Engineered mitochondrion
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- AGENCY FOR SCI TECH & RES
- Filing Date
- 2024-08-08
- Publication Date
- 2026-06-24
AI Technical Summary
Current methods for mitochondrial uptake by host cells are inefficient, and there are no methods to specifically target mitochondria for uptake by specific cell types, limiting the effectiveness of mitotherapy for mitochondrial disorders and degenerative diseases.
Engineering a small protein motif on the surface of donor mitochondria to enhance interactions with the host cell surface, specifically by inserting a cell surface binding moiety like the laminin-derived peptide IKVAV onto the mitochondrial outer membrane using Cas9-mediated genome-editing strategies.
Improves mitochondrial uptake by increasing the duration or propensity of close mitochondrial proximity to the host cell, leading to enhanced targeting and uptake by specific cell types, such as cardiomyocytes, thereby potentially treating mitochondrial disorders more effectively.
Smart Images

Figure IMGF000014_0001 
Figure IMGF000015_0001 
Figure IMGF000016_0001
Abstract
Description
[0001] ENGINEERED MITOCHONDRION
[0002] TECHNICAL FIELD
[0003] The present disclosure relates broadly to an engineered organelle. The present disclosure relates specifically to an engineered mitochondrion. The present disclosure also relates to methods of improving / increasing mitochondrion uptake by a cell of interest.
[0004] BACKGROUND
[0005] Mitotherapy, or mitochondrial transplantation, is a viable therapeutic treatment for mitochondrial disorders and degenerative diseases. However, the current efficiency of mitochondrial uptake by host cells is low, and there are no current methods to target mitochondria for uptake by specific cell types.
[0006] Extracellular mitochondria can be internalized by cells in vitro and in vivo. However, the efficiency of uptake is low. Accordingly, there is a need to provide engineered mitochondria that may be easily uptake by specific cell types.
[0007] There is a need to provide an alternative cell-based therapy. There is an urgent need to provide an engineered organelle such as an engineered mitochondrion.
[0008] SUMMARY
[0009] Treatment of therapeutics in vivo would benefit from cell-specific internalization of the therapeutic into the cells of interest. One potential therapeutic of interest is the utilization of exogenously generated healthy mitochondria to treat cells. However, the efficiency of uptake of mitochondria into cells is low.
[0010] The present disclosure improves mitochondrial uptake by increasing the duration or propensity of close mitochondrial proximity to the host cell. The present inventors do so by engineering a small protein motif on the surface of donor mitochondrion to enhance interactions between the mitochondrion surface to the cell surface. There are currently no known small protein motifs that have been demonstrated to have interactions with cardiomyocyte surfaces. Therefore, two methods to identify possible motifs that have such binding properties are disclosed herein. Using Cas9-mediated genome-editing strategies on wild-type induced pluripotent stem cells, the present disclosure inserted a cell surface binding moiety based on the sequence of laminin-derived peptide (IKVAV, SEQ ID NO: 18) onto the mitochondrial outer membrane to enhance its targeting and uptake by cells expressing the p1-integrin. Using the same concept, the present inventors genetically engineered a human induced pluripotent stem cell (iPSC) cell line using CRISPR to produce the bioengineered mitochondria expressing the proposed cardiac peptide motifs on the mitochondrial surface.
[0011] In one aspect, there is provided an engineered mitochondrion comprising one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
[0012] In some examples, the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide, optionally the ECM binding motif / peptide is on the cytosolic face of the outer mitochondrial membrane.
[0013] In some examples, the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide comprising a laminin-derived peptide, a surface marker peptide, a fibronectin-derived peptide, a collagen-derived peptide, a gelatin-derived peptide, an agrin-derived peptide, and / or a combination thereof.
[0014] In some examples, the exogenous protein binding motif / peptide comprises about 4 to 40 amino acids residues.
[0015] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide.
[0016] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 17),
[0017] Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18),
[0018] Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),
[0019] Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),
[0020] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide
[0021] D, Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),
[0022] Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),
[0023] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
[0024] In some examples, the exogenous protein binding motif / peptide comprises a cardiac-specific laminin that interacts with cardiomyocyte-surface integrins.
[0025] In some examples, the exogenous protein binding motif / peptide comprises one or more exposed regions on the interacting domain of laminin, including the helix, loop, and laminin globular (LG) domains LG1 , LG2, LG3, LG4, LG5, and / or combinations thereof, optionally the exogenous protein binding motif / peptide comprises an exposed region between Helix and LG1 , an exposed region between LG1 and LG2, an exposed region between LG2 and LG3, and an exposed loop in LG3, or combinations thereof.
[0026] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence of
[0027] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide 1),
[0028] Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),
[0029] Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),
[0030] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
[0031] In some examples, the exogenous protein binding motif / peptide comprises a surface marker peptide.
[0032] In some examples, the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte.
[0033] In some examples, the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte is SIRPa.
[0034] In some examples, the exogenous protein binding motif / peptide comprising a SIRPa surface marker protein comprising a peptide having the sequence Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - peptide 7),
[0035] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5
[0036] - peptide 5),
[0037] Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE, SEQ ID NO: 6 - peptide 6), or combinations thereof.
[0038] In some examples, the exogenous protein binding motif / peptide comprising a SIRPa surface marker protein comprising a peptide having the sequence
[0039] Val-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA, SEQ ID NO: 12 - ABC peptide),
[0040] Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF, SEQ ID NO: 11 - AB- rear),
[0041] Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - AB full),
[0042] Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV, SEQ ID NO: 10 - AB-Mid),
[0043] Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN, SEQ ID NO: 9 - AB- front),
[0044] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5
[0045] - BC peptide), or combinations thereof.
[0046] In some examples, the exogenous protein binding motif / peptide comprises a fibronectin-derived peptide comprising Arg-Gly-Asp (RGD, SEQ ID NO: 13), Pro-His- Ser-Arg-Asn (PHSRN, SEQ ID NO: 14), cyclic RGD, and / or a combination thereof.
[0047] In some examples, the exogenous protein binding motif / peptide comprises a collagen-derived peptide comprising Asp-Gly-Glu-Ala (DGEA, SEQ ID NO: 16).
[0048] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous mitochondrial outer membrane protein.
[0049] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous translocase of the outer mitochondrial membrane complex, optionally an exogenous TQM20, TQM70, TQM40, TOM22, TOM7, TOM6, TOM5, TQM70, SAM50, SAM35, SAM37, Mimi , Mim2, or combinations thereof.
[0050] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TQM20, TOM22, TQM70, SAM50, PORIN, outer membrane protein 25 (OMP25), or combinations thereof. In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TOM20 protein.
[0051] In some examples, the mitochondrion is derived from a cell selected from the group consisting of an induced pluripotent stem cell, a mesenchymal stem cell, an adipose-derived stem cell, and an adult stem cell.
[0052] In yet another aspect, there is provided a polynucleotide encoding the mitochondrion as disclosed herein.
[0053] In some examples, the polynucleotide encodes for an insertion construct comprising sequences encoding an exogenous outer membrane protein of a mitochondrion and / or an exogenous protein binding motif / peptide.
[0054] In some examples, the polynucleotide encoding encodes for an exogenous protein binding motif / peptide having one or more sequences selected from the group consisting of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 17),
[0055] Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18),
[0056] Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),
[0057] Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),
[0058] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS - CP peptide 1 , SEQ ID NO: 1),
[0059] Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lso (CTVSPQVEDSEGTI - CP peptide 2, SEQ ID NO: 2),
[0060] Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT- CP peptide 3, SEQ ID NO: 3),
[0061] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA - CP peptide 4, SEQ ID NO: 4),
[0062] Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF - peptide 7, SEQ ID NO: 7),
[0063] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - peptide 5, SEQ ID NO: 5),
[0064] Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE - peptide 6, SEQ ID NO: 6),
[0065] Val-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA - ABC peptide, SEQ ID NO: 12), Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF - AB-rear, SEQ ID NO: 11), Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTWIPCF - AB full, SEQ ID NO: 7), Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV - AB-Mid, SEQ ID NO: 10), Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN - AB-front), Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - BC peptide, SEQ ID NO: 5), or combinations thereof.
[0066] In some examples, the polynucleotide encodes for an insertion construct comprising sequences encoding a TQMM20 and / or a cardiac peptide motif.
[0067] In yet another aspect, there is provided a vector comprising the polynucleotide encoding the mitochondrion as disclosed herein or comprising the polynucleotide as disclosed herein.
[0068] In yet another aspect, there is provided a host cell comprising the vector as disclosed herein.
[0069] In yet another aspect, there is provided a cell comprising the mitochondrion of as disclosed herein.
[0070] In yet another aspect, there is provided a composition or pharmaceutical composition comprising the engineered mitochondrion or polynucleotide as disclosed herein.
[0071] In yet another aspect, there is provided a composition or pharmaceutical composition as disclosed herein for use in therapy / medicine.
[0072] In yet another aspect, there is provided a method of preventing and / or treating a disease in a subject in need thereof, the method comprises administering to the subject the engineered mitochondrion as disclosed herein or polynucleotide as disclosed herein or composition as disclosed herein.
[0073] In some examples, the disease is a mitochondrial disorder or a proliferative disease. In yet another aspect, there is provided a method of improving mitochondrion uptake into a target cell comprising genetically modifying a host cell to express a modified mitochondrion, wherein the modified mitochondrion comprises one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
[0074] In some examples, the host cell is genetically modified via viral transduction or a CRISPR gene modification system.
[0075] DEFINITIONS
[0076] As used herein, the term “engineered organelle” or “bioengineered organelle” refers to an organelle that is modified by the application of biological techniques (such as genome editing).
[0077] As used herein, the term “engineered mitochondrion” or “bioengineered mitochondrion” refers to a mitochondrion that is modified by the application of biological techniques (such as genome editing). In the present disclosure, the engineered mitochondrion has improved / enhanced micropinocytosis.
[0078] As used herein, the term “motif”, “binding motif”, “binding moiety”, “protein binding motif”, “protein motif” and “peptides” are understood to describe the same component and may therefore be used interchangeably. The term “binding motif” refers to protein amino acid sequences that are shown in the present disclosure to have increased binding or interaction affinity to other cell surfaces.
[0079] As used herein, the term “extracellular matrix / ECM” refers to a network consisting of extracellular macromolecules and minerals, such as collagen, enzymes, glycoproteins and hydroxyapatite that provide structural and biochemical support to surrounding cells. The ECM is composed of an interlocking mesh of fibrous proteins and glycosaminoglycans (GAGs).
[0080] As used herein, the term “cell penetrating peptide” refers to short peptides (from 5 to 12 amino acids) that penetrate cell membranes, facilitate uptake in recipient cells and allow for endosomal escape to the cytosol after endocytosis.
[0081] As used herein, the term “mitochondrial membrane protein” refers to mitochondrial membrane transport proteins / mitochondrial carrier proteins which exist in the membranes of the mitochondria. The mitochondria membrane protein serves to transport molecules and other factors, such as ions, into or out of the organelles. Mitochondria contain both an inner and outer membrane, separated by the intermembrane space, or inner boundary membrane.
[0082] As used herein, the term “outer mitochondrial membrane protein” refers to integral proteins in the outer membrane of the mitochondrion which consists of proteins with transmembrane p-barrel and proteins with one or more a-helical membrane anchors. The outer mitochondrial membrane forms the border of mitochondria towards the cellular environment. The outer membrane mitochondrial proteins carry out functions for mitochondrial biogenesis and integration between mitochondria and the cellular system.
[0083] As used herein, the term “exogenous” refers to substances that originate from outside an organism, tissue, or cell. This is in contrast to endogenous substances that originate from within a living system. In the present disclosure, exogenous engineered mitochondrion is introduced by facilitating enhanced endocytosis by the target cell. As disclosed herein, the mitochondrion is engineered to have an enhanced capability of being endocytosed by the target cell.
[0084] As used herein, the term “insertion” refers to the addition of one or more nucleotide base pairs to a DNA sequence with the aim of introducing non-native expression of peptide. Therefore, as used herein, the term “insertion” causes the engineered mitochondrion to express one or more binding motif that would not be natively expressed by a wild type mitochondrion.
[0085] As used herein, the term “death signals” refer to signals e.g., active, or passive molecules that are released accompanying cell death. Death signals can communicate with recipient cells and regulate physio- or pathological events.
[0086] As described herein, a "vector" is any molecule or composition that has the ability to carry a nucleic acid sequence into a suitable host cell where e g., synthesis of the encoded polypeptide can take place. Typically, and preferably, a vector is a nucleic acid that has been engineered, using recombinant DNA techniques that are known in the art, to incorporate a desired nucleic acid sequence (e.g., a nucleic acid of the present disclosure). Expression vectors typically contain one or more of the following components (if they are not already provided by the nucleic acid molecules): a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a leader sequence for secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. Vectors are typically selected to be functional in the host cell in which the vector will be used (the vector is compatible with the host cell machinery such that amplification of the gene and / or expression of the gene can occur. The vector as described herein may be an expression vector and / or a cloning vector.
[0087] The term “host cell,” as used herein, is intended to refer to a cell into which an expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.
[0088] In some examples, the term “treating", "treat" and “therapy”, and synonyms thereof refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) a medical condition, which includes but is not limited to diseases, symptoms, and disorders. A medical condition also includes a body’s response to a disease or disorder, e.g., inflammation. Those in need of such treatment include those already with a medical condition as well as those prone to getting the medical condition or those in whom a medical condition is to be prevented.
[0089] The term “subject” as used herein includes patients and non-patients. The term “patient” refers to individuals suffering or are likely to suffer from a medical condition, while “non-patients” refer to individuals not suffering and are likely to not suffer from the medical condition. “Non-patients” include healthy individuals, non-diseased individuals and / or an individual free from the medical condition. The term “subject” includes humans and animals. Animals may include, but are not limited to, mammals (for example nonhuman primates, canine, murine, leporid, and the like), and the like. “Murine” refers to any mammal from the family Muridae, such as mouse, rat, and the like. “Leporid” refers to any mammal from the family Leporidae, such as hare, rabbit, and the like
[0090] The term “preventing” and / or “reducing the severity of symptoms” as used herein refers to process of delaying the onset, reducing the severity of symptoms, reducing and / or preventing weight loss, preventing death, inhibiting deterioration, inhibiting further deterioration, and / or ameliorating at least one sign or symptom of a disease.
[0091] The term "and / or", e.g., "X and / or Y" is understood to mean either "X and Y" or "X or Y" and should be taken to provide explicit support for both meanings or for either meaning. Further, in the description herein, the word “substantially” whenever used is understood to include, but not restricted to, "entirely" or “completely” and the like. In addition, terms such as "comprising", "comprise", and the like whenever used, are intended to be non-restricting descriptive language in that they broadly include elements / components recited after such terms, in addition to other components not explicitly recited. For example, when “comprising” is used, reference to a “one” feature is also intended to be a reference to “at least one” of that feature. Terms such as “consisting”, “consist”, and the like, may in the appropriate context, be considered as a subset of terms such as "comprising", "comprise", and the like. Therefore, in embodiments disclosed herein using the terms such as "comprising", "comprise", and the like, it will be appreciated that these embodiments provide teaching for corresponding embodiments using terms such as “consisting”, “consist”, and the like. Further, terms such as "about", "approximately" and the like whenever used, typically means a reasonable variation, for example a variation of + / - 5% of the disclosed value, or a variance of 4% of the disclosed value, or a variance of 3% of the disclosed value, a variance of 2% of the disclosed value or a variance of 1% of the disclosed value.
[0092] Furthermore, in the description herein, certain values may be disclosed in a range. The values showing the end points of a range are intended to illustrate a preferred range. Whenever a range has been described, it is intended that the range covers and teaches all possible sub-ranges as well as individual numerical values within that range. That is, the end points of a range should not be interpreted as inflexible limitations. For example, a description of a range of 1% to 5% is intended to have specifically disclosed sub-ranges 1% to 2%, 1% to 3%, 1 % to 4%, 2% to 3% etc., as well as individually, values within that range such as 1%, 2%, 3%, 4% and 5%. It is to be appreciated that the individual numerical values within the range also include integers, fractions and decimals. Furthermore, whenever a range has been described, it is also intended that the range covers and teaches values of up to 2 additional decimal places or significant figures (where appropriate) from the shown numerical end points. For example, a description of a range of 1% to 5% is intended to have specifically disclosed the ranges 1 .00% to 5.00% and also 1 .0% to 5.0% and all their intermediate values (such as 1 .01 %, 1.02% ... 4.98%, 4.99%, 5.00% and 1.1%, 1.2% ... 4.8%, 4.9%, 5.0% etc.,) spanning the ranges. The intention of the above specific disclosure is applicable to any depth / breadth of a range. DESCRIPTION OF EMBODIMENTS
[0093] The present disclosure provides an engineered mitochondrion (or organelle) comprising one or more binding motifs expressed on the outer membrane of the mitochondrion (or organelle).
[0094] Therefore, in one aspect, there is provided an engineered mitochondrion comprising one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
[0095] In some examples, the mitochondrion may be a mammalian mitochondrion. In some examples, mitochondrion may be from human, non-human primates, mammals (such as porcine (e.g. pigs) and rodents (e.g. rats, mice, and the like)), the like. In some examples, the background of a mice may include but is not limited to, C57BL / 6, BALB / c, CD-1 , SCID, and the like. In some examples, the background of a rat may include but is not limited to, A / J, Sprague Dawley, Wistar, and the like. In some examples, non-human primates may include but is not limited to, Rhesus monkey, Japanese monkey, Olive baboon, Squirrel monkey, Capuchin monkey, and the like. In some examples, the mitochondrion is a human mitochondrion.
[0096] In some examples, the mitochondrion may be a non-mammalian mitochondrion. In some examples, the non-mammalian mitochondrion may include yeast, and the like.
[0097] In some examples, the binding motif / peptide is a cell surface binding motif / peptide.
[0098] In some examples, the cell surface binding motif / peptide may include but is not limited to an extracellular matrix protein, a cell adhesion molecule, a ligand, a receptor, a DNA aptamer, an RNA aptamer, and the like.
[0099] In some examples, the binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide.
[0100] In some examples, the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide, optionally the ECM binding motif / peptide is on the cytosolic face of the outer mitochondrial membrane.
[0101] In some examples, the engineered mitochondrion comprises an insertion of an ECM protein binding motif / ECM-derived peptide, or two EMC protein binding motifs / ECM-derived peptides, or three ECM protein binding motifs / ECM-derived peptides, or four ECM protein binding motifs / ECM-derived peptides, or five ECM protein binding motifs / ECM-derived peptides. In some examples, ECM may include proteoglycans (such as heparan sulfate, chondroitin sulfate, keratan sulfate, and the like), non-proteoglycan polysaccharide (such as but is not limited to hyaluronic acid, and the like), proteins (such as but is not limited to collagen, elastin, and the like), extracellular vesicles, cell adhesion proteins (such as but is not limited to fibronectin, laminin, and the like), and the like.
[0102] In some examples, the ECM protein binding motif / ECM derived peptide may include a protein tag. In some examples, the protein tag may include but is not limited to, his-tag / polyhistidine tag, glutathione S-transferase tag (GST-tag), and hemagglutinin tag (HA tag), green fluorescent protein (GFP), streptavidin tag, V5 tag, and the like. In some examples, the protein tag includes three copies of HA tag (i.e., 3 x HA).
[0103] In some examples, the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide comprising a laminin-derived peptide, a surface marker peptide, a fibronectin-derived peptide, a collagen-derived peptide, a gelatin-derived peptide, an agrin-derived peptide, and / or a combination thereof.
[0104] In some examples, the extracellular matrix protein binding motif / ECM-derived peptide may include but is not limited to a laminin-derived peptide, fibronectin-derived peptide, collagen-derived peptides, gelatin-derived peptide, agrin-derived peptide, and / or a combination thereof.
[0105] In some examples, the exogenous protein binding motif / peptide comprises about 4 to 40 amino acids residues. In some examples, the exogenous protein binding motif / peptide may comprise 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids residue. In some examples, the binding motif comprises about 4 to 12 amino acids residue. In some examples, the exogenous protein binding motif / peptide may comprise 5, 8, 9, 10, 11, 14, or 18 amino acids residues.
[0106] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide.
[0107] In some examples, the ECM protein binding motif / ECM-derived peptide comprises a laminin-derived peptide.
[0108] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 17),
[0109] Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18), Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),
[0110] Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),
[0111] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide 1),
[0112] Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),
[0113] Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),
[0114] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
[0115] In some examples, the laminin-derived peptide may include, but is not limited to, (or is selected from the group consisting of) a peptide having the sequence of lle-Lys- Val-Ala-Val (IKVAV), Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18), Pro-Pro-Phe-Leu- Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19), Asp-Leu-Thr-lle- Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20), and / or a combination thereof.
[0116] In some examples, the exogenous protein binding motif / peptide comprises a cardiac-specific laminin that interacts with cardiomyocyte-surface integrins.
[0117] In some examples, the cardiac-specific laminin may be laminin-221 or alpha laminin LAMA2 protein. In some examples, the cardiac-specific laminin may be within LAMA1 protein or LAMA2 protein.
[0118] In some examples, the exogenous protein binding motif / peptide comprises one or more exposed regions on the interacting domain of laminin, including the helix, loop, and laminin globular (LG) domains LG1 , LG2, LG3, LG4, LG5, and / or combinations thereof, optionally the exogenous protein binding motif / peptide comprises an exposed region between Helix and LG1 , an exposed region between LG1 and LG2, an exposed region between LG2 and LG3, and an exposed loop in LG3, or combinations thereof.
[0119] In some examples, the laminin-derived peptide comprises the following localisation and / or protein sequence as follows:
[0120] In some examples, the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence of
[0121] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide 1),
[0122] Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),
[0123] Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),
[0124] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
[0125] In some examples, the exogenous protein binding motif / peptide comprises a surface marker peptide.
[0126] In some examples, the surface marker peptide may include a surface protein specific to cells of interest or a surface marker peptide that interacts with the surface protein of the cell of interest. As used herein, the cell of interest may be the host cell for producing the engineered mitochondria and / or the cell that would benefit from a mitotherapy (i.e. a target cell to be treated). For example, the cell of interest may be any cell that requires energy to function. The cell of interest may include, but is not limited to, a cell of the cardiovascular system (such as a cardiomyocyte, and the like), a cell of the nervous system (such as but is not limited to a cell of the central and / or peripheral nervous system, such as a nerve cell, a glial cell, a retinal glial cell, and the like), a cell of a digestive system (such as but is not limited to a liver cell, a stomach cell, a cell of small intestine, a cell of large intestine, and the like), a cell of musculo-skeletal system (such as but is not limited to a muscle cell, a chondrocyte, an osteocyte, an osteoblast, and the like), a cell of an endocrine system (such as but is not limited to a cell from an adrenal gland, a cell from a pancreas including a beta cell, a gamma cell, an alpha cell, and the like, and the like), a cell of a reproductive system (such as but is not limited to an ovum, a sperm, and the like), an immune cell (such as but is not limited to an innate immune cell including a natural killer cell, a macrophage, a dendritic cell; an adaptive immune cell including a T lymphocyte, an NK T lymphocyte, a B lymphocyte, and the like), an epithelial cell (such as but is not limited to a keratinocyte, a hair follicle, and the like), and the like. In some examples, the cell of interest may be a retinal cell, a retinal glial cell, a cardiomyocyte, and the like. In some examples, the cell may be modified or recombinant or engineered cell such as, but is not limited to, CAR cells such as CAR T cell or CAR NK cell. Without wishing to be bound by theory, the cell may be a CAR-T cell as transplanted mitochondria may provide energy for cellular division processes. In some examples, the improvement in energy production is also envisaged to be useful in intervention such as In Vitro Fertilisation (IVF) processes.
[0127] In some examples, the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte.
[0128] In some examples, the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte is SIRPa.
[0129] In some examples, the surface marker protein is SIRPa that interacts with a surface marker protein expressed on immune cells to regulate immune response near the heart (e.g. CD47). In some examples, the surface marker protein includes amino acid elements between strands A and B, strands B and C (BC loop), and strands F and G (FG loop) of SIRPa. In some examples, the surface marker protein comprises the following localisation and / or protein sequence as follows:
[0130] In some examples, the exogenous protein binding motif / peptide comprising a SIRPa surface marker protein comprising a peptide having the sequence
[0131] Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - peptide 7),
[0132] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5
[0133] - peptide 5),
[0134] Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE, SEQ ID NO: 6 - peptide 6), or combinations thereof. In some examples, the surface marker protein may comprise alternative localisation, combinations, and / or protein sequence as follows:
[0135] In some examples, the exogenous protein binding motif / peptide comprising a
[0136] SIRPa surface marker protein comprising a peptide having the sequence
[0137] Val-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA, SEQ ID NO: 12 - ABC peptide),
[0138] Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF, SEQ ID NO: 11 - AB- rear),
[0139] Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - AB full),
[0140] Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV, SEQ ID NO: 10 - AB-Mid),
[0141] Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN, SEQ ID NO: 9 - AB- front),
[0142] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5 - BC peptide), or combinations thereof.
[0143] In some examples, the exogenous protein binding motif / peptide comprises a fibronectin-derived peptide comprising Arg-Gly-Asp (RGD, SEQ ID NO: 13), Pro-His- Ser-Arg-Asn (PHSRN, SEQ ID NO: 14), cyclic RGD, and / or a combination thereof. In some examples, the fibronectin-derived peptides may include, but is not limited to, (or is selected from the group consisting of) Arg-Gly-Asp (RGD, SEQ ID NO: 13), Pro- His-Ser-Arg-Asn (PHSRN, SEQ ID NO: 14), cyclic RGD, and / or a combination thereof.
[0144] In some examples, the exogenous protein binding motif / peptide comprises a collagen-derived peptide comprising Asp-Gly-Glu-Ala (DGEA, SEQ ID NO: 16).
[0145] In some examples, the collagen-derived peptides may include, but is not limited to, Asp-Gly-Glu-Ala (DGEA, SEQ ID NO: 16), and the like.
[0146] In some examples, the one or more binding motifs may include combinations of the same binding motif or combinations of different binding motifs.
[0147] In some examples, combinations of the same binding motif may include multiple copies of a motif such as but is not limited to IKVAV (SEQ ID NO: 17), RGD (SEQ ID NO: 13), and the like.
[0148] In some examples, combinations of different binding motifs may include IKVAV (SEQ ID NO: 17) and RGD (SEQ ID NO: 13), and the like.
[0149] In some examples, the engineered mitochondrion may include insertion of one binding motif / peptide, two binding motifs / peptides, three binding motifs / peptides, four binding motifs / peptides, five binding motifs / peptides, and the like.
[0150] In some examples, the engineered mitochondrion may bind to one target of a target cell, two targets of a target cell, three targets of a target cell, four targets of a target cell, or five targets of a target cell, and the like.
[0151] In some examples, the engineered mitochondrion comprises one binding motif / peptide.
[0152] In some examples, the peptide is a cell penetrating peptide.
[0153] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous mitochondrial outer membrane protein.
[0154] In some examples, the mitochondrial membrane protein is an outer mitochondrial membrane protein (such as proteins with transmembrane a-helical or p-barrel).
[0155] In some examples, the outer mitochondrial membrane protein may include p- barrel outer membrane proteins and / or a-helical outer membrane proteins, and the like.
[0156] Examples of p-barrel outer membrane proteins may include but is not limited to the translocase of the outer membrane (TOM) complex (such as TQM20, TQM70, TQM40, TOM22, TOM7, TOM6, TOM5, TQM70, and the like), the sorting and assembly machinery (SAM) complex (such as SAM50, SAM35, SAM37, and the like), the voltage dependent anion ion channel (VDAC), porins and the like. Examples of a-helical outer membrane proteins may include the mitochondrial import complex (MIM) (such as Mimi , Mim2, and the like).
[0157] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous translocase of the outer mitochondrial membrane complex, optionally an exogenous TOM20, TOM70, TOM40, TOM22, TOM7, TOM6, TOM5, TOM70, SAM50, SAM35, SAM37, Mimi , Mim2, or combinations thereof.
[0158] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TOM20, TOM22, TOM70, SAM50, PORIN, outer membrane protein 25 (OMP25), or combinations thereof.
[0159] In some examples, the outer mitochondrial membrane protein may include TOM22, TOM70, SAM50, PORIN, outer membrane protein 25 (OMP25), and the like.
[0160] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TOM20 protein.
[0161] In some examples, the ECM binding motif / peptide is on the cytosolic face of the outer mitochondrial membrane protein.
[0162] Without wishing to be bound by theory, having the motif on the cytosolic face allows the motif to interact with targets (e.g., integrins) expressed on the target cell to facilitate cellular uptake.
[0163] In some examples, the outer mitochondrial membrane protein is a translocase of the outer mitochondrial membrane complex subunit 20 (TOM20).
[0164] As used herein, TOM20 (describes the TOM20 protein) and TOMM20 (describes the TOM20 gene name) are understood to describe the same component and may therefore be used interchangeably.
[0165] In some examples, the engineered mitochondrion as disclosed herein may comprise a fusion protein with an IKVAV targeting motif (tethered to HA tag) inserted on the cytosolic face of TOM20 (TOM20-1xlKVAV-3xHA).
[0166] As shown in Figure 2 in the present disclosure, expression of the TOM20 fusion protein was confirmed by methods known in the art (such as western blot using antibodies against HA and TOM20). As shown in Figure 3 of the present disclosure, mitochondria isolated from cells with antibody-based purification using anti-HA microbeads / anti-TOM22 microbeads show similar size and granularity in the flow cytometry analyses. This confirms that the anti-HA microbeads can be used to purify mitochondria from cell lysates and that the IKVAV-HA motif is located on the mitochondrial surface. In addition, as shown in Figure 4 of the present disclosure, higher amounts of mitochondria protein were isolated using anti-HA microbeads compared to anti-TOM22 microbeads, suggesting that the binding efficiency of anti-HA microbeads to the TOM20 fusion protein is higher than that of the anti-TOM22 microbeads to the TOM22 protein, resulting in the higher yield of the mitochondrial obtained.
[0167] In some examples, the outer mitochondrial membrane protein may comprise a further genetic modification. In some examples, the genetic modification may include but is not limited to insertion, deletion, single amino acid substitution, amino acid modifications (such as acetylation, phosphorylation, and the like), and the like.
[0168] In some examples, the mitochondrion is derived from a cell.
[0169] In some examples, the cell may include such as, but is not limited to, a pluripotent stem cell (such as an induced pluripotent stem cell), a mesenchymal stem cell, an adipose-derived stem cell, an adult stem cell, a cell that carry mitochondrion, and the like.
[0170] In some examples, the cell is an induced pluripotent stem cell.
[0171] In another aspect, there is provided a polynucleotide encoding the organelle (or mitochondrion) as disclosed herein.
[0172] In some examples, the polynucleotide encodes for an insertion construct comprising sequences encoding an exogenous outer membrane protein of a mitochondrion and / or an exogenous protein binding motif / peptide. In some examples, the polynucleotide may comprise polynucleotide encoding a fusion protein comprising an exogenous outer mitochondrial membrane protein and an exogenous protein binding motif / peptide. In some examples, the fusion protein is configured to be expressed on the surface of the mitochondrion of the host cell. In some examples, the polynucleotide may encode a fusion protein comprising generally:
[0173] In some examples, the exogenous outer membrane protein of a mitochondrion / mitochondrial membrane protein is an outer mitochondrial membrane protein such as proteins with transmembrane a-helical or p-barrel.
[0174] In some examples, the exogenous outer mitochondrial membrane protein may include p-barrel outer membrane proteins and / or a-helical outer membrane proteins, and the like.
[0175] Examples of p-barrel outer membrane proteins may include but is not limited to the translocase of the outer membrane (TOM) complex (such as TOM20, TOM70, TOM40, TOM22, TOM7, TOM6, TOM5, TOM70, and the like), the sorting and assembly machinery (SAM) complex (such as SAM50, SAM35, SAM37, and the like), the voltage dependent anion ion channel (VDAC), porins and the like.
[0176] Examples of a-helical outer membrane proteins may include the mitochondrial import complex (MIM) (such as Mimi , Mim2, and the like).
[0177] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous translocase of the outer mitochondrial membrane complex, optionally an exogenous TOM20, TOM70, TOM40, TOM22, TOM7, TOM6, TOM5, TOM70, SAM50, SAM35, SAM37, Mimi , Mim2, or combinations thereof.
[0178] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TOM20, TOM22, TOM70, SAM50, PORIN, outer membrane protein 25 (OMP25), or combinations thereof.
[0179] In some examples, the outer mitochondrial membrane protein may include TOM22, TOM70, SAM50, PORIN, outer membrane protein 25 (OMP25), and the like.
[0180] In some examples, the exogenous protein binding motif / peptide is expressed on an exogenous TOM20 protein.
[0181] In some examples, the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide comprising a laminin-derived peptide, a surface marker peptide, a fibronectin-derived peptide, a collagen-derived peptide, a gelatin-derived peptide, an agrin-derived peptide, and / or a combination thereof.
[0182] In some examples, the polynucleotide encoding encodes for an exogenous protein binding motif / peptide having one or more sequences selected from the group consisting of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 17),
[0183] Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18),
[0184] Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),
[0185] Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),
[0186] Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS - CP peptide 1 , SEQ ID NO: 1),
[0187] Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lso (CTVSPQVEDSEGTI - CP peptide 2, SEQ ID NO: 2), Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT- CP peptide 3, SEQ ID NO: 3),
[0188] Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA - CP peptide 4, SEQ ID NO: 4),
[0189] Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF - peptide 7, SEQ ID NO: 7),
[0190] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - peptide 5, SEQ ID NO: 5),
[0191] Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE - peptide 6, SEQ ID NO: 6),
[0192] Val-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA - ABC peptide, SEQ ID NO: 12),
[0193] Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF - AB-rear, SEQ ID NO: 11),
[0194] Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF - AB full, SEQ ID NO: 7),
[0195] Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV - AB-Mid, SEQ ID NO: 10), Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN - AB-front),
[0196] Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - BC peptide, SEQ ID NO: 5), or combinations thereof.
[0197] In some examples, the polynucleotide encodes for an insertion construct comprising sequences encoding a TOMM20 and / or a cardiac peptide motif.
[0198] In some examples, the insertion construct may further comprise a hemagglutinin tag, for example a HA-tag, a 3xHA tag, and the like.
[0199] In yet another aspect, there is provided a vector comprising the polynucleotide encoding the organelle (or mitochondrion) as disclosed herein.
[0200] In yet another aspect, there is provided a host cell comprising the vector as disclosed herein.
[0201] In yet another aspect, there is provided a cell comprising the organelle (or mitochondrion) as disclosed herein.
[0202] In some examples, the cell is a pluripotent cell.
[0203] In some examples, the cell is a pluripotent cell, optionally an induced pluripotent cell.
[0204] In some examples, the cell is a cell of interest such as a diseased cell that would improve its function when it is transplanted with an engineered mitochondrion. For example, the cell of interest may be any cell that requires energy to function. Therefore, the cell of interest may include, but is not limited to, a cell of the cardiovascular system (such as a cardiomyocyte, and the like), a cell of the nervous system (such as but is not limited to a cell of the central and / or peripheral nervous system, such as a nerve cell, a glial cell, a retinal glial cell, and the like), a cell of a digestive system (such as but is not limited to a liver cell, a stomach cell, a cell of small intestine, a cell of large intestine, and the like), a cell of musculo-skeletal system (such as but is not limited to a muscle cell, a chondrocyte, an osteocyte, an osteoblast, and the like), a cell of an endocrine system (such as but is not limited to a cell from an adrenal gland, a cell from a pancreas including a beta cell, a gamma cell, an alpha cell, and the like, and the like), a cell of a reproductive system (such as but is not limited to an ovum, a sperm, and the like), an immune cell (such as but is not limited to an innate immune cell including a natural killer cell, a macrophage, a dendritic cell; an adaptive immune cell including a T lymphocyte, an NK T lymphocyte, a B lymphocyte, and the like), an epithelial cell (such as but is not limited to a keratinocyte, a hair follicle, and the like), and the like. In some examples, the cell of interest may be a retinal cell, a retinal glial cell, a cardiomyocyte, and the like. In some examples, the cell may be modified or recombinant or engineered cell such as, but is not limited to, CAR cells such as CAR T cell or CAR NK cell. Without wishing to be bound by theory, the cell may be a CAR-T cell as transplanted mitochondria may provide energy for cellular division processes. In some examples, the improvement in energy production is also envisaged to be useful in intervention such as In Vitro Fertilisation (IVF) processes.
[0205] In yet another aspect, there is provided a method of improving / enhancing / increasing mitochondrial uptake / targeting in a target cell comprising providing the engineered mitochondrion as disclosed herein.
[0206] In yet another aspect, there is provided a method of improving mitochondrion uptake into a target cell comprising genetically modifying a host cell to express a modified mitochondrion, wherein the modified mitochondrion comprises one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
[0207] Without wishing to be bound by theory, mitochondrial transplantation / mitochondrial therapy (mitotherapy) / mitochondrial transfer aims to transfer functional exogenous mitochondria into mitochondria-defective cells for recovery of the cell viability and consequently, prevention of the disease progression. Exogenous mitochondria can directly enter mammalian cells for disease therapy following local and intravenous administration, with the transferred mitochondria playing their roles in the target cells, including energy production and maintenance of cell function. The efficiency of methods known in the art for mitochondrial uptake by host cells is low and there are no current methods to target mitochondria uptake by specific cell types.
[0208] As shown in Figure 8 of the present disclosure, IKVAV-labelled mitochondria were more significantly internalized by the mouse photoreceptor precursor cell line 661 W than mitochondria without the motif. In addition, Figure 9 of the present disclosure shows a dose-dependent increase in mitochondrial uptake for both TOM20-HA and TOM20- IKVAV-HA mitochondria, with TOM20-IKVAV-HA mitochondria demonstrated significantly higher internalization at the 12-hour post treatment (compared to the 5-hour post treatment) of human motor neurons with the mitochondria.
[0209] In some examples, the engineered mitochondrion comprises an insertion of one or more binding motifs on the outer membrane of the mitochondrion.
[0210] In some examples, the insertion of one or more binding motifs to the mitochondrion of the host cell may be done by methods known in the art such as but is not limited to, CRISPR-Cas9 genome editing, Zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), and the like.
[0211] In some examples, the host cell may be genetically modified by viral transduction and / or a CRISPR genetic modification strategy. It would be appreciated by the person skilled in the art that both viral transduction and CRISPR genetic modification strategies are known in the art and would be readily adapted to implement the methods of the present disclosure.
[0212] In some examples, the host cell may be genetically modified via viral transduction or a CRISPR gene modification system.
[0213] In some examples, the target cell may include but is not limited to, an immortalized cell line, a primary cell, a cell with metabolic disease (e.g., mitochondria defects, mitochondrial DNA mutations), an aged cell (i.e., a cell that tend to have increased mitochondrial DNA mutations), an engineered mitochondrion carrying death signals, and the like.
[0214] In some examples, the target cells may include but is not limited to [31-integrin expressing cells, laminin receptor-expressing cells, collagen receptor-expressing cells, fibronectin receptor expressing cells, and the like. In some examples, p 1 -integrin expressing cells may include but are not limited to neurons (such as human motor neurons, and the like), retina cells (such as mouse photoreceptor precursor cell line 661 W, retinal ganglion cells, and the like), and the like.
[0215] In some examples, the target cell may be a mammalian cell. In some examples, target cells may be from human, non-human primates, pig, mouse, rat, and the like. In some examples, the background of a mice may include but is not limited to, C57BL6, BALB / c, CD-1, SCID, and the like. In some examples, the background of a rat may include but is not limited to, A / J, Sprague Dawley, Wistar, and the like. In some examples, non-human primates may include but is not limited to, Rhesus monkey, Japanese monkey, Olive baboon, Squirrel monkey, Capuchin monkey, and the like.
[0216] In some examples, the engineered mitochondrion may be purified I isolated from a cell comprising: sonicating the cell; and / or removing the impurities by differential centrifugation; and / or filtering the mitochondria enriched pellet to further reduce contaminants (such as other cellular organelles).
[0217] Without wishing to be bound by theory, methods known in the art for deriving intact mitochondria which includes ultracentrifugation, differential centrifugation or microbead-based sorting are not well suited for intact mitochondria extraction from induced pluripotent stem cells. For example, dounce homogenization (a standard approach for mechanically lysing cells) was not efficient in lysing pluripotent stem cells (as they are smaller than typical cultured cells) and produced large batch-to-batch and user-to-user variability. In addition, microbeads co- precipitate with the mitochondria and cannot be efficiently separated which affects downstream applications.
[0218] The inventors of the present disclosure overcome the cons of methods known in the art by using weak sonication to lyse the cells while maintaining the integrity of the mitochondria. A combination of sonication, differential centrifugation, and size selection (S+DC method) was used in the present disclosure to isolate a highly enriched mitochondrial population. Advantageously, the method of the present disclosure can be completed in 60 minutes which is faster than the known in the art microbead approach. In addition, the method of the present disclosure has improved mitochondrial yield and purity as compared to known in the art differential centrifugation approach which shows significant nuclear fragment contaminants (Figure 6).
[0219] As shown in the Figure 7 of the present disclosure, the inventors of the present disclosure showed that mitochondria isolated via the S+DC method sequestered tetramethylrhodamine methyl ester perchlorate (TMRE) a red fluorescent dye and respond to a mitochondrial membrane depolarizing molecule (FCCP). This confirms that mitochondria isolated with the S+DC approach of the present disclosure were intact and biologically active.
[0220] In yet another aspect, there is provided a composition or pharmaceutical composition comprising the engineered mitochondrion or polynucleotide as described herein.
[0221] In yet another aspect, there is provided a composition comprising the engineered mitochondrion or polynucleotide as disclosed herein.
[0222] In yet another aspect, there is provided a pharmaceutical composition comprising the engineered mitochondrion or polynucleotide as disclosed herein and suitable pharmaceutical composition thereof.
[0223] In yet another aspect, there is provided a composition or pharmaceutical composition as described herein for use in therapy / medicine.
[0224] In some examples, the composition is a prophylactic and / or therapeutic composition.
[0225] Pharmaceutically acceptable agents for use in the present pharmaceutical compositions include carriers, excipients, diluents, antioxidants, preservatives, colouring, flavouring and diluting agents, emulsifying agents, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, tonicity agents, cosolvents, wetting agents, complexing agents, buffering agents, antimicrobials, and surfactants.
[0226] Also disclosed is a composition as described herein for use in therapy / medicine.
[0227] In some examples, such compositions further comprising an excipient and / or stabilizers.
[0228] In yet another aspect, there is provided a method of preventing and / or treating a disease in a subject in need thereof, the method comprises administering to the subject the engineered mitochondrion or composition as described herein.
[0229] In yet another aspect, there is provided a method of preventing and / or treating diseased tissues in a subject in need thereof, the method comprises administering to the subject the engineered mitochondrion or composition as disclosed herein.
[0230] In yet another aspect, there is provided a method of preventing and / or reducing the severity of symptoms caused by a disease in a subject in need thereof, the method comprises administering to the subject the engineered mitochondrion or composition as disclosed herein.
[0231] In some examples, the term “preventing” and / or “reducing the severity of symptoms” refer to process of delaying the onset, reducing the severity of symptoms, reducing and / or preventing weight loss, preventing death, inhibiting deterioration, inhibiting further deterioration, and / or ameliorating at least one sign or symptom of a disease.
[0232] In some examples, the disease is a mitochondrial disorder or a proliferative disease.
[0233] In some examples, the diseased tissues may include but is not limited to tissues from mitochondrial disorders, proliferative disease, and the like.
[0234] In some examples, the disease may include but is not limited to mitochondrial disorders, proliferative disease, and the like.
[0235] In some examples, mitochondrial disorders may include but are not limited to mitochondrial encephalopathy, lactic acidosis and stroke like episodes (MELAS) syndrome, Leber hereditary optic neuropathy (LHON), Leigh syndrome, Kearns-Sayre syndrome (KSS), Myoclonic epilepsy and ragged-red fibre disease (MERRF), Friedreich’s ataxia (FA), and the like.
[0236] The proliferative disease as described herein includes inflammatory disease / degenerative disease.
[0237] In some examples, an inflammatory disease / degenerative disease may be a neurodegenerative disease, such as neuroinflammation that leads to neurodegeneration / brain damage / nerve damage. In some examples, the disease may be a neurodegenerative disease such as dementia, Alzheimer’s disease, Parkinson’s, Multiple Sclerosis, Huntington’s disease, and the like. Other degenerative diseases may include but are not limited to arthritis, muscular dystrophy, Amyotrophic Lateral Sclerosis (ALS), and the like.
[0238] In some examples, the inflammatory disease may include but is not limited to fibrosis, muscle aging, and the like.
[0239] In some examples, the proliferative disease may be inflammatory disease such as an acute inflammatory disease and / or a chronic inflammatory disease. In some examples, chronic inflammation / chronic inflammatory disease acute inflammation I acute inflammatory disease may include but is not limited to ulcerative colitis, Crohn’s disease, infectious disease, and the like.
[0240] In some examples, the infectious disease may be caused by a bacterial pathogen, a viral pathogen, a fungal pathogen, or a parasite.
[0241] Examples of a bacterial pathogen may include, but is not limited to, Escherichia coli, Mycobacteria spp, Salmonella spp, Staphylococcus spp, Clostridium difficile, Listeria monocytogenes, Group B streptococci, vancomycin-resistant enterococci (VRE), and the like. Examples of a viral pathogen may include, but is not limited to, Human papillomavirus, Rhinovirus, Human cytomegalovirus in HIV-1 positive patient, Hepatitis virus, Coronavirus (CoV), severe acute respiratory syndrome (SARS), monkey pox virus, Enterovirus 71 (EV71), and the like.
[0242] Examples of a fungal pathogen may include, but is not limited to, Botrytis cinerea, Pseudomonas syringae, Fusarium oxysporum and the like.
[0243] Examples of a parasite may include, but is not limited to, Leishmania parasites, Giardia, Cryptosporidum, Entamoeba and the like.
[0244] In yet another aspect, there is provided the use of the engineered mitochondrion as disclosed herein in the manufacture of a medicament for preventing and / or treating a disease.
[0245] In some examples, the engineered mitochondrion or composition or pharmaceutical composition or use or method as described herein may be administered to the subject through one or more routes of administration including, but not limited to, topical, intravascular, intravenous, oral, subcutaneous, intraarterial, intrathecal, intraperitoneal, intranasal, intradermal, intramuscular, intravitreal, and the like.
[0246] Disclosed are engineered mitochondrion / methods as described herein.
[0247] Also disclosed are polynucleotides encoding the mitochondrion as described herein.
[0248] Also disclosed is a vector comprising the polynucleotide as described herein.
[0249] Additionally, when describing some embodiments, the disclosure may have disclosed a method and / or process as a particular sequence of steps. However, unless otherwise required, it will be appreciated that the method or process should not be limited to the particular sequence of steps disclosed. Other sequences of steps may be possible. The particular order of the steps disclosed herein should not be construed as undue limitations. Unless otherwise required, a method and / or process disclosed herein should not be limited to the steps being carried out in the order written. The sequence of steps may be varied and still remain within the scope of the disclosure.
[0250] Furthermore, it will be appreciated that while the present disclosure provides embodiments having one or more of the features / characteristics discussed herein, one or more of these features / characteristics may also be disclaimed in other alternative embodiments and the present disclosure provides support for such disclaimers and these associated alternative embodiments. DESCRIPTION OF FIGURES
[0251] Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following discussions and if applicable, in conjunction with the figures. It should be appreciated that other modifications may be made without deviating from the scope of the invention. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new exemplary embodiments. The example embodiments should not be construed as limiting the scope of the disclosure.
[0252] Figure 1 shows CRISPR-Cas9 cloning strategy to insert the overexpression cassette for TOMM20 fusion protein. The fusion protein cDNA sequences (1 . to 3.) were first constructed and cloned into HDR donor plasmids. Co-transfecting the donor plasmid with the Cas9-gRNA expression plasmids causes a targeted double-stranded break between Exonl and Exon2 of the AAVS1 loci. The double-stranded break is repaired using host machinery via homologous recombination using the HDR plasmid, resulting in the overexpression cassette insertion into the host genomic DNA and subsequent overexpression of the TOMM20 fusion protein.
[0253] Figure 2 shows immunostaining and western blot data using specific antibodies against HA epitope (top blot) and TOMM20 (bottom blot). Both TOM20-HA and TOM20- 1xlKVAV-HA clones show positive signals when probed with anti-HA and anti-TOM20 antibodies as expected.
[0254] Figure 3 shows flow analysis to show that mitochondria extracted with either anti- TOM22 microbeads and anti-HA microbeads were similar in size and granularity. The ability to purify mitochondria using anti-HA beads also confirms that HA epitope is expressed on the outer surface of mitochondrial membrane.
[0255] Figure 4 shows the quantification of relative protein quantity by BCA assay following isolation of mitochondria by microbead-based methods. Three biological replicates were performed (BR1 to BR3) comparing amount of mitochondria isolated using anti-TOM20 beads and anti-HA beads. In all three preps, higher amounts of protein were isolated using anti-HA beads, suggesting that mitochondrial yield is higher using this approach.
[0256] Figure 5 shows a schematic summarizing a rapid protocol to obtain high yields of mitochondria from iPSCs. iPSCs were first sonicated to lyse the cells, followed by a series of differential centrifugation steps to remove impurities. Thereafter, the pellet that is highly enriched with mitochondria is passed through a 5pm filter to further reduce contaminants from other cellular organelles. Figure 6 shows Western blot analysis of whole cell lysates (lanes 1-3), S+DC mitochondrial preps (lanes 4-7) and the traditional DC approach (lanes 8-9). While mitochondria isolation by S+DC or traditional DC approaches result in enrichment of the mitochondrial fraction (shown by stronger TOM20 intensity), the traditional approach suffers from significant nuclear fragment contaminants (shown by presence of histone 3 or H3 bands) while no observable histone 3 contamination is seen in the S+DC mitochondria preps.
[0257] Figure 7 shows TMRE and oxygen consumption rate (OCR) assays to determine intact, functional mitochondria. TMRE accumulates in mitochondria with a membrane potential difference, as seen by the rightward shift of the blue graph. Since FCCP is a mitochondrial uncoupler and depolarizing agent, incubation of mitochondrial preps with FCCP resulted in a leftward shift of the TMRE-treated mitochondria, as seen by the (2) graph (see arrow), indicating bioactive and intact mitochondria. OCR was measured using a metabolic flux analyser where increased OCR was observed with increasing amounts of mitochondria.
[0258] Figure 8 shows immunostaining and quantification of internalized engineered human mitochondria based on HA staining. 1.5pg of either TOM20-IKVAV-HA or TOM20-HA mitochondria were incubated with 10,000 661W cells for 24 hours. In the control group, cells were not treated with mitochondria (far left). Immunostaining was performed using antibodies again HA and TOM20 while cellular nuclei were counterstained with DAPI. Quantification of HA intensities per cell revealed higher intensities in 661W cells incubated with TOM20-IKVAV-HA mitochondria.
[0259] Figure 9 shows increase uptake of TOM20-IKVAV-HA mitochondria by human motor neurons. Human motor neurons were incubated with increasing amounts of TOM20-HA orTOM20-IKVAV-HA mitochondria. Quantifications of HA intensities per cell indicated that there is a dose-dependent increase in mitochondrial uptake with increasing amounts of mitochondria, and TQM20-IK AV-HA are more efficiently taken up compared to control TQM20-HA mitochondria.
[0260] Figure 10 shows exogenous mitochondria can be internalised by RGCs. Efficiency of mitochondrial transfer in retinal ganglion cells. (A) 50 mg of human mitochondria or the same volume of PBS was injected intravitreally into WT mice eyes. Tissues were harvested 1 week post injection and serially sectioned at a 1 :32 sampling rate. (B) Representative immunofluorescence images from each section showing density of Brn3a+ retinal ganglion cells and presence of human mitochondria (HuMT) in samples that received mitochondria but not in PBS control. (C) Treatment with mitochondria results in a significant increase in the presence of Brn3a+ / HuMT+ cells, whilst (D) total number of Brn3a+ retinal ganglion cells remain similar between mitochondria-treated and PBS controls.
[0261] Figure 11 shows mitotherapy increases mitochondrial function in vivo. A) Retinal tissue from mice injected with 50 mg mitochondria or PBS as a control were collected 1 week post injection. Tissues were lysed and mitochondrial complex I activity determined using an enzyme-linked immunosorbent assay (ELISA). B) Mitochondria-treated retinal tissue showed an approximately 20% increase in complex I activity after normalization for protein amount as a proxy for cell number. C) Total levels of protein obtained after lysis was similar between mitochondria-treated samples and PBS controls.
[0262] Figure 12 shows no significant retinal abnormalities were observed in retina post- mitotherapy. Functional imaging of mice eyes reveal no gross abnormalities after mitotherapy. Fundus imaging (left) at week 0 and week 6 showed no observable differences at the retina of mice eyes treated with mitochondria or PBS. OCT imaging (right) also at week 0 and week 6 showed no retinal detachment. Retinal thickness was quantified from the OCT images, which demonstrated that there were no significant differences between mitotherapy and control eyes.
[0263] Figure 13 shows human BJ iPSCs engineered to express exogenous TOM20- 3xHA fusion protein. A) CRISPR strategy to express exogenous TOM20-3xHA fusion protein, driven by CMV human overexpression promoter, (i) Insertion construct for TOM20-3xHA fusion protein expression; (II) Insertion construct for TOM20-Cardiac Peptide Motif-3xHA fusion protein expression. B) Immunofluorescence confirmation of TOM20-3xHA fusion protein expression on mitochondrial surface in the CRISPR engineered TOM20-HA BJ iPSC line.
[0264] Figure 14 shows Western blot analysis for mitochondrial extract purity. Lanes 1- 3: Whole Cell Control before extraction. Lanes 4-5: Two cell lines replicates using differential centrifugation protocol. Lanes 6-7: Two cell line replicates using differential centrifugation and filtration protocol. Lanes 8-9: Two cell line replicates using HA microbead antibody column extraction protocol. TOM20 marks mitochondrial load, H3 marks nuclear contamination, PDI marks endoplasmic reticulum contamination, GAPDH marks cytosolic contamination. DC: Differential centrifugation; BR1 - BR2: Cell lines 1 and 2 expressing TOM20 fusion proteins with 3xHA tag; ER: Endoplasmic Reticulum.
[0265] Figure 15 shows Laminin Alpha Subunit 1 (LAMA1) protein structure prediction. A) Protein structure around LG1 containing the IKVAV motif. B) Protein structure around LG3 containing the RGD motif. The figures (A’ and B’) on the bottom show close-up view of the motifs of interest which are highlighted in green. CC: Coiled-coil domain; LG1-5: Laminin Globular domain 1 to 5; IKV: IKVAV protein motif; RGD: RGD protein motif.
[0266] Figure 16 shows Laminin Alpha Subunit 2 (LAMA2) protein structure prediction and peptides of interest. A) Exposed peptide sequence 1 between CC and LG1. B) Exposed peptide sequence 2,3,4 between LG1 and LG2 (B’), LG2 and LG3 (B”), and within LG3 (B’”) respectively. A’, B’, B” and B’” show close-up views of the motifs of interest highlighted in green and labelled accordingly. Pep1-4: Peptide 1 to Peptide 4.
[0267] Figure 17 shows CD47-SIRPa Cryo-EM elucidated protein structure. A) Annotated CD47 amino acid sequence. Strands A to G form beta sheet structures. B) Structure of CD47 (yellow ribbons) complexed with SIRPa (blue ribbons). The inset shows a close-up view of the interaction interface. The FG loop and BC loop of CD47 play key interacting roles with SIRPa. Figures retrieved from Hatherley et al.
[0268] Figure 18 shows synthesized peptides have improved binding to cardiomyocyte surfaces. A) Treatment protocol for the four different cell types treated with the eight identified peptides. B) Fluorescence quantification of treated wells using a microplate fluorescence reader. Fluorescence data is normalised to pre-treatment fluorescence intensity, and expressed as Mean ± SD (N = 3 experimental replicates). ***, p<0.0001 ; One-way ANOVA with Dunnett’s multiple comparison test. Significance tests are only shown in the peptides with significantly more retention in CM compared to all three other cell types. CM: Cardiomyocytes; Fib: Fibroblast, MN: Motor Neurons; ESC: Embryonic Stem Cells.
[0269] Figure 19 shows fluorescence imaging confirms specific increased binding to CM surfaces. A) Representative fluorescence images of hPSC derived cell types after two- day treatment with FITC tagged synthesized peptides post-washing. Peptides 2,3 and 7 depicted herein are significantly increased retention on CM compared to the other cell types based on microplate fluorescence analysis (Figure 18B). Peptides 1 and 4 depicted herein to show their lack of retention on CM, similar to peptides 5,6 and 8 (Not shown). B) Brightfield images superimposed on the fluorescence images showing colocalization of fluorescence with the cell surfaces. Scale bar: 200 pm.
[0270] Figure 20 shows alternative peptide sequences suggest that the rear of peptide 7 and front of peptide 5 contains the interacting peptides between CD47 and CMs. Fluorescence quantification of treated wells using a microplate fluorescence reader. Peptide names are described in table 3. Fluorescence data is normalised to pretreatment fluorescence intensity and expressed as Mean ± SD (N = 3 experimental replicates). *, p<0.05; **, p<0.01; ***, p<0.0001 ; ns, p>0.05; One-way ANOVA with Dunnett’s multiple comparison test. Significance tests are shown only for comparisons to AB-Full, the original full-length Peptide 7.
[0271] Figure 21 shows Western blot confirms fusion protein expression in clonal donor cell lines. A) Top: Anti-HA blot shows expression of the exogenous fusion protein in CP2 but not CP3. Bottom: Anti-TOM20 blot shows that the HA tag is present on the exogenous fusion TOM20. In addition, it confirms that while the endogenous TOM20 protein is detected in CP3, the exogenous fusion protein was not expressed. B) Similar western blot image depicted the four clonal donor cell lines used for downstream analysis. C) Flow cytometric analysis of isolated mitochondria, treated with TMRE (Stains polarized mitochondria), and / or FCCP (Depolarizes functional mitochondria).
[0272] Figure 22 shows immunofluorescence suggests CP2 and CP7 expression improves mitochondria uptake efficiency into CMs. A) Treatment protocol for the matured CMs using the mitochondria from the four donor cell lines. Donor mitochondria uptake into host cells was quantified through presence of HA protein within host cells. B) Left: Quantification of Cellular HA intensity, corresponding to the total HA fluorescence detected within each CM. Right: Quantification of the number of HA spots, corresponding to the number of detected fluorescent spots within each CM. Student’s t-test for significance were conducted between all treated groups, and only significant results are depicted. UT: Untreated CMs.
[0273] Figure 23 shows Fluorescence imaging suggests increased CM uptake of exogenous mitochondria expressing CP2 or CP7 fusion protein. Representative images show fixed mitochondria treated cells stained with CTNT, depicting >95% pure CMs, successfully took up exogenous mitochondria expression HA tag on the mitochondria surface.
[0274] Figure 24 shows exogenous mitochondria marked with mitotracker confirms that CP7 expression improves mitochondrial uptake into CMs. A) Treatment protocol for the matured CMs using the mitochondria from the four donor cell lines. Donor mitochondria was pre-stained in donor cells using mitotracker red, which was used to quantify donor mitochondria uptake into host cells. B) Quantification of Cellular Mitotracker intensity, corresponding to the total mitotracker red fluorescence detected within each CM. Student’s t-test for significance were conducted between all treated groups, and only significant results are depicted. UT: Untreated CMs. C) Representative fluorescence images of Live CMs, marked by GCaMP expression. Mitotracker red (MT Red) carried by donor mitochondria were detected within the Live CMs. Figure 25 shows Aging model CMs treated with donor mitochondria resulted in metabolic improvements and reversal of senescence phenotypes. A) Seahorse OCR assay to determine the respiration capacity of aging CMs. B) Beta-galactosidase staining (Blue) depicts senescing and aging cells.
[0275] EXPERIMENTAL SECTION
[0276] Generating a genetically modified induced pluripotent stem cell line with IKVAV-3xHA expressed on the cytosolic face of the outer mitochondrial membrane
[0277] Cloning methodology for CMV-TOMM20-3xHA and CMV-TOMM20-1xlKVAV- 3xHA expression BJ iPSC lines
[0278] First, the fusion protein sequence was sequentially cloned in a pUC19 vector in the MCS sequence. First, the TOMM20 cDNA was amplified from pMCherry N1 TOMM20 (Addgene #157761), using TOMM20_EcoRI_FP forward primer and TOMM20-G-BamHI_RP reverse primer for the sequence without IxlKVAV; and using TOMM20-GSSG-1xlKV-G-BamHI_RP reverse primer for the sequence containing the IxlKVAV. The 3xHA cDNA was amplified from pGCS-N2(3xHA) (Addgene #85719) using HA_BamHI_FP forward primer and HA_Pstl_RP reverse primer. Using the appropriate restriction enzymes, the two cDNA sequences were cloned into the MCS sequence of pUC19 vector using EcoRI / BamHI / Pstl. Finally, the entire fusion protein sequences were amplified using TOMM20_Sall_FP forward primer and HA_Mlul_RP reverse primer and cloned into AAVS1-CAG-hrGFP (Addgene #52344) using Sall / Mlul, to serve as the homology directed repair (HDR) template to insert the expression cassettes into cell lines using CRISPR. The gRNA targeting the AAVS1 loci was generated by cloning the gRNA Sequence GAGCTTGGCTGAAGATGATG into pSPCas9(BB)-2A-GFP (Addgene #48138), which will express the Cas9-gRNA fusion protein to enable CRISPR HDR. The cloning strategy is summarized in Figure 1 below. The HDR template plasmid with the Cas9-gRNA plasmid were then transfected using LipofectamineTM Stem into BJ iPSCs, and clonally expanded. The various DNA primers used in this genetic cloning is listed in Table 4.
[0279] Table 4. Primer name and sequences
[0280] Validation of expression of fusion TQM20 protein containing targeting and tag motifs
[0281] To confirm the expression of the fusion TOM20 protein, the inventors performed Western blots using antibodies against HA and TOM20. Using the anti-HA antibody, the inventors detected ~20kDa bands for TOM20-HA and TOM20-1xlKVAV-HA. This corresponds to the genetically modified fusion proteins. Next, using the anti-TOM20 antibody, the endogenous TOM20 protein (~15kDa) was detected in the parental BJ-iPS wild-type (BJ-WT) line. For the engineered lines TOM20-HA and TOM20-IK AV-HA, both the endogenous TOM20 protein (~15 kDa) and genetically modified TOM20 (~20 kDa) were detected as expected. To increase the number of targeting IKVAV (SEQ ID NO: 18) motifs, the inventors also cloned in 5 copies of IKVAV (5xlKVAV) followed by the HA tag using the same strategy described above. However, the inventors noted that 5xlKVAV-HA could not be expressed as a fusion protein (Figure 2).
[0282] Validation that IKVAV-HA is expressed on the cytosolic face of the mitochondrion outer membrane
[0283] The IKVAV targeting motif (which is tethered to HA tag) has to be inserted on the outer surface of the mitochondrion, i.e. on the cytosolic face so that the motifs on the purified mitochondria can interact with integrins expressed on the host cell to facilitate endocytosis. To confirm that the IKVAV-HA motif is located on the surface of mitochondria, the inventors performed antibody-based mitochondria purification from iPSCs using the anti-HA microbeads, and benchmarked this with the anti-TOM22 microbead (Miltenyi Biotec Cat No. 130-094-872). First, the microbead purified mitochondria were subjected to flow cytometry analyses, where the inventors found that mitochondria isolated from both approaches have similar size and granularity (Figure 3). This confirmed that anti-HA microbeads can be used to purify mitochondria from cell lysates, indicating that the IKVAV-HA motif is located on the mitochondrial surface. The inventors also performed the BCA Protein Assay to determine the protein concentration as a means to quantify mitochondrial yield, which suggests that more mitochondria can be isolated using anti-HA microbeads compared to anti-TOM22 microbeads (Figure 4).
[0284] Method of isolating intact and bioactive mitochondria from induced pluripotent stem cells
[0285] An improvised methodology to derive intact mitochondria (S+DC method)
[0286] Even though protocols exist to derive intact mitochondria, either by means of ultracentrifugation, differential centrifugation or microbead-based sorting, each comes with specific pros and cons and not well-suited for intact mitochondria extraction from induced pluripotent stem cells. For example, the inventors found that dounce homogenization, which is a standard approach for mechanically lysing cells, was not efficient in lysing pluripotent stem cells (since they are smaller than typical cultured cells) and produced large batch-to-batch and user-to-user variability. Eventually, the inventors overcame this by using weak sonication to lyse the cells while maintaining the integrity of mitochondria. The inventors also found that microbeads co-precipitate with the mitochondria and cannot be efficiently separated, which is a severe limitation for downstream applications. Therefore, the inventors relied on a combination of sonication, differential centrifugation and size selection (S+DC method) to isolate a highly enriched mitochondrial population (Figure 5). The new methodology can be completed in 60 minutes, which is faster than the microbead approach and has better mitochondrial yield and purity compared to the traditional differential centrifugation approach (Figure 6).
[0287] Validation that mitochondria isolated from S+DC method are biologically active
[0288] Intact, healthy and biologically active mitochondria maintain a mitochondrial membrane potential sustained by the activities of proton pumps (Complexes I, III and IV). On the other hand, damaged and defective mitochondria have depolarized membranes. Using TMRE (tetramethylrhodamine methyl ester perchlorate), a red fluorescent dye sequestered by active mitochondria with a high mitochondrial membrane potential, the inventors evaluated the fluorescence of mitochondria isolated via the S+DC method where the inventors found that isolated mitochondria sequestered TMRE dye (blue curves), and respond to FCCP, a well-characterized mitochondrial membrane depolarizing molecule (orange curves) (Figure 7). Taken together, this suggests that mitochondria isolated from the S+DC approach were intact and biologically active.
[0289] In vitro evidence that IKVAV-modified mitochondria are preferentially internalized by neural cells and neurons
[0290] Purified mitochondria with IKVAV motif are more efficiently internalized by control mitochondria in vitro
[0291] Prior studies have shown that exogenous mitochondria can be internalized by cultured cells via an endocytic process known as macropinocytosis. The inventors reasoned that mitochondria in close proximity to the cellular membrane of the recipient cells would be more effectively endocytosed. The pi -integrin is expressed on many cell types, most notably neurons in the central nervous system and retina, and it is well characterized that the laminin-derived peptide IKVAV binds to pi-integrin. Therefore, the inventors compared the efficiency of uptake of mitochondria with and without the IKVAV motif (TOM20-IKVAV-HA and TOM20-HA respectively) on their surface (Figure 8). The mouse photoreceptor precursor cell line 661 W was used in this study where 10,000 cells were plated in a single cell of a 96-well plate and incubated with 1.5 g of mitochondria for 24 hours. Thereafter, cells were fixed and immunostaining was performed. TOM20 staining was performed to elucidate the host mitochondrial network within 661 W cells while HA staining reveals internalized human mitochondria. Confocal imaging was performed and Figure 8 below shows a single imaging plane in the cytoplasmic layer of the cell. Quantification of HA intensities per cell also revealed that IKVAV-labelled mitochondria were more significantly internalized by 661 W cells.
[0292] Expanding on this, the inventors performed a similar mitochondria uptake study in human motor neurons. Differing amounts of TOM20-HA or TOM20-IKVAV-HA mitochondria (0.25pg to 1 pg) were incubated with 10,000 human motor neurons. Cells were fixed for immunostaining analyses at either 5 hours or 12 hours post treatment. Amount of mitochondrial uptake was quantified based on mean intensity of HA signal per cell. Using this method, the inventors confirmed that there was a dose-dependent increase in mitochondrial uptake for both TOM20-HA and TOM20-IKVAV-HA mitochondria. More importantly, the inventors also confirmed that TOM20-IKVAV-HA mitochondria demonstrated significantly higher internalization at the 12-hour time point (Figure 9). Knock-in expression of HA-tagged TOM20
[0293] The first step to achieving the overall milestone of the project is to prove that iPSC cells can be bioengineered to express protein motifs on the surfaces of their mitochondrion. TOM20 protein encoded by the TOMM20 genomic gene sequence is a mitochondrial outer membrane protein, with its C-terminus facing the cytosol. Previous works have shown that exogenous TOM20-3xHA fusion protein can be virally transduced into cell lines to tag endogenous mitochondria. However, viral modifications to cell lines severely limit its utility in the disease modelling and therapeutic space. Therefore, the inventors decided to take a CRISPR genetic modification strategy to introduce a TOM20- 3xHA expression cassette into the AASV1 safe harbor loci to create iPSC lines as factories for bioengineered mitochondria (Figure 13A, i). Genetic modification was done through plasmid transfection, with no cellular exposure to viral material. Immunofluorescent analysis of successfully transfected, clonally expanded BJ iPSCs expressing TOM20-3xHA fusion protein (Termed TOM20-HA BJ iPSCs) demonstrated co-expression of TOM20 and HA tags (Figure 13B). Therefore, the inventors propose that an additional modification of cardiac peptide motifs (described below) can be added unto the TOM20-3xHA fusion protein expression cassette, preceding the 3xHA motif, to generate the bioengineered mitochondria with preferential binding to cardiac cells (Figure 13A, ii).
[0294] Demonstrate mitochondrial extraction from iPSC lines with enhanced purity
[0295] Extraction of functional mitochondria for therapeutic purposes involves several considerations, chief of which is the purity of the mitochondrial extract. There are three main steps to extract mitochondria for functional purposes - Lysis of the donor cells, mitochondrial purification from the cell lysate and quantification of the final mitochondrial product. The inventors first compared low-strength sonication against dounce homogenization lysis methods, and the inventors found that dounce homogenization had poor cell lysis efficiency, resulting in much material loss during an initial whole-cell cleanup step. Thereafter, three purification methods were tested - 1. Differential centrifugation; 2. Differential centrifugation with a final 5 pm mesh filtration step; 3. HA microbead antibody for column-based extraction. An equal load of mitochondrial extract from the three methods were compared using western blotting (Figure 14). The inventors found that an optimized differential centrifugation protocol could achieve increased yields of mitochondria compared to whole cell control (TOM20 bands), with little nuclear contamination (H3 bands), endoplasmic reticulum contamination (PDI band) and cytoplasmic contamination (GAPDH band). Similar purity was also achieved using the same differential centrifugation protocol with an additional filtration step, which the inventors thus deemed unnecessary. Surprisingly, the HA microbead antibody column-based extraction yielded impure mitochondria. Although increased mitochondria yield was obtained, significant nuclear contamination, as well as presence of endoplasmic reticulum and cytoplasmic contaminants were observed. Therefore, the inventors conclude that a sonication and differential centrifugation protocol can yield pure mitochondria for functional and therapeutic purposes.
[0296] Identification of the binding motifs from cardiac -specific laminin-221 that interact with cardiomyocyte-surface integrins
[0297] Extracellular matrices are known to express specific components in the different regions of the human body. One such variation occurs in the basement membranes, a thin extracellular structure in the immediate vicinity to the cell surface. Laminins are one such structural protein found on the basement membrane and are known to have multiple cell-specific isoforms. Transcriptomic analysis of the human left heart ventricle shows enhanced expression of LAMA2, LAMB2 and LAMC1 genes, corresponding to the trimeric isoform of laminin-2212. The Laminin E8 fragment, which is the truncated C- terminal region of the trimeric protein, contains five laminin globular (LG1 -5) domains, of which LG1-3 is known to be the interacting domain of the laminin trimers to their associated integrin isoform binding partners on cell surfaces. On cardiomyocytes, this cell-specific integrin isoform is a7X2|31 , with which laminin-221 has been shown to interact with. Previous work has identified small peptide motifs, termed Cell-Adhesion Peptides (CAPs), such as the peptide sequence RGD and IKVAV, found on laminin E8 fragments, to be the interacting domains with cellular integrins. These previous findings form the background for the inventors’ search for a CAP that preferentially interacts with the cell surface of cardiomyocytes.
[0298] Firstly, the inventors identified that the previously studied CAPs known to interact with integrin, RGD and IKVAV, are found on the Alpha subunit of Laminin, which contains the LG domains in the laminin trimer. The inventors used Alphafold protein prediction software to predict the structure around the LG1-3 domain within LAMA1 protein, which contains the RGD (SEQ ID NO: 13) and IKVAV CAP motifs. Notably, the RGD and IKVAV (SEQ ID NO: 18) motifs do not lie within the globular domains of LG1-3. The RGD motif is found in the exposed region between the end of the coiled-coil structure and the start of the LG1 domain (Figure 15A), while the IKVAV motif is found in the exposed region on the LG3 domain (Figure 15B). These results support a hypothesis that the exposed regions on the LG domains found on the laminin alpha subunits would contain the binding motifs that interact with cell-specific integrins.
[0299] The inventors similarly predicted the structure around the LG1-3 domain of LAMA2 protein, the predominant alpha laminin subunit isoform found in the adult heart. From the prediction, the inventors identified four exposed peptide sequences as potential motifs that have preferential binding to cardiomyocytes (Table 1 , Figure 16).
[0300] Table 1. Exposed amino acids in LAMA2 protein.
[0301] Identification of the binding motifs from CD47 which interacts with cardiacspecific SIRPa surface marker protein
[0302] An alternative approach to identify a cardiomyocyte specific binding motif is to identify amino acid sequences of proteins that are known to interact with surface proteins specific to cardiomyocytes. One established cardiomyocyte surface marker protein is SIRPa. The primary known binding partner of SIRPa is CD47, a surface marker protein expressed on immune cells to regulate immune response near the heart. Previous reports have elucidated the protein structures of SIRPa and CD47, as well as the protein sequence that are responsible for their protein-protein interaction - the amino acid elements between strands B and C (BC loop), as well as the elements between strands F and G (FG loop) (Figure 17). From these findings, the inventors identified the peptide sequences of the BC loop and the FG loop. The inventors also decided to study the peptide sequence preceding BC loop which enable the conformation of BC loop to interact with SIRPa (Table 2). An extensive table that covers the interacting peptides between CD47 and SIRPa is presented by Hatherley et al., which justifies the cut-off points for the peptide sequences identified for this work.
[0303] These peptide sequences as well as the peptide sequences identified in Table 1 , and a 6x Histidine control peptide sequence were synthesized with a small FITC fluorochrome tag for downstream experiments to confirm their interaction and binding to cardiomyocyte surfaces.
[0304] Table 2. CD47 peptide sequences that interact with cardiomyocyte surface marker SIRPa
[0305] Synthesized peptide sequences have improved binding efficiency to cardiomyocyte surfaces
[0306] Using human pluripotent stem cells (hPSC), the inventors generated mature contracting cardiomyocytes (CM), fibroblasts (Fib) and motor neurons (MN) using previously established protocols in the lab. These derived cells, as well as hPSCs, were seeded confluently into 96-well plate wells and allowed to recover. These cells were treated with each of the 8 synthesized peptides tagged with FITC identified in Table 1 and 2, in accordance with the treatment protocol described (Figure 18A). After two days of treatment, the cells were washed thoroughly twice, and the residual peptides bound to the cells was quantified using a fluorescence microplate reader (Figure 18B). Peptides 2,3 and 7 show significantly increased binding to CM compared to all other cell types. Analysis using a fluorescence microscope confirms that these three peptides are retained in CM while at a reduced level compared to the other cell types, in addition, the other peptides are not detected (Figure 19). Choosing peptide motifs for bioengineered expression on donor BJ hiPSC
[0307] For the source of bioengineered mitochondria, the inventors chose the BJ human iPSC (hiPSC) line which was previously validated to have genetically pristine mitochondria. As outlined in Figure 13A, CRISPR genetic modification was used to modify the donor BJ hiPSC line to express the bioengineered mitochondria. From Figure 18, the inventors demonstrated that peptides 2,3 and 7 have enhanced affinity for CMs. Peptide 5 remains to be of interest as it is the known interacting region of the SIRPa protein to CD47, and it is directly succeeding the peptide 7 motif.
[0308] Preliminary analysis from a parallel project looked at the affinity of the different regions of peptide 7 and peptide 5 in binding CMs, conducted in the same manner (Figure 18A). The inventors demonstrated that while peptide 5 has weak binding affinity, it is the region between peptides 7 and 5 that has the strongest binding affinity (Figure 20, Table 3)
[0309] Table 3. Alternative peptide sequences tested to identify an optimized binding motif.
[0310] CRISPR genetic modification to express fusion TOM20 protein containing targeting peptides and HA tag For this project, the inventors decided to stick to the generation of four additional donor lines, expressing either targeting peptide 2, 3, 5 or 7. After successful CRISPR genetic modification, clonal selection and expansion, the inventors generated four BJ hiPSC lines expressing fusion protein TOM20 - Cardiac Peptide - 3xHA, henceforth termed CP2, CP3, CP5 and CP7, representing Cardiac Peptides 2, 3, 5, 7 respectively. In addition, the inventors have the previously generated BJ hiPSC control line expressing fusion protein TOM20 - 3xHA, henceforth termed T20.
[0311] The four BJ hiPSC lines were genotyped for homozygous insertion of the expression cassette, and sanger sequencing was conducted to confirm that no unintended mutations occurred. Western blot analysis showed that CP3 line did not express the fusion protein (Figure 21A). CP2, CP5 and CP7 successfully expressed the fusion protein (Figure 21 B). To confirm that the engineered mitochondria remain functional, TMRE / FCCP flow analysis of isolated mitochondria was done (Figure 21 C). Isolated engineered mitochondria were successfully stained by TMRE, demonstrating that the mitochondria are polarised. In addition, they were successfully depolarised by the addition of mitochondria decoupler FCCP.
[0312] Demonstrate peptide sequences expressed on surface of bioengineered mitochondria facilitates mitochondria targeting and uptake in CMs
[0313] Matured CMs used for the following assays were magnetic sorted for pure CM. CMs were treated with mitochondria derived from the four engineered cell lines (T20, CP2, CP5, CP7) (Figure 22A). After treatment, cells were washed, fixed, permeabilized and stained for CTNT and HA. Quantification of the total HA staining intensity in the CMs showed significantly increased uptake from CP2 mitochondria compared to T20 control mitochondria (Figure 22B, Left). Interestingly, quantification of HA spots within each CM showed increased uptake of CP7 mitochondria compared to T20 (Figure 22B, Right).
[0314] Qualitatively, the increased uptake of CP7 mitochondria can be observed from the immunofluorescence images (Figure 23). The inventors hypothesize that there is an effect from unequal expression of the exogenous fusion protein (Figure 21 B - anti-HA), resulting in less HA fluorescence intensity per uptaken CP7 mitochondria.
[0315] To account for uneven exogenous fusion protein expression, mitotracker red was used to stain the donor cell’s mitochondria prior to lysis and harvesting, to ensure an equal amount of fluorescence per donor mitochondria prior to host CM treatment (Figure 24A). The inventors observed that there was significantly increased mitotracker red fluorescence within each CM in the CP7 mitochondria treated wells compared to the T20 mitochondria treated wells, corresponding to a relatively increased uptake of CP7 mitochondria (Figure 24B,C). These data support the hypothesis that CP7 engineered on the surface of mitochondria does enhance targeting and uptake by CMs.
[0316] Demonstrate functionality of mitochondria through improvement in cellular metabolism
[0317] Aging model CMs were used to demonstrate functional cellular improvements upon mitochondria treatment. The inventors have previously generated hPSC lines that could be induced to knockdown SIRT6 protein, resulting in a rapidly aging phenotype developing. Two hPSC lines (SIRT6 C2 and SIRT6 C3) were differentiated to matured CMs for use in the following assays. After induction of SIRT6 knockdown using doxycycline, CMs were then treated with mitochondria to reverse the aging phenotype. Metabolic capacity of the CMs were assessed using Seahorse Oxygen Consumption Rate (OCR) assay. Comparison with mitochondria untreated control CMs showed notable increase in aged CMs ATP production, basal respiration and maximal respiration (Figure 25A). Beta-galactosidase staining also confirmed that mitochondria treated CMs had lesser senescence staining (Figure 25B). Therefore, the treatment of CMs using the harvested mitochondria as described herein successfully demonstrated functional improvements to their metabolic capacity, and reversed senescence associated phenotypes.
[0318] References
[0319] 1 Gella, A. et al. Mitochondrial Proteome of Affected Glutamatergic Neurons in a Mouse Model of Leigh Syndrome. Frontiers in Cell and Developmental Biology 8. doi:10.3389 / fcell.2020.00660 (2020).
[0320] 2 Yap, L. et al. In vivo generation of post-infarct human cardiac muscle by laminin-promoted cardiovascular progenitors. Cell reports 26, 3231-3245. e3239 (2019).
[0321] 3 Aumailley, M. The laminin family. Cell Adh Migr 7, 48-55, doi:10.4161 / cam.22826 (2013).
[0322] 4 Miyazaki, T. et al. Laminin E8 fragments support efficient adhesion and expansion of dissociated human pluripotent stem cells. Nature Communications 3, 1236, doi:10.1038 / ncomms2231 (2012).
[0323] 5 Kihara, Y. et al. Laminin-221-derived recombinant fragment facilitates isolation of cultured skeletal myoblasts. Regen Ther 20, 147-156, doi: 10.1016 / j.reth.2022.04.006 (2022). 6 Huettner, N., Dargaville, T. R. & Forget, A. Discovering cell-adhesion peptides in tissue engineering: beyond RGD. Trends in biotechnology 36, 372-383 (2018).
[0324] 7 Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021).
[0325] 8 Dubois, N. C. et al. SIRPA is a specific cell-surface marker for isolating cardiomyocytes derived from human pluripotent stem cells. Nat Biotechnol 29, 1011- 1018, doi:10.1038 / nbt.2005 (2011).
[0326] 9 Hatherley, D. et al. Paired receptor specificity explained by structures of signal regulatory proteins alone and complexed with CD47. Molecular cell 31 , 266-277 (2008).
[0327] APPLICATIONS
[0328] Embodiments of modified cells as disclosed herein takes advantage of the possibility of introducing exogenous outer membrane protein to the cytosolic face of a mitochondrion. The present disclosure established a protocol to harvest and purify engineered mitochondrion from cell cultures (e.g. iPSC cultures). Using these bioengineered mitochondria, the present disclosure demonstrated that cardiac peptides can be successfully expressed on the surface of these donor mitochondria and that the expression of cardiac peptides enhanced the engineered mitochondria uptake into cardiomyocytes.
[0329] In addition, the present disclosure also demonstrated in the aging cardiomyocyte model that the uptake of exogenous donor mitochondria advantageously enhanced the cardiomyocyte metabolic capacity, as well as reversed the accumulation of senescent biomarker beta-galactosidase.
[0330] It will be appreciated by a person skilled in the art that other variations and / or modifications may be made to the embodiments disclosed herein without departing from the spirit or scope of the disclosure as broadly described. For example, in the description herein, features of different exemplary embodiments may be mixed, combined, interchanged, incorporated, adopted, modified, included etc. or the like across different exemplary embodiments. The present embodiments are, therefore, to be considered in all respects to be illustrative and not restrictive.
Claims
CLAIMS1. An engineered mitochondrion comprising one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
2. The engineered mitochondrion of claim 1 , wherein the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM-derived peptide, optionally the ECM binding motif / peptide is on the cytosolic face of the outer mitochondrial membrane.
3. The engineered mitochondrion of claim 1 or 2, wherein the exogenous protein binding motif / peptide is an extracellular matrix (ECM) protein binding motif / ECM- derived peptide comprising a laminin-derived peptide, a surface marker peptide, a fibronectin-derived peptide, a collagen-derived peptide, a gelatin-derived peptide, an agrin-derived peptide, and / or a combination thereof.
4. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises about 4 to 40 amino acids residues.
5. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a laminin-derived peptide.
6. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 17),Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 18),Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide 1),Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
7. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a cardiac-specific laminin that interacts with cardiomyocyte-surface integrins.
8. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises one or more exposed regions on the interacting domain of laminin, including the helix, loop, and laminin globular (LG) domains LG1 , LG2, LG3, LG4, LG5, and / or combinations thereof, optionally the exogenous protein binding motif / peptide comprises an exposed region between Helix and LG1 , an exposed region between LG1 and LG2, an exposed region between LG2 and LG3, and an exposed loop in LG3, or combinations thereof.
9. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a laminin-derived peptide comprising a peptide having the sequence ofAsn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS, SEQ ID NO: 1 - CP peptide 1),Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lle (CTVSPQVEDSEGTI, SEQ ID NO: 2 - CP peptide 2),Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT, SEQ ID NO: 3- CP peptide 3),Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA, SEQ ID NO: 4 - CP peptide 4), and / or a combination thereof.
10. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a surface marker peptide.
11. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte.
12. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a surface marker protein of a cardiomyocyte is SIRPa.
13. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprising a SIRPa surface marker protein comprising a peptide having the sequenceThr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - peptide 7),Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5 - peptide 5),Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE, SEQ ID NO: 6 - peptide 6), or combinations thereof.
14. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprising a SIRPa surface marker protein comprising a peptide having the sequenceVal-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA, SEQ ID NO: 12 - ABC peptide),Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF, SEQ ID NO: 11 - AB- rear),Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF, SEQ ID NO: 7 - AB full),Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV, SEQ ID NO: 10 - AB-Mid),Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN, SEQ ID NO: 9 - AB- front),Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY, SEQ ID NO: 5 - BC peptide), or combinations thereof.
15. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a fibronectin-derived peptide comprising Arg-Gly-Asp (RGD, SEQ ID NO: 13), Pro-His-Ser-Arg-Asn (PHSRN, SEQ ID NO: 14), cyclic RGD, and / or a combination thereof.
16. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide comprises a collagen-derived peptide comprising Asp-Gly-Glu-Ala (DGEA, SEQ ID NO: 16).
17. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide is expressed on an exogenous mitochondrial outer membrane protein.
18. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide is expressed on an exogenous translocase of the outer mitochondrial membrane complex, optionally an exogenous TQM20, TQM70, TQM40, TOM22, TOM7, TOM6, TOM5, TQM70, SAM50, SAM35, SAM37, Mimi , Mim2, or combinations thereof.
19. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide is expressed on an exogenous TQM20, TOM22, TQM70, SAM50, PORIN, outer membrane protein 25 (OMP25), or combinations thereof.
20. The engineered mitochondrion of any one of the preceding claims, wherein the exogenous protein binding motif / peptide is expressed on an exogenous TQM20 protein.
21. The engineered mitochondrion of any one of the preceding claims, wherein the mitochondrion is derived from a cell selected from the group consisting ofan induced pluripotent stem cell, a mesenchymal stem cell, an adipose-derived stem cell, and an adult stem cell.
22. A polynucleotide encoding the mitochondrion of any one of the preceding claims.
23. The polynucleotide of claim 22, wherein the polynucleotide encodes for an insertion construct comprising sequences encoding an exogenous outer membrane protein of a mitochondrion and / or an exogenous protein binding motif / peptide.
24. The polynucleotide of claim 22 or 23, wherein the polynucleotide encoding encodes for an exogenous protein binding motif / peptide having one or more sequences selected from the group consisting of lle-Lys-Val-Ala-Val (IKVAV, SEQ ID NO: 18),Tyr-lle-Gly-Ser-Arg (YIGSR, SEQ ID NO: 19),Pro-Pro-Phe-Leu-Met-Leu-Leu-Lys-Gly-Ser-Thr-Arg (PPFLMLLKGSTR, SEQ ID NO: 19),Asp-Leu-Thr-lle-Asp-Asp-Ser-Tyr-Trp-Tyr-Arg-lle (DLTIDDSYWYRI, SEQ ID NO: 20),Asn-Ser-lle-Lys-Val-Ser-Val-Ser-Ser (NSIKVSVSS - CP peptide 1 , SEQ ID NO: 1),Cys-Thr-Val-Ser-Pro-Gly-Val-Glu-Asp-Ser-Glu-Gly-Thr-lso (CTVSPQVEDSEGTI - CP peptide 2, SEQ ID NO: 2),Lys-Gly-Cys-Ser-Leu-Glu-Asn-Val-Tyr-Thr (KGCSLENVYT- CP peptide 3, SEQ ID NO: 3),Ser-Gly-Gly-Thr-Pro-Ala-Pro-Pro-Arg-Arg-Lys-Arg-Arg-Glu-Thr-Gly-Glu-Ala (SGGTPAPPRRKRRQTGQA - CP peptide 4, SEQ ID NO: 4),Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTVVIPCF - peptide 7, SEQ ID NO: 7),Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - peptide 5, SEQ ID NO: 5),Thr-Glu-Leu-Thr-Arg-Glu-Gly-Glu (TELTREGE - peptide 6, SEQ ID NO: 6),Val-Val-lso-Pro-Cys-Phe-Val-Thr-Asn-Met-Glu-Ala (VVIPCFVTNMEA - ABC peptide, SEQ ID NO: 12),Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (CNDTVVIPCF - AB-rear, SEQ ID NO: 11), Thr-Lys-Val-Glu-Phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val-lso-Pro-Cys-Phe (TKSVEFTFCNDTWIPCF - AB full, SEQ ID NO: 7), Glu-phe-Thr-Phe-Cys-Asn-Asp-Thr-Val-Val (EFTFCNDTVV - AB-Mid, SEQ ID NO: 10), Thr-Lys-Ser-Val-Glu-Phe-Thr-Phe-Cys-Asn (TKSVEFTFCN - AB-front), Asn-Met-Glu-Ala-GIn-Asn-Thr-Thr-Glu-Val-Tyr (NMEAQNTTEVY - BC peptide, SEQ ID NO: 5), or combinations thereof.
25. The polynucleotide of any one of 22 to to 24, wherein the polynucleotide encodes for an insertion construct comprising sequences encoding a TOMM20 and / or a cardiac peptide motif.
26. A vector comprising the polynucleotide encoding the mitochondrion of of any one of claims 1 to 21 or comprising the polynucleotide according to any one of claims 22 to 25.
27. A host cell comprising the vector of the claim 26.
28. A cell comprising the mitochondrion of any one of the claims 1 to 21.
29. A composition or pharmaceutical composition comprising the engineered mitochondrion of any one of claims 1 to 21 or polynucleotide according to any one of claims 22 to 25.
30. The composition or pharmaceutical composition of claim 29 for use in therapy / medicine.
31. A method of preventing and / or treating a disease in a subject in need thereof, the method comprises administering to the subject the engineered mitochondrion of any one of claims 1 to 21 or polynucleotide according to any one of claims 22 to 25 or composition of claim 29.
32. The method according to claim 31 , wherein the disease is a mitochondrial disorder or a proliferative disease.
33. A method of improving mitochondrion uptake into a target cell comprising genetically modifying a host cell to express a modified mitochondrion, wherein the modified mitochondrion comprises one or more exogenous protein binding motif / peptide expressed on the outer membrane of the mitochondrion.
34. The method of claim 33, wherein the host cell is genetically modified via viral transduction or a CRISPR gene modification system.