Downy mildew resistance in spinach

EP4757586A1Pending Publication Date: 2026-06-17KWS VEGETABLES BV

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
KWS VEGETABLES BV
Filing Date
2023-08-07
Publication Date
2026-06-17

AI Technical Summary

Technical Problem

Spinach cultivars have developed susceptibility to Peronospora effusa, a pathogen causing downy mildew, with existing resistance genes being overcome by the pathogen, leading to a need for broad-spectrum resistance against multiple races and isolates.

Method used

Development of spinach plants with broad-spectrum resistance to Peronospora effusa races 1-19, isolates 4US, 21A, PV2144, Pe22-53, PV2240, and PV2201, achieved through introgression from plants grown from seeds deposited with the National Collection of Industrial, Food, and Marine Bacteria (NCIMB) under specific accession numbers.

Benefits of technology

The spinach plants exhibit stable resistance to a broad spectrum of Peronospora effusa races and isolates, effectively preventing infection and maintaining resistance in progeny, thus addressing the issue of pathogen adaptation and resistance loss.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000035_0001
    Figure IMGF000035_0001
  • Figure IMGF000035_0002
    Figure IMGF000035_0002
  • Figure IMGF000035_0003
    Figure IMGF000035_0003
Patent Text Reader

Abstract

The current invention relates to spinach plants comprising a gene or locus which leads to a broad spectrum resistance to Peronospora effusa (Pe). The invention also relates to progeny of said spinach plants, to propagation material of said spinach plants, to a cell of said spinach plants, to seed of said spinach plants, and to harvested leaves of said spinach plants. The invention also relates to use of said spinach plants in breeding to confer resistance against Peronospora effusa. The invention further relates to a method for generating a spinach plant having a broad spectrum resistance to Peronospora effusa (Pe).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DOWNY MILDEW RESISTANCE IN SPINACH

[0002] FIELD OF THE INVENTION

[0003] The invention pertains to spinach plants comprising a gene or locus which leads to a broad spectrum resistance to Peronospora effusa (Pe). The invention also relates to progeny of said spinach plants, to propagation material of said spinach plants, to a cell of said spinach plants, to seed of said spinach plants, and to harvested leaves of said spinach plants. The invention also relates to use of said spinach plants in breeding to confer resistance against Peronospora effusa. The invention further relates to a method for generating a spinach plant having a broad spectrum resistance to Peronospora effusa (Pe).

[0004] BACKGROUND

[0005] Spinach Spinacia oleracea) is a flowering plant from the Amaranthaceae family that is grown as a vegetable. The consumable parts of spinach are the leaves from the vegetative stage. Spinach is sold loose, bunched, in prepacked bags, canned, or frozen. There are three basic types of spinach, namely the savoy, semi-savoy and smooth types. Savoy has crinkly and curly leaves. Flat or smooth leaf spinach has in general broad, smooth leaves. Semi-savoy is a variety with slightly crinkled leaves. The main market for spinach is baby-leaf. Baby spinach leaves are usually of the flat-leaf variety and usually the harvested leaves are not longer than about eight centimeters. These tender, sweet leaves are sold loose rather than in bunch. They are often used in salads, but can also be lightly cooked. Downy mildew, which in spinach is caused by the pathogen Peronospora effusa (formerly known as P. farinosa f. sp. spinaciae), is a major threat for spinach growers, because it affects the harvested plant parts, namely the leaves. Infection makes the leaves unsuitable for sale and consumption, as it manifests itself phenotypically as yellow lesions on the older leaves, and on the abaxial leaf surface a greyish fungal growth can be observed. The infection can spread very rapidly, and it can occur both in glasshouse cultivation and in soil cultivation. The optimal temperature for formation and germination of P. effusa is 9 to 12° C., and it is facilitated by a high relative humidity. When pathogens are deposited on a humid leaf surface they can readily germinate and infect the leaf. Pathogen growth is optimal between 8 and 20° C. and a relative humidity of >80%, and growth can be observed within 6 and 13 days after infection. P. effusa can survive in the soil for up to 3 years, or in seeds or living plants. In recent years various resistance genes have been identified that provide spinach plants with a resistance against downy mildew. However, it has been observed that previously resistant spinach cultivars can again become susceptible to the pathogen. Investigations revealed that the cultivars themselves had not changed, and that the loss of downy mildew resistance must therefore be due to P. effusa overcoming the resistance in these spinach cultivars. The downy mildew races that were able to infect resistant spinach cultivars have been identified on a differential reference set, used to test spinach cultivars for resistance. The differential set comprises a series of spinach cultivars (hybrids) that have different resistance patterns to the currently identified pathogenic races. To date, 19 pathogenic races of spinach downy mildew (Pe) have been officially identified and characterized. Races 4 through 10 were identified between 1990 and 2009, which illustrates the versatility and adaptability of the pathogen to overcome resistances in spinach.

[0006] In different geographical regions different combinations of pathogenic races or isolates occur, and the spinach industry therefore has a strong demand for spinach cultivars that are resistant to as many relevant downy mildew races as possible, preferably to all races that may occur in their region, and even to the newest threats that cannot be countered with the resistances that are present in the commercially available spinach cultivars.

[0007] It is crucial to stay at the forefront of developments in this field, as Peronospora continuously develops the ability to break the resistances that are present in commercial spinach varieties. For this reason, new resistance genes are very valuable assets, and they form an important research focus in spinach breeding. The goal of spinach breeders is to rapidly develop spinach varieties with resistance to as many Peronospora races as possible, including the latest identified. To date, 19 Pe races are officially recognized by the International Working Group on Peronospora in spinach (IWGP) and made publicly available from the Department of Plant Pathology, University of Arkansas, Fayetteville, Ark. 72701, USA, and also from NAK Tuinbouw, Sotaweg 22, 2371 GD Roelofarendsveen, the Netherlands. Recently identified isolates SP1924 and UA202001E have been denominated Pe 18 and Pe 19, respectively.

[0008] It is the object of the invention to provide spinach plants, conferring a broad spectrum resistance, i.e. resistance to various Peronospora races and / or isolates, including the ones that have been most recently identified. SUMMARY OF THE INVENTION

[0009] The present invention provides spinach plants comprising resistance at least against one or more of Peronospora effusa races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016- 21A), PV2144, Pe22-53, PV2240 and PV2201. Said plants are obtainable by introgression from a plant grown from seeds of which representative samples have been deposited with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) Ltd., under the following accession numbers:

[0010] NCIMB Number

[0011] NCIMB 44186 NCIMB 44187 NCIMB 44188 NCIMB 44189 NCIMB 44190 NCIMB 44191 NCIMB 44192 NCIMB 44193 NCIMB 44194 NCIMB 44195

[0012] The plants have a broad spectrum of Peronospora -effusa resistance, which is stably transferred to the progeny.

[0013] DETAILED DESCRIPTION OF TH E INVENTION

[0014] Definitions

[0015] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the present invention.

[0016] The indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

[0017] "Plant variety" is a group of plants within the same botanical taxon of the lowest grade known, which (irrespective of whether the conditions for the recognition of plant breeder's rights are fulfilled or not) can be defined on the basis of the expression of characteristics that result from a certain genotype or a combination of genotypes, can be distinguished from any other group of plants by the expression of at least one of those characteristics, and can be regarded as an entity, because it can be multiplied without any change. Therefore, the term "plant variety" cannot be used to denote a group of plants, even if they are of the same kind, if they are all characterized by the presence of one or two loci or genes (or phenotypic characteristics due to these specific loci or genes), but which can otherwise differ from one another enormously as regards the other loci or genes.

[0018] "Spinach" or "cultivated spinach" or "cultivated Spinacia oleracea" refers herein to plants of the species Spinacia oleracea (or seeds from which the plants can be grown), and parts of such plants, bred by humans for food and having good agronomic characteristics. This includes any cultivated spinach, such as breeding lines (e.g., backcross lines, inbred lines), cultivars and varieties (open pollinated or hybrids). This includes any type of spinach, such as savoy, flat- or smooth-leaf spinach or semi-savoy types. Wild spinach (i.e. not cultivated spinach) or wild relatives of spinach, such as Spinacia tetrandra and Spinacia turkestanica, are not encompassed by this definition.

[0019] As used herein, the term "plant" includes the seed (from which the plant can be grown), the whole plant or any parts such as plant organs (e.g., harvested or nonharvested leaves, etc.), plant cells, plant protoplasts, plant cell- or tissue cultures from which whole plants can be regenerated, propagating or non-propagating plant cells, plants cells which are not in tissue culture (but which are for example in vivo in a plant or plant part), plant callus, plant cell clumps, plant transplants, seedlings, plant cells that are intact in plants, plant clones or micro-propagations, or parts of plants (e.g., harvested tissues or organs), such as plant cuttings, vegetative propagations, embryos, pollen, ovules, flowers, leaves, heads, seeds (produced on the plant after self-fertilization or cross-fertilization), clonally propagated plants, roots, stems, stalks, root tips, grafts, parts of any of these and the like, or derivatives thereof, preferably having the same genetic make-up (or very similar genetic makeup) as the plant from which it is obtained. Also, any developmental stage is included, such as seedlings, cuttings prior or after rooting, mature and / or immature plants or mature and / or immature leaves. When "seeds of a plant" are referred to, these either refer to seeds from which the plant can be grown or to seeds produced on the plant, after self-fertilization or cross-fertilization.

[0020] "Somatic cells" and "reproductive cells" can be distinguished, whereby somatic cells are cells other than gametes (e.g., ovules and pollen), germ cells and gametocytes. Gametes, germ cells and gametocytes are "reproductive cells.

[0021] "Tissue Culture" or "cell culture" refers to an in vitro composition comprising isolated cells of the same or a different type or a collection of such cells organized into plant tissue. Tissue cultures and cell cultures of spinach, and regeneration of spinach plants therefrom, is well known and widely published (see, e.g., Nguyen et al., 2013, Plant Biotechnology Reports, Vol. 7 Issue 1, p 99).

[0022] "Harvested plant material" refers herein to plant parts (e.g., leaves detached from the whole plant) which have been collected for further storage and / or further use.

[0023] "Harvested seeds" refers to seeds harvested from a line or variety, e.g., produced after self-fertilization or cross-fertilization and collected.

[0024] "Harvested leaves" as used herein refers to spinach leaves, i.e., the plant without the root system, for example substantially all (harvested) leaves.

[0025] "Progeny" or "progenies" or "descendants" as used herein refers to offspring, or the first and all further descendants derived from (obtainable from) (derivable from or obtained from) a plant of the invention that comprises (retains) the resistance gene in homozygous or heterozygous form and / or the resistance phenotype described herein. Progeny may be derived by regeneration of cell culture or tissue culture, or parts of a plant, or selfing of a plant, or by producing seeds of a plant. In further embodiments, progeny may also encompass spinach plants derived from crossing of at least one spinach plant with another spinach plant of the same or another variety or (breeding) line, and / or backcrossing, and / or inserting of a locus into a plant and / or mutation. A progeny is, e.g., a first generation progeny, i.e. the progeny is directly derived from, obtained from, obtainable from or derivable from the parent plant by, e.g., traditional breeding methods (selfing and / or crossing) or regeneration. However, the term "progeny" generally encompasses further generations such as second, third, fourth, fifth, sixth, seventh or more generations, i.e., generations of plants which are derived from, obtained from, obtainable from or derivable from the former generation by, e.g., traditional breeding methods, regeneration or genetic transformation techniques. For example, a second generation progeny can be produced from a first generation progeny by any of the methods mentioned above. Also, double haploid plants are progeny.

[0026] "Plant line" is for example a breeding line which can be used to develop one or more varieties.

[0027] "Fl, F2, F3, etc." refers to the consecutive related generations following a cross between two parent plants or parent lines. The plants grown from the seeds produced by crossing two plants or lines is called the Fl generation. Selfing the Fl plants results in the F2 generation, etc.

[0028] "Hybrid" refers to the seeds harvested from crossing one plant line or variety with another plant line or variety, and the plants or plant parts grown from said seeds.

[0029] "Fl hybrid" plant (or Fl hybrid seed) is the generation obtained from crossing two non-isogenic inbred parent lines. Thus, Fl hybrid seeds are seeds from which Fl hybrid plants grow.

[0030] An "interspecific hybrid" refers to a hybrid produced from crossing a plant of one species (e.g., S. oleracea) with a plant of another species (e.g., S. tetrandra or S. turkestanica) .

[0031] "Crossing" refers to the mating of two parent plants. Equally "Cross-pollination" refers to fertilization by the union of two gametes from different plants.

[0032] "Selfing" refers to the self-pollination of a plant, i.e., to the union of gametes from the same plant.

[0033] "Backcrossing" refers to a breeding method by which a (single) trait, such as Pe resistance conferred by a resistance gene, can be transferred from one genetic background (also referred to as "donor"; generally but not necessarily this is an inferior genetic background) into another genetic background (also referred to as "recurrent parent"; generally but not necessarily this is a superior genetic background). An offspring of a cross (e.g., an Fl plant obtained by crossing a wild spinach or wild relative of spinach with a cultivated spinach; or an F2 plant or F3 plant, etc., obtained from selfing the Fl) is "backcrossed" to the parent with the superior genetic background, e.g., to the cultivated parent.

[0034] After repeated backcrossing, the trait of the donor genetic background, e.g., the resistance gene, will have been incorporated into the recurrent genetic background. The terms "gene converted" or "conversion plant" or "single locus conversion" in this context refer to plants which are developed by backcrossing wherein essentially all of the desired morphological and / or physiological characteristics of the recurrent parent are recovered in addition to the one or more genes (e.g., the resistance gene) transferred from the donor parent.

[0035] The term "traditional breeding techniques" encompasses herein crossing, backcrossing, selfing, selection, chromosome doubling, double haploid production, embryo rescue, the use of bridge species, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic modification / transformation / transgenic methods), by which, for example, the - resistance gene can be obtained, identified, selected, and / or transferred.

[0036] "Regeneration" refers to the development of a plant from in vitro cell culture or tissue culture or vegetative propagation.

[0037] "Vegetative propagation", "vegetative reproduction" or "clonal propagation" are used interchangeably herein and mean the method of taking part of a plant and allowing that plant part to form at least roots where plant part is, e.g., defined as or derived from (e.g., by cutting off) leaf, pollen, embryo, cotyledon, hypocotyl, cells, protoplasts, meristematic cell, root, root tip, pistil, anther, flower, shoot tip, shoot, stem, fruit, and petiole. When a whole plant is regenerated by vegetative propagation, it is also referred to as a "vegetative propagation" or a "vegetatively propagated plant".

[0038] "Single locus converted (conversion) plant" refers to plants which are developed by plant breeding techniques comprising or consisting of backcrossing, wherein essentially all of the desired morphological and / or physiological characteristics of a spinach plant are recovered in addition to the characteristics of the single locus having been transferred into the plant via the backcrossing technique and / or by genetic transformation.

[0039] "Transgene" or "chimeric gene" refers to a genetic locus comprising a DNA sequence which has been introduced into the genome of a spinach plant by transformation. A plant comprising a transgene stably integrated into its genome is referred to as transgenic plant".

[0040] "Transgene" or "chimeric gene" refers to a genetic locus comprising a DNA sequence which has been introduced into the genome of a spinach plant by transformation. A plant comprising a transgene stably integrated into its genome is referred to as "transgenic plant".

[0041] "Pe" or "Peronospora effusa" or "downy mildew" refers to races of the pathogen Peronospora effusa. Pe 1-19 refers to the officially recognized races, which can be differentiated on the differential hosts of spinach, and which can be obtained from the Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen, The Netherlands, or via references provided by the ISF (International Seed Federation).

[0042] "Differential hosts" or "differentials" refers to the differential hosts of spinach for distinguishing Pe 1-19, which can be obtained from the Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen, The Netherlands, or via references provided by the ISF (International Seed Federation).

[0043] A "Pe resistant plant" or "downy mildew resistant plant" or a plant having "Pe resistance" or a "Pe resistant phenotype" refers to a spinach plant which is resistant against one or more pathogenic races and / or pathogenic isolates of Pe, as determined in a qualitative resistance assay under controlled environmental conditions. In such a resistance assay a plurality of plants (e.g., at least 2 replicates of at least 10 plants) of a genotype, are inoculated with a sporangia suspension of the race or isolate and incubated under suitable conditions. After a suitable incubation period (e.g., 7, 8, 9, 10, 11 or more days after inoculation) the plants are evaluated for symptoms. Susceptible controls should show sporulation at the time of symptom evaluation. Any plant showing sporulation on the cotyledons (and / or on the true leaf / leaves) is considered "susceptible", while any plant not showing any sporulation on the cotyledons (and / or on the true leaf / leaves) is considered "resistant". Additionally, any plants showing sparse sporulation on the tips of cotyledons (and / or on the true leaf / leaves), indicative of a reduced level of infection, is considered "intermediate resistant." A plant genotype with 95-100% of the inoculated plants being classified as "resistant" plants is considered to be resistant against the race or isolate. In the test greater than >95% of inoculated plants (preferably 100% of plants) of the susceptible control plant, such as cultivar 'Viroflay', should show sporulation. Suitable tests are described in Irish et al. 2007 (Plant Disease Vol. 91 No. 11, in Materials and Methods on page 1392-1394), or in Correll et al. 2010 ("Guidelines for Spinach Downy Mildew: Peronospora farinosa f sp. spinaciae (Ps) found on the website of the International Seed Federation). As used herein, "+" refers to susceptibility, refers to resistance, and "(-)" refers to intermediate resistance, also known as field resistance.

[0044] The term "locus" (loci plural) means a specific place or places or a site on a chromosome where, for example, a gene or genetic marker is found.

[0045] The term "allele(s)" means any of one or more alternative forms of a gene at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. A diploid plant species may comprise a large number of different alleles at a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).

[0046] The term "gene" means a (genomic) DNA sequence comprising a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked to regulatory region (e.g., a promoter). Different alleles of a gene are thus different alternative forms of the gene, which may be in the form of e.g., differences in one or more nucleotides of the genomic DNA sequence (e.g., in the promoter sequence, the exon sequences, intron sequences, etc.), mRNA and / or amino acid sequence of the encoded protein.

[0047] "Allelism test" refers to a genetic test whereby it can be tested whether a phenotype, such as Pe resistance, seen in two plants, is determined by the same gene or by different genes. For example, the plants to be tested are crossed with each other, the Fl is selfed and the segregation of the phenotypes amongst the F2 progeny is determined. Other segregating populations can equally be made (e.g., backcross populations). The ratio of segregation of the phenotype indicates if the genes are allelic (alleles of the same gene) or non-allelic (different, independent genes).

[0048] "Introgression fragment" or "introgression segment" or "introgression region" refers to a chromosome fragment (or chromosome part or region) which has been introduced into another plant of the same or related species by crossing or traditional breeding techniques, such as backcrossing, i.e. the introgressed fragment is the result of breeding methods referred to by the verb "to introgress" (such as backcrossing). In spinach, wild spinach or wild relatives of spinach are often used to introgress fragments of the wild genome into the genome of cultivated spinach. Such a spinach plant thus has a "genome of Spinacia oleracea", but comprises in the genome a fragment of a wild spinach or spinach relative. It is understood that the term "introgression fragment" never includes a whole chromosome, but only a part of a chromosome. The introgression fragment can be large, e.g., even half of a chromosome, but is preferably smaller, such as about 15 Mb or less, such as about 10 Mb or less, about 9 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less, about 3 Mb or less, about 2 Mb or less, about 1 Mb (equals 1,000,000 base pairs) or less, or about 0.5 Mb (equals 500,000 base pairs) or less, such as about 200,000 bp (equals 200 kilo base pairs) or less, about 100,000 bp (100 kb) or less, about 50,000 bp (50 kb) or less, about 25,000 bp (25 kb) or less.

[0049] "Physical distance" between loci (e.g., between molecular markers and / or between phenotypic markers) on the same chromosome is the actual physical distance expressed in base pairs (bp), kilobase pairs (kb) or megabase pairs (Mb).

[0050] "Genetic distance" between loci (e.g., between molecular markers and / or between phenotypic markers) on the same chromosome is measured by frequency of crossing-over, or recombination frequency (RF) and is indicated in centimorgans (cM). One cM corresponds to a recombination frequency of 1%. If no recombinants can be found, the RF is zero and the loci are either extremely close together physically or they are identical. The further apart two loci are, the higher the RF.

[0051] A genetic element, a locus, an introgression fragment or a gene or allele conferring a trait (such as resistance against Pe) is said to be "obtainable from" or can be "obtained from" or "derivable from" or can be "derived from" or "as present in" or "as found in" a plant or seed if it can be transferred from the plant or seed in which it is present into another plant or seed in which it is not present (such as a line or variety) using traditional breeding techniques without resulting in a phenotypic change of the recipient plant apart from the addition of the trait conferred by the genetic element, locus, introgression fragment, gene or allele. The terms are used interchangeably and the genetic element, locus, introgression fragment, gene or allele can thus be transferred into any other genetic background lacking the trait. Not only seeds deposited and comprising the genetic element, locus, introgression fragment, gene or allele can be used, but also progeny / descendants from such seeds which have been selected to retain the genetic element, locus, introgression fragment, gene or allele, can be used and are encompassed herein, such as commercial varieties developed from the deposited seeds or from descendants thereof. Whether a plant comprises the same genetic element, locus, introgression fragment, gene or allele as obtainable from the deposited seeds can be determined by the skilled person using one or more techniques known in the art, such as phenotypic assays, whole genome sequencing, molecular marker analysis, trait mapping, chromosome painting, allelism tests and the like.

[0052] The term "traditional breeding techniques" encompasses herein crossing, backcrossing, selfing, selection, chromosome doubling, double haploid production, embryo rescue, the use of bridge species, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic modification / transformation / transgenic methods), by which, for example, the resistance according to the current invention can be obtained, identified, selected, and / or transferred.

[0053] A "molecular marker", "genetic marker", or simply "marker" as used herein, refers to a nucleotide sequence that contains, surrounds or associates with variation (polymorphism) at a given genomic locus, and can be used to identify plants having a particular allele. Molecular markers can be developed based on polymorphisms that include, but are not limited to, single nucleotide polymorphism (SNP), insertion / deletion (InDei), simple sequence repeat (SSR), presence / absence variation (PAV), and copy number variation (CNV). Methods and techniques of developing, identifying and genotyping molecular markers are well known in the art.

[0054] A "single nucleotide variant" or "SNV" refers to a type of variant where one nucleotide base is replaced by another nucleotide base. SNV is similar in context with the more commonly used term "single nucleotide polymorphism (SNP)" but is a preferred term over SNP when no implications of frequency in a population are involved. For the purpose of this application, the terms SNV and SNP are used interchangeably.

[0055] As used herein, a "genetic determinant" refers to the genetic information in the genome of a plant that causes or associates with a trait of interest. Genetic determinants include, but are not limited to, genes, alleles, genetic markers, and quantitative trait loci (QTL).

[0056] As used herein, the term "screening" refers to a process of evaluating or identifying plant material for a property of interest. The property of interest can be a phenotypic property (e.g., disease resistance), or a genotypic property (e.g., presence of a certain allele).

[0057] Description

[0058] The present invention relates to spinach plants comprising resistance against at least one or more of Peronospora effusa races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19, isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22- 53, , PV2240 and PV2201. The resistance is a broad spectrum resistance and may further comprise resistance to further Pe races.

[0059] More specifically the plant is obtainable by (or obtained by, or derivable from, or derived from) introgression from a plant grown from seeds of which a representative sample has been deposited with NCIMB under the accession number 44186, or 44187, or 44188, or 44189, or 44190, or 44191, or 44192, or 44193, or 44194, or 44195, or any plant derived therefrom.

[0060] The resistance trait may be inherited by a single gene, preferably a dominant gene. In another embodiment, said resistance is conferred by two or more genes, or a multilocus. In fact, the resistance locus or loci (and the Pe resistance phenotype conferred thereby), can be transferred from the seeds deposited under any of the NCIMB accession numbers provided above, or from progeny of said seeds, into any spinach line or variety by traditional breeding techniques and can confer resistance against one or more of Pe races 1-19, isolates 4US also known as 4+, 21A (UA2016- 21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 (and optionally resistance against new pathogenic isolates) onto another spinach plant. Thus, for example, a spinach plant of the invention can be used as male or female parent in a cross with another spinach plant, and progeny, such as Fl, F2, F3, or further generations of selfing and / or backcross progeny (e.g., BC1, BC2, BC1S1, BC2S1, BC1S2, etc.) can be identified and selected, whereby the progeny comprise the same Pe resistance phenotype as the initial plant of the invention. Selection of progeny for the presence of the resistance can, therefore, be carried out using a disease resistance assay as described herein, whereby resistance against one or more (or all) of the Pe races is tested in the progeny.

[0061] Whether a spinach plant genotype (i.e., a spinach line or variety) comprises resistance against one or more Pe races or isolates can be tested using qualitative disease resistance assays under controlled environment conditions. Different protocols of such assays exist and can be used by the person skilled in the art. In short, seedlings of a plurality of plants of the plant genotype to be tested (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) are inoculated with inoculum of the Pe race and the seedlings are incubated under conditions which are favorable to the pathogen. Several days after incubation, the plants are assessed for infection symptoms, especially sporulation on the cotyledons and / or leaves (e.g., first true leaf), and each plant is categorized as "resistant" (showing no signs of sporulation) or "susceptible" (showing sporulation). If a certain percentage of all plants of a genotype are classified as "resistant", e.g., more than about 95%, 98%, 99% (or even 100%), then the spinach plant genotype is resistant to the race tested. Obviously, also one or more control plants (e.g., a susceptible line or variety, a resistant line or variety) should be included in the assay using the same treatment(s) and environmental conditions, to ensure that the assay works as expected.

[0062] Alternatively, or in addition to the phenotypic assay, selection or identification of a spinach plant (e.g., a progeny plant) comprising the resistance gene or locus / loci of the invention may be achieved by detecting one or more molecular markers linked to the resistance gene or locus. This aspect will be described elsewhere herein.

[0063] In one embodiment of the invention, the spinach plant is an inbred line, especially an inbred line which can be used as a parent for Fl hybrid seed production. In another embodiment of the invention, the spinach plant is a hybrid, especially an Fl hybrid. An Fl hybrid may be generated by crossing a first inbred parent line which comprises the resistance gene or locus / loci, preferably in homozygous form, with a second inbred parent line. The first inbred parent line may be a line developed from using seeds deposited under any of the NCIMB accession numbers provided above or from progeny of plants grown from these seeds, whereby the progeny retains the Pe resistance phenotype (and the resistance gene or locus / loci).

[0064] The second inbred parent line may be any spinach line, i.e. it may completely lack Pe resistance, or it may comprise a different Pe resistance gene (and different resistance phenotype) or it may also comprise the resistance gene or locus / loci according to the current invention.

[0065] As mentioned, the spinach plant according to the invention may be any type of spinach. For example, the spinach plant may be a savoy type, a semi-savoy type or flat- or smooth leaved spinach. In other words, the resistance can be introduced into any other spinach plant by introgression from a plant grown from seeds of which a representative sample was deposited under any of the NCIMB accession numbers provided above, or any spinach plant derived therefrom and comprising the gene or locus / loci. The deposited seeds are therefore a source of the resistance of the invention, as are spinach plants not directly obtained from the deposit, but for example indirectly obtained (e.g., later released commercial varieties) and which contain the resistance gene or locus / loci of the invention.

[0066] The resistance of the current invention was identified in wild material from a genebank and was introduced through backcrossing into S. oleracea. In one aspect, therefore, a spinach plant is provided comprising resistance against one or more isolates of Pe 1-19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and possibly new pathogenic isolates, wherein said resistance against Peronospora effusa is conferred by an introgression fragment from wild spinach or from a wild relative of spinach. In a preferred aspect, a spinach plant is provided comprising resistance against at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016- 21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0067] In one embodiment, the introgression fragment is the fragment as found in (and as obtainable from; or obtained from; or derivable from; or derived from) spinach seeds, a representative sample of seeds having been deposited with the NCIMB under any of the accession numbers provided above. The fragment can be identified by various methods, such as chromosome painting or sequencing the spinach genome and identifying chromosome parts which are introgressions from wild spinach or wild relatives of spinach. The fragment can also be identified by one or more molecular markers (e.g., SNP markers, AFLP markers, RFLP markers, etc.), especially molecular markers which are polymorphic between cultivated spinach and the wild introgression fragment.

[0068] In another embodiment, the introgression fragment is derived from the fragment as found in spinach seeds, a representative sample of seeds having been deposited with the NCIMB under any of the NCIMB accession numbers provided above , whereby the introgression fragment is shorter but retains the resistance gene or locus / loci (and the Pe resistance phenotype conferred by the gene). Spinach plants comprising such shorter introgression fragments can be generated by crossing a plant of the invention with another spinach plant and selecting recombinant progeny which retain the resistance phenotype conferred by the resistance gene or locus / loci, but which contain a shorter introgression fragment.

[0069] In one aspect a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1-19, preferably at least against Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, , PV2240 and PV2201. The method comprises the steps of: a) Providing a first spinach plant comprising resistance against one or more Pe races; ; b) Crossing said first spinach plant with a second spinach plant to produce Fl seeds; c) Optionally, selfing the plants grown from Fl seeds one or more times to produce F2, F3 or further generation selfing progeny; d) Identifying (or selecting) spinach plants grown from Fl, F2, F3 seeds or further generation selfing progeny which have resistance against the said one or more Pe races; e) Optionally, crossing said identified (or selected) Fl progeny or selfing progeny to any spinach plant, to produce a backcross progeny; f) Optionally, selecting backcross progeny comprising resistance against the said one or more Pe races (e.g., preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201).

[0070] In the above embodiment, the term "any spinach plant" encompasses the first spinach plant of step (a), the second spinach plant of step (b), or any other spinach plant.

[0071] In another embodiment a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1-19, preferably against at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. The method comprises the steps of: a) Providing a spinach plant comprising an introgression fragment obtainable from (or as in) accession NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195, said introgression fragment conferring resistance at least against one or more of Pe races 1-19, preferably at least against Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016- 21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201; b) Crossing said spinach plant with a second spinach plant, for example with a spinach plant which is susceptible against one or more of Pe races 1-19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201., to produce Fl seeds; c) Optionally selfing the plants grown from Fl seeds one or more times to produce F2, F3 or further generation selfing progeny; d) Identifying spinach plants grown from Fl, F2, F3 seeds or further generation selfing progeny which have resistance at least against one or more of Pe races 1-19, preferably at least against Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment; e) Optionally, crossing said identified Fl progeny or selfing progeny to any spinach plant , to produce a backcross progeny; f) Optionally, selecting backcross progeny which comprises resistance against the one or more Pe races 1-19 (e.g., preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19), isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment.

[0072] Regarding both methods, the following is encompassed herein.

[0073] In one aspect, the plant of a) comprises the resistance trait as found in seeds deposited under a NCIMB accession number NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195. The spinach plant may be the plant grown from the seeds of the deposit or any spinach plant made using, or having used, the seed deposit and which retains the Pe resistance phenotype (and the gene or locus / loci conferring it). This includes commercial spinach varieties which were made using the seed deposit. Thus, the spinach plant of a) comprises the resistance gene / locus / loci according to the invention, e.g., as found in (or as obtainable from; obtained from; derivable from; derived from)NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195. The plant in a) may therefore be a plant grown from seeds, a representative sample of which has been deposited under any of the NCIMB accession numbers listed above.

[0074] Selections (or identification) in step d) and / or f) may be made based on the phenotype ( / .e., using a Pe resistance assay) and / or based on molecular methods, such as detection of molecular markers linked to the resistance gene or locus / loci, or other methods such as sequencing.

[0075] According to an aspect of the present invention, plants according to the current invention comprise alleles identifiable by one or more of SEQ ID NOs: 1-15. According to a further aspect, plants according to the present invention comprise alleles identifiable by at least six, at least seven, at least eight, at least nine, or at least ten of the SEQ ID NOs: 1-15. Preferably, the plants of the present invention comprise alleles or sequences comprising one or more of the SEQ ID NOs: 1-15. According to another embodiment, the different S. tetrandra introgression fragments are identifiable by generating specific haplotypes (as shown in Table III), through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs: l-15.

[0076] Preferably, said plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs: 1-15, whereby the presence of at least one or more of the above sequences, preferably at least 6 or more of the above sequences is a prerequisite for a plant according to the current invention. In another embodiment, selection of plants or progeny according to the current invention occurs on the basis of the presence of at least one sequence, preferably of at least 6 of the sequences selected from SEQ ID NOs: 1-15 in said plants or progeny. In step b) the first spinach plant is, in one aspect, crossed with a spinach plant which is susceptible against at least one of the Pe races against which the plant of a) is resistant. If the second parent in b) is a spinach plant which is susceptible against at least one of the Pe races against which the plant of a) is resistant, then the selection in step (d) and / or (f) may be based on selecting plants which now have resistance against that race. Steps e) and f) may be repeated one or more times and preferably on the basis of the sequences given in one or more of SEQ ID NOs: 1-15.

[0077] In the above methods, also plants can be selected and / or identified which retain the Pe resistance phenotype according to the current invention, but which have a smaller introgression fragment. This can have advantages, as negative traits coupled to the wild introgression fragment can thereby be removed. Initial introgression fragments from wild sources can be quite large, e.g., 20 Mb or 30 Mb. It is therefore preferred to reduce the size of the introgression fragment by recombination and to select plants comprising smaller introgression fragments, but which retain the resistanceconferring part. So, spinach with all sizes of introgression fragments originating from (or derived from; or derivable from; or obtained from; or obtainable from) seeds deposited with NCIMB, under any of the accession numbers provided above are included herein, as long as the Pe resistance conferring part is retained in the spinach plant. As mentioned, the presence can be tested and selected phenotypically and / or using molecular methods known in the art. By preference, selection occurs on the basis of the sequence as given in one or more of SEQ ID NOs: 1-15.

[0078] In another aspect the plants according to the current invention is obtained by genome editing techniques such as CRISPR Cas, or mutagenesis techniques, preferably by introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO: 1-15.

[0079] Also plants obtainable or obtained by any of the above methods are embodiments of the invention. The plants according to the invention may be any cultivated spinach, e.g., savoy, semi-savoy, flat- or smooth leaved spinach. They may be inbred lines, Fl hybrids, double haploids, transgenic plants, mutant plants, etc.

[0080] Plants of the invention can be used to generate progeny, which have or retain the Pe resistance phenotype as obtainable from (as present in; as derivable from; as obtained or derived from) seeds deposited with NCIMB under any of the accession numbers provided above. To generate progeny, a spinach plant according to the invention can be selfed and / or crossed one or more times with another spinach plant and seeds can be collected. The presence of resistance according to the current invention or the gene / locus / loci responsible therefor in the progeny plants can be determined by the Pe resistance phenotype and / or molecular methods, such as molecular markers (e.g., SNP markers) closely linked to the gene or locus / loci. Also seeds from which the plants of the invention can be grown are provided. In one embodiment, the use of a spinach plant, of which representative seeds have been deposited with NCIMB under any of the accession numbers provided above , or progeny thereof (e.g., obtained by selfing) is provided for generating a spinach plant comprising Pe resistance at least against one or more of Pe races 1-19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. Preferably the spinach plant comprises resistance against at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0081] In another embodiment, methods of use a spinach plant comprising resistance against at least one or more of Pe races 1-19, preferably Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.) conferred by an introgression fragment obtainable from (or as present in; as derivable from; as obtained or derived from) seeds deposited with NCIMB under any of the accession numbers provided above , or from progeny thereof (e.g., obtained by selfing), is provided for generating a spinach plant comprising resistance against one or more of Pe races 1- 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22- 53, PV2240 and PV2201.

[0082] It is noted that also allelism tests can be used to determine whether the resistance gene in a spinach plant is the same gene / locus / loci or a different gene / locus / loci as the resistance gene / locus / loci as present in any of the NCIMB accession numbers provided above (or in progeny thereof). For instance, NCIMB 44186 (or progeny) can be crossed with another spinach plant comprising the same resistance phenotype and in progeny of such a cross one can determine in which ratios the phenotype segregates. So in one aspect a spinach plant is provided comprising resistance against one or more of Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, wherein said resistance gene / locus / loci conferring said resistance phenotype is the gene / locus / loci as present in NCIMB44186 (or progeny thereof), as determinable in an allelism test. Allelism tests for dominant genes are known in the art (see, e.g., Hibberd et al., 1987, Phytopathology 77: 1304-1307).

[0083] Also seeds from which any of the plants of the invention can be grown are provided, as are containers or packages containing or comprising such seeds. Seeds can be distinguished from other seeds due to the presence of the resistance gene / locus / loci, either phenotypically (based on plants having the resistance phenotype according to the current invention) and / or using molecular methods.

[0084] In one aspect, seeds are packaged into small and / or large containers (e.g., bags, cartons, cans, etc.). The seeds may be pelleted prior to packing (to form pills or pellets) and / or treated with various compounds, such as seed coatings.

[0085] Pelleting creates round or rounded shapes, which are easily sown with modern sowing machines. A pelleting mixture typically contains seeds and at least glue and filler material. The latter could be, for example, clay, mica, chalk or cellulose. In addition, certain additives can be included to improve particular properties of the pellet, e.g., a seed treatment formulation comprising at least one insecticidal, acaricidal, nematocidal or fungicidal compound can be added directly into the pelleting mixture or in separate layers. A seed treatment formulation can include one of these types of compounds only, a mixture of two or more of the same type of compounds or a mixture of one or more of the same type of compounds with at least one other insecticide, acaricide, nematicide or fungicide.

[0086] Formulations especially suitable for the application as a seed treatment can be added to the seed in the form of a film coating also including the possibility of using the coating in or on a pellet, as well as including the seed treatment formulation directly into the pellet mixture. Characteristically, a film coating is a uniform, dust-free, water permeable film, evenly covering the surface of all individual seeds.

[0087] Besides the formulation, the coating mixture generally also contains other ingredients such as water, glue (typically a polymer), filler materials, pigments and certain additives to improve particular properties of the coating. Several coatings can be combined on a single seed.

[0088] In addition, several combinations with film coating are possible: the film coating can be added on the outside of the pellet, in between two layers of pelleting material, and directly on the seed before the pelleting material is added. Also, more than 1 film coating layer can be incorporated in a single pellet. A special type of pelleting is encrusting. This technique uses less filler material, and the result is a "mini-pellet".

[0089] Seeds may also be primed. Spinach is often primed. Priming is a water-based process that is performed on seeds to increase uniformity of germination and emergence from the soil, and thus enhance vegetable stand establishment. Priming decreases the time span between the emergence of the first and the last seedlings. Methods how to prime spinach seeds are well known in the art.

[0090] In a further aspect, plant parts obtained from (obtainable from) a plant of the invention are provided herein, and containers or packages comprising said plant parts. In a preferred embodiment, the plant parts are leaves of spinach plants of the invention, preferably harvested leaves, or parts of these. Leaves may be loose, bunched, fresh (e.g., in bags), frozen, blanched or boiled. Leaves may be fresh or processed, they may be part of food or feed products, such as salads, etc. Other plant parts, of plants of the invention, include stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds etc.

[0091] Seeds include for example seeds produced on the plant of the invention after self- pollination or seed produced after cross-pollination, e.g., pollination of a plant of the invention with pollen from another spinach plant or pollination of another spinach plant with pollen of a plant of the invention.

[0092] In a further aspect, the plant part is a plant cell. In still a further aspect, the plant part is a non-regenerable cell or a regenerable cell.

[0093] In another aspect the plant cell is a somatic cell. A non-regenerable cell is a cell which cannot be regenerated into a whole plant through in vitro culture, but the non- regenerable cell may be in a plant or plant part (e.g., leaves) of the invention.

[0094] Moreover, there is provided an in vitro cell culture or tissue culture of spinach plants of the invention in which the cell- or tissue culture is derived from a plant parts described above, such as, for example and without limitation, leaves, pollen, embryos, cotyledon, hypocotyls, callus, meristematic cells, roots, root tips, anthers, flowers, seeds or stems, somatic cells, reproductive cells.

[0095] Also provided are spinach plants regenerated from the above-described plant parts, or regenerated from the above-described cell or tissue cultures, said regenerated plant having a Pe resistance phenotype, i.e., retains the resistance gene / locus / loci (or the introgression fragment comprising the resistance gene / locus / loci) of the invention. These plants can also be referred to as vegetative propagations of plants of the invention. Also provided are harvested leaves of plants of the invention and packages comprising a plurality of leaves of plants of the invention. These leaves thus comprise the resistance of the invention, detectable by e.g., linked molecular markers or phenotypically (for the originally used whole plant and / or regenerated plant).

[0096] The invention also provides for a food product, comprising or consisting of a plant or plant part of the plant of the invention, suitable for edible use in humans. Preferably, said plant part is a leaf or a plurality thereof.

[0097] The invention further provides for a feed composition or a product, comprising or consisting of a plant or a plant part of the plant of the invention.

[0098] The food or feed product may be fresh, raw, or processed, e.g. comminuted or chopped, thermally processed (for example, steamed, boiled, fried, blanched), encased (e.g., canned, packaged) and / or frozen etc. Examples of food products according to the present invention, are salad or salad mixtures, or frozen vegetable mixtures comprising leaves or parts of leaves of plants of the invention.

[0099] A spinach plant of the invention or a progeny thereof retaining the Pe resistance phenotype conferred by the gene / locus / loci and / or retaining the introgression fragment comprising the gene / locus / loci, as present in any of the NCIMB accession numbers provided above, and parts of the afore-mentioned plants, can be suitably packed for, e.g., transport, and / or sold fresh. Such parts encompass any cells, tissues and organs obtainable from the seedlings or plants, such as but not limited to: leaves, cuttings, pollen, parts of leaves, and the like.

[0100] Leaves may be harvested immature, as baby-leaf or baby spinach, or mature. A plant, plants or parts thereof may be packed in a container (e.g., bags, cartons, cans, etc.) alone or together with other plants or materials. Parts can be stored and / or processed further. Encompassed are therefore also food or feed products comprising one or more of such parts, such leaves or parts thereof obtainable from a plant of the invention, a progeny thereof and parts of the afore-mentioned plants. For example, containers such as cans, boxes, crates, bags, cartons, Modified Atmosphere Packaging, films (e.g., biodegradable films), etc. comprising plant parts of plants (fresh and / or processed) of the invention are also provided herein.

[0101] In another embodiment, plants and parts of spinach plants of the invention, and progeny of spinach plants of the invention are provided, e.g., grown from seeds, produced by sexual or vegetative reproduction, regenerated from the abovedescribed plant parts, or regenerated from cell or tissue culture, in which the reproduced (seed propagated or vegetatively propagated) plant comprises resistance at least against one or more of Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0102] As mentioned before, whether or not a plant, progeny or vegetative propagation comprises the Pe resistance phenotype as conferred by the current invention can be tested phenotypically using e.g., the Pe disease resistance assays as described above; and / or using molecular techniques such as molecular marker analysis, DNA sequencing (e.g., whole genome sequencing to identify the wild introgression), chromosome painting, etc.

[0103] In one embodiment, the resistance gene / locus / loci obtainable from (obtained from; as found in) plants deposited with NCIMB under any of the accession numbers provided above, or progeny thereof, can be combined with other Peronospora effusa resistance genes or resistance loci or with other traits, such resistance against bacteria (e.g., Pseudomonas syringae pv. spinacea; Erwinia carotovora), fungi (e.g., Albugo occidentalis; Colletotrichum dematium fsp. spinaciae; Stemphylium beticola (formerly known as Stemphylium botryosum f sp. spinaciae), Stemphylium vesicarium, Stemphylium drummondi viruses (e.g., viruses causing curly top disease) or nematodes. This can be done by traditional breeding techniques, e.g., by backcrossing in order to introduce one or more traits into a plant of the invention or in order to introduce the gene / locus / loci of a plant of the invention into another spinach plant comprising such one or more additional traits. Thus, in one aspect a plant of the invention is used as a donor of the resistance according to the current invention, while in another aspect a plant of the invention is used as recipient of one or more other traits.

[0104] Furthermore, the invention provides for progeny comprising or retaining the Pe resistance phenotype, such as progeny obtained by, e.g., selfing one or more times and / or cross-pollinating a plant of the invention with another spinach plant of a different variety or breeding line, or with a spinach plant of the invention one or more times. In particular, the invention provides for progeny that retain the resistance gene / locus / loci (conferring the Pe resistance phenotype) of (as found in) any of the NCIMB accession numbers provided above. In one aspect the invention provides for a progeny plant comprising the resistance according to the current invention, such as a progeny plant that is produced from a spinach plant comprising the resistance according to the current invention by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation.

[0105] Mutation may be spontaneous mutations or human induced mutations or somaclonal mutations. In one embodiment, plants or seeds of the invention may also be mutated (by e.g., irradiation, chemical mutagenesis, heat treatment, TILLING, etc.) and / or mutated seeds or plants may be selected (e.g., natural variants, somaclonal variants, etc.) in order to change one or more characteristics of the plants. According to an embodiment of the present invention, the introgression fragment or a part thereof conferring resistance to one or more of the Pe races 1-19 given above, is introduced to a plant cell, by genome editing technologies, for example CRISPR gene editing.

[0106] In some embodiments, the resistance alleles can be modified or mutated using mutagenesis, gene editing techniques, or other methods known in the art to obtain the plants of the current disclosure. In some embodiments, the gene editing technique is selected from the group of transcription activator-like effector nuclease (TALEN) gene editing techniques, clustered Regularly Interspaced Short Palindromic Repeat (CRISPR / Cas9) gene editing techniques, or zinc- finger nuclease (ZFN) gene editing techniques. In some embodiments, the mutation is introduced using one or more vectors including gene editing components selected from the group of a CRISPR / Cas9 system, a TALEN, a zinc finger, and a meganuclease designed to target a nucleic acid sequence encoding a resistance gene.

[0107] Similarly, plants of the invention may be transformed and regenerated, whereby one or more chimeric genes are introduced into the plants. Transformation can be carried out using standard methods, such as Agrobacterium tumefaciens mediated transformation or biolistics, followed by selection of the transformed cells and regeneration into plants.

[0108] A desired trait (e.g., genes conferring pest or disease resistance, herbicide, fungicide or insecticide tolerance, etc.) can be introduced into the plants, or progeny thereof, by transforming a plant of the invention or progeny thereof with a transgene that confers the desired trait, wherein the transformed plant retains the resistance according to the current invention and the Pe resistance phenotype conferred by it and contains the desired trait. The resistance gene or locus / loci may be transferred to progeny by further breeding. In one aspect progeny are Fl progeny obtained by crossing a plant of the invention with another plant or SI progeny obtained by selfing a plant of the invention. Also encompassed are F2 progeny obtained by selfing the Fl plants, or further generation progeny. "Further breeding" encompasses traditional breeding techniques (e.g., selfing, crossing, backcrossing), marker-assisted breeding, and / or mutation breeding. In one embodiment, the progeny have the Pe resistance phenotype of a plant derivable from a seed deposited with NCIMB under any of the accession numbers provided above .

[0109] The current invention further relates to a method for producing spinach seed, comprising crossing a plant of the invention with itself or a different spinach plant and harvesting the resulting seed. In a further embodiment the invention relates to seed produced according to this method and / or a spinach plant produced by growing such seed. Thus, a plant of the invention may be used as male and / or female parent, in the production of spinach seeds, whereby the plants grown from said seeds comprise resistance at least against one or more of Pe races 1-19, preferably Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201).

[0110] Thus, in one aspect progeny of a spinach plant of the invention are provided, wherein the progeny plant is produced by selfing, crossing, mutation, or transformation and wherein the progeny retain the resistance gene / locus / loci (and phenotype conferred by it) described herein, i.e. obtainable by crossing a spinach plant, grown from seeds deposited under any of the NCIMB accession numbers provided above, with another spinach plant. In other words, the resistance gene or locus (or introgression fragment comprising the gene or locus) present in or as derivable from seed deposited with NCIMB under any of the accession numbers provided above, is retained in the progeny plants.

[0111] Molecular markers may also be used to aid in the identification of the plants (or plant parts or nucleic acids obtained therefrom) containing the resistance gene or locus or allele(s). For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the resistance gene, locus or allele. This can be done by crossing a resistant spinach plant with a susceptible spinach plant and developing a segregating population (e.g., F2 or backcross population) from that cross. The segregating population can then be phenotyped for Pe resistance and genotyped using e.g., molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the Pe resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the resistance gene or locus can be identified. Molecular markers which are closely linked to resistance locus or loci, e.g., markers at a 5 cM distance or less, can then be used in detecting and / or selecting plants (e.g., plants of the invention or progeny of a plant of the invention) or plant parts comprising or retaining the introgression fragment comprising the resistance gene or locus. Such closely linked molecular markers can replace phenotypic selection (or be used in addition to phenotypic selection) in breeding programs, i.e. in Marker Assisted Selection (MAS). Preferably flanking markers are used in MAS, i.e. one marker on either side of the resistance gene or locus / loci.

[0112] Any other type of molecular marker and / or other assay that is able to identify the relative presence or absence of a trait of interest in a plant or plant part can also be useful for breeding purposes.

[0113] Said progeny plants according to the current invention comprise alleles identifiable by one or more of SEQ ID NOs: 1-15.. According to a further aspect, plants according to the present invention comprise alleles identifiable by at least six, at least seven, at least eight, at least nine, or at least ten of SEQ ID NOs: 1-15. According to another aspect, the plants of the present invention comprise alleles or sequences comprising one or more of the SEQ ID NOs: 1-15. Preferably, the plants of the present invention comprise at least 6 of the sequences selected from SEQ ID NOs: 1-15. According to a another embodiment, the different S. tetrandra introgression fragments are identifiable by generating specific haplotypes (as shown in Table III), through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs: l-15.

[0114] Preferably said progeny plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs: 1-15, whereby the presence of at least one or more of the above sequences, preferably at least 6 or more of the above sequences is a prerequisite for a plant according to the current invention. In some embodiments, selection of plants according to the current invention occurs on the basis of the presence of at least one sequence selected from SEQ ID NOs: 1-15, preferably of at least 6 or more of the above sequences. 1

[0115] Deposit Information

[0116] A total of 6250 seeds of spinach lines X21-018-XX (where XX is selected from 50-4; 58-l;5-2; 56-5; 19-12; 23-l;31-l; 15-11; 10-2; 16-6) were deposited with NCIMB under the accession numbers provided in Example 1 by KWS Vegetables B.V. on [25 / 07 / 2023], at the NCIMB Ltd., Ferguson Building, Craibstone Estate, Bucksbum, Aberdeen AB21 9YA, United Kingdom (NCIMB). Subject to 37 C.F.R. § 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.). The biological material shall be made available as provided for under Rule 13bis.6 PCT and Rule 32(1) EPC only by the issuance of a sample to an Expert.

[0117] Enumerated Embodiments

[0118] The following enumerated embodiments are representative of some aspects of the invention.

[0119] 1. A spinach plant comprising resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0120] 2. The spinach plant of embodiment 1, wherein the plant is obtainable by introgression from a plant grown from seeds of which a representative sample has been deposited with NCIMB under the accession number NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, NCIMB 44195, or any plant derived therefrom.

[0121] 3. The spinach plant of embodiment 1 or 2, whereby said spinach plant comprises alleles identifiable by one or more of SEQ ID NO: 1-15.

[0122] 4. The spinach plant of embodiment 3, whereby said allele or sequence is linked to the resistance. 5. The spinach plant of any one of embodiments 1 to 4, whereby said spinach plant is a hybrid plant.

[0123] 6. The spinach plant of any one of embodiments 1 to 5, whereby said spinach plant is an inbred plant.

[0124] 7. The spinach plant of any one of embodiments 1 to 6, whereby said plant is selected from the group consisting of: savoy, semi-savoy, flat or smooth leaved.

[0125] 8. A progeny plant of the spinach plant of any one of embodiments 1 to 7, wherein said progeny plant retains resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8,

[0126] 9. 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016- 21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0127] 9. The progeny plant of embodiment 8, wherein the progeny plant is produced by one or more methods selected from the group consisting of: selfing, crossing, mutation, genome editing or transformation.

[0128] 10. The progeny plant of embodiment 8 or 9, whereby said progeny plant comprise alleles identifiable by one or more SEQ ID NO: 1-15.

[0129] 11. Seed from which a spinach plant of any one of embodiments 1 to 7 can be grown.

[0130] 12. Use of one or more seeds as deposited with NCIMB under the accession number NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195, or a progeny thereof, for generating a spinach plant comprising resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

[0131] 13. 16, 17, 18 and 19, preferably at least Pe races7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, PE22-53, PV2240 and PV2201.

[0132] 13. A part of the spinach plant of any one of embodiments 1 to 7 or a part of the progeny plant of any one of embodiments 8 to 10, wherein the part is selected from the group consisting of: stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds, leaves.

[0133] 14. A cell culture or tissue culture comprising cells or tissue derived from the part according to the embodiment 13.

[0134] 15. A spinach plant regenerated from the cell or tissue culture of embodiment 14, wherein said spinach plant comprises resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0135] 16. The spinach plant of embodiment 15, wherein said spinach plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO: 1-15.

[0136] 17. A food product comprising any plant part suitable for edible use in humans, preferably the leaves of the plant of any one of embodiments 1 to 7 or a progeny according to any of the claims 8 to 10.

[0137] 18. A container comprising one or more spinach plants of any one of embodiments 1 to 10, or 15 to 16, in a growth substrate for harvest of plant parts, preferably leaves from said plants.

[0138] 19. A method for generating a spinach plant comprising resistance at least against one or more Peronospora effusa (Pe) races or isolates, preferably a plurality of Peronospora effusa (Pe) races or isolates, comprising the steps of: a) providing a spinach plant comprising an introgression fragment obtainable from accession NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or 44193, or NCIMB 44194, or NCIMB 44195, wherein said introgression fragment confers resistance against one or more of Pe races; b) crossing said spinach plant with another spinach plant, which is susceptible against one or more of the plurality of Pe races, to produce Fl seeds; c) optionally selfing the plants grown from Fl seeds one or more times to produce F2, F3 or further generation selfing progeny; d) identifying (or selecting) spinach plants grown from Fl, F2, F3 seeds resulting from step c, or further generation selfing progeny which have resistance against said one or more of Pe races and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment; e) optionally crossing said identified (or selected) Fl progeny of step (d) or selfing progeny to any spinach plant, to produce a backcross progeny; f) optionally selecting backcross progeny which comprises resistance against the one or more of the plurality of Pe races and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment.

[0139] 20. The method of claim 19, wherein the plurality of Pe races comprises Pe races 1- 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A),PV2144, Pe22-53, PV2240 and PV2201.

[0140] 21. The method of any of the embodiments 19-20, whereby said identification step in step d) occurs via marker assisted selection.

[0141] 22. The method of any of the embodiments 19-21, whereby said identifying spinach plants and / or selecting backcross progeny occurs by identifying the presence of alleles in said plants or progeny; using one or more of the SEQ ID NOs: l-15.

[0142] 23. A spinach plant comprising resistance at least against one or more Peronospora effusa (Pe) races 1-19, wherein said resistance is conferred by a resistance gene, which is present in seeds deposited under an accession number NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195.

[0143] 24. The plant of embodiment 23, wherein said spinach plant further comprises resistance against one or more Pe isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0144] 25. The plant of any of the embodiments 23-24, wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: l-15, or at least one nucleotide sequence having at least 95% identity to one or more of the group consisting of SEQ ID NOs: 1-15, preferably at least 98% identity and more preferably at least 99% identity.

[0145] 26. A seed from which the plant of embodiment 23 can be grown.

[0146] 27. A leaf of the plant of embodiment 23.

[0147] 28. A progeny plant of the plant of embodiment 23, wherein said progeny plant retains the resistance gene which confers resistance to at least one Pe races 1-19.

[0148] 29. The progeny plant of embodiment 28, wherein said progeny plant is resistant to at least one Pe isolates isolates 4US also known as 4+, 21A (UA2016-21A or 2016- 21A), PV2144, Pe22-53 , PV2240 and PV2201.

[0149] 30. The progeny plant of any of the embodiments 28 to 29, wherein said progeny plant is produced by one or more methods of selfing, crossing, mutation, genome editing techniques or transformation.

[0150] 31. The progeny plant of any of the embodiments 28 to 30, wherein said progeny plant comprises at least one nucleotide sequence from SEQ ID NOs: 1-15, or at least one nucleotide sequence having at least 95% identity to one or more of the group consisting of SEQ ID NOs: l-15, preferably at least 98% identity and more preferably at least 99% identity.

[0151] 32. A method of generating a spinach plant comprising a broad spectrum resistance against Pe races or isolates, comprising growing a plant from a seed selected from the group consisting of seeds with accession number NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, NCIMB 44195;or a progeny thereof, wherein said progeny comprises a resistance gene which confers a broad spectrum resistance against Pe races.

[0152] 33. The method of embodiment 32, wherein said resistance gene confers resistance against Pe , races 1-19, at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. 34. The method according to embodiment 32 and 33, wherein the introduction of the one or more resistance alleles of said resistance gene is achieved by genome editing techniques such as CRISPR Cas, or mutagenesis techniques.

[0153] 35. A method of generating a spinach plant comprising a broad spectrum resistance against Pe races or isolates, comprising introduction of the one or more resistance alleles identifiable by one or more SEQ ID NO: 1-15, wherein the introduction of said alleles is achieved by genome editing techniques such as CRISPR Cas, or mutagenesis techniques.

[0154] 36. A part of the spinach plant of any of the embodiments 23 to 25, wherein the part is selected from the group consisting of a stem, a cutting, a petiole, a cotyledon, a flower, an anther, a pollen, an ovary, a root, a root tip, a protoplast, a callus, a microspore, a stalk, an ovule, a shoot, a seed, an embryo, an embryo sac, a cell, a meristem, a bud or a leaf.

[0155] 37. A cell culture or tissue culture comprising a cell or a tissue derived from the part of embodiment 34.

[0156] 38. A spinach plant regenerated from the cell culture or tissue culture of embodiment 35 and comprising resistance at least against one or more Pe races 1-19, wherein said resistance is conferred by a resistance gene present in seeds deposited under an accession number as defined in embodiment 23 number NCIMB.

[0157] 39. The spinach plant of any of the embodiments 23, 28 and 38 , wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: l-15, having at least 95% identity to one or more of the group consisting of SEQ ID NOs: l-15, preferably at least 98% identity and more preferably at least 99% identity.

[0158] 40. A food product comprising harvested leaves of the spinach plant of embodiment 23.

[0159] 41. A container comprising the spinach plant of embodiment 23, in a growth substrate for harvest of leaves from said plant.

[0160] 42. The spinach plant according to embodiment 1 , wherein said spinach plant is obtained by genome editing techniques such as CRISPR Cas, or mutagenesis techniques, preferably by introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO: 1-15.

[0161] EXAMPLES

[0162] The present disclosure will be more fully understood by reference to the following examples. It should not, however, be construed as limiting the scope of the present disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

[0163] Example 1: Downy Mildew-Resistant Spinach Families X21-18-XX., corresponding to NCIMB accession numbers 44186-44195.

[0164] Origin of Breeding:

[0165] The 'X21-18 progeny' spinach lines were developed by first crossing a plant of variety 'Viroflay' (S. oleracea) with 19 accessions of Spinacia tetrandra (see crossing scheme below, scheme 1).

[0166] Scheme 1 :

[0167] Year 1

[0168] V ccessions

[0169] Year 2 Fl

[0170] Year 3 W03-324-4-6-3 / 5 BC1

[0171] Year 4 X21-018

[0172] Bio-assay mix

[0173] Year 5 X21-018-X BC2S1

[0174] Bio-assays and genotyping

[0175] Year 6 X21-018-X-X BC2S2 Bio-assays and genotyping

[0176] Year 7 Bio-assays and genotyping Step 1: crossing between cultivar 'Viroflay' (S. oleracea) and with 19 accessions of Spinacia tetra nd ra (Table I);

[0177] TABLE I. Spinacia tetrandra accessions used in Step 1 of the outlined crossing scheme. CGN number is the collection number of the Dutch Center of Genetic Resources. PI numbers have been retrieved from USDA Plant Introduction stations.

[0178] Step 2: crossing of Fl progeny plants from step 1 with a S. oleracea cultivar with internal reference 'Bll-509-7-41-2';

[0179] Step 3: crossing of Fl progeny plants from step 2 with a S. oleracea cultivar with an elite line with internal reference 'W03-324-4-6-3 / 5' leading to the (BC2) X21-018 progeny;

[0180] Step 4: thousands of seedlings of the X21-018 progeny were inoculated with a mixture of Peronospora effusa (Pe) Pe 16, Pe 19 and isolate 4US also known as 4+.

[0181] Step 5: Survivors ( / .e. resistant) plants of the inoculations from step 4 were selfed leading to the (BC2S1) X21-018-X families;

[0182] Step 6: 74 inbred families from step 5 were retested with Pe 16, Pe 19 Pe isolates 4US also known as 4+.and 21A (UA2016-21A or 2016-21A);. A set of 80 SNP markers were used to genotype the inbred families.

[0183] Step 7: 10 inbred families from step 6 were fully resistant to Pe-isolates Pe isolates 4US also known as 4+., Pe 16, Pe 19 and non-denominated isolate 21A (UA2016- 21A or 2016-21A); and were selfed leading to (BC2) X21-018-X-X families. The 10 inbred families were also tested for resistance to Pe-isolates Pe 7, Pe 8, Pe 10, Pe 12, Pe 13, Pe 17, Pe 18 and two isolates with internal references Pe PV2144 and Pe PV2201. The results of the screening are shown in Table II. Families X21-018-50-4 (Allele 1), X21-018-58-1 (Allele 2), X21-018-56-5 (Allele 5), X21-018-19-12 (Allele 6), 8-23-1 (Allele 7), X21-018-15-11 (Allele 10) and X21-018-16-6 (Allele

[0184] 12) are resistant to all tested Pe-isolates.

[0185] TABLE II. Overview of the different Pe isolates and their score per BC2S1 family tested. R is resistant, S is susceptible, '?' is no clear result.

[0186] Seeds from the 10 inbred families were deposited with the NCIMB listed in table IV below

[0187] TABLE IV: Seeds from inbred families deposited to NCIMB

[0188] Example 2: Haplotypinq new resistance alleles

[0189] A subset of the 80 SNP markers from step 6 (SEQ ID NO: 1-15, see Example 1) was used in genotyping of BC2S1 inbred families. The results of the genotyping are shown in Table III. The results indicate that the introgressed resistances in the 10 families were not derived from the S. turkestanica backgrounds in elite line Bl 1-509-7-41-2 from step 2, nor from the elite line W03-324-4-6-3 / 5 from step 3. The screening patterns are therefore derived from introgression of a mixture of the 19 S. tetrandra accessions mentioned in step 1.

[0190] Table III. KASP scores for SEQ ID Nos: 1-15 of the BC2S1 families. Alleles correspond to alleles in SEQ ID Nos: 1-15 sequences.

[0191] Each of the sequences given below consist of two alternatives, the variant being indicated within the brackets.

[0192] SEQ ID NO 1 : CCCCGGCCGTTTTCTTAGGCTTCTCGTCGTTCACCTCGGCTTCTCCGGCCACCAGAGAATC

[0193] ATCGGACACGCACGGTTTTCCGATCAAAACACCACATAA[T / A]CCCTCATTACCCACAAAT GATGATGGGTGCAAATTAGGGAAAATTGACCCAGATGATGGTATAGCACCACTCAAGAGA TTATATGACACATTAAAAGTCT SEQ ID NO 2:

[0194] >

[0195] CATATGTTATATTTTTTATGCAACTGCTACACAAGCTAACCAATAGCTGC[T / C]GAATTCCA

[0196] CTCTTCAACTCTCCCTAACCCCAAACTTCTTGCACTTTGAGG

[0197] SEQ ID NO 3:

[0198] CGGGTTCGAATCTTCAATTCGTATCGGTAAGAGTCGGGGGAGAGAGTTTGATGTTGGTGT

[0199] TGTGCCACCTGGCCTCTAGATTGACCGCGAGAGACAATTT[C / T]CCGTAGAATATGTGATT TGAATGGAAAAACAAAGAAAGTAACAAATAAAAAGGGAGAAAGCACACTATAACCATTAG AGAGAAGTATTAGTTGGTGATCA

[0200] SEQ ID NO 4:

[0201] > > >

[0202] AATGCAATGTTTTCTATCTGTCATTCAGTAATTCTTGGAGATTATTTTACTTTTACCACATAT

[0203] > >

[0204] ATTCACCC I I I I I ATTTCATTGTTGCAGG I I I I I ATG[G / A]CAGCAAACACAACACTTACGG

[0205] >

[0206] TTTGAATTGCAGGAAGACATGCCTAACTGCCAAAGATTGTGATCACCATGTTGGTCTTTGT

[0207] CACTCAAGCAGACTTGCA

[0208] SEQ ID NO 5:

[0209] > >

[0210] TTTTGCAAGAATTGGAGTATGTAGATTTCGAGTGATTTTATAAATGGGTTAATTTCGAGCAT

[0211] > >

[0212] GAAGGAAGTCAGATAGAACAGCAAGTAAACTTTTGCTA[C / T]GATTTTAGGAGAAATCTTA

[0213] > >

[0214] TCAGGCAAAGTAGTATTTTAAGTCCCTTCATCTGAAAATGATTGTTACTTTTATTGCCAACG

[0215] >

[0216] TTTTCTAGATGATGAGGAT

[0217] SEQ ID NO 6:

[0218] >

[0219] CATGGGGTAGAGACTTGGAGTATGTAGATTTCGAGTGATTTTAGAAATGG[G / T]TTAATCT

[0220] CGAGCATGATTGAAGGCAGTCAGATAAACTGAAAGTAAACTTT

[0221] SEQ ID NO 7:

[0222] >

[0223] TAAAATCTGAGGCTTTTACCATTGCAGTTATGCCACACAAAAACATGAATACGATGATCTG

[0224] AAGCATCCCACCGAGAGCAGAAACAGGCCCTACTGCTCT[A / G]AGCTGCACCAAAGTACA

[0225] > >

[0226] GTTAGTACAGCTTCTACCATTAAACATAAATAGGGTAATGGTTTTGTATTTTTGATGAAGCT

[0227] >

[0228] GTTCATTTTCTCAAAAAGTAC

[0229] SEQ ID NO 8:

[0230] AGTAATTAATGATTAGAAAAAGAGAAACATAACTTGTTACTAACTACCTG[G / A]TTTAGGA

[0231] AGATTGTAATGCATAAATTCAATACACTTCTATAACTTTTACT

[0232] SEQ ID NO 9:

[0233] >

[0234] TTGACAGAAGTACTAAATGTTTCCTCTTTGTATAGGGCACAATTTCACAATTGCCAAAATAA ACAGTAATCACAACACCAGAACCAACCACAACTACAAT[G / A]AACATATGTCTAGGGTTCT

[0235] GAAACCATGATTTAAAACCTCTTGGTTTAAAGTGTTGAATTTGGTTACTATCAACATAGTAA

[0236] TTTCTCCTAGTAATAATAC

[0237] SEQ ID NO 10:

[0238] TCAGTTCGTACAGATTTAAGCTCTACTCTGAGGAACCCTACAATAGCGTAAATGCATAATC CCATATCGGGATGTGAGGTGTGATAAGTTACCTTTATAT[A / G]CGCCAATTCTTAATATGT ATATTGTTTGTCAGATGGGAAACACCGTGCGATAAGAGCAAGCCTAATAGATACCATTGAC CCAATAAGGTTCTATAGAGGA

[0239] SEQ ID NO 11 :

[0240] AAAAATGAATGTAACCTAGATTTTTTCTGTAATCACACTTGTTGCAAGATTTGAAGGACCTC ATCTTTTGTTGGTAAATCGGGAATCGCTCCTTTCTTTG[T / C]AATCGTAACAGCACCACATG CGTTTGAGAAATACAAAGCCTCCTTTAACCGCTTTTCATCCTGCCAGAAGAGCCAAAAGCA AAATAAAATTTGAAGAAAA

[0241] SEQ ID NO 12:

[0242] CGTTGCATGTACTATTAGATTTGCCACTGATTGACGCAAAATACCTTTCC[G / A]AACATTAC TAAGTGATATCAAATCGTGAACATAATTTCAAAAAGATTTAT

[0243] SEQ ID NO 13:

[0244] CTGTAACCATACACATACACAGAGGGTCATGAATGTAAGAAGATTATAAC[C / A]ATCGTTT TTAACTGTAAATGTTTTTATGTAATACTTATAATCACAAAATG

[0245] SEQ ID NO 14:

[0246] ATGTAGTTCAAGTCGAGGGACAACATTCGAATATAAAAGAGATGAATATCACGTTAGTTAT TCAAAGCGTTCCATACATAAGTTTATCTTTGTGTTGTTA[G / A]AAACAATAGCATATATATG TCGGTCAAGGGTAGTTCTCTCGAAAAGTCGAAGTCCCATGAAATAAAAAATACTGGAGTAA CAAATTCATGTAAGTTTTCT

[0247] SEQ ID NO 15:

[0248] CTTGTAAAGTACTCCGTAGTAATGTATCCCTATGTCATGTAAACTTTACAGCACTCACTCCA AAGCTCATACCAAAAGTCAACTGTGTAATCTCATAACA[C / T]ATGATATTCTTGTGAAAGTT GTGATGCAAGTACTCGTATTAACAATATGCACCTTACAACTAACAGGTTCTGTGACACTGA AAGTTTAAAAGTAAAAGCA

Claims

CLAIMS1. A spinach plant comprising resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

2. The spinach plant of claim 1, wherein the plant is obtainable by introgression from a plant grown from seeds with accession number NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, NCIMB 44195, or any plant derived therefrom.

3. The spinach plant of claim 1 or 2, whereby said spinach plant comprises alleles identifiable by one or more of SEQ ID NO: 1-15.

4. The spinach plant of claim 3, whereby said allele or sequence is linked to the resistance.

5. The spinach plant of any one of the previous claims, whereby said spinach plant is a hybrid plant.

6. The spinach plant of any one of the previous claims, whereby said spinach plant is an inbred plant.

7. The spinach plant of any one of the previous claims, whereby said plant is selected from the group consisting of: savoy, semi-savoy, flat or smooth leaved.

8. The spinach plant according to claim 1 , wherein said spinach plant is obtained by genome editing techniques such as CRISPR Cas, or mutagenesis techniques, preferably by introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO: 1-15.

9. A progeny plant of the spinach plant of any one of the previous claims, wherein said progeny plant retains resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

10. The progeny plant of claim 9, wherein the progeny plant is produced by one or more methods selected from the group consisting of: selfing, crossing, mutation, genome editing or transformation.

11. The progeny plant of claim 9 or 10, whereby said progeny plant comprise alleles identifiable by one or more SEQ ID NO: 1-15.

12. A seed from which a spinach plant of any one of claims 1 to 8 can be grown.

13. Use of one or more seeds with accession number NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195, or a progeny thereof, for generating a spinach plant comprising resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, PE22-53, PV2240 and PV2201.

14. A part of the spinach plant of any one of claims 1 to 8 or a part of the progeny plant of any one of claims 9 to 11, wherein the part is selected from the group consisting of: stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds, leaves.

15. A cell culture or tissue culture comprising cells or tissue derived from the part of the spinach plant of the claim 14.

16. A spinach plant regenerated from the cell or tissue culture of claim 15, wherein said spinach plant comprises resistance against at least one or more Pe races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

17. The spinach plant of claim 16, wherein said spinach plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO: 1- 15.

18. A method for generating a spinach plant comprising resistance at least against one or more Peronospora effusa (Pe) races or isolates, preferably aplurality of Peronospora effusa (Pe) races or isolates, comprising the steps of: a) providing a spinach plant comprising an introgression fragment obtainable from accession NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or 44193, or NCIMB 44194, or NCIMB 44195, wherein said introgression fragment confers resistance against one or more of Pe races; b) crossing said spinach plant with another spinach plant, which is susceptible against one or more of the plurality of Pe races, to produce Fl seeds; c) optionally selfing the plants grown from Fl seeds one or more times to produce F2, F3 or further generation selfing progeny; d) identifying (or selecting) spinach plants grown from Fl, F2, F3 seeds resulting from step c, or further generation selfing progeny which have resistance against said one or more of Pe races and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment; e) optionally crossing said identified (or selected) Fl progeny of step (d) or selfing progeny to any spinach plant, to produce a backcross progeny; f) optionally selecting backcross progeny which comprises resistance against the one or more of the plurality of Pe races and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment.

19. The method of claim 18, wherein the plurality of Pe races comprises Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A),PV2144, Pe22-53, PV2240 and PV2201.

20. The method of any of the claims 18-19, whereby said identification step in step d) occurs via marker assisted selection.

21. The method of any of the claims 18-20, whereby said identifying spinach plants and / or selecting backcross progeny occurs by identifying the presenceof alleles in said plants or progeny; using one or more of the SEQ ID NOs: 1- 15.

22. A spinach plant comprising resistance at least against one or more Peronospora effusa (Pe) races 1-19, wherein said resistance is conferred by a resistance gene, present in accessions NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195.

23. The plant of claim 22, wherein said spinach plant further comprises resistance against one or more Pe isolates isolates 4US also known as 4+, 21A (UA2016- 21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

24. The plant of any of the claims 22-23, wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-15, or at least one nucleotide sequence having at least 95% identity to one or more of the group consisting of SEQ ID NOs: 1-15, preferably at least 98% identity and more preferably at least 99% identity.

25. A seed from which the plant of claim 22 can be grown or a leaf of the plant of claim 22.

26. A progeny plant of the plant of claim 22, wherein said progeny plant retains the resistance gene which confers resistance to at least one Pe races 1-19.

27. The progeny plant of claim 26, wherein said progeny plant is resistant to at least one Pe isolates isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53 , PV2240 and PV2201.

28. The progeny plant of any of the claims 26 to 27, wherein said progeny plant is produced by one or more methods of selfing, crossing, mutation, genome editing techniques or transformation.

29. The progeny plant of any of the claims 26 to 28, wherein said progeny plant comprises at least one nucleotide sequence from SEQ ID NOs: 1-15, or at least one nucleotide sequence having at least 95% identity to one or more of the group consisting of SEQ ID NOs: 1-15, preferably at least 98% identity and more preferably at least 99% identity.

30. A method of generating a spinach plant comprising a broad spectrum resistance against Pe races, comprising growing a plant from a seed selectedfrom the group consisting of seeds with accession number NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, NCIMB 44195; or a progeny thereof, wherein said progeny comprises a resistance gene which confers a broad spectrum resistance against Pe races.

31. The method of claim 30, wherein said resistance gene confers resistance against Pe , races 1-19, at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

32. The method according to claim 30 or 31, wherein the introduction of the one or more resistance alleles of said resistance gene is achieved by genome editing techniques such as CRISPR Cas, or mutagenesis techniques.

33. A method of generating a spinach plant comprising a broad spectrum resistance against Pe races, comprising introduction of the one or more resistance alleles identifiable by one or more SEQ ID NO: 1-15, wherein the introduction of said alleles is achieved by genome editing techniques such as CRISPR Cas, or mutagenesis techniques.

34. A spinach plant regenerated from the cell culture or tissue culture derived from a part of the spinach plant of any of the claims 22 to 24 and / or 26 and comprising resistance at least against one or more Pe races 1-19, wherein said resistance is conferred by a resistance gene present in seeds deposited under an accession number NCIMB 44186, or NCIMB 44187, or NCIMB 44188, or NCIMB 44189, or NCIMB 44190, or NCIMB 44191, or NCIMB 44192, or NCIMB 44193, or NCIMB 44194, or NCIMB 44195.

35. The spinach plant of any of the claims 23, 26 and 34 , wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-15, having at least 95% identity to one or more of the group consisting of SEQ ID NOs: 1-15, preferably at least 98% identity and more preferably at least 99% identity.