Compositions and methods for multiplexed activation and repression of t cell gene expression

EP4754248A1Pending Publication Date: 2026-06-10TUNE THERAPEUTICS INC

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
TUNE THERAPEUTICS INC
Filing Date
2024-07-30
Publication Date
2026-06-10

AI Technical Summary

Technical Problem

Current Adoptive Cell Therapy (ACT) treatments for diseases like cancer face challenges such as suboptimal T cell function, expansion, and persistence.

Method used

An epigenetic-modifying DNA-targeting system comprising a plurality of DNA-targeting modules, including activator and repressor modules, which use fusion proteins with specific DNA-binding domains and transcriptional activator or repressor domains to modulate T cell gene expression.

Benefits of technology

The system effectively increases transcription of activation genes and represses transcription of repression genes in T cells, enhancing T cell function, expansion, and persistence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024040246_06022025_PF_FP_ABST
    Figure US2024040246_06022025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are epigenetic-modifying DNA-targeting systems, such as CRISPR-Cas / guide RNA (gRNA) systems, that bind to or target multiple genes or regulatory elements thereof, for instance in a T cell. In some aspects, the provided epigenetic-modifying DNA-targeting systems promote increased transcription of one or more first genes and promote repressed transcription of one or more second genes. In some aspects, the provided epigenetic-modifying DNA-targeting systems modulate a T cell function, such as a T cell phenotype or activity. Also provided herein are polynucleotides, vectors, cells, methods, and uses related to the provided epigenetic-modifying DNA-targeting systems, for example in modulating T cells, such as in connection with methods of adoptive T cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

22474-20028.40 COMPOSITIONS AND METHODS FOR MULTIPLEXED ACTIVATION AND REPRESSION OF T CELL GENE EXPRESSION Cross-Reference to Related Applications

[0001] This application claims priority from U.S. provisional application No.63 / 530,049 filed July 31, 2023, U.S. provisional application No.63 / 581,952 filed September 11, 2023, and U.S. provisional application No.63 / 570,751 filed March 27, 2024, the contents of which are incorporated by reference in their entireties. Incorporation by Reference of Sequence Listing

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 22474-2002840_SeqList.xml, created July 252024, which is 954,065 bytes in size. The information in the electronic format of the Sequence Listing is herein incorporated by reference in its entirety. Field

[0003] The present disclosure relates in some aspects to epigenetic-modifying DNA- targeting systems, such as CRISPR-Cas / guide RNA (gRNA) systems, that bind to or target multiple genes or regulatory elements thereof, for instance in a T cell. In some aspects, the provided epigenetic-modifying DNA-targeting systems promote increased transcription of one or more first genes (also referred to herein as activation genes) and promote repressed transcription of one or more second genes (also referred to herein as repression genes). In some aspects, the provided epigenetic-modifying DNA-targeting systems modulate a T cell function, such as a T cell phenotype or activity. The present disclosure also relates in some aspects to polynucleotides, vectors, cells, methods, and uses related to the provided epigenetic-modifying DNA-targeting systems, for example in modulating T cells, such as in connection with methods of adoptive T cell therapy. Background

[0004] The administration of T cells targeting a specific antigen, also known as Adoptive Cell Therapy (ACT), is a promising approach for treating diseases such as cancer. However, sf-605940722474-20028.40 current ACT treatments face challenges, including suboptimal T cell function, expansion, and persistence. Therefore, there is a need for new and improved methods to overcome these challenges. The present disclosure addresses these and other needs. Summary

[0005] Provided herein in some embodiments is an epigenetic-modifying DNA-targeting system comprising a plurality of DNA-targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes in a T cell, and each activator DNA-targeting module comprises a fusion protein comprising (i) a first DNA-binding domain for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes in the T cell, and each repressor DNA-targeting module comprises a fusion protein comprising (i) a second DNA-binding domain for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain; wherein the first DNA- binding domain or domains are all different from the second DNA-binding domain or domains.

[0006] In some of any embodiments, the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some of any embodiments, the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0007] Also provided herein in some embodiments is an epigenetic-modifying DNA- targeting system comprising a plurality of DNA-targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises a fusion protein comprising (i) a first DNA-binding domain for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain, wherein the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes, and each repressor DNA- sf-605940722474-20028.40 targeting module comprises a fusion protein comprising (i) a second DNA-binding domain for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain, wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first DNA-binding domain or domains are all different from the second DNA-binding domain or domains.

[0008] In some of any embodiments, the epigenetic-modifying DNA-targeting system does not introduce a genetic disruption or a DNA break.

[0009] In some of any embodiments, at least one, optionally each first DNA-binding domain is a Clustered Regularly Interspaced Short Palindromic Repeats associated (Cas) protein; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing endonuclease; or an I-SceI enzyme. In some of any embodiments, at least one, optionally each first DNA-binding domain is catalytically inactive.

[0010] In some of any embodiments, at least one, optionally each second DNA-binding domain is a Cas protein; a ZFP; a TALE; a meganuclease; a homing endonuclease; or an I-SceI enzyme. In some of any embodiments, at least one, optionally each second DNA-binding domain is catalytically inactive.

[0011] In some of any embodiments, at least one, optionally each first DNA-binding domain is a first Cas protein, and at least one, optionally each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes. In some of any embodiments, each first DNA-binding domain is a first Cas protein, and each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes.

[0012] In some of any embodiments, at least one, optionally each second DNA-binding domain is a ZFP.

[0013] In some of any embodiments, at least one, optionally each second DNA-binding domain is a second Cas protein, and at least one, optionally each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes. In some of any embodiments, each second DNA-binding domain is a second Cas protein, and each of the at least one repressor DNA- sf-605940722474-20028.40 targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

[0014] In some of any embodiments, at least one, optionally each first DNA-binding domain is a ZFP.

[0015] In some of any embodiments, at least one, optionally each first DNA-binding domain is a ZFP; and at least one, optionally each second DNA-binding domain is a Cas protein, and at least one, optionally each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

[0016] In some of any embodiments: at least one, optionally each first DNA-binding domain is a first Cas protein, and at least one, optionally each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; and at least one, optionally each second DNA-binding domain is a second Cas protein, and at least one, optionally each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

[0017] In some of any embodiments: each first DNA-binding domain is a first Cas protein, and each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; and each second DNA-binding domain is a second Cas protein, and each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

[0018] In some of any embodiments, the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins.

[0019] Also provided herein in some embodiments is an epigenetic-modifying DNA- targeting system comprising a plurality of DNA-targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises (1) a fusion protein comprising (i) a first Cas protein and (ii) at least one transcriptional activator domain, and (2) a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; wherein the one or more activation genes are selected from the group consisting of sf-605940722474-20028.40 BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes, and each repressor DNA-targeting module comprises (1) a fusion protein comprising (i) a second Cas protein and (ii) at least one transcriptional repressor domain, and (2) a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes; wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins.

[0020] Also provided herein in some embodiments is an epigenetic-modifying DNA- targeting system comprising a plurality of DNA-targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of IL-2, and each activator DNA-targeting module comprises (1) a fusion protein comprising (i) an dSaCas protein and (ii) at least one transcriptional activator domain, and (2) a gRNA for targeting the dSaCas protein to a target site of IL-2; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes, and each repressor DNA-targeting module comprises (1) a fusion protein comprising (i) an dSpCas9 protein and (ii) at least one transcriptional repressor domain, and (2) a gRNA for targeting the dSpCas9 protein to a target site of one of the one or more repression genes; wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0021] In some of any embodiments, the first Cas protein or proteins do not bind to the protospacer-adjacent motifs (PAMs) that the second Cas protein or proteins bind to.

[0022] Also provided herein in some embodiments is an epigenetic-modifying DNA- targeting system comprising a plurality of DNA-targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises (1) a fusion protein comprising (i) a first Cas protein and (ii) at least one transcriptional activator domain, and (2) a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; wherein the one or more activation genes are selected from the group consisting of sf-605940722474-20028.40 BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repressor genes, and each repressor DNA-targeting module comprises (1) a fusion protein comprising (i) a second Cas protein and (ii) at least one transcriptional repressor domain, and (2) a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes; wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first Cas protein or proteins do not bind to the protospacer- adjacent motifs (PAMs) that the second Cas protein or proteins bind to.

[0023] In some of any embodiments, the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins.

[0024] In some of any embodiments, at least one, optionally each of the first Cas protein or proteins bind to a first PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide. In some of any embodiments, at least one, optionally each of the second Cas protein or proteins bind to a second PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A.

[0025] In some of any embodiments, the first Cas protein or proteins bind to a first PAM 5’- NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide. In some of any embodiments, the second Cas protein or proteins bind to a second PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A.

[0026] In some of any embodiments, at least one, optionally each of the first Cas protein or proteins bind to a first PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A. In some of any embodiments, at least one, optionally each of the second Cas protein or proteins bind to a second PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide.

[0027] In some of any embodiments, the first Cas protein or proteins bind to a first PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A. In some of any embodiments, the second Cas protein or proteins bind to a second PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide.

[0028] In some of any embodiments, the first Cas protein or proteins do not bind to the gRNA or gRNAs that target the one or more repression genes, and the second Cas protein or proteins do not bind to the gRNA or gRNAs that target the one or more activation genes. sf-605940722474-20028.40

[0029] In some of any embodiments, at least one, optionally each first Cas protein is a deactivated (dCas) protein. In some of any embodiments, at least one, optionally each first Cas protein lacks nuclease activity. In some of any embodiments, at least one, optionally each first Cas protein is a dCas9 protein.

[0030] In some of any embodiments, at least one, optionally each first Cas protein is a Staphylococcus aureus dCas9 (dSaCas9) protein. In some of any embodiments, at least one, optionally each first Cas protein is a dSaCas9 protein comprising at least one amino acid mutation selected from D10A and N580A with reference to numbering of positions of SEQ ID NO:124. In some of any embodiments, at least one, optionally each first Cas protein comprises the sequence set forth in SEQ ID NO:125 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each first Cas protein is set forth in SEQ ID NO:125.

[0031] In some of any embodiments, at least one, optionally each first Cas protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein. In some of any embodiments, at least one, optionally each first Cas protein is a dSpCas9 protein comprising at least one amino acid mutation selected from D10A and H840A with reference to numbering of positions of SEQ ID NO:126. In some of any embodiments, at least one, optionally each first Cas protein comprises the sequence set forth in SEQ ID NO:127 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each first Cas protein is set forth in SEQ ID NO:127.

[0032] In some of any embodiments, at least one, optionally each first Cas protein is a dCas12 protein.

[0033] In some of any embodiments, the at least one activator DNA-targeting module is a single activator DNA-targeting module. In some of any embodiments, the at least one activator DNA-targeting module is a plurality of activator DNA-targeting modules.

[0034] In some of any embodiments, at least one of the first DNA-binding domains is a ZFP that targets a target site of one of the one or more activation genes. In some of any embodiments, at least one of the second DNA-binding domains is a ZFP that targets a target site of one of the one or more repression genes.

[0035] In some of any embodiments: the first DNA-binding domains of the at least one activator DNA-targeting module are different from one another. sf-605940722474-20028.40

[0036] In some of any embodiments, at least one, optionally each activator DNA-targeting module of the at least one activator DNA-targeting module is different.

[0037] In some of any embodiments, the at least one activator DNA-targeting module is 2, 3, 4, 5, or 6 activator DNA-targeting modules. In some of any embodiments, the at least one activator DNA-targeting module is 2 activator DNA-targeting modules.

[0038] In some of any embodiments, the one or more activation genes comprise IL-2. In some of any embodiments, the one or more activation genes is IL-2.

[0039] In some of any embodiments, the at least one activator DNA-targeting module targets two or more activation genes. In some of any embodiments, the one or more activation genes comprise BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; EOMES and IL-2; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; or VAV1 and IL-2. In some of any embodiments, the one or more activation genes comprise IL-2RB and VAV1. In some of any embodiments, the one or more activation genes comprise IL-2 and VAV1.

[0040] In some of any embodiments, the target site for at least one, optionally each of the one or more activation genes is in a gene or a regulatory DNA element. In some of any embodiments, the target site for at least one, optionally each of the one or more activation genes is in a gene, an enhancer, or a promoter. In some of any embodiments, the target site for at least one, optionally each of the one or more activation genes is in an enhancer or a promoter.

[0041] In some of any embodiments, the target site for at least one, optionally each of the one or more activation genes is within 1000 base pairs of a transcriptional start site of one of the one or more activation genes. In some of any embodiments, the target site for at least one, optionally each of the one or more activation genes is within 500 base pairs of a transcriptional start site of one of the one or more activation genes.

[0042] In some of any embodiments, the target site for at least one of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site sf-605940722474-20028.40 for BATF having the sequence set forth in any one of SEQ ID NOS:172-174, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144-146 and 189-191, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175-177, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184-186, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150-152 and 187-188, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; and (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153-155, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

[0043] In some of any embodiments, the target site for at least one of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403 or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172-174, or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144-146 and 189-191, or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175-177, or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184-186, or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150-152 and 187-188, or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sf-605940722474-20028.40 sequence set forth in any one of SEQ ID NOS:153-155, or a complementary sequence of any of the foregoing.

[0044] In some of any embodiments, the target site for each of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172-174, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144-146 and 189-191, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175-177, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184-186, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150-152 and 187-188, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153-155, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

[0045] In some of any embodiments, the target site for each of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403 or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172-174, or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144-146 and 189-191, or a complementary sequence of any of the foregoing; (e) a target sf-605940722474-20028.40 site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175-177, or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184-186, or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150-152 and 187-188, or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153-155, or a complementary sequence of any of the foregoing.

[0046] In some of any embodiments, the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403 or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78 and 388-403 or a complementary sequence of any of the foregoing.

[0047] In some of any embodiments, the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412 or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is a target site for sf-605940722474-20028.40 IL-2 having the sequence set forth in any one of SEQ ID NO:404-412 or a complementary sequence of any of the foregoing.

[0048] In some of any embodiments, the target site for at least one of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for at least one of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453 or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453 or a complementary sequence of any of the foregoing.

[0049] In some of any embodiments, the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO: 451. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: QNAHRKT (SEQ ID NO: 472), F2: RKYYLAK (SEQ ID NO: 473), F3: RSAHLSR (SEQ ID NO: 474), F4: QSGDLTR (SEQ ID NO: 475), F5: RSDHLTQ (SEQ ID NO: 476), and F6: DSANLSR (SEQ ID NO: 477). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 458, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 458. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 465 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 465.

[0050] In some of any embodiments, the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO: 452. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DSSHLEL (SEQ ID NO: 478), F2: DRSNLTR (SEQ ID NO: 479), F3: RSDNLSE (SEQ ID sf-605940722474-20028.40 NO: 480), F4: VRRALSS (SEQ ID NO: 481), F5: QSGALAR (SEQ ID NO: 482), and F6: RLDWLPM (SEQ ID NO: 483). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 459, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 459. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 466 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 466. In some of any embodiments, the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO: 453. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSDNLSV (SEQ ID NO: 484), F2: RSAHLSR (SEQ ID NO: 485), F3: QNAHRKT (SEQ ID NO: 486), F4: LRHHLTR (SEQ ID NO: 487), F5: TSSNRKT (SEQ ID NO: 488), and F6: TSSNLSR (SEQ ID NO: 489). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 460, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 460. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 467 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 467.

[0051] In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence that is complementary to a target site of one of the one or more activation genes. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence between 14 nt and 24 nt or between 16 nt and 22 nt in length. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length. sf-605940722474-20028.40

[0052] In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more activation genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:69. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one or the one or more activation genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:387.

[0053] In some of any embodiments, at least one of the gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:178-180, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:157-159 and 197- 199, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:160-162, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:181-183, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:192-194, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:163-165 and 195-196, or a contiguous portion thereof of at least 14 nt; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:166-168, or a contiguous portion thereof of at least 14 nt.

[0054] In some of any embodiments, at least one of the gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428; (c) a gRNA targeting a target site sf-605940722474-20028.40 for BATF and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:178- 180; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:157-159 and 197-199; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:160-162; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:181-183; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:192-194; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:163-165 and 195-196; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:166-168.

[0055] In some of any embodiments, each gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:178-180, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:157-159 and 197-199, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:160-162, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:181-183, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:192-194, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:163-165 and 195-196, or a contiguous portion thereof of at least 14 nt; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:166-168, or a contiguous portion thereof of at least 14 nt. sf-605940722474-20028.40

[0056] In some of any embodiments, each gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:178-180; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:157-159 and 197-199; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:160-162; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:181-183; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:192-194; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:163- 165 and 195-196; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:166-168.

[0057] In some of any embodiments, at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428. In some of any embodiments, each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428.

[0058] In some of any embodiments, at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:429-437, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, at least one of the sf-605940722474-20028.40 gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:429-437. In some of any embodiments, each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:429-437, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, each gRNA targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:429-437.

[0059] In some of any embodiments, at least one, optionally each transcriptional activator domain epigenetically modifies a target site of one of the one or more activation genes to promote increased transcription of one of the one or more activation genes.

[0060] In some of any embodiments, at least one, optionally each transcriptional activator domain is a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, optionally wherein the TET protein is TET1, a SunTag domain, or a domain, portion, variant, or truncation of any of the foregoing. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises at least one VP16 domain or a variant or portion thereof that exhibits transcriptional activation activity. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a VP16 tetramer (VP64) domain or a variant or portion thereof that exhibits transcriptional activation activity. In some of any embodiments, at least one, optionally each transcriptional activator domain is a VP64 domain.

[0061] In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a NCOA3 domain or a variant or portion thereof that exhibits transcriptional activation activity. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a FOXO3 domain or a variant or portion thereof that exhibits transcriptional activation activity. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a NCOA3-FOXO3-NCOA3 domain. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a NCOA3-FOXO3-NCOA3 domain. In some of any embodiments, at least one, optionally each transcriptional activator domain is a NCOA3-FOXO3-NCOA3 domain. In some of any embodiments, at least one, optionally each transcriptional activator domain comprises a VP16 tetramer (VP64) domain and a NCOA3-FOXO3-NCOA3 domain. In some of any embodiments, sf-605940722474-20028.40 at least one, optionally each transcriptional activator domain is a VP16 tetramer (VP64) domain and a NCOA3-FOXO3-NCOA3 domain.

[0062] In some of any embodiments, at least one, optionally each transcriptional activator domain comprises the sequence set forth in SEQ ID NO:142, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0063] In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:77 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0064] In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:386 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0065] In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:528 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:529 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:514 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:515 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:516 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. sf-605940722474-20028.40

[0066] In some of any embodiments, at least one, optionally each second Cas protein is a deactivated (dCas) protein. In some of any embodiments, at least one, optionally each second Cas protein lacks nuclease activity. In some of any embodiments, at least one, optionally each second Cas protein is a dCas9 protein.

[0067] In some of any embodiments, at least one, optionally each second Cas protein is a dSaCas9 protein. In some of any embodiments, at least one, optionally each second Cas protein is a dSaCas9 protein comprising at least one amino acid mutation selected from D10A and N580A with reference to numbering of positions of SEQ ID NO:124. In some of any embodiments, at least one, optionally each second Cas protein comprises the sequence set forth in SEQ ID NO:125 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each second Cas protein is set forth in SEQ ID NO:125.

[0068] In some of any embodiments, at least one, optionally each second Cas protein is a dSpCas9 protein. In some of any embodiments, at least one, optionally each second Cas protein is a dSpCas9 protein comprising at least one amino acid mutation selected from D10A and H840A with reference to numbering of positions of SEQ ID NO:126. In some of any embodiments, at least one, optionally each second Cas protein comprises the sequence set forth in SEQ ID NO:127 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, at least one, optionally each second Cas protein is set forth in SEQ ID NO:127.

[0069] In some of any embodiments, at least one, optionally each second Cas protein is a dCas12 protein.

[0070] In some of any embodiments, the at least one repressor DNA-targeting module is a single repressor DNA-targeting module. In some of any embodiments, the at least one repressor DNA-targeting module is a plurality of repressor DNA-targeting modules.

[0071] In some of any embodiments, the second DNA-binding domains of the at least one repressor DNA-targeting module are different from one another.

[0072] In some of any embodiments, at least one, optionally each repressor DNA-targeting module of the at least one repressor DNA-targeting module is different.

[0073] In some of any embodiments, the at least one repressor DNA-targeting module is 2, 3, 4, 5, or 6 repressor DNA-targeting modules. In some of any embodiments, the at least one repressor DNA-targeting module is 2 repressor DNA-targeting modules. sf-605940722474-20028.40

[0074] In some of any embodiments, the one or more repression genes comprise MED12. In some of any embodiments, the one or more repression genes is MED12.

[0075] In some of any embodiments, the at least one repressor DNA-targeting modules targets two or more repression genes. In some of any embodiments, the one or more repression genes comprise CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH, and MYB; GATA3, CBLB, and MYB; GATA3, CD5, and MYB; or PRDM1, GATA3, and CISH. In some of any embodiments, the two or more repression genes comprise CBLB and MYB. In some of any embodiments, the two or more repression genes comprise CBLB and MED12. In some of any embodiments, the two or more repression genes comprise CBLB and CCNC. In some eof any embodiments, the two or more repression genes comprise MED12 and TGFBR2.

[0076] In some of any embodiments, the at least one repressor DNA-targeting modules targets three or more repression genes. In some embodiments, the three or more repression genes comprise MED12, TGFBR2 and CISH.

[0077] In some of any embodiments, the target site for at least one, optionally each of the one or more repression genes is in a gene or a regulatory DNA element. In some of any embodiments, the target site for at least one, optionally each of the one or more repression genes is in a gene, an enhancer, or a promoter. In some of any embodiments, the target site for at least one, optionally each of the one or more repression genes is in an enhancer or a promoter.

[0078] In some of any embodiments, the target site for at least one, optionally each of the one or more repression genes is within 1000 base pairs of a transcriptional start site of one of the one or more repression genes. In some of any embodiments, the target site for at least one, optionally each of the one or more repression genes is within 500 base pairs of a transcriptional start site of one of the one or more repression genes.

[0079] In some of any embodiments, the target site for at least one of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any sf-605940722474-20028.40 one of SEQ ID NOS:1-3, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4-6, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10-12, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13-15, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19-21, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22-24, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25-27, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31-33, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102-112, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200-205 and 292-295, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206-211, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth sf-605940722474-20028.40 in any one of SEQ ID NOS:300-302 and 306-308, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

[0080] In some of any embodiments, the target site for at least one of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3 or a complementary sequence thereof; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4-6 or a complementary sequence thereof; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10- 12 or a complementary sequence thereof; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13-15 or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18 or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19-21 or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22-24 or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25-27 or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30 or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31-33 or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102-112 or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200-205 and 292-295 or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206-211 or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302 and 306-308 or a complementary sequence of any of the foregoing.

[0081] In some of any embodiments, the target site for each of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4-6, a contiguous portion thereof of at least 14 nucleotides (nt), or a sf-605940722474-20028.40 complementary sequence of any of the foregoing; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10-12, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13-15, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19-21, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22-24, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25-27, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31-33, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102-112, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200-205 and 292-295, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206-211, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302 and 306-308, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

[0082] In some of any embodiments, the target site for each of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ sf-605940722474-20028.40 ID NOS:1-3 or a complementary sequence thereof; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4-6 or a complementary sequence thereof; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10-12 or a complementary sequence thereof; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13-15 or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18 or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19-21 or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22-24 or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25-27 or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30 or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31-33 or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102-112 or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200-205 and 292-295 or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206-211 or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302 and 306-308 or a complementary sequence of any of the foregoing.

[0083] In some of any embodiments, the target site for at least one of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for at least one of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 or a complementary sequence of any of the foregoing. In some of any embodiments, the target site for each of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In sf-605940722474-20028.40 some of any embodiments, the target site for each of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 or a complementary sequence of any of the foregoing.

[0084] In some of any embodiments, the target site of one of the one or more repression genes is any one of the sequences set forth in any one of SEQ ID NO:454-457, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. In some of any embodiments, the target site of one of the one or more repression genes is any one of the sequences set forth in any one of SEQ ID NO:454-457 or a complementary sequence of any of the foregoing.

[0085] In some of any embodiments, the second DNA-binding domain is a ZFP or that targets the target site of one or more repression genes set forth in SEQ ID NO: 454. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DRSHLTR (SEQ ID NO: 490), F2: DRSYRNT (SEQ ID NO: 491), F3: QRRSLPH (SEQ ID NO: 492), F4: RSADLSR (SEQ ID NO: 493), F5: RSDTLSE (SEQ ID NO: 494), and F6: NRRGRWS (SEQ ID NO: 495). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 461, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 461. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 468 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 468.

[0086] In some of any embodiments, the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in SEQ ID NO: 455. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSANLAR (SEQ ID NO: 496), F2: DRSALAR (SEQ ID NO: 497), F3: RSDALST (SEQ ID NO: 498), F4: QSATRTK (SEQ ID NO: 499), F5: RSDTLSE (SEQ ID NO: 500), and F6: FRYARQY (SEQ ID NO: 501). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 462, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some sf-605940722474-20028.40 of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 462. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 469 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 469.

[0087] In some of any embodiments, the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in in SEQ ID NO: 456. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DQSNLRA (SEQ ID NO: 502), F2: QNAHRKT (SEQ ID NO: 503), F3: TSGSLSR (SEQ ID NO: 504), F4: DRSNLSS (SEQ ID NO: 505), F5: RSAHLSR (SEQ ID NO: 506), and F6: RSDHLTQ (SEQ ID NO: 507). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 463, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 463. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 470 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 470.

[0088] In some of any embodiments, the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in SEQ ID NO: 457. In some of any embodiments, the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSDHLSA (SEQ ID NO: 508), F2: QSSDLRR (SEQ ID NO: 509), F3: HHNNRTH (SEQ ID NO: 510), F4: RNASRTR (SEQ ID NO: 511), F5: RSDHLSA (SEQ ID NO: 512), and F6: RSANLTR (SEQ ID NO: 513). In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 464, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP comprises the sequence set forth in SEQ ID NO: 464. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 471 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, sf-605940722474-20028.40 97%, 98%, or 99% sequence identity thereto. In some of any embodiments, the ZFP is encoded by the sequence set forth in SEQ ID NO: 471.

[0089] In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence that is complementary to a target site of one of the one or more repression genes. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence between 14 nt and 24 nt or between 16 nt and 22 nt in length. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length.

[0090] In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more repression genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:69. In some of any embodiments, at least one, optionally each gRNA for targeting a target site of one of the one or more repression genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:387.

[0091] In some of any embodiments, at least one of the gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:35-37, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:38-40, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:44-46, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:47-49, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:50-52, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:53-55, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:56-58, or a contiguous portion thereof of at least 14 nt; (h) a gRNA sf-605940722474-20028.40 targeting a target site for GATA3 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:59-61, or a contiguous portion thereof of at least 14 nt; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:62-64, or a contiguous portion thereof of at least 14 nt; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:65-67, or a contiguous portion thereof of at least 14 nt; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:113-123, or a contiguous portion thereof of at least 14 nt; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:212-217 and 296-299, or a contiguous portion thereof of at least 14 nt; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:218-223, or a contiguous portion thereof of at least 14 nt; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:303-305 and 309-311, or a contiguous portion thereof of at least 14 nt.

[0092] In some of any embodiments, at least one of the gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:35-37; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:38-40; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:44-46; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:47-49; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:50-52; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:53-55; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:56-58; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:59-61; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence set forth in any one of sf-605940722474-20028.40 SEQ ID NOS:62-64; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:65-67; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91- 101; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:113-123; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:212-217 and 296-299; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:218-223; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:303-305 and 309-311.

[0093] In some of any embodiments, each gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:35-37, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:38-40, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:44-46, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:47-49, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:50-52, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:53-55, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:56-58, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:59-61, or a contiguous portion thereof of at least 14 nt; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:62-64, or a contiguous portion thereof of at least 14 nt; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:65-67, or a sf-605940722474-20028.40 contiguous portion thereof of at least 14 nt; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:113-123, or a contiguous portion thereof of at least 14 nt; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:212-217 and 296-299, or a contiguous portion thereof of at least 14 nt; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:218-223, or a contiguous portion thereof of at least 14 nt; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:303-305 and 309-311, or a contiguous portion thereof of at least 14 nt.

[0094] In some of any embodiments, each gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:35-37; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:38-40; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:44-46; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:47-49; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:50-52; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:53-55; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:56-58; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:59-61; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:62-64; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:65-67; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:113-123; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:212-217 and 296-299; (n) a gRNA targeting a sf-605940722474-20028.40 target site for Fli1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:218-223; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:303-305 and 309-311.

[0095] In some of any embodiments, at least one of the gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, at least one of the gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101. In some of any embodiments, each gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, each gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101.

[0096] In some of any embodiments, at least one, optionally each transcriptional repressor domain epigenetically modifies a target site of one of the one or more repression genes to promote reduced transcription of one of the one or more repression genes.

[0097] In some of any embodiments, at least one, optionally each transcriptional repressor domain is a KRAB domain, a DNMT3A domain, a DNMT3L domain, a DNMT3B domain, a DNMT3A-DNMT3L fusion protein domain, an ERF repressor domain, an Mxi1 repressor domain, a SID4X repressor domain, a Mad-SID repressor domain, an LSD1 repressor domain, an EZH2 repressor domain, a SunTag domain, a variant or portion of any of the foregoing, or a combination of any of the foregoing. In some of any embodiments, at least one, optionally each transcriptional repressor domain is a KRAB domain, a DNMT3A domain, a DNMT3L domain, or a combination of any of the foregoing.

[0098] In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises a KRAB domain or a variant or portion thereof that exhibits transcriptional repressor activity. In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:70, 235, and 355- sf-605940722474-20028.40 358, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0099] In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises a DNMT3A domain or a variant or portion thereof that exhibits transcriptional repressor activity. In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises the sequence set forth in SEQ ID NO:131 or 238, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0100] In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises a DNMT3L domain or a variant or portion thereof that exhibits transcriptional repressor activity. In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:133 and 240-242, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0101] In some of any embodiments, at least one, optionally each transcriptional repressor domain is a DNMT3A-DNMT3L fusion protein domain, a DNMT3B-DNMT3L fusion protein domain, or a variant thereof that exhibits transcriptional repressor activity. In some of any embodiments, at least one, optionally each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:135, 137, or 363, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0102] In some of any embodiments, at least one, optionally each fusion protein of the at least one repressor DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOS:138-141, 332-351, and 365-384, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0103] In some of any embodiments, at least one, optionally each fusion protein of the at least one repressor DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOS:517-520, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0104] In some of any embodiments, delivery of the epigenetic-modifying DNA-targeting system to the T cell increases transcription of the one or more activation genes and decreases sf-605940722474-20028.40 transcription of the one or more repression genes, compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system.

[0105] In some of any embodiments, delivery of the epigenetic-modifying DNA-targeting system to the T cell promotes increased T cell effector function upon T cell stimulation, compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system.

[0106] In some of any embodiments, the delivery is transient delivery of the epigenetic- modifying DNA-targeting system to the T cell. In some of any embodiments, transient delivery of the epigenetic-modifying DNA-targeting system to the T cell increases transcription of the one or more activation genes and decreases transcription of the one or more repression genes, compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system. In some of any embodiments, transient delivery of the epigenetic-modifying DNA- targeting system to the T cell promotes increased T cell effector function upon T cell stimulation, compared to a T cell that has not been delivered the epigenetic-modifying DNA- targeting system.

[0107] In some of any embodiments, the T cell effector function is selected from the group consisting of IL-2 production, IFN-gamma production, TNF-alpha production, T cell proliferation, and a combination of any of the foregoing. In some of any embodiments, the T cell effector function is IL-2 production. In some of any embodiments, the T cell effector function is IFN-gamma production. In some of any embodiments, the T cell effector function is IL-2 production and IFN-gamma production. In some of any embodiments, the T cell effector function is polyfunctional production of IL-2, IFN-gamma, and TNF-alpha.

[0108] In some of any embodiments, the T cell effector function further comprises T cell proliferation. In some of any embodiments, the T cell effector function further comprises killing of target cells. In some of any embodiments, the T cell effector function further comprises T cell persistence.

[0109] In some of any embodiments, the increased T cell effector function occurs 48 hours or more after the delivery of the epigenetic-modifying DNA-targeting system to the T cell. In some of any embodiments, the increased T cell effector function occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, or up to 71 days after the delivery of the epigenetic- modifying DNA-targeting system to the T cell. In some of any embodiments, the increased T sf-605940722474-20028.40 cell effector function occurs for up to 6 days, for up to 9 days, for up to 12 days, for up to 15 days, for up to 21 days, for up to 28 days, for up to 35 days, for up to 42 days, for up to 49 days, for up to 56 days, for up to 63 days, or for up to 71 days after the delivery of the epigenetic- modifying DNA-targeting system to the T cell.

[0110] In some of any embodiments, the T cell stimulation is with an anti-CD3 and anti- CD28 activation reagent.

[0111] In some of any embodiments, the T cell expresses a recombinant receptor. In some of any embodiments, the recombinant receptor is a chimeric antigen receptor (CAR) or a T cell receptor (eTCR). In some of any embodiments, the recombinant receptor is a CAR. In some of any embodiments, the recombinant receptor is directed against an antigen, and the T cell stimulation is an antigen-specific stimulation of the recombinant receptor. In some of any embodiments, the T cell stimulation is with antigen-expressing target cells.

[0112] In some of any embodiments, the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells.

[0113] Also provided herein in some embodiments is a polynucleotide encoding any of the provided epigenetic-modifying DNA-targeting systems.

[0114] Also provided herein in some embodiments is two or more polynucleotides together encoding any of the provided epigenetic-modifying DNA-targeting systems.

[0115] Also provided herein in some embodiments is a polynucleotide comprising (a) a promoter sequence, (b) a first nucleic acid encoding: at least one activator DNA-targeting module comprising a fusion protein comprising (i) a first zinc finger protein (ZFP) for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain; and (c) a second nucleic acid encoding at least one repressor DNA-targeting module comprising a fusion protein comprising (i) a second zinc finger protein (ZFP) for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain; and (d) a cleavable linker sequence that is located between the first nucleic acid sequence and the second nucleic acid sequence, wherein the promoter is operably linked to the first nucleic and and second nucleic acid to control their expression. In some embodiments, the cleavable linker sequence encodes a self-cleaving peptide. In some of any embodiments, the first ZFP targets the target site of one or more activation genes set forth in any one of SEQ ID NOs: 451-453; and the second ZFP targets the target site set forth in any one of SEQ ID NOs: 454-457. In some of any embodiments, the first ZFP comprises the sequence sf-605940722474-20028.40 set forth in any one of SEQ ID NOs: 458-460; and the second ZFP comprises the sequence set forth in any one of SEQ ID NOs: 461-464. In some of any embodiments, the at least one transcriptional activator domain comprises a sequence set forth in SEQ ID NO: 549; and the at least one transcriptional repressor domain comprises sequences set forth in SEQ ID NO: 70 and SEQ ID NO: 135. In some of any embodiments, the at least one activator DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOs: 514-516; and the at least one repressor DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOs: 517-520. In some of any embodiments, the at least one activator DNA-targeting module comprises SEQ ID NO: 516; and the at least one repressor DNA-targeting module comprises SEQ ID NO: 517. In some of any embodiments, the polynucleotide, from N-terminus to C- terminus, comprises: (a) the promoter sequence; (b) the first nucleic acid sequence encoding the at least one activator DNA-targeting module, (c) the cleavable linker sequence, and (d) the second nucleic acid encoding the at least one repressor DNA-targeting module. In some of any embodiments, the polynucleotide, from N-terminus to C-termionus, comprises: (a) the promoter sequence; (b) the second nucleic acid sequence encoding the at least one repressor DNA- targeting module, (c) the cleavable linker sequence, and (d) the first nucleic acid encoding the at least one activator DNA-targeting module. In some embodiments, the self-cleaving peptide is a 2A sequence, such as a P2A or T2A sequence. In some of any embodiments, the self-cleaving peptide comprises the sequence set forth in SEQ ID NO: 352. In some embodiments, the promoter sequence is a constitutive promoter, such as a CMV promoter, a EF-1α promoter, or a SV40 promoter.

[0116] Also provided herein in some embodiments is a vector comprising any of the provided polynucleotides. Also provided herein in some embodiments is a vector comprising any of the provided two or more polynucleotides.

[0117] In some of any embodiments, the vector is a viral vector. In some of any embodiments, the vector is an adeno-associated virus (AAV) vector. In some of any embodiments, the vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector.

[0118] In some of any embodiments, the vector is a non-viral vector. In some of any embodiments, the vector is a lipid nanoparticle, a liposome, an exosome, or a cell penetrating peptide. In some of any embodiments, the vector is a lipid nanoparticle. sf-605940722474-20028.40

[0119] In some of any embodiments, the vector exhibits immune cell tropism. In some of any embodiments, the vector exhibits T cell tropism.

[0120] Also provided herein in some embodiments is two or more vectors together comprising any of the provided two or more polynucleotides.

[0121] In some of any embodiments, at least one, optionally each of the two or more vectors are viral vectors. In some of any embodiments, at least one, optionally each of the two or more vectors are AAV vectors. In some of any embodiments, at least one, optionally each vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector.

[0122] In some of any embodiments, at least one, optionally each of the two or more vectors are non-viral vectors. In some of any embodiments, at least one, optionally each vector is a lipid nanoparticle, a liposome, an exosome, or a cell penetrating peptide. In some of any embodiments, at least one, optionally each of the two or more vectors are lipid nanoparticles.

[0123] In some of any embodiments, the two or more vectors exhibit immune cell tropism. In some of any embodiments, the two or more vectors exhibit T cell tropism.

[0124] Also provided herein in some embodiments is a modified T cell comprising any of the provided DNA-targeting systems, any of the provided polynucleotides, or any of the provided two or more polynucleotidess.

[0125] Also provided herein in some embodiments is a modified T cell comprising an epigenetic or phenotypic modification resulting from being contacted by any of the provided DNA-targeting systems, any of the provided polynucleotides, any of the provided two or more polynucleotides, any of the provided vectors, or any of the provided two or more vectors.

[0126] In some of any embodiments, the modified T cell is derived from a cell from a subject. In some of any embodiments, the modified T cell is derived from a primary T cell. In some of any embodiments, the modified T cell is derived from a T cell progenitor, a pluripotent stem cell, or an induced pluripotent stem cell.

[0127] In some of any embodiments, the modified T cell is a tumor infiltrating lymphocyte (TIL) or is an engineered T cell that further comprises an eTCR or CAR.

[0128] Also provided herein in some embodiments is a method of modulating transcription in a T cell, the method comprising introducing into a T cell any of the provided DNA-targeting systems, any of the provided polynucleotides, any of the provided two or more polynucleotides, any of the provided vectors, or any of the provided two or more vectors. sf-605940722474-20028.40

[0129] Also provided herein in some embodiments is a method of increasing T cell effector function, the method comprising introducing into a T cell any of the provided DNA-targeting systems, any of the provided polynucleotides, any of the provided two or more polynucleotides, any of the provided vectors, or any of the provided two or more vectors.

[0130] In some of any embodiments, T cell effector function of the T cell is increased upon T cell stimulation compared to a T cell that has not been introduced to the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors.

[0131] In some of any embodiments, the method further comprises stimulating the T cell.

[0132] In some of any embodiments, the T cell effector function is selected from the group consisting of IL-2 production, IFN-gamma production, TNF-alpha production, T cell proliferation, and a combination of any of the foregoing. In some of any embodiments, the T cell effector function is IL-2 production. In some of any embodiments, the T cell effector function is IFN-gamma production. In some of any embodiments, the T cell effector function is IL-2 production and IFN-gamma production. In some of any embodiments, the T cell effector function is polyfunctional production of IL-2, IFN-gamma, and TNF-alpha.

[0133] In some of any embodiments, the T cell effector function further comprises T cell proliferation. In some of any embodiments, the T cell effector function further comprises killing of target cells. In some of any embodiments, the T cell effector function further comprises T cell persistence.

[0134] In some of any embodiments, the increased T cell effector function occurs 48 hours or more after the introducing to the T cell. In some of any embodiments, the increased T cell effector function occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, or up to 71 days after the introducing. In some of any embodiments, the increased T cell effector function occurs for up to 6 days, for up to 9 days, for up to 12 days, for up to 15 days, for up to 21 days, for up to 28 days, for up to 35 days, for up to 42 days, for up to 49 days, for up to 56 days, for up to 63 days, or for up to 71 days after the delivery of the epigenetic-modifying DNA- targeting system to the T cell.

[0135] In some of any embodiments, the T cell stimulation is with an anti-CD3 and anti- CD28 activation reagent. sf-605940722474-20028.40

[0136] In some of any embodiments, the T cell is a tumor infiltrating lymphocyte (TIL) therapy.

[0137] In some of any embodiments, the T cell expresses a recombinant receptor. In some of any embodiments, the recombinant receptor is a CAR or a eTCR. In some of any embodiments, the recombinant receptor is directed against an antigen, and the T cell stimulation is an antigen- specific stimulation of the recombinant receptor. In some of any embodiments, the T cell stimulation is with antigen-expressing target cells.

[0138] In some of any embodiments, the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells.

[0139] In some of any embodiments, the T cell is a T cell in a subject, and the method is carried out in vivo.

[0140] In some of any embodiments, the T cell is a T cell from a subject or derived from a cell from the subject, and the method is carried out ex vivo.

[0141] In some of any embodiments, the T cell is a primary T cell. In some of any embodiments, the T cell is derived from a T cell progenitor, a pluripotent stem cell, or an induced pluripotent stem cell.

[0142] In some of any embodiments, the introducing is by transient delivery into the T cell.

[0143] In some of any embodiments, the introducing comprises electroporation, transfection, or transduction.

[0144] In some of any embodiments, the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors are transiently present in the T cell.

[0145] In some of any embodiments, the introducing increases transcription of the one or more activation genes in the T cell. In some of any embodiments, the introducing represses transcription of the one or more repression genes in the T cell.

[0146] Also provided herein in some embodiments is a modified T cell produced by any of the provided methods.

[0147] Also provided herein in some embodiments is a method of treating a disease or condition in a subject, the method comprising administering to the subject any of the provided modified T cells.

[0148] Also provided herein in some embodiments is a method of increasing T cell persistence in T cells of a subject, the method comprising administering to the subject any of the sf-605940722474-20028.40 provided DNA-targeting systems, any of the provided polynucleotides, any of the provided two or more polynucleotides, any of the provided vectors, or any of the provided two or more vectors.

[0149] In some of any embodiments, the T cells are from an adoptive T cell therapy for treating a disease or condition in the subject. In some of any embodiments, the adoptive T cell therapy comprises T cells expressing a recombinant receptor directed against an antigen associated with the disease or condition.

[0150] In some of any embodiments, the administration is carried out prior to, concurrently with, or after administration of the adoptive T cell therapy. In some of any embodiments, the administration is carried out after administration of the adoptive T cell therapy to the subject and at a time after the numbers or effector function of T cells of the adoptive T cell therapy are reduced, or are suspected of being reduced, in the subject.

[0151] Also provided herein in some embodiments is a method of treating a disease or condition in a subject, the method comprising administering to a subject: an adoptive T cell therapy for treating the disease or condition; and any of the provided DNA-targeting systems, any of the provided polynucleotides, any of the provided two or more polynucleotides, any of the provided vectors, or any of the provided two or more vectors.

[0152] In some of any embodiments, the adoptive T cell therapy is a tumor infiltrating lymphocyte (TIL) therapy. In some of any embodiments, the adoptive T cell therapy comprises T cells expressing a recombinant receptor directed against an antigen associated with the disease or condition. In some of any embodiments, the recombinant receptor is an eTCR or CAR.

[0153] In some of any embodiments, the antigen is a tumor antigen.

[0154] In some of any embodiments, the disease or condition is a cancer. In some of any embodiments, the cancer is a hematological cancer or is a solid tumor.

[0155] In some of any embodiments, the disease or condition is an autoimmune condition and / or an inflammatory condition.

[0156] In some of any embodiments, the administering of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors results in transient delivery to the T cells of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors. sf-605940722474-20028.40

[0157] In some of any embodiments, the administering of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors increases transcription of the one or more activation genes in the T cells.

[0158] In some of any embodiments, the administering of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors represses transcription of the one or more repression genes in the T cells. Brief Description of the Drawings

[0159] FIG.1A shows an exemplary workflow for a transient CRISPR screen. Cells are transfected with a gRNA library. Following enrichment of transfected cells, an epi-editor, such as a dCas fused to an effector domain (e.g., transcriptional repressor, transcriptional activator, etc.), is transiently transfected into the cells, such as by electroporation. Cells are then screened for the desired phenotype. FIG.1B shows an exemplary plot showing expression of IL-2 and IFNg in cells as assessed by flow cytometry, with boxes indicating populations to be sorted according to different phenotypes.

[0160] FIG.2 shows a plot of an exemplary CRISPRi screen for gRNAs and genes that modulate IL-2 expression, IFNg expression, and / or proliferation. In particular, the plot shows gRNAs affecting IL-2 expression. Dots (designated by an “x”) represent individual gRNAs. gRNAs on the left are those that target genes whose inhibition results in decreased IL-2 expression, while gRNAs on the right are those that target genes whose inhibition result in upregulation of IL-2 expression. X-axis represents log2 fold change of gRNA abundance in IL- 2+ sorted cells versus unsorted cells. Y-axis represents significance (-log10 adjusted p-value).

[0161] FIG.3 shows a plot from an exemplary CRISPRi screen for gRNAs and genes that modulate IL-2 expression, IFNg expression, and / or proliferation. In particular, the plot shows gRNAs affecting proliferation. Dots (designated by an “x”) represent individual gRNAs. gRNAs on the left are those that target genes whose inhibition results in decreased proliferation, while gRNAs on the right are those that target genes whose inhibition result in increased proliferation. X-axis represents log2 fold change of gRNA abundance in unsorted cells 6 days after electroporation versus unsorted cells before electroporation with a transiently expressed epi- editor for targeted transcriptional repression. Y-axis represents significance (-log10 adjusted p- value). sf-605940722474-20028.40

[0162] FIG.4 shows numbers of gRNA hits from indicated conditions at day 9, day 12, or both day 9 and day 12 of a CRISPRi screen for gRNAs and genes modulating T cell phenotypes.

[0163] FIG.5 shows a plot from an exemplary CRISPRa screen for gRNAs and genes that modulate IL-2 expression, IFNg expression, and / or proliferation. In particular, the plot shows gRNAs affecting IL-2 expression. Dots (designated by an “x”) represent individual gRNAs. gRNAs on the left are those that target genes whose activation results in decreased IL-2 expression, while gRNAs on the right are those that target genes whose activation results in increased IL-2 expression. X-axis represents log2 fold change of gRNA abundance in IL-2+ sorted cells versus unsorted cells. Y-axis represents significance (-log10 adjusted p-value).

[0164] FIG.6A shows percent knockdown (% KD) of MED12 expression, as assessed by RT-qPCR following transient delivery of dSpCas9-KRAB and indicated MED12-targeting gRNAs or non-targeting gRNAs (NT1, NT2), or dSpCas9-KRAB alone. Results are shown for 48 hours (left) and 6 days (right) after transfection, and for T cells from two different donors.

[0165] FIG.6B shows MED12 expression, as assessed by RT-qPCR following transient delivery of dSpCas9-KRAB and indicated MED12-targeting gRNAs in T cells (left) and CAR T cells (right). Control conditions for left panel include cells delivered with dSpCas9-KRAB and non-targeting gRNAs (NT1, NT2), and dSpCas9-KRAB alone. Control conditions for right panel include cells not expressing a CAR (Mock), and cells not delivered with a DNA-targeting system. Results are shown for 48 hours (left) and 72 hours and 7 days after transfection. Results are normalized to dSpCas9-KRAB only condition (left panel) or Mock condition (right panel).

[0166] FIG.6C shows percent knockdown (% KD) of CCNC expression, as assessed by RT-qPCR following transient delivery of dSpCas9-KRAB and indicated CCNC-targeting gRNAs or non-targeting gRNAs (NT1, NT2), or dSpCas9-KRAB alone. Results are shown for 48 hours (left) and 6 days (right) after transfection, and for T cells from two different donors.

[0167] FIG.6D shows percent knockdown (% KD) of FAS expression, as assessed by intracellular cytokine staining (ICS) and flow cytometry following transient delivery of dSpCas9-KRAB and indicated FAS-targeting gRNAs, dSpCas9-KRAB alone, or mock delivery. Results are shown for 72 hours (bottom panel, left) and 7 days (bottom panel, right) after delivery, and for T cells from two different donors. Top panel shows an exemplary flow cytometry plot for assessing FAS expression in CD3+ T cells following delivery with dSpCas9- KRAB only, or dSpCas9-KRAB and a FAS-targeting gRNA. sf-605940722474-20028.40

[0168] FIG.7A shows flow cytometry plots for assessing IL-2 expression in CD3+ Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and an IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78). Results are shown for CAR T cells derived from 2 different donors. CAR T cells were stimulated with SKOV3 or 143B cells. Different control conditions excluded the CAR, the gRNA, or stimulation, as indicated.

[0169] FIG.7B shows quantified IL-2 expression (% IL-2+ cells as assessed by flow cytometry) in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and an IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78). Control conditions excluded the CAR (mock transduction), the gRNA, or stimulation, as indicated.

[0170] FIG.7C shows IL-2 expression in CAR T cells following delivery of a DNA- targeting system for IL-2 activation. Left panel shows IL-2 expression in Her2 CAR T cells as assessed RT-qPCR at 72 hours and 7 days following transient delivery with a DNA-targeting system containing dSpCas9-2xVP64 and an IL-2 targeting gRNA (IL-2_1, targeting SEQ ID NO:78). Control conditions included cells not expressing the CAR (mock), or CAR T cells not delivered with a DNA-targeting system (CAR Only). Expression levels were normalized to the mock control cells. Right panel shows IL-2 expression in control cells (CAR only) and CAR T cells delivered with the DNA-targeting system for IL-2 activation following stimulation with Her2 antigen-expressing tumor cells, as assessed by ICS and flow cytometry.

[0171] FIGS. 8A-8C show flow cytometry plots for assessing IL-2 (FIG.8A), IFNg (FIG. 8B), or TNFa (FIG.8C) expression in CD3+ Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and a VAV1-targeting gRNA (VAV1_5, targeting SEQ ID NO:170). Results are shown for CAR T cells derived from 2 different donors. CAR T cells were stimulated with SKOV3 or 143B cells. Different control conditions excluded the CAR, the gRNA, or stimulation, as indicated.

[0172] FIG.9 shows percentage polyfunctional cells (IL-2+ / IFNg+ / TNFa+ cells) as assessed by flow cytometry in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and an IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78) or a VAV1- targeting gRNA (VAV1_5, targeting SEQ ID NO:170). Control conditions excluded the CAR (mock transduction), the gRNA, or stimulation, as indicated.

[0173] FIG.10 shows flow cytometry plots for assessing IL-2 and IFNg expression in CD4+ (top) or CD8+ (bottom) Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and indicated CBLB-targeting gRNAs or a control non-targeting gRNA. Flow sf-605940722474-20028.40 cytometry plots allow for quantification of percentage of cells with specific phenotypes (e.g. IL- 2+), and for quantification of mean fluorescence intensity (MFI; corresponding to average expression levels), as shown in right panels.

[0174] FIG.11A shows a heatmap indicating relative levels of intracellular cytokine expression (as assessed by ICS and flow cytometry) in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and indicated gRNAs. Cytokine expression was quantified according to % Her2 CAR T cells with the indicated phenotypes (e.g. CD4+ / IL-2+, CD4+ / IFNg+ / TNFa+) as assessed by flow cytometry, and log 2 fold change was calculated with respect to the control condition with a non-targeting gRNA (non-targeting_sp_1). Darker shades correspond to higher cytokine expression, as indicated in the legend. Each condition was assigned a cumulative score according to all cytokine expression measurements and ranked from low to high cytokine expression.

[0175] FIG.11B shows exemplary results from a serial stimulation killing assay. Growth of antigen-expressing target cells expressing a fluorescent marker was quantified over time based on overall fluorescence using an Incucyte automated tracking system. Antigen-expressing target cells were co-cultured with CAR T cells transiently delivered with a DNA-targeting system for activation of IL-2, CAR T cells transiently delivered with a DNA-targeting system for repression of MED12, CAR T cells with no DNA-targeting system (CAR alone), or cells not expressing a CAR (Mock). Serial stimulations (shown as stim 1, stim 2, and stim 3) were performed by replating CAR T cells with fresh target cells at a 1:4 ratio of CAR T cells:target cells.

[0176] FIG.11C shows quantification of fold expansion (left) and IL-2 secretion (right) by CAR T cells and control cells from experiment shown in FIG.11B, following the second stimulation.

[0177] FIG.12A depicts flow cytometry plots of intracellular cytokine staining (ICS) for IL-2 and IFN-g expression after transient transfection of T cells with control dSpCas9-2xVP64 effector only (without targeting gRNA) or with dSpCas9-2xVP64 in combination with a gRNA targeting either VAV1 (VAV1_5) or IL-2 (IL-2_1) individually.

[0178] FIG.12B depicts an ICS flow cytometry plot for IL-2 and IFN-g after transient transfection of T cells with dSpCas9-2xVP64 effector and gRNAs targeting both VAV1 and IL-22474-20028.40

[0179] FIG.12C depicts the percent of IL-2+ cells (left panel) or IL-2+, IFNg+ and TNFalpha+ cells (right panel) after transient transfection of T cells from either of two donors with dSpCas9-2xVP64 effector only (without targeting gRNA), dSpCas9-2xVP64 in combination with VAV1 or IL-2, or dSpCas9-2xVP64 in combination with gRNAs targeting both VAV1 and IL-2.

[0180] FIGS. 13A-13B show heatmaps indicating relative levels of intracellular cytokine expression, cytokine secretion, proliferation, and target cell killing activity in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the indicated gRNAs, for Her2 CAR T cells derived from a first donor (FIG.13A) and a second donor (FIG.13B). Multiple rounds of stimulation were performed, and cells electroporated with the different DNA-targeting systems were assessed based on multiple readouts of T cell effector function after the stimulations, including intracellular cytokine expression (by ICS), cytokine secretion, proliferation, and killing of target cells, as described in Example 5. The readouts of T cell effector function were quantified after a first, second, and / or third stimulation (shown as stim 1, stim 2, or stim 3 in figures). ICS was performed after a first stimulation only. Results are shown as Log 2 fold-change in comparison to control cells delivered with a non-targeting gRNA (NT). Darker shades correspond to increased measured T cell effector functions, as indicated in the legend. Each condition was assigned a cumulative score according to all measurements and ranked from low to high T cell effector function.

[0181] FIG.14 shows a heatmap indicating relative levels of intracellular cytokine expression in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and a combination of 2 gRNAs targeting the indicated genes. gRNAs for targeting each gene are shown next to the heatmap. Where the genes targeted are the same, the same gRNA was delivered at twice the concentration. Cytokine expression was quantified according to % Her2 CAR T cells with the indicated phenotypes (e.g. CD8+ / IL-2+ / IFNg+ / TNFa+) as assessed by ICS and flow cytometry, and log 2 fold change was calculated with respect to the control condition with a non-targeting gRNAs (NT+NT). Darker shades correspond to higher cytokine expression, as indicated in the legend. Each condition was assigned a cumulative score according to all cytokine expression measurements and ranked from low to high cytokine expression.

[0182] FIGS. 15A-15B show heatmaps indicating relative levels of proliferation and cytokine expression in Her2 CAR T cells after stimulation and transient delivery of dSpCas9- 2xVP64 or dSpCas9-KRAB and gRNAs or combinations thereof targeting the indicated genes. sf-605940722474-20028.40 gRNAs for targeting each gene are indicated in the accompanying tables. Cytokine expression was quantified according to % Her2 CAR T cells with the indicated phenotypes (e.g. CD4+ / IL- 2+ / IFNg+ / TNFa+) as assessed by ICS and flow cytometry. Proliferation was quantified according to fold change of Her2 CAR T cell numbers before and after 45timulateon, as described herein. For each cytokine or proliferation phenotype value, log 2 fold change was calculated with respect to a control condition with a non-targeting gRNA (non-targeting_sp_1 for FIG.15A; dCas only for FIG.15B). Darker shades correspond to increased proliferation and cytokine expression, as indicated in the legend. Each condition was assigned a cumulative score according to all cytokine and proliferation measurements and ranked from low to high cytokine expression and proliferation.

[0183] FIG.16 shows fold expansion (i.e. proliferation) of Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and indicated gRNAs. Results are shown for Her2 CAR T cells derived from two different donors, after a first stimulation with antigen-expressing target cells. Negative control conditions included CAR T cells delivered with a dCas-effector and no gRNA, CAR T cells not delivered with a DNA- targeting system (CAR only), and cells not expressing a CAR (mock).

[0184] FIG.17 shows levels of secreted cytokines IL-2 or IFNg in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and indicated gRNAs. Results are shown for Her2 CAR T cells derived from two different donors, after a first stimulation with antigen-expresing target cells. Negative control conditions included CAR T cells delivered with a dCas-effector and no gRNA, CAR T cells not delivered with a DNA- targeting system (CAR only), and cells not expressing a CAR (mock).

[0185] FIG.18 shows killing activity based on calculated killing index in Her2 CAR T cells after transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and indicated gRNAs, after a third stimulation with antigen-expressing target cells. Negative control conditions included CAR T cells delivered with a dCas-effector and no gRNA, CAR T cells not delivered with a DNA- targeting system (CAR only), and cells not expressing a CAR (mock).

[0186] FIGS. 19A-19B show heatmaps indicating relative levels of quantified T cell effector functions in Her2 CAR T cells after stimulation and transient delivery of dSpCas9- 2xVP64 or dSpCas9-KRAB and indicated gRNAs. Results are shown for cells derived from a first donor (FIG.19A) and second donor (FIG.19B). Assessed T cell effector functions included intracellular cytokine expression, secreted cytokine expression, proliferation, and sf-605940722474-20028.40 killing, which were measured as described in Example 5. The T cell effector functions were quantified after a first, second, and / or third stimulation with antigen-expressing target cells, as indicated in the figure. For each quantified T cell effector function, results are shown as log 2 fold change as calculated with respect to the negative control condition (CAR alone, i.e. CAR T cells not delivered with a DNA-targeting system). Darker shades correspond to increased measured T cell effector functions, as indicated in the legend. Each condition was assigned a cumulative score according to all measurements and ranked from low to high T cell effector function.

[0187] FIGS. 20A-20C show results from CAR T cells electroporated with gRNAs targeting indicated genes and mRNA encoding either dSpCas9-2xVP64 for activation or dSpCas9-KRAB for repression. For all results, experiments were performed using CAR T cells from two different donors, and results are plotted for each of the two donors (triangles), with average value indicated by vertical line. FIG.20A shows CAR T fold expansion following electroporation of the DNA-targeting systems (production), and following a first, second, and third round of stimulation with Her2 antigen-expressing target cells. FIG.20B shows CAR T cell target cell killing index following the first and second round of stimulation. FIG.20C shows CAR T cell cytokine production as assessed by ICS and flow cytometry at Day 9 post- electroporation with the DNA-targeting systems, and after a first stimulation with Her2 antigen- expressing target cells.

[0188] FIGS. 21A-21C show results from stimulated CAR T cells delivered with DNA- targeting systems for repression of TGF-beta receptor 2 (TGFBR2). DNA-targeting systems included indicated TGFBR2-targeting gRNAs, and either dSpCas9-KRAB (SEQ ID NO:332) or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO:337). Control cells included dSpCas9 only, cells not expressing a CAR (Mock), or CAR T cells not stimulated with antigen-expressing cells (CAR Alone). FIG.21A shows expression of TGFBR2 at 48 hours post-electroporation with the DNA-targeting systems. FIG.21B shows secreted IFNg from the CAR T cells 24 hours after a second stimulation with Her2 antigen-expressing cells, in the presence of 10ng / mL TGFb. FIG.21C shows fold expansion of the stimulated CAR T cells after the second stimulation with Her2 antigen-expressing cells in the presence of 10ng / mL TGFb.

[0189] FIGS. 21D-21G show results from stimulated CAR T cells delivered with DNA- targeting systems for repression of TGF-beta receptor 2 (TGFBR2). CAR T cells were electroporated for transient expression of DNA-targeting systems composed of dSpCas9-KRAB- sf-605940722474-20028.40 DNMT3A / L and indicated gRNAs targeting TGFBR2. Negative control cells were electroporated with dSpCas9-KRAB-DNMT3A / L and a non-targeting gRNA (non-targeting), not electroporated with a DNA-targeting system (CAR only), or did not express a CAR (mock). FIG.21D shows % TGFBR2 negative cells after indicated days post-electroporation. FIG.21E shows fold cell expansion of CAR T cells after stimulation with anti-CD3 / anti-CD28 coated wells and exposure to indicated concentrations of TGF-beta, with expansion normalized to conditions with 0 ng / mL TGF-beta. FIG.21F shows production of IFNg by CAR T cells in response to exposure to 10 ng / mL TGF-beta. Dotted horizontal line indicates CAR only control condition. FIG.21G shows levels of secreted cytokines in stimulated CAR T cells after exposure to indicated concentrations of TGF-beta, with secreted cytokine levels normalized to conditions with 0 ng / mL.

[0190] FIGS. 22A-22C show time course (FIG.22A) and results (FIG.22B) from an experiment for in vivo assessment of CAR T cells delivered with a DNA-targeting system for IL-2 activation (FIG.22B) or MED12 repression (FIG.22C). The in vivo experiments were carried out in immune-deficient mice transplanted implanted with antigen-expressing tumor cells (NCI-H1975) and injected with CAR T cells. FIG.22A shows timing and details of tumor implantation, CAR T cell injection, and tracking. FIG.22B and FIG.22C show results from experiments, including animal survival (left panels), tumor growth (middle panels), and levels of circulating CAR T cells (right panels) for CAR T cells delivered with the DNA-targeting system for IL-2 activation (dSpCas9-2xVP64 and gRNA IL-2_1, targeting SEQ ID NO:78) or the DNA-targeting system for MED12 repression (dSpCas9-KRAB and gRNA MED12_2, targeting SEQ ID NO:81), respectively. Control mice were injected with CAR T cells not delivered with a DNA-targeting system (CAR alone), were injected with T cells not expressing a CAR (Mock T Cells), or were not injected with T cells (Tumor Alone).

[0191] FIG.23 shows MED12 expression as assessed by RT-qPCR at day 4 and day 21 post-electroporation with a MED12-targeting gRNA (MED12_2, targeting SEQ ID NO:81) and mRNA encoding dSpCas9 (control; no transcriptional repressor effector domain), dSpCas9- KRAB (SEQ ID NO:332), or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO: 337). Expression levels (shown as fold-change in expression) are normalized to expression levels in T cells electroporated with the same fusion protein but with a non-targeting gRNA (dotted line at 1.0). sf-605940722474-20028.40

[0192] FIGS. 24A-24F show results from CAR T cells delivered with DNA-targeting systems comprising indicated MED12-targeting gRNAs and dSpCas9-KRAB (SEQ ID NO:332), or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO: 337). Control cells included cells delivered with DNMT3A / L-XTEN80-dSpCas9-KRAB and no gRNA, DNMT3A / L- XTEN80-dSpCas9-KRAB and a non-targeting gRNA, and T cells not expressing a CAR (Mock). FIG.24A shows MED12 expression as assessed by qRT-PCR at day 10 post- electroporation with the DNA-targeting systems. FIG.24B shows MED12 expression at days 2, 7, 10, and 14 post-electroporation. FIG.24C shows CD25 expression as assessed by flow cytometry in CAR T cells at days 3, 7, 10, and 14 post-electroporation. FIG.24D shows secreted IFN-gamma expression, and FIG.24E shows secreted IL-2 expression, at 24 hours after a second stimulation of the CAR T cells with Her2-positive NCI-H1975 tumor cells. FIG. 24F shows proliferation (fold expansion normalized to fold expansion of CAR alone controls) after the second stimulation with the antigen-expressing cells.

[0193] FIG.25 shows a timecourse of expression of an exemplary dSpCas9 protein following electroporation of mRNA encoding the protein. Results are shown for electroporation of the dSpCas9 protein with a non-targeting gRNA, a gRNA targeting a gene in the cell, or no electroporation (control). Expression was assessed based on an associated GFP tag, with results indicating percent GFP+ cells as assessed by flow cytometry at indicated time points.

[0194] FIGS. 26A-26B show arrangements of fusion proteins for targeted transcriptional repression (FIG.26A), and results from experiments testing ability of the fusion proteins to mediate targeted and sustained gene repression (FIG.26B). FIG.26A shows 4 different arrangements of the dSpCas9 fusion proteins from N-terminal to C-terminal, with the fusion proteins including various domains selected from a DNMT3A, DNMT3B, DNMT3L, and a KRAB or EZH2 domain (shown as [KRAB]). FIG.26B shows MED12 expression at 4 days and 21 days in T cells electroporated with a gRNA targeting MED12 (MED12_2, targeting SEQ ID NO:81), and mRNA encoding the fusion proteins having each of the 4 different arrangements, and comprising a repression domain (shown as [KRAB]) selected from: a KRAB domain from KOX1 (KOX1(2-99)) (SEQ ID NO:355; KRAB domain used in dSpCas9 fusion proteins of preceding Examples), a KRAB domain from KOX1 (KOX1(1-72)) (SEQ ID NO:356), a KRAB domain from ZIM3 (SEQ ID NO:357), a KRAB domain from ZNF324 (SEQ ID NO:358), and an EZH2 domain (SEQ ID NO:359). The mRNA encoding the fusion proteins further included an N-terminal FLAG epitope and a C-terminal P2A-mCherry domain to assess expression of the sf-605940722474-20028.40 fusion protein. For each experimental condition, MED 12 expression was normalized to expression levels in T cells electroporated with the same fusion protein but with a non-targeting gRNA.

[0195] FIG.27A shows IL-2 locus within human genome assembly GRCh38 (hg38) genomic coordinates chr4:122,451,261-122,593,946, with 7 annotated distinct regions. FIG. 27B shows a log 2 fold change (log2fc) to log2 fold change plot between two different donors. Large black dors, which have been boxed, represent verified hits. FIG.27C shows the distribution of target site hits across various regions within the IL-2 locus.

[0196] FIG.28A shows the percent IL-2 expression following a first stimulation of Her2 CAR T cells that were delivered mRNA encoding a dSpCas9-2xVP64 effector fusion protein and various SpCas9 IL-2-targeting gRNA. FIG. 28B shows percent IL-2 expression following a second stimulation of the same Her2 CAR T cells shown in FIG.28A. FIG.28C shows percent IL-2 expression following a third stimulation of the same Her2 CAR T cells shown in FIG.28A. The solid line demarcates the percent IL-2 expression when using the control guide RNA IL-2 gRNA-1. The dashed line demarcates the percent IL-2 expression of Her2 CAR T cells (“CAR”).

[0197] FIG.29A shows the change in percent IL-2 expression between the first stimulation and third stimulation for gRNA IL-2_H, gRNA IL-2 gRNA-1 and gRNA SpNT as well as other gRNAs. FIG.29B shows the fold IL-2+ CAR T cells over the non-targeting gRNA spNT between the first stimulation and third stimulation for gRNA IL-2_H, gRNA IL-2 gRNA-1 and other gRNAs. Data points representative of gRNA IL-2_H and gRNA IL-2 gRNA-1 are denoted. The open circle data points represent data from using the gRNA spNT.

[0198] FIG.30 shows the mean fluorescence intensity (MFI) of Her2 CAR T cells that transiently expressed dCas9 effector fusion proteins for activation of IL-2 targeted by guide RNA IL-2_H compared to other guides. Data points of gRNA IL-2_H and gRNA IL-2 gRNA-1 are denoted. The open circle data points represent data from using the gRNA spNT.

[0199] FIG.31A shows the fold increase in IL-2+ cells (which is the ratio of the absolute count of edited CAR+ IL-2+ cells to the absolute count of NT control, CAR+ IL-2+ cells at the third round of serial killing) against the IL-2 activation durability in an exemplary donor. FIG. 31B and 31C similarly show the fold increase in IL-2+ cells against the IL-2 activation durability in two additional exemplary donors. Select data points representing select combinations of gRNAs are highlighted for each exemplary donor. sf-605940722474-20028.40

[0200] FIG.32A shows percent IL-2 expression following a first stimulation of Her2 CAR T cells that were delivered mRNA encoding a dSpCas9-2xVP64 effector fusion protein and various SpCas9 IL-2-targeting gRNA or a dSaCas9-2xVP64 effector fusion protein and various SaCas9 IL-2-targeting gRNA. FIG.32B shows percent IL-2 expression following a second stimulation of the same Her2 CAR T cells shown in FIG.32A.

[0201] FIG.33A shows IL-2 expression following stimulation of Her2 CAR T cells that were delivered mRNA encoding a dSpCas9-KRAB-DNMT3A / L effector fusion protein, an SpCas9 MED12-targeting gRNA, and mRNA encoding a dSpCas9-2xVP64 effector fusion protein.

[0202] FIG.33B shows IL-2 expression following stimulation of Her2 CAR T cells that were delivered mRNA encoding a dSpCas9-KRAB-DNMT3A / L effector fusion protein, an SpCas9 IL-2-targeting gRNA, and mRNA encoding a dSpCas9-2xVP64 effector fusion protein.

[0203] FIG.34A and FIG.34B depict schemes for combined activation of a first gene, e.g., IL-2, and repression of a second gene, e.g., MED12, in order to increase T cell effector function. The genes can be targeted using CRISPR / Cas-based DNA-targeting systems in which a dCas protein from one species, e.g., dSaCas9, is used for targeting the first gene for activation, and a dCas protein from a different species, e.g., dSpCas9, is used for targeting the second gene for repression. Increased T cell effector function can include increased CD25 expression, such as via MED12 repression. Increased T cell effector function can also include improved T cell proliferation, such as via IL-2 signaling in the JAK / STAT pathway. Together, simultaneous activation of IL-2 and repression of MED12 can be used in some aspects to amplify homeostatic feedback and sustain enhanced T cell function.

[0204] FIG.34C shows IL-2 expression following stimulation of Her2 CAR T cells that were delivered mRNA encoding an dSpCas9-KRAB-DNMT3A / L effector fusion protein, an SpCas9 MED12-targeting gRNA, mRNA encoding an dSaCas9-2xVP64 effector fusion protein, and the SaCas9 IL-2-targeting gRNA IL-2_X.

[0205] FIG.34D shows IL-2 expression in terms of IL-2 frequency (left) and IL-2 median fluorescent intensity (MFI; right) following stimulation of Her2 CAR T cells that were delivered mRNA encoding an dSpCas9-KRAB-DNMT3A / L effector fusion protein, the SpCas9 MED12- targeting gRNA MED12_7, mRNA encoding an dSaCas9-2xVP64 effector fusion protein, and the SaCas9 IL-2-targeting gRNA IL-2_X. sf-605940722474-20028.40

[0206] FIG.34E shows IL-2 expression in terms of % IL-2 postiive cells (left) and IL-2 median fluorescent intensity (MFI; right) following a first stimulation of Her2 CAR T cells that were delivered various combinations of the following: mRNA encoding a dSpCas9-KRAB- DNMT3A / L effector fusion protein, the SpCas9 MED12-targeting gRNA MED12_3, mRNA encoding a dSaCas9-2xVP64 effector fusion protein, and one or both of the SaCas9 IL-2- targeting gRNA IL-2_U and the SaCas9 IL-2-targeting gRNA IL-2_X. FIG.34F shows IL-2+ cell counts following a second stimulation (re-challenge) of the Her2 CAR T cells.

[0207] FIG.35 depicts two exemplary dSaCas9 fusion proteins for transcriptional activation: dSaCas9 covalently linked to effector domains NCOA3-FOXO3-NCOA3 (NFN) and VP64 (dSaCas9-NFN-VP64) on the left and dSaCas9 covalently linked to 2 VP64 domains (dSaCas9-2xVP64) on the right.

[0208] FIG.36 shows the intracellular expression of IL-2 after first stimulation using an average of two donors as %IL-2 positive cells in the left panel and mean fluorescent levels (MFI; corresponding to average expression levels) in the right panel, in cells that were delivered mRNA encoding dSaCas9-2xVP64, dSaCas9-VP64-NFN, or dSpCas9-2xVP64 mRNA with corresponding IL-2 targeting gRNA(s). No delivery of exemplary fusion protein (CAR only) was used as a negative control.

[0209] FIG.37 shows fold IL-2+ Her2 CAR T cell expansion following two (left) or three (right) rounds of stimulation after delivery of various combinations of the following: mRNA encoding a dSpCas9-KRAB-DNMT3A / L effector fusion protein, the SpCas9 MED12-targeting gRNA MED12_3, SpCas9 CISH-targeting gRNA, the SpCas9 TGFBR2-targeting gRNA, mRNA encoding the dSaCas9-NFN-VP64 effector fusion protein, SaCas9 IL-2-targeting gRNAs, and / or non-targeting gRNA (SaNT). No delivery of fusion proteins (CAR only) was also used as a negative control.

[0210] FIG.38A and FIG.38B show proliferation of Her2 CAR T cells after a first (top) or second (bottom) stimulation in a first donor (FIG.38A) or second donor (FIG.38B) after delivery of various combinations of the following: mRNA encoding a dSpCas9-KRAB- DNMT3A / L effector fusion protein, SpCas9 MED12-targeting gRNA, SpCas9 CISH-targeting gRNA, SpCas9 TGFBR2-targeting gRNA, mRNA encoding the dSaCas9-NFN-VP64 effector fusion protein, SaCas9 IL-2-targeting gRNAs, and / or non-targeting gRNA (SaNT). No delivery of fusion proteins (CAR alone) and mock delivery (mock) were also used as negative controls. sf-605940722474-20028.40

[0211] FIG.39 shows tumor cell killing (i.e., cytotoxic activity) of tumors when incubated with Her CAR T cells derived from a first (top row) or second (bottom row) donor following a first (left), second (middle), or third (right) stimulation after delivery of various combinations of the following: mRNA encoding a dSpCas9-KRAB-DNMT3A / L effector fusion protein, SpCas9 MED12-targeting gRNA, SpCas9 CISH-targeting gRNA, the SpCas9 TGFBR2-targeting gRNA, mRNA encoding the dSaCas9-NFN-VP64 effector fusion protein, SaCas9 IL-2-targeting gRNAs, and / or non-targeting gRNA (SaNT). No delivery of fusion proteins (CAR alone) and mock delivery (mock) were also used as negative controls.

[0212] FIG.40 shows viability of T cells 72 hours post-delivery of various combinations of the following: mRNA encoding a dSpCas9-KRAB-DNMT3A / L effector fusion protein, SpCas9 MED12-targeting gRNA, SpCas9 CISH-targeting gRNA, the SpCas9 TGFBR2-targeting gRNA, mRNA encoding the dSaCas9-NFN-VP64 effector fusion protein, SaCas9 IL-2-targeting gRNAs, and / or non-targeting gRNA (SaNT or SpNT). No delivery of fusion proteins (CAR alone) and mock delivery (mock) were also used as negative controls. As additional controls, cells were also delivered : (a) mRNA encoding dSpCas9-2xVP64, and gRNA IL-2_H or (b) mRNA encoding dSaCas9-2xVP64, and gRNAs IL-2_U and IL-2_X, and mRNA encoding dSpCas9-KRAB-DNMT3A / L, and gRNA MED12_3 (IL-2 dSaCas9-2xVP64 + MED12).

[0213] FIGS. 41-45 show alignments of a subset of designed engineered zinc finger protein (ZFP) target sites for a given target region: IL-2 gene region 4 (FIG.41), IL-2 region 5 (FIG. 42), IL-2 transcription start site (TSS; FIG.43), MED-12 TSS (FIG.44), and TGFBR2 TSS (FIG.45). Each solid rectangle represents a given target site. Top-performing ZFPs (see Table E17) and guide RNAs (gRNAs) are indicated by a box.

[0214] FIG.46 shows the expression of IL-2 following delivery of the top-performing IL-2- targeting ZFP fusion proteins set forth in Table E17, dSpCas9-2xVP64 and gRNA IL2_H (SpCas9), or no delivery (CAR alone). IL-2 expression was represented as % IL-2 positivity following a first stimulation 72 hours post-delivery (top) or cell counts of IL-2-positive CAR T- cells following a second stimulation (bottom).

[0215] FIGS. 47A and 47B show the expression of IL-2 and TGFBR2 following delivery of the top-performing TGFBR2 ZFP fusion protein set forth in Table E17, dSpCas9-KRAB- DNMT3A / L and gRNA TGFB2_2 (SpCas9), or no delivery (CAR alone). In addition to the fusion protein sequence listed in Table E17, each TGFBR2 fusion protein also contained a 3x FLAG tag (SEQ ID NO: 287) on its N-terminus. IL-2 expression was represented as % IL-2 sf-605940722474-20028.40 positive CAR T cells following a second stimulation (FIG.47A) and expression of TGFBR2 as % knockdown (KD) of TGFBR2 after either 72 hours post-delivery (FIG.47B; left) or 15 days post-delivery (FIG.47B; right), as assessed by qRT-PCR.

[0216] FIGS. 48A and 48B show the expression of IL-2 and CD25 following delivery of the top-performing MED12 ZFPs set forth in Table E17, dSpCas9-KRAB-DNMT3A / L and gRNA MED12_3 (SpCas9), or no delivery (CAR alone). In addition to the fusion protein sequence listed in Table E17, each MED12 fusion protein also contained a 3x FLAG tag (SEQ ID NO: 287) on its N-terminus. IL-2 expression is represented as % IL-2 positive CAR T cells following a second stimulation (FIG.48A) and expression of CD25 as % positivity after either 7 days post-delivery (FIG.48B; top) or 15 days post-delivery (FIG.48B; bottom), as assessed by flow cytometery.

[0217] FIG.49A-C show overall cell count 72 hours post-delivery of top-performing IL-2- targeting ZFP fusion proteins (FIG.49A), the top-performing TGFBR2-targeting ZFP fusion protein (FIG.49B), and top-performing MED12-targeting ZFP fusions (FIG.49C) as set forth in Table E17. As controls, cells were also delivered a dSpCas9 fusion protein (dSpCas9- 2xVP64 for transcriptional activation of IL-2; dSpCas9-KRAB-DNMT3A / L for transcriptional repression of TGFBR2 or MED12) and a corresponding gRNA or cells did not receive any fusion proteins (CAR alone).

[0218] FIG.50A-C shows the expression of IL-2, shown by % IL-2 positive cells, after a first stimulation (FIG.50A) or number of IL-2 positive cells, normalized to CAR alone, in the presence of TGF-beta (TGFb) after a second (FIG.50B) or third (FIG.50C) stimulation using fresh cells following delivery of mRNA encoding (a) dSpCas9-KRAB-DNMT3A / L and TGFBR2-, MED12-, and CISH-targeting gRNAs, (b) dSpCas9-KRAB-DNMT3A / L and TGFBR2- and MED12-targeting gRNAs, (c) dSpCas9-KRAB-DNMT3A / L and CISH- and MED12-targeting gRNAs, (d) dSpCas9-KRAB-DNMT3A / L and TGFBR2-, MED12-, and CISH-targeting gRNAs paired with dSaCas9-NFN-VP64 with IL-2-targeting gRNA (referred to as IL2 in figures), (e) dSpCas9-KRAB-DNMT3A / L and TGFBR2- and MED12-targeting gRNAs paired with dSaCas9-NFN-VP64 with IL-2-targeting gRNA, (f) dSpCas9-KRAB- DNMT3A / L and a TGFBR2-targeting gRNA paired with dSaCas9-NFN-VP64 with IL-2- targeting gRNA, (g) dSpCas9-KRAB-DNMT3A / L and a MED12-targeting gRNA paired with dSaCas9-NFN-VP64 with IL-2-targeting gRNA, (h) dSpCas9-KRAB-DNMT3A / L and TGFBR2-, MED12-, and CISH-targeting gRNAs paired with either IL2_R4_B ZFP fusion sf-605940722474-20028.40 protein or IL2_R5_A ZFP fusion protein, (i) TGFBR2_A ZFP fusion protein paired with activation of IL-2 using dSpCas9-2xVP64 and IL-2-targeting gRNA (IL2 dSpCas9-2xVP64), or (j) multiplexed repression of TGFBR2, MED12, and CISH using dSpCas9-KRAB-DNMT3A / L paired with activation of IL-2 using dSaCas9-NFN with corresponding gRNAs (TGFBR2+MED12+CISH+IL2-NFN). As controls, cells were also delivered: (a) dSaCas9-NFN with a non-targeting gRNA SaNT (SEQ ID NO: 439), (b) dSaCas9-NFN-VP64 with a non- targeting gRNA SaNT (SEQ ID NO: 439), (c) no delivery of fusion protein (CAR only), or (d) mock delivery (mock).

[0219] FIGS. 51A-C show the level of polyfunctional T cells after a first (FIG.51A), second (FIG.51B), or third simulation (FIG.51C) using fresh cells and after delivery of the same constructs as described for FIG.51A-C.

[0220] FIG.52 shows frequency of CAR T cells after each stimulation in cells derived from the first donor (left) or second donor (right) using frozen cells and after delivery of the same constructs as described for FIG.50A-C.

[0221] FIG.53 shows a schematic of two dual ZFP fusion protein constructs, Construct 1 and Construct 2, which each contain two ZFP fusion proteins separated by a P2A sequence. One ZFP fusion protein contains a MED12-targeting ZFP fused to DNMT3A-DNMT3L (DNMT3A- 3L) and a KRAB domain, while the second ZFP fusion protein contains a IL-2-targeting ZFP fused to effector domains NCOA3-FOXO3-NCOA3 (NFN).

[0222] FIG.54A and FIG.54B shows expression of IL-2, as measured by qPCR, in CAR T cells derived from Donor 1 (FIG.54A) or Donor 2 (FIG.54B) one day post-delivery via electroporation of the indicated constructs expressing both ZFP fusion proteins (Construct 1 or Construct 2), a construct expressing one ZFP fusion protein (IL2_R5_A ZFP FP or MED12_A ZFP FP), a Cas9 fusion protein paired with either a MED12-targeting gRNA (MED12_3) or IL- 2-targeting gRNA (IL2_J), or electroporation of two constructs, each expressing one ZFP fusion fusion, at a concentration of either 75 ug / mL or 37.5 ug / mL each. As a control, a mock electroporation (mock EP) was also performed.

[0223] FIG.55 shows expression of MED12, as measured by qPCR, in CAR T cells derived from one of three indicated donors two days post-delivery via electroporation of the indicated constructs expressing both ZFP fusion proteins (Construct 1 or Construct 2), a construct expressing one ZFP fusion protein (IL2_R5_A ZFP FP or MED12_A ZFP FP), a Cas9 fusion protein paired with either a MED12-targeting gRNA (MED12_3) or IL-2-targeting gRNA sf-605940722474-20028.40 (IL2_J), or electroporation of two constructs, each expressing one ZFP fusion fusion, at a concentration of either 75 ug / mL or 37.5 ug / mL each. As a control, a mock electroporation (mock EP) was also performed.

[0224] FIG.56 shows the amount of IL-2+ CAR T cells (as indicated by the presence of surrogate EGFR) per microliter following a third stimulation and delivery of one of the indicated constructs expressing both ZFP fusion proteins (Construct 1 or Construct 2), a construct expressing one ZFP fusion protein (IL2_R5_A ZFP FP or MED12_A ZFP FP), a Cas9 fusion protein paired with either a MED12-targeting gRNA (MED12_3) or IL-2-targeting gRNA (IL2_J), or electroporation of two constructs, each expressing one ZFP fusion fusion, at a concentration of either 75 ug / mL or 37.5 ug / mL each. As a control, a mock electroporation (mock EP) was also performed. Detailed Description

[0225] Provided herein in some embodiments is an epigenetic-modifying DNA-targeting system. In some embodiments, the DNA-targeting system is a multiplexed DNA-targeting system, i.e., targeted to target sites for multiple genes. In some embodiments, the DNA-targeting system comprises synthetic transcription factors that are able to modulate, such as decrease (or downregulate) or increase (or upregulate), transcription of multiple genes in a targeted manner. In some embodiments, the DNA-targeting system comprises at least one first DNA-targeting module (also referred to herein as an activator DNA-targeting module) for increasing transcription of one or more first genes (also referred to herein as activation genes) and at least one second DNA-targeting module (also referred to herein as an repressor DNA-targeting module) for repressing transcription of one or more second genes (also referred to herein as repression genes). In some embodiments, the one or more second genes are all different from the one or more first genes.

[0226] In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises a first fusion protein comprising (i) a first DNA-binding domain for targeting to a target site of one of the one or more first genes and (ii) at least one transcriptional activator domain. In some embodiments, at least one, optionally each, of the second DNA- targeting modules comprises a second fusion protein comprising (i) a second DNA-binding domain for targeting to a target site of one of the one or more second genes and (ii) at least one sf-605940722474-20028.40 transcriptional repressor domain. In some embodiments, the first DNA-binding domain or domains are all different from the second DNA-binding domain or domains.

[0227] Also provided herein are polynucleotides encoding the DNA-targeting system, as well as vectors and cells containing the provided polynucleotides. Also provided herein are methods of using the epigenetic-modifying DNA-targeting systems, such as for modulating transcription, phenotype, or function of cells, such as T cells, and the resulting modified cells.

[0228] The provided embodiments relate to compositions and methods for promoting T cell function, such as one or more T cell effector functions, by epigenetically modifying target sites in multiple target genes. In some embodiments, the methods can be used in connection with T cell therapies, such as in connection with adoptive T cell therapies. In some embodiments, modulating transcription of the multiple genes increases or improves one or more T cell phenotypes or functions. In some embodiments, a T cell effector function is increased, such as the ability to produce cytokines, for example IL-2 or IFN-gamma (IFNg), the ability of T cells to proliferate, the ability of T cells to kill target cells, or the ability of T cells to exhibit a persistent immune response. In particular embodiments, modulation of the multiple genes improves T cell effector functions after or upon T cell stimulation, including following serial stimulation that mimics conditions of repeated antigen encounter as occurs in vivo.

[0229] The administration of T cells targeting a specific antigen, also known as Adoptive Cell Therapy (ACT), is a promising approach for treating diseases such as cancer. However, current ACT treatments face challenges, including suboptimal T cell function, expansion, and persistence. Furthermore, the persistence and functionality of the transferred T cells can significantly differ between different T cell subsets and among T cells from different patients. Recent clinical trials for ACT suggest that the ability to persist long term in circulation is dependent on the differentiation stage of the T cells, including the ability to retain a network of transcription factors and metabolic regulators (Pilipow K., et.al., Journal of Clinical Investigation Insight 2018;3(18):e122299). The T cells transferred into the patient are often terminally differentiated and therefore fail to persist long term, ultimately limiting effective anti- tumor response. For instance, while the first CAR T cell therapy was FDA-approved as a cell & gene therapy in 2017, patients whose cancer relapse or do not respond to treatment often suffer from lack of chimeric antigen receptor (CAR) T cell persistence (Mueller et al, Blood (2018)). Moreover, no durable benefit has yet been observed for CAR T cell therapies in solid tumors.

[0230] Strategies to mitigate these challenges and enhance the persistence, expansion, and sf-605940722474-20028.40 anti-tumor activity of CAR engineered T cells have been tested in preclinical and clinical settings. For instance, strategies for optimizing ex vivo T cell culture conditions, including the addition of cytokines during manufacturing (Besser M.J., Cytotherapy 2009;11(2):206-17), expression of cytokines and / or receptors by the CAR T cells (Krenciute G., Cancer Immunol Res. 201707;5(7):571-581), use of pharmacological inhibitors during expansion to inhibit signaling pathways such as AKT (Urak R.et.al., Journal of Immunotherapy Cancer 2017 Mar 21;5:26) or PI3K (Peterson C.T et.al., Blood Advances 2018 Feb 13;2(3):210-223), immune- depletion, and checkpoint blockade (Cherkassky L. et.al., Journal of clinical investigation 2016 Aug 1;126(8):3130-44), have been so far explored. However, existing strategies have not been entirely satisfactory. In some cases, concerns regarding cytokine-induced toxicity or the emergence of lymphoproliferative diseases as a result of the above-mentioned strategies have raised questions for alternative approaches.

[0231] The provided embodiments relate to identification of genomic locations that are epigenetically modified in a T cell to impact or promote T cell effector functions upon T cell stimulation, including those induced in a TCR and / or CAR-induced or dependent manner, such as demonstrated by assessment for cells producing IL-2 and / or IFNg, having the ability to proliferate, or having the ability to kill target cells. In some embodiments, the stimulating conditions or agents include one or more agents, e.g., ligands, which are capable of activating an intracellular signaling domain of a TCR complex. In some aspects, the agent turns on or initiates TCR / CD3 intracellular signaling cascade in a T cell. Such agents can include antibodies, such as those specific for a TCR component and / or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example bound to a solid support such as a bead, and / or one or more cytokines. In some embodiments, the one or more agents are PMA and ionomycin. In some embodiments, the T cell stimulation is an antigen-specific stimulation, in which the cells are stimulated with an agent providing an antigen or epitope thereof that is specific to, or recognized by, an antigen receptor (e.g., CAR) expressed on the T cell. For instance, the stimulating agent may include antigen- expressing target cells. In particular embodiments, the phenotype is or includes the production or secretion of a cytokine, such as IL-2 or IFN-g, in response to a T cell stimulation. The production and / or the secretion of cytokines contributes to immune responses and is involved in different processes, including the induction of anti-viral proteins and the induction of T cell proliferation. Cytokines are not pre-formed factors but are rapidly produced and secreted in response to cellular activation. The production or secretion of cytokines may be measured, sf-605940722474-20028.40 detected, and / or quantified by any suitable technique known in the art.

[0232] In certain embodiments, the T cell function is the production of one or more cytokines. In particular embodiments, the production of one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining (ICS). ICS by flow cytometry is a technique well-suited for studying cytokine production at the single-cell level. It detects the production and accumulation of cytokines within the cell (such as within the endoplasmic reticulum) after cell stimulation, allowing for the identification of cell populations that are positive or negative for production of a particular cytokine or for the separation of high producing and low producing cells based on a threshold. ICS can also be used in combination with other flow cytometry protocols for immunephenotyping using cell surface markers or with MHC multimers to access cytokine production in a particular subgroup of cells, making it a flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include ELISPOT, limiting dilution, and T cell cloning.

[0233] Notably, the target genes, and target sites therein, of the present disclosure were identified by a screening method involving transient delivery in which DNA-binding domain- effector fusion proteins (also called “epi-editors”) were delivered to a T cell transiently (i.e., delivered by a method that results in transient expression and / or presence of the fusion protein in the T cell) followed by primary or serial stimulation of the T cells to assess impact on functional T cell cytokines. It was found herein that the transient delivery of the epigenetic-modifying DNA-targeting systems allowed identification of genomic targets whose modulation substantially impacts T cell function, but without requiring permanent presence of the epigenetic-modifying DNA-targeting systems and / or stable knockdown or knockout of the target gene. This approach is advantageous because it permits identification of target genes and target sites that provide a better safety profile, as their modulation is not reliant on a permanent editor integration, such as by lentiviral transduction. Moreover, the transient screening strategies allow for identification of target genes and target sites therein in which there is a durability of the effect of the epigenetic-modifying DNA-targeting system that is not masked as a result of permanent integration into the genome and expression therefrom. This is in contrast to other screening approaches in which lentiviral delivery of DNA-systems has been employed (Schmidt et al.2022 Science, 375, DOI: 10.1126 / science.abj4008; Freimer et al.2022 Nature Genetics, 54:1133-1144).

[0234] The provided embodiments can be used to target genes that, when transcriptionally sf-605940722474-20028.40 altered by epigenetic modification, can vastly facilitate or promote T cell function, including effector activities required for T cell persistence and function. Such a T cell profile is expected to produce durable effector functions, have better fitness / proliferation benefit, and have the ability to produce pro-proliferation cytokines (e.g., IL-2) and / or cytotoxic cytokines (e.g., IFNg) upon TCR or antigen stimulation. In particular, the provided embodiments provide for epigenetic-modifying DNA-targeting systems (i.e., “epi-editing systems”) and methods that can provide for long-lasting effector function with better fitness. This approach offers substantial clinical solutions to circumvent the problems with T cell persistence, suboptimal functionality, and / or exhaustion. Moreover, the epigenetic modification of the cell does not modify DNA at the sequence level, thereby avoiding safety concerns with gene editing approaches. The ability to epigenetically control the differentiation fate of T cells provides an advantageous approach for increasing the percentage or number of T cells in a population of T cells.

[0235] The provided embodiments can also be used to target multiple genes, with one or more first genes targeted for increased transcription and one or more second genes targeted for repressed transcription. In some aspects, T cell function is improved by such combined targeting, relative to any improvements in T cell function achieved by only targeting genes for increased transcription or only targeting genes for decreased transcription. In some embodiments, combined transcriptional activation and repression is affected by using different DNA-binding domains between the first DNA-targeting modules used for increasing transcription and the second DNA-targeting modules used for repressing transcription. In some embodiments, the DNA-binding domains for the first DNA-targeting modules do not bind to the target sites for the one or more second genes, and vice versa. For instance, the DNA-binding domains may be different zinc finger proteins (ZFPs) or transcription activator-like effectors (TALEs) between the first and second DNA-targeting modules. In some embodiments, the DNA-binding domains comprise Cas proteins, and the Cas proteins for the first DNA-targeting modules do not bind to gRNAs targeting the one or more second genes, and vice versa. In some embodiments, the Cas proteins for the first DNA-targeting modules are from a different species than the Cas proteins for the second DNA-targeting modules. In some embodiments, the Cas proteins for the first DNA-targeting modules bind to different protospacer-adjacent motifs (PAMs) than do the Cas proteins for the second DNA-targeting modules. In some aspects, the use of such non-overlapping DNA-binding domains between the first DNA-targeting modules used for increasing transcription and the second DNA-targeting modules used for repressing sf-605940722474-20028.40 transcription prevent off-target effects that may lead to, for instance, increased transcription of a gene intended to be repressed, and vice versa.

[0236] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0237] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. DNA-TARGETING SYSTEMS

[0238] In some embodiments, provided herein are epigenetic-modifying DNA-targeting systems capable of specifically targeting a target site for each of multiple genes (i.e., multiple target genes) and modulating transcription of the target genes. In some embodiments, transcriptional modulation of gene expression by the DNA-targeting system promotes or improves function of lymphoid cells. In some embodiments, the DNA-targeting system promotes T cell function, such as one or more T cell effector functions, by epigenetically modifying target sites in the genes.

[0239] In some embodiments, the target genes include one or more first genes (also referred to herein as activation genes) for which transcription is activated and one or more second genes (also referred to herein as repression genes) for which transcription is repressed. In some embodiments, the transcriptional modulation is increased transcription for the one or more first genes, and the transcriptional modulation is decreased transcription for the one or more second genes. In some embodiments, the one or more first genes are all different from the one or more second genes. In some embodiments, the target genes include a single first gene. In some embodiments, the target genes include a plurality of first genes, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 first genes for which transcription is increased. In some embodiments, the target genes include a single second gene. In some embodiments, the target genes include a plurality of second genes, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 second genes. sf-605940722474-20028.40

[0240] In some embodiments, the one or more first genes are T cell activator genes. In some embodiments, the one or more first genes, e.g., BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and / or VAV1, are positive regulators of T cell function.

[0241] In some embodiments, the one or more second genes are T cell repressor genes. In some embodiments, the one or more second genes, e.g., CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and / or RASA2, are negative regulators of T cell function.

[0242] In some embodiments, the DNA-targeting system includes at least one first DNA- targeting module (also referred to herein as an activator DNA-targeting module) for increasing transcription of the one or more first genes and at least one second DNA-targeting module (also referred to herein as an repressor DNA-targeting module) for repressing transcription of the one or more second genes. In some embodiments, the DNA-targeting system includes a single first DNA-targeting module. In some embodiments, the DNA-targeting system includes a plurality of first DNA-targeting modules, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 first DNA-targeting modules. In some embodiments, the DNA-targeting system includes a single second DNA-targeting module. In some embodiments, the DNA-targeting system includes a plurality of second DNA-targeting module, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 second DNA-targeting modules.

[0243] In some embodiments, each first DNA-targeting module includes a first fusion protein containing (i) a first DNA-binding domain for targeting to a target site of one of the one or more first genes and (ii) at least one transcriptional activator domain. In some embodiments, the first DNA-binding domain or domains target a plurality of first genes. In some embodiments, the first DNA-binding domain or domains target a single first gene. In some embodiments, the first DNA-binding domain is the same across the at least one first DNA-targeting module. In some embodiments, the first DNA-binding domain is different across the at least one first DNA- targeting module. In some embodiments, the at least one transcriptional activator domain is the same across the at least one first DNA-targeting module. In some embodiments, the at least one transcriptional activator domain is different across the at least one first DNA-targeting module.

[0244] In some embodiments, the at least one transcriptional activator domain activates or increases transcription of a first gene as compared to transcription of the first gene in the absence of the DNA-targeting system. In some embodiments, the at least one transcriptional sf-605940722474-20028.40 activator domain directly or indirectly leads to increased transcription of the first gene. In some embodiments, the at least one transcriptional activator domain induces, catalyzes, or leads to transcription activation. In some embodiments, the at least one transcriptional activator domain induces transcription activation. In some aspects, the at least one transcriptional activator domain comprises a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, optionally wherein the TET protein is TET1, a SunTag domain, or a domain, portion, variant, or truncation of any of the foregoing. In some embodiments, the at least one transcriptional activator domain is VP64.

[0245] In some embodiments, at least one, optionally each, of the first fusion proteins is a dCas9-VP64 fusion protein. In some embodiments, at least one, optionally each, of the first fusion proteins is a dCas9-2xVP64 fusion protein.

[0246] In some embodiments, each second DNA-targeting module includes a second fusion protein containing (i) a second DNA-binding domain for targeting to a target site of one of the one or more second genes and (ii) at least one transcriptional repressor domain. In some embodiments, the second DNA-binding domain or domains target a plurality of second genes. In some embodiments, the second DNA-binding domain or domains target a single second gene. In some embodiments, the second DNA-binding domain is the same across the at least one second DNA-targeting module. In some embodiments, the second DNA-binding domain is different across the at least one second DNA-targeting module. In some embodiments, the at least one transcriptional repressor domain is the same across the at least one second DNA-targeting module. In some embodiments, the at least one transcriptional repressor domain is different across the at least one second DNA-targeting module.

[0247] In some embodiments, the at least one transcriptional repressor domain inhibits or reduces transcription of a second gene as compared to transcription of the second gene in the absence of the DNA-targeting system. In some embodiments, the at least one transcriptional repressor domain directly or indirectly leads to reduced transcription of the second gene. In some embodiments, the at least one transcriptional repressor domain induces, catalyzes, or leads to transcription repression. In some embodiments, the at least one transcriptional repressor domain induces transcription repression. In some aspects, the at least one transcriptional repressor domain is selected from a KRAB domain, ERF repressor domain, MXI1 domain, SID4X domain, MAD-SID domain, DNMT family protein domain (e.g., DNMT3A or sf-605940722474-20028.40 DNMT3B), a fusion of one or more DNMT family proteins or domains thereof (e.g., DNMT3A / L, which comprises a fusion of DNMT3A and DNMT3L domains), LSD1, EZH2, a partially or fully functional fragment or domain of any of the foregoing, and a combination of any of the foregoing. In some embodiments, the at least one transcriptional repressor domain is KRAB. In some embodiments, the at least one transcriptional repressor domain is DNMT3A / L.

[0248] In some embodiments, at least one, optionally each, of the second fusion proteins is a dCas9-KRAB fusion protein. In some embodiments, at least one, optionally each, of the second fusion proteins is a dCas9-KRAB-DNMT3A / L fusion protein.

[0249] In some embodiments, the first and / or second DNA-binding domain comprises a CRISPR associated (Cas) protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), meganuclease, homing endonuclease, I-SceI enzyme, or variants thereof. In some embodiments, the first and / or second DNA-binding domain comprises a catalytically inactive (e.g., nuclease-inactive or nuclease-inactivated) variant of any of the foregoing. In some embodiments, the first and / or second DNA-binding domain comprises a deactivated Cas9 (dCas9) protein that is a catalytically inactivated so that it is inactive for nuclease activity and is not able to cleave the DNA.

[0250] In some embodiments, a first and / or second DNA-targeting module is a CRISPR / Cas-based DNA-targeting module. In some embodiments, the first and / or second DNA-binding domain comprises a Cas protein, such as a nuclease-inactive Cas or dCas, e.g., dCas9, and the DNA-targeting module comprising the Cas protein comprises one or more guide RNAs (gRNAs), such as a combination of gRNAs (e.g., two gRNAs or three gRNAs). In some embodiments, the gRNA comprises a spacer sequence that is capable of targeting and / or hybridizing to a target site. In some embodiments, the gRNA is capable of complexing with the Cas protein. In some aspects, the gRNA directs or recruits the Cas protein to the target site.

[0251] In some embodiments, at least one, optionally each, of the first DNA-binding domains is a first Cas protein, and the first DNA-targeting module comprising the first Cas protein further comprises a first gRNA for targeting the first DNA-binding domain to a target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-binding domains is a second Cas protein, and the second DNA-targeting module comprising the second Cas protein further comprises a second gRNA for targeting the second DNA-binding domain to a target site of one of the one or more second genes.

[0252] In some embodiments, the first DNA-binding domain or domains are all different sf-605940722474-20028.40 from the second DNA-binding domain or domains. In some embodiments, the first DNA- binding domain or domains do not bind to the target sites for the one or more second genes, and vice versa. In some embodiments, the first DNA-binding domain or domains are ZFPs, and the second DNA-binding domain or domains are different ZFPs. In some embodiments, the first DNA-binding domain or domains are TALEs, and the second DNA-binding domain or domains are different TALEs. In some embodiments, the first DNA-binding domain or domains are ZFPs, and the second DNA-binding domain or domains are TALEs. In some embodiments, the first DNA-binding domain or domains are TALEs, and the second DNA-binding domain or domains are ZFPs. In some embodiments, the first DNA-binding domain or domains are Cas proteins, and the second DNA-binding domain or domains are ZFPs. In some embodiments, the first DNA-binding domain or domains are ZFPs, and the second DNA-binding domain or domains are Cas proteins. In some embodiments, the first DNA-binding domain or domains are Cas proteins, and the second DNA-binding domain or domains are TALEs. In some embodiments, the first DNA-binding domain or domains are TALEs, and the second DNA- binding domain or domains are Cas proteins.

[0253] In some embodiments, the first and second DNA-binding domains are both Cas poteins. In some embodiments, the first Cas protein or proteins for the first DNA-targeting modules do not bind to gRNAs targeting the one or more second genes, and vice versa. In some embodiments, the first Cas protein or proteins for the first DNA-targeting modules are from a different species than the second Cas protein or proteins for the second DNA-targeting modules. In some embodiments, the first Cas protein or proteins for the first DNA-targeting modules bind to different protospacer-adjacent motifs (PAMs) than do the second Cas protein or proteins for the second DNA-targeting modules.

[0254] Exemplary components and features of the DNA-targeting systems are provided below in the following subsections. A. Target Genes and Target Sites For Promoting Lymphoid Activation and Function

[0255] In some embodiments, modulation of the target genes promotes T cell activation or function. In some embodiments, increased transcription of the one or more first genes and repressed transcription of the one or more second genes promotes T cell activation or function.

[0256] In some embodiments, the target site for a gene is a target site in the gene or a regulatory DNA element thereof. In some embodiments, the target site for each gene is a target sf-605940722474-20028.40 site in the gene. In some embodiments, the target site for each gene is a target site in a regulatory DNA element of the gene. In some embodiments, the target sites across genes are a mix of target sites in a gene and target sites in a regulatory DNA element of a gene. In some embodiments, the target genes are genes in a lymphoid cell, such as a T cell.

[0257] In some embodiments, a regulatory DNA element is a sequence to which a gene regulatory protein may bind and affect transcription of the gene. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream, or downstream regulatory DNA element of a gene. In some embodiments, the regulatory DNA element is a promoter or enhancer of the gene. In some embodiments, the target site is located within a promoter, enhancer, exon, intron, untranslated region (UTR), 5’ UTR, or 3’ UTR of the gene. In some embodiments, the regulatory DNA element is a promoter. In some embodiments, a promoter is a nucleotide sequence to which RNA polymerase binds to begin transcription of the gene. In some embodiments, a promoter is a nucleotide sequence located within about 100bp, about 500bp, or about 1000bp of a transcriptional start site of the gene. In some embodiments, a promoter is within 500bp of a transcriptional start site of the gene. In some embodiments the target site is located within a sequence of unknown or known function that is suspected of being able to control expression of a gene. 1. Lymphoid Cells and Modulated Effector Functions

[0258] In some embodiments, the provided DNA-targeting systems provide for transcriptional modulation to repress or increase expression of multiple target genes. In some embodiments, the target genes regulate a cellular phenotype, e.g., of a T cell. In some embodiments, modulated expression of the target genes promotes increased T cell effector function upon T cell stimulation. In some embodiments, the increased T cell effector function is increased compared to a T cell in which expression of the genes has not been modulated, e.g., not modulated with a provided DNA-targeting system. Methods for modulating T cell function or functions of other lymphoid cells by provided DNA-targeting systems are further described below and in Section IV.

[0259] In some embodiments, the DNA-targeting system is transiently delivered to the cell. In some embodiments, delivery of the DNA-targeting system, for example by transient delivery, promotes increased T cell effector function upon T cell stimulation. In some embodiments, the T cell effector function is increased in comparison to a comparable T cell to which the DNA- targeting system has not been delivered. sf-605940722474-20028.40

[0260] In some aspects, transient delivery refers to any method of delivery that results in expression and / or presence of one or more components of the DNA-targeting system in the cell for a limited duration. For example, delivery of mRNA (such as by electroporation) encoding the fusion protein of the DNA-targeting system to a cell can result in transient expression of the fusion protein in the cell, for example until the mRNA is degraded. In other examples, the DNA- targeting system can be expressed from one or more nucleic acids encoding the DNA-targeting system, wherein the nucleic acids encoding the DNA-targeting system are not incorporated into the genome of the cell, and are eventually degraded and / or removed from the cell such that expression of the DNA-targeting system does not persist. In other examples, one or more components of the DNA-targeting system, such as a fusion protein and optionally a gRNA can be synthesized in vitro and delivered directly to the cell (e.g. by electroporation) without the need for an expression vector, resulting in transient presence of the DNA-targeting system, for example until the fusion protein and / or gRNA are degraded. In some aspects, transient delivery differs from non-transient methods of delivery that result in stable expression, such as methods involving incorporation of an expression vector for a DNA-targeting system or component thereof into the genome of the cell.

[0261] In some embodiments, delivery of the DNA-targeting system to the cell (e.g. T cell), such as by transient delivery, promotes a phenotype in the cell (e.g. T cell). In some embodiments, the phenotype is increased activation or function in the cell (e.g. T cell). In some embodiments, delivery of the DNA-targeting system to the cell (e.g. T cell), such as by transient delivery, promotes increased activation or function in the cell (e.g. T cell). In some embodiments, the phenotype is increased T cell effector function upon T cell stimulation. In some embodiments, the T cell effector function is increased compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system. In some embodiments, the T cell effector function is characterized by an activity selected from the group consisting of IL-2 production, IFN-gamma production, TNF-alpha production, T cell proliferation or a combination of any of the foregoing.

[0262] In some embodiments, the provided DNA-targeting systems promote or increase an improved T cell effector function as may occur after stimulation in vitro, ex vivo, or in vivo. In some embodiments, the T cell stimulation is a polyclonal T cell stimulation. In some embodiments, the T cell stimulation is with an anti-CD3 and anti-CD28 activation reagent. In some embodiments, the T cell stimulation is an antigen-specific activity that is mediated or sf-605940722474-20028.40 induced by specific binding of an antigen to an antigen receptor on the surface of the T cell. In some embodiments, the T cell expresses a chimeric antigen receptor (CAR) or engineered T cell receptor (eTCR) directed against an antigen, and the T cell stimulation is an antigen-specific stimulation of the CAR or eTCR. In some embodiments, the T cell stimulation is with antigen- expressing target cells. In some embodiments, the T cell stimulation occurs when the T cell contacts a cell expressing the antigen. In some embodiments, the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells. In some embodiments, the T cells are stimulated and then are transiently delivered a provided DNA-targeting system prior to assessment of a T cell effector function or phenotype.

[0263] In certain embodiments, the cell composition that contains T cells is stimulated with an anti-CD3 / anti-CD28 activation reagent for an amount of time, and an effector function is measured at one or more time points during or after the incubation. In some embodiments, such an activation reagent has anti-CD3 / anti-CD28 coated on a support, such as magnetic beads or other matrix. Exemplary activation reagents include Dynabeads™ and T cell TransAct™. In some embodiments, the T cells are incubated with the activation reagent for 3 hours to 72 hours, such as 12 hours to 48 hours, for example 12 hours, 18 hours, 24 hours, 36 hours, or 48 hours, or any value between any of the foregoing. In some embodiments, cells can be assessed directly for an effector function, such as production of cytokines or ability to proliferate. In some embodiments, the supernatant of the culture can be collected, and the amount of a soluble factor, e.g., a cytokine, is detected. In some embodiments, the T cells can be collected and re-exposed to the activation reagent to monitor cytolytic activity. In some embodiments, cells can be restimulated one or more times, such as by serial stimulation methods, and serially assessed for effector functions after each stimulation.

[0264] In certain embodiments, the antigen-specific activity is measured by incubating the cell composition that contains T cells expressing the antigen receptor, e.g., a CAR, with antigen- expressing cells for an amount of time, and an effector function is measured at one or more time points during or after the incubation. In some embodiments, the T cells are incubated with the antigen specific agent, such as antigen-expressing cells, for 3 hours to 96 hours, such as 12 hours to 72 hours, for example 12 hours, 24 hours, 48 hours, or 72 hours, or any value between any of the foregoing. In some embodiments, cells can be assessed directly for an effector function, such as production of cytokines or ability to proliferate. In some embodiments, the supernatant of the culture can be collected, and the amount of a soluble factor, e.g., a cytokine, is detected. n sf-605940722474-20028.40 some embodiments, the T cells can be collected and re-exposed to antigen-expressing target cells to monitor cell killing (cytolytic activity) of target cells. In some embodiments, cells can be restimulated one or more times, such as by serial stimulation methods, and serially assessed for effector functions after each stimulation. In some embodiments, the T cells with the engineered antigen receptor (e.g., a CAR) are incubated with a constant number of the antigen-expressing cells, such as at an effector to target (E:T) ratio of 1:4 to 4:1, such as at a ratio of 1:4, 1:3, 1:2, or 1:1.

[0265] In some embodiments, the cell (e.g., T cell) exhibits increased cytokine production. In some embodiments, the increased cytokine production occurs upon T cell stimulation. In some embodiments, T cell effector function is characterized by cytokine production. In some embodiments, the cytokine production is increased by at least about 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 2 fold, 5 fold, 10 fold, 50 fold, or 100 fold in comparison to a cell that has not been delivered the epigenetic-modifying DNA-targeting system. In some embodiments, the cytokine production is production of IL-2, IFN-gamma, TNF-alpha, or a combination thereof. In some embodiments, the T cell effector function is characterized by IL-2 production. In some embodiments, the cell (e.g., T cell) exhibits increased IL-2 production. In some embodiments, the T cell effector function is characterized by IFN-gamma production. In some embodiments, the cell (e.g., T cell) exhibits increased IFN-gamma production. In some embodiments, the T cell effector function is characterized by IL-2 production and IFN-gamma production. In some embodiments, the cell (e.g., T cell) exhibits increased IL-2 production and increased IFN- gamma production. In some embodiments, the T cell effector function is characterized by polyfunctional production of IL-2, IFN-gamma, and TNF-alpha. In some embodiments, the cell (e.g., T cell) exhibits increased IL-2, IFN-gamma, and TNF-alpha production.

[0266] Suitable techniques for the measurement of the production or secretion of a soluble factor, such as a cytokine, are known in the art. Production and / or secretion of a soluble factor can be measured by determining the concentration or amount of the extracellular amount of the factor, or determining the amount of transcriptional activity of the gene that encodes the factor. Suitable techniques include assays such as an immunoassay, an aptamer-based assay, a histological or cytological assay, an mRNA expression level assay, an enzyme linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, radioimmunoassay (RIA), immunostaining, flow cytometry assay, surface plasmon resonance (SPR), chemiluminescence assay, lateral flow immunoassay, inhibition assay or avidity assay, protein sf-605940722474-20028.40 microarrays, high-performance liquid chromatography (HPLC), Meso Scale Discovery (MSD) electrochemiluminescence, and bead based multiplex immunoassays (MIA). In some embodiments, the suitable technique may employ a detectable binding reagent that specifically binds the soluble factor.

[0267] In some embodiments, cytokine production is measured as a percentage of cells being positive for the cytokine, for example as measured by intracellular cytokine staining (ICS) and flow cytometry. Intracellular cytokine staining (ICS) by flow cytometry is a technique well- suited for studying cytokine production at the single-cell level. It detects the production and accumulation of cytokines within the endoplasmic reticulum after cell stimulation, allowing for the identification of cell populations that are positive or negative for production of a particular cytokine or for the separation of high producing and low producing cells based on a threshold. ICS can also be used in combination with other flow cytometry protocols for immunephenotyping using cell surface markers or with MHC multimers to access cytokine production in a particular subgroup of cells, making it an extremely flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include ELISPOT, limiting dilution, and T cell cloning.

[0268] In some embodiments, the cytokine production is measured as the amount of cytokine secreted from the cell, for example as measured by ELISA (enzyme-linked immunosorbent assay). ELISA is a plate-based assay technique designed for detecting and quantifying substances such as peptides, cytokines, antibodies, and hormones. In an ELISA, the soluble factor, such as a cytokine, is immobilized to a solid surface and then complexed with an antibody that is linked to an enzyme. Detection is accomplished by assessing the conjugated enzyme activity via incubation with a substrate to produce a detectable signal.

[0269] In some embodiments, the T cell effector function is characterized by activity that further comprises T cell proliferation. In some embodiments, the cell (e.g., T cell) exhibits increased proliferation. In some embodiments, the increased proliferation occurs upon T cell stimulation. In some embodimnets, the proliferation is increased by at least about 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 2 fold, 5 fold, 10 fold, 50 fold, or 100 fold in comparison to a cell that has not been delivered the epigenetic-modifying DNA-targeting system. In some embodiments, the proliferation is measured as the increase in cell numbers before and after stimulation. In some embodiments, the increased proliferation is measured as the number of cells after stimulation in a cell population delivered with the epigenetic-modifying DNA- sf-605940722474-20028.40 targeting system compared to the number of cells after stimulation in a cell population not delivered the epigenetic-modifying DNA-targeting system. In some embodiments, the cell (e.g., T cell) does not exhibit increased proliferation.

[0270] In some embodiments, the T cell effector function is characterized by activity that further comprises killing of target cells. In some embodiments, the cell (e.g., T cell) exhibits increased killing of target cells. In some embodiments, the increased killing of target cells occurs upon T cell stimulation. In some embodiments, the stimulation is performed by contacting the cells (e.g., T cells) with target cells. In some embodiments, T cells are incubated with antigen-expressing target cells at ratios between 4:1 and 1:4, inclusive, such as at ratios of 1:4, 1:3, 1:2, or 1:1. In some embodiments, the killing of target cells is increased by at least about 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 2 fold, 5 fold, 10 fold, 50 fold, or 100 fold in comparison to a cell that has not been delivered the epigenetic-modifying DNA-targeting system. In some embodiments, the killing is measured as the ability of the cells to kill target cells when contacted by the target cells. Killing of target cells can be measured by any suitable assay, for example as described herein in the Examples. In some embodiments, the killing is measured in an in vitro assay, wherein cells delivered with the epigenetic-modifying DNA- targeting system are co-cultured with the target cells, and the number of target cells are measured over time. In some embodiments, reduced numbers and / or proliferation of the target cells are indicative of target cell killing. The cytolytic activity can be measured by directly or indirectly measuring the target cell number over time. For example, the target cells may be incubated with a detectable marker prior to being incubated with antigen receptor (e.g., CAR)- expressing cells, such a marker that is detectable then the target cell is lysed, or a detectable marker that is detectable in viable target cells. These readouts provide direct or indirect of target cell number and / or target cell death and can be measured at different time points during the assay. A reduction of target cell number and / or an increase of target cell death can indicate the cytolytic activity of the cells. Suitable methods for performing cytolytic assays are known in the art and include chromium-51 release assays, non-radioactive chromium assays, and flow cytometric assays that use fluorescent dyes such as carboxyfluorescein succinimidyl ester (CFSE), PKH-2, and PKH-26.

[0271] In some embodiments, the T cell effector function is characterized by activity that further comprises T cell persistence. In some embodiments, the cell (e.g., T cell) exhibits increased persistence (e.g., T cell persistence). In some embodiments, persistence relates to the sf-605940722474-20028.40 ability of cells to remain present and / or maintain an immune response in the presence of target cells. In some embodiments, persistence can be measured in vitro or in vivo, for example after administration of cells to a subject. Persistence can be measured by any suitable method, for example as described in Section IV.

[0272] In certain embodiments, the ability of T cells to persist can be measured as a pharmacokinetic property of the cell composition following its administration to a subject. In some embodiments, the pharmacokinetic parameter can include exposure, number, concentration, persistence, and proliferation. In some cases, pharmacokinetics can be assessed by measuring such parameters as the maximum (peak) plasma concentration, the peak time (i.e., when maximum plasma concentration (Cmax) occurs; Tmax), the minimum plasma concentration (i.e., the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; Cmin), the elimination half-life (T1 / 2), and area under the curve (i.e., the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC), following administration. The parameters of the administered engineered T cells can be measured in samples of blood from the subject. For example, nucleic acid-based methods, such as quantitative PCR (qPCR) or flow cytometry-based methods, or other assays, such as an immunoassay, ELISA, or chromatography / mass spectrometry-based assays, can be used.

[0273] In some aspects, nucleic acid-based methods, such as quantitative PCR (qPCR), is used to assess the quantity of cells expressing the antigen receptor (e.g., CAR-expressing cells administered for T cell based therapy) in the blood, serum, organ, or tissue sample (e.g., disease site, e.g., tumor sample) of the subject. In some aspects, persistence is quantified as copies of DNA or plasmid encoding the receptor, e.g., CAR, per microgram of DNA, or as the number of antigen receptor-expressing, e.g., CAR-expressing, cells per microliter of the sample, e.g., of blood or serum, or per total number of peripheral blood mononuclear cells (PBMCs), white blood cells, or T cells per microliter of the sample. In some embodiments, the primers or probe used for qPCR or other nucleic acid-based methods are specific for binding, recognizing, and / or amplifying nucleic acids encoding the antigen receptor and / or other components or elements of the plasmid and / or vector, including regulatory elements, e.g., promoters, transcriptional, and / or post-transcriptional regulatory elements or response elements, or markers, e.g., surrogate markers. In some embodiments, the primers can be specific for regulatory elements, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). sf-605940722474-20028.40

[0274] In some embodiments, any of the phenotypes described herein, such as increased IL- 2 production, increased IFN-gamma production, increased IL-2 production and increased IFN- gamma production, increased IL-2, IFN-gamma and TNF-alpha production, increased proliferation or proliferation that is not increased, increased killing of target cells, and / or increased persistence, are observed after stimulation (e.g., T cell stimulation).

[0275] In some embodiments, the phenotype, such as any phenotype described herein, including increased T cell effector function, occurs 48 hours or more after the transient delivery of the epigenetic-modifying DNA-targeting system to the T cell. In some embodiments, the phenotype, such as increased T cell effector function, occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, or up to 71 days after the transient delivery of the epigenetic- modifying DNA-targeting system to the T cell.

[0276] In some aspects, the phenotype is one that is characterized by a cell surface phenotype of the cells. In some embodiments, the phenotype comprises expression of one or more cell-surface markers selected from IL-2+, TNFa+, IFNg+, and any combination thereof. In some embodiments, the phenotype is a phenotype in a T cell, such as a CD3+ T cell, which may be a CD4+ T cell or CD8+ T cell. Thus, in some embodiments, the phenotype comprises expression of one or more cell-surface markers selected from CD3+, CD4+, CD8+, IL-2+, TNFa+, IFNg+, and any combination thereof. In some aspects, the phenotype comprises expression of IL-2+. In some embodiments, the phenotype comprises expression of IL-2- and IFNg+.

[0277] It is understood that embodiments of the provided epigenetic-modifying DNA- targeting systems are not limited to modulating expression of target genes and promoting phenotypes in T cells, but may also be used to modulate any one or more of the target genes as described herein in any lymphoid cell. In addition to T cells, lymphoid cells can include NK cells, NKT cells, and any cells that have been differentiated from stem cells into such lymphoid cells and / or have been differentiated from progenitor cells, such as common lymphoid progenitors (CLPs). In some embodiments, the lymphoid cells are differentiated from stem cells, such as hematopoietic stem or progenitor cells, or progenitor cells. In some embodiments, the lymphoid cells are trans-differentiated from a non-pluripotent cell of non-hematopoietic lineage.

[0278] In some embodiments, the lymphoid cell for modulation is an isolated or enriched population of lymphoid immune cells, such as a population isolated or enriched in T, NK, and / or sf-605940722474-20028.40 NKT cells. In some embodiments, the cells for modulation are isolated or enriched T cells. In some embodiments, the cells for modulation are isolated or enriched NK cells. In some embodiments, the cells for modulation are isolated or enriched NK T cells.

[0279] In some embodiments, isolated or enriched populations or subpopulations of immune cells comprising T, NK, and / or NKT cells for modulation can be obtained from a unit of blood using any number of techniques known to the skilled artisan, such as Ficoll™ separation. In one embodiment, T, NK, or NKT cells from the circulating blood of an individual are obtained by apheresis and separated from other nucleated white blood cells, red blood cells, and platelets, such as by Ficoll™ separation or affinity-based selection. In some embodiments, the cells are primary cells. In some embodiments, the primary cells are isolated or enriched from a peripheral blood sample from a subject, such as a human subject.

[0280] In some embodiments, the lymphoid cells for modulation are differentiated in vitro from a stem cell or progenitor cell. In some embodiments, the lymphoid cells, such as T, NK, or NKT cells or lineages thereof, can be differentiated from a stem cell, a hematopoietic stem or progenitor cell (HSC), or a progenitor cell. The progenitor cell can be a CD34+ hemogenic endothelium cell, a multipotent progenitor cell, a T cell progenitor, an NK cell progenitor, or an NKT cell progenitor. In some embodiments, the progenitor cells is a lymphoid progenitor cells, such as a common lymphoid progenitor cell, early thymic progenitor cells, pre-T cell progenitor cells, pre-NK progenitor cell, T progenitor cell, NK progenitor cell, or NKT progenitor cell. The stem cell can be a pluripotent stem cell, such as induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs). The iPSC is a non-naturally occurring reprogrammed pluripotent cell. Once the cells of a subject have been reprogrammed to a pluripotent state, the cells can then be programmed or differentiated to a desired cell type or subtypes, such as T, NK, or NKT cells.

[0281] In some embodiments, the iPSC is differentiated to a T, NK, or NKT cells by a multi- stage differentiation platform wherein cells from various stages of development can be induced to assume a hematopoietic phenotype, ranging from mesodermal stem cells to fully differentiated T, NK, or NKT cells (See e.g. U.S. Pat. No.10,626,372).

[0282] In some embodiments, the population or subpopulation of lymphoid cells is trans- differentiated in vitro from a non-pluripotent cell of non-hematopoietic fate to a hematopoietic lineage cell or from a non-pluripotent cell of a first hematopoietic cell type to a different hematopoietic cell type, which can be a T, NK, or NKT progenitor cell or a fully differentiated specific type of immune cell, such as an T, NK, or NKT cell (see, e.g., U.S. Pat. No.9,376,664 sf-605940722474-20028.40 and U.S. application Ser. No.15 / 072,769, the disclosure of which is incorporated herein in their entirety). In some embodiments, the non-pluripotent cell of non-hematopoietic fate is a somatic cell, such as a skin fibroblast, an adipose tissue-derived cell, and a human umbilical vein endothelial cell (HUVEC). Somatic cells useful for trans-differentiation may be immortalized somatic cells.

[0283] Various strategies are being pursued to induce pluripotency, or increase potency, in cells (Takahashi, K., and Yamanaka, S., Cell 126, 663-676 (2006); Takahashi et al., Cell 131, 861-872 (2007); Yu et al., Science 318, 1917-1920 (2007); Zhou et al., Cell Stem Cell 4, 381- 384 (2009); Kim et al., Cell Stem Cell 4, 472-476 (2009); Yamanaka et al., 2009; Saha, K., Jaenisch, R., Cell Stem Cell 5, 584-595 (2009)), and improve the efficiency of reprogramming (Shi et al., Cell Stem Cell 2, 525-528 (2008a); Shi et al., Cell Stem Cell 3, 568-574 (2008b); Huangfu et al., Nat Biotechnol 26, 795-797 (2008a); Huangfu et al., Nat Biotechnol 26, 1269- 1275 (2008b); Silva et al., Plos Bio 6, e253. Doi: 10.1371 / journal. Pbio.0060253 (2008); Lyssiotis et al., PNAS 106, 8912-8917 (2009); Ichida et al., Cell Stem Cell 5, 491-503 (2009); Maherali, N., Hochedlinger, K., Curr Biol 19, 1718-1723 (2009b); Esteban et al., Cell Stem Cell 6, 71-79 (2010); and Feng et al., Cell Stem Cell 4, 301-312 (2009)), the disclosures of which are hereby incorporated by reference in their entireties.

[0284] It is understood that a cell that is positive (+) for a particular cell surface marker is a cell that expresses the marker on its surface at a level that is detectable. Likewise, it is understood that a cell that is negative (-) for a particular cell surface marker is a cell that expresses the marker on its surface at a level that is not detectable. Antibodies and other binding entities can be used to detect expression levels of marker proteins to identify or detect a given cell surface marker. Suitable antibodies may include polyclonal, monoclonal, fragments (such as Fab fragments), single chain antibodies, and other forms of specific binding molecules. Antibody reagents for cell surface markers are readily known to a skilled artisan. A number of well-known methods for assessing expression level of surface markers or proteins may be used, such as detection by affinity-based methods, e.g., immunoaffinity-based methods, e.g., in the context of surface markers, such as by flow cytometry. In some embodiments, the label is a fluorophore, and the method for detection or identification of cell surface markers on cells (e.g., T cells) is by flow cytometry. In some embodiments, different labels are used for each of the different markers by multicolor flow cytometry. In some embodiments, surface expression can be determined by flow cytometry, for example by staining with an antibody that specifically sf-605940722474-20028.40 binds to the marker and detecting the binding of the antibody to the marker.

[0285] In some embodiments, a cell (e.g., T cell) is positive (pos or +) for a particular marker if there is detectable presence on or in the cell of a particular marker, which can be an intracellular marker or a surface marker. In some embodiments, surface expression is positive if staining by flow cytometry is detectable at a level substantially above the staining detected carrying out the same procedures with an isotype-matched control under otherwise identical conditions and / or at a level substantially similar to, or in some cases higher than, a cell known to be positive for the marker and / or at a level higher than that for a cell known to be negative for the marker.

[0286] In some embodiments, a cell (e.g. T cell) is negative (neg or -) for a particular marker if there is an absence of detectable presence on or in the cell of a particular marker, which can be an intracellular marker or a surface marker. In some embodiments, surface expression is negative if staining is not detectable by flow cytometry at a level substantially above the staining detected carrying out the same procedures with an isotype-matched control under otherwise identical conditions and / or at a level substantially lower than a cell known to be positive for the marker and / or at a level substantially similar to a cell known to be negative for the marker.

[0287] In some aspects, the phenotype can be characterized by one or more functions of the cells. In some aspects, the phenotype is characterized by polyfunctional activity of the T cells to produce more than one T cell stimulatory cytokine, such as determined in a polyfunctional cytokine secretion assay following stimulation of the T cells with a stimulatory agent. In some embodiments, the T cell is polyfunctional for producing two or more cytokines. In some embodiments, a T cell is polyfunctional for producing two or more cytokines selected from among interferon-gamma (IFN-gamma), interleukin 2 (IL-2), and TNF-alpha. In some embodiments, a polyfunctional T cell produces IFN-gamma, IL-2, and TNF-alpha. In some embodiments, the stimulatory agent is a non-specific or non-antigen-dependent T cell stimulatory agent. In some embodiments, the non-specific or non-antigen dependent T cell stimulatory agent is a polyclonal stimulatory agent. In some embodiments, the non-specific or non-antigen dependent stimulatory agent comprises PMA / ionomycin, anti-CD3 / anti-CD28, phytohemagglutinin (PHA), or concanavalin A (ConA). In some embodiments, the non-specific or non-antigen dependent T cell stimulatory agent contains PMA / ionomycin.

[0288] In particular embodiments, the production of one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining. Intracellular cytokine staining sf-605940722474-20028.40 (ICS) by flow cytometry is a technique well-suited for studying cytokine production at the single-cell level. It detects the production and accumulation of cytokines within the endoplasmic reticulum after cell stimulation, allowing for the identification of cell populations that are positive or negative for production of a particular cytokine or for the separation of high producing and low producing cells based on a threshold. In some embodiments, the stimulation can be performed using nonspecific stimulation, e.g., is not an antigen-specific stimulation. For example, PMA / ionomycin can be used for nonspecific cell stimulation. ICS can also be used in combination with other flow cytometry protocols for immunephenotyping using cell surface markers or with MHC multimers to access cytokine production in a particular subgroup of cells, making it an extremely flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include ELISPOT, limiting dilution, and T cell cloning. In some embodiments, the assays to assay polyfunctional cytokine secretion of multiple cytokines can include multiplexed assays or other assays to assess polyfunctionality (see, e.g., Xue et al., (2017) Journal for ImmunoTherapy of Cancer 5:85). 2. Genes and Target Sites for Increasing Transcription

[0289] In some embodiments, the target genes include one or more first genes for which transcription is to be increased. In some embodiments, the target genes include a single first gene. In some embodiments, the target genes include a plurality of first genes, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 first genes for which transcription is increased.

[0290] In some embodiments, the one or more first genes are T cell activator genes. In some embodiments, the one or more first genes are positive regulators of T cell function. In some embodiments, the one or more first genes are selected from BATF, CD28, EOMES, IL-2, IL2RB , IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the one or more first genes is or compise IL-2.

[0291] In some embodiments, the DNA-targeting system comprises a plurality of first DNA- targeting modules. In some embodiments, each first DNA-targeting module targets a target site. In some embodiments, the plurality of first DNA-targeting modules target a plurality of first genes, wherein the plurality of first genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the plurality of first DNA-targeting modules target 2 or 3 genes selected from the sf-605940722474-20028.40 group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0292] In some embodiments, the DNA-targeting system targets a combination of first genes set forth in Table 1. In some embodiments, the plurality of first DNA-targeting modules target a combination of first genes set forth in Table 1. In some embodiments, transcription of each of the first genes of the combination is increased by the DNA-targeting system. Table 1. Combinations of first genes targeted by a multiplexed epigenetic-modifying DNA- targeting system for increasing transcription of first genessf-605940722474-20028.40

[0293] In some embodiments, the DNA-targeting system targets a target site for BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and / or VAV1. In some embodiments, the target site comprises a sequence selected from any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 451-453 or a contiguous portion thereof of at least 14 nucleotides, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a sf-605940722474-20028.40 contiguous portion of any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 451-453 that is 15, 16, 17, 18 or 19 nucleotides in length, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a contiguous portion of a target site sequence described herein above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 451-453. In some embodiments, the target site comprises a sequence selected from any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, and 184-191, or a contiguous portion thereof of at least 14 nucleotides, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, and 184-191 that is 15, 16, 17, 18 or 19 nucleotides in length, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a contiguous portion of a target site sequence described herein above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, and 184-191. In some embodiments, the target site is a sequence set forth in Table 5.

[0294] In some embodiments, the DNA-targeting system targets a combination of first genes, such as any combination shown in Table 1. In some embodiments, the DNA-targeting system targets a combination of first genes selected from: BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; and VAV1 and IL-2.

[0295] In some embodiments, the DNA-targeting system targets IL-2 and VAV1. In some embodiments, the DNA-targeting system targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78, and a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170.

[0296] In some embodiments, the DNA-targeting system targets IL2RB and VAV1.

[0297] In some embodiments, the DNA-targeting system targets a combination of target sites for a combination of first genes for transcriptional activation, as shown in Table 2. Table 2. First gene and target site combinations for transcriptional activation sf-605940722474-20028.40sf-605940722474-20028.40

[0298] In some embodiments, the DNA-targeting system targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172, and a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the DNA-targeting system targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172, and a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the DNA- targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the DNA-targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for EOMES comprising the sequence set forth in SEQ ID NO:149. In some embodiments, the DNA-targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the DNA-targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151. In some sf-605940722474-20028.40 embodiments, the DNA-targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the DNA-targeting system targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the DNA-targeting system targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the DNA-targeting system targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151. In some embodiments, the DNA-targeting system targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the DNA-targeting system targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the DNA-targeting system targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the DNA-targeting system targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the DNA-targeting system targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the DNA-targeting system targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the DNA-targeting system targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the DNA-targeting system targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the DNA-targeting system targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the DNA-targeting system targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and a target site for VAV1 comprising the sf-605940722474-20028.40 sequence set forth in SEQ ID NO:170. In some embodiments, the DNA-targeting system targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170, and a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78.

[0299] In some embodiments, delivery of the DNA-targeting system increases expression (e.g. transcription) of one or more first genes. In some embodiments, the increase in gene expression in a cell (e.g. T cell) is about a log2 fold change of greater than 1.0. For instance, the log2 fold change is greater than at or about 1.5, at or about 2.0, at or about 2.5, at or about 3.0, at or about 4.0, at or about 5.0, at or about 6.0, at or about 7.0, at or about 8.0, at or about 9.0, at or about 10.0, or any value between any of the foregoing compared to the level of the first gene in a control cell. 3. Genes and Target Sites for Decreasing Transcription

[0300] In some embodiments, the target genes include one or more second genes for which transcription is to be repressed. In some embodiments, the target genes include a single second gene. In some embodiments, the target genes include a plurality of second genes, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 first genes for which transcription is repressed.

[0301] In some embodiments, the one or more second genes are T cell repressor genes. In some embodiments, the one or more second genes are negative regulators of T cell function. In some embodiments, the one or more second genes are selected from CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the one or more second genes is or compise MED12.

[0302] In some embodiments, the DNA-targeting system comprises a plurality of second DNA-targeting modules. In some embodiments, each second DNA-targeting module targets a target site. In some embodiments, the plurality of second DNA-targeting modules target a plurality of second genes, wherein the plurality of second genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the plurality of second DNA-targeting modules target 2 or 3 genes selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0303] In some embodiments, the DNA-targeting system targets a combination of second genes set forth in Table 3. In some embodiments, the plurality of second DNA-targeting sf-605940722474-20028.40 modules target a combination of second genes set forth in Table 3. In some embodiments, transcription of each of the second genes of the combination is repressed by the DNA-targeting system. Table 3. Combinations of second genes targeted by a multiplexed epigenetic-modifying DNA-targeting system for decreasing transcription of second genessf-605940722474-20028.40sf-605940722474-20028.40sf-605940722474-20028.40sf-605940722474-20028.40sf-605940722474-20028.40

[0304] In some embodiments, the DNA-targeting system targets a target site for CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and / or RASA2. In some embodiments, the target site comprises a sequence selected from any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, 306- 308, and 454-457 or a contiguous portion thereof of at least 14 nucleotides, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, 306-308, and 454-457 that is 15, 16, 17, 18 or 19 nucleotides in length, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a contiguous portion of a target site sequence described herein above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOS:1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, 306-308, and 454-457. In some embodiments, the target site comprises a sequence selected from any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308, or a contiguous portion thereof of at least 14 nucleotides, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:1-6, 10-33, 80- sf-605940722474-20028.40 90, 102-112, 200-211, 292-295, 300-302, and 306-308 that is 15, 16, 17, 18 or 19 nucleotides in length, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a contiguous portion of a target site sequence described herein above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOS:1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308. In some embodiments, the target site is a sequence set forth in Table 6.

[0305] In some embodiments, the DNA-targeting system targets a combination of second genes, such as any combination shown in Table 3. In some embodiments, the DNA-targeting system targets a combination of second genes selected from: CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; MED12 and TGFBR2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH, and MYB; GATA3, CBLB, and MYB; GATA3, CD5, and MYB; and PRDM1, GATA3, and CISH.

[0306] In some embodiments, the DNA-targeting system targets CBLB and MYB. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18.

[0307] In some embodiments, the DNA-targeting system targets CBLB and MED12. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for MED12 comprising the sequence set forth in SEQ ID NO:81.

[0308] In some embodiments, the DNA-targeting system targets CBLB and CCNC. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for CCNC comprising the sequence set forth in SEQ ID NO:104. sf-605940722474-20028.40

[0309] In some embodiments, the DNA-targeting system targets MED12 and TGFBR2. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for TGFBR2 comprising the sequence set forth in SEQ ID NO:301.

[0310] In some embodiments, the DNA-targeting system targets MED12, TGFBR2 and CISH. In some embodiments, the DNA-targeting system targets a target site for MED12 compirsing the sequence set forth in SEQ ID NO:81, a target site for TGFBR2 comprising the sequence set forth in SEQ ID NO:301, and a target site for CISH comprising the sequence set forth in SEQ ID NO:28 or 30.

[0311] In some embodiments, the DNA-targeting system targets a combination of target sites for a combination of second genes for transcriptional repression, as shown in Table 4. Table 4. Second gene and target site combinations for transcriptional repressionsf-605940722474-20028.40sf-605940722474-20028.40sf-605940722474-20028.40

[0312] In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for CCNC comprising the sequence set forth in SEQ ID NO:104. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for CD5 comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the DNA- targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for ELOB comprising the sequence set forth in SEQ ID NO:24. In some embodiments, the DNA-targeting system targets a sf-605940722474-20028.40 target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for FAS comprising the sequence set forth in SEQ ID NO:204. In some embodiments, the DNA- targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for Fli1 comprising the sequence set forth in SEQ ID NO:208. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for KDM1A comprising the sequence set forth in SEQ ID NO:4. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for MED12 comprising the sequence set forth in SEQ ID NO:81. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the DNA-targeting system targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the DNA-targeting system targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the DNA-targeting system targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the DNA-targeting system targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the DNA-targeting system targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and a target site for CD5 comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the DNA-targeting system targets a target site for sf-605940722474-20028.40 GATA3 comprising the sequence set forth in SEQ ID NO:26, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the DNA-targeting system targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for CBLB comprising the sequence set forth in SEQ ID NO:11. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for CD5 comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for ELOB comprising the sequence set forth in SEQ ID NO:24. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and a target site for TGFBR2 comprising the sequence set forth in SEQ ID NO:301. In some embodiments, the DNA-targeting system targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18, and a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the DNA-targeting system targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some sf-605940722474-20028.40 embodiments, the DNA-targeting system targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32, and a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26. In some embodiments, the DNA-targeting system targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32, and a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the DNA-targeting system targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, and a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the DNA-targeting system targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32, a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the DNA-targeting system targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, a target site for TGFBR2 comprising the sequence set forth in SEQ ID NO:301, and a target site for CISH comprising the sequence set forth in SEQ ID NO: 28 or 30.

[0313] In some embodiments, delivery of the DNA-targeting system reduces (e.g., decreases or represses) transcription of one or more second genes. In some embodiments, the reduction in gene expression in a cell (e.g., T cell) is about a log2 fold change of less than -1.0. For instance, the log2 fold change is less than at or about -1.5, at or about -2.0, at or about -2.5, at or about - 3.0, at or about -4.0, at or about -5.0, at or about -6.0, at or about -7.0, at or about -8.0, at or about -9.0, at or about -10.0, or any value between any of the foregoing compared to the level of the second gene in a control cell. sf-605940722474-20028.40 B. CRISPR / Cas-Based DNA-Targeting Systems and DNA-Binding Domains

[0314] Provided herein are multiplexed epigenetic-targeting DNA-targeting systems based on CRISPR / Cas systems, i.e., CRISPR / Cas-based DNA-targeting systems, that are able to bind to a target site for each of multiple target genes. In some embodiments, the CRISPR / Cas DNA- binding domain is nuclease inactive, such as includes a dCas (e.g., dCas9) so that the system binds to the target site for a target gene without mediating nucleic acid cleavage at the target site. The CRISPR / Cas-based DNA-targeting systems may be used to modulate expression of target genes in a cell, such as a T cell. In some embodiments, the CRISPR / Cas-based DNA- targeting system can include any known Cas enzyme, and generally a nuclease-inactive or dCas. In some embodiments, the dCas protein is any suitable dCas protein. In some embodiments, the dCas protein is a dCas9 protein, such dSpCas9 or dSaCas9. In some embodiments, the CRISPR / Cas-based DNA-targeting system includes a fusion protein of a nuclease-inactive Cas protein and an effector domain, and at least one gRNA. In some embodiments, the effector domain increases transcription of the one or more first genes (e.g., the effector domain is a transcriptional activator domain). In some embodiments, the effector domain reduces transcription of the one or more second genes (e.g., the effector domain is a transcriptional repressor domain).

[0315] In some embodments, the DNA-targeting system comprises at least one first DNA- targeting module for increasing transcription of the one or more first genes and at least one second DNA-targeting module for repressing transcription of the one or more second genes. In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises (a) a first fusion protein comprising (i) a first Cas protein and (ii) at least one transcriptional activator domain and (b) a first gRNA for targeting the first Cas protein domain to a target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-targeting modules comprises (a) a second fusion protein comprising (i) a second Cas protein and (ii) at least one transcriptional repressor domain and (b) a second gRNA for targeting the second Cas protein domain to a target site of one of the one or more second genes.

[0316] In some embodiments, the first Cas protein is the same across the at least one first DNA-targeting module. In some embodiments, the first Cas protein is different across the at least one first DNA-targeting module. In some embodiments, the first gRNA is the same across the at least one first DNA-targeting module. In some embodiments, the first gRNA is different across the at least one first DNA-targeting module. sf-605940722474-20028.40

[0317] In some embodiments, the second Cas protein is the same across the at least one second DNA-targeting module. In some embodiments, the second Cas protein is different across the at least one second DNA-targeting module. In some embodiments, the second gRNA is the same across the at least one second DNA-targeting module. In some embodiments, the second gRNA is different across the at least one second DNA-targeting module.

[0318] In some embodiments, the first Cas protein or proteins are all different from the second Cas protein or proteins. In some embodiments, the first Cas protein or proteins do not bind to the second gRNA or gRNAs, and the second Cas protein or proteins do not bind to the first gRNA or gRNAs. In some embodiments, the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins. In some embodiments, the first Cas protein or proteins do not bind to the protospacer-adjacent motifs (PAMs) that the second Cas protein or proteins bind to.

[0319] In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises (a) a first fusion protein comprising (i) a dSpCas9 protein and (ii) at least one transcriptional activator domain and (b) a dSpCas9 gRNA for targeting the dSpCas9 Cas protein to a target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-targeting modules comprises (a) a second fusion protein comprising (i) a dSaCas9 protein and (ii) at least one transcriptional repressor domain and (b) a dSaCas9 gRNA for targeting the dSaCas9 Cas protein to a target site of one of the one or more second genes.

[0320] In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises (a) a first fusion protein comprising (i) a dSaCas9 protein and (ii) at least one transcriptional activator domain and (b) a dSaCas9 gRNA for targeting the dSaCas9 Cas protein to a target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-targeting modules comprises (a) a second fusion protein comprising (i) a dSpCas9 protein and (ii) at least one transcriptional repressor domain and (b) a dSpCas9 gRNA for targeting the dSpCas9 Cas protein to a target site of one of the one or more second genes.

[0321] In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises (a) a first fusion protein comprising (i) a first Cas protein that binds to a first PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide, and (ii) at least one transcriptional activator domain and (b) a first gRNA for targeting the first Cas protein to a sf-605940722474-20028.40 target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-targeting modules comprises (a) a second fusion protein comprising (i) a second Cas protein that binds to a second PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A, and (ii) at least one transcriptional repressor domain and (b) a second gRNA for targeting the second Cas protein to a target site of one of the one or more second genes. In some embodiments, the first Cas protein does not bind to the second PAM, and the second Cas protein does not bind to the first PAM.

[0322] In some embodiments, at least one, optionally each, of the first DNA-targeting modules comprises (a) a first fusion protein comprising (i) a first Cas protein that binds to a first PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A, and (ii) at least one transcriptional activator domain and (b) a first gRNA for targeting the first Cas protein to a target site of one of the one or more first genes. In some embodiments, at least one, optionally each, of the second DNA-targeting modules comprises (a) a second fusion protein comprising (i) a second Cas protein that binds to a second PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide, and (ii) at least one transcriptional repressor domain and (b) a second gRNA for targeting the second Cas protein to a target site of one of the one or more second genes. In some embodiments, the first Cas protein does not bind to the second PAM, and the second Cas protein does not bind to the first PAM.

[0323] The CRISPR system (also known as CRISPR / Cas system, or CRISPR-Cas system) refers to a conserved microbial nuclease system, found in the genomes of bacteria and archaea, that provides a form of acquired immunity against invading phages and plasmids. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) refers to loci containing multiple repeating DNA elements that are separated by non-repeating DNA sequences called spacers. Spacers are short sequences of foreign DNA that are incorporated into the genome between CRISPR repeats, serving as a “memory” of past exposures. Spacers encode the DNA-targeting portion of RNA molecules that confer specificity for nucleic acid cleavage by the CRISPR system. CRISPR loci contain or are adjacent to one or more CRISPR-associated (Cas) genes, which can act as RNA-guided nucleases for mediating the cleavage, as well as non-protein coding DNA elements that encode RNA molecules capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage.

[0324] In Type II CRISPR / Cas systems with the Cas protein Cas9, two RNA molecules and the Cas9 protein form a ribonucleoprotein (RNP) complex to direct Cas9 nuclease activity. The sf-605940722474-20028.40 CRISPR RNA (crRNA) contains a spacer sequence that is complementary to a target nucleic acid sequence (target site) and that encodes the sequence specificity of the complex. The trans- activating crRNA (tracrRNA) base-pairs to a portion of the crRNA and forms a structure that complexes with the Cas9 protein, forming a Cas / RNA RNP complex.

[0325] Naturally occurring CRISPR / Cas systems, such as those with Cas9, have been engineered to allow efficient programming of Cas / RNA RNPs to target desired sequences in cells of interest, both for gene-editing and modulation of gene expression. The tracrRNA and crRNA have been engineered to form a single chimeric guide RNA molecule, commonly referred to as a guide RNA (gRNA), for example as described in WO 2013 / 176772, WO 2014 / 093661, WO 2014 / 093655, Jinek, M. et al. Science 337(6096):816-21 (2012), or Cong, L. et al. Science 339(6121):819-23 (2013). The spacer sequence of the gRNA can be chosen by a user to target the Cas / gRNA RNP complex to a desired locus, e.g. a desired target site in the target gene.

[0326] Cas proteins have also been engineered to be catalytically inactivated or nuclease inactive to allow targeting of Cas / gRNA RNPs without inducing cleavage at the target site. Mutations in Cas proteins can reduce or abolish nuclease activity of the Cas protein, rendering the Cas protein catalytically inactive. Cas proteins with reduced or abolished nuclease activity are referred to as deactivated Cas (dCas), or nuclease-inactive Cas (iCas) proteins, as referred to interchangeably herein. An exemplary deactivated Cas9 (dCas9) derived from S. pyogenes contains silencing mutations of the RuvC and HNH nuclease domains (D10A and H840A), for example as described in WO 2013 / 176772, WO 2014 / 093661, Jinek, M. et al. Science 337(6096):816-21 (2012), and Qi, L. et al. Cell 152(5):1173-83 (2013). Exemplary dCas variants derived from the Cas12 system (i.e. Cpf1) are described, for example in WO 2017 / 189308 and Zetsche, B. et al. Cell 163(3):759-71 (2015). Conserved domains that mediate nucleic acid cleavage, such as RuvC and HNH endonuclease domains, are readily identifiable in Cas orthologues, and can be mutated to produce inactive variants, for example as described in Zetsche, B. et al. Cell 163(3):759-71 (2015).

[0327] dCas-fusion proteins with transcriptional and / or epigenetic regulators have been used as a versatile platform for ectopically regulating gene expression in target cells. These include fusion of a Cas with an effector domain, such as a transcriptional activator or transcriptional repressor. For example, fusing dCas9 with a transcriptional activator such as VP64 (a polypeptide composed of four tandem copies of VP16, a 16 amino acid transactivation domain sf-605940722474-20028.40 of the Herpes simplex virus) can result in robust induction of gene expression. Alternatively, fusing dCas9 with a transcriptional repressor such as KRAB (Krüppel associated box) can result in robust repression of gene expression. A variety of dCas-fusion proteins with effector domains can be engineered for regulation of gene expression, for example as described in WO 2014 / 197748, WO 2016 / 130600, WO 2017 / 180915, WO 2021 / 226555, WO 2013 / 176772, WO 2014 / 152432, WO 2014 / 093661, WO 2021 / 247570, Adli, M. Nat. Commun.9, 1911 (2018), Perez-Pinera, P. et al. Nat. Methods 10, 973–976 (2013), Mali, P. et al. Nat. Biotechnol.31, 833–838 (2013), Maeder, M. L. et al. Nat. Methods 10, 977–979 (2013), Gilbert, L. A. et al. Cell 154(2):442-451 (2013), and Nuñez, J.K. et al. Cell 184(9):2503-2519 (2021). 1. CRISPR / Cas-Based DNA-Binding Domains

[0328] In some aspects, the first and / or second DNA-binding domain comprises a CRISPR- associated (Cas) protein. In particular embodiments here, the Cas protein is nuclease-inactive (i.e., is a dCas protein).

[0329] In some embodiments, the Cas protein is derived from a Class 1 CRISPR system (i.e., multiple Cas protein system), such as a Type I, Type III, or Type IV CRISPR system. In some embodiments, the Cas protein is derived from a Class 2 CRISPR system (i.e., single Cas protein system), such as a Type II, Type V, or Type VI CRISPR system. In some embodiments, the Cas protein is from a Type V CRISPR system. In some embodiments, the Cas protein is a Cas12 protein (i.e., Cpf1), for example as described in WO 2017 / 189308 and Zetsche, B. et al. Cell.163(3):759-71 (2015). In some embodiments, the Cas protein is derived from a Type II CRISPR system. In some embodiments, the Cas protein is a Cas9 protein, for example as described in WO 2013 / 176772, WO 2014 / 152432, WO 2014 / 093661, WO 2014 / 093655, Jinek, M. et al. Science 337(6096):816-21 (2012), Mali, P. et al. Science 339(6121):823-6 (2013), Cong, L. et al. Science 339(6121):819-23 (2013), Perez-Pinera, P. et al. Nat. Methods 10, 973– 976 (2013), or Mali, P. et al. Nat. Biotechnol.31, 833–838 (2013). Various CRISPR / Cas systems and associated Cas proteins for use in gene editing and regulation have been described, for example in Moon, S.B. et al. Exp. Mol. Med.51, 1–11 (2019), Zhang, F. Q. Rev. Biophys. 52, E6 (2019), and Makarova K.S. et al. Methods Mol. Biol.1311:47-75 (2015).

[0330] In some embodiments, the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule. In some embodiments, the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule of S. pyogenes, S. thermophilus, S. aureus, C. jejuni, N. meningitidis, F. novicida, S. canis, or S. auricularis. In some embodiments, sf-605940722474-20028.40 the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule of S. aureus. In some embodiments, the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule of S. pyogenes.

[0331] Non-limiting examples of Cas9 orthologs from other bacterial strains include Cas proteins identified in Acaryochloris marina MBIC11017; Acetohalobium arabaticum DSM 5501; Acidithiobacillus caldus; Acidithiobacillus ferrooxidans ATCC 23270; Alicyclobacillus acidocaldarius LAA1; Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446; Allochromatium vinosum DSM 180; Ammonifex degensii KC4; Anabaena variabilis ATCC 29413; Arthrospira maxima CS-328; Arthrospira platensis str. Paraca; Arthrospira sp. PCC 8005; Bacillus pseudomycoides DSM 12442; Bacillus selenitireducens MLS10; Burkholderiales bacterium 1_1_47; Caldicelulosiruptor becscii DSM 6725; Candidatus Desulforudis audaxviator MP104C; Caldicellulosiruptor hydrothermalis 108; Clostridium phage c-st; Clostridium botulinum A3 str. Loch Maree; Clostridium botulinum Ba4 str.657; Clostridium difficile QCD- 63q42; Crocosphaera watsonii WH 8501; Cyanothece sp. ATCC 51142; Cyanothece sp. CCY0110; Cyanothece sp. PCC 7424; Cyanothece sp. PCC 7822; Exiguobacterium sibiricum 255-15; Finegoldia magna ATCC 29328; Ktedonobacter racemifer DSM 44963; Lactobacillus delbrueckii subsp. bulgaricus PB2003 / 044-T3-4; Lactobacillus salivarius ATCC 11741; Listeria innocua; Lyngbya sp. PCC 8106; Marinobacter sp. ELB17; Methanohalobium evestigatum Z- 7303; Microcystis phage Ma-LMM01; Microcystis aeruginosa NIES-843; Microscilla marina ATCC 23134; Microcoleus chthonoplastes PCC 7420; Neisseria meningitidis; Nitrosococcus halophilus Nc4; Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111; Nodularia spumigena CCY9414; Nostoc sp. PCC 7120; Oscillatoria sp. PCC 6506; Pelotomaculum_thermopropionicum SI; Petrotoga mobilis SJ95; Polaromonas naphthalenivorans CJ2; Polaromonas sp. JS666; Pseudoalteromonas haloplanktis TAC125; Streptomyces pristinaespiralis ATCC 25486; Streptomyces pristinaespiralis ATCC 25486; Streptococcus thermophilus; Streptomyces viridochromogenes DSM 40736; Streptosporangium roseum DSM 43021; Synechococcus sp. PCC 7335; and Thermosipho africanus TCF52B (Chylinski et al., RNA Biol., 2013; 10(5): 726-737).

[0332] In some aspects, the Cas protein is a variant that lacks nuclease activity (i.e., is a dCas protein). In some embodiments, the Cas protein is mutated so that nuclease activity is reduced or eliminated. Such Cas proteins are referred to as deactivated Cas or dead Cas (dCas) or nuclease-inactive Cas (iCas) proteins, as referred to interchangeably herein. In some sf-605940722474-20028.40 embodiments, the variant Cas protein is a variant Cas9 protein that lacks nuclease activity or that is a deactivated Cas9 (dCas9 or iCas9) protein.

[0333] In some embodiments, the Cas9 protein is derived from a Staphylococcus aureus Cas9 (SaCas9) protein or a variant thereof. In some embodiments, the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) that comprises at least one amino acid mutation selected from D10A and N580A, with reference to numbering of positions of SEQ ID NO:124. In some embodiments, the variant Cas9 protein comprises the sequence set forth in SEQ ID NO:125, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0334] In some embodiments, the Cas9 protein is derived from a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof. In some embodiments, the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein that comprises at least one amino acid mutation selected from D10A and H840A, with reference to numbering of positions of SEQ ID NO:126. In some embodiments, the variant Cas9 protein comprises the sequence set forth in SEQ ID NO:127, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 2. Guide RNAs (gRNAs)

[0335] In some embodiments, the Cas protein (e.g., dCas9) is provided in combination or as a complex with one or more guide RNA (gRNA). In some aspects, the gRNA is a nucleic acid that promotes the specific targeting or homing of the gRNA / Cas RNP complex to the target site of a target gene. In some embodiments, a target site of a gRNA may be referred to as a protospacer.

[0336] In some embodiments, the gRNA is capable of complexing with the Cas protein. In some embodiments, the gRNA comprises a gRNA spacer sequence (i.e., a spacer sequence or a guide sequence) that is capable of hybridizing to the target site, or that is complementary to the target site. In some embodiments, the gRNA comprises a scaffold sequence that complexes with or binds to the Cas protein.

[0337] In some embodiments, the gRNA is a chimeric gRNA. In general, gRNAs can be unimolecular (i.e., composed of a single RNA molecule), or modular (comprising more than one, and typically two, separate RNA molecules). Modular gRNAs can be engineered to be unimolecular, wherein sequences from the separate modular RNA molecules are comprised in a single gRNA molecule, sometimes referred to as a chimeric gRNA, synthetic gRNA, or single sf-605940722474-20028.40 gRNA. In some embodiments, the chimeric gRNA is a fusion of two non-coding RNA sequences: a crRNA sequence and a tracrRNA sequence, for example as described in WO 2013 / 176772, or Jinek, M. et al. Science 337(6096):816-21 (2012). In some embodiments, the chimeric gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the Type II Effector system, wherein the naturally occurring crRNA:tracrRNA duplex acts as a guide for the Cas9 protein.

[0338] In some aspects, the spacer sequence of a gRNA is a polynucleotide sequence comprising at least a portion that has sufficient complementarity with the target site to hybridize with the target site in the target gene and direct sequence-specific binding of a Cas / gRNA complex to the sequence of the target site. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization. In some embodiments, the gRNA comprises a spacer sequence that is complementary, e.g., at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% (e.g., fully complementary), to the target site. The strand of the target nucleic acid comprising the target site sequence may be referred to as the “complementary strand” of the target nucleic acid.

[0339] In some aspects, a gRNA targets a target site in double-stranded DNA. Thus, in some aspects, the sequence of the target site may be defined by the sequence that the gRNA spacer hybridizes to, or by the sequence complementary to the sequence that the gRNA spacer hybridizes to. In some aspects, the sequence of the target site may be defined by the sequence that the gRNA spacer displaces in order to hybridize to the DNA. In some embodiments, the sequence of the target site is the sequence that the gRNA hybridizes to.

[0340] In some embodiments, the gRNA spacer sequence is between about 14 nucleotides (nt) and about 26 nt, or between 16 nt and 22 nt in length. In some embodiments, the gRNA spacer sequence is 14 nt, 15 nt, 16 nt, 17 nt,18 nt, 19 nt, 20 nt, 21 nt or 22 nt, 23 nt, 24 nt, 25 nt, or 26 nt in length. In some embodiments, the gRNA spacer sequence is 18 nt, 19 nt, 20 nt, 21 nt or 22 nt in length. In some embodiments, the gRNA spacer sequence is 20 nt in length.

[0341] A target site of a gRNA may be referred to as a protospacer. In some aspects, the spacer is designed to target a protospacer with a specific protospacer-adjacent motif (PAM), i.e., a sequence immediately adjacent to the protospacer that contributes to and / or is required for Cas binding specificity. Different CRISPR / Cas systems have different PAM requirements for targeting. For example, in some embodiments, S. pyogenes Cas9 uses the PAM 5’-NGG-3’ (SEQ ID NO: 224), where N is any nucleotide. In some embodiments, S. aureus Cas9 uses the sf-605940722474-20028.40 PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), where N is any nucleotide, and R is G or A. In some embodiments, N. meningitidis Cas9 uses the PAM 5′-NNNNGATT-3’ (SEQ ID NO: 226), where N is any nucleotide. In some embodiments, C. jejuni Cas9 uses the PAM 5′- NNNNRYAC-3′ (SEQ ID NO: 227), where N is any nucleotide, R is G or A, and Y is C or T. In some embodiments, S. thermophilus uses the PAM 5’-NNAGAAW-3’ (SEQ ID NO: 228), where N is any nucleotide and W is A or T. In some embodiments, F. Novicida Cas9 uses the PAM 5’-NGG-3’ (SEQ ID NO: 224), where N is any nucleotide. In some embodiments, T. denticola Cas9 uses the PAM 5’-NAAAAC-3’ (SEQ ID NO: 229), where N is any nucleotide. In some embodiments, Cas12a (also known as Cpf1) from various species, uses the PAM 5’- TTTV-3’ (SEQ ID NO: 230). In some embodiments, Cas proteins may use or be engineered to use different PAMs from those listed above. For example, mutated SpCas9 proteins may use the PAMs 5’-NGG-3’ (SEQ ID NO: 224), 5’-NGAN-3’ (SEQ ID NO: 231), 5’-NGNG-3’ (SEQ ID NO: 232), 5’-NGAG-3’ (SEQ ID NO: 233), or 5’-NGCG-3’ (SEQ ID NO: 234). In some embodiments, the protospacer-adjacent motif (PAM) of a gRNA for complexing with S. pyogenes Cas9 is NGG, as set forth in SEQ ID NO: 224. In some embodiments, the PAM of a gRNA for complexing with S. aureus Cas9 is NNGRRT, as set forth in SEQ ID NO: 225.

[0342] A spacer sequence may be selected to reduce the degree of secondary structure within the spacer sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm.

[0343] In some embodiments, the gRNA (including the guide sequence) will comprise the base uracil (U), whereas DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, in some embodiments, it is believed that the complementarity of the guide sequence with the target sequence contributes to specificity of the interaction of the gRNA molecule / Cas molecule complex with a target nucleic acid. It is understood that in a guide sequence and target sequence pair, the uracil bases in the guide sequence will pair with the adenine bases in the target sequence.

[0344] In some embodiments, one, more than one, or all of the nucleotides of a gRNA can have a modification, e.g., to render the gRNA less susceptible to degradation and / or improve bio-compatibility. By way of non-limiting example, the backbone of the gRNA can be modified with a phosphorothioate, or other modification(s). In some cases, a nucleotide of the gRNA can comprise a 2’ modification, e.g., a 2-acetylation, e.g., a 2’ methylation, or other modification(s).

[0345] In some embodiments, the gRNA further comprises a scaffold sequence. In some sf-605940722474-20028.40 aspects, the scaffold sequence (in some cases including a crRNA sequence and / or a tracrRNA sequence) will be different depending on the Cas protein. In some aspects, different CRISPR / Cas systems have different gRNA scaffold sequences for associating with Cas protein.

[0346] In some embodiments, the scaffold sequence is an SpCas9 scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO:69 (GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC), or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a portion thereof. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 69.

[0347] In some embodiments, the scaffold sequence is an SaCas9 scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO:387 (GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUU AUCUCGUCAACUUGUUGGCGAGA), or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a portion thereof. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 387.

[0348] In some embodiments, the scaffold sequence is an Acidaminococcus sp. Cas12a scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:443, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:443. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 443.

[0349] In some embodiments, the scaffold sequence is a CasPhi-2 scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:444, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:444. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 444.

[0350] In some embodiments, the scaffold sequence is a Un1Cas12f1 scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:445, a sequence “GGAAUGAAC” as set forth in SEQ ID NO:446, or a sequence “UUUUAUUUU” as set forth in SEQ ID NO:447, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID sf-605940722474-20028.40 NO:445, 446, or 447. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:445, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:445. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 445. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:446, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:446. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 446. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:447, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:447. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 447.

[0351] In some embodiments, the scaffold sequence is a C. jejuni Cas9 scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:448, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:448. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 448.

[0352] In some embodiments, the scaffold sequence is a Cas12k scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:449, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:449. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 449.

[0353] In some embodiments, the scaffold sequence is a CasMini scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence set forth in SEQ ID NO:450, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:450. In some embodiments, the scaffold sequence is set forth in SEQ ID NO: 450.

[0354] Methods for designing gRNAs and exemplary targeting domains can include those described in, e.g., International PCT Pub. Nos. WO 2014 / 197748, WO 2016 / 130600, WO 2017 / 180915, WO 2021 / 226555, WO 2013 / 176772, WO 2014 / 152432, WO 2014 / 093661, WO 2014 / 093655, WO 2015 / 089427, WO 2016 / 049258, WO 2016 / 123578, WO 2021 / 076744, WO 2014 / 191128, WO 2015 / 161276, WO 2017 / 193107, and WO 2017 / 093969. sf-605940722474-20028.40 a. gRNAs for Transcriptional Activation

[0355] In some embodiments, a first gRNA targets a target site for a first gene for transcriptional activation. In some embodiments, the first gRNA targets a target site for a first gene, such as a first gene in a T cell, wherein the first gene is selected from BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the first gRNA targets IL-2.

[0356] In some embodiments, the first gRNA is a Cas9 gRNA. In some embodiments, the first gRNA is a Cas12 gRNA.

[0357] In some embodiments, the first gRNA is an SpCas9 gRNA. In some embodiments, the first gRNA is an SaCas9 gRNA.

[0358] In some embodiments, the first gRNA targets a target site that comprises a sequence selected from any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 388-412 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 388-412 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is set forth in any one of SEQ ID NOS: 7-9, 78, 144-156, 170, 172-177, 184-191, and 388-412.

[0359] In some embodiments, the first gRNA comprises a spacer sequence selected from any one of SEQ ID NOS:41-43, 79, 157-169, 171, 178-183, 192-199, and 413-437, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:41-43, 79, 157-169, 171, 178-183, 192-199, and 413-437 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:41- 43, 79, 157-169, 171, 178-183, 192-199, and 413-437.

[0360] In some embodiments, the first gRNA is an SpCas9 gRNA that targets a target site that comprises a sequence selected from any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172- 177, 184-191, and 388-403 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at sf-605940722474-20028.40 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:7-9, 78, 144-156, 170, 172-177, 184-191, and 388-403 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is set forth in any one of SEQ ID NOS: 7-9, 78, 144-156, 170, 172-177, 184-191, and 388- 403.

[0361] In some embodiments, the first gRNA is an SpCas9 gRNA that comprises a spacer sequence selected from any one of SEQ ID NOS:41-43, 79, 157-169, 171, 178-183, 192-199, and 413-428, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:41-43, 79, 157-169, 171, 178-183, 192-199, and 413-428 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:41-43, 79, 157-169, 171, 178-183, 192-199, and 413-428.

[0362] In some embodiments, the first gRNA is an SaCas9 gRNA that targets a target site that comprises a sequence selected from any one of SEQ ID NOS:404-412 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS:404-412 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is set forth in any one of SEQ ID NOS: 404-412.

[0363] In some embodiments, the first gRNA is an SpCas9 gRNA that comprises a spacer sequence selected from any one of SEQ ID NOS:429-437, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:429-437 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:429-437.

[0364] In some embodiments, the first gRNA targets IL-2. sf-605940722474-20028.40

[0365] In some embodiments, the first gRNA targets an IL-2 target site that comprises a sequence selected from any one of SEQ ID NOS:78 and 388-412 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 target site is a contiguous portion of any one of SEQ ID NOS:78 and 388-412 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL- 2 target site is set forth in any one of SEQ ID NOS: 78 and 388-412.

[0366] In some embodiments, the first gRNA comprises an IL-2-targeting spacer sequence selected from any one of SEQ ID NOS:79 and 413-437, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:79 and 413-437 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:79 and 413-437.

[0367] In some embodiments, the first gRNA is an SpCas9 gRNA that targets an IL-2 target site that comprises a sequence selected from any one of SEQ ID NOS:78 and 388-403 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 target site is a contiguous portion of any one of SEQ ID NOS:78 and 388-403 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL- 2 target site is set forth in any one of SEQ ID NOS:78 and 388-403.

[0368] In some embodiments, the first gRNA is an SpCas9 gRNA that comprises an IL-2 targeting spacer sequence selected from any one of SEQ ID NOS:79 and 413-428, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:79 and 413-428 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:79 and 413-428. sf-605940722474-20028.40

[0369] In some embodiments, the first gRNA is an SaCas9 gRNA that targets an IL-2 target site that comprises a sequence selected from any one of SEQ ID NOS:404-412 as shown in Table 5, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 target site is a contiguous portion of any one of SEQ ID NOS:404-412 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL-2 target site is set forth in any one of SEQ ID NOS: 404-412.

[0370] In some embodiments, the first gRNA is an SpCas9 gRNA that comprises an IL-2- targeting spacer sequence selected from any one of SEQ ID NOS:429-437, as shown in Table 5, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is a contiguous portion of any one of SEQ ID NOS:429-437 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the IL-2 targeting spacer sequence of the first gRNA is set forth in any one of SEQ ID NOS:429-437.

[0371] In some embodiments, a combination of first gRNAs that each target a target site for a first gene for transcriptional activation is used. In some embodiments, a combination of first gRNAs comprising at least two first gRNAs targeting at least two different first genes for transcriptional activation is used. In some embodiments, the first gRNAs target a combination of first genes selected from the combinations of first genes listed in Table 1.

[0372] In some embodiments, the combination of first gRNAs comprises a plurality of first gRNAs targeted to at least two different first genes. In some embodiments, one first gRNA targets BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, or VAV1, and the other first gRNA targets a different gene from BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, one first gRNA targets IL-2, and the other first gRNA targets BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, or VAV1. In some embodiments, one first gRNA targets VAV1, and the other first gRNA targets BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, or VAV1.

[0373] In some embodiments, one first gRNA targets IL-2 and the other first gRNA targets VAV1. In some embodiments, one first gRNA targets a target site for IL-2 having the sequence sf-605940722474-20028.40 set forth in SEQ ID NO:78 and the other first gRNA targets a target site for VAV1 having the sequence set forth in SEQ ID NO:170.

[0374] In some embodiments, the combination of first gRNAs comprises at least three first gRNAs each targeting a different first gene selected from BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0375] In some embodiments, the combination of first gRNAs targets a combination of target sites for a combination of first genes for transcriptional activation, for instance as shown in Table 2.

[0376] In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172, and another first gRNA that targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172, and another first gRNA that targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for CD28 comprising the sequence set forth in SEQ ID NO:144, and another first gRNA that targets a target site for VAV1 comprising the sequence set forth in sf-605940722474-20028.40 SEQ ID NO:170. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and another first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and another first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and another first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for EOMES comprising the sequence set forth in SEQ ID NO:149, and another first gRNA that targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and another first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and another first gRNA that targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and another first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for LCP2 comprising the sequence set forth in SEQ ID NO:151, and another first gRNA that targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and another first gRNA that targets a target site for BATF comprising the sequence set forth in SEQ ID NO:172. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and another first gRNA that targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID sf-605940722474-20028.40 NO:155, and another first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for TBX21 comprising the sequence set forth in SEQ ID NO:155, and another first gRNA that targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170. In some embodiments, the combination of first gRNAs comprises one first gRNA that targets a target site for VAV1 comprising the sequence set forth in SEQ ID NO:170, and another first gRNA that targets a target site for IL-2 comprising the sequence set forth in SEQ ID NO:78. Table 5. First genes, target sites, and first gRNAs for transcriptional activationsf-605940722474-20028.40b. gRNAs for Transcriptional Repression

[0377] In some embodiments, a second gRNA targets a target site for a second gene for transcriptional repression. In some embodiments, the second gRNA targets a target site for a second gene, such as a second gene in a T cell, wherein the second gene is selected from the list consisting of: CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the second gRNA targets MED12.

[0378] In some embodiments, the second gRNA is a Cas9 gRNA. In some embodiments, the sf-605940722474-20028.40 second gRNA is a Cas12 gRNA.

[0379] In some embodiments, the second gRNA is an SpCas9 gRNA. In some embodiments, the second gRNA is an SaCas9 gRNA.

[0380] In some embodiments, the second gRNA targets a target site that comprises a sequence selected from any one of SEQ ID NOS:1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308, as shown in Table 6, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, and 200-211 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is set forth in any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308.

[0381] In some embodiments, the second gRNA comprises a spacer sequence selected from any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309- 311, as shown in Table 6, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the second gRNA is a contiguous portion of any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the second gRNA is set forth in any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311.

[0382] In some embodiments, the second gRNA is an SpCas9 gRNA that targets a target site that comprises a sequence selected from any one of SEQ ID NOS:1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308, as shown in Table 6, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, and 200-211 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is set forth in any one of SEQ ID NOS: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308. sf-605940722474-20028.40

[0383] In some embodiments, the second gRNA is an SpCas9 gRNA that comprises a spacer sequence selected from any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296- 299, 303-305, and 309-311, as shown in Table 6, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the second gRNA is a contiguous portion of any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the second gRNA is set forth in any one of SEQ ID NOS:35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311.

[0384] In some embodiments, the second gRNA targets MED12.

[0385] In some embodiments, the second gRNA targets a MED12 target site that comprises a sequence selected from any one of SEQ ID NOS:80-90, as shown in Table 6, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the MED12 target site is a contiguous portion of any one of SEQ ID NOS: 80-90 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the MED12 target site is set forth in any one of SEQ ID NOS: 80-90.

[0386] In some embodiments, the second gRNA comprises a MED12-targeting spacer sequence selected from any one of SEQ ID NOS:91-101, as shown in Table 6, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the MED12-targeting spacer sequence of the second gRNA is a contiguous portion of any one of SEQ ID NOS:91-101 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the MED12-targeting spacer sequence of the second gRNA is set forth in any one of SEQ ID NOS:91-101.

[0387] In some embodiments, the second gRNA is an SpCas9 gRNA that targets a MED12 target site that comprises a sequence selected from any one of SEQ ID NOS:80-90, as shown in Table 6, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. sf-605940722474-20028.40 In some embodiments, the MED12 target site is a contiguous portion of any one of SEQ ID NOS:80-90 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the MED12 target site is set forth in any one of SEQ ID NOS:80-90.

[0388] In some embodiments, the second gRNA is an SpCas9 gRNA that comprises a MED12-targeting spacer sequence selected from any one of SEQ ID NOS:91-101, as shown in Table 6, or a contiguous portion thereof of at least 14 nt, or a sequence having at or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the MED12-targeting spacer sequence of the second gRNA is a contiguous portion of any one of SEQ ID NOS:91-101 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the MED12-targeting spacer sequence of the second gRNA is set forth in any one of SEQ ID NOS:91-101.

[0389] In some embodiments, a combination of second gRNAs that each target a target site for a second gene for transcriptional repression is used. In some embodiments, a combination of second gRNAs comprising at least two second gRNAs targeting at least two different second genes for transcriptional repression is used. In some embodiments, the second gRNAs target a combination of second genes selected from the combinations of second genes listed in Table 3.

[0390] In some embodiments, the combination of second gRNAs comprises a plurality of second gRNAs targeted to at least two different second genes. In some embodiments, one second gRNA targets CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2, and the other second gRNA targets a different gene from CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0391] In some embodiments, one second gRNA targets CBLB, and the other second gRNA targets CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. In some embodiments, one second gRNA targets CCNC, and the other second gRNA targets CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. In some embodiments, one second gRNA targets MED12, and the other second gRNA targets CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. In some embodiments, one second gRNA targets MYB, and the other second gRNA targets CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. sf-605940722474-20028.40

[0392] In some embodiments, one second gRNA targets CBLB and the other second gRNA targets MYB. In some embodiments, one second gRNA targets a target site for CBLB having the sequence set forth in SEQ ID NO:11 and the other second gRNA targets a target site for MYB having the sequence set forth in SEQ ID NO:18.

[0393] In some embodiments, one second gRNA targets CBLB and the other second gRNA targets CCNC. In some embodiments, one second gRNA targets a target site for CBLB having the sequence set forth in SEQ ID NO:11 and the other second gRNA targets a target site for CCNC having the sequence set forth in SEQ ID NO:104.

[0394] In some embodiments, one second gRNA targets CBLB and the other second gRNA targets MED12. In some embodiments, one second gRNA targets a target site for CBLB having the sequence set forth in SEQ ID NO:11 and the other second gRNA targets a target site for MED12 having the sequence set forth in SEQ ID NO:81.

[0395] In some embodiments, one second gRNA targets MED12 and the other second gRNA targets TGFBR2. In some embodiments, one second gRNA targets a target site for MED12 having the sequence set forth in SEQ ID NO:81 and the other second gRNA targets a target site for TGFBR2 having the sequence set forth in SEQ ID NO:301.

[0396] In some embodiments, one second gRNA targets MED12 and the other second gRNA targets CISH. In some embodiments, one second gRNA targets a target site for MED12 having the sequence set forth in SEQ ID NO:81 and the other second gRNA targets a target site for CISH having the sequence set forth in SEQ ID NO:28 or 30.

[0397] In some embodiments, the combination of second gRNAs comprises at least three second gRNAs each targeting a different second gene selected from CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0398] In some embodiments, the combination of second gRNAs targets a combination of target sites for a combination of second genes for transcriptional repression, for intance as shown in Table 4.

[0399] In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for CCNC comprising the sequence set forth in SEQ ID NO:104. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for CD5 comprising the sequence set sf-605940722474-20028.40 forth in SEQ ID NO:3. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for ELOB comprising the sequence set forth in SEQ ID NO:24. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for FAS comprising the sequence set forth in SEQ ID NO:204. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for Fli1 comprising the sequence set forth in SEQ ID NO:208. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for KDM1A comprising the sequence set forth in SEQ ID NO:4. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the combination of second gRNAs comprises one sf-605940722474-20028.40 second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11, and another second gRNA that targets a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, and another second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3, and another second gRNA that targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and another second gRNA that targets a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and another second gRNA that targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30, and another second gRNA that targets a target site for RASA2 comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and another second gRNA that targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and another second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26, and another second gRNA that targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for CBLB comprising the sequence set forth in SEQ ID NO:11. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another sf-605940722474-20028.40 second gRNA that targets a target site for CD5 comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for CISH comprising the sequence set forth in SEQ ID NO:30. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for DGKZ comprising the sequence set forth in SEQ ID NO:13. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for ELOB comprising the sequence set forth in SEQ ID NO:24. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for GATA3 comprising the sequence set forth in SEQ ID NO:26. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for MYB comprising the sequence set forth in SEQ ID NO:18. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for PRDM1 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the combination of second gRNAs comprises one second gRNA that targets a target site for MED12 comprising the sequence set forth in SEQ ID NO:81, and another second gRNA that targets a target site for RASA2 ...

Claims

22474-20028.40 WHAT IS CLAIMED:

1. An epigenetic-modifying DNA-targeting system comprising a plurality of DNA- targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes in a T cell, and each activator DNA-targeting module comprises a fusion protein comprising (i) a first DNA-binding domain for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes in the T cell, and each repressor DNA-targeting module comprises a fusion protein comprising (i) a second DNA-binding domain for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain; wherein the first DNA-binding domain or domains are all different from the second DNA-binding domain or domains.

2. The epigenetic-modifying DNA-targeting system of claim 1, wherein the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

3. The epigenetic-modifying DNA-targeting system of claim 1 or claim 2, wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

4. An epigenetic-modifying DNA-targeting system comprising a plurality of DNA- targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises a fusion protein comprising (i) a first DNA-binding domain for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain, wherein the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes, and each repressor DNA-targeting module comprises a fusion protein sf-605940722474-20028.40 comprising (i) a second DNA-binding domain for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain, wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first DNA-binding domain or domains are all different from the second DNA-binding domain or domains.

5. The epigenetic-modifying DNA-targeting system of any of claims 1-4, wherein the epigenetic-modifying DNA-targeting system does not introduce a genetic disruption or a DNA break.

6. The epigenetic-modifying DNA-targeting system of any of claims 1-5, wherein each first DNA-binding domain is a Clustered Regularly Interspaced Short Palindromic Repeats associated (Cas) protein; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing endonuclease; or an I-SceI enzyme.

7. The epigenetic-modifying DNA-targeting system of any of claims 1-6, wherein each first DNA-binding domain is catalytically inactive.

8. The epigenetic-modifying DNA-targeting system of any of claims 1-7, wherein each second DNA-binding domain is a Cas protein; a ZFP; a TALE; a meganuclease; a homing endonuclease; or an I-SceI enzyme.

9. The epigenetic-modifying DNA-targeting system of any of claims 1-8, wherein each second DNA-binding domain is catalytically inactive.

10. The epigenetic-modifying DNA-targeting system of any of claims 1-9, wherein each first DNA-binding domain is a first Cas protein, and each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes.

11. The epigenetic-modifying DNA-targeting system of any of claims 1-10, wherein each second DNA-binding domain is a ZFP.

12. The epigenetic-modifying DNA-targeting system of any of claims 1-10, wherein each second DNA-binding domain is a second Cas protein, and each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

13. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11, and 12, wherein each first DNA-binding domain is a ZFP. sf-605940722474-20028.40 14. The epigenetic-modifying DNA-targeting system of any of claims 1-10 and 12, wherein: each first DNA-binding domain is a ZFP; and each second DNA-binding domain is a Cas protein, and each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

15. The epigenetic-modifying DNA-targeting system of any of claims 1-10 and 12, wherein: each first DNA-binding domain is a first Cas protein, and each of the at least one activator DNA-targeting module further comprises a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; and each second DNA-binding domain is a second Cas protein, and each of the at least one repressor DNA-targeting module further comprises a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes.

16. The epigenetic-modifying DNA-targeting system of claim 15, wherein the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins.

17. An epigenetic-modifying DNA-targeting system comprising a plurality of DNA- targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises (1) a fusion protein comprising (i) a first Cas protein and (ii) at least one transcriptional activator domain, and (2) a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; wherein the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repression genes, and each repressor DNA-targeting module comprises (1) a fusion protein comprising (i) a second Cas protein and (ii) at least one transcriptional repressor domain, and (2) a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes; sf-605940722474-20028.40 wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins.

18. The epigenetic-modifying DNA-targeting system of any of claims 15-17, wherein the first Cas protein or proteins do not bind to the protospacer-adjacent motifs (PAMs) that the second Cas protein or proteins bind to.

19. An epigenetic-modifying DNA-targeting system comprising a plurality of DNA- targeting modules comprising at least one activator DNA-targeting module and at least one repressor DNA-targeting module, wherein: the at least one activator DNA-targeting module is for increasing transcription of one or more activation genes, and each activator DNA-targeting module comprises (1) a fusion protein comprising (i) a first Cas protein and (ii) at least one transcriptional activator domain, and (2) a gRNA for targeting the first Cas protein to a target site of one of the one or more activation genes; wherein the one or more activation genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL-2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and the at least one repressor DNA-targeting module is for repressing transcription of one or more repressor genes, and each repressor DNA-targeting module comprises (1) a fusion protein comprising (i) a second Cas protein and (ii) at least one transcriptional repressor domain, and (2) a gRNA for targeting the second Cas protein to a target site of one of the one or more repression genes; wherein the one or more repression genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; wherein the first Cas protein or proteins do not bind to the protospacer-adjacent motifs (PAMs) that the second Cas protein or proteins bind to.

20. The epigenetic-modifying DNA-targeting system of claim 19, wherein the first Cas protein or proteins are from a different Staphylococcus species than the second Cas protein or proteins. sf-605940722474-20028.40 21. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 20, wherein the first Cas protein or proteins bind to a first PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide.

22. The epigenetic-modifying DNA-targeting system of any of claims 12-21, wherein the second Cas protein or proteins bind to a second PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A.

23. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 19, wherein the first Cas protein or proteins bind to a first PAM 5’- NNGRRT-3’ (SEQ ID NO: 225), wherein N is any nucleotide, and R is G or A.

24. The epigenetic-modifying DNA-targeting system of any of claims 12-20 and 23, wherein the second Cas protein or proteins bind to a second PAM 5’-NGG-3’ (SEQ ID NO: 224), wherein N is any nucleotide.

25. The epigenetic-modifying DNA-targeting system of any of claims 15-24, wherein the first Cas protein or proteins do not bind to the gRNA or gRNAs that target the one or more repression genes, and the second Cas protein or proteins do not bind to the gRNA or gRNAs that target the one or more activation genes.

26. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 25, wherein each first Cas protein is a deactivated (dCas) protein.

27. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 26, wherein each first Cas protein lacks nuclease activity.

28. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 27, wherein each first Cas protein is a dCas9 protein.

29. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, and 23-28, wherein each first Cas protein is a Staphylococcus aureus dCas9 (dSaCas9) protein.

30. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, and 23-29, wherein each first Cas protein is a dSaCas9 protein comprising at least one amino acid mutation selected from D10A and N580A with reference to numbering of positions of SEQ ID NO:

124.

31. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, and 23-30, wherein each first Cas protein comprises the sequence set forth in SEQ ID NO:125 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. sf-605940722474-20028.40 32. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, and 23-31, wherein each first Cas protein is set forth in SEQ ID NO:

125.

33. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, and 25-28, wherein each first Cas protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein.

34. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, and 33, wherein each first Cas protein is a dSpCas9 protein comprising at least one amino acid mutation selected from D10A and H840A with reference to numbering of positions of SEQ ID NO:

126.

35. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33, and 34, wherein each first Cas protein comprises the sequence set forth in SEQ ID NO:127 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

36. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, and 33-35, wherein each first Cas protein is set forth in SEQ ID NO:

127.

37. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 27, wherein each first Cas protein is a dCas12 protein.

38. The epigenetic-modifying DNA-targeting system of any of claims 1-37, wherein the at least one activator DNA-targeting module is a single activator DNA-targeting module.

39. The epigenetic-modifying DNA-targeting system of any of claims 1-37, wherein the at least one activator DNA-targeting module is a plurality of activator DNA-targeting modules.

40. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 12, and 39, wherein at least one of the first DNA-binding domains is a ZFP that targets a target site of one of the one or more activation genes.

41. The epigenetic-modfying DNA-targeting system of any of claims 1-10 and 39, wherein at least one of the second DNA-binding domains is a ZFP that targets a target site of one of the one or more repression genes.

42. The epigenetic-modifying DNA-targeting system of any of claims 1-37 and 39- 41, wherein: the first DNA-binding domains of the at least one activator DNA-targeting module are different from one another; and / or sf-605940722474-20028.40 each activator DNA-targeting module of the at least one activator DNA-targeting module is different.

43. The epigenetic-modifying DNA-targeting system of any of claims 1-37 and 40- 42, wherein the at least one activator DNA-targeting module is 2, 3, 4, 5, or 6 activator DNA- targeting modules.

44. The epigenetic-modifying DNA-targeting system of any of claims 1-37 and 39- 43, wherein the at least one activator DNA-targeting module is 2 activator DNA-targeting modules.

45. The epigenetic-modifying DNA-targeting system of any of claims 1-44, wherein the one or more activation genes comprise IL-2.

46. The epigenetic-modifying DNA-targeting system of any of claims 1-45, wherein the one or more activation genes is IL-2.

47. The epigenetic-modifying DNA-targeting system of any of claims 1-37 and 39- 45, wherein the at least one activator DNA-targeting module targets two or more activation genes.

48. The epigenetic-modifying DNA-targeting system of any of claims 1-37, 39-45, and 47, wherein the one or more activation genes comprise BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; EOMES and IL-2; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; or VAV1 and IL-2.

49. The epigenetic-modifying DNA-targeting system of any of claims 1-37, 39-45, 47, and 48, wherein the one or more activation genes comprise IL-2RB and VAV1.

50. The epigenetic-modifying DNA-targeting system of any of claims 1-37, 39-45, 47, and 48, wherein the one or more activation genes comprise IL-2 and VAV1.

51. The epigenetic-modifying DNA-targeting system of any of claims 1-50, wherein the target site for each of the one or more activation genes is in a gene or a regulatory DNA element.

52. The epigenetic-modifying DNA-targeting system of any of claims 1-51, wherein the target site for each of the one or more activation genes is in a gene, an enhancer, or a promoter. sf-605940722474-20028.40 53. The epigenetic-modifying DNA-targeting system of any of claims 1-52, wherein the target site for each of the one or more activation genes is in an enhancer or a promoter.

54. The epigenetic-modifying DNA-targeting system of any of claims 1-53, wherein the target site for each of the one or more activation genes is within 1000 base pairs of a transcriptional start site of one of the one or more activation genes.

55. The epigenetic-modifying DNA-targeting system of any of claims 1-54, wherein the target site for each of the one or more activation genes is within 500 base pairs of a transcriptional start site of one of the one or more activation genes.

56. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-55, wherein the target site for at least one of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388- 403, and 451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172- 174, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144- 146 and 189-191, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175- 177, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184- 186, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; sf-605940722474-20028.40 (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150- 152, 187, and 188, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153- 155, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

57. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-56, wherein the target site for at least one of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388- 403, and 451-453 or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172- 174, or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144- 146 and 189-191, or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175- 177, or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184- 186, or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150- 152 and 187-188, or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153- 155, or a complementary sequence of any of the foregoing.

58. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-57, wherein the target site for each of the one or more activation genes is selected from: sf-605940722474-20028.40 (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388- 403, and 452-453 a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172- 174, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144- 146 and 189-191, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175- 177, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184- 186, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150- 152 and 187-188, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153- 155, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

59. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-58, wherein the target site for each of the one or more activation genes is selected from: (a) a target site for VAV1 having the sequence set forth in any one of SEQ ID NOS:7-9, 156, and 170, or a complementary sequence of any of the foregoing; sf-605940722474-20028.40 (b) a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388- 403, and 451-453, or a complementary sequence of any of the foregoing; (c) a target site for BATF having the sequence set forth in any one of SEQ ID NOS:172- 174, or a complementary sequence of any of the foregoing; (d) a target site for CD28 having the sequence set forth in any one of SEQ ID NOS:144- 146 and 189-191, or a complementary sequence of any of the foregoing; (e) a target site for EOMES having the sequence set forth in any one of SEQ ID NOS:147-149, or a complementary sequence of any of the foregoing; (f) a target site for IRF4 having the sequence set forth in any one of SEQ ID NOS:175- 177, or a complementary sequence of any of the foregoing; (g) a target site for LAT having the sequence set forth in any one of SEQ ID NOS:184- 186, or a complementary sequence of any of the foregoing; (h) a target site for LCP2 having the sequence set forth in any one of SEQ ID NOS:150- 152 and 187-188, or a complementary sequence of any of the foregoing; or (i) a target site for TBX21 having the sequence set forth in any one of SEQ ID NOS:153- 155, or a complementary sequence of any of the foregoing.

60. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-59, wherein the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388-403, and 451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

61. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-60, wherein the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388-403, and 451-453, or a complementary sequence of any of the foregoing.

62. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-61, wherein the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388-403, amd 451-453 a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

63. The epigenetic-modifying DNA-targeting system of any of claims 1-22, 25-28, 33-36, and 38-62, wherein the target site for each of the one or more activation genes is a target sf-605940722474-20028.40 site for IL-2 having the sequence set forth in any one of SEQ ID NO:78, 388-403, and 451-453, or a complementary sequence of any of the foregoing.

64. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, and 38-55, wherein the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

65. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 38-55, and 64, wherein the target site for at least one of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412 or a complementary sequence of any of the foregoing.

66. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 38-55, 64, and 65, wherein the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

67. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 38-55, and 64-66, wherein the target site for each of the one or more activation genes is a target site for IL-2 having the sequence set forth in any one of SEQ ID NO:404-412 or a complementary sequence of any of the foregoing.

68. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, wherein the target site for at least one of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

69. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, and 68, wherein the target site for at least one of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453 or a complementary sequence of any of the foregoing.

70. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, 68, and 69, wherein the target site for each of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NO:451-453, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. sf-605940722474-20028.40 71. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, and 68-70, wherein the target site for each of the one or more activation genes is any one of the sequences set forth in any one of SEQ ID NOs:451-453 or a complementary sequence of any of the foregoing.

72. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, and 68-71, wherein the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO:

451.

73. The epigenetic-modifying DNA-targeting system of claim 72, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: QNAHRKT (SEQ ID NO: 472), F2: RKYYLAK (SEQ ID NO: 473), F3: RSAHLSR (SEQ ID NO: 474), F4: QSGDLTR (SEQ ID NO: 475), F5: RSDHLTQ (SEQ ID NO: 476), and F6: DSANLSR (SEQ ID NO: 477).

74. The epigenetic-modifying DNA-targeting system of claim 72 or 73, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 458, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

75. The epigenetic-modifying DNA-targeting system of any of claims 72-74, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

458.

76. The epigenetic-modifying DNA-targeting system of any of claims 72-75, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 465 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

77. The epigenetic-modifying DNA-targeting system of any of claims 72-76, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

465.

78. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, and 68-71, wherein the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO:

452.

79. The epigenetic-modifying DNA-targeting system of claim 78, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DSSHLEL (SEQ ID NO: 478), F2: DRSNLTR (SEQ ID NO: 479), F3: RSDNLSE (SEQ ID NO: 480), F4: sf-605940722474-20028.40 VRRALSS (SEQ ID NO: 481), F5: QSGALAR (SEQ ID NO: 482), and F6: RLDWLPM (SEQ ID NO: 483).

80. The epigenetic-modifying DNA-targeting system of claim 78 or 79, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 459, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

81. The epigenetic-modifying DNA-targeting system of any of claims 78-80, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

459.

82. The epigenetic-modifying DNA-targeting system of any of claims 78-81, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 466 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

83. The epigenetic-modifying DNA-targeting system of any of claims 78-82, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

466.

84. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, and 68-71, wherein the first DNA-binding domain is a ZFP that targets the target site of one or more activation genes set forth in SEQ ID NO:

453.

85. The epigenetic-modifying DNA-targeting system of claim 84, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSDNLSV (SEQ ID NO: 484), F2: RSAHLSR (SEQ ID NO: 485), F3: QNAHRKT (SEQ ID NO: 486), F4: LRHHLTR (SEQ ID NO: 487), F5: TSSNRKT (SEQ ID NO: 488), and F6: TSSNLSR (SEQ ID NO: 489).

86. The epigenetic-modifying DNA-targeting system of claim 84 or 85, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 460, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

87. The epigenetic-modifying DNA-targeting system of any of claims 84-86, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

460.

88. The epigenetic-modifying DNA-targeting system of any of claims 84-87, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 467 or a portion thereof, or an sf-605940722474-20028.40 amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

89. The epigenetic-modifying DNA-targeting system of any of claims 84-88, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

467.

90. The epigenetic-modifying DNA-targeting system of any of claims 10-12 and 15- 67, wherein each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence that is complementary to a target site of one of the one or more activation genes.

91. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-67, and 90-65, wherein each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence between 14 nt and 24 nt or between 16 nt and 22 nt in length.

92. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-67, 90, and 91, wherein each gRNA for targeting a target site of one of the one or more activation genes comprises a gRNA spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length.

93. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-67, and 90-92, wherein each gRNA for targeting a target site of one of the one or more activation genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:

69.

94. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, 23-32, 38-56, 64-67, and 90-92, wherein each gRNA for targeting a target site of one or the one or more activation genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:

387.

95. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, and 68-93, wherein at least one of the gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt; sf-605940722474-20028.40 (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:178-180, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:157-159 and 197-199, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:160-162, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:181-183, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:192-194, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:163-165 and 195-196, or a contiguous portion thereof of at least 14 nt; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:166-168, or a contiguous portion thereof of at least 14 nt.

96. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 68-93, and 95, wherein at least one of the gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:178-180; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:157-159 and 197-199; sf-605940722474-20028.40 (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:160-162; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:181-183; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:192-194; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:163-165 and 195-196; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:166-168.

97. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 68-93, 95, and 96, wherein each gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:178-180, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:157-159 and 197-199, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:160-162, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:181-183, or a contiguous portion thereof of at least 14 nt; sf-605940722474-20028.40 (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:192-194, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:163-165 and 195-196, or a contiguous portion thereof of at least 14 nt; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:166-168, or a contiguous portion thereof of at least 14 nt.

98. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 68-93, and 95-97, wherein each gRNA for targeting a target site of one or the one or more activation genes is selected from: (a) a gRNA targeting a target site for VAV1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:41-43, 169, and 171; (b) a gRNA targeting a target site for IL-2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428; (c) a gRNA targeting a target site for BATF and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:178-180; (d) a gRNA targeting a target site for CD28 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:157-159 and 197-199; (e) a gRNA targeting a target site for EOMES and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:160-162; (f) a gRNA targeting a target site for IRF4 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:181-183; (g) a gRNA targeting a target site for LAT and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:192-194; (h) a gRNA targeting a target site for LCP2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:163-165 and 195-196; or (i) a gRNA targeting a target site for TBX21 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:166-168.

99. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, and 68-98, wherein at least one of the gRNA for targeting a target site of sf-605940722474-20028.40 one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413-428, or a contiguous portion thereof of at least 14 nt.

100. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 68-99, wherein at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428.

101. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 90-93, and 95-98, wherein each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:79 and 413- 428, or a contiguous portion thereof of at least 14 nt.

102. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-22, 25-28, 33-36, 38-63, 90-93, and 95-101, wherein each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:79 and 413-428.

103. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, 23-32, 38-55, 64-92, and 94, wherein at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:429-437, or a contiguous portion thereof of at least 14 nt.

104. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, 23-32, 38-55, 64-92, 94, and 103, wherein at least one of the gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:429-437.

105. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, 23-32, 38-55, 64-67, 90-92, 94, 103, and 104, wherein each gRNA for targeting a target site of one or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NO:429-437, or a contiguous portion thereof of at least 14 nt.

106. The epigenetic-modifying DNA-targeting system of any of claims 10-12, 15-20, 23-32, 38-55, 64-67, 90-92, 94, and 103-105, wherein each gRNA targeting a target site of one sf-605940722474-20028.40 or the one or more activation genes is a gRNA targeting a target site for IL-2 and comprises a gRNA spacer sequence set forth in any one of SEQ ID NO:429-437.

107. The epigenetic-modifying DNA-targeting system of any of claims 1-106, wherein each transcriptional activator domain epigenetically modifies a target site of one of the one or more activation genes to promote increased transcription of one of the one or more activation genes.

108. The epigenetic-modifying DNA-targeting system of any of claims 1-107, wherein each transcriptional activator domain is a NCOA3 domain, a FOXO3 domain, a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, optionally wherein the TET protein is TET1, a SunTag domain, or a domain, portion, variant, or truncation of any of the foregoing.

109. The epigenetic-modifying DNA-targeting system of any of claims 1-108, wherein each transcriptional activator domain comprises at least one VP16 domain or a variant or portion thereof that exhibits transcriptional activation activity.

110. The epigenetic-modifying DNA-targeting system of any of claims 1-109, wherein each transcriptional activator domain comprises a VP16 tetramer (VP64) domain or a variant or portion thereof that exhibits transcriptional activation activity.

111. The epigenetic-modifying DNA-targeting system of any of claims 1-110, wherein each transcriptional activator domain is a VP64 domain.

112. The epigenetic-modifying DNA-targeting system of any of claims 1-110, wherein each transcriptional activator domain comprises a NCOA3 domain or a variant or portion thereof that exhibits transcriptional activation activity.

113. The epigenetic-modifying DNA-targeting system of any of claims 1-110 and 112, wherein each transcriptional activator domain comprises a FOXO3 domain or a variant or portion thereof that exhibits transcriptional activation activity.

114. The epigenetic-modifying DNA-targeting system of any of claims 1-110, 112, and 113, wherein each transcriptional activator domain comprises a NCOA3-FOXO3-NCOA3 domain.

115. The epigenetic-modifying DNA-targeting system of any of claims 1-110 and 112-114, wherein each transcriptional activator domain comprises a NCOA3-FOXO3-NCOA3 domain. sf-605940722474-20028.40 116. The epigenetic-modifying DNA-targeting system of any of claims 1-108 and 112-115, wherein each transcriptional activator domain is a NCOA3-FOXO3-NCOA3 domain.

117. The epigenetic-modifying DNA-targeting system of any of claims 1-110 and 112-115, wherein each transcriptional activator domain comprises a VP16 tetramer (VP64) domain and a NCOA3-FOXO3-NCOA3 domain.

118. The epigenetic-modifying DNA-targeting system of any of claims 1-110, 112- 115, and 117, wherein each transcriptional activator domain is a VP16 tetramer (VP64) domain and a NCOA3-FOXO3-NCOA3 domain.

119. The epigenetic-modifying DNA-targeting system of any of claims 1-111, 117, and 118, wherein each transcriptional activator domain comprises the sequence set forth in SEQ ID NO:142, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

120. The epigenetic-modifying DNA-targeting system of any of claims 1-12, 15-22, 25-28, 33-36, 38, 39, 41-63, 90-93, 95-97, and 107-111, and 119, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:77 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

121. The epigenetic-modifying DNA-targeting system of any of claims 1-12, 15-20, 23-32, 38, 39, 41-55, 64-67, 90-92, 94, and 103-111, and 119, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:386 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

122. The epigenetic-modifying DNA-targeting system of any of claims 1-110 and 112-118, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:528 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

123. The epigenetic-modifying DNA-targeting system of any of claims 1-12, 15-20, 23-32, 38, 39, 41-55, 64-67, 90-92, 94, and 103-110, 112-115, 117, 118, and 122, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:529 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. sf-605940722474-20028.40 124. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, 68-77, 107, 108, 112-116, and 122, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:514 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

125. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, 68-71, 78-83, 107, 108, 112-116, and 122, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:515 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

126. The epigenetic-modifying DNA-targeting system of any of claims 1-9, 11-14, 38- 63, 68-71, 84-89, 107, 108, 112-116, and 122, wherein each fusion protein of the at least one activator DNA-targeting module comprises the sequence set forth in SEQ ID NO:516 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

127. The epigenetic-modifying DNA-targeting system of any of claims 12-126, wherein each second Cas protein is a deactivated (dCas) protein.

128. The epigenetic-modifying DNA-targeting system of any of claims 12-127, wherein each second Cas protein lacks nuclease activity.

129. The epigenetic-modifying DNA-targeting system of any of claims 12-128, wherein each second Cas protein is a dCas9 protein.

130. The epigenetic-modifying DNA-targeting system of any of claims 12-22, 25-28, 33-63, 68-93, 95-102, 107-120, and 127-129, wherein each second Cas protein is a dSaCas9 protein.

131. The epigenetic-modifying DNA-targeting system of any of claims 12-22, 25-28, 33-63, 68-93, 95-102, 107-120, and 127-130, wherein each second Cas protein is a dSaCas9 protein comprising at least one amino acid mutation selected from D10A and N580A with reference to numbering of positions of SEQ ID NO:

124.

132. The epigenetic-modifying DNA-targeting system of any of claims 12-22, 25-28, 33-63, 68-93, 95-102, 107-120, and 127-131, wherein each second Cas protein comprises the sequence set forth in SEQ ID NO:125 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. sf-605940722474-20028.40 133. The epigenetic-modifying DNA-targeting system of any of claims 12-22, 25-28, 33-63, 68-93, 95-102, 107-120, and 127-132, wherein each second Cas protein is set forth in SEQ ID NO:

125.

134. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-92, 94, 103-119, and 121-129, wherein each second Cas protein is a dSpCas9 protein.

135. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-92, 94, 103-119, 121-129, and 134, wherein each second Cas protein is a dSpCas9 protein comprising at least one amino acid mutation selected from D10A and H840A with reference to numbering of positions of SEQ ID NO:

126.

136. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-92, 94, 103-119, 121-129, 134, and 135, wherein each second Cas protein comprises the sequence set forth in SEQ ID NO:127 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

137. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-92, 94, 103-119, 121-129, and 134-136, wherein each second Cas protein is set forth in SEQ ID NO:

127.

138. The epigenetic-modifying DNA-targeting system of any of claims 12-128, wherein each second Cas protein is a dCas12 protein.

139. The epigenetic-modifying DNA-targeting system of any of claims 1-138, wherein the at least one repressor DNA-targeting module is a single repressor DNA-targeting module.

140. The epigenetic-modifying DNA-targeting system of any of claims 1-138, wherein the at least one repressor DNA-targeting module is a plurality of repressor DNA-targeting modules.

141. The epigenetic-modifying DNA-targeting system of any of claims 1-138 and 140, wherein: the second DNA-binding domains of the at least one repressor DNA-targeting module are different from one another; and / or each repressor DNA-targeting module of the at least one repressor DNA-targeting module is different.

142. The epigenetic-modifying DNA-targeting system of any of claims 1-138, 140, and 141, wherein the at least one repressor DNA-targeting module is 2, 3, 4, 5, or 6 repressor DNA-targeting modules. sf-605940722474-20028.40 143. The epigenetic-modifying DNA-targeting system of any of claims 1-138 and 140-142, wherein the at least one repressor DNA-targeting module is 2 repressor DNA-targeting modules.

144. The epigenetic-modifying DNA-targeting system of any of claims 1-143, wherein the one or more repression genes comprise MED12.

145. The epigenetic-modifying DNA-targeting system of any of claims 1-144, wherein the one or more repression genes is MED12.

146. The epigenetic-modifying DNA-targeting system of any of claims 1-138 and 140-144, wherein the at least one repressor DNA-targeting modules targets two or more repression genes.

147. The epigenetic-modifying DNA-targeting system of any of claims 1-138, 140- 144, and 146, wherein the one or more repression genes comprise CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; MED12 and TGFBR2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH, and MYB; GATA3, CBLB, and MYB; GATA3, CD5, and MYB; or PRDM1, GATA3, and CISH.

148. The epigenetic modifying DNA-targeting system of any of claims 1-138, 140- 144, 146, and 147, wherein: the two or more repression genes comprise CBLB and MYB; the two or more repression genes comprise CBLB and MED12; the two or more repression genes comprise CBLB and CCNC; or the two or more repression genes comprise MED12 and TGFBR2.

149. The epigenetic-modifying DNA-targeting system of any of claims 1-138 and 140-144, wherein the at least one repressor DNA-targeting modules targets three or more repression genes.

150. The epigenetic-modifying DNA-targeting system of any of claims 1-138, 140- 144, and 149, wherein the one or more repression genes comprise MED12, TGFBR2 and CISH. sf-605940722474-20028.40 151. The epigenetic-modifying DNA-targeting system of any of claims 1-150, wherein the target site for each of the one or more repression genes is in a gene or a regulatory DNA element.

152. The epigenetic-modifying DNA-targeting system of any of claims 1-151, wherein the target site for each of the one or more repression genes is in a gene, an enhancer, or a promoter.

153. The epigenetic-modifying DNA-targeting system of any of claims 1-152, wherein the target site for each of the one or more repression genes is in an enhancer or a promoter.

154. The epigenetic-modifying DNA-targeting system of any of claims 1-153, wherein the target site for each of the one or more repression genes is within 1000 base pairs of a transcriptional start site of one of the one or more repression genes.

155. The epigenetic-modifying DNA-targeting system of any of claims 1-154, wherein the target site for each of the one or more repression genes is within 500 base pairs of a transcriptional start site of one of the one or more repression genes.

156. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-155, wherein the target site for at least one of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4- 6, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10- 12, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13- 15, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16- 18, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; sf-605940722474-20028.40 (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19- 21, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22- 24, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25- 27, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31- 33, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80- 90 and 454-456, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102- 112, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200- 205 and 292-295, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206- 211, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302, 306-308 and 457, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing. sf-605940722474-20028.40 157. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-156, wherein the target site for at least one of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3 or a complementary sequence thereof; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4- 6 or a complementary sequence thereof; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10- 12 or a complementary sequence thereof; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13- 15 or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18 or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19- 21 or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22- 24 or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25- 27 or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30 or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31- 33 or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80- 90 and 454-456 or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102- 112 or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200- 205 and 292-295 or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206- 211 or a complementary sequence of any of the foregoing; and sf-605940722474-20028.40 (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302, 306-308, and 457, or a complementary sequence of any of the foregoing.

158. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-157, wherein the target site for each of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4- 6, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10- 12, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13- 15, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16- 18, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19- 21, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22- 24, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25- 27, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; sf-605940722474-20028.40 (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31- 33, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80- 90 and 454-456, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102- 112, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200- 205 and 292-295, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206- 211, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302, 306-308, and 557, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

159. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-158, wherein the target site for each of the one or more repression genes is selected from: (a) a target site for CD5 having the sequence set forth in any one of SEQ ID NOS:1-3 or a complementary sequence thereof; (b) a target site for KDM1A having the sequence set forth in any one of SEQ ID NOS:4- 6 or a complementary sequence thereof; (c) a target site for CBLB having the sequence set forth in any one of SEQ ID NOS:10- 12 or a complementary sequence thereof; (d) a target site for DGKZ having the sequence set forth in any one of SEQ ID NOS:13- 15 or a complementary sequence of any of the foregoing; (e) a target site for MYB having the sequence set forth in any one of SEQ ID NOS:16-18 or a complementary sequence of any of the foregoing; sf-605940722474-20028.40 (f) a target site for RASA2 having the sequence set forth in any one of SEQ ID NOS:19- 21 or a complementary sequence of any of the foregoing; (g) a target site for ELOB having the sequence set forth in any one of SEQ ID NOS:22- 24 or a complementary sequence of any of the foregoing; (h) a target site for GATA3 having the sequence set forth in any one of SEQ ID NOS:25- 27 or a complementary sequence of any of the foregoing; (i) a target site for CISH having the sequence set forth in any one of SEQ ID NOS:28-30 or a complementary sequence of any of the foregoing; (j) a target site for PRDM1 having the sequence set forth in any one of SEQ ID NOS:31- 33 or a complementary sequence of any of the foregoing; (k) a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80- 90 and 454-456 or a complementary sequence of any of the foregoing; (l) a target site for CCNC having the sequence set forth in any one of SEQ ID NOS:102- 112 or a complementary sequence of any of the foregoing; (m) a target site for FAS having the sequence set forth in any one of SEQ ID NOS:200- 205 and 292-295 or a complementary sequence of any of the foregoing; (n) a target site for Fli1 having the sequence set forth in any one of SEQ ID NOS:206- 211 or a complementary sequence of any of the foregoing; and (o) a target site for TGFBR2 having the sequence set forth in any one of SEQ ID NOS:300-302, 306-308, and 457, or a complementary sequence of any of the foregoing.

160. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-159, wherein the target site for at least one of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 and 454-456, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

161. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-109, 121-129, 134-137, and 139-160, wherein the target site for at least one of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 and 454-456, or a complementary sequence of any of the foregoing.

162. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-89, 94, 103-119, 121-129, 134-137, and 139-161, wherein the target site for each of sf-605940722474-20028.40 the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 and 454-456, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

163. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-89, 94, 103-119, 121-129, 134-137, and 139-162, wherein the target site for each of the one or more repression genes is a target site for MED12 having the sequence set forth in any one of SEQ ID NOS:80-90 and 454-456, or a complementary sequence of any of the foregoing.

164. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-163, wherein the target site of one of the one or more repression genes is any one of the sequences set forth in any one of SEQ ID NO:454-457, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

165. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-164, wherein the target site of one of the one or more repression genes is any one of the sequences set forth in any one of SEQ ID NO:454-457 or a complementary sequence of any of the foregoing.

166. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-165, wherein the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in SEQ ID NO:

454.

167. The epigenetic-modifying DNA-targeting system of claim 166, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DRSHLTR (SEQ ID NO: 490), F2: DRSYRNT (SEQ ID NO: 491), F3: QRRSLPH (SEQ ID NO: 492), F4: RSADLSR (SEQ ID NO: 493), F5: RSDTLSE (SEQ ID NO: 494), and F6: NRRGRWS (SEQ ID NO: 495).

168. The epigenetic-modifying DNA-targeting system of claim 166 or 167, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 461, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

169. The epigenetic-modifying DNA-targeting system of any of claims 166-168, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

461.

170. The epigenetic-modifying DNA-targeting system of any of claims 166-169, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 468 or a portion thereof, sf-605940722474-20028.40 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

171. The epigenetic-modifying DNA-targeting system of any of claims 166-170, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

468.

172. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-165, wherein the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in SEQ ID NO:

455.

173. The epigenetic-modifying DNA-targeting system of claim 172, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSANLAR (SEQ ID NO: 496), F2: DRSALAR (SEQ ID NO: 497), F3: RSDALST (SEQ ID NO: 498), F4: QSATRTK (SEQ ID NO: 499), F5: RSDTLSE (SEQ ID NO: 500), and F6: FRYARQY (SEQ ID NO: 501).

174. The epigenetic-modifying DNA-targeting system of claim 172 or 173, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 462, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

175. The epigenetic-modifying DNA-targeting system of any of claims 172-174, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

462.

176. The epigenetic-modifying DNA-targeting system of any of claims 172-175, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 469 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

177. The epigenetic-modifying DNA-targeting system of any of claims 172-176, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

469.

178. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-165, wherein the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in in SEQ ID NO:

456.

179. The epigenetic-modifying DNA-targeting system of claim 178, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: DQSNLRA (SEQ ID NO: 502), F2: QNAHRKT (SEQ ID NO: 503), F3: TSGSLSR (SEQ ID NO: 504), F4: sf-605940722474-20028.40 DRSNLSS (SEQ ID NO: 505), F5: RSAHLSR (SEQ ID NO: 506), and F6: RSDHLTQ (SEQ ID NO: 507).

180. The epigenetic-modifying DNA-targeting system of claim 178 or 179, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 463, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

181. The epigenetic-modifying DNA-targeting system of any of claims 178-180, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

463.

182. The epigenetic-modifying DNA-targeting system of any of claims 178-181, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 470 or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

183. The epigenetic-modifying DNA-targeting system of any of claims 178-182, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

470.

184. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, and 139-159, wherein the second DNA-binding domain is a ZFP that targets the target site of one or more repression genes set forth in SEQ ID NO:

457.

185. The epigenetic-modifying DNA-targeting system of claim 184, wherein the ZFP comprises a zinc finger recognition region comprising six zinc fingers denoted F1 through F6 in order from N-terminus to C-terminus, selected from F1-F6 as follows: F1: RSDHLSA (SEQ ID NO: 508), F2: QSSDLRR (SEQ ID NO: 509), F3: HHNNRTH (SEQ ID NO: 510), F4: RNASRTR (SEQ ID NO: 511), F5: RSDHLSA (SEQ ID NO: 512), and F6: RSANLTR (SEQ ID NO: 513).

186. The epigenetic-modifying DNA-targeting system of claim 185, wherein the ZFP comprises the sequence set forth in SEQ ID NO: 464, or a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

187. The epigenetic-modifying DNA-targeting system of claim 185 or 186, wherein the ZFP comprises the sequence set forth in SEQ ID NO:

464.

188. The epigenetic-modifying DNA-targeting system of any of claims 185-187, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO: 471 or a portion thereof, sf-605940722474-20028.40 or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

189. The epigenetic-modifying DNA-targeting system of any of claims 185-188, wherein the ZFP is encoded by the sequence set forth in SEQ ID NO:

471.

190. The epigenetic-modifying DNA-targeting system of any of claims 12-163, wherein each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence that is complementary to a target site of one of the one or more repression genes.

191. The epigenetic-modifying DNA-targeting system of any of claims 12-163 and 190, wherein each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence between 14 nt and 24 nt or between 16 nt and 22 nt in length.

192. The epigenetic-modifying DNA-targeting system of any of claims 12-163, 190, and 191, wherein each gRNA for targeting a target site of one of the one or more repression genes comprises a gRNA spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length.

193. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-192, wherein each gRNA for targeting a target site of one of the one or more repression genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:

69.

194. The epigenetic-modifying DNA-targeting system of any of claims 12-22, 25-28, 33-63, 90-93, 95-102, 107-120, 122, 124-133, 139-155, and 190-191, wherein each gRNA for targeting a target site of one of the one or more repression genes further comprises a gRNA scaffold sequence set forth in SEQ ID NO:

387.

195. The epigenetic-modifying DNA-targeting system of any of claims 12-20, 23-32, 37-55, 64-67, 90-92, 94, 103-119, 121-123, 134-137, 139-163, and 190-192, wherein at least one of the gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:35-37, or a contiguous portion thereof of at least 14 nt; sf-605940722474-20028.40 (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:38-40, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:44-46, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:47-49, or a contiguous portion thereof of at least 14 nt; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:50-52, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:53-55, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:56-58, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:59-61, or a contiguous portion thereof of at least 14 nt; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:62-64, or a contiguous portion thereof of at least 14 nt; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:65-67, or a contiguous portion thereof of at least 14 nt; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt; sf-605940722474-20028.40 (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:113-123, or a contiguous portion thereof of at least 14 nt; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:212-217 and 296-299, or a contiguous portion thereof of at least 14 nt; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:218-223, or a contiguous portion thereof of at least 14 nt; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:303-305 and 309-311, or a contiguous portion thereof of at least 14 nt.

196. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-123, 134-137, 139-163, 190-193, and 195, wherein at least one of the gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:35-37; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:38-40; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:44-46; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:47-49; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:50-52; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:53-55; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:56-58; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:59-61; sf-605940722474-20028.40 (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:62-64; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:65-67; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:113-123; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:212-217 and 296-299; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:218-223; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:303-305 and 309-311.

197. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, 190-193195, and 196, wherein each gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:35-37, or a contiguous portion thereof of at least 14 nt; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:38-40, or a contiguous portion thereof of at least 14 nt; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:44-46, or a contiguous portion thereof of at least 14 nt; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:47-49, or a contiguous portion thereof of at least 14 nt; sf-605940722474-20028.40 (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:50-52, or a contiguous portion thereof of at least 14 nt; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:53-55, or a contiguous portion thereof of at least 14 nt; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:56-58, or a contiguous portion thereof of at least 14 nt; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:59-61, or a contiguous portion thereof of at least 14 nt; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:62-64, or a contiguous portion thereof of at least 14 nt; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:65-67, or a contiguous portion thereof of at least 14 nt; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:113-123, or a contiguous portion thereof of at least 14 nt; (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:212-217 and 296-299, or a contiguous portion thereof of at least 14 nt; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:218-223, or a contiguous portion thereof of at least 14 nt; and sf-605940722474-20028.40 (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:303-305 and 309-311, or a contiguous portion thereof of at least 14 nt.

198. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-193, and 195-197, wherein each gRNA for targeting a target site of one of the one or more repression genes is selected from: (a) a gRNA targeting a target site for CD5 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:35-37; (b) a gRNA targeting a target site for KDM1A and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:38-40; (c) a gRNA targeting a target site for CBLB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:44-46; (d) a gRNA targeting a target site for DGKZ and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:47-49; (e) a gRNA targeting a target site for MYB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:50-52; (f) a gRNA targeting a target site for RASA2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:53-55; (g) a gRNA targeting a target site for ELOB and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:56-58; (h) a gRNA targeting a target site for GATA3 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:59-61; (i) a gRNA targeting a target site for CISH and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:62-64; (j) a gRNA targeting a target site for PRDM1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:65-67; (k) a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101; (l) a gRNA targeting a target site for CCNC and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:113-123; sf-605940722474-20028.40 (m) a gRNA targeting a target site for FAS and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:212-217 and 296-299; (n) a gRNA targeting a target site for Fli1 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:218-223; and (o) a gRNA targeting a target site for TGFBR2 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:303-305 and 309-311.

199. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-193, and 195-198, wherein at least one of the gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt.

200. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-193, and 195-199, wherein at least one of the gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101.

201. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-193, and 195-200, wherein each gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence comprising the sequence set forth in any one of SEQ ID NOS:91-101, or a contiguous portion thereof of at least 14 nt.

202. The epigenetic-modifying DNA-targeting system of any of claims 20, 23-32, 37- 55, 64-67, 90-92, 94, 103-119, 121-1239, 134-137, 139-163, and 190-193, and 195-201, wherein each gRNA for targeting a target site of one of the one or more repression genes is a gRNA targeting a target site for MED12 and comprising a gRNA spacer sequence set forth in any one of SEQ ID NOS:91-101.

203. The epigenetic-modifying DNA-targeting system of any of claims 1-202, wherein each transcriptional repressor domain epigenetically modifies a target site of one of the one or more repression genes to promote reduced transcription of one of the one or more repression genes. sf-605940722474-20028.40 204. The epigenetic-modifying DNA-targeting system of any of claims 1-203, wherein each transcriptional repressor domain is a KRAB domain, a DNMT3A domain, a DNMT3L domain, a DNMT3B domain, a DNMT3A-DNMT3L fusion protein domain, an ERF repressor domain, an Mxi1 repressor domain, a SID4X repressor domain, a Mad-SID repressor domain, an LSD1 repressor domain, an EZH2 repressor domain, a SunTag domain, a variant or portion of any of the foregoing, or a combination of any of the foregoing.

205. The epigenetic-modifying DNA-targeting system of any of claims 1-204, wherein each transcriptional repressor domain is a KRAB domain, a DNMT3A domain, a DNMT3L domain, or a combination of any of the foregoing.

206. The epigenetic-modifying DNA-targeting system of any of claims 1-205, wherein each transcriptional repressor domain comprises a KRAB domain or a variant or portion thereof that exhibits transcriptional repressor activity.

207. The epigenetic-modifying DNA-targeting system of any of claims 1-206, wherein each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:70, 235, and 355-358, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

208. The epigenetic-modifying DNA-targeting system of any of claims 1-205, wherein each transcriptional repressor domain comprises a DNMT3A domain or a variant or portion thereof that exhibits transcriptional repressor activity.

209. The epigenetic-modifying DNA-targeting system of any of claims 1-205 and 208, wherein each transcriptional repressor domain comprises the sequence set forth in SEQ ID NO:131 or 238, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

210. The epigenetic-modifying DNA-targeting system of any of claims 1-205, wherein each transcriptional repressor domain comprises a DNMT3L domain or a variant or portion thereof that exhibits transcriptional repressor activity.

211. The epigenetic-modifying DNA-targeting system of any of claims 1-205 and 210, wherein each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:133 and 240-242, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. sf-605940722474-20028.40 212. The epigenetic-modifying DNA-targeting system of any of claims 1-205, wherein each transcriptional repressor domain is a DNMT3A-DNMT3L fusion protein domain, a DNMT3B-DNMT3L fusion protein domain, or a variant thereof that exhibits transcriptional repressor activity.

213. The epigenetic-modifying DNA-targeting system of any of claims 1-205 and 212, wherein each transcriptional repressor domain comprises the sequence set forth in any one of SEQ ID NOS:135, 137, or 363, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

214. The epigenetic-modifying DNA-targeting system of any of claims 1-20, 23-32, 37-55, 64-67, 90-92, 94, 103-119, 121-123, 134-137, 139-163, 190-192, and 195-213, wherein each fusion protein of the at least one repressor DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOS:138-141, 332-351, and 365-384, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

215. The epigenetic-modifying DNA-targeting system of any of claims 1-11, 13, and 37-126, 139-189, and 203-213, wherein each fusion protein of the at least one repressor DNA- targeting module comprises the sequence set forth in any one of SEQ ID NOS:517-520, a portion thereof, or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

216. The epigenetic-modifying DNA-targeting system of any of claims 1-215, wherein delivery of the epigenetic-modifying DNA-targeting system to the T cell increases transcription of the one or more activation genes and decreases transcription of the one or more repression genes, compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system.

217. The epigenetic-modifying DNA-targeting system of any of claims 1-216, wherein delivery of the epigenetic-modifying DNA-targeting system to the T cell promotes increased T cell effector function upon T cell stimulation, compared to a T cell that has not been delivered the epigenetic-modifying DNA-targeting system.

218. The epigenetic-modifying DNA-targeting system of claim 216 or claim 217, wherein the delivery is transient delivery of the epigenetic-modifying DNA-targeting system to the T cell. sf-605940722474-20028.40 219. The epigenetic-modifying DNA-targeting system of claim 217 or claim 218, wherein the T cell effector function is selected from the group consisting of IL-2 production, IFN-gamma production, TNF-alpha production, T cell proliferation, and a combination of any of the foregoing.

220. The epigenetic-modifying DNA-targeting system of any of claims 217-219, wherein the T cell effector function is IL-2 production.

221. The epigenetic-modifying DNA-targeting system of any of claims 217-219, wherein the T cell effector function is IFN-gamma production.

222. The epigenetic-modifying DNA-targeting system of any of claims 217-219, wherein the T cell effector function is IL-2 production and IFN-gamma production.

223. The epigenetic-modifying DNA-targeting system of any of claims 217-219, wherein the T cell effector function is polyfunctional production of IL-2, IFN-gamma, and TNF- alpha.

224. The epigenetic-modifying DNA-targeting system of any of claims 217-223, wherein the T cell effector function further comprises T cell proliferation.

225. The epigenetic modifying DNA-targeting system of any of claims 217-224, wherein the T cell effector function further comprises killing of target cells.

226. The epigenetic-modifying DNA-targeting system of any of claims 217-225, wherein the T cell effector function further comprises T cell persistence.

227. The epigenetic-modifying DNA-targeting system of any of claims 217-226, wherein the increased T cell effector function occurs 48 hours or more after the delivery of the epigenetic-modifying DNA-targeting system to the T cell.

228. The epigenetic-modifying DNA-targeting system of any of claims 217-227, wherein the increased T cell effector function occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, or up to 71 days after the delivery of the epigenetic-modifying DNA- targeting system to the T cell.

229. The epigenetic-modifying DNA-targeting system of any of claims 217-228, wherein the T cell stimulation is with an anti-CD3 and anti-CD28 activation reagent.

230. The epigenetic-modifying DNA-targeting system of any of claims 1-229, wherein the T cell expresses a recombinant receptor. sf-605940722474-20028.40 231. The epigenetic-modifying DNA-targeting system of claim 230, wherein the recombinant receptor is a chimeric antigen receptor (CAR) or a T cell receptor (eTCR).

232. The epigenetic-modifying DNA-targeting system of claim 230 or claim 231, wherein the recombinant receptor is a CAR.

233. The epigenetic-modifying DNA-targeting system of any of claims 230-232, wherein the recombinant receptor is directed against an antigen, and the T cell stimulation is an antigen-specific stimulation of the recombinant receptor.

234. The epigenetic-modifying DNA-targeting system of any of claims 217-228 and 233, wherein the T cell stimulation is with antigen-expressing target cells.

235. The epigenetic-modifying DNA-targeting system of any of claims 217-234, wherein the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells.

236. A polynucleotide encoding the epigenetic-modifying DNA-targeting system of any of claims 1-235.

237. Two or more polynucleotides together encoding the epigenetic-modifying DNA- targeting system of any of claims 1-235.

238. A polynucleotide comprising (a) a promoter sequence; (b) a first nucleic acid sequence encoding at least one activator DNA-targeting module comprising a fusion protein comprising (i) a first zinc finger protein (ZFP) for targeting to a target site of one of the one or more activation genes and (ii) at least one transcriptional activator domain; (c) a second nucleic acid encoding at least one repressor DNA-targeting module comprising a fusion protein comprising (i) a second zinc finger protein (ZFP) for targeting to a target site of one of the one or more repression genes and (ii) at least one transcriptional repressor domain; and (d) a cleavable linker sequence located between the first and second nucleic acid sequence, wherein the promoter is operably linked to the first and second nucleic acid to control expression their expression.

239. The polynucleotide of claim 238, wherein the cleavable linker sequence encodes a self-cleaving peptide, optionally P2A or T2A.

240. The polynucleotide of claim 238 or claim 239, wherein the first ZFP targets the target site of one or more activation genes set forth in any one of SEQ ID NOs: 451-453; and the second ZFP targets the target site set forth in any one of SEQ ID NOs: 454-457. sf-605940722474-20028.40 241. The polynucleotide of any of claims 238-240, wherein the first ZFP comprises the sequence set forth in any one of SEQ ID NOs: 458-460; and the second ZFP comprises the sequence set forth in any one of SEQ ID NOs: 461-464.

242. The polynucleotide of any of claims 238-241, wherein the at least one transcriptional activator domain comprises a sequence set forth in SEQ ID NO: 549; and the at least one transcriptional repressor domain comprises sequences set forth in SEQ ID NO: 70 and SEQ ID NO:

135.

243. The polynucleotide of any of claims 238-242, wherein the at least one activator DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOs: 514-516; and the at least one repressor DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOs: 517-520.

244. The polynucleotide of any of claims 238-243, wherein the at least one activator DNA-targeting module comprises SEQ ID NO: 516; and the at least one repressor DNA- targeting module comprises SEQ ID NO:

517.

245. The polynucleotide of any of claims 238-244, wherein the polynucleotide, from N-terminus to C-terminus, comprises :(a) the promoter sequence; (b) the first nucleic acid encoding the at least one activator DNA-targeting module, (c) the cleavable linker sequence, and (d) the second nucleic acid encoding the at least one repressor DNA-targeting module.

246. The polynucleotide of any of claims 238-244, wherein the polynucleotide, from N-terminus to C-terminus, comprises: (a) the promoter sequence; (b) the second nucleic acid encoding the at least one repressor DNA-targeting module, (c) the cleavable linker sequence, and (d) the first nucleic acid encoding the at least one activator DNA-targeting module.

247. The polynucleotide of any of claims 238-246, wherein the self-cleaving peptide comprises the sequence set forth in SEQ ID NO:

352.

248. A vector comprising the polynucleotide of any of claims 236 and 238-247.

249. A vector comprising the two or more polynucleotides of claim 237.

250. The vector of claim 248 or claim 249, wherein the vector is a viral vector.

251. The vector of any of claims 248-250, wherein the vector is an adeno-associated virus (AAV) vector.

252. The vector of any of claims 248-251, wherein the vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector.

253. The vector of claim 248 or claim 249, wherein the vector is a non-viral vector. sf-605940722474-20028.40 254. The vector of any of claims 248, 249, and 253, wherein the vector is a lipid nanoparticle, a liposome, an exosome, or a cell penetrating peptide.

255. The vector of any of claims 248-249, 253, and 254, wherein the vector is a lipid nanoparticle.

256. The vector of any of claims 248-255, wherein the vector exhibits immune cell tropism, optionally wherein the vector exhibits T cell tropism.

257. Two or more vectors together comprising the two or more polynucleotides of claim 237.

258. The two or more vectors of claim 257, wherein the two or more vectors are viral vectors.

259. The two or more vectors of claim 257 or claim 258, wherein the two or more vectors are AAV vectors.

260. The two or more vectors of any of claims 257-259, wherein each vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector.

261. The two or more vectors of claim 257, wherein the two or more vectors are non- viral vectors.

262. The two or more vectors of claim 257 or claim 261, wherein each vector is a lipid nanoparticle, a liposome, an exosome, or a cell penetrating peptide.

263. The two or more vectors of any of claims 257, 261, and 262, wherein the two or more vectors are lipid nanoparticles.

264. The two or more vectors of any of claims 257-263, wherein the two or more vectors exhibit immune cell tropism.

265. The two or more vectors of any of claims 257-264, wherein the two or more vectors exhibit T cell tropism.

266. A modified T cell comprising the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, or the two or more polynucleotides of claim 237.

267. A modified T cell comprising an epigenetic or phenotypic modification resulting from being contacted by the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, the two or more polynucleotides of claim 237, the vector of any of claims 248-256, or the two or more vectors of any of claims 257-265. sf-605940722474-20028.40 268. The modified T cell of claim 266 or claim 267, wherein the modified T cell is derived from a cell from a subject.

269. The modified T cell of any of claims 266-268, wherein the modified T cell is derived from a primary T cell.

270. The modified T cell of any of claims 266-268, wherein the modified T cell is derived from a T cell progenitor, a pluripotent stem cell, or an induced pluripotent stem cell.

271. The modified T cell of any of claims 266-268, wherein the modified T cell is a tumor infiltrating lymphocyte (TIL) or is an engineered T cell that further comprises an eTCR or CAR.

272. A method of modulating transcription in a T cell, the method comprising introducing into a T cell the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, the two or more polynucleotides of claim 237, the vector of any of claims 248-256, or the two or more vectors of any of claims 257-265.

273. A method of increasing T cell effector function, the method comprising introducing into a T cell the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, the two or more polynucleotides of claim 237, the vector of any of claims 248-256, or the two or more vectors of any of claims 257-265.

274. The method of claim 272 or claim 273, wherein T cell effector function of the T cell is increased upon T cell stimulation compared to a T cell that has not been introduced to the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors.

275. The method of any of claims 272-274, further comprising stimulating the T cell.

276. The method of claim 274 or claim 275, wherein the T cell effector function is selected from the group consisting of IL-2 production, IFN-gamma production, TNF-alpha production, T cell proliferation, and a combination of any of the foregoing.

277. The method of any of claims 274-276, wherein the T cell effector function is IL-2 production.

278. The method of any of claims 274-276, wherein the T cell effector function is IFN-gamma production.

279. The method of any of claims 274-276, wherein the T cell effector function is IL-2 production and IFN-gamma production. sf-605940722474-20028.40 280. The method of any of claims 274-276, wherein the T cell effector function is polyfunctional production of IL-2, IFN-gamma, and TNF-alpha.

281. The method of any of claims 274-280, wherein the T cell effector function further comprises T cell proliferation.

282. The method of any of claims 274-281, wherein the T cell effector function further comprises killing of target cells.

283. The method of any of claims 274-282, wherein the T cell effector function further comprises T cell persistence.

284. The method of any of claims 274-283, wherein the increased T cell effector function occurs 48 hours or more after the introducing to the T cell.

285. The method of any of claims 274-284, wherein the increased T cell effector function occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, or up to 71 days after the introducing.

286. The method of any of claims 274-285, wherein the T cell stimulation is with an anti-CD3 and anti-CD28 activation reagent.

287. The method of any of claims 274-286, wherein the T cell is a tumor infiltrating lymphocyte (TIL) therapy.

288. The method of any of claims 274-286, wherein the T cell expresses a recombinant receptor.

289. The method of claim 288, wherein the recombinant receptor is a CAR or a eTCR.

290. The method of claim 288 or claim 289, wherein the recombinant receptor is directed against an antigen, and the T cell stimulation is an antigen-specific stimulation of the recombinant receptor.

291. The method of any of claims 274-285 and 290, wherein the T cell stimulation is with antigen-expressing target cells.

292. The method of any of claims 274-291, wherein the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells.

293. The method of any of claims 272-292, wherein the T cell is a T cell in a subject, and the method is carried out in vivo.

294. The method of any of claims 272-292, wherein the T cell is a T cell from a subject or derived from a cell from the subject, and the method is carried out ex vivo. sf-605940722474-20028.40 295. The method of claim 294, wherein the T cell is a primary T cell.

296. The method of claim 294, wherein the T cell is derived from a T cell progenitor, a pluripotent stem cell, or an induced pluripotent stem cell.

297. The method of any of claims 272-296, wherein the introducing is by transient delivery into the T cell.

298. The method of any of claims 272-297, wherein the introducing comprises electroporation, transfection, or transduction.

299. The method of any of claims 272-298, wherein the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors are transiently present in the T cell.

300. The method of any of claims 272-299, wherein the introducing increases transcription of the one or more activation genes in the T cell.

301. The method of any of any of claims 272-300, wherein the introducing represses transcription of the one or more repression genes in the T cell.

302. A modified T cell produced by the method of any of claims 272-301.

303. A method of treating a disease or condition in a subject, the method comprising administering to the subject the modified T cell of any of claims 266-271 and 302.

304. A method of increasing T cell persistence in T cells of a subject, the method comprising administering to the subject the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, the two or more polynucleotides of claim 237, the vector of any of claims 248-256, or the two or more vectors of any of claims 257-265.

305. The method of claim 304, wherein the T cells are from an adoptive T cell therapy for treating a disease or condition in the subject.

306. The method of claim 305, wherein the adoptive T cell therapy comprises T cells expressing a recombinant receptor directed against an antigen associated with the disease or condition.

307. The method of claim 305 or claim 306, wherein the administration is carried out prior to, concurrently with, or after administration of the adoptive T cell therapy.

308. The method of any of claims 305-307, wherein the administration is carried out after administration of the adoptive T cell therapy to the subject and at a time after the numbers or effector function of T cells of the adoptive T cell therapy are reduced, or are suspected of being reduced, in the subject. sf-605940722474-20028.40 309. A method of treating a disease or condition in a subject, the method comprising administering to a subject: an adoptive T cell therapy for treating the disease or condition; and the DNA-targeting system of any of claims 1-235, the polynucleotide of any of claims 236 and 238-247, the two or more polynucleotides of claim 237, the vector of any of claims 248- 256, or the two or more vectors of any of claims 257-265.

310. The method of any of claims 305 and 307-309, wherein the adoptive T cell therapy is a tumor infiltrating lymphocyte (TIL) therapy.

311. The method of any of claims 305-309, wherein the adoptive T cell therapy comprises T cells expressing a recombinant receptor directed against an antigen associated with the disease or condition.

312. The method of any of claims 306-308 and 311, wherein the recombinant receptor is an eTCR or CAR.

313. The method of any of claims 306-308, 311, and 312, wherein the antigen is a tumor antigen.

314. The method of any of claims 303 and 305-313, wherein the disease or condition is a cancer.

315. The method of claim 314, wherein the cancer is a hematological cancer or is a solid tumor.

316. The method of any of claims 303 and 305-313, wherein the disease or condition is an autoimmune condition and / or an inflammatory condition.

317. The method of any of claims 304-316, wherein the administering of the DNA- targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors results in transient delivery to the T cells of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors.

318. The method of any of claims 304-317, wherein the administering of the DNA- targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors increases transcription of the one or more activation genes in the T cells.

319. The method of any of any of claims 304-318, wherein the administering of the DNA-targeting system, the polynucleotide, the two or more polynucleotides, the vector, or the two or more vectors represses transcription of the one or more repression genes in the T cells. sf-6059407