Pharmaceutical preparations for treating bietti's crystalline dystrophy

EP4757841A1Pending Publication Date: 2026-06-17CHIGENOVO CO LTD

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
CHIGENOVO CO LTD
Filing Date
2023-08-09
Publication Date
2026-06-17

AI Technical Summary

Technical Problem

Current pharmaceutical preparations for treating Bietti’s crystalline dystrophy face challenges such as instability of AAV capsid proteins, aggregation, and immune responses, which affect the safety and efficacy of subretinal injections.

Method used

A pharmaceutical preparation comprising a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate buffer, and water for injection, with a pH between 7.0 and 7.6, is developed to enhance virus titer stability, reduce AAV aggregates, and minimize retinal irritation.

Benefits of technology

The formulation achieves excellent virus titer stability, high mRNA expression of the target gene after multiple freeze-thaw cycles and high temperature exposure, and reduces local inflammatory responses in the retina, meeting safety and effectiveness standards in clinical trials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2023111972-FTAPPB-I100001
    Figure PCTCN2023111972-FTAPPB-I100001
  • Figure PCTCN2023111972-FTAPPB-I100002
    Figure PCTCN2023111972-FTAPPB-I100002
  • Figure PCTCN2023111972-FTAPPB-I100003
    Figure PCTCN2023111972-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a pharmaceutical preparation for treating Bietti's crystalline dystrophy (BCD), comprising a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and having a pH between 7.0 to 7.6. The pharmaceutical preparation has an excellent virus titer stability, very few AAV aggregates, a high mRNA expression of the target gene after multiple times of freezing and thawing, and / or an excellent high temperature stability. Moreover, the animal experiments in vivo demonstrate that the preparations with the formulations have an excellent property in reducing local inflammatory response of the retina, and further clinical trials demonstrate that the pharmaceutical preparations conform to the relevant technical specifications for safety and effectiveness in the Chinese Pharmacopoeia and the United States Pharmacopoeia (USP).
Need to check novelty before this filing date? Find Prior Art

Description

PHARMACEUTICAL PREPARATIONS FOR TREATING BIETTI’S CRYSTALLINE DYSTROPHYTECHNICAL FIELD

[0001] The present application relates to a pharmaceutical composition for treating Bietti’s crystalline dystrophy (BCD) by subretinal injection, comprising a recombinant AAV (rAAV) expressing CYP4V2, sodium chloride, poloxamer, and phosphate (salt) buffer.BACKGROUND

[0002] Bietti’s crystalline dystrophy (BCD) is a rare disease of retinal degeneration, and the symptoms mainly include crystals (transparent coverings) in the cornea; small, yellow or white, crystalline deposits deposited in the photosensitive tissues of the retina; and progressive atrophy of the retina, choriocapillary, and choroid. The deposits may damage the retina, causing gradual loss of vision. Studies have shown that BCD is a genetic disease caused by CYP4V2 gene mutations, and it is generally believed that CYP4V2 gene mutations destroy its enzymatic function involved in fatty acid metabolism, thereby affecting the lipid decomposition.

[0003] The Chinese patent CN113106124B previously filed by the applicant discloses a recombinant AAV expressing CYP4V2, which comprises an adeno-associated virus (AAV) vector expressing a polynucleotide encoding CYP4V2 by a promoter. The experiments demonstrate that, such a recombinant AAV vector produces a good expression efficacy with a high expression rate and a more stable expression intensity. It can not only be expressed in RPE cells of retina, but also can be effectively expressed in the photoreceptor cell layer. It has a wide expression range, and can effectively reduce the lipid deposition in RPE cells with CYP4V2 gene mutations, and thus it can be used for the treatment of BCD.

[0004] In the drug development and application, the ingredients of the preparation play a crucial role in keeping the stability and compatibility of the biologically active ingredients of the drug. For the preparations containing a recombinant AAV, an unsuitable preparation may cause the instability of AAV capsid proteins, resulting in the release of the genome, which can be reflected in the stability of virus titer; or may cause AAV aggregation to form aggregates, which can be reflected in AAV particle size (see FIG. 1) . At the same time, the preparations containing a recombinant AAV may experience repeated freezing and thawing as well as a high temperature stress during manufacture, transportation and use, all of which pose a challenge to the stability of the preparations.

[0005] In July 2021, Adverum (agene therapy company in U.S.A. ) suspended the clinical trial of its AAV gene therapy drug ADVM-022 for the treatment of diabetic retinopathy macular edema (DME) due to serious adverse reactions such as inflammation in the subjects. Thus, the preparations containing a recombinant AAV, especially when used for ocular administration, must be little immunostimulatory to be suitable for clinical use. Furthermore, the immune response will significantly reduce the transduction efficiency, which will reduce the efficacy of the administrated gene therapy and / or require a higher dose to be administrated.

[0006] For gene therapy products using AAV as vector, there is no fixed formulation and adjuvants in the art, because there are often no rules for the impacts of various adjuvants on the stability, safety, and effectiveness of different types of AAV products, and the designs and experiment studies must be performed according to the properties of specific recombinant AAV to find suitable, safe, stable, and effective formulations.

[0007] For the recombinant AAV vector for treating BCD in the above-mentioned Chinese patent CN113106124B, since it usually needs to be administrated by subretinal injection, there is a need for it to develop a pharmaceutical preparation / injection composition for treating Bietti’s crystalline dystrophy with good stability, safety (such as low retinal irritation) and effectiveness.SUMMARY

[0008] Therefore, the problem to be solved in the present application is to provide a pharmaceutical preparation for treating Bietti’s crystalline dystrophy having an excellent virus titer stability, very few AAV aggregates, a high mRNA expression of the target gene after multiple times of freezing and thawing, and / or an excellent high temperature stability. Moreover, the animal experiments in vivo demonstrate that the preparations with the formulations in the present application have excellent performances in reducing local inflammatory responses of the retina, and further clinical trials demonstrate that the pharmaceutical preparations of the present application conform to the relevant technical specifications for safety and effectiveness in the Chinese Pharmacopoeia and the United States Pharmacopoeia (USP) .

[0009] The solution to this problem is based on the fact that the inventors have found that for the AAV gene therapy drug of the present application, a specific type of buffer system (such as phosphate salt buffer system) , a specific type of stabilizer (such as poloxamer, especially Poloxamer 188) , a specific salt ion concentration, a specific pH value, or combinations thereof is critical to obtain a stable formulation product with a good safety and little ocular (retinal) irritation.

[0010] Thus, the first aspect of the present application relates to a pharmaceutical preparation comprising: a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, wherein the pharmaceutical preparation has a pH between about 7.0 to about 7.6.

[0011] In certain embodiments, the recombinant AAV comprises an AAV vector expressing a polynucleotide encoding CYP4V2 by a promoter (i.e., a packaged recombinant AAV genome) , and preferably the AAV vector sequentially comprises, in 5’ to 3’ direction: a promoter, a polynucleotide encoding CYP4V2, and a PolyA signal site, wherein the promoter is operably linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0012] In certain embodiments, the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises an amino acid sequence set forth in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises a nucleotide sequence set forth in SEQ ID NO: 3; and / or the PolyA signal site comprises a BGH polyA signal, preferably a nucleotide sequence set forth in SEQ ID NO: 4; more preferably, the AAV vector also comprises a Kozak sequence set forth in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably, the AAV vector also comprises identical or different ITR sequences at 5’ side of the CAG promoter and at 3’ side of the PolyA signal site, respectively, preferably the ITR sequences are from AAV2.

[0013] In certain embodiments, the AAV vector comprises the following genomic elements, in 5’ to 3’ direction: ITR-CAG-Kozak-CYP4V2-BGH-ITR, and preferably comprises the genomic sequence set forth in SEQ ID NO: 6; and / or the capsid protein of the recombinant AAV has a serotype of AAV8. In a more preferred embodiment, the capsid protein of the recombinant AAV is AAV8 capsid protein, composed of 60 capsid protein subunits including VP1 having an amino acid sequence set forth in SEQ ID NO: 7, VP2 having an amino acid sequence set forth in SEQ ID NO: 8, and VP3 having an amino acid sequence set forth in SEQ ID NO: 9 at a number ratio of 1: 1: 10.

[0014] In certain embodiments, the pharmaceutical preparation is in a form of aqueous solution for injection, and / or the titer of the recombinant AAV in the pharmaceutical preparation is between about 1.0×1011 vg / ml to about 1.0×1013 vg / ml, preferably between about 2.0×1011 vg / ml to about 8.0×1012 vg / ml, more preferably between about 2.5×1011 vg / ml to about 2.0×1012 vg / ml, for example about 2.5×1011 vg / ml, about 1.0×1012 vg / ml, and about 2.0×1012 vg / ml, and more preferably about 2.5×1011 vg / ml, about 5.0×1011 vg / ml, or about 1.0×1012 vg / ml.

[0015] In certain embodiments, the poloxamer comprises Poloxamer 188, preferably at a concentration of between about 0.0001%by weight to about 0.01%by weight, preferably  between about 0.0002%by weight to about 0.005%by weight, most preferably about 0.001%by weight, by the weight of the pharmaceutical preparation.

[0016] In certain embodiments, the concentration of sodium chloride in the pharmaceutical preparation (aqueous solution for injection) is between about 120 to about 360 mM, preferably between about 150 mM to about 180 mM, and most preferably about 150 mM.

[0017] In certain embodiments, the phosphate is selected from the group consisting of disodium hydrogen phosphate or hydrates thereof, sodium dihydrogen phosphate or hydrates thereof, dipotassium hydrogen phosphate or hydrates thereof, potassium dihydrogen phosphate or hydrates thereof, sodium phosphate or hydrates thereof, potassium phosphate or hydrates thereof, and any combination thereof; preferably a combination of disodium hydrogen phosphate or hydrates thereof and sodium dihydrogen phosphate or hydrates thereof, or a combination of dipotassium hydrogen phosphate or hydrates thereof and potassium dihydrogen phosphate or hydrates thereof, more preferably a combination of disodium hydrogen phosphate or hydrates thereof (disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or hydrates thereof (sodium dihydrogen phosphate monohydrate) , preferably at a molar concentration ratio of between about 1: 10 to about 10: 1, more preferably between about 1: 5 to about 5: 1, for example about 1: 1 or about 8: 2; and / or the concentration of the phosphate in the pharmaceutical preparation is between about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably 10 mM to about 20 mM, and most preferably about 10 mM, based on all phosphates in the pharmaceutical preparation.

[0018] In certain embodiments, the pharmaceutical preparation of the present application has a pH of between about 7.0 to about 7.6, preferably about 7.0, about 7.2, about 7.3, or about 7.6, and most preferably 7.3.

[0019] In certain embodiments, the pharmaceutical preparation is in a form of aqueous solution for injection, comprising the recombinant AAV according to present invention, about 120 to about 360 mM of sodium chloride、about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pharmaceutical preparation has a pH of about 7.3.

[0020] In certain embodiments, the pharmaceutical preparation is in a form of aqueous solution for injection, comprising the recombinant AAV according to present invention, about 150 mM of sodium chloride, about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the pharmaceutical preparation has a pH of about 7.3, and the  phosphate comprises about 8 mM of disodium hydrogen phosphate dodecahydrate and about 2 mM of sodium dihydrogen phosphate monohydrate.

[0021] In certain embodiments, the pharmaceutical preparation is a colorless, clear and transparent liquid, and / or has an osmotic pressure of between about 270 to about 330 mOsmol / kg.

[0022] In a second aspect, the present application relates to a method for treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, comprising administrating to a subject in need thereof a therapeutically effective amount of the pharmaceutical preparation described above.

[0023] In certain embodiments, the disease or disorder is Bietti’s crystalline dystrophy (BCD) .

[0024] In certain embodiments, the subject is a human.

[0025] In certain embodiments, the pharmaceutical preparation is administrated by subretinal injection (i.e., through injection into the subretinal space) , preferably with an administration volume of between about 50 to about 300 μL; and an administration amount of between about 1x1010 vg / eye to about 1x1012 vg / eye, preferably between about 5×1010 vg / eye to about 2.5×1011 vg / eye.

[0026] The present application also provides the pharmaceutical preparation described above, for treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy in a subject in need thereof, preferably for treating, alleviating, and / or preventing Bietti’s crystalline dystrophy (BCD) , and more preferably the subject is a human.

[0027] Other aspects and advantages of the present application can be readily appreciated by those skilled in the art from the detailed descriptions below. Only exemplary embodiments of the present application are shown and described in the detailed descriptions below. As will be recognized by those skilled in the art, the contents of the present application enable those skilled in the art to make changes to the specific embodiments without departing from the spirit and scope of the invention disclosed in the present application. Accordingly, the accompanying drawings and the descriptions in the specification of the present application are only exemplary and by no means restrictive.

[0028] DESCRIPTION OF THE DRAWINGS

[0029] The above-mentioned features and advantages of the invention will become more apparent from the detailed descriptions below in conjunction with the accompanying drawings, wherein:

[0030] FIG. 1 shows a schematic diagram for the release of the genome due to the instability of AAV capsid proteins as well as the aggregate formation due to AAV aggregation in the preparation;

[0031] FIG. 2 shows the particle size measurement results for ZVS101e in different preparations;

[0032] FIG. 3 shows the denaturation curves for ZVS101e in different preparations;

[0033] FIG. 4 shows the aggregation curves for ZVS101e in different preparations;

[0034] FIG. 5 shows the mRNA expressions of the target gene (CYP4V2) after freezing and thawing in different formulations;

[0035] FIG. 6 shows the mRNA expressions of the target gene (CYP4V2) after placed at a high temperature in different formulations;

[0036] FIG. 7 shows the color photographs of optic fundi of mice by 2 weeks after administration into the subretinal space in Example 4;

[0037] FIG. 8 shows the color photographs and OCT of optic fundi of mice by 2 weeks after administration into the subretinal space in Example 5;

[0038] FIG. 9 shows the mRNA expression levels of transgene hCYP4V2 (human CYP4V2) in the retina and RPE layer for the mice of each group in Example 5;

[0039] FIG. 10 shows the mRNA expression levels of endogenous mCYP4V3 in the retina and RPE layer for the mice of each group in Example 5;

[0040] FIG. 11 shows the mRNA expression levels of inflammatory factors mCD11b and mNLRP3 in the retina and RPE layer for the mice of each group in Example 5; and

[0041] FIG. 12 shows the improvements of ETDRS number chart for some patients in Example 7.DESCRIPTION OF EMBODIMENTS

[0042] Definitions of terms

[0043] Unless otherwise indicated, the terms used herein have ordinary technical meanings as understood by those skilled in the art. For definitions and terms in the art, the skilled artisan is specifically referred to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Plainsview, New York (1989) ; and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47) , John Wiley &Sons, New York (1999) .

[0044] As used herein, the term “AAV” is the standard abbreviation for adeno-associated virus. The adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells, some functions of which are provided by the co-infection of helper virus. General information and reviews on AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York) .

[0045] As used herein, the term “AAV vector” generally refers to a vector comprising one or more polynucleotides (or transgenes) of interest flanked by AAV inverted terminal repeats (ITRs) . Such AAV vectors can be replicated and packaged into infectious virus particles when present in host cells that have been transfected with vectors encoding and expressing the rep and cap gene products. The term “recombinant AAV virion” or “recombinant AAV particle” or “AAV vector particle” refers to a virus particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered into mammalian cells) , it is often referred to as an “AAV vector particle” or simply referred to as “AAV vector. ” Thus, the production of AAV vector particles necessarily includes the production of AAV vectors such that the vectors are contained within the AAV vector particles.

[0046] As used herein, the term “promoter” generally refers to a deoxyribonucleic acid (DNA) sequence that enables the transcription of a particular gene. The promoter can be recognized by RNA polymerase, and initiate the transcription and synthesis of RNA. During the synthesis of ribonucleic acid (RNA) , the promoter can interact with the transcription factor for regulating the gene transcription, to control the initiation time and expression degree of the gene expression (transcription) . The promoter comprises the core promoter region and the regulatory region, and is located in the regulatory sequence that controls the gene expression and upstream of the gene transcription initiation site (5’ direction of the DNA antisense strand) , and itself has no compilation function.

[0047] As used herein, the term “operably linked” generally refers to placing the regulatory sequence necessary for the expression of a coding sequence at an appropriate position relative to the coding sequence so as to affect the expression of the coding sequence. For example, when a first nucleic acid sequence is in a functional relationship with a second nucleic acid sequence, the first nucleic acid sequence is operably linked to the second nucleic acid sequence. In certain embodiments, the arrangement of coding sequences and transcription control elements in an expression vector can be represented. The control element may include promoter, enhancer, and termination element. For example, if a promoter influences the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. In certain embodiments, “operably linked” can also refer to the ligation of a target gene into a vector such that transcription and translation control sequences within the vector exert their intended functions of regulating the transcription and translation of the target gene.

[0048] As used herein, the term “CYP4V2” generally refers to a protein that is member 2 of subfamily V of cytochrome P450 family 4. The term “cytochrome P450, ” also known as CYP450, usually refers to a family of ferroheme proteins, belonging to a class of monooxygenases, and involved in the metabolism of endogenous substances or exogenous substances comprising drugs and environmental compounds. According to the homology degree of amino acid sequence, the members are divided into three levels: family, subfamily, and individual enzymes. The cytochrome P450 enzyme system may be abbreviated as CYP, wherein the family is represented by Arabic number, the subfamily is represented by English capital letter, and the individual enzyme is represented by Arabic number, such as CYP4V2 herein. The human CYP4V2 gene (HGNC: 23198) , located at 4q35, has a full length of 19.28 kb with 11 exons, and plays an important role in fatty acid metabolism (Kumar S., Bioinformation, 2011, 7:360-365) . CYP4V2 is expressed almost in all tissues, but is expressed at a higher level in the retina and retinal pigment epithelium while at a slightly lower level in the cornea tissues. The mutations in the CYP4V2 gene may be associated with Bietti’s crystalline dystrophy and / or posterior retinitis pigmentosa.

[0049] As used herein, the term “polyadenylation (PolyA) sequence” , also known as polyadenylation tail and PolyA tail, generally refers to a stretch of tens to hundreds of single adenosines added at 3’ end of mRNA after transcription. The polyadenylation usually occurs during and after the transcription of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) in the nucleus, and this reaction is usually completed by PolyA polymerase. In the eukaryote, the polyadenylation is a mechanism by which the mRNA molecule is interrupted at its 3’ end, and the PolyA sequence can protect mRNA from the attack of exonuclease, and is very important for the nuclear export, translation and stability of mRNA.

[0050] As used herein, the term “polyadenylation (PolyA) signal site” generally refers to a base sequence located at 3’ end of messenger RNA (mRNA) that can be recognized by the polyadenylation-related cleavage factor. Usually, it is also a cis-regulatory signal on the mRNA. In general, the process of tailing (i.e., polyadenylation) begins after the termination of transcription, and tens to hundreds of single adenosines are added following 3’ UTR in mRNA by the polyadenylation-related cleavage factor under the regulation of the PolyA signal site. The common tailing signals include SV40, BGH, HSV, TK signals, and the like.

[0051] As used herein, the term “preventing” generally refers to the prophylactic administration of a pharmaceutical preparation to a healthy subject to prevent the occurrence of a certain disease or disorder. It may also include the prophylactic administration of a pharmaceutical preparation to a patient in the early stage of an allergic disease to be treated. The term “preventing” does not  require 100%elimination of the likelihood of a disease or disorder; in other words, the term “preventing” generally means that the likelihood of a disease or disorder is reduced in the presence of the administrated pharmaceutical preparation.

[0052] As used herein, the term “alleviating” refers to reducing, diminishing, or retarding a certain condition, disease, disorder, or phenotype. The condition, disease, disorder, or phenotype may include subjective perceptions of the subject such as pain, dizziness, or other physiological disturbances, or focus conditions detected by medical laboratory means.

[0053] As used herein, the term “treating” generally refers to a clinical intervention for altering the natural course of the treated individual or cell in a clinical pathological process. It may include improving the disease status, eliminating lesions, or improving the prognosis.

[0054] As used herein, the term “about” is inclusive of the stated value and refers to falling within an acceptable deviation range for the particular value as determined by those skilled in the art in consideration of the errors associated with the measurements of the stated values (i.e., the limitations of the measurement system) . For example, “about” can mean falling within one or more standard deviations of the stated value, or within ±30%, ±20%, ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, or ±0.5%of the stated value.

[0055] DETAILED DESCRIPTION OF THE INVENTION

[0056] CYP4V2

[0057] The AAV vector in the present application may comprise a polynucleotide encoding CYP4V2. In the present application, CYP4V2 may comprise a class of proteins whose dysfunctions or encoding gene mutations may lead to Bietti’s crystalline dystrophy, including but not limited to CYP4V2 from human, chimpanzee, gorilla, rhesus monkey, dog, cow, mouse, rat, chicken, drosophila, nematode, or frog, or functional variants thereof. For example, the CYP4V2 may include human CYP4V2. In the present application, the polynucleotide encoding CYP4V2 may encode an amino acid sequence set forth in SEQ ID NO: 2. For example, the polynucleotide encoding CYP4V2 may encode an amino acid sequence having at least 90%identity to the amino acid sequence set forth in SEQ ID NO: 2, for example any amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%identity to the amino acid sequence set forth in SEQ ID NO: 2.

[0058] In certain instances, the polynucleotide encoding CYP4V2 of the present application may comprise a synonymously mutated sequence of the polynucleotide naturally encoding CTP4V2. In certain instances, the polynucleotide encoding CYP4V2 of the present application may comprise a nucleotide sequence set forth in SEQ ID NO: 3. For example, the polynucleotide  encoding CYP4V2 may comprise a nucleotide sequence having at least 90%identity to the nucleotide sequence set forth in SEQ ID NO: 3, for example any polynucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%identity to the nucleotide sequence set forth in SEQ ID NO: 3.

[0059] The kozak sequence may be comprised at 5’ end of the polynucleotide encoding CYP4V2 of the present application. For example, the kozak sequence may comprise a nucleotide sequence set forth in SEQ ID NO: 5.

[0060] Promoter

[0061] The AAV vector of the present application may comprise a promoter. In the present application, the promoter may include a RPE cell-specific promoter, retinal cell-specific promoter, corneal cell-specific promoter, ocular cell-specific promoter, or constitutive promoter. The promoter may also include a mammalian beta-actin promoter or a viral promoter. The promoter may also include a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter) , human beta actin promoter, small CBA (smCBA) promoter, CBS promoter or CBh promoter, elongation factor 1αshort (EFS) promoter, elongation factor 1α (EF-1α) promoter, CMV promoter, PGK promoter, UBC promoter, GUSB promoter, UCOE promoter, VMD2 (also known as BEST1) promoter, OPEFS promoter, CYP4V2 native promoter, RPE65 promoter, or hybrids or derivatives thereof. For example, the promoter may be a CAG promoter.

[0062] For example, the promoter may comprise a nucleotide sequence set forth in SEQ ID NO: 1. For example, the promoter may comprise a nucleotide sequence having at least 90%identity to the nucleotide sequence set forth in SEQ ID NO: 1, for example any polynucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[0063] In the present application, the promoter may be operably linked to the polynucleotide encoding CYP4V2. In certain instances, the promoter may be located at 5’ end of the polynucleotide encoding CYP4V2.

[0064] Polyadenylation (PolyA) signal site

[0065] In the present application, the AAV vector may also comprise a polyadenylation (PolyA) signal site. The PolyA signal site may include SV40 signal site, BGH signal site, WPRE signal site, WPRE-SV40 signal site, WPRE-BGH signal site, or derivatives thereof.

[0066] In certain instances, the PolyA signal site can be recognized by a polyadenylation-related cleavage factor, leading to SV40 PolyA sequence, BGH signal PolyA sequence, HSV signal PolyA sequence, TK signal PolyA sequence, WPRE signal PolyA sequence, etc. For example,  the PolyA signal site may be a BGH signal site, which may comprise a nucleotide sequence set forth in SEQ ID NO: 4. For example, the PolyA signal site may comprise a nucleotide sequence having at least 90%identity to the nucleotide sequence set forth in SEQ ID NO: 4, for example any polynucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%identity to the nucleotide sequence set forth in SEQ ID NO: 4.

[0067] In certain instances, the polyadenylation signal site may be located at 3’ end of the polynucleotide encoding CYP4V2.

[0068] Recombinant AAV expressing CYP4V2

[0069] In the pharmaceutical preparation of the present application, the recombinant AAV included therein comprises an AAV vector expressing a polynucleotide encoding CYP4V2 by a promoter, which sequentially comprises, in 5’ to 3’ direction: a promoter, a polynucleotide encoding CYP4V2, and a PolyA signal site, wherein the promoter is operably linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0070] In a preferred embodiment, the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises an amino acid sequence set forth in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises a nucleotide sequence set forth in SEQ ID NO: 3; and / or the PolyA signal site comprises a BGH polyA signal, preferably a nucleotide sequence set forth in SEQ ID NO: 4; more preferably, the AAV vector also comprises a Kozak sequence set forth in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably, the AAV vector also comprises identical or different ITR sequences at 5’ side of the CAG promoter and at 3’ side of the PolyA signal site, preferably the ITR sequences are from AAV2.

[0071] In a more preferred embodiment, the AAV vector comprises the following genomic elements, in 5’ to 3’ direction: ITR-CAG-Kozak-CYP4V2-BGH-ITR, and preferably comprises the genomic sequence set forth in SEQ ID NO: 6.

[0072] In a preferred embodiment, the capsid protein of the recombinant AAV has a serotype of AAV8.

[0073] In a preferred embodiment, the capsid protein of the recombinant AAV expressing CYP4V2 in the present application is AAV8 capsid protein (see WO 03 / 052051A2) . In a more preferred embodiment, the capsid protein of the recombinant AAV expressing CYP4V2 in the present application is AAV8 capsid protein, composed of 60 capsid protein subunits comprising (for example at a number ratio of 1: 1: 10) three capsid proteins, i.e., VP1 having an amino acid sequence set forth in SEQ ID NO: 7, VP2 having an amino acid sequence set forth in SEQ ID NO: 8, and VP3 having an amino acid sequence set forth in SEQ ID NO: 9.

[0074] Methods for producing recombinant AAVs using the recombinant AAV vectors described above are well-known to those skilled in the art. In short, the method generally comprises (a) introducing the AAV vector of the present application (including a genome construct expressing CYP4V2, i.e., a recombinant AAV genome to be packaged) into a host cell, (b) introducing an AAV helper construct into the host cell wherein the helper construct comprises the viral function lacked relative to the wild-type rAAV genome, and (c) introducing a helper virus construct into the host cell. All functions for AAV vector replication and packaging (such as AAV rep protein and AAV cap protein) should be present for AAV genome replication and packaging into the AAV vector. The introductions into host cells as described above can be accomplished using standard molecular biology techniques, and can be accomplished simultaneously or sequentially. Finally, the host cells are cultured to produce AAV vectors, which are purified using standard techniques. Typically, a three-plasmid system including (a) , (b) , and (c) described above is co-transfected into host cells (such as 293F cells) for serum-free suspension culturing. The purification method can be carried out by the procedures such as lysis and clarification, affinity chromatography, ion exchange chromatography, ultrafiltration, filtration, and the like.

[0075] In a preferred embodiment, the recombinant AAV expressing CYP4V2 in the present application can be prepared according to the methods described in CN113106124B and US17 / 812, 425, which is a recombinant AAV2 / 8 virus.

[0076] Adjuvant

[0077] (a) Sodium chloride

[0078] In an injection preparation, sodium chloride usually plays a role in regulating the osmotic pressure. In the present application, the inventors unexpectedly found through animal experiments that the concentration of sodium chloride in an AAV preparation has a significant effect on the local irritation of the animal retina. The AAV preparation containing an inappropriate concentration of sodium chloride can lead to local immune reactions in the eyes, cause inflammatory cell infiltration in the vitreous cavity, and result in the cellular damage, as evidenced by the mRNA expression levels of inflammatory factors.

[0079] Thus, in a preferred embodiment, the concentration of sodium chloride in the pharmaceutical preparation (injection) of the subject application is between about 120 mM to about 360 mM, preferably between about 150 mM to about 180 mM, and most preferably about 150 mM.

[0080] (b) Poloxamer

[0081] The poloxamer (Poloxamer) , with the trade name of Pluronic, is a macromolecular nonionic surfactant, as a polyoxyethylene-polyoxypropylene-polyoxyethylene (PEO-PPO-PEO)  triblock copolymer. Its trade name is Pluronic, with a general formula of HO (C2H4O) a- (C3H6O) b- (C2H4O) aH, where the polyoxyethylene chain is relatively hydrophilic and the polyoxypropylene chain is relatively lipophilic. The compound may have different molecular weights and different content ratios of ethylene oxide to propylene oxide in the molecule, and may possess thus different physical properties. Thus, it is a non-ionic polymer surfactant.

[0082] Poloxamer 407 is composed of about 70%of ethylene oxides and about 30%of propylene oxides, with an average molecular weight of 11, 500 Da and a melting point of 56℃. It is odorless and tasteless, soluble in water, acid and alkali, and stable to metal ions. It has a special reverse thermal gelation effect, that is, it is a liquid at low temperature and becomes a gel at body temperature. It has low toxicity, low irritation, and good biocompatibility. It is an ideal material for controlled drug release and is widely used in various fields such as medicine and pharmacy. Poloxamer 407 has been used in ciprofloxacin lactate ophthalmic gel, levofloxacin ophthalmic gel, diclofenac sodium ophthalmic gel, and the like.

[0083] Poloxamer 188 is commonly used in the pharmaceutical field as a lubricant for emulsions, ointments, and suspensions, as a solubilizer and dispersant for tablets or capsules, and also as a carrier for solid dispersions. The average molecular weight is 7, 680~9, 510 Da, and it is easy to dissolve in water regardless of the molecular weight. Poloxamer 188 is soluble in water but is insoluble or has little solubility in propylene glycol, and has a strong surface activity and gelation function. Poloxamer 188 is both fat-soluble and water-soluble, and can be dissolved out with the aqueous phase and evenly dispersed in the lipophilic polycaprolactone in a molecular state, forming a uniform porous structure on the microsphere surface.

[0084] In the present application, the inventors unexpectedly found through the formulation design and screening tests that, for the recombinant AAV expressing CYP4V2 of the subject application, in the formulation of the present application, Poloxamer 188 has significantly better performances in the virus titer determination, freezing-thawing stability, high temperature stability, and biological activity detection, as compared to Poloxamer 407.

[0085] Thus, in a preferred embodiment of the subject application, the adjuvant comprised in the pharmaceutical preparation of the subject application comprises poloxamer, particularly comprises Poloxamer 188, preferably at a concentration of between about 0.0001%by weight to about 0.01%by weight, preferably between about 0.0002%by weight to about 0.005%by weight, most preferably about 0.001%by weight, by the weight of the pharmaceutical preparation.

[0086] (c) Buffer

[0087] The buffer (buffered salt solution) in the pharmaceutical preparation is usually used to keep the pH of the solution system from being significantly changed by adding a small amount of  acid or base. The buffers commonly used include inorganic salt buffers (phosphate, carbonate, and the like) and organic salt buffers (acetate, citrate, succinate, glycinate, maleate, and the like) .

[0088] In the present application, the inventors unexpectedly found through the formulation design and screening tests that, for the recombinant AAV expressing CYP4V2 of the subject application, in the formulation of the present application, the phosphate has significantly better performances in the virus titer determination, freezing-thawing stability, high temperature stability, and biological activity detection, as compared to the citrate.

[0089] Thus, in a preferred embodiment of the subject application, the adjuvant comprised in the pharmaceutical preparation of the subject application comprises a phosphate, preferably the phosphate is selected from disodium hydrogen phosphate or hydrates thereof, sodium dihydrogen phosphate or hydrates thereof, dipotassium hydrogen phosphate or hydrates thereof, potassium dihydrogen phosphate or hydrates thereof, sodium phosphate or hydrates thereof, potassium phosphate or hydrates thereof, or any combination thereof, preferably a combination of disodium hydrogen phosphate or hydrates thereof and sodium dihydrogen phosphate or hydrates thereof, or a combination of dipotassium hydrogen phosphate or hydrates thereof and potassium dihydrogen phosphate or hydrates thereof, more preferably a combination of disodium hydrogen phosphate dodecahydrate and sodium dihydrogen phosphate monohydrate, preferably at a molar concentration ratio of between about 1: 10 to about 10: 1, more preferably between about 1: 5 to about 5: 1, for example about 1: 1 or about 8: 2. In another preferred embodiment, the concentration of the phosphate in the pharmaceutical preparation is between about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably 10 mM to about 20 mM, and most preferably about 10 mM, based on all phosphates in the pharmaceutical preparation.

[0090] (d) pH

[0091] The pH of the pharmaceutical preparation as an injection is generally comparable to the physiological pH of the human body, and is usually in the range of about 7.0 to about 7.6.

[0092] In the present application, the inventors found through the formulation design and screening tests that, for the recombinant AAV expressing CYP4V2 of the subject application, in the formulation of the present application, the preparation at pH 7.3 has significantly better performances in the virus titer determination, freezing-thawing stability, high temperature stability, and biological activity detection. In particular, the inventors unexpectedly found that, when the formulation of the subject application has a pH of about 7.3, the mRNA expression level of the target gene (CYP4V2) was the highest after repeated freezing and thawing (for example, 5 times) .

[0093] Thus, in a preferred embodiment of the subject application, the pharmaceutical preparation of the present application has a pH of between about 7.0 to 7.6, preferably about 7.0, about 7.2, about 7.3, or about 7.6, and most preferably about 7.3.

[0094] Pharmaceutical preparation

[0095] The present application provides a pharmaceutical preparation for treating Bietti’s crystalline dystrophy (BCD) , comprising a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and having a pH between about 7.0 to about 7.6.

[0096] In a preferred embodiment of the present application, the pharmaceutical preparation of the present application is in the form of an aqueous solution for injection, comprising the recombinant AAV, about 120 to about 360 mM of sodium chloride、about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pharmaceutical preparation has a pH of about 7.3.

[0097] In a preferred embodiment of the present application, the pharmaceutical preparation of the present application is in the form of an aqueous solution for injection, comprising the recombinant AAV, about 150 mM of sodium chloride, about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the pharmaceutical preparation has a pH of about 7.3, and the phosphate comprises about 8 mM of disodium hydrogen phosphate dodecahydrate and about 2 mM of sodium dihydrogen phosphate monohydrate. The sodium chloride, disodium hydrogen phosphate dodecahydrate, and sodium dihydrogen phosphate monohydrate in the formulation of the present application described above can not only maintain the stability of the pH of the preparation, but also ensure the isotonicity of the preparation and the plasma osmotic pressure, ensuring the stability of the injection itself and the drug safety. The amount of each adjuvant in the formulation described above falls within the maximum limit stipulated by NMPA / FDA, and conforms to the standards of Part II and Part IV of the 2020 edition of the Chinese Pharmacopoeia.

[0098] In a preferred embodiment of the present application, the pharmaceutical preparation of the present application is a colorless, clear and transparent liquid, and has an osmotic pressure of between about 270 to about 330 mOsmol / kg.

[0099] In a preferred embodiment of the present application, the pharmaceutical preparation of the present application is in the form of an aqueous solution for injection, and / or the titer of the recombinant AAV in the pharmaceutical preparation is between about 1.0×1011 vg / ml (vg / ml means the number of viral genome copies per milliliter) to about 1.0×1013 vg / ml, preferably  between about 2.0×1011 vg / ml to about 8.0×1012 vg / ml, more preferably between about 2.5×1011 vg / ml to about 2.0×1012 vg / ml, for example about 2.5×1011 vg / ml, about 1.0×1012 vg / ml, and about 2.0×1012 vg / ml, and more preferably about 2.5×1011 vg / ml, about 5.0×1011 vg / ml, or about 1.0×1012 vg / ml.

[0100] In a particularly preferred embodiment, the constitution of the pharmaceutical preparation of the present application (except for water for injection and rAAV) is as shown in Table A:

[0101] Table A

[0102] Treatment method

[0103] The present application also provides a method for treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, including administrating to a subject in need thereof a therapeutically effective amount of the pharmaceutical preparation according to the present application.

[0104] Preferably, the pharmaceutical preparation is an injection.

[0105] In a preferred embodiment of the present application, the disease or disorder is Bietti’s crystalline dystrophy (BCD) .

[0106] In a preferred embodiment of the present application, the subject is a human.

[0107] In another preferred embodiment of the present application, the pharmaceutical preparation is administrated through injection into the subretinal space, preferably with an administration volume of between about 50 to about 300 μL; and an administration amount of between about 1x1010 vg / eye to about 1x1012 vg / eye, preferably between about 5×1010 vg / eye to about 2.5×1011 vg / eye. The administration procedure through the subretinal space requires one or more thin needles, one or more syringes, and may be accompanied by a vitrectomy.

[0108] For example, the dosage of the pharmaceutical preparation of the subject application may be an injection preparation, and its specification may be about 1.0×1012 vg / ml, 0.3 ml / vial; or about 2.5×1011 vg / ml, 0.3 ml / vial.

[0109] Example

[0110] With respect to gene therapy products expressing CYP4V2 with AAV8 as vector for treating BCD, the inventors screened the type and concentration of buffer salt ions, the surfactant type, and the pH for the formulation of the injection preparation, involving 18 combinations for different preparation formulations in total, and conducted the virus titer determination, freezing-thawing stability test, high temperature stability test, and biological activity detection for the recombinant AAV (ZVS101e) expressing CYP4V2 in different formulation systems for preparations to determine the final formulations for preparations.

[0111] Example 1. Screening of formulation ingredients for preparations

[0112] 1) Preparation of recombinant AAV expressing CYP4V2

[0113] The recombinant AAV expressing CYP4V2 was prepared according to the method in described in CN113106124B or US17 / 812,425, to obtain the recombinant AAV2 / 8 virus ZVS101e.

[0114] The product information for ZVS101e is as follows:

[0115] Vector: AAV8

[0116] Genome sequences (ITR sequences at both ends, both from AAV2) :

[0117] 5’ ITR-CAG-kozak-CYP4V2-BGH-ITR 3’

[0118] wherein the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises an amino acid sequence set forth in SEQ ID NO: 2, the polynucleotide encoding CYP4V2 comprises a nucleotide sequence set forth in SEQ ID NO: 3; the BGH polyA signal comprises a nucleotide sequence set forth in SEQ ID NO: 4; the Kozak sequence is set forth in SEQ ID NO: 5; and the ITR sequence is from AAV2. The genome sequence described above is set forth in SEQ ID NO: 6.

[0119] Capsid protein: AAV8

[0120] which is composed of 60 capsid protein subunits comprising VP1 having an amino acid sequence set forth in SEQ ID NO: 7, VP2 having an amino acid sequence set forth in SEQ ID NO: 8 and VP3 having an amino acid sequence set forth in SEQ ID NO: 9 at a number ratio of 1: 1: 10.

[0121] 2) Formulation design and screening for the preparation

[0122] First, two aqueous buffer systems were designed: phosphate buffer system and sodium citrate buffer system; and two surfactant formulations were tried at the same time: Poloxamer 188 and Poloxamer 407 (BASF) . Combined with different salt ion concentrations, 12 formulations as follows were designed for ZVS101e:

[0123] Table 1. Formulation design for the solution of the preparation

[0124] After the formulation was completed, the ZVS101e virus (target titer 2.0×1012 vg / mL) was ultrafiltered into the 12 formulation buffers as above using 100 KDa ultrafiltration tubes. The specific ultrafiltration procedure was as follows: 0.5 mL of virus stock solution was taken and filled up with a buffer to 15 mL, centrifuged to remain 0.5 mL, filled up again, centrifuged to remain 0.5 mL, finally added with a buffer to 1.2 mL, and aliquoted into a total of 12 tubes with 0.1 mL / tube.

[0125] (1) According to the method reported in the literature (Martinez-Fernandez de la Camara, C., et al. (2021) . “Accurate Quantification of AAV Vector Genomes by Quantitative PCR. ” Genes (Basel) 12 (4) ) , the virus titers for ZVS101e in different preparations were detected:

[0126] Table 2

[0127] The results showed that (Table 2) , the virus titers of ZVS101e in citrate buffer (Formulation 15 and Formulation 16) were quite different from the target titer; the virus titers of ZVS101e when using Poloxamer 407 as the surfactant (Formulation 10 and Formulation 11) were quite different from the target titer (such differences would not only cause distortions of experiment results and affect the quantification, but also seriously affect the product quality control) ; while the virus titers of ZVS101e in the formulations for the preparation using phosphate and Poloxamer 188 as the surfactant exhibited a small difference from the target titer. They were more suitable for acting as the formulation ingredients of the ZVS101e preparation.

[0128] (2) Measurement results for the particle size of ZVS101e in different preparations

[0129] The particle size and distribution of ZVS101e in different preparations were analyzed, using Unchained Labs Uncle Versatile Protein Stability Analyzer (brand: Unchained Labs; model: Uncle) . The dynamic light scattering (DLS) results showed that (see FIG. 2) , Formulations 01, 03, 04, 05, 09, 10, 15, and 16 had particle sizes ranging from 26 to 29 nm, only with slight aggregation peaks; while Formulations 06, 07, 08, and 11 had relatively discrete particle size distributions, with relatively obvious aggregation peaks.

[0130] (3) Detections of the denaturation curve and aggregation curve for ZVS101e in different preparations

[0131] The denaturation and aggregation curves of ZVS101e in different preparations were detected, using Unchained Labs Uncle Versatile Protein Stability Analyzer. The measurement results showed that (see FIG. 3 and FIG. 4) , the trends of denaturation curves were relatively similar, speculating that the conformations, denaturation processes, titers, and buffer conditions of AAV were relatively similar; and there was a clear upward trend around 70℃ , speculating that AAV were aggregated. The aggregation curves showed that the aggregation degrees for Formulations 4, 6, and 8 were significantly increased, speculating that larger aggregates were formed.

[0132] (4) Summary

[0133] From the above tests, the virus titer stability, particle size distribution, and aggregation of ZVS101e in different formulations were evaluated (see Table 3) , wherein Formulations 01, 03, 05, and 09 had better performances. Thus, further screenings may be subsequently conducted in the conditions around 10 mM~20 mM PB (phosphate buffer) , 120~360 mM NaCl, 0.001%poloxamer 188, pH 7.2.

[0134] Table 3

[0135] Example 2. Screening of salt ion concentration and pH in the preparation formulation

[0136] In order to further determine the salt ion concentration and pH in the preparation formulation, 6 kinds of preparation formulations were designed and the experiments were conducted with 2.0×1012 vg / mL as the target titer of ZVS101e injection solution, as shown in the table below:

[0137] Table 4. Formulations for the preparation solutions

[0138] (pH 7.3 solution: 10 mM PB comprising about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate; and the remaining pH solutions were adjusted to pH 7.0 or pH 7.6 by adding an appropriate amount of 1M NaOH solution or 1M HCl solution based on the pH 7.3 solution; and P188 refers to Poloxamer 188)

[0139] The purified ZVS101e stock solution was put into 6 different aqueous solutions in Table 4 using Millipore 50 kD ultrafiltration centrifuge tubes, respectively, with a target titer of 2.0×1012 vg / mL. After filtering with a 0.22 μm PVDF syringe filter, a total volume of about 5 ml was divided into 3 bottles, with about 1.4 ml for each bottle. The freezing-thawing test (freezing-thawing once, and freezing-thawing for five times) and high-temperature stability test (37 ℃ for 7 days) were carried out, respectively, and the sample stability was judged by detecting the genome titer and the mRNA expression of the target gene.

[0140] 1) Freezing-thawing test

[0141] A) Genome titer

[0142] The genome titers after freezing-thawing once and freezing-thawing for 5 times were detected, respectively, as shown in Table 5. The results showed that the genome titers for the 6 groups of solutions were normal after freezing-thawing test, and there were no significant differences among these 6 formulations.

[0143] Table 5. Freezing-thawing stability results for genome titer

[0144] B) mRNA expression of target gene (CYP4V2)

[0145] The samples were tested for mRNA expression after freezing-thawing once and freezing-thawing for 5 times. With MOI=1e5, 293T cells were infected. The cells were harvested and lysed after 3 days, to extract RNAs (TaKaRa, MiniBEST Universal RNA Extraction Kit) and detect the expression levels of target gene mRNA and internal reference gene mRNA (ACTB-βactin as internal reference gene) . The detection instrument was 7500, ABI. The kit for reverse transcription and qPCR detection was HiScript II U+ One Step qRT-PCR Probe Kit, Vazyme, Q222-CN-00. The primer probes were synthesized by Anhui GeneralBiol, and the sequences were as follows (5’→3’) : CYP4V2-qPCR-F  ATTGTGAAGTGGCAGGTTACA (SEQ ID NO: 10) CYP4V2-qPCR-R  GGGAAGTATCTCGGATCTCTG (SEQ ID NO: 11) CYP4V2-qPCR-P  CATAGGGAATGATGACGGCTT (SEQ ID NO: 12) ACTB-qPCR-F    CTCGGCCACATTGTGAACTT (SEQ ID NO: 13) ACTB-qPCR-R    AACGGTGAAGGTGACAGCA (SEQ ID NO: 14) ACTB-qPCR-P    ATGCTCGCTCCAACCGAC (SEQ ID NO: 15)

[0146] The mRNA expression results of the freezing-thawing test were shown in FIG. 5.

[0147] The mRNA measurement results showed that, Solution 18 (Formulation 18, 150 mM NaCl, pH 7.3) and Solution 19 (Formulation 19, 150 mM NaCl, pH 7.6) had slightly higher mRNA expressions, where 150 mM NaCl, pH 7.3 exhibited the highest expression level.

[0148] 2) High temperature stability test

[0149] A) Genome titer

[0150] The genome titers at Point 0 and after 7 days of storage at 37℃ for the 6 formulations were detected, respectively, as shown in Table 6. The results showed that the titer of Formulation 17 decreased slightly after 7 days of storage at 37℃, and there were no significant differences among other formulations.

[0151] Table 6. Genome titers for different formulations after being placed at high temperature

[0152] B) mRNA expression of target gene (CYP4V2)

[0153] The samples of the 6 formulations were tested for mRNA expression at Point 0 and after 7 days of storage at 37℃. With MOI=1e5, 293T cells were infected. The cells were harvested and lysed after 3 days, to extract RNAs for reverse transcription and detect the expression levels of target gene mRNA and internal reference gene mRNA. The mRNA expression results after storage at high temperature for different formulations were shown in FIG. 6.

[0154] According to the results of mRNA expression, mRNA was expressed under the conditions of each group. After 7 days of storage at 37℃, the expression level in the 180 mM NaCl experiment group (Formulation 20, Formulation 21, and Formulation 22) gradually decreased as the pH increased; while the expression level in the 150 mM NaCl experiment group (Formulation 17, Formulation 18, and Formulation 19) was relatively stable.

[0155] In comprehensive consideration of the screening test results for the preparation stability as above, Formulation 18 was selected as the formulation for further research on ZVS101e .

[0156] Example 3. Comparative study on the stability of ZVS101e and AAV8-Cas9 in Formulation 18 as the preparation formulation

[0157] In order to explore whether Formulation 18 was applicable to all AAVs with AAV8 as the serotype, or only applicable to ZVS101e (AAV8 virus capsid, and expression vector for CYP4V2) , ZVS101e and AAV8-Cas9 (the construction for AAV8-Cas9 referring to  CN113038972B) were used in a comparative study on the stability of Formulation 18 as the preparation formulation (stability test conditions: storage at < -60℃) . The results were shown in Table 7.

[0158] Table 7

[0159] The above results showed that, after 3 months of stability study, ZVS101e had a good stability in Formulation 18, while the genome titer of AAV8-Cas9 in the same formulation decreased significantly.

[0160] Example 4. Short-term irritation comparison for different adjuvant solutions in wild-type mice administrated by subretinal injection

[0161] The local irritation in eyes for different preparations after subretinal injection in mice was also evaluated. Since the local inflammatory response in the retina caused by the injection operation or preparation formulation could be reflected in the fundus color photographs, the fundus color photographs served as the main observation index for this test.

[0162] The test system was 4-8 weeks old wild-type C57BL / 6J mice (commercially purchased from Vitalriver) , and the specific grouping and administration were shown in the table below:

[0163] Table 8

[0164] (10 mM PB comprising about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate; and P188 refers to Poloxamer 188)

[0165] Two weeks after administration by subretinal injection, fundus color photographs were taken to evaluate the local irritation in the retina. The results of fundus color photographs showed that (FIG. 7) , the local pigment degeneration was seen in the fundus of mice in each test group, wherein Groups 1, 2, and 4 were slightly severe. In other words, the formulation (10 mM PB, 150 mM NaCl, 0.001%P188, pH 7.3) was significantly less irritating to the retina of mice than the formulation (10 mM PB, 180 mM NaCl, 0.001%P188, pH 7.3) . This was unexpected since their difference only lied in the NaCl concentration.

[0166] Example 5. Short-term safety comparison for ZVS101e with different preparation formulations in BCD mice injected through the subretinal space

[0167] In order to investigate whether the difference in retinal inflammatory response caused by the formulations described above was still existed when AAV was included, two batches of ZVS101e injections were made using two different formulations. The formulation used in Lot 1 was 10 mM PB, 150 mM NaCl, 0.001%P188, pH 7.3; and the formulation used in Lot 2 was 10 mM PB, 180 mM NaCl, 0.001%P188, pH 7.3. In order to compare the safety of the two batches of drugs and corresponding formulations, 2 weeks after injection through the subretinal space in BCD mice (purchased from Beijing Biocytogen, Cyp4v3- / -) , the local retinal inflammation was  observed by fundus color photograph, the retinal structure change was observed by OCT, and the visual function in mice was observed by ERG. After the biopsy detections as above were completed, the mice were euthanized, and the left eyeball was taken for paraffin section preparation to observe the retinal tissue structure; and the right eyeball was used for RNA extraction to detect the mRNA expression levels of transgenic hCYP4V2 and inflammatory factors.

[0168] Table 9

[0169] The results of fundus color photographs showed that (FIG. 8) , the mice in the injection groups had local retinal physical damages at the injection sites as compared with the mice in the non-injection mock group. At the same time, the local pigment degenerations were seen in the fundus of the mice, wherein the degrees of retinal degeneration in vehicle-2 and lot-2 groups were higher than those in vehicle-1 and lot-1 groups, respectively.

[0170] The retina and RPE layer were separated from the right eyes of mice in each group, and RNAs were extracted, respectively (TaKaRa, MiniBEST Universal RNA Extraction Kit) and subjected to reverse transcription (TaKaRa, PrimeScriptTM RT reagent Kit with gDNA Eraser) to detect the mRNA expression levels of transgenic hCYP4V2, endogenous mCYP4V3, and inflammatory factors. The detection instrument was 7500, ABI. The kit for PCR detection was Real Time PCR SYBR Master Mix, ABI. The PCR primers were synthesized by Genewiz (Suzhou) , and the sequences were as follows: CYP4V2-qPCR-F  AGTTCCAGCCTGAGCGGTTCTT (SEQ ID NO: 16) CYP4V2-qPCR-R  CCTCAGGATGCACGAAAGAATGG (SEQ ID NO: 17) mCYP4V3-qPCR-F CTTAGCGAGGACTGTGAAGTGG (SEQ ID NO: 18) mCYP4V3-qPCR-R GAAAGAACCGCTCTGGTCGGAA (SEQ ID NO: 19) mACTB-qPCR-F   CATTGCTGACAGGATGCAGAAGG (SEQ ID NO: 20) mACTB-qPCR-R   TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO: 21) mCD11b-qPCR-F  TACTTCGGGCAGTCTCTGAGTG (SEQ ID NO: 22) mCD11b-qPCR-R  ATGGTTGCCTCCAGTCTCAGCA (SEQ ID NO: 23) mNLRP3-qPCR-F  TCACAACTCGCCCAAGGAGGAA (SEQ ID NO: 24) mNLRP3-qPCR-R  AAGAGACCACGGCAGAAGCTAG (SEQ ID NO: 25)

[0171] As shown in FIG. 9, FIG. 10, and FIG. 11, the results of RNA level detection showed that, in both lot-1 and lot-2, hCYP4V2 mRNA could be successfully expressed in the retina and RPE cells of mice, wherein lot-1 showed a higher expression efficiency. There was no significant difference in the expression level of endogenous mCYP4V3 among the groups. The results of inflammatory factor detection showed that, compared with the vehicle-1 and lot-1 groups, the expression levels of the inflammatory factor mNLRP3 in the retina and RPE of the mice were higher in the vehicle-2 and lot-2 groups, and the levels of macrophage marker mCD11b in the retina of mice increased in the vehicle-2 and lot-2 groups.

[0172] Again, the above results showed that, for the gene therapy AAV product of the present application (ZVS101e) , the formulation of 10 mM PB, 150 mM NaCl, 0.001%P188, pH 7.3 was a safer, more stable, and more effective formulation.

[0173] Example 6. GLP safety pharmacology, pharmacokinetics, and toxicology researches of ZVS101e in cynomolgus monkeys and rats using Formulation 18 as the preparation formulation

[0174] According to the formulation stability screening test and mouse test as above, Formulation 18 was selected as the preparation formulation for ZVS101e.

[0175] In order to further verify the safety and effectiveness in its clinical application, the GLP safety pharmacology, pharmacokinetics, and toxicology researches were conducted in cynomolgus monkeys and BN rats (relevant GLP trials were accomplished by JOINN (Suzhou) ) .

[0176] Cynomolgus monkeys were subjected to the single injection through the subretinal space in both eyes with adjuvant (separate preparation) and low and high dosage ZVS101e injections, and the recovery period was 13 weeks (see Table 10) . No abnormal changes associated with test products were observed in the cardiovascular, respiratory, and nervous systems of animals. At 4 and 13 weeks after administration in cynomolgus monkeys, the viral genome was detected to be widely distributed in ocular tissues, with the largest distributions in the retina and choroid. The mRNA was expressed in most of the ocular tissues, with high mRNA expressions in the choroid  and retina. The histopathological results showed that, there was no abnormality in the general observation of cynomolgus monkeys, and only slight or mild lymphocyte infiltration as well as the disorder, atrophy, or hyperplasia in the local retinal layer in the area covered by the drug solution were seen in the high dosage group.

[0177] Table 10: Toxicity test design for ZVS101e single injections through the subretinal space in both eyes to cynomolgus monkeys and 13-week recovery period

[0178] Rats were subjected to the single injection through the subretinal space in both eyes with adjuvant (separate preparation) and low and high dosage ZVS101e injections (see Table 11) , and the recovery period was 13 weeks. At 4 and 13 weeks after administration, the viral genome was detected to be widely distributed in ocular tissues, with the largest distributions in the retina / choroid and sclera. The mRNA was expressed in most of the ocular tissues, with high mRNA expressions in the retina / choroid, sclera, and iris. No systemic toxicity was seen. The slight or mild dosage-related retinal morphological or structural abnormalities were seen in the eyes.

[0179] Table 11: Toxicity test design for ZVS101e single injections through the subretinal space in both eyes to BN rats and 13-week recovery period

[0180] The above results showed that this preparation formulation had a good safety profile and local ocular tolerance for injection through the subretinal space in rats and monkeys. At the same time, ZVS101e diluted in this preparation formulation also had a good safety profile and could effectively infect the retina and express the target gene mRNA.

[0181] Example 7. Human clinical safety and effectiveness researches of ZVS101e using Formulation 18 as the preparation formulation

[0182] Using Formulation 18 as the preparation formulation for ZVS101e, under GMP-level production and strict QC quality control as well as sufficiently scientific in vivo and in vitro pharmacodynamics and GLP toxicology researches, ZVS101e showed significant preclinical safety and effectiveness, and could effectively support its clinical applications.

[0183] In 2021, a clinical trial for ZVS101e administrated through the subretinal space in BCD patients was launched at Beijing Tongren Hospital affiliated to Capital Medical University (NCT04722107) (7.5×1010 vg / eye, administration volume 150 μL / eye) . It was the first clinical trial for BCD in the world. At present, all 12 patients have been enrolled, and 6 patients have been followed up for more than 1 year. During the research period, none of the subjects had serious drug-related adverse reactions, showing that ZVS101e had a good clinical safety. At the same time, the visual functions of the subjects were improved, and the best corrected visual acuity (BCVA) (Chaikitmongkol, V., et al. (2018) . “Repeatability and Agreement of Visual Acuity Using the ETDRS Number Chart, Landolt C Chart, or ETDRS Alphabet Chart in Eyes With or Without Sight-Threatening Diseases. ” JAMA Ophthalmol 136 (3) : 286-290) and other  indicators were significantly improved, showing that ZVS101e had a good clinical effectiveness (the results of some patients referring to FIG. 12) .

[0184] Those skilled in the art should understand that, although the invention has been described in details with reference to the above examples, the invention is not limited to these specific examples. Based on the methods and technical solutions taught by the invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the invention, and the equivalent embodiments thus obtained are all within the scope of the invention.

Claims

1.A pharmaceutical preparation comprising: a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, wherein the pharmaceutical preparation has a pH between about 7.0 to about 7.6.2.The pharmaceutical preparation according to claim 1, wherein the recombinant AAV comprises an AAV vector expressing a polynucleotide encoding CYP4V2 by a promoter as the genomic sequence, and preferably the AAV vector sequentially comprises, in 5’ to 3’ direction: a promoter, a polynucleotide encoding CYP4V2, and a PolyA signal site, wherein the promoter is operably linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.3.The pharmaceutical preparation according to claim 2, wherein the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises an amino acid sequence set forth in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises a nucleotide sequence set forth in SEQ ID NO: 3; and / or the PolyA signal site comprises a BGH polyA signal, preferably a nucleotide sequence set forth in SEQ ID NO: 4; more preferably, the AAV vector also comprises a Kozak sequence set forth in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably, the AAV vector also comprises identical or different inverted terminal repeat (ITR) sequences at 5’ side of the CAG promoter and at 3’ side of the PolyA signal site, respectively, preferably the ITR sequences are from AAV2.4.The pharmaceutical preparation according to any of claims 2 to 3, wherein the AAV vector comprises the following genomic elements in 5’ to 3’ direction: ITR-CAG-Kozak-CYP4V2-BGH-ITR, and preferably comprises the genomic sequence set forth in SEQ ID NO: 6; and / or the capsid protein of the recombinant AAV has a serotype of AAV8.5.The pharmaceutical preparation according to any of claims 1 to 4, wherein the capsid protein of the recombinant AAV is AAV8 capsid protein, composed of 60 capsid protein subunits comprising VP1 having an amino acid sequence set forth in SEQ ID NO: 7, VP2 having an  amino acid sequence set forth in SEQ ID NO: 8 and VP3 having an amino acid sequence set forth in SEQ ID NO: 9 at a number ratio of 1: 1: 10.6.The pharmaceutical preparation according to any of claims 1 to 5, wherein the pharmaceutical preparation is in a form of aqueous solution for injection, and / or the titer of the recombinant AAV in the pharmaceutical preparation is between about 1.0×1011 vg / ml to about 1.0×1013 vg / ml, preferably between about 2.0×1011 vg / ml to about 8.0×1012 vg / ml, more preferably between about 2.5×1011 vg / ml to about 2.0×1012 vg / ml, for example about 2.5×1011 vg / ml, about 1.0×1012 vg / ml, and about 2.0×1012 vg / ml, and more preferably about 2.5×1011 vg / ml, about 5.0×1011 vg / ml, or about 1.0×1012 vg / ml.7.The pharmaceutical preparation according to any of claims 1 to 6, wherein the poloxamer comprises Poloxamer 188, preferably at a concentration of between about 0.0001%by weight to about 0.01%by weight, preferably between about 0.0002%by weight to about 0.005%by weight, most preferably about 0.001%by weight, by the weight of the pharmaceutical preparation.8.The pharmaceutical preparation according to any of claims 1 to 7, wherein the concentration of the sodium chloride in the pharmaceutical preparation is between about 120 mM to about 360 mM, preferably between about 150 mM to about 180 mM, and most preferably 150 mM.9.The pharmaceutical preparation according to any of claims 1 to 8, wherein1) the phosphate is selected from disodium hydrogen phosphate or hydrates thereof, sodium dihydrogen phosphate or hydrates thereof, dipotassium hydrogen phosphate or hydrates thereof, potassium dihydrogen phosphate or hydrates thereof, sodium phosphate or hydrates thereof, potassium phosphate or hydrates thereof, or any combination thereof, preferably a combination of disodium hydrogen phosphate or hydrates thereof and sodium dihydrogen phosphate or hydrates thereof, or a combination of dipotassium hydrogen phosphate or hydrates thereof and potassium dihydrogen phosphate or hydrates thereof, more preferably a combination of disodium hydrogen phosphate or hydrates thereof (for example disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or hydrates thereof (for example sodium dihydrogen phosphate monohydrate) , preferably at a molar concentration ratio of between about 1: 10 to about 10: 1, more preferably between about 1: 5 to about 5: 1, for example about 1: 1 or about 8: 2; and / or2) the concentration of the phosphate in the pharmaceutical preparation is between about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably 10 mM to about 20 mM, and most preferably about 10 mM, based on all phosphates in the pharmaceutical preparation.10.The pharmaceutical preparation according to any of claims 1 to 9, which is in a form of aqueous solution for injection, comprising the recombinant AAV, about 120 to about 360 mM of sodium chloride、 about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pharmaceutical preparation has a pH of about 7.3.11.The pharmaceutical preparation according to claim 10, comprising the recombinant AAV, about 150 mM of sodium chloride, about 0.001%by weight of Poloxamer 188, about 10 mM of phosphate, and water for injection, wherein the pharmaceutical preparation has a pH of about 7.3, and the phosphate comprises about 8 mM of disodium hydrogen phosphate dodecahydrate and about 2 mM of sodium dihydrogen phosphate monohydrate.12.The pharmaceutical preparation according to any of claims 1 to 11, which is a colorless, clear and transparent liquid, and having an osmotic pressure of between about 270 to about 330 mOsmol / kg.13.A method for treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, including administrating to a subject a therapeutically effective amount of the pharmaceutical preparation according to any of claims 1 to 12.14.The method according to claim 13, wherein the disease or disorder is Bietti’s crystalline dystrophy (BCD) , and preferably the subject is a human.15.The method according to claim 14, wherein the pharmaceutical preparation is administrated by subretinal injection, preferably with an administration volume of between about 50 to about 300 μL; and an administration amount of between about 1x1010 vg / eye to about 1x1012 vg / eye, preferably between about 5×1010 vg / eye to about 2.5×1011 vg / eye.