-biotics, and Post-biotics. Front Nutr 8, 634897.
[0208] Lyons, S.M., Fay, M.M., and Ivanov, P. (2018). The role of RNA modifications in the regulation of tRNA cleavage. FEBS Lett 592, 2828-2844.
[0209] Mahmood, T., and Yang, P.C. (2012). Western blot: technique, theory, and trouble shooting. N Am J Med Sci 4, 429-434.
[0210] Marks, T., and Farkas, W.R. (1997). Effects of a diet deficient in tyrosine and queuine on germfree mice. Biochem Biophys Res Commun 230, 233-237.
[0211] Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 17, 3.
[0212] Meier, F., Suter, B., Grosjean, EL, Keith, G., and Kubli, E. (1985). Queuosine modification of the wobble base in tRNAHis influences 'in vivo' decoding properties. EMBO J 4, 823-827.
[0213] Muller, M., Hartmann, M., Schuster, I., Bender, S., Thuring, K.L., Helm, M., Katze, J.R., Nellen, W., Lyko, F., and Ehrenhofer-Murray, A.E. (2015). Dynamic modulation of Dnmt2-dependent tRNA methylation by the micronutrient queuine. Nucleic Acids Res 43, 10952-10962.
[0214] Muller, M., Legrand, C., Tuorto, F., Kelly, V.P., Atlasi, Y., Lyko, F., and Ehrenhofer-Murray, A.E. (2019). Queuine links translational control in eukaryotes to a micronutrient from bacteria. Nucleic Acids Res 47, 3711-3727.
[0215] Nagaraja, S., Cai, M.W., Sun, J., Varet, H., Sarid, L., Trebicz-Geffen, M., Shaulov, Y., Mazumdar, M., Legendre, R., Coppee, J.Y., et al. (2021). Queuine Is a Nutritional Regulator of Entamoeba histolytica Response to Oxidative Stress and a Virulence Attenuator. mBio 12.
[0216] Nakahara, K., Ohkuni, A., Kitamura, T., Abe, K., Naganuma, T., Ohno, Y., Zoeller, R.A., and Kihara, A. (2012). The Sjogren-Larsson syndrome gene encodes a hexadecenal dehydrogenase of the sphingosine 1 -phosphate degradation pathway. Mol Cell 46, 461-471.
[0217] Nishimura, S. (1983). Structure, biosynthesis, and function of queuosine in transfer RNA. Prog Nucleic Acid Res Mol Biol 28, 49-73.
[0218] Pandey, S., Takahama, M., Gruenbaum, A., Zewde, M., Cheronis, K., and Chevrier, N. (2020). A whole-tissue RNA-seq toolkit for organism-wide studies of gene expression with PME-seq. Nat Protoc 15, 1459-1483.
[0219] Patel, B.I., Heiss, M., Samel-Pommerencke, A., Carell, T., and Ehrenhofer-Murray, A.E. (2022). Queuosine salvage in fission yeast by Qngl-mediated hydrolysis to queuine. Biochem Biophys Res Commun 624, 146-150.
[0220] Rakovich, T., Boland, C., Bernstein, I., Chikwana, V.M., Iwata-Reuyl, D., and Kelly, V.P. (2011). Queuosine deficiency in eukaryotes compromises tyrosine production through increased tetrahydrobiopterin oxidation. J Biol Chem 286, 19354-19363.
[0221] Randerath, E., Agrawal, H.P., and Randerath, K. (1984). Specific lack of the hypermodified nucleoside, queuosine, in hepatoma mitochondrial aspartate transfer RNA and its possible biological significance. Cancer Res 44, 1167-1171.
[0222] Rawson, R.B., Zelenski, N.G., Nijhawan, D., Ye, J., Sakai, J., Hasan, M.T., Chang, T.Y., Brown, M.S., and Goldstein, J.L. (1997). Complementation cloning of S2P, a gene encoding a putative metalloprotease required for intramembrane cleavage of SREBPs. Mol Cell 7, 47-57.
[0223] Robinson, J.T., Thorvaldsdottir, H., Winckler, W ., Guttman, M., Lander, E.S., Getz, G., and Mesirov, J.P. (2011). Integrative genomics viewer. Nat Biotechnol 29, 24-26.
[0224] Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140.
[0225] Sakai, J., Rawson, R.B., Espenshade, P.J., Cheng, D., Seegmiller, A.C., Goldstein, J.L., and Brown, M.S. (1998). Molecular identification of the sterol -regulated luminal protease that cleaves SREBPs and controls lipid composition of animal cells. Mol Cell 2, 505-514.
[0226] Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genomewide libraries for CRISPR screening. Nat Methods 11, 783-784.
[0227] Sarid, L., Sun, J., Chittrakanwong, J., Trebicz-Geffen, M., Ye, J., Dedon, P.C., and Ankri, S. (2022). Queuine Salvaging in the Human Parasite Entamoeba histolytica. Cells 77.
[0228] Schaefer, M., Pollex, T., Hanna, K., Tuorto, F., Meusburger, M., Helm, M., and Lyko, F. (2010). RNA methylation by Dnmt2 protects transfer RNAs against stress-induced cleavage. Genes Dev 24, 1590-1595.
[0229] Smith, T. J., Tardu, M., Khatri, H.R., and Koutmou, K.S. (2022). mRNA and tRNA modification states influence ribosome speed and frame maintenance during poly(lysine) peptide synthesis. J Biol Chem 298, 102039.
[0230] Stadler, M., and Fire, A. (2011). Wobble base-pairing slows in vivo translation elongation in metazoans. RNA 77, 2063-2073.
[0231] Suzuki, T., Yashiro, Y., Kikuchi, I., Ishigami, Y., Saito, H., Matsuzawa, I., Okada, S., Mito, M., Iwasaki, S., Ma, D., et al. (2020). Complete chemical structures of human mitochondrial tRNAs. Nat Commun 77, 4269.
[0232] Szklarczyk, D., Gable, A.L., Nastou, K.C., Lyon, D., Kirsch, R., Pyysalo, S., Doncheva, N.T., Legeay, M., Fang, T., Bork, P., et al. (2021). The STRING database in 2021 : customizable protein-protein networks, and functional characterization of user-uploaded gene / measurement sets. Nucleic Acids Res 49, D605-D612.
[0233] Tagaya, M., Arasaki, K., Inoue, H., and Kimura, H. (2014). Moonlighting functions of the NRZ (mammalian Dsll) complex. Front Cell Dev Biol 2, 25.
[0234] Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76, 4350-4354.
[0235] Tuorto, F., Legrand, C., Cirzi, C., Federico, G., Liebers, R., Muller, M., Ehrenhofer- Murray, A.E., Dittmar, G., Grone, H.J., and Lyko, F. (2018). Queuosine-modified tRNAs confer nutritional control of protein translation. EMBO J 37.
[0236] Vasanthakumar, T., and Rubinstein, J.L. (2020). Structure and Roles of V-type ATPases. Trends Biochem Sci 45, 295-307.
[0237] Wang, L., Wu, D., Robinson, C.V., Wu, H., and Fu, T.M. (2020). Structures of a Complete Human V-ATPase Reveal Mechanisms of Its Assembly. Mol Cell 80, 501-511 e503.
[0238] Wang, X., Matuszek, Z., Huang, Y., Parisien, M., Dai, Q., Clark, W., Schwartz, M.H., and Pan, T. (2018). Queuosine modification protects cognate tRNAs against ribonuclease cleavage. RNA 24, 1305-1313.
[0239] Watkins, C.P., Zhang, W ., Wylder, A.C., Katanski, C.D., and Pan, T. (2022). A multiplex platform for small RNA sequencing elucidates multifaceted tRNA stress response and translational regulation. Nat Commun 13, 2491.
[0240] Webster, D.E., Roulland, S., and Phelan, J.D. (2019). Protocols for CRISPR-Cas9 Screening in Lymphoma Cell Lines. Methods Mol Biol 1956, 337-350.
[0241] Wu, H.J., and Wu, E. (2012). The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes 3, 4-14.
[0242] Yang, Y., Zhu, T., Wang, X., Xiong, F., Hu, Z., Qiao, X., Yuan, X., and Wang, D. (2022). ACSL3 and ACSL4, Distinct Roles in Ferroptosis and Cancers. Cancers (Basel) 14.
[0243] Yao, H, and Ye, J. (2008). Long chain acyl-CoA synthetase 3 -mediated phosphatidylcholine synthesis is required for assembly of very low density lipoproteins in human hepatoma Huh7 cells. J Biol Chem 283, 849-854.
[0244] Yoon, H., Shaw, J.L., Haigis, M.C., and Greka, A. (2021). Lipid metabolism in sickness and in health: Emerging regulators of lipotoxicity. Mol Cell 81, 3708-3730.
[0245] Yuan, Y., Zallot, R., Grove, T.L., Payan, D.J., Martin- Verstraete, I., Sepic, S., Balamkundu, S., Neelakandan, R., Gadi, V.K., Liu, C.F., et al. (2019). Discovery of novel bacterial queuine salvage enzymes and pathways in human pathogens. Proc Natl Acad Sci U S A 116, 19126-19135.
[0246] Zaborske, J.M., DuMont, V.L., Wallace, E.W., Pan, T., Aquadro, C.F., and Drummond, D.A. (2014). A nutrient-driven tRNA modification alters translational fidelity and genome-wide protein coding across an animal genus. PLoS Biol 72, e 1002015.
[0247] Zhang, J., Lu, R., Zhang, Y., Matuszek, Z., Zhang, W., Xia, Y., Pan, T., and Sun, J. (2020a). tRNA Queuosine Modification Enzyme Modulates the Growth and Microbiome Recruitment to Breast Tumors. Cancers (Basel) 72.
[0248] Zhang, W., Xu, R., Matuszek, Z., Cai, Z., and Pan, T. (2020b). Detection and quantification of glycosylated queuosine modified tRNAs by acid denaturing and APB gels. RNA 26, 1291-1298.
[0249] Zheng, D., Liwinski, T., and Elinav, E. (2020). Interaction between microbiota and immunity in health and disease. Cell Res 30, 492-506.
[0250] Zoetendal, E.G., Booijink, C.C., Klaassens, E.S., Heilig, H.G., Kleerebezem, M., Smidt, H., and de Vos, W.M. (2006). Isolation of RNA from bacterial samples of the human gastrointestinal tract. Nat Protoc 7, 954-959.
Claims
WHAT IS CLAIMED IS:
1. A method of treating cancer in a patient, the method comprising administering an effective amount of pre-queuosine 1 (preQi) to the patient.
2. The method of claim 1, wherein the effective amount produces a concentration of about 100 nM to 1 pM of preQi in the patient.
3. The method of claim 2, wherein the concentration in the patient is a blood concentration.
4. The method of claim 2, wherein the concentration in the patient is a plasma concentration.
5. The method of claim 2, wherein the concentration in the patient is a tumor microenvironment concentration.
6. The method of any one of claims 1-5, wherein the effective amount increases an amount of preQi in the patient above a baseline level.
7. The method of claim 6, wherein the baseline level is a concentration of preQi in the patient before the administering of preQi.
8. The method of any one of claims 1-7, wherein the effective amount comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg of preQi.
9. The method of any one of claims 1-7, wherein the effective amount comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg / kg of preQi.
10. The method of any one of claims 1-9, wherein the patient has not received an administration of queuine.
11. The method of any one of claims 1-10, wherein the patient is a mammal.
12. The method of any one of claims 1-11, wherein the patient is a human.
13. The method of any one of claims 1-12, wherein the cancer is a melanoma.
14. A method of treating cancer in a patient, the method comprising administering an effective amount of a therapeutic composition comprising pre-queuosine 1 (preQi) to the patient.
15. The method of claim 14, wherein the effective amount produces a concentration of about 100 nM to 1 pM of preQi in the patient.
16. The method of claim 15, wherein the concentration in the patient is a blood concentration.
17. The method of claim 15, wherein the concentration in the patient is a plasma concentration.
18. The method of claim 15, wherein the concentration in the patient is a tumor microenvironment concentration.
19. The method of any one of claims 14-18, wherein the effective amount increases an amount of preQi in the patient above a baseline level.
20. The method of claim 19, wherein the baseline level is a plasma concentration of preQi in the patient before the administering of preQi.
21. The method of any one of claims 14-20, wherein the effective amount comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg of preQi.
22. The method of any one of claims 14-20, wherein the effective amount comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg / kg of preQi.
23. The method of any one of claims 14-22, wherein the therapeutic composition does not comprise queuine.
24. The method of any one of claims 14-23, wherein the patient is a mammal.
25. The method of any one of claims 14-24, wherein the patient is a human.
26. The method of any one of claims 14-25, wherein the cancer is a melanoma.
27. A method of reducing tRNA with a tyrosine, histidine, asparagine, or aspartic acid cognate amino acid in a cell, the method comprising introducing an effective amount of pre- queuosine 1 (preQi) to the cell.
28. The method of claim 27, wherein the cell is a cancer cell.
29. The method of claim 27 or 28, wherein the effective amount produces a concentration of about 100 nM to 1 pM of preQi in the cell.
30. The method of any one of claims 27-29, wherein the effective amount produces a concentration of about 100 nM to 1 pM of preQi around the cell.
31. The method of any one of claims 27-30, wherein the effective amount increases the amount of preQi in the cell.