Treatment of staphylococcal abscesses
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- KATHOLIEKE UNIV LEUVEN
- Filing Date
- 2024-07-22
- Publication Date
- 2026-05-27
AI Technical Summary
Current antibiotics are ineffective against multicellular bacterial communities such as biofilms and abscesses, particularly those encapsulated in fibrin, which are difficult to treat due to antibiotic resistance and pharmacokinetic issues.
A composition comprising a fibrinolytic enzyme, staphylokinase, and an antibacterial agent, specifically an endolysin or antibiotic, is used to enhance antibacterial activity against staphylococcal abscess communities by breaking down fibrin and targeting bacterial cell walls.
The combination of staphylokinase and endolysin significantly enhances antibacterial activity against staphylococcal abscesses, overcoming the limitations of existing antibiotics in treating biofilm-encapsulated infections, and shows potential as a new drug for difficult-to-treat infections like fracture-related infections.
Smart Images

Figure EP2024070673_23012025_PF_FP_ABST
Abstract
Description
[0001] TREATMENT OF STAPHYLOCOCCAL FIELD OF THE INVENTION The invention relates to the treatment of bacterial infections. The invention further relates to the therapeutic use of staphylokinase. BACKGROUND OF THE INVENTION Since their discovery in the first half of the 20thcentury, antibiotics have become an indispensable tool in human medicine. Their availability facilitated complex medical interventions such as organ transplants and incorporation of prostheses [Gould et al. (2013) Virulence 4, 185–191]. However, this extensive use accelerated the natural process of resistance development, rendering most routinely used antibiotics ineffective. Moreover, difficult-to-treat infections with multicellular communities of bacteria such as biofilms and abscesses are almost impossible to eradicate with the currently available antibiotics [Masters et al. (2022) Nature Rev. Microbiol. 20, 385– 400]. In the early 2000s, the antibacterial potential of the first bacteriophage-derived lytic enzymes, endolysins, was explored [Jado et al. (2003) J. Antimicrobial Chemotherapy 52, 967–973; Loeffler et al. (2003) Infection and Immunity 71, 6199–6204; Morita et al. (2001) J. Biosci. Bioeng. 91, 469–473; Nelson et al. (2001) Proc. Natl. Acad. Sci. USA 98, 4107–4112]. Meanwhile, endolysins have been marked to be a promising class of novel antibacterials with some of them currently being tested in clinical trials [Czaplewski et al. (2016) Lancet Infectious Diseases 16, 239–251; Watson et al. (2020) Antimicrobial Agents Chemother. 64, 1–5]. While research focusing on the use of entire phages as therapeutics was experiencing hurdles with bacterial resistance development, pharmacokinetics and / or regulatory issues [Jault et al. (2019) Lancet Infectious Dis. 19, 35–45; Tsonos et al. (2014) Vet. Microbiol. 171, 460–669] the advantage of using just one phage-derived antibacterial protein was acknowledged. Since their discovery, endolysins were engineered in several different ways to be used as biotherapeutics, as reviewed by De Maesschalck et al. (2020) Crit. Rev. Microbiol. 46, 1-17. Specific approaches, tackling clinically relevant hurdles could be categorized in so-called third-generation endolysins. For example, some endolysins were engineered to extend their half-life or to target intracellular Staphylococcus aureus infections [Becker et al. (2016) Sci. Rep. 6, 1–10; Röhrig et al. (2020) mBio 11, e00209- e00220; Seijsing et al. (2018) Front. Microbiol.9, 2927; Wang et al. (2018) Sci. Rep. 8, 1–15]. SUMMARY OF THE INVENTION The methods and compositions overcome the reduced efficacy of endolysins when targeting multicellular communities such as biofilms or abscesses. In S. aureus, a key component encapsulating bacteria in both biofilms as well as abscess communities, is fibrin [Liesenborghs et al. (2018) J. Thromb. Haemostas. 16, 441- 454]. This protein can specifically be broken down by proteases such as plasmin. Staphylokinase (SAK), a prophage-encoded virulence factor of S. aureus, is known to be a plasminogen activator, leading to the activation of plasmin and subsequently to fibrin-specific degradation. SAK is used as a fusion partner to an engineered endolysin. The fusion protein greatly enhances antibacterial activity against staphylococcal abscess communities (SACs). Moreover, SAK is not toxic indicating its high potential as a new drug for difficult-to-treat abscess-associated infections such as fracture-related infections (FRIs). The invention is further summarized in the following statements: 1. A fibrinolytic enzyme and an antibacterial agent, for use as a medicament, wherein the fibrinolytic enzyme is a staphylokinase and the antibacterial agent is an endolysin and / or antibiotic. 2. The fibrinolytic enzyme and antibacterial agent for use according to claim 1, wherein the antibacterial agent is an endolysin. 3. The fibrinolytic enzyme and antibacterial agent for use according to claim 1 or 2, wherein the endolysin lacks a muramidase domain. 4. The fibrinolytic enzyme and antibacterial agent for use according to any one of claim 1 to 3, wherein the staphylokinase and the endolysin are a fusion protein. 5. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 4, wherein the staphylokinase is of a virus of the taxonomic group of Caudoviricetes. 6. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 5, wherein the staphylokinase has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK [SEQ ID NO: 2]. 7. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 6, wherein the endolysin has the sequence MAKTQAEINK RLDAYAKGTV DSPYRIKKAT SYDPSFGVME AGAIDADGYY HAQCQDLITD YVLWLTDNKV RTWGNAKDQI KQSYGTGFKI HENKPSTVPK KGWIAVFTSG SYQQWGHIGI VYDGGNTSTF TILEQNWNGY ANKKPTKRVD TWYKPESATF VNGNQPIITR IGSPFLNAPI GGNLPAGATI VYDEVCIQAG HIWIGYNAYN GNRVYCPVRT CQGVPPNHIP GVAWGVFKG [SEQ ID NO: 4]. 8. The fibrinolytic enzyme and antibacterial agent for use according to claim 4, wherein the fusion protein has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGYGKAGG TVTPTPNTAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY [SEQ ID:21]. 9. The fibrinolytic enzyme and antibacterial agent for use according to claim 1, wherein the antibacterial agent is an antibiotic. 10. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is a fluoroquinolone. 11. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is sitafloxacin. 12. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is an aminoglycoside. 13. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is gentamycin. 14. The fibrinolytic enzyme and antibacterial agent according for use according to any one of claims 1 to, wherein the fibrinolytic enzyme is a staphylokinase and wherein the antibacterial agent is an endolysin and an antibiotic. 15. A fibrinolytic enzyme and an antibacterial agent as defined in any one of claims 1 to 14, for use in the treatment or prevention of a bacterial infection that is fibrin-encapsulated. 16. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises multicellular communities of bacteria. 17. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises S. aureus. 18. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises MRSA. 19. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection is an abscess. The fibrinolytic enzyme and agent as defined in any one of claims 1 to 14, wherein the bacterial infection is a biofilm. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection is a biofilm on a medical implant in the body. In vitro non-medical use of a staphylokinase and an antibacterial agent as defined in any one of claims 1 to 13,in the prevention or treatment of fibrin encapsulated bacteria on a surface. The in vitro use according to claim 22, wherein the fibrin encapsulated bacteria are a biofilm. fibrinolytic enzyme and an antibacterial agent, for use as a medicament. The fibrinolytic enzyme and antibacterial agent for use according to claim 24, herein the fibrinolytic enzyme is a fibrin degrading enzyme. The fibrinolytic enzyme and antibacterial agent for use according to claim 25, wherein the fibrin degrading enzyme is selected from the group consisting of plasmin, collagenase-1, gelatinase A, stromelysin-1, collagenase-2 and gelatinase B. The fibrinolytic enzyme and antibacterial agent for use according to claim 24, wherein the fibrinolytic enzyme is enzyme that activates fibrin degrading enzymes. The fibrinolytic enzyme and antibacterial agent for use according to claim 27, wherein the enzyme that activates fibrin degrading enzymes is selected from the group consisting of Staphylokinase, Streptokinase, Tissue plasminogen activator (tPA), Urokinase, and Thrombin activatable fibrinolysis inhibitor (TAFI). The fibrinolytic enzyme and antibacterial agent for use according to claim 27 or 28, wherein the enzyme that activates fibrin degrading enzymes is a Staphylokinase. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 24 to 29, wherein the antibacterial agent is a peptidoglycan degrading enzyme. The fibrinolytic enzyme and antibacterial agent for use according to claim 30, wherein the peptidoglycan degrading enzyme is selected from the group consisting of an N-acetyl-β-D glucosaminidase (EC 3.2.1.52), an N-acetyl-β-D- muramidase (EC 3.2.1.17), an N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) and a endopeptidases (EC 3.4.X.X). 32. The fibrinolytic enzyme and agent for use according to claim 24, wherein the antibacterial agent is an endolysin. 33. The fibrinolytic enzyme and antibacterial agent for use according to claim 32, wherein the endolysin lacks a muramidase domain. 34. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 24 to 33, wherein the fibrinolytic enzyme is a staphylokinase and the antibacterial agent is an endolysin. 35. The fibrinolytic enzyme and antibacterial agent for use according to claim 34, wherein the staphylokinase and the endolysin are a fusion protein. 36. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 24 to 35, wherein the fibrinolytic enzyme is a staphylokinase of a virus of the taxonomic group of Caudoviricetes. 37. The fibrinolytic enzyme and antibacterial agent for use according to claim 36, wherein the staphylokinase has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK [SEQ ID NO: 2]. 38. The fibrinolytic enzyme and antibacterial agent for use according to claim 32, wherein the endolysin has the sequence MAKTQAEINK RLDAYAKGTV DSPYRIKKAT SYDPSFGVME AGAIDADGYY HAQCQDLITD YVLWLTDNKV RTWGNAKDQI KQSYGTGFKI HENKPSTVPK KGWIAVFTSG SYQQWGHIGI VYDGGNTSTF TILEQNWNGY ANKKPTKRVD NYYGLTHFIE IPVKAGATSS STIVKDGKTS SASTPATRPV TGSWKKNQFG TWYKPESATF VNGNQPIITR IGSPFLNAPI GGNLPAGATI VYDEVCIQAG HIWIGYNAYN GNRVYCPVRT CQGVPPNHIP GVAWGVFKG [SEQ ID NO: 4]. 39. The fibrinolytic enzyme and antibacterial agent for use according to claim 35, wherein the fusion protein has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGYGKAGG TVTPTPNTAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY [SEQ ID:21]. 40. The fibrinolytic enzyme and antibacterial agent for use according to claim 24, wherein the antibacterial agent is an antibiotic. 41. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the antibiotic is a fluoroquinolone. 42. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the antibiotic is sitafloxacin. 43. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the antibiotic is an aminoglycoside. 44. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the antibiotic is gentamycin. 45. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the fibrinolytic enzyme is a staphylokinase and antibacterial agent is an antibiotic. 46. The fibrinolytic enzyme and antibacterial agent for use according to claim 41, wherein the fibrinolytic enzyme is a staphylokinase and antibacterial agent is an endolysin and / or an antibiotic. 47. A fibrinolytic enzyme and an antibacterial agent as defined in any one of claims 24 to 26 for use in the treatment or prevention of a bacterial infection that is fibrin-encapsulated. 48. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 47, wherein the bacterial infection comprises multicellular communities of bacteria. 49. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 46, wherein the bacterial infection comprises S. aureus. 50. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 46, wherein the bacterial infection comprises MRSA. 51. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 46, wherein the bacterial infection is an abscess. 52. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 46, wherein the bacterial infection is a biofilm. 53. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 24 to 46, wherein the bacterial infection is a biofilm on a medical implant in the body. 54. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 43 to 46, wherein the fibrinolytic enzyme is a staphylokinase and the antibacterial agent is an endolysin, optionally as a fusion protein, which is administered together with an antibiotic. 55. In vitro non-medical use of a staphylokinase and an antibacterial agent as defined in any one of claims 23 to 46, in the prevention or treatment of fibrin encapsulated bacteria on a surface. 56. The in vitro use according to claim wherein the fibrin encapsulated bacteria are a biofilm. 57. A composition comprising a fibrinolytic protein and an endolysin. 58. The composition according to statement 56, wherein the fibrinolytic protein and the endolysin are a fusion protein. 59. The composition according to statement 56 or 57, wherein the fibrinolytic protein is staphylokinase. 60. The composition according to statement 57, wherein the staphylokinase is of a virus of the taxonomic group of Caudoviricetes. 61. The composition according to statement 59 or 60, wherein the staphylokinase has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK [SEQ ID NO: 2]. 62. The composition according to statement 57 or 58, wherein the endolysin has the sequence MAKTQAEINK RLDAYAKGTV DSPYRIKKAT SYDPSFGVME AGAIDADGYY HAQCQDLITD YVLWLTDNKV RTWGNAKDQI KQSYGTGFKI HENKPSTVPK KGWIAVFTSG SYQQWGHIGI VYDGGNTSTF TILEQNWNGY ANKKPTKRVD NYYGLTHFIE IPVKAGATSS STIVKDGKTS SASTPATRPV TGSWKKNQFG TWYKPESATF VNGNQPIITR IGSPFLNAPI GGNLPAGATI VYDEVCIQAG HIWIGYNAYN GNRVYCPVRT CQGVPPNHIP GVAWGVFKG [SEQ ID NO: 4]. 63. The composition according to any one of statements 58 to 62, with sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGYGKAGG TVTPTPNTAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY [SEQ ID:21] 64. A composition as defined in any one of statements 56 to 63, for use as a medicament. 65 A composition as defined in any one of statements 56 to 64, for use in the treatment and prevention of fibrin-associated bacterial infections. 66. The composition for use according to statement 65, wherein the fibrin- associated bacterial infections comprise multicellular communities of bacteria. 67. The composition for use according to statement 65 or 66, wherein the bacterial infection comprises S. aureus, more particular MRSA. 68. The composition for use according to any one of statements 9 to 11, wherein the fibrin-associated bacterial infection is an abscess. 69. The composition for use according any one of statements 9 to 11, wherein the fibrin-associated bacterial infection is a biofilm on an implant. 70. The composition for use according to any one of statements 9 to 13, which is administered together with an antibiotic, preferably a fluoroquinolone, more preferably sitafloxacin. DETAILED DESCRIPTION Figure legends Figure 1: Phylogenetic tree of staphylokinases identified within the Caudoviricetes. To cover the genetic diversity of staphylokinases, three different SAKs were selected (highlighted in bold). This tree was constructed based on a multiple sequence alignment using ClustalΩ [Sievers et al. (2011) Mol. Systems Biol. 7, 539]. The tree was visualized with iTol [Letunic & Peer (2021) Nucl. Acids Res. 49, W293–w296.] Figure 2: Multiple sequence alignment of the three selected staphylokinases. Staphylokinase SAK1 and staphylokinase SAK3 share the highest sequence identity (97.81%), whereas the sequences of staphylokinase SAK2 and staphylokinase SAK3 differ the most (54.41% sequence identity). The similarity between staphylokinase SAK1 and staphylokinase SAK2 is also low (55.15%). Several amino acids differ in physicochemical property, resulting in a different shade of grey. Remarkably, an extra tail is observed in the C-terminal region of staphylokinase SAK2 before the common Lys-Lys terminus. The alignment was created using MAFFT and visualized with Jalview [Katoh et al. (2013) Mol. Biol. Evol. 30, 772–780]. Figure 3: Small-scale protein expression to determine optimal expression conditions for the three staphylokinases. Optimal expression conditions can be defined as the condition in which the expression yields most protein in the soluble protein fraction (SPF) while having barely any protein in the insoluble protein fraction (IPF). The total protein fraction (TPF) comprises the combined SPF and IPF. For staphylokinase SAK1, this was determined to be 4h at 37°C and 18h at 30°C (overnight) for staphylokinase SAK2 and staphylokinase SAK3 as indicated with a black frame. Figure 4: Pathway used to detect staphylokinase activity. Plasminogen is converted into plasmin which then cleaves a peptide substrate, VALY, leading to the release of p-nitroaniline, a chromophore with absorption at 405 nm. A linear relationship was established between the concentration of p-nitroaniline and the absorbance at 405 nm allowing of this enzymatic conversion. At the right, the three staphylokinase are shown upon recombinant expression. Figure 5: Illustration of staphylokinase activity in vitro. Staphylokinases were tested at a concentration of 3 µM. In all three cases, a plateau was reached indicating substrate depletion. Figure 6: Varying concentrations of staphylokinase SAK2 reveal a dose- dependent character which allows to characterize the initial reaction velocity. Calculating the slope of the linear part of the enzymatic reaction allows to calculate the initial reaction velocity which is a measure of the maximum amount of substrate that can be converted per minute. (right) Saturation of plasminogen activation reaction starts to appear starting from 5 µM of staphylokinase SAK2. This experiment was performed in duplicate (n=2). Figure 7: Fibrinolytic activity of staphylokinase SAK2 in an in vitro staphylokinase model, visualized using phase contrast microscopy. (A) Fibrin degradation could be observed after a 2h treatment with 10 µM staphylokinase SAK2 as indicated with a white arrow. This was further confirmed using a Picro-Mallory trichome staining (B) in which fibrin is stained (line indicate with arrows). In the treatment condition, this is reduced significantly. Scale bars indicate 100 µm. Figure 8: Illustration of the plate-based muralytic screening assay. (Left) No cleared zones are visible in the negative control (NC) as this contains an empty vector without lytic protein. Hence, no cell wall substrate is broken down. (Middle) Cleared zones appear when an active endolysin is present in the destination vector pVTD3 as indicated by the arrow. (Right) A construct, in this case the staphylokinase-Endolysin fusion protein SAK3-L8, is able to show muralytic activity. This means that an N-terminal fusion of staphylokinase SAK3 by linker 8 to LysRODIΔami does not impair its muralytic activity. Figure 9: Overview of the SPFs of the fusion proteins tested in the plasminogen activation screen. The intense overexpression bands might indicate the presence of the fusion protein in each of the lysates, as indicated in the black frames. The lysates were loaded on a 12% SDS-PAGE gel. Pageruler® prestained protein ladder was used as a reference. Figure 10: Overview of recombinant, purified staphylokinase SAK2- LysRODIΔamidase fusion constructs. Top: fusion proteins are all around 50 kDa in size, depending on the linker. In all cases, contaminating proteins were co-purified using bench purification. Bottom: Western blot images of bench purified proteins. All recombinantly expressed variants appear in an anti-His blot, except for staphylokinase-endolysin fusion protein SAK2- L9. Incorrect expression might be an explanation. Furthermore, multiple bands can be observed for the staphylokinase-endolysin fusion protein SAK2-L2 lane hinting towards N-terminal degradation of the fusion construct. The lysates were loaded on a 12% SDS-PAGE gel. Pageruler® prestained protein ladder was used as a reference. Figure 11: Plasminogen activation assay performed with the roughly, bench purified fusion constructs containing staphylokinase SAK2. To perform this assay, 1.25 µM of all protein samples was used. All samples, of which the presence of the fusion protein could be confirmed using a Western blot, showed activity. In the case of staphylokinase-endolysin fusion protein SAK2-L1, no plateau indicating substrate depletion could be reached within the three-hour time frame. This experiment comprised two independent replicates, represented by the dotted lines (n=2). Figure 12: FPLC-purification of staphylokinase-endolysin fusion protein SAK2-L8 expressed in ClearColi® (DE3). The fusion protein could be purified in a standardized way using FPLC resulting in contaminant-free protein fractions. The samples were loaded on a 12% SDS-PAGE gel. LF: load fraction, FT: Flow through. As a reference, Pageruler® prestained protein ladder was loaded. Figure 13: Plasminogen activation assay performed with staphylokinase- endolysin fusion protein SAK2-L8 in different pH conditions. At all different pHs, plasmin activity as a result of plasminogen activation could be observed, albeit lower in the lower pHs (pH 4 and pH 5) compared to higher pH conditions. In the optimal buffer (Storage Buffer), the highest activity was observed (pH 7.4). This experiment had three independent replicates, represented by the dots (n=3). Figure 14: staphylokinase-endolysin fusion protein SAK-L8 retains its activity at elevated temperature (42°C). The fusion protein has a comparable plasmin activation rate when this reaction takes place at 42°C as it does at 37°C while the lag phase is somewhat longer. In this assay, a concentration of 2.5 µM staphylokinase-endolysin fusion protein SAK2-L8 was tested. The line represents the the three individual replicates (n = 3), indicated with the markers. Figure 15: Plasmin activation assay in heat-inactivated human serum. In two out of three replicates, a 20 µM concentration of the fusion protein (indicated with the ‘+’ markers) exerts activity in human serum. The line represents the mean of the three individual replicates (n = 3), indicated with the markers. Figure 16: A. Quantification of SAC samples treated with different sub inhibitory concentrations of antibiotics alone or in combination with decreasing concentration of staphylokinase-endolysin fusion protein SAK2-L8. The data are presented as means (±SD) and are from three independent experiments with three replicates per test. Significant differences in the data are denoted by asterisks: *p^<^0.05; **p^<^0.01; ***p^<^0.001, ****p^<^0.0001. Figure 17: Quantification of SAC samples treated with different sub inhibitory concentrations of antibiotics alone, antibiotics in combination with staphylokinase SAK2, antibiotics in combination with L8 Endolysin (construct without amidase domain), or staphylokinase-endolysin fusion protein SAK2-L8. The data are presented as means (±SD) and are from three independent experiments with three replicates per test. Significant differences in the data are denoted by asterisks: *p^<^0.05; **p^<^0.01; ***p^<^0.001, ****p^<^0.0001. (L8 = endolysin) Figure 18: staphylokinase-endolysin fusion protein SAK2-L8 does not show cytotoxicity in HeLa cells. The survival rate was calculated as the ratio of the fluorescence emitted by the sample wells and the fluorescence emitted by the positive control (0 µM) wells (0 µM). As a negative control, 50% DMSO was used resulting in significant cytotoxicity at α = 0.01. . (L8 = endolysin) Figure 19: Cytotoxicity assessment of staphylokinase-endolysin fusion protein SAK2-L8 in human dermal fibroblast cells (BJ-1). Cells were exposed to varying concentrations of staphylokinase SAK2, endolysin, and staphylokinase-endolysin fusion protein SAK2-L8 for 24, 72, and 170 hours. Each bar represents the mean value ± standard error (SE) obtained from three independent experimental replicates. The values were calculated as a percentage of surviving cells relative to the control sample. Figure 20: Survival curve of G. larvae upon injection with staphylokinase-endolysin fusion protein SAK2-L8. Whereas one treatment group received 20 µL of a 50 µg / mL solution, the other received 20 µL of a 100 µg / mL solution. One day after injection, two larvae injected with the highest concentration of staphylokinase-endolysin fusion protein SAK2-L8 died whereas all others lived until the end of the experiment on day 3. As a control to check whether all manipulations were executed correctly, a PBS-treated group was included. Every group consisted of ten larvae (n = 10). Figure 21: Quantitative bacteriological evaluation of soft tissue, implant, and bone at euthanasia. Data are shown for the saline control group, antibiotic only, and SAK2 and endolysin as separate proteins, and fusion protein of Staphylokinase SAK2 and endolysin. Each symbol represents data from a single mouse. The data were presented as mean ± standard deviation of results and error bars represent standard deviation, and statistical significance was determined using a Kruskal-Wallis test followed by Dunn's posttest (*p < 0.05). CFU, colony forming units. (L8 = endolysin). Figure 22 Quantification of total CFU using staphylokinase and antibiotic treatment on SACs Each bar plot represents the average value derived from three technical replicates, obtained from three distinct biological replicates. Data are presented as mean ± standard deviation, with error bars indicating the standard deviation. Statistical significance was assessed using the Kruskal-Wallis test followed by Dunn's post-test (*p < 0.05). Definitions Representative groups of antibiotics and examples thereof are: Penicillins such as Amoxicillin and Ampicillin. Cephalosporins such as Cefalexin and Ceftriaxone. Tetracyclines such as Doxycycline and Minocycline. Macrolides such as such as Azithromycin and Clarithromycin. Aminoglycosides such as Gentamicin and Tobramycin. Fluoroquinolones such as Ciprofloxacin, Levofloxacin, Moxifloxacin and Sitafloxacin. Sulphonamides often used in combination with trimethoprim such as Trimethoprim- sulfamethoxazole (TMP-SMX). Glycopeptides such as Vancomycin and Teicoplanin. Endolysins are enzymes from bacteriophages that digest the cell wall of bacterial hosts from within, thereby causing the host cell to burst open. Endolysins specifically target and cleave the peptidoglycan layer of bacterial cell walls, leading to lysis (destruction) of the bacterial cell. Endolysins, were explored as antibacterials to target Gram-positive pathogens such as S. aureus. Several bonds of the peptidoglycan layer are prone to cleavage by different classes of enzymes in which also endolysins can be categorized. N-acetyl-β-D glucosaminidases (EC 3.2.1.52), N-acetyl-β-D-muramidases (EC 3.2.1.17), and lytic transglycosylases (EC 3.2.1.17) cleave a bond in the glycan backbone, whereas N- acetylmuramoyl-L-alanine amidases (EC 3.5.1.28) and endopeptidases (EC 3.4.X.X) cleave in the peptide stem. The enzymatic domains of an endolysin consist of an amidase-2 and a cysteine, histidine-dependent aminohydrolase / peptidase (CHAP) domain, both cleaving in either the peptide stem or cross-bridge. This finding also holds for chimeric lysins, as resistance was developed against the chimeric endolysin P128. This endolysin consists of an endopeptidase cleaving the cross-bridge and a cell-wall binding domain originating from the peptidoglycan-degrading bacteriocin lysostaphin. Fibrinolytic enzyme refers to an enzyme that degrades fibrin or to an enzyme that activates fibrin degrading enzymes. Examples of enzymes that degrade fibrin are plasmin and certain Metalloproteinases [MMP-1 (collagenase-1), MMP-2 (gelatinase A), MMP-3 (stromelysin-1), MMP-8 (collagenase-2), and MMP-9 (gelatinase B).] Examples of enzymes that activate fibrin degrading enzymes are Streptokinase, Staphylokinase, Tissue plasminogen activator (tPA), Urokinase, and Thrombin activatable fibrinolysis inhibitor (TAFI) . Specific embodiments of staphylokinase are of viruses of the taxonomic group of Caudoviricetes. Muralytic refers to the property of a compound to break down or degrade the cell walls of microorganisms such as bacteria, fungi, and viruses. The fibrinolytic enzyme and antibacterial agent can be administered separately or simultaneously. “Simultaneously”, when referring to an type, means in the present application that the administration type concerned consists in the administration of two or more active ingredients and / or treatments at approximately the same time; wherein it is understood that a simultaneous administration will lead to exposure of the subject to the two or more active ingredients and / or treatments at the same time. When administered simultaneously, said two or more active ingredients may be administered in a fixed dose combination, or in an equivalent non-fixed dose combination (e.g. by using two or more different pharmaceutical compositions to be administered by the same route of administration at approximately the same time), or by a non-fixed dose combination using two or more different routes of administration; wherein said administration leads to essentially simultaneous exposure of the subject to the two or more active ingredients and / or treatments. “Fixed dose combination”, when referring to an administration type, means in the present application that the administration type concerned consists in the administration of one single pharmaceutical composition comprising the two or more active ingredients. “Separately”, when referring to an administration type, means in the present application that the administration type concerned consists in the administration of two or more active ingredients and / or treatments at different points in time; wherein it is understood that a separate administration will lead to a treatment phase (e.g. at least 1 hour, notably at least 6 hours, especially at least 12 hours) where the subject is exposed to the two or more active ingredients and / or treatments at the same time; but a separate administration may also lead to a treatment phase where for a certain period of time (e.g. at least 12 hours, especially at least one day) the subject is exposed to only one of the two or more active ingredients and / or treatments. Separate administration especially refers to situations wherein at least one of the active ingredients and / or treatments is given with a periodicity substantially different from daily (wherein “daily” especially refers to once or twice daily) administration (e.g. wherein one active ingredient and / or treatment is given e.g. once or twice a day, and another is given e.g. once a week or at even longer distances). Sequences depicted in the present application may have a sequence identity of more than 95 %, more than 96 %, more than 97 %, more than 98 % or more than 99 %, as long as these modified versions mention their activity. Also sequences depicted in the present may be truncated at the N- or C- terminus as long as these truncated versions mention their activity (e.g. versions lacking a signal peptide. To find related prophage-encoded staphylokinases (SAKs), a BLASTp search was performed across all Caudoviricetes with query P68802 (Staphylococcus aureus staphylokinase). This revealed 11 staphylokinases , for which a phylogenetic tree was created (Figure 1). To cover most genetic diversity observed in the phylogenetic tree, the staphylokinases of phages phiN315, phi575 and 42D were selected for further research. staphylokinase SAK1 and staphylokinase SAK3 have the highest sequence similarity (97.81% sequence identity), whereas staphylokinase SAK2 and staphylokinase SAK3 only share 54.41% sequence identity. Upon cloning the E. coli codon-optimized genes encoding the three selected staphylokinases in Tiles, a VersaTile reaction was performed with the staphylokinases in the first position, followed by a His-tag spanning positions two until four. The validated constructs were expressed in E. coli BL21(DE3). To determine optimal expression conditions, 4 mL-cultures were induced with 1 mM IPTG and incubated at either 16°C or 30°C overnight or 37°C for four hours. Next, the soluble and insoluble protein fractions were separated allowing insights in the expression efficiency of the recombinant staphylokinase (Figure 3). The recombinant staphylokinase were shown to express very well in E. coli BL21(DE3) although some differences exist emphasizing the importance of these optimization experiments. For example, staphylokinase SAK1 doesn’t express well at 16°C while this is the case for staphylokinase SAK2 and staphylokinase SAK3. Conversely, expression at 37°C doesn’t yield any recombinant staphylokinase SAK1 in the insoluble protein fraction (IPF), while a significant amount is found in the IPF for staphylokinase SAK3. Hence, the conditions framed in Figure 4 are used for further, lab-scale expressions. Following Ni-NTA purification with FPLC, the three selected staphylokinases were tested for their activity in an in vitro assay with a chromogenic substrate (Figure 4). In this indirect assay, plasminogen is converted into active plasmin by staphylokinase. This plasmin can subsequently exert its proteolytic activity on the chromogenic substrate D-Val-Leu-Lys 4- dihydrochloride (VALY), resulting in the release of p-nitroaniline absorbing at a wavelength of 405 nm. Therefore, a standard curve of p-nitroaniline was used to correlate the measured absorbance with a concentration of cleaved substrate (Figure 45). At a concentration of 3 µM of staphylokinase, activity was show for all three tested staphylokinases: all staphylokinases were able to reach a plateau between 600 and 800 µM of p- nitroaniline indicating substrate depletion (Figure 5). Staphylokinase SAK2 shows activity in an in vitro abscess model. To investigate whether staphylokinase SAK2 retains its catalytic activity in an abscess model, S. aureus JAR was grown in the presence of human plasma for 24 hours until the formation of fibrin-based protected staphylokinases. Subsequently, these staphylokinases were challenged with varying concentrations of staphylokinase SAK2. Starting at a concentration of 10 µM, a 6-hour treatment of staphylokinase SAK2 could significantly disrupt the structural integrity of the staphylokinases. The reduction of the fibrin protective layer was confirmed through multiple methods including Bright field microscopy and Picro-Mallory trichrome staining (figure 7) This observation was further confirmed using a fibrin-specific antibody, an Alexa fluor 568-conjugated secondary antibody and a Syto9 dye specifically staining nucleic acids and hence both eDNA as well as genomic DNA inside the S. aureus cells of the staphylokinase . Whereas all fibrin is broken down in the staphylokinase SAK2 treated condition, the fibrin remains in the untreated control, leaving the S. aureus cells encapsulated. The three recombinant staphylokinases were fused to a truncated endolysin, LysRODIΔamidase, a previously known and characterized endolysin [Gutiérrez et al. (2021) Front. Microbiol. 12, 1–16]. Nine linkers of different length were included in the library of fusion proteins. In brief, this library was designed using VersaTile shuffling with three staphylokinases on position 1, nine linkers on position 2, one endolysin on position 3 and 4 and a His-tag encoded in pVTD3, resulting in 27 different fusion proteins. The fusion proteins all have the truncated endolysin, LysRODIΔamidase in common. Throughout the application fusion proteins are referred to by the specific staphylokinase and specific linker. Thus for example, SAK2-L8 is fusion protein of staphylokinase2, linker 8 and LysRODIΔamidase. These fusion proteins were assessed to validate which fusion proteins retained both activities: the plasminogen-activating activity by the staphylokinase and the muralytic activity provided by the endolysin. First, the muralytic activity was assessed by plating the E. coli BL21(DE3) transformants, each containing an expression plasmid encoding one of the 27 different fusion proteins, on an agar plate containing S. aureus cell wall substrate and IPTG as an inducer. When the endolysin is correctly expressed and still active upon fusion, a halo surrounding the colony can be observed. This is not the case when the activity is abolished. This can happen if the fusion protein is incorrectly folded or inactive due to the fusion of different proteins (Figure 8). Based on this assay, all constructs were assessed for the retention of their muralytic activity on S. aureus peptidoglycan. The performance of each fusion construct was evaluated based on the size of the cleared zones surrounding the colony: when this zone was equally good to the unfused endolysin, ‘+++’ is displayed in Table 1. Is the zone smaller, then ‘++’ is displayed, followed by a ‘+’ for only weakly positive clones. A ‘-‘ indicates no observed activity in this assay. Only a few staphylokinase-endolysin fusion proteins lost their muralytic activity: SAK1-L5, SAK2-L6, SAK3-L4 and SAK3- L7. As muralytic activity is the mode-of-action of this antibacterial, these constructs were assumed to also have lost their antibacterial activity. This results in 85% of all fusion proteins retaining their antibacterial mode-of-action. Table 1: Muralytic screen of fusion protein library. The performance of each fusion construct was evaluated based on the size of the cleared zones surrounding the colony: when this zone was equally good to the unfused endolysin, ‘+++’ is displayed. Is the zone smaller, then ‘++’ is displayed, followed by a ‘+’ for only weakly positive clones. A ‘-‘ indicates no observed activity in this assay. e s nienieniassasssnyilyl aylko nio nio o dko dkd l y n es yln o es ylns yh nti yh nti yentip 1 ovip 2 ovih p 3 ovaKit Ast aKiuc st aKis itAtA S SucfAtAcS SfS SufA SAK1-L1 +++ SAK2-L1 +++ SAK3-L1 +++ SAK1-L2 +++ SAK2-L2 ++ SAK3-L2 +++ SAK1-L3 +++ SAK2-L3 + SAK3-L3 + SAK1-L4 + SAK2-L4 + SAK3-L4 - SAK1-L5 - SAK2-L5 + SAK3-L5 ++ SAK1-L6 + SAK2-L6 - SAK3-L6 +++ SAK1-L7 + SAK2-L7 SAK3-L7 - SAK1-L8 + SAK2-L8 +++ SAK3-L8 +++ SAK1-L9 ++ SAK2-L9 ++ SAK3-L9 ++ To validate the enzymatic activity of the staphylokinase upon fusion to the truncated endolysin, the aforementioned plasmin activation assay was performed with the soluble protein fraction of 4 mL expression cultures of each construct (Figure 9). For all constructs, a clear overexpression protein band was visible around the expected size of the fusion proteins, except for staphylokinase-endolysin fusion protein SAK1- L1 and SAK1-L3. For SAK1-L1, a clear band is visible at 15 kDa, the size of staphylokinase SAK1, indicating proper expression of staphylokinase SAK1. However, no band at the size of the endo lysin (34 kDa) was observed, indicating a premature termination of translation. For staphylokinase-endolysin fusion protein SAK1-L3, no clear expression pattern was observed which can pinpoint towards toxicity of the expression construct hampering even the growth of the host. The lysates containing staphylokinase-endolysin fusion proteins SAK1-L3 and SAK2- L9 were unable to activate plasmin while all other fusions remained active. Together with the results for the muralytic screen, 20 constructs out of 27 are retaining both their plasminogen activating as well as their muralytic and hence antibacterial activity (Table 2). Furthermore, this small library suggests linkers 1, 2 and 8 as the most versatile ones allowing all selected proteins to exert their enzymatic function. Interestingly, all three linkers are flexible linkers, even though they vary in length. All other linkers are rigid, which apparently hampers the activity of one of both fusion partners. The fusion proteins containing the staphylokinase SAK2 construct were further analysed. Table 2: Overview of the screened library for both muralytic and plasmin activation properties. Constructs retaining both activities upon fusion are interesting new therapeutic compounds. Staphylokinase activity . muralytic activity L1 L2 L3 L4 L5 L6 L7 L8 L9 SAK1 + . + + . + ‐ . + + . + ‐ . ‐ + . + + . + + . + + . + SAK2 + . + + . + + . + + . + + . + ‐ . ‐ + . + + . + ‐ . + SAK3 + . + + . + + . ‐ + . ‐ + . + + . + + . ‐ + . + + . + Eight fusion proteins containing staphylokinase SAK2 were expressed on a larger scale. Therefore, expressions in a 600 mL volume were performed allowing bench affinity purification and a partial purification of the recombinant protein from the expression host proteome (Figure 10). With these partially purified proteins, a more detailed insight could be gained in the performance of each fusion construct. This was done assessing both antibacterial as well as plasminogen-activating activity. Therefore, the recombinant fusion proteins were dialyzed to PBS as a constraint for assessing protein stability as several proteins tend to aggregate in non-stabilizing conditions. Firstly, a MIC assay was performed to check the antibacterial performance of the recombinant fusion proteins (Table 3). Table 3: MIC assay performed with the roughly, bench purified fusion constructs containing staphylokinase SAK2. No value indicates no observed antibacterial activity at a concentration of 0.5 µM. For this assay, all fusion proteins were dialyzed to PBS, allowing screening in a non-stabilizing environment. Hence, together with the plasminogen activating assay, this assay also provides information on the robustness of the generated fusion proteins. staphylokinase-endolysin fusion protein SAK2-L2 and SAK2-L8 were the only fusion proteins able to display activity against all five tested strains. Strain L1 L2 L3 L4 L5 L7 L8 L9 S. aureus 0.25 µM 0.25 µM JAR S. aureus 0.25 µM 0.5 µM Newman S. aureus 0.5 µM 0.25 µM 0.25 µM Mu8 S. aureus 0.25 µM 0.5 µM 0.25 µM Mu100 S. epider- 0.12 µM 0.25 µM 0.25 µM midis 103.1 Five staphylococcal strains were initially selected, including an MRSA strain (S. aureus Mu100) and an S. epidermidis strain. Plasminogen activation was observed for all expressed recombinant fusion proteins, as confirmed by Western blot (Figure 10, Figure 11). In summary, five fusion proteins containing staphylokinase SAK2 were able to maintain their full plasminogen-activating properties, with only two staphylokinase- endolysin fusion proteins (SAK2-L2 and SAK2-L8) also being able to kill all five selected staphylococcal strains, including a methicillin-resistant S. aureus (Table 3, Figure 11). Both constructs contain a long flexible linker allowing maximal flexibility between both proteins. Staphylokinase-endolysin fusion protein SAK2-L8 was further characterized. Firstly, a recombinant expression and purification pipeline was developed to achieve pure recombinant, therapeutic protein. performed in ClearColi®(DE3) strain having non-immunogenic LPS and FPLC was used for protein purification. In combination with a more extensive washing procedure, it was possible to achieve a pure, therapeutic fusion protein (Figure 12. To assess the pH stability of the fusion protein, SAK2-L8 was diluted into a general pH buffer to a concentration of 2.5 µM. Upon addition of plasminogen and VALY, its potential to activate plasminogen was assessed in a pH ranging from 4 to 9 (Figure 13). Although plasmin activity could be observed in all pH conditions, it is clear that the plateau was not reached when the reaction took place at pH 4 and 5 during the given timeframe (i.e. 180 minutes). For all other conditions, this was the case. However, the initial reaction velocity, obtained by calculating the slope in the linear part of the curves displayed on Figure 11, was calculated to be significantly different between the reactions tested at a lower pH (pH 4, pH 5 and pH 6) and the ones tested at a higher pH (pH 7, pH 8, pH 9). In other words, the more acidic conditions in which plasmin activation needs to take place, the slower this process takes place. However, potent activity is still observed at low concentrations (2.5 µM). As S. aureus infections often cause a rise in body temperature, the activity of staphylokinase-endolysin fusion protein SAK2-L8 was also assessed at 42°C, showing similar results as before (Figure 14). Lastly, several potential proteinaceous therapeutic compounds are known to lose their activity when tested in serum. The difference in matrix renders the protein inactive. Therefore, activity of staphylokinase-endolysin fusion protein SAK2-L8 was assessed in heat-inactivated human serum (Figure 15). When testing high concentrations of staphylokinase SAK2 (20 µM), plasminogen activation was achieved in two of the three replicates. This was not the case when testing previously used concentrations in this matrix. This loss in activity could be caused by the presence of a protease inhibitor. One such inhibitor, present in human serum, is alpha-2- antiplasmin (α2AP). α2AP is a known inhibitor of staphylokinases . Rather than a disadvantage, this could be an advantage in future applications as this factor is hypothesized to keep the plasmin activity locally at the site of administration to avoid any potential off-target effects. The antibacterial spectrum of the fusion protein SAK2-L8 was determined using a MIC assay including a wide variety of staphylococcal strains, selected to cover the genomic diversity of these species (Table 4). When considering these strains and the previously tested ones, staphylokinase- fusion protein SAK2-L8 can inhibit growth of 10 out of 14 tested S. aureus strains (71%) and two out of four S. epidermidis strains (50%). Furthermore, growth of other staphylococcal strains such as Staphylococcus haemolyticus was inhibited as well, whereas staphylokinase- endolysin fusion protein SAK2-L8 did not target Staphylococcus capitis, Staphylococcus hominis and Staphylococcus lugdunensis. staphylokinase-endolysin fusion protein SAK2-L8 can thus be considered an anti-staphylococcal agent. This specific activity is interesting as staphylokinase-endolysin fusion protein SAK2-L8 only targets the pathogenic bacteria present at the site of infection, leaving the present microbiome unaffected. Table 4: Antibacterial spectrum of staphylokinase-endolysin fusion protein SAK2-L8 Strain MIC- Strain MIC-value value S. aureus ST5 >0.5 µM S. aureus Mu8 0.25 µM S. aureus ST30 0.24 µM S. aureus Mu100 0.25 µM S. aureus ST22 >0.5 µM S. aureus 008 0.12 µM S. aureus ST15 > 0.5 µM S. epidermidis 103.1 0.25 µM S. aureus ST8 0.12 µM S. epidermidis TRH1 >1 µM S. aureus ST1 >0.5 µM S. epidermidis TRH5 0.48 µM S. aureus ST17 0.24 µM S. epidermidis 012 >1 µM S. aureus V-191016-1 0.24 µM S. capitis 052 >1 µM S. aureus JAR 0.25 µM S. haemolyticus 015 0.12 µM S. aureus Newman 0.5 µM S. hominis 01 >1 µM S. aureus Xen36 0.12 µM S. lugdunensis 018 >1 µM . When antibacterial activity was observed in this in vitro assay, the strain and the MIC value is displayed in bold. The fusion protein showed antibacterial activity in vitro against 71 % of all tested S. aureus strains, 50 % of all S. epidermidis strains and against some other staphylococcal strains such as S. haemolyticus. This indicates that the SAK2-L8 fusion protein can be classified as an anti-staphylococcal agent. To evaluate the potential impact of staphylokinase-endolysin fusion protein SAK2-L8 on the activity of gentamicin, vancomycin and sitafloxacin at sub-inhibitory concentrations, a comparative analysis of these antibiotics was conducted in the presence and absence of staphylokinase-endolysin fusion protein SAK2-L8 in mature SACs. After a 6-hour co-treatment, the number of bacterial cells was quantified, which revealed a significant reduction of nearly 2 log folds using staphylokinase- endolysin fusion protein SAK2-L8 at the two highest concentrations. The combination of 10 μg / ml sitafloxacin and 10 and 5 μM of staphylokinase-endolysin fusion protein SAK2-L8 exhibited the most substantial effect, demonstrating complete bactericidal activity. These findings suggest that adding staphylokinase-endolysin fusion protein SAK2-L8 may enhance the efficacy of certain antibiotics, particularly sitafloxacin, at sub-inhibitory concentrations. (Figure 16). staphylokinase-endolysin fusion protein SAK2-L8 is thus is synergistic with certain fluoroquinolones . SAK2 fibrinolytic activity on an in vitro SAC model. SACs were cultured on transwell inserts in a humidified incubator at 37°C in the presence of 1% human plasma for a total of 24 hours. After this incubation period, residual plasma was removed, and the samples were washed once with PBS. On a CLSM image of a SAC sample shown before and after a 2-hour 10μM SAK2 treatment the fibrin layer has been degraded. Co-treatment of SAK2 with antibiotics also leads to bacterial eradication and hence disruption of the SAC. This concept was tested with either gentamycin, vancomyin or sitafloxacin. The synergistic effect of staphylokinase-endolysin fusion protein SAK2-L8, which exhibits both fibrinolytic and antimicrobial activity, was studied on established S. aureus JAR biofilms. Therefore, 100 µL of a diluted overnight culture (OD600= 0.1) was added to the wells of a 24-well plate containing a sterile, titanium disc. The total volume of the wells was adjusted to 1 ml by adding Tryptic Soy Broth (TSB) supplemented with 1% human plasma, and the samples were allowed to incubate statically at 37°C. The medium was changed after 24 hours, and the samples were gently washed with phosphate-buffered saline (PBS). Subsequently, the samples were treated with staphylokinase-endolysin fusion protein SAK2-L8 either alone or in combination with a sub-inhibitory concentration of antibiotics. After a six-hour co- treatment of antibiotics and staphylokinase-endolysin fusion protein SAK2-L8, there was a 2-log fold reduction in the total number of CFUs compared to the action of antibiotics alone (Figure 17), indicating antibiofilm activity of the staphylokinase- endolysin fusion protein SAK2-L8. The SAC model was further used to measure the antimicrobial efficacy of staphylokinase alone and in combination with the antibiotics gentamicin, vancomycin, and sitafloxacin. A concentration of 10 µM staphylokinase (SAK2) was administered either individually or in conjunction with a fixed concentration of the respective antibiotic (10xMIC) for 6 hours. Figure 22 shows the efficacy of the combination of staphylokinase with gentamicin or with sitafloxacin. Cytotoxicity of staphylokinase-endolysin protein SAK2-L8 was assessed in different ways. In a first experiment, toxicity was examined in vitro using a HeLa cell line. These epithelial cells were exposed to a concentration of staphylokinase- endolysin fusion protein SAK2-L8 ranging from 0.039 to 5 µM. After 24h of co- incubation, viability was read-out. 50% DMSO was used as a negative control. The survival rate, i.e., the ratio of the fluorescence intensities of the tested concentration over the control (0 µM) was plotted in Figure 18. No significant cytotoxicity was observed at α = 0.01 using Dunnett’s test with the 0 µM condition as control group. Potential cytotoxicity of staphylokinase-endolysin fusion protein SAK2-L8 was also tested with a human fibroblast cell line (BJ1). Cells were co-exposed at different concentrations of staphylokinase (SAK2), endolysin (L8) and staphylokinase- endolysin fusion protein (SAK2-L8) for a total of 5 days and the viability tested at 24, 72 and 170 hrs (Figure 19). No significant reductions in cell viability were observed after 170 hrs. Next, Galleria mellonella larvae were used as a first in vivo system to assess potential toxicity of this newly developed compound. This invertebrate lacks fibrin but other potential toxic effects of this potential drug could be observed in this system. Two doses of staphylokinase-endolysin fusion protein SAK2-L8 were tested. Either a 20 µL-shot of 50 µg / mL or 100 µg / mL was injected in the hind leg of the larvae (Figure 20). As a control, PBS was used. At the lower concentration, which is still high for similar drugs in previously reported studies using G. mellonella [Blasco et al. (2020) Sci. rep. 10, 7163], all larvae were still alive after three days upon injection. At the higher concentration of 100 µg / mL, two larvae died within the first 24h following injection. This could be an indication that a high dose of protein is mildly toxic for the tested system. However, general toxicity in this system can be ruled out at lower doses which should be sufficient for eradicating an infection in this system. For example, Blasco et al. (cited above) used a 25 µg / mL injection in combination with ¼ MIC of colistin to rescue all tested larvae from an Acinetobacter baumannii infection. Finally, mice were used to check the ability of the staphylokinase-endolysin fusion protein SAK2-L8 to reduce bacterial burden and SAC formation in vivo. The mouse model involves an initial surgery to create a femoral osteotomy, which was repaired with a 4-hole titanium MouseFix plate. Simultaneously, mice were inoculated with 104 CFU of S. aureus JAR 06.01.31 in logarithmic growth phase. The wound was then closed, and the infection allowed to for 5 days, after which revision surgery was conducted. During this revision procedure, the wound was opened, irrigated, and samples were collected to perform quantitative bacterial culture to confirm and measure the extent of infection. Both the irrigation solution and soft tissue samples from around the infected implant were examined. All animals were confirmed infected at this time. Treatments included systemic antibiotic, staphylokinase-endolysin fusion protein SAK2-L8, staphylokinase SAK2 and endolysin and saline, were administered during the revision surgery and for the following 13 days. A 3-day washout period was implemented to allow the clearance of enzymes and antibiotics before the mice were euthanized and analysed on day 21 following the initial surgery. Upon initial assessment, animals administered saline were the most infected with the highest CFU count. Mice treated with antibiotics, staphylokinase SAK2 plus L8 and staphylokinase-endolysin fusion protein SAK2-L8 exhibited a 2-fold log reduction in viable bacteria in the soft tissue, implant, and bone, in comparison to the saline group. The staphylokinase SAK2 plus L8 (not fused) and staphylokinase-endolysin fusion protein SAK2-L8 exhibited a strong reduction in the bone, which was greater than the reduction for antibiotic therapy (Figure 21). The efficacy of the different treatments in reducing bacterial burden in the mice was statistically assessed. When comparing all groups, the Sys group significantly reduced the bacterial burden in soft tissue compared to the controls (p < 0.05) (Figure 21). Mice treated with Staphylokinase had 6.5-fold fewer living bacteria in soft tissue than controls. EXAMPLES Example 1 material and methods Bacterial strains, growth and media All bacterial strains used are listed in Table 3. Bacterial strains were grown in either lysogeny broth (LB) or tryptic soy broth (TSB; BD Biosciences, USA) unless mentioned otherwise. Selectable markers were added when necessary. 100 µg / mL ampicillin (Amp100; VWR, Belgium) was used together with 5% sucrose (Acros Organics, Belgium) to select for clones harbouring entry plasmid pVTE. When selecting for clones harbouring destination plasmid pVTD2 or pVTD3, 50 µg / mL kanamycin (Kan50; Thermo Scientific, USA) and 5% sucrose were used. In general, bacteria in liquid culture were grown shaking (150 rpm) at 37°C and bacteria on plate statically at 37°C, unless specified Strains were stored at -80°C in a stock containing 20% glycerol (Acros Organics). Assembly of expression constructs All constructs were assembled using the VersaTile shuffling technique disclosed in WO2018114980. Briefly, this technique comprises two different steps, a cloning phase to encode a sequence of interest on pVTE (a Tile), and a shuffling phase to make fusion constructs by a combinatorial approach. In this first phase, three different staphylokinase genes were codon optimized for Escherichia coli and synthesized comprising the desired position markers and restriction sites for BsaI and SapI (Thermo Fischer Scientific) for cloning into pVTE. All linker Tiles, the lysRODIdamidase Tile and a hexahistidine (His) tag Tile were available. Upon a cyclic restriction-ligation into pVTE, E. coli TOP10 cells were transformed with the created plasmids for validation by Sanger sequencing. In the second phase, all desired Tiles were assembled into the destination vector pVTD2 or pVTD3 in a single restriction-ligation reaction. All used primers and Tiles are listed in Table 5 and Table 6, respectively. Table 5: List of primers Names Sequence (5’-3’) Used for TCTTTCCTGCGTTATCCC pVTSEIII_F[SEQ ID NO:32]Colony PCR and SangerCATGAGCGGATACATATTTG sequencing of pVTE pVTSEIII_R [SEQ ID NO:33] TAATACGACTCACTATAGGG Colony PCR and Sanger T7_F [SEQ ID NO:34] sequencing of pVTD2 ATCCGGATATAGTTCCTCCTTTC T7_R [SEQ ID NO:35] Table 6: List of Tiles Tile Position Tile Position marker(s) marker(s) staphylokinase SAK 1 1 Linker 5 2 staphylokinase SAK 2 1 Linker 6 2 staphylokinase SAK 3 1 Linker 7 2 Linker 1 2 Linker 8 2 Linker 2 2 Linker 9 2 Linker 3 2 His 2-4 Linker 4 2 RODIΔamidase 3-4 Table 7: Strains, together with the growth medium used and its main function. The results sections making use of the strains are indicated in the third column. Strain medium Used for Origin E. coli TOP10 LB Molecular cloning, Thermo Fisher Scientific, vector assembly USA E. coli LB Recombinant protein Thermo Fisher Scientific, BL21(DE3) expression USA ClearColi®(DE3) LB Recombinant protein Lucigen, USA expression S. aureus 9 TSB Antibacterial Instituto de Productos susceptibility assays, Lacteos de Asturias, Spain screening assays S. aureus JAR TSB Antibacterial AO Foundation, Switzerland susceptibility assays S. aureus TSB Antibacterial AO Foundation, Switzerland Newman susceptibility assays S. aureus Mu8 TSB Antibacterial AO Foundation, Switzerland susceptibility assays S. aureus Mu100 TSB Antibacterial AO Foundation, Switzerland susceptibility assays S. epidermidis TSB Antibacterial AO Foundation, Switzerland 103.1 susceptibility assays S. aureus ST5 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST30 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST22 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST15 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST8 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST1 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus ST17 TSB Antibacterial Antibiolab strain collection susceptibility assays S. aureus V- TSB Antibacterial Clinical isolate UZ Leuven, 191016-1 susceptibility assays Belgium S. epidermidis TSB Antibacterial Clinical isolate UZ Leuven, TRH1 susceptibility assays Belgium S. epidermidis TSB Antibacterial Clinical isolate UZ Leuven, TRH5 susceptibility assays Belgium S. aureus 008 TSB Antibacterial Clinical isolate UZ Leuven, susceptibility assays Belgium S. capitis 052 TSB Antibacterial Clinical isolate UZ Leuven, susceptibility assays Belgium S. epidermidis TSB Antibacterial Clinical isolate UZ Leuven, 012 susceptibility assays Belgium S. haemolyticus TSB Antibacterial Clinical isolate UZ Leuven, 015 susceptibility assays Belgium S. hominis 01 TSB Antibacterial Clinical isolate UZ Leuven, susceptibility assays Belgium S. lugdunensis TSB Clinical isolate UZ Leuven, 018 susceptibility assays Belgium S. aureus Xen36 TSB Antibacterial Perkin Elmer, USA susceptibility assays Recombinant expression and purification of target proteins Multiple colonies were picked from a fresh culture plate to make an overnight culture of the desired expression vector in either E. coli BL21(DE3) or ClearColi®(DE3) depending on the final application. For the first expression strain, the overnight culture comprised 1.5% of the final expression volume whereas this was 4.5% for the latter, slower-growing strain. Upon inoculation, cells were grown to exponential phase (optical density at 600 nm (OD600) of 0.6) after which the culture was induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG; Sigma Aldrich). Depending on the peptide encoded on the expression plasmid, optimal expression conditions differed (Table 8). Table 8: Expression conditions used for recombinant protein expression. All expression conditions are listed for the (engineered) proteins. All proteins contained a carboxyterminal His fusion for purification. Expression conditions Used for 18 hours, 16°C LysRODIΔami, SAK2-L1, SAK2-L2, SAK2-L3, SAK2-L4, SAK2-L5, SAK2-L6, SAK2-L7, SAK2-L8, SAK2-L9 18 hours, 30°C staphylokinase SAK2, staphylokinase SAK3 4 hours 37°C staphylokinase SAK1 After protein expression, cells were harvested by centrifugation (4600 g, 45’, 4°C), after which the pellet was resuspended in lysis buffer (20 mM NaH2PO4, 500 mM NaCl, pH 7.4) containing 20 mM imidazole (Acros Organics) and 1 mM Pefabloc protease inhibitor (Merck). Subsequently, the lysates were subjected to three freeze-thaw cycles at -80°C followed by sonication (5” on / 5” off for 4’, 40% amplitude; Vibracell) and DNase I treatment (Thermo Fisher Scientific). Next, the soluble proteins were separated from the cell debris using centrifugation (60 628 g, 10’, 4°C) and were filtered using 0.22 µm filters. Recombinant proteins were purified using immobilized metal ion affinity purification (IMAC) as the encoded His-tag shows affinity for divalent cations such as Ni2+and Co2+. Depending on throughput and application, recombinant proteins were purified using Fast Protein Liquid Chromatography (FPLC) or bench purification (Table 9). Fractions of interest were pooled and concentrated using Microsep Advanced Centrifugal Devices (3 kDa or 10 kDa MWCO, Pall Corporation, USA), followed by dialysis to storage buffer (20 mM mM NaCl, 40 mM L-histidine, 40 mM L-arginine, pH 7.4) unless mentioned otherwise. Protein concentration was determined by measuring absorbance at 280 nm (SimpliNano) or using the QubitTMprotein BR assay kit (Invitrogen, USA). Table 9: Protein purification protocols. FPLC was performed using an AKTApure system (Cytiva, USA). CV: column volumes. Column Protino® Ni-NTA 1 mL Poly Ni-NTA His-bind® resin (Macherey Nagel, Germany) 2 mL (Merck) Flow speed 1 mL min-1Gravity flow (equilibration and elution 0.5 mL min-1) Buffer A1 20 mM NaH2PO4, 20 mM mQ H2O imidazole, 0.5 M NaCl, 0.1% empigen (pH 7.4) Buffer A2 20 mM NaH2PO4, 0.5 M NaCl (pH 7.4) Buffer B 20 mM NaH2PO4, 0.5 M imidazole, 0.5 M NaCl (pH 7.4) Equilibration10 CVs A2 (4% B)30 CVs A110 CVs A2 (4% B)Sample 4% B N / A application Wash 20 CV A1 10 CV A2 (4% B) 15 CVs A2 (4% B) 15 CV A2 (10% B) 10 CVs A2 (10% B) 10 CV A2 (16% B) Elution 3 CVs A2 (10% B) 20 CVs A2, linear gradient 10- 3 CVs A2 (20% B) 100% B 3 CVs A2 (50% B) 5 CVs B Used for staphylokinase SAK1, SAK2-L1, SAK2-L2, SAK2-L3, staphylokinase SAK2, SAK2-L4, SAK2-L5, SAK2-L6, staphylokinase SAK3, SAK2-L7, SAK2-L8, SAK2-L9 LysRODIΔami, SAK2-L2, SAK2-L8 Protein analysis Protein fractions of interest were visualized using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). To detect recombinant proteins, a Western blot was performed exploiting the His6-tag fused to the recombinant protein. Muralytic activity screen E. coli BL21(DE3) transformants were screened for muralytic activity on a 2% agar plate containing 0.05 mM IPTG, the necessary selectable markers and 1% S. aureus cell wall substrate. This substrate was prepared by autoclaving a 300 mL overnight culture of the desired S. aureus strain followed by centrifugation (4000 g, 30’, 4°C). Next, the pellet was washed in 20 mL Phosphate Buffered Saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4; pH 7.4) followed by a new round of centrifugation under the same conditions. Subsequently, the pellet was resuspended in the amount of PBS needed to obtain a suspension of 0.2 g of substrate per mL PBS. The formation of a translucent halo around the colonies indicated muralytic activity. Plasminogen activation assay To assess whether proteins can activate plasminogen to active plasmin, an indirect assay was performed measuring the amount of chromogenic substrate cleaved by plasmin. Therefore, the purified protein sample was mixed with 0.01 unit / mL plasminogen (Sigma Aldrich) and 1 mM D-Val-Leu-Lys-4-nitroanilide dihydrochloride in a 100 µL volume. The samples were incubated at 37°C unless specified otherwise. Absorbance at 405 nm was measured every three minutes during the entire experiment with a Clariostar Plus (BMG Labtech, Germany) multimode plate reader. Minimal inhibitory concentration (MIC) assay To assess the antibacterial potential of recombinant proteins, a MIC assay was performed according to CLSI standards. Briefly, 106bacteria were incubated with a twofold dilution of the tested protein in 200 µL Mueller-Hinton broth (BD). Following overnight incubation at 37°C, the MIC was determined by interpreting the well with the lowest protein concentration where growth inhibition took place. SAC model In vitro SACs were produced as described in Hofstee et al. (2020) Infect. Immun. 88, e00293-e00320.]. Briefly, a 25 µL bacterial solution containing approximately 10 colony-forming units (CFUs) of S. aureus JAR was grown between two layers of collagen gel, prepared from a solution of rat collagen type I (1.78 mg / mL, pH 7.4; Gibco, Basel, Switzerland) in accordance with the manufacturer's instructions. The collagen gel was then transferred to a 24-well Transwell system (Corning Life Sciences B.V., Amsterdam, The Netherlands), which featured a polyester membrane with a porosity of 0.4 µm, and allowed to polymerize for 1 hour at 37°C in a humidified incubator. Subsequently, 100 µL of pooled human plasma (Regional Blood Donation Service SRK Graubünden, Chur, Switzerland) was added to the samples, which were then incubated overnight at 37°C. Drug safety assessments In vitro cytotoxicity assay in HeLa cells HeLa cells, cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, 25 mM D-glucose, 4 mM L-glutamine, 1 mM sodium pyruvate; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Fischer Scientific), were seeded in a 96- well plate at a density of approximately 106cells / mL. After 24h of incubation (37°C, 5% CO2), 100 µL of protein in DMEM was added to the tested wells, followed by another 24h of incubation. Finally, 20 µL of AlamarBlue® (Thermo Fischer Scientific) was added to the wells. After 2h of incubation (37°C, 5% CO2), fluorescence was measured using a Clariostar Plus reader (ex. 540 nm / em. 610 nm). In vivo Galleria mellonella toxicity assessment To assess systemic toxicity in a simple living organism, G. mellonella larvae were injected in their hindmost left proleg with 20 µL of recombinant fusion protein in PBS. As a negative control, PBS was injected. Larvae were placed in sterile petri dishes (37°C, dark) and their health status was assessed every day for three days according to a scoring sheet (Table 10). Table 10: Scoring sheet assessing the health status of G. mellonella larvae Category Description Score No activity 0 Minimal activity on stimulation 1 Activity Active when stimulated 2 Active without stimulation 3 Complete melanisation (black) 0 Dark spots on brown wax worm 0 Melanisation ≥ 3 spots on beige wax worm 2 < 3 spots on beige wax worm 3 No melanisation 4 SurvivalDead 0Alive 2 Total Sum of all categories In vivo murine fracture-related infection model The fusion protein and its individual components were subjected to further evaluation in a pre-existing mouse model of fracture-related infection, developed at ARI (AO Research Institute, Davos), to assess their antimicrobial activity (Table 11). The study also incorporated a control group and a group receiving antibiotics. The treatments consisted of daily injections of 50 μl of the antimicrobial agent, resuspended in PBS. Table 11: Timeline infected phase with relative treatment groups and outcome. Control yes 50 µl saline 1 x daily intoinfected tissue4 8−1 Antibiotic yes110 mg kgvancomycinSQ 2x daily 4 8Staphyloki nase – SAK2-L8 1 x daily into endolysin yes (10 µM in 50 infe4 8fusion µl)cted tissueprotein Staphyloki Staphylo- nase & kinase SAK2 1 x daily into endolysin yes plus L8 (10 µM in 50i4 8(non-nfected tissuefused) µl) In addition to assessing antimicrobial activity, the fibrinolytic activity was also investigated to determine its impact on delaying bone healing. A group receiving treatment with the fusion protein was compared to a control group that mimicked the natural bone healing process. Table 12: Time line non-infected phase with relative treatment groups and outcome. Group Infected Treatment Frequency Histologytesting1 x daily into non- Control no 50 µl saline 4 6 infected tissue 1 x daily Staphylokinase- SAK2-L8 endolysin fusion no (10 µM in into non- 4 6 infected protein 50 µl) tissue SEQUENCES > staphylokinase SAK1 [SEQ ID NO:1] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEK 136 > staphylokinase SAK2[SEQ ID NO:2] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK 140 > staphylokinase SAK3 [SEQ ID NO:3] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKK 137 >RODIdAMI [SEQ ID NO:4] MAKTQAEINK RLDAYAKGTV DSPYRIKKAT SYDPSFGVME AGAIDADGYY 50 HAQCQDLITD YVLWLTDNKV RTWGNAKDQI KQSYGTGFKI HENKPSTVPK 100 KGWIAVFTSG SYQQWGHIGI VYDGGNTSTF TILEQNWNGY ANKKPTKRVD 150 NYYGLTHFIE IPVKAGATSS STIVKDGKTS SASTPATRPV TGSWKKNQFG 200 TWYKPESATF VNGNQPIITR IGSPFLNAPI GGNLPAGATI VYDEVCIQAG 250 HIWIGYNAYN GNRVYCPVRT CQGVPPNHIP GVAWGVFKG 289 >SAK1-L1-RODIdAMI[SEQ ID NO:5] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAA GAGAGAGAKT 150 QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI DADGYYHAQC 200 QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK PSTVPKKGWI 250 AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK PTKRVDNYYG 300 LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW KKNQFGTWYK 350 PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE VCIQAGHIWI 400 GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 437 >SAK1-L2-RODIdAMI[SEQ ID NO:6 ] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAG AGAGAGAGAG 150 AGAAGAKTQA EINKRLDAYA KGTVDSPYRI KKATSYDPSF GVMEAGAIDA 200 DGYYHAQCQD LITDYVLWLT DNKVRTWGNA KDQIKQSYGT GFKIHENKPS 250 TVPKKGWIAV FTSGSYQQWG HIGIVYDGGN TSTFTILEQN WNGYANKKPT 300 KRVDNYYGLT HFIEIPVKAG ATSSSTIVKD GKTSSASTPA TRPVTGSWKK 350 NQFGTWYKPE SATFVNGNQP IITRIGSPFL NAPIGGNLPA GATIVYDEVC 400 IQAGHIWIGY NAYNGNRVYC PVRTCQGVPP NHIPGVAWGV FKGKY 445 >SAK1-L3-RODIdAMI [SEQ ID NO: 7] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAL SRFFHAELAG 150 AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH 200 AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK 250 GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT NKKPTKRVDN 300 YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT 350 WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH 400 IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 440 >SAK1-L4-RODIdAMI[SEQ ID NO: 8] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAV FNQRKEHKGY 150 MLAAGAKTQA EINKRLDAYA KGTVDSPYRI KKATSYDPSF GVMEAGAIDA 200 DGYYHAQCQD LITDYVLWLT DNKVRTWGNA KDQIKQSYGT GFKIHENKPS 250 TVPKKGWIAV FTSGSYQQWG HIGIVYDGGN TSTFTILEQN WNGYANKKPT 300 KRVDNYYGLT HFIEIPVKAG ATSSSTIVKD GKTSSASTPA TRPVTGSWKK 350 NQFGTWYKPE SATFVNGNQP IITRIGSPFL NAPIGGNLPA GATIVYDEVC 400 IQAGHIWIGY NAYNGNRVYC PVRTCQGVPP NHIPGVAWGV FKGKY 445 >SAK1-L5-RODIdAMI [SEQ ID NO: 9] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAI PQGRSHPVQP 150 YPGAFAGAKT QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI 200 DADGYYHAQC QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK 250 PSTVPKKGWI AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK 300 PTKRVDNYYG LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW 350 KKNQFGTWYK PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE 400 VCIQAGHIWI GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 447 >SAK1-L6-RODIdAMI[SEQ ID NO: 10] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAP AVPPPAGAKT 150 QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI DADGYYHAQC 200 QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK PSTVPKKGWI 250 AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK PTKRVDNYYG 300 LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW KKNQFGTWYK 350 PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE VCIQAGHIWI 400 GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 437 >SAK1-L7-RODIdAMI[SEQ ID NO: 11] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAE AAAKEAAKEA 150 AKAGAKTQAE INKRLDAYAK GTVDSPYRIK KATSYDPSFG VMEAGAIDAD 200 GYYHAQCQDL ITDYVLWLTD NKVRTWGNAK DQIKQSYGTG FKIHENKPST 250 VPKKGWIAVF TSGSYQQWGH IGIVYDGGNT STFTILEQNW NGYANKKPTK 300 RVDNYYGLTH FIEIPVKAGA TSSSTIVKDG KTSSASTPAT RPVTGSWKKN 350 QFGTWYKPES ATFVNGNQPI ITRIGSPFLN APIGGNLPAG ATIVYDEVCI 400 QAGHIWIGYN AYNGNRVYCP VRTCQGVPPN HIPGVAWGVF KGKY 444 >SAK1-L8-RODIdAMI[SEQ ID NO: 12] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT GYGKAGGTVT 150 PTPNTAGAKT QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI 200 DADGYYHAQC QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK 250 PSTVPKKGWI AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK 300 PTKRVDNYYG LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW 350 KKNQFGTWYK PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE 400 VCIQAGHIWI GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 447 >SAK1-L9-RODIdAMI[SEQ ID NO: 13] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDSKGNEL LSPHYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAE AAAKEAAAKE 150 AAAKAGAKTQ AEINKRLDAY AKGTVDSPYR IKKATSYDPS FGVMEAGAID 200 ADGYYHAQCQ DLITDYVLWL TDNKVRTWGN AKDQIKQSYG TGFKIHENKP 250 STVPKKGWIA VFTSGSYQQW GHIGIVYDGG NTSTFTILEQ NWNGYANKKP 300 TKRVDNYYGL THFIEIPVKA GATSSSTIVK DGKTSSASTP ATRPVTGSWK 350 KNQFGTWYKP ESATFVNGNQ PIITRIGSPF LNAPIGGNLP AGATIVYDEV 400 CIQAGHIWIG YNAYNGNRVY CPVRTCQGVP PNHIPGVAWG VFKGKY 446 >SAK2-L1-RODIdAMI[SEQ ID NO: 14] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGAGAGAG 150 AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH 200 AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK 250 GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN 300 YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT 350 WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH 400 IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 440 >SAK2-L2-RODIdAMI[SEQ ID NO: 15] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAGAGAGAGA 150 GAGAGAAGAK TQAEINKRLD AYAKGTVDSP YRIKKATSYD PSFGVMEAGA 200 IDADGYYHAQ CQDLITDYVL WLTDNKVRTW GNAKDQIKQS YGTGFKIHEN 250 KPSTVPKKGW IAVFTSGSYQ QWGHIGIVYD GGNTSTFTIL EQNWNGYANK 300 KPTKRVDNYY GLTHFIEIPV KAGATSSSTI VKDGKTSSAS TPATRPVTGS 350 WKKNQFGTWY KPESATFVNG NQPIITRIGS PFLNAPIGGN LPAGATIVYD 400 EVCIQAGHIW IGYNAYNGNR VYCPVRTCQG VPPNHIPGVA WGVFKGKY 448 >SAK2-L3-RODIdAMI[SEQ ID NO: 16] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GALSRFFHAE 150 LAGAKTQAEI NKRLDAYAKG TVDSPYRIKK ATSYDPSFGV MEAGAIDADG 200 YYHAQCQDLI TDYVLWLTDN KVRTWGNAKD QIKQSYGTGF KIHENKPSTV 250 PKKGWIAVFT SGSYQQWGHI GIVYDGGNTS TFTILEQNWN GYANKKPTKR 300 VDNYYGLTHF IEIPVKAGAT SSSTIVKDGK TSSASTPATR PVTGSWKKNQ 350 FGTWYKPESA TFVNGNQPII TRIGSPFLNA PIGGNLPAGA TIVYDEVCIQ 400 AGHIWIGYNA YNGNRVYCPV RTCQGVPPNH IPGVAWGVFK GKY 443 >SAK2-L4-RODIdAMI[SEQ ID NO: 17] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAVFNQRKEH 150 KGYMLAAGAK TQAEINKRLD AYAKGTVDSP YRIKKATSYD PSFGVMEAGA 200 IDADGYYHAQ CQDLITDYVL WLTDNKVRTW GNAKDQIKQS YGTGFKIHEN 250 KPSTVPKKGW IAVFTSGSYQ QWGHIGIVYD GGNTSTFTIL EQNWNGYANK 300 KPTKRVDNYY GLTHFIEIPV KAGATSSSTI VKDGKTSSAS TPATRPVTGS 350 WKKNQFGTWY KPESATFVNG NQPIITRIGS PFLNAPIGGN LPAGATIVYD 400 EVCIQAGHIW IGYNAYNGNR VYCPVRTCQG VPPNHIPGVA WGVFKGKY 448 >SAK2-L5-RODIdAMI[SEQ ID NO: 18] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAIPQGRSHP 150 VQPYPGAFAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA 200 GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH 250 ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA 300 NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT 350 GSWKKNQFGT WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV 400 YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 450 >SAK2-L6-RODIdAMI[SEQ ID NO: 19] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAPAVPPPAG 150 AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH 200 AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK 250 GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN 300 YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT 350 WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH 400 IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 440 >SAK2-L7-RODIdAMI[SEQ ID NO: 20] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAEAAAKEAA 150 KEAAKAGAKT QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI 200 DADGYYHAQC QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK 250 PSTVPKKGWI AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK 300 PTKRVDNYYG LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW 350 KKNQFGTWYK PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE 400 VCIQAGHIWI GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 447 >SAK2-L8-RODIdAMI[SEQ ID NO: 21] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGYGKAGG 150 TVTPTPNTAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA 200 GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH 250 ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA 300 NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT 350 GSWKKNQFGT WYKPESATFV NGNQPIITRI GNLPAGATIV 400 YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 450 >SAK2-L9-RODIdAMI[SEQ ID NO: 22] MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK 50 PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV 100 TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAEAAAKEAA 150 AKEAAAKAGA KTQAEINKRL DAYAKGTVDS PYRIKKATSY DPSFGVMEAG 200 AIDADGYYHA QCQDLITDYV LWLTDNKVRT WGNAKDQIKQ SYGTGFKIHE 250 NKPSTVPKKG WIAVFTSGSY QQWGHIGIVY DGGNTSTFTI LEQNWNGYAN 300 KKPTKRVDNY YGLTHFIEIP VKAGATSSST IVKDGKTSSA STPATRPVTG 350 SWKKNQFGTW YKPESATFVN GNQPIITRIG SPFLNAPIGG NLPAGATIVY 400 DEVCIQAGHI WIGYNAYNGN RVYCPVRTCQ GVPPNHIPGV AWGVFKGKY 449 >SAK3-L1-RODIdAMI[SEQ ID NO: 23] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAA GAGAGAGAKT 150 QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI DADGYYHAQC 200 QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK PSTVPKKGWI 250 AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK PTKRVDNYYG 300 LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW KKNQFGTWYK 350 PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE VCIQAGHIWI 400 GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 437 >SAK3-L2-RODIdAMI[SEQ ID NO: 24] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAG AGAGAGAGAG 150 AGAAGAKTQA EINKRLDAYA KGTVDSPYRI KKATSYDPSF GVMEAGAIDA 200 DGYYHAQCQD LITDYVLWLT DNKVRTWGNA KDQIKQSYGT GFKIHENKPS 250 TVPKKGWIAV FTSGSYQQWG HIGIVYDGGN TSTFTILEQN WNGYANKKPT 300 KRVDNYYGLT HFIEIPVKAG ATSSSTIVKD GKTSSASTPA TRPVTGSWKK 350 NQFGTWYKPE SATFVNGNQP IITRIGSPFL NAPIGGNLPA GATIVYDEVC 400 IQAGHIWIGY NAYNGNRVYC PVRTCQGVPP NHIPGVAWGV FKGKY 445 >SAK3-L3-RODIdAMI[SEQ ID NO: 25] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAL SRFFHAELAG 150 AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH 200 AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK 250 GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN 300 YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT 350 WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH 400 IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY 440 >SAK3-L4-RODIdAMI[SEQ ID NO: 26] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAV FNQRKEHKGY 150 MLAAGAKTQA EINKRLDAYA KGTVDSPYRI KKATSYDPSF GVMEAGAIDA 200 DGYYHAQCQD LITDYVLWLT DNKVRTWGNA GFKIHENKPS 250 TVPKKGWIAV FTSGSYQQWG HIGIVYDGGN TSTFTILEQN WNGYANKKPT 300 KRVDNYYGLT HFIEIPVKAG ATSSSTIVKD GKTSSASTPA TRPVTGSWKK 350 NQFGTWYKPE SATFVNGNQP IITRIGSPFL NAPIGGNLPA GATIVYDEVC 400 IQAGHIWIGY NAYNGNRVYC PVRTCQGVPP NHIPGVAWGV FKGKY 445 >SAK3-L5-RODIdAMI[SEQ ID NO: 27] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAI PQGRSHPVQP 150 YPGAFAGAKT QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI 200 DADGYYHAQC QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK 250 PSTVPKKGWI AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK 300 PTKRVDNYYG LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW 350 KKNQFGTWYK PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE 400 VCIQAGHIWI GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 447 >SAK3-L6-RODIdAMI[SEQ ID NO: 28] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAP AVPPPAGAKT 150 QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI DADGYYHAQC 200 QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK PSTVPKKGWI 250 AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK PTKRVDNYYG 300 LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW KKNQFGTWYK 350 PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE VCIQAGHIWI 400 GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 437 >SAK3-L7-RODIdAMI[SEQ ID NO: 29] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAE AAAKEAAKEA 150 AKAGAKTQAE INKRLDAYAK GTVDSPYRIK KATSYDPSFG VMEAGAIDAD 200 GYYHAQCQDL ITDYVLWLTD NKVRTWGNAK DQIKQSYGTG FKIHENKPST 250 VPKKGWIAVF TSGSYQQWGH IGIVYDGGNT STFTILEQNW NGYANKKPTK 300 RVDNYYGLTH FIEIPVKAGA TSSSTIVKDG KTSSASTPAT RPVTGSWKKN 350 QFGTWYKPES ATFVNGNQPI ITRIGSPFLN APIGGNLPAG ATIVYDEVCI 400 QAGHIWIGYN AYNGNRVYCP VRTCQGVPPN HIPGVAWGVF KGKY 444 >SAK3-L8-RODIdAMI[SEQ ID NO: 30] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV ELDPSAKIEV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAA GYGKAGGTVT 150 PTPNTAGAKT QAEINKRLDA YAKGTVDSPY RIKKATSYDP SFGVMEAGAI 200 DADGYYHAQC QDLITDYVLW LTDNKVRTWG NAKDQIKQSY GTGFKIHENK 250 PSTVPKKGWI AVFTSGSYQQ WGHIGIVYDG GNTSTFTILE QNWNGYANKK 300 PTKRVDNYYG LTHFIEIPVK AGATSSSTIV KDGKTSSAST PATRPVTGSW 350 KKNQFGTWYK PESATFVNGN QPIITRIGSP FLNAPIGGNL PAGATIVYDE 400 VCIQAGHIWI GYNAYNGNRV YCPVRTCQGV PPNHIPGVAW GVFKGKY 447 >SAK3-L9-RODIdAMI[SEQ ID NO: 31] MSSSFDKGKY KKGDDASYFE PTGPYLMVNV TGVDGKRNEL LSPRYVEFPI 50 KPGTTLTKEK IEYYVEWALD ATAYKEFRVV TYYDKNKKKE 100 ETKSFPITEK GFVVPDLSEH IKNPGFNLIT KVVIEKKGAE AAAKEAAAKE 150 AAAKAGAKTQ AEINKRLDAY AKGTVDSPYR IKKATSYDPS FGVMEAGAID 200 ADGYYHAQCQ DLITDYVLWL TDNKVRTWGN AKDQIKQSYG TGFKIHENKP 250 STVPKKGWIA VFTSGSYQQW GHIGIVYDGG NTSTFTILEQ NWNGYANKKP 300 TKRVDNYYGL THFIEIPVKA GATSSSTIVK DGKTSSASTP ATRPVTGSWK 350 KNQFGTWYKP ESATFVNGNQ PIITRIGSPF LNAPIGGNLP AGATIVYDEV 400 CIQAGHIWIG YNAYNGNRVY CPVRTCQGVP PNHIPGVAWG VFKGKY 446
Claims
CLAIMS 1. A fibrinolytic enzyme and an antibacterial agent, for use as a medicament, wherein the fibrinolytic enzyme is a staphylokinase and the antibacterial agent is an endolysin and / or antibiotic.
2. The fibrinolytic enzyme and antibacterial agent for use according to claim 1, wherein the antibacterial agent is an endolysin.
3. The fibrinolytic enzyme and antibacterial agent for use according to claim 1 or 2, wherein the endolysin lacks a muramidase domain.
4. The fibrinolytic enzyme and antibacterial agent for use according to any one of claim 1 to 3, wherein the staphylokinase and the endolysin are a fusion protein.
5. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 4, wherein the staphylokinase is of a virus of the taxonomic group of Caudoviricetes.
6. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 5, wherein the staphylokinase has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK[SEQ ID NO: 2].
7. The fibrinolytic enzyme and antibacterial agent for use according to any one of claims 1 to 6, wherein the endolysin has the sequence MAKTQAEINK RLDAYAKGTV DSPYRIKKAT SYDPSFGVME AGAIDADGYY HAQCQDLITD YVLWLTDNKV RTWGNAKDQI KQSYGTGFKI HENKPSTVPK KGWIAVFTSG SYQQWGHIGI VYDGGNTSTF TILEQNWNGY ANKKPTKRVD NYYGLTHFIE IPVKAGATSS STIVKDGKTS SASTPATRPV TGSWKKNQFG TWYKPESATF VNGNQPIITR IGSPFLNAPI GGNLPAGATI VYDEVCIQAG HIWIGYNAYN GNRVYCPVRT CQGVPPNHIP GVAWGVFKG [SEQ ID NO: 4].
8. The fibrinolytic enzyme and antibacterial agent for use according to claim 4, wherein the fusion protein has the sequence MATYDHKQIK IGESRDYQEI VGPHLIVNVT GVDKNGNDKL HPKFMEFHIK PGQVLNKKEI TKYVEWTLDG TAYNKYRVVD FAQGSKVEVT YFSKTEKRNV TQSFPITDKG FVVPDLSEHT TNPGYTLVTN VIIEEKKSKK GAAGYGKAGG TVTPTPNTAG AKTQAEINKR LDAYAKGTVD SPYRIKKATS YDPSFGVMEA GAIDADGYYH AQCQDLITDY VLWLTDNKVR TWGNAKDQIK QSYGTGFKIH ENKPSTVPKK GWIAVFTSGS YQQWGHIGIV YDGGNTSTFT ILEQNWNGYA NKKPTKRVDN YYGLTHFIEI PVKAGATSSS TIVKDGKTSS ASTPATRPVT GSWKKNQFGT WYKPESATFV NGNQPIITRI GSPFLNAPIG GNLPAGATIV YDEVCIQAGH IWIGYNAYNG NRVYCPVRTC QGVPPNHIPG VAWGVFKGKY [SEQ ID:21].
9. The fibrinolytic enzyme and antibacterial agent for use according to claim 1, wherein the antibacterial agent is an antibiotic.
10. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is a fluoroquinolone.
11. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is sitafloxacin.
12. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is an aminoglycoside.
13. The fibrinolytic enzyme and antibacterial agent for use according to claim 9, wherein the antibiotic is gentamycin.
14. The fibrinolytic enzyme and antibacterial agent according for use according to any one of claims 1 to, wherein the fibrinolytic enzyme is a staphylokinase and wherein the antibacterial agent is an endolysin and an antibiotic.
15. A fibrinolytic enzyme and an antibacterial agent as defined in any one of claims 1 to 14, for use in the treatment or prevention of a bacterial infection that is fibrin-encapsulated.
16. The fibrinolytic enzyme and agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises multicellular communities of bacteria.
17. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises S. aureus.
18. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection comprises MRSA.
19. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection is an abscess.
20. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection is a biofilm.
21. The fibrinolytic enzyme and antibacterial agent as defined in any one of claims 1 to 14, wherein the bacterial infection is a biofilm on a medical implant in the body.
22. In vitro non-medical use of a staphylokinase and an antibacterial agent as defined in any one of claims 1 to 14, in the prevention or treatment of fibrin encapsulated bacteria on a surface.
23. The in vitro use according to claim 22, wherein the fibrin encapsulated bacteria are a biofilm.