Methods and materials for assessing and treating cancers
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- MAYO FOUNDATION FOR MEDICAL EDUCATION & RESEARCH
- Filing Date
- 2024-08-15
- Publication Date
- 2026-06-24
AI Technical Summary
Current methods for predicting the responsiveness of mesothelioma to immune checkpoint inhibitors (ICIs) are inadequate, particularly for patients with epithelioid mesothelioma, leading to suboptimal treatment selection.
The use of specific non-coding RNAs (ncRNAs), such as mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p, to assess the likelihood of mesothelioma responding to ICIs by determining their presence or absence in cancer cell samples.
This approach allows for more accurate identification of mesothelioma patients likely to benefit from ICIs, enabling personalized treatment strategies that improve disease-free survival and overall survival while minimizing ineffective treatments.
Smart Images

Figure IMGF000029_0001 
Figure IMGF000032_0001 
Figure IMGF000028_0001
Abstract
Description
[0001] METHODS AND MATERIALS FOR ASSESSING AND TREATING CANCERS
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit of U.S. Patent Application Serial No. 63 / 532,740, filed on August 15, 2023. The disclosure of the prior application is considered part of, and is incorporated by reference in, the disclosure of this application.
[0004] SEQUENCE LISTING
[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2247W01_SL.xml.” The XML file, created on August 14, 2024, is 7,233 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0006] TECHNICAL FIELD
[0007] This document relates to methods and materials involved in assessing and / or treating a mammal (e.g., a human) having cancer (e.g., mesothelioma). For example, methods and materials provided herein can be used to identify a cancer (e g., a mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors. In some cases, methods and materials provided herein can be used to treat a mammal (e.g., a human) having cancer (e.g., mesothelioma) where the cancer treatment is selected based on whether or not the cancer is likely to be responsive to one or more immune checkpoint inhibitors.
[0008] BACKGROUND
[0009] The combination of the immune checkpoint inhibitors (ICI) nivolumab and ipilimumab was recently approved by the United States Food and Drug Administration for the treatment of unresectable pleural mesothelioma. Currently, histology is the greatest predictor of survival, as patients with non-epithelioid mesothelioma derived the greatest benefit with ICI compared to chemotherapy. There are however patients with epithelioid mesothelioma who also benefit from ICI, and better predictors are urgently needed to help select which of these patients should receive ICI or chemotherapy. SUMMARY
[0010] This document provides methods and materials for assessing and / or treating a mammal (e.g., a human) having cancer (e.g., mesothelioma). For example, this document provides methods and materials for identifying a cancer (e g., a mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors. This document also provides methods and materials for using the presence or absence of one or more non-coding ribonucleic acids (ncRNAs; e.g., microRNAs (miRNAs) and competing endogenous RNAs (ceRNAs)) within cancer cells of the cancer) to identify the cancer as being likely to respond to one or more immune checkpoint inhibitors. For example, a sample containing cancer cells obtained from a mammal having cancer (e.g., mesothelioma) can be assessed to identify the mammal as having a cancer that is likely to respond to one or more immune checkpoint inhibitors based, at least in part, on the presence or absence of one or more ncRNAs in the sample.
[0011] As demonstrated herein, the presence or absence of one or more ncRNAs in a cancer (e.g., a mesothelioma) can indicate whether or not the mammal (e g., human) is likely to respond to one or more immune checkpoint inhibitors. For example, a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be used to determine the presence or absence of one or more ncRNAs in the cancer, whereby the presence or absence of one or more ncRNAs in the cancer indicates whether the cancer is likely to respond to one or more immune checkpoint inhibitors. In some cases, the presence of one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer (e.g., mesothelioma) can indicate that the cancer is likely to respond to one or more immune checkpoint inhibitors. In some cases, the absence of each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer (e g., mesothelioma) can indicate that the cancer is not likely to respond to one or more immune checkpoint inhibitors.
[0012] Having the ability to identify a cancer as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer) allows clinicians to assess cancer patients in a more accurate manner than current protocols. The ability to identify a cancer as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer) also allows clinicians to provide a personalized approach in selecting cancer treatments, thereby improving disease-free survival and / or overall survival for this identified patient population. In addition, the ability to identify a cancer as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer) can minimize subjecting patients to ineffective treatments.
[0013] In general, one aspect of this document features methods for assessing a mammal having cancer where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the presence of one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) classifying the cancer as being likely to respond to an immune checkpoint inhibitor. The mammal can be a human. The method can include determining the presence of the mir-888-5p. The method can include determining the presence of the mir-892a. The method can include determining the presence of the mir204-5p. The method can include determining the presence of the mir34a-5p. The method can include determining the presence of the mir-195-5p. The method can include determining the presence of each of the mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0014] In another aspect, this document features methods for assessing a mammal having cancer where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the absence of (e.g., lacking) each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) classifying the cancer as not being likely to respond to an immune checkpoint inhibitor. The mammal can be a human. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0015] In another aspect, this document features methods for treating a mammal having cancer, where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the presence of one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) selecting an immune checkpoint inhibitor as a treatment for the cancer. The mammal can be a human. The method can include determining the presence of the mir-888-5p. The method can include determining the presence of the mir-892a. The method can include determining the presence of the mir204-5p. The method can include determining the presence of the mir34a-5p. The method can include determining the presence of the mir-195-5p. The method can include determining the presence of each of the mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0016] In another aspect, this document features methods for treatment for a mammal having cancer, where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the absence of (e.g., lacking) each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) selecting a cancer treatment other than an immune checkpoint inhibitor as a treatment for the cancer. The mammal can be a human. The cancer treatment can include performing surgery. The cancer treatment can include radiation therapy. The cancer treatment can include administering, to the mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0017] In another aspect, this document features methods for treating a mammal having cancer, where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the presence of one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) administering an immune checkpoint inhibitor to the mammal. The mammal can be a human. The method can include determining the presence of the mir-888-5p. The method can include determining the presence of the mir-892a. The method can include determining the presence of the mir204-5p. The method can include determining the presence of the mir34a-5p. The method can include determining the presence of the mir-195-5p. The method can include determining the presence of each of the mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0018] In another aspect, this document features methods for treating cancer, where the methods can include, or consist essentially of, administering an immune checkpoint inhibitor to a mammal identified as having cancer cells having the presence of one or more of mir- 888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p, thereby treating cancer within the mammal. The mammal can be a human. The method can include determining the presence of the mir-888-5p. The method can include determining the presence of the mir-892a. The method can include determining the presence of the mir204-5p. The method can include determining the presence of the mir34a-5p. The method can include determining the presence of the mir-195-5p. The method can include determining the presence of each of the mir-888- 5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti -CTL4 A antibody, an anti -LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0019] In another aspect, this document features methods for treating a mammal having cancer, where the methods can include, or consist essentially of, (a) determining that a sample obtained from the mammal and including cancer cells having the absence of (e.g., lacking) each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p; and (b) administering a cancer treatment to the mammal, where the cancer treatment is not an immune checkpoint inhibitor. The mammal can be a human. The cancer treatment can include performing surgery. The cancer treatment can include radiation therapy. The cancer treatment can include administering, to the mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0020] In another aspect, this document features methods for treating cancer, where the methods can include, or consist essentially of, administering a cancer treatment that is not an immune checkpoint inhibitor to a mammal identified as having cancer cells having the absence of (e.g., lacking) each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195- 5p. The mammal can be a human. The cancer treatment can include performing surgery. The cancer treatment can include radiation therapy. The cancer treatment can include administering, to the mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor. The cancer can be a mesothelioma. The mesothelioma can be a pleural mesothelioma, a peritoneal mesothelioma, a pericardial mesothelioma, or a testicular mesothelioma.
[0021] In another aspect, this document features methods for assessing a mammal having cancer, where the methods can include, or consist essentially of, (a) determining a level of one or more of mir34a-5p and mir-195-5p in a sample comprising cancer cells obtained from said mammal; and (b) classifying said mammal as being likely to experience a poor outcome when said sample comprises a low level of one or more of mir34a-5p and mir-195-5p; or (c) classifying said mammal as not being likely to experience a poor outcome when said sample lacks a low level of each of mir34a-5p and mir-195-5p. The mammal can be a human. The poor outcome can include poor survival and / or a poor response to an immune checkpoint inhibitor. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab. The cancer can be a mesothelioma.
[0022] In another aspect, this document features methods for treating a mammal having mesothelioma, where the methods can include, or consist essentially of, administering one or more of mir34a-5p and mir-195-5p to said mammal, thereby treating cancer within said mammal. The mammal can be a human. The method can include administering said mir34a- 5p and said mir-195-5p. The mir34a-5p and / or said mir-195-5p can be conjugated to a targeting moiety. The mir34a-5p and / or said mir-195-5p can be encapsulated within a liposome. The liposome can include a targeting moiety. The method also can include administering an immune checkpoint inhibitor to said mammal. The immune checkpoint inhibitor can be an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti -CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, or an anti-VISTA antibody. The immune checkpoint inhibitor can be nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, or avelumab.
[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0024] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 shows a network of ceRNAs in mesothelioma based on The Cancer Genome Atlas (TCGA) that revealed interconnections between LOXL2, ITGA5, CALU, and MYBL2 hub genes. The mesothelioma ceRNA network in paired miRNA and RNA (n=86) TCGA data contained the 106 most statistically significant connections with adjusted p-value < 0.001.
[0026] Figure 2 shows that a reduced level of mir204-5p following immunotherapy was associated with poor survival. Abbreviations: Pre-T: “Pre treatment”, at the baseline before the start of therapy. On-T: “On treatment”, during the course of treatment after treatment had started. NR: Non-responders, patients who died less than 18 months after therapy. R: Responders, patients who remained alive more than 18 months after therapy.
[0027] Figures 3A-3F: Figure 3 A) HMMR was up regulated in mesothelioma (M) compared with normal pleura (NP) in GSE1024 dataset. Figure 3B) HMMR had a robust expression in Epithelioid (EP), biphasic (BI), and sarcomatoid (SR) mesotheliomas according to the Bueno data. Figure 3C) High HMMR expression was associated with a reduced survival in TCGA tumors. Figure 3D- Figure 3E) Immune deconvolution identified enrichments of Th2 T cells in high (Hi) versus low (Lo) HMMR expressing tumors in TCGA and Bueno data. Lo and Hi were based on lowest 1 / 3 and highest 2 / 3 HMMR expressions in TCGA (n = 29 each) and Bueno (n = 61 each) data. Figure 3F) GATA3 was over expressed in Hi versus Lo tumors in TCGA. A.U.: arbitrary unit.
[0028] Figures 4A-4D: Figure 4A) SPONGE program identified a ceRNA network in which HMMR and 10 other genes with significant roles in cell cycle (vertical orange bar) or chemo sensitivity (Chem. Sens., horizontal cyan bar) were targeted by either miR-34a-5p (red diamond), miR-195-5p (blue diamond), or both. Figure 4B) Genes in the ceRNA network had highly correlated expressions. Plot shows correlations between HMMR and BIRC5. High expressions of miR-34a-5p (Figure 4C) and miR-195-5p (Figure 4D) were significantly and marginally associated with improved survival in TCGA data, respectively. DETAILED DESCRIPTION
[0029] This document provides methods and materials for assessing and / or treating a mammal (e.g., a human) having cancer (e.g., mesothelioma). For example, this document provides methods and materials for identifying a cancer (e g., a mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors, and, optionally, treating the mammal. In some cases, the methods and materials described herein can be used to predict responsiveness to one or more immune checkpoint inhibitors. For example, a sample (e.g., a sample containing one or more cancer cells) from a mammal having cancer (e.g., mesothelioma) can be assessed to identify the cancer as being likely to respond to one or more immune checkpoint inhibitors based, at least in part, on the presence or absence of one or more ncRNAs in the sample.
[0030] Any appropriate mammal having cancer (e.g., mesothelioma) can be assessed and / or treated as described herein. Examples of mammals that can have cancer and can be assessed and / or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a human having cancer (e.g., mesothelioma) can be assessed and / or treated as described herein.
[0031] When assessing a mammal (e.g., a human) having cancer as described herein and / or treating a mammal (e.g., a human) having cancer as described herein, the cancer can be any type of cancer. In some cases, a cancer assessed and / or treated as described herein can include one or more solid tumors. In some cases, a cancer assessed and / or treated as described herein can be a primary cancer. In some cases, a cancer assessed and / or treated as described herein can be a metastatic cancer. In some cases, a cancer assessed and / or treated as described herein can be a refractory cancer. In some cases, a cancer assessed and / or treated as described herein can be a relapsed cancer. Examples of cancers that can be assessed and / or treated as described herein include, without limitation, mesotheliomas such as epithelioid mesotheliomas. When a cancer is a mesothelioma (e.g., an epithelioid mesothelioma) the mesothelioma can be in the mesothelial lining of any appropriate tissues / organs within the mammal’s body. Examples of tissues / organs within a mammal’s body that having a mesothelial lining (e.g., are lined with mesothelium) and can be assessed and / or treated as described herein include, without limitation, lungs, abdominal organs, heart, and testicles. For example, a mesothelioma can be a pleural mesothelioma (e.g., a mesothelioma of the mesothelium surrounding the lung). For example, a mesothelioma can be a peritoneal mesothelioma (e.g., a mesothelioma of the mesothelium surrounding the abdominal organs). For example, a mesothelioma can be a pericardial mesothelioma (e.g., a mesothelioma of the mesothelium surrounding the heart). For example, a mesothelioma can be a testicular mesothelioma (e.g., a mesothelioma of the mesothelium surrounding the testicles). In some cases, a mammal (e.g., a human) having cancer and being assessed and / or treated as described herein, can have multiple (e.g., two or more) different types of cancer. In some cases, a human having cancer and being assessed and / or treated as described herein can have a cancer that has metastasized to multiple different locations. For example, pleural mesothelioma can metastasize to the lungs. For example, pleural mesothelioma can directly invade into the lungs and / or chest wall.
[0032] In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having cancer (e.g., mesothelioma). Any appropriate method can be used to identify a mammal as having cancer. For example, physical examinations, imaging techniques, and laboratory techniques (e.g., analysis of biopsy samples) can be used to identify mammals (e.g., humans) as having cancer.
[0033] Any appropriate sample from a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be assessed as described herein (e.g., for the presence or absence of one or more ncRNAs in the cancer). In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more cancer cells. In some cases, a sample can contain one or more biological molecules (e.g., nucleic acids such as DNA and RNA, polypeptides, carbohydrates, lipids, hormones, and / or metabolites). Examples of samples that can be assessed as described herein include, without limitation, tissue samples such as pleural tissue samples and tissue samples of metastatic lesions. A sample can be a fresh sample (e.g., a fresh, frozen sample) or a fixed sample (e.g., a formaldehyde-fixed sample or a formalin- fixed sample). In some cases, one or more biological molecules can be isolated from a sample (e.g., from one or more cancer cells within the sample). For example, nucleic acid can be isolated from a sample and can be assessed as described herein. In another example, polypeptides can be isolated from a sample and can be assessed as described herein. Any appropriate method can be used to obtain a sample from a mammal (e.g., a human) having cancer (e.g., mesothelioma). In some cases, a sample (e.g., a sample including one or more cancer cells) can be obtained using biopsy techniques (e.g., pleural biopsy techniques).
[0034] A sample (e.g., a sample including one or more cancer cells) obtained from a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be assessed for the presence or absence of any appropriate number of ncRNAs. For example, a sample obtained from a mammal having cancer can be assessed for the presence or absence of one or more (e.g., one, two, three, four, five, or more) ncRNAs. In some cases, a sample obtained from a mammal having cancer can be assessed for the presence or absence of a single ncRNA. In some cases, a sample obtained from a mammal having cancer can be assessed for the presence or absence of two ncRNAs. In some cases, a sample obtained from a mammal having cancer can be assessed for the presence or absence of three ncRNAs.
[0035] A sample (e.g., a sample including one or more cancer cells) obtained from a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be assessed for any appropriate one or more (e.g., one, two, three, four, five, or more) ncRNAs. In some cases, a ncRNA that can be used to assess a mammal having cancer as described herein can be a miRNA. In some cases, a ncRNA that can be used to assess a mammal having cancer as described herein can be a ceRNA.
[0036] A ncRNA that can be used to assess a mammal (e.g., a human) having cancer (e.g., mesothelioma) as described herein (e.g., to determine whether or not the cancer is likely to respond to one or more immune checkpoint inhibitors) can regulate any one or more cellular processes (e.g., one or more cellular processes associated with cancer). For example, a ncRNA that can be used to assess a mammal having cancer as described herein can regulate cell cycle progression, cell survival, cell differentiation, immunoglobulin production, oxygen transport, humoral immune response mediated by circulating immunoglobulins, ethanol metabolic processes, peptide cross-linking, cellular pH responses, complement activation, and / or cellular immune responses.
[0037] A ncRNA that can be used to assess a mammal (e.g., a human) having cancer (e.g., mesothelioma) as described herein (e.g., to determine whether or not the cancer is likely to respond to one or more immune checkpoint inhibitors) can regulate expression of any one or more polypeptides (e.g., one or more polypeptides associated with cancer). For example, a ncRNAthat can be used to assess a mammal having cancer as described herein can regulate expression of L0XL2 polypeptides, ITGA5 polypeptides, CALU polypeptides, MYBL2 polypeptides, CNN3 polypeptides, MAPK8 polypeptides, CHST2 polypeptides, FAM101B polypeptides, CD226 polypeptides, RBPJ polypeptides, SULT1B1 polypeptides, SH0X2 polypeptides, MMP13 polypeptides, DCX polypeptides, ERBB3 polypeptides, NCAM1 polypeptides, MAPK11 polypeptides, H0XB7 polypeptides, DRAM1 polypeptides, NCEH1 polypeptides, RNF213 polypeptides, PLAUR polypeptides, NR1H3 polypeptides, VASP polypeptides, PIGF polypeptides, NUDT1 polypeptides, PTK2B polypeptides, SDC1 polypeptides, RER1 polypeptides, LRR1 polypeptides, LPCAT1 polypeptides, HMGCR polypeptides, WRB polypeptides, KLRC1 polypeptides, DNASE1L3 polypeptides, SLC12A7 polypeptides, CFP polypeptides, PCDHGA8 polypeptides, NDUFA4L2 polypeptides, LILRB5 polypeptides, RAB37 polypeptides, RFTN2 polypeptides, TSPAN15 polypeptides, C9orf24 polypeptides, LSP1 polypeptides, PAH polypeptides, CCDC69 polypeptides, SLC26A7 polypeptides, PIK3C2B polypeptides, F0XD2 polypeptides, VTN polypeptides, TRDC polypeptides, CHI3L2 polypeptides, RALGAPA2 polypeptides, SIGLEC16 polypeptides, SERPING1 polypeptides, XIRP2 polypeptides, TMEM63B polypeptides, SLC39A11 polypeptides, TMEM138 polypeptides, AGPAT5 polypeptides, ZNF540 polypeptides, RNF145 polypeptides, CNDP2 polypeptides, RETSAT polypeptides, INTS7 polypeptides, MMP3 polypeptides, ADCY3 polypeptides, CYB5A polypeptides, IGFN1 polypeptides, TMEM102 polypeptides, SCN4B polypeptides, PGD polypeptides, PH 6 polypeptides, MME polypeptides, TNIP1 polypeptides, GPR19 polypeptides, PRADC1 polypeptides, RPS19BP1 polypeptides, ACTN2 polypeptides, CAGE1 polypeptides, RDH16 polypeptides, H0XD13 polypeptides, COQ2 polypeptides, DTX4 polypeptides, DHX8 polypeptides, AGT polypeptides, CHST4 polypeptides, CACNA1S polypeptides, GPR39 polypeptides, Cl QB polypeptides, ZNF423 polypeptides, KIAA0100 polypeptides, CLSTN3 polypeptides, GRK5 polypeptides, IRS4 polypeptides, MGAT5 polypeptides, RPL36AL polypeptides, AQP3 polypeptides, SIL1 polypeptides, CD163L1 polypeptides, PIK3R3 polypeptides, GPLD1 polypeptides, HEXIM1 polypeptides, D0K2 polypeptides, Clorf74 polypeptides, FBXL15 polypeptides, GRID2IP polypeptides, SNF8 polypeptides, KLHL36 polypeptides, H0XB2 polypeptides, EDA polypeptides, MAB21L1 polypeptides, CYP2R1 polypeptides, ZFYVE19 polypeptides, SM0C1 polypeptides, ABCG1 polypeptides, CHURC1 polypeptides, SUSD4 polypeptides, ATP2A3 polypeptides, TENM1 polypeptides, MRC1 polypeptides, GLP2R polypeptides, MRPL52 polypeptides, FSTL4 polypeptides, PCDH11X polypeptides, TRAPPC4 polypeptides, TMIGD2 polypeptides, KIAA0319 polypeptides, FAM166B polypeptides, SLC6A20 polypeptides, PLA2G4E polypeptides, Clorfl l6 polypeptides, GLYAT polypeptides, ZG16 polypeptides, FAM83 A polypeptides, N0L3 polypeptides, MG ATI polypeptides, PPEF1 polypeptides, DBI polypeptides, C orf 10 polypeptides, ALX4 polypeptides, MYH7 polypeptides, DHRS7 polypeptides, DHRS2 polypeptides, CKM polypeptides, PTPN5 polypeptides, GPR133 polypeptides, GNLY polypeptides, 2-Mar polypeptides, FAM86A polypeptides, ADCY4 polypeptides, COX4I2 polypeptides, MY018B polypeptides, FCN3 polypeptides, FCRL5 polypeptides, HMCN2 polypeptides, COX6A2 polypeptides, LRRC71 polypeptides, KLKB1 polypeptides, AMN polypeptides, SERPINB7 polypeptides, GLYATL1 polypeptides, SCNN1B polypeptides, OR4N2 polypeptides, PPP1R14BP3 polypeptides, MAP3K15 polypeptides, NQ01 polypeptides, CXCR3 polypeptides, ZNF311 polypeptides, SPRN polypeptides, MCF2 polypeptides, AC005702.1 polypeptides, BCYRN1 polypeptides, CYP1B1-AS1 polypeptides, DNAJC5B polypeptides, FCN1 polypeptides, HMGB3P22 polypeptides, IGHV4-39 polypeptides, KRT42P polypeptides, LINC00310 polypeptides, LINC00467 polypeptides, MT1JP polypeptides, PCDHB 18 polypeptides, PSMC1P1 polypeptides, RPS23P6 polypeptides, SFTA1P polypeptides, TCL6 polypeptides, and / or VIPR2 polypeptides.
[0038] Examples of ncRNAs that can be used to assess a mammal (e.g., a human) having cancer (e.g., mesothelioma) as described herein (e.g., to determine whether or not the cancer is likely to respond to one or more immune checkpoint inhibitors) include, without limitation, mir-888-5p (e g., hsa- mir-888-5p), mir-892a (e g., hsa- mir-892a), mir204-5p (e.g., hsa- mir204-5p), mir34a-5p (e.g., has-mir34a-5p), and mir-195-5p (e.g., hsa-mir-195-5p).
[0039] In some cases, the presence or absence of a mir-888-5p can be used to identify a mammal (e.g., a human) having cancer (e.g., mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer). A mir-888-5p can have any appropriate sequence. For example, a mir-888-5p can have a sequence set forth in mirBase accession no MIMAT0004916. For example, a mir-888-5p can comprise, consist essentially of, or consist of the nucleic acid sequence UACUCAAAAAGCUGUCAGUCAC (SEQ ID NO: 1). As used herein, a mir-888-5p “that consists essentially of’ SEQ ID NO: 1 is a miRNA that has zero, one, or two nucleotide substitutions within SEQ ID NO: 1, that has zero, one, two, three, four, or five nucleotides directly preceding SEQ ID NO: 1, and / or that has zero, one, two, three, four, or five nucleotides directly following SEQ ID NO: 1, provided that the miRNA maintains its basic ability to target and bind nucleic acid (e.g., a transcript) encoding a CNN3 polypeptide, a MAPK8 polypeptide, a CHST2 polypeptide, and / or a FAM101B polypeptide.
[0040] In some cases, the presence or absence of a mir-892a can be used to identify a mammal (e.g., a human) having cancer (e.g., mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer). A mir-892a can have any appropriate sequence. For example, a mir-892a can have a sequence set forth in mirBase accession no MIMAT0004907. For example, a mir-892a can comprise, consist essentially of, or consist of the nucleic acid sequence CACUGUGUCCUUUCUGCGUAGA (SEQ ID NO:2). As used herein, a mir-892a “that consists essentially of’ SEQ ID NO:2 is a miRNA that has zero, one, or two nucleotide substitutions within SEQ ID NO:2, that has zero, one, two, three, four, or five nucleotides directly preceding SEQ ID NO:2, and / or that has zero, one, two, three, four, or five nucleotides directly following SEQ ID NO:2, provided that the miRNA maintains its basic ability to target and bind nucleic acid (e.g., a transcript) encoding a CD226 polypeptide, a RBPJ polypeptide, a SULT1B1 polypeptide, and / or a SH0X2 polypeptide.
[0041] In some cases, the presence or absence of a mir204-5p can be used to identify a mammal (e.g., a human) having cancer (e.g., mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer). A mir204-5p can have any appropriate sequence. For example, a mir204-5p can have a sequence set forth in mirBase accession no MIMAT0000265. For example, a mir204-5p can comprise, consist essentially of, or consist of the nucleic acid sequence UUCCCUUUGUCAUCCUAUGCCU (SEQ ID NO:3). As used herein, a mir204-5p “that consists essentially of’ SEQ ID NO:3 is a miRNA that has zero, one, or two nucleotide substitutions within SEQ ID NO:3, that has zero, one, two, three, four, or five nucleotides directly preceding SEQ ID NO:3, and / or that has zero, one, two, three, four, or five nucleotides directly following SEQ ID NO:3, provided that the miRNA maintains its basic ability to target and bind nucleic acid (e.g., a transcript) encoding a MMP13 polypeptide, a DCX polypeptide, a ERBB3 polypeptide, aNCAMl polypeptide, aMAPKl l polypeptide, aH0XB7 polypeptide, aDRAMl polypeptide, aNCEHl polypeptide, aRNF213 polypeptide, aPLAUR polypeptide, aNRlH3 polypeptide, aVASP polypeptide, aPIGF polypeptide, aNUDTl polypeptide, aPTK2B polypeptide, aSDCl polypeptide, aRERl polypeptide, aLRRl polypeptide, aLPCAT 1 polypeptide, aHMGCR polypeptide, aWRB polypeptide, aKLRCl polypeptide, aDNASElL3 polypeptide, aSLC12A7 polypeptide, aCFP polypeptide, aPCDHGA8 polypeptide, aNDUFA4L2 polypeptide, aLILRB5 polypeptide, aRAB37 polypeptide, aRFTN2 polypeptide, aTSPAN15 polypeptide, aC9orf24 polypeptide, aLSPl polypeptide, aPAH polypeptide, aCCDC69 polypeptide, aSLC26A7 polypeptide, aPIK3C2B polypeptide, aF0XD2 polypeptide, aVTN polypeptide, aTRDC polypeptide, aCHI3L2 polypeptide, aRALGAPA2 polypeptide, aSIGLEC16 polypeptide, aSERPINGl polypeptide, aXIRP2 polypeptide, aTMEM63B polypeptide, aSLC39All polypeptide, aTMEM138 polypeptide, aAGPAT5 polypeptide, aZNF540 polypeptide, aRNF145 polypeptide, aCNDP2 polypeptide, aRETSAT polypeptide, aINTS7 polypeptide, aMMP3 polypeptide, aADCY3 polypeptide, aCYB5A polypeptide, alGFNl polypeptide, aTMEM102 polypeptide, aSCN4B polypeptide, aPGD polypeptide, aPI16 polypeptide, aMME polypeptide, aTNIPl polypeptide, aGPR19 polypeptide, aPRADCl polypeptide, aRPS19BPl polypeptide, aACTN2 polypeptide, aCAGEl polypeptide, aRDH16 polypeptide, aH0XD13 polypeptide, aC0Q2 polypeptide, aDTX4 polypeptide, aDHX8 polypeptide, aAGT polypeptide, aCHST4 polypeptide, aCACNAlS polypeptide, aGPR39 polypeptide, aCIQB polypeptide, aZNF423 polypeptide, aKIAAOlOO polypeptide, aCLSTN3 polypeptide, aGRK5 polypeptide, aIRS4 polypeptide, aMGAT5 polypeptide, aRPL36AL polypeptide, aAQP3 polypeptide, aSILl polypeptide, aCD163Ll polypeptide, aPIK3R3 polypeptide, aGPLDl polypeptide, aHEXIMl polypeptide, aD0K2 polypeptide, aClorf74 polypeptide, aFBXL15 polypeptide, aGRID2IP polypeptide, aSNF8 polypeptide, aKLHL36 polypeptide, aH0XB2 polypeptide, aEDA polypeptide, aMAB21Ll polypeptide, aCYP2Rl polypeptide, aZFYVE19 polypeptide, aSMOCl polypeptide, aABCGl polypeptide, aCHURCl polypeptide, aSUSD4 polypeptide, aATP2A3 polypeptide, aTENMl polypeptide, aMRCl polypeptide, aGLP2R polypeptide, aMRPL52 polypeptide, aFSTL4 polypeptide, aPCDHHX polypeptide, aTRAPPC4 polypeptide, aTMIGD2 polypeptide, aKIAA0319 polypeptide, aFAM166B polypeptide, aSLC6A20 polypeptide, aPLA2G4E polypeptide, aClorfll6 polypeptide, aGLYAT polypeptide, aZG16 polypeptide, aFAM83 A polypeptide, aN0L3 polypeptide, aMGATl polypeptide, aPPEFl polypeptide, aDBI polypeptide, aC19orflO polypeptide, aALX4 polypeptide, aMYH7 polypeptide, aDHRS7 polypeptide, aDHRS2 polypeptide, aCKM polypeptide, aPTPN5 polypeptide, aGPR133 polypeptide, aGNLY polypeptide, a2 -Mar polypeptide, aFAM86A polypeptide, aADCY4 polypeptide, aCOX4I2 polypeptide, aMY018B polypeptide, aFCN3 polypeptide, aFCRL5 polypeptide, aHMCN2 polypeptide, aCOX6A2 polypeptide, aLRRC71 polypeptide, aKLKBl polypeptide, aAMN polypeptide, aSERPINB7 polypeptide, aGLYATLl polypeptide, aSCNNIB polypeptide, aOR4N2 polypeptide, aPPPlR14BP3 polypeptide, aMAP3K15 polypeptide, aNQOl polypeptide, aCXCR3 polypeptide, aZNF311 polypeptide, aSPRN polypeptide, aMCF2 polypeptide, aAC005702.1 polypeptide, aBCYRNl polypeptide, aCYPIBl-ASI polypeptide, aDNAJC5B polypeptide, aFCNl polypeptide, aHMGB3P22 polypeptide, aIGHV4-39 polypeptide, aKRT42P polypeptide, aLINC00310 polypeptide, aLINC00467 polypeptide, aMTIJP polypeptide, aPCDHB18 polypeptide, aPSMCIPl polypeptide, aRPS23P6 polypeptide, aSFTAlP polypeptide, aTCL6 polypeptide, and / or a VIPR2 polypeptide.
[0042] In some cases, the presence or absence of a mir34a-5p can be used to identify a mammal (e.g., a human) having cancer (e.g., mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer). A mir34a-5p can have any appropriate sequence. For example, a mir34a-5p can have a sequence set forth in mirBase accession no MIMAT0000255. For example, a mir34a-5p can comprise, consist essentially of, or consist of the nucleic acid sequence UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO:4). As used herein, a mir34a-5p “that consists essentially of’ SEQ ID NO:4 is a miRNA that has zero, one, or two nucleotide substitutions within SEQ ID NO:4, that has zero, one, two, three, four, or five nucleotides directly preceding SEQ ID NO:4, and / or that has zero, one, two, three, four, or five nucleotides directly following SEQ ID NO:4, provided that the miRNA maintains its basic ability to target and bind nucleic acid (e.g., a transcript) encoding a PD-L1 polypeptide and / or a GAT A3 polypeptide.
[0043] In some cases, the presence or absence of a mir-195-5p can be used to identify a mammal (e.g., a human) having cancer (e.g., mesothelioma) as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer). A mir-195-5p can have any appropriate sequence. For example, a mir-195-5p can have a sequence set forth in mirBase accession no MIMAT0000461. For example, a mir-195-5p can comprise, consist essentially of, or consist of the nucleic acid sequence UAGCAGCACAGAAAUAUUGGC (SEQ ID NO:5). As used herein, a mir-195-5p “that consists essentially of’ SEQ ID NO:5 is a miRNA that has zero, one, or two nucleotide substitutions within SEQ ID NO: 5, that has zero, one, two, three, four, or five nucleotides directly preceding SEQ ID NO: 5, and / or that has zero, one, two, three, four, or five nucleotides directly following SEQ ID NO: 5, provided that the miRNA maintains its basic ability to target and bind nucleic acid (e.g., a transcript) encoding a PD-L1 polypeptide.
[0044] Any appropriate method can be used to determine the presence, absence, or level of a ncRNA described herein. Exemplary methods that can be used to determine the presence, absence, or level a ncRNA described herein in a sample (e.g., a sample containing one or more cancer cells) include, without limitation, polymerase chain reaction (PCR) techniques and sequencing techniques.
[0045] As described herein, the presence of one or more ncRNAs in a cancer (e.g., mesothelioma) can be used to identify the cancer as being likely to respond to one or more immune checkpoint inhibitors. In some cases, the presence of one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be used to identify the cancer as being likely to respond to one or more immune checkpoint inhibitors. For example, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be identified as being likely to respond to one or more immune checkpoint inhibitors.
[0046] In some cases, the absence of one or more ncRNAs in a cancer can be used to identify a cancer (e.g., mesothelioma) as not being likely to respond to one or more immune checkpoint inhibitors. For example, the absence of each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be used to identify the cancer as being unlikely to respond to one or more immune checkpoint inhibitors. In some cases, a mammal (e.g., a human) having a cancer that is identified as lacking each of mir-888-5p, mir- 892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be identified as not being likely to respond to one or more immune checkpoint inhibitors.
[0047] In some cases, a mammal (e.g., a human) having a cancer (e.g., mesothelioma) that is identified as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence of one or more ncRNAs in the cancer) can be selected to receive one or more (e.g., one, two, three, or more) immune checkpoint inhibitors to treat the cancer. For example, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir- 195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be selected to receive one or more immune checkpoint inhibitors.
[0048] In some cases, a mammal (e.g., a human) having a cancer that is identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the absence of one or more ncRNAs in the cancer) can be selected to receive an alternative cancer treatment (e.g., one or more cancer treatments that do not include an immune checkpoint inhibitor) to treat the cancer. For example, a mammal having a cancer that is identified as lacking each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be selected to receive an alternative cancer treatment (e.g., one or more cancer treatments that do not include any immune checkpoint inhibitors).
[0049] This document also provides methods and materials for treating a mammal (e.g., a human) having cancer (e.g., mesothelioma). In some cases, a mammal (e.g., a human) having cancer (e.g., mesothelioma) and assessed as described herein (e.g., to determine whether or not the cancer is likely to respond to one or more immune checkpoint inhibitors based, at least in part, on the presence or absence of one or more ncRNAs in the cancer) can be administered or instructed to self-administer one or more (e.g., one, two, three, or more) cancer treatments, where the one or more cancer treatments are effective to treat the cancer within the mammal. For example, a mammal having cancer can be administered or instructed to self-administer one or more cancer treatments selected based, at least in part, on whether or not the cancer is likely to respond to one or more immune checkpoint inhibitors (e.g., based, at least in part, on the presence or absence of one or more ncRNAs in the cancer).
[0050] When treating a mammal (e.g., a human) having a cancer (e.g., mesothelioma) that is identified as being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the presence of one or more ncRNAs in the cancer), the mammal can be administered or instructed to self-administer one or more immune checkpoint inhibitors. For example, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be administered or instructed to self-administer one or more (e.g., one, two, three, or more) immune checkpoint inhibitors. In some cases, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be administered or instructed to self-administer a single immune checkpoint inhibitor. In some cases, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be administered or instructed to self- administer two immune checkpoint inhibitors. In some cases, a mammal having cancer and identified as having one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir- 195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from the mammal can be administered or instructed to self-administer three immune checkpoint inhibitors.
[0051] An immune checkpoint inhibitor that can be administered to a mammal (e.g., a human) having cancer (e.g., mesothelioma) and identified has being likely to respond to one or more immune checkpoint inhibitors as described herein can be any appropriate immune checkpoint inhibitor. An immune checkpoint inhibitor can inhibit one or more polypeptides involved in an immune checkpoint pathway. Examples of immune checkpoint pathways include, without limitation, PD-1 / PD-L1 pathways, PD-1 / PD-L2 pathways, CTLA-4 pathways, TRAIL pathways, LAG-3 pathways, TIM-3 pathways, and VISTA pathways. An immune checkpoint inhibitor can inhibit any polypeptide involved in an immune checkpoint pathway. Examples of polypeptides involved in an immune checkpoint pathway that can be inhibited by an immune checkpoint inhibitor as described herein include, without limitation, PD-1 polypeptides, PD-L1 polypeptides, CTLA4 polypeptides, LAG-3 polypeptides, TIM-3 polypeptides, and VISTA polypeptides.
[0052] An immune checkpoint inhibitor can inhibit polypeptide activity of a polypeptide involved in an immune checkpoint pathway or can inhibit polypeptide expression of a polypeptide involved in an immune checkpoint pathway. Examples of compounds that can inhibit polypeptide activity of a polypeptide involved in an immune checkpoint pathway include, without limitation, antibodies (e.g., neutralizing antibodies) that target (e.g., target and bind) to a polypeptide involved in an immune checkpoint pathway and small molecules that target (e.g., target and bind) to a polypeptide involved in an immune checkpoint pathway. Examples of compounds that can inhibit polypeptide expression of a polypeptide involved in an immune checkpoint pathway include, without limitation, nucleic acid molecules designed to induce RNA interference of polypeptide expression of a polypeptide involved in an immune checkpoint pathway (e.g., a siRNA molecule or a shRNA molecule), antisense molecules that can target (e.g., are complementary to) nucleic acid encoding a polypeptide involved in an immune checkpoint pathway, and miRNAs that can target (e.g., are complementary to) nucleic acid encoding a polypeptide involved in an immune checkpoint pathway. In some cases, an immune checkpoint inhibitor can be an anti-PD-1 antibody. In some cases, an immune checkpoint inhibitor can be an anti-PD-Ll antibody. In some cases, an immune checkpoint inhibitor can be an anti-CTL4A antibody. In some cases, an immune checkpoint inhibitor can be an anti-LAG-3 antibody. In some cases, an immune checkpoint inhibitor can be an anti-TIM-3 antibody. In some cases, an immune checkpoint inhibitor can be an anti-VISTA antibody. Examples of immune checkpoint inhibitors that can be administered to mammal (e.g., a human) having cancer and identified as being likely to respond to one or more immune checkpoint inhibitors as described herein include, without limitation, nivolumab (e.g., OPDIVO®), ipilimumab (e.g., YERVOY®), pembrolizumab (e.g., KEYTRUDA®), atezolizumab (e.g., TECENTRIQ®), durvalumab, cemiplimab, and avelumab. In some cases, an immune checkpoint inhibitor can be as described elsewhere (see, e.g., Zhang etal., Anal. Chew., 92(13): 9086-9094 (2020) at, for example, Figure 5).
[0053] When treating a mammal (e.g., a human) having a cancer (e.g., mesothelioma) that is identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein (e.g., based, at least in part, on the absence of one or more ncRNAs in the cancer), the mammal can be administered or instructed to self-administer one or more (e.g., one, two, three, four, five, or more) alternative cancer treatments (e.g., one or more cancer treatments that do not include any immune checkpoint inhibitor). For example, a mammal having cancer and identified as lacking each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p in a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be administered or instructed to selfadminister one or more alternative cancer treatments (e.g., one or more cancer treatments that do not include any immune checkpoint inhibitor).
[0054] In some cases, one or more (e.g., one, two, three, four, five, or more) alternative cancer treatments (e.g., one or more cancer treatments that do not include any immune checkpoint inhibitor) can include administering to the mammal one or more (e g., one, two, three, or more) alternative anti-cancer agents used to treat cancer and / or performing one or more (e.g., one, two, three, or more) therapies used to treat cancer. For example, an alternative anti-cancer agent that can be used to treat a mammal (e.g., a human) having cancer and identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein can be a chemotherapeutic agent. For example, an alternative anti -cancer agent that can be used to treat a mammal (e.g., a human) having cancer (e.g., mesothelioma) and identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein can be a cytotoxic agent. For example, an alternative anti-cancer agent that can be used to treat a mammal (e.g., a human) having cancer (e g., mesothelioma) and identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein can be an angiogenesis inhibitor. Examples of anti-cancer agents that can be administered to a mammal (e g., a human) having cancer (e.g., mesothelioma) and identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein to treat the mammal include, without limitation, sorafenib, regorafenib, ramucirumab, carboplatin, pemetrexed, gemcitabine, vinorelbine, and any combinations thereof. Examples of therapies that can be used to treat a mammal (e.g., a human) having cancer (e.g., mesothelioma) and identified as not being likely to respond to one or more immune checkpoint inhibitors as described herein include, without limitation, radiation therapies, surgeries (e.g., to remove one or more tumors), and / or ablation therapies (e.g., to remove one or more tumors).
[0055] When treating a mammal (e.g., a human) having a cancer (e.g., mesothelioma) as described herein, the mammal can be administered or instructed to self-administer one or more one or more (e.g., one, two, three, or more) ncRNAs described herein (e.g., one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p). In some cases, one or more ncRNAs described herein can be administered together with one or more delivery vehicles. For example, a mammal having cancer can be administered one or more liposome encapsulated ncRNAs. In some cases, one or more ncRNAs described herein can be administered together with one or more targeting moieties. For example, a mammal having cancer can be administered one or more ncRNAs that are each conjugated to an antibody (e.g., a single-chain variable fragment (scFv) antibody) such as an antibody that can target a HMMR polypeptide.
[0056] One or more ncRNAs described herein (e.g., one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p) can be administered to a mammal (e.g., a human) having cancer (e.g., mesothelioma) in any appropriate amount (e.g., any appropriate dose). In some cases, an effective dose of one or more ncRNAs can be a flat dose. In some cases, as effective dose of one or more ncRNAs can be based on the body of a mammal (e.g., a human) to be treated as described herein. An effective amount of one or more ncRNAs can be any amount that can treat a mammal having cancer without producing significant toxicity to the mammal. The effective amount of one or more immune checkpoint inhibitors can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and / or severity of the cancer in the mammal being treated may require an increase or decrease in the actual effective amount administered.
[0057] In some cases, when treating a mammal (e.g., a human) having cancer (e.g., mesothelioma) as described herein, the treatment can be effective to treat the cancer. For example, the number of cancer cells present within a mammal can be reduced using the methods and materials described herein. In another example, the size (e.g., volume) of one or more tumors present within a mammal can be reduced using the methods and materials described herein. In some cases, the methods and materials described herein can be used to reduce the size of one or more tumors present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the methods and materials described herein can be used to treat cancer in a manner such that the size (e.g., volume) of one or more tumors present within a mammal does not increase.
[0058] In some cases, when treating a mammal (e.g., a human) having cancer (e.g., mesothelioma) as described herein, the treatment can be effective to improve survival of the mammal. For example, the methods and materials described herein can be used to improve disease-free survival (e.g., relapse-free survival). For example, the methods and materials described herein can be used to improve progression-free survival. For example, the methods and materials described herein can be used to improve the survival of a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the methods and materials described herein can be used to improve the survival of a mammal having cancer by, for example, at least 6 months (e.g., about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, or about 3 years).
[0059] One or more immune checkpoint inhibitors can be administered to a mammal (e.g., a human) having cancer (e.g., mesothelioma) in any appropriate amount (e.g., any appropriate dose). In some cases, an effective dose of one or more immune checkpoint inhibitors can be a flat dose. In some cases, as effective dose of one or more immune checkpoint inhibitors can be based on the body of a mammal (e.g., a human) to be treated as described herein. An effective amount of one or more immune checkpoint inhibitors can be any amount that can treat a mammal having cancer without producing significant toxicity to the mammal. In cases where one or more immune checkpoint inhibitors includes nivolumab, an effective amount of nivolumab can be about 3 mg / kg per day. In cases where one or more immune checkpoint inhibitors includes nivolumab, an effective amount of nivolumab can be from about 240 mg to about 480 mg (e.g., from about 240 mg to about 420 mg, from about 240 mg to about 360 mg, from about 240 mg to about 290 mg, from about 290 mg to about 480 mg, from about 360 mg to about 480 mg, from about 420 mg to about 480 mg, from about 290 mg to about 420 mg, from about 290 mg to about 360 mg, or from about 360 mg to about 420 mg) per day. In cases where one or more immune checkpoint inhibitors includes ipilimumab, an effective amount of ipilimumab can be from about 1 mg / kg to about 10 mg / kg (e.g., from about 1 to about 8 mg / kg, from about 1 to about 6 mg / kg, from about 1 to about 5 mg / kg, from about 1 to about 4 mg / kg, from about 1 to about 3 mg / kg, from about 1 to about 2 mg / kg, from about 3 to about 10 mg / kg, from about 5 to about 10 mg / kg, from about 6 to about 10 mg / kg, from about 7 to about 10 mg / kg, from about 8 to about 10 mg / kg, from about 9 to about 10 mg / kg, from about 2 to about 8 mg / kg, from about 3 to about 7 mg / kg, from about 4 to about 6 mg / kg, from about 2 to about 4 mg / kg, from about 3 to about 5 mg / kg, from about 5 to about 7 mg / kg, from about 6 to about 8 mg / kg, or from about 7 to about 9 mg / kg) per day. The effective amount of one or more immune checkpoint inhibitors can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and / or severity of the cancer in the mammal being treated may require an increase or decrease in the actual effective amount administered.
[0060] One or more immune checkpoint inhibitors can be administered to a mammal (e.g., a human) having cancer (e.g., mesothelioma) at any appropriate frequency. The frequency of administration can be any frequency that can treat a mammal having cancer without producing significant toxicity to the mammal. For example, the frequency of administration can be about once every 2 weeks, once every 3 weeks, once every 4 weeks, or once every 6 weeks. The frequency of administration can remain constant or can be variable during the duration of treatment. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple treatment agents, and / or route of administration may require an increase or decrease in administration frequency.
[0061] One or more immune checkpoint inhibitors can be administered to a mammal (e.g., a human) having cancer (e.g., mesothelioma) for any appropriate duration. An effective duration can be any duration that can treat a mammal having cancer without producing significant toxicity to the mammal. For example, the effective duration can vary from several weeks to several months, from several months to several years, or from several years to a lifetime. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, and / or route of administration.
[0062] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
[0063] EXAMPLES
[0064] Example 1: ncRNA in ICI-responsive mesothelioma
[0065] This Example describes the identification of ncRNAs that can be used to predict patient response to treatment with one or more ICIs.
[0066] An integrated RNA and miRNA analysis was used to determine how RNA species influence biology and response to treatment with one or more ICIs. Particular miRNAs and ceRNAs that were altered in mesothelioma patients that responded to treatment with one or more ICIs and experienced improved survival were identified.
[0067] Materials and Methods
[0068] Patient samples
[0069] Pleural biopsies were obtained from patients with mesothelioma (n = 44) who received at least one line of therapy with a platinum agent and pemetrexed. Biopsies were obtained before treatment with nivolumab alone (NCT29908324) or before treatment with nivolumab in combination with ipilimumab (NCT30660511) from the NivoMes and INITIATE clinical trials respectively. The biopsies were processed for RNA and miRNA sequencing. An overall survival (OS) cutoff of 1.5 years was used to distinguish patients with (n=20) and without (n=24) durable benefit.
[0070] Gene set analysis (GSA)
[0071] All data analyses were performed in R. The edgeR package was used to perform expression data normalization (by cpm function) and differential expression (by glmQLFTest function) between patients with and without durable benefit in the RNA and miRNA data. Reported miRNA differential expressions were based on a false discovery rate (FDR) of 0.05. GSA was done using a model-based GSA (mGSA) package. Targets of underexpressed miRNA (p < 0.05) and over-expressed genes (p < 0.05) were analyzed by “mgsa” function using Gene Ontology Molecular Functions (GOMF) and Biological Processes (GOBP) databases and the most significant gene sets were reported. ceRNA calculations
[0072] Expression count summary files for gene and miRNA expression in TCGA were downloaded from NCI CDC portal and processed by the edgeR package to obtain normalized expression data. To determine competing endogenous RNA (ceRNA) networks, the SPONGE package was used (see, for example, List et al., Bioinformatics, 15;35(14):i596- i604 (2019)). A miRNA gene target matrix was created by integration of four experimentally and computationally generated matrices including miRcode, miRbase, and mirTarBase in the SPONGE package and the Tarbase package (see, for example, Sethupathy et al., RNA, 12(2): 192-7 (2006)). Interactions between genes and miRNA were estimated using “sponge_gene_miRNA_interaction_filter”. These interactions were then input to the “sponge” function to determine ceRNA interactions. Null distributions were calculated at 10' 7 resolution and used in “sponge_compute_p_values” along with ceRNA interactions to determine the statistical significance of interactions including FDR and to identify the most significant ceRNA networks. To validate ceRNA networks, a similar procedure was used to determine significant networks. Interactions by LOX2 were validated at p<0.05.
[0073] Results
[0074] Two datasets with paired RNA and miRNA were used, including the TCGA mesothelioma cohort (n=86) and a cohort of mesothelioma patients (n=44) described in the Materials and Methods section (e.g., mesothelioma patients treated with nivolumab alone (NivoMes, NCT02497508) or treated with nivolumab and ipilimumab (INITIATE, NCT03048474)). The majority of patients in both cohorts had epithelioid disease.
[0075] Three miRNAs were associated with mesothelioma response to ICI, including mir- 888-5p (FDR=0.0006), mir-892a (FDR=0.0006), and mir204-5p (FDR=0.038) (Table 1).
[0076] Table 1. Identified miRNAs associated with response to ICI.
[0077] In further analyses, a network of ceRNAs was identified in mesothelioma patients based on the TCGA cohort that revealed interconnections between LOXL2, ITGA5, CALU, and MYBL2 hub genes (Figure 1). LOXL2 included the most extensive ceRNA network of which more than 20 of the ceRNAs were validated in the NivoMes and INITIATE cohorts. LOXL2 interactions were also validated in the Dutch samples (see below gene intersections).
[0078] To identify gene sets that were coordinately regulated by RNA and miRNA, overexpressed genes and validated targets of down-regulated miRNA were grouped. Groups were used to perform GSA using a Bayesian modeling approach. The top gene set identified using GOMF was "Antigen Binding." In further analyses in Biological Processes (GOBP) datasets, additional immune related gene sets related to humoral immune response were identified that were over-expressed in mesothelioma patients with response to ICI including immunoglobulin production, oxygen transport, humoral immune response mediated by circulating immunoglobulins, ethanol metabolic processes, peptide cross-linking, cellular pH responses, and complement activation.
[0079] Taken together, these results demonstrate that the presence or absence of one or more ncRNAs (e.g., miRNAs and ceRNAs) in cancer cells of a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be used to identify that mammal as being likely to respond to one or more immune checkpoint inhibitors. For example, the presence of one or more of mir- 888-5p, mir-892a, and mir204-5p in cancer cells of a mammal (e.g., a human) having cancer (e.g., mesothelioma) can be used to identify that mammal as being likely to respond to one or more immune checkpoint inhibitors.
[0080] Example 2: mir204-5p and survival mir204-5p was identified as having altered levels in mesothelioma patients that responded to treatment with one or more ICIs and experienced improved survival was described in Example 1.
[0081] A reduced level of mir204-5p following immunotherapy (e.g., as compared a level of miR-204 prior to immunotherapy) was associated with poor survival (Figure 2). Example 3: mir34a-5p and mir-195-5p in mesothelioma
[0082] To identify new treatments, the expression of genes encoding cancer-specific plasma membrane proteins known as the cancer surfaceome in mesothelioma public data was examined and hyaluronan mediated motility receptor (HMMR) was identified a promising candidate. HMMR plays key roles in tumor both as an intra- and extra-cellular protein. The extracellular HMMR forms complex with another hyaluronic acid (HA) receptor CD44 and a protein tyrosine kinase (PTK) on the plasma membrane to activate MAPK / ERK pathway which promotes proliferation and invasion of tumor cells. On the other hand, intracellular HMMR interacts directly with ERK1 and acts as MAPK / ERK scaffold through which it regulates proliferation and migration. Thus, both intra-and extra-cellular HMMR appear to tandemly coordinate cell motility and proliferation in response to the environmental clues (Telmer et al., Commun. Iniegr. Biol., 4(2): 182-5 (2011)).
[0083] HMMR was highly over-expressed in mesothelioma compared to non-neoplastic pleura according to GSE51024 (Figure 3A) and GSE51024 and GSE2549 datasets. Additionally, HMMR expression was robust in epithelioid, biphasic, and sarcomatoid subtypes (Figure 3B). Expression of HMMR was significantly associated with poor overall survival the TCGA cohort (Figure 3C) and in the Bueno et al. (Bueno et al., Nat. Genet., 48(4):407-16 (2016)) dataset8(p = 10'?), suggesting that HMMR plays a significant role in aggressive behavior of mesothelioma.
[0084] Bioinformatics investigations in HMMR roles in mesothelioma. Contributions of HMMR in mesothelioma and its tumor microenvironment (TME) were examined by in silica analysis of public data. High (top 2 / 3) and low (bottom 1 / 3) HMMR expressing tumors were compared by gene set analyses (GSA) in a cancer Hallmark dataset. This analysis identified enrichments of four cell cycle related gene sets (Table 2). These gene sets were not only consistent with the roles of HMMR in other cancers but were also remarkably consistent with processes that are essential for oncogenesis and development of mesotheliomas (Cakiroglu et al, Int. J. Mol. Sei., 21: 17 (2020)), suggesting that blocking HMMR signaling can provide an effective therapy in mesothelioma. To find potential HMMR roles in TME, tumors with high and low HMMR were bioinformatically compared by immune deconvolution. As shown in Figures 3D-3E in both TCGA and Bueno datasets highly significant enrichments of type 2 helper T cells (Th2) were identified in tumors with high HMMR expression (p = IO’10in both sets). Expression of GATA3, which is the master regulator of Th2 differentiation, was examined through the control and secretion of IL-5, IL-13, and particularly IL-4. GATA3 was significantly elevated in high versus low HMMR expressing tumors in TCGA (Figure 3F) and Bueno data (p=0.0058, data not show). Also, there were significant correlations between HMMR and GAT A3 in TCGA (p=0.016) and Bueno (p=0.005) tumors (data not shown).
[0085] A specific micro-RNA (miRNA) that can target both HMMR and GATA3 could be used to investigate a link between HMMR and GATA3 and by extension Th2 polarization of helper T cells in mesotheliomas.
[0086] Table 2: Significant gene sets in Hi versus Lo HMMR TCGA tumors in Cancer Hallmark dataset. p-value q-value G2 / M Checkpoint 00001 00025
[0087] E2F Targets 0.0001 0.0025
[0088] MTORC1 Signaling 0.0023 0.038
[0089] Mitotic Spindle 0.0035 0.044
[0090] Impact of an HMMR network of competing endogenous RNA (ceRNA). To determine potential mechanisms through which HMMR is regulated, it was examined if HMMR participated in a ceRNA network. Transcripts in a ceRNA network are targeted by a common set of miRNAs and are thus coordinately regulated either up or down because they compete for binding to the same pool of miRNAs. SPONGE computational analysis tool was used and was paired miRNA / RNA TCGA data to identify significant ceRNA interactions (p < 0.05). This analysis used both experimental (miRTarBase) and computational (TargetScan and miRcode) databases to confirm targeting of mRNA by miRNA, and furthermore, was limited only to mRNA / miRNA pairs with evidence for significant reverse correlations in the TCGA data. 10 genes were identified which were targeted by miR-34a-5p, miR-195-5p, or both and have key roles in pathways that are crucial to mesothelioma including cell cycle or chemoresistance or both (Figure 4A). Genes in this network were highly correlated with each other. A notable example was the apoptosis inhibitor BIRC5 which plays an important role in mesothelioma treatment resistance and was very highly correlated with HMMR in TCGA (p < IO'15, data not shown) and Bueno (Figure 4B) datasets. A Bayesian based computational tool was used to find cancer hallmarks enriched by targets of these two miRNAs. The top 2 gene sets by both miRNAs were consistent with HMMR related hallmarks in Table 2, suggesting that these miRNAs effectively target HMMR functions (Table 3). Moreover, within these gene sets, there was considerable non-overlap (-50%) between genes that were targeted by these two miRNAs (data not shown), suggesting that these miRNAs act synergistically. Importantly, low expression of miR-34a-5p and miR-195-5p were significantly (p = 0.017) and marginally (p = 0.068) associated with reduced survival in mesothelioma (Figures 4C-4D).
[0091] Contributions of the two miRNAs to TME. Both miR-34a-5p and miR-195-5p have been reported for having roles in transforming an immunosuppressive TME to pro- inflammatory microenvironment and inhibiting the expression of PD-L1 (Shadbad et al., Genes (Basel), 12(8) (2021); He et al., Cell. Biol, Ini., 2023;47(9): 1519-34 (2023); Yin et al., Cancer Med., 12(10): 11602-10 (2023); Zhou et al., J. Cell. Physiol., 234(12):23176-89 (2019); and Liu et al., ImmunopharmacoL Immunotoxicol., 43(4):443-51 (2021)). PD-L1 was also identified as a miR-34a-5p target in TCGA data. Another target of miR-34a-5p was GAT A3. This finding may at least partly explain GAT A3 correlations with HMMR.
[0092] Table 3: Cancer Hallmark gene set enrichments in (A) miR-34a-5p and (B) mir-195-5p target genes. length hits cpaiue
[0093] G2 / M Checkpoint 200 57 3E-O5
[0094] E2F Targets 200 51 3E-O5
[0095] Apical Surface 44 7 0.004
[0096] Angiogenesis 35 4 0.036 length hits Rvalue
[0097] G2 / M Checkpoint 200 40 7E-04
[0098] E2F Targets 200 44 7E-04 Together, these results demonstrate that a reduced level of mir34a-5p and / or mir-195- 5p in a cell obtained from a mammal (e.g., a human) having mesothelioma (e.g., as compared to patients with durable benefit with ICIs) can be used to identify that mammal as being likely to have a poor outcome (e.g., having poor survival and / or having poor response to therapy such as treatment with one or more ICIs). These results also demonstrate that mir34a-5p and / or mir-195-5p can be administered to a mammal (e.g., a human) having mesothelioma to treat that mammal (e.g., by improving the outcome of the mammal).
[0099] Example 4: Assessing cancer for responsiveness to treatment with one or more ICIs
[0100] A tissue sample containing one or more cancer cells is obtained from a human having cancer (e g., mesothelioma). The obtained sample is examined for the presence or absence of one or more ncRNAs in the cancer.
[0101] If the sample includes one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p, then the cancer is classified as being responsive to one or more immune checkpoint inhibitors.
[0102] If the sample lacks each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir- 195-5p, then the cancer is classified as not being responsive to one or more immune checkpoint inhibitors.
[0103] Example 5: Treating cancer
[0104] A tissue sample containing one or more cancer cells is obtained from a human having cancer (e.g., mesothelioma). The obtained sample is examined for the presence or absence of one or more ncRNAs in the cancer.
[0105] If the sample includes one or more of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir-195-5p then the human is administered or instructed to self-administer one or more (e.g., one, two, three, four, five, or more) immune checkpoint inhibitors. Once administered to the human, the one or more immune checkpoint inhibitors can reduce the number of cancer cells present in the human. Example 6: Treating cancer
[0106] A tissue sample containing one or more cancer cells is obtained from a human having cancer (e.g., mesothelioma). The obtained sample is examined for the presence or absence of one or more ncRNAs in the cancer.
[0107] If the sample lacks each of mir-888-5p, mir-892a, mir204-5p, mir34a-5p, and mir- 195-5p, then the human is administered one or more (e.g., one, two, three, four, five, or more) alternative cancer treatments (e.g., one or more cancer treatments that do not include any immune checkpoint inhibitors). The alternative cancer treatment can reduce the number of cancer cells present in the human.
[0108] Example 7: Exemplary Embodiments
[0109] Embodiment 1. A method for assessing a mammal having cancer, wherein said method comprises:
[0110] (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and
[0111] (b) classifying said cancer as being likely to respond to an immune checkpoint inhibitor.
[0112] Embodiment 2. The method of embodiment 1, wherein said mammal is a human.
[0113] Embodiment 3. The method of any one of embodiments 1-2, wherein said method comprises determining the presence of said mir-888-5p.
[0114] Embodiment 4. The method of any one of embodiments 1-2, wherein said method comprises determining the presence of said mir-892a.
[0115] Embodiment 5. The method of any one of embodiments 1-2, wherein said method comprises determining the presence of said mir204-5p. Embodiment 6. The method of any one of embodiments 1-2, wherein said method comprises determining the presence of each of said mir-888-5p, mir-892a, and mir204-5p.
[0116] Embodiment 7. The method of any one of embodiments 1-6, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
[0117] Embodiment 8. The method of any one of embodiments 1-6, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
[0118] Embodiment 9. The method of any one of embodiments 1-8, wherein said cancer is a mesothelioma.
[0119] Embodiment 10. The method of embodiment 9, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0120] Embodiment 11. A method for assessing a mammal having cancer, wherein said method comprises:
[0121] (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and
[0122] (b) classifying said cancer as not being likely to respond to an immune checkpoint inhibitor.
[0123] Embodiment 12. The method of embodiment 16, wherein said mammal is a human.
[0124] Embodiment 13. The method of any one of embodiments 11-12, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
[0125] Embodiment 14. The method of any one of embodiments 11-12 wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
[0126] Embodiment 15. The method of any one of embodiments 11 -14, wherein said cancer is a mesothelioma.
[0127] Embodiment 16. The method of embodiment 15, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0128] Embodiment 17. A method for selecting a treatment for a mammal having cancer, wherein said method comprises:
[0129] (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and
[0130] (b) selecting an immune checkpoint inhibitor as a treatment for said cancer.
[0131] Embodiment 18. The method of embodiment 17, wherein said mammal is a human.
[0132] Embodiment 19. The method of any one of embodiments 17-18, wherein said method comprises determining the presence of said mir-888-5p.
[0133] Embodiment 20. The method of any one of embodiments 17-18, wherein said method comprises determining the presence of said mir-892a.
[0134] Embodiment 21. The method of any one of embodiments 17-18, wherein said method comprises determining the presence of said mir204-5p. Embodiment 22. The method of any one of embodiments 17-18, wherein said method comprises determining the presence of each of said mir-888-5p, mir-892a, and mir204-5p.
[0135] Embodiment 23. The method of any one of embodiments 17-22, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
[0136] Embodiment 24. The method of any one of embodiments 17-22 wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
[0137] Embodiment 25. The method of any one of embodiments 17-24, wherein said cancer is a mesothelioma.
[0138] Embodiment 26. The method of embodiment 25, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0139] Embodiment 27. A method for selecting a treatment for a mammal having cancer, wherein said method comprises:
[0140] (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and
[0141] (b) selecting a cancer treatment other than an immune checkpoint inhibitor as a treatment for said cancer.
[0142] Embodiment 28. The method of embodiment 27, wherein said mammal is a human. Embodiment 29. The method of any one of embodiments 27-28, wherein said cancer treatment comprises performing surgery.
[0143] Embodiment 30. The method of any one of embodiments 27-28, wherein said cancer treatment comprises radiation therapy.
[0144] Embodiment 31. The method of any one of embodiments 27-28, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
[0145] Embodiment 32. The method of any one of embodiments 27-31, wherein said cancer is a mesothelioma.
[0146] Embodiment 33. The method of embodiment 32, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0147] Embodiment 34. A method for treating for a mammal having cancer, wherein said method comprises:
[0148] (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and
[0149] (b) administering an immune checkpoint inhibitor to said mammal.
[0150] Embodiment 35. The method of embodiment 34, wherein said mammal is a human.
[0151] Embodiment 36. The method of any one of embodiments 34-35, wherein said method comprises determining the presence of said mir-888-5p.
[0152] Embodiment 37. The method of any one of embodiments 34-35, wherein said method comprises determining the presence of said mir-892a. Embodiment 38. The method of any one of embodiments 34-35, wherein said method comprises determining the presence of said mir204-5p.
[0153] Embodiment 39. The method of any one of embodiments 34-35, wherein said method comprises determining the presence of each of said mir-888-5p, mir-892a, and mir204-5p.
[0154] Embodiment 40. The method of any one of embodiments 34-39, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
[0155] Embodiment 41. The method of any one of embodiments 34-39, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
[0156] Embodiment 42. The method of any one of embodiments 34-41, wherein said cancer is a mesothelioma.
[0157] Embodiment 43. The method of embodiment 42, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0158] Embodiment 44. A method for treating cancer, wherein said method comprises administering an immune checkpoint inhibitor to a mammal identified as having cancer cells comprising the presence of one or more of mir-888-5p, mir-892a, and mir204-5p, thereby treating cancer within said mammal.
[0159] Embodiment 45. The method of embodiment 44, wherein said mammal is a human. Embodiment 46. The method of any one of embodiments 44-45, wherein said cancer cells comprise the presence of said mir-888-5p.
[0160] Embodiment 47. The method of any one of embodiments 44-45, wherein said cancer cells comprise the presence of said mir-892a.
[0161] Embodiment 48. The method of any one of embodiments 44-45, wherein said cancer cells comprise the presence of said mir204-5p.
[0162] Embodiment 49. The method of any one of embodiments 44-45, wherein said cancer cells comprise the presence of each of said mir-888-5p, mir-892a, and mir204-5p.
[0163] Embodiment 50. The method of any one of embodiments 44-49, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti -VISTA antibody.
[0164] Embodiment 51. The method of any one of embodiments 44-49, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
[0165] Embodiment 52. The method of any one of embodiments 44-51, wherein said cancer is a mesothelioma.
[0166] Embodiment 53. The method of embodiment 52, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0167] Embodiment 54. A method for treating a mammal having cancer, wherein said method comprises: (a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and
[0168] (b) administering a cancer treatment to said mammal, wherein said cancer treatment is not an immune checkpoint inhibitor.
[0169] Embodiment 55. The method of embodiment 54, wherein said mammal is a human.
[0170] Embodiment 56. The method of any one of embodiments 54-55, wherein said cancer treatment comprises performing surgery.
[0171] Embodiment 57. The method of any one of embodiments 54-55, wherein said cancer treatment comprises radiation therapy.
[0172] Embodiment 58. The method of any one of embodiments 54-55, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
[0173] Embodiment 59. The method of any one of embodiments 54-58, wherein said cancer is a mesothelioma. Embodiment 60. The method of embodiment 59, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0174] Embodiment 61. A method for treating cancer, wherein said method comprises administering a cancer treatment that is not an immune checkpoint inhibitor to a mammal identified as having cancer cells comprising the absence of each of mir-888-5p, mir-892a, and mir204-5p.
[0175] Embodiment 62. The method of embodiment 61, wherein said mammal is a human. Embodiment 63. The method of any one of embodiments 61-62, wherein said cancer treatment comprises performing surgery.
[0176] Embodiment 64. The method of any one of embodiments 61-62, wherein said cancer treatment comprises radiation therapy.
[0177] Embodiment 65. The method of any one of embodiments 61 -62, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
[0178] Embodiment 66. The method of any one of embodiments 61-65, wherein said cancer is a mesothelioma.
[0179] Embodiment 67. The method of embodiment 66, wherein said mesothelioma is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, and testicular mesothelioma.
[0180] OTHER EMBODIMENTS
[0181] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
WHAT IS CLAIMED IS:
1. A method for assessing a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and(b) classifying said cancer as being likely to respond to an immune checkpoint inhibitor.
2. The method of claim 1, wherein said mammal is a human.
3. The method of any one of claims 1-2, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
4. The method of any one of claims 1-2, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
5. The method of any one of claims 1-2, wherein said cancer is a mesothelioma.
6. A method for assessing a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and(b) classifying said cancer as not being likely to respond to an immune checkpoint inhibitor.
7. The method of claim 6, wherein said mammal is a human.
8. The method of any one of claims 6-7, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
9. The method of any one of claims 6-7 wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
10. The method of any one of claims 6-7, wherein said cancer is a mesothelioma.
11. A method for selecting a treatment for a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and(b) selecting an immune checkpoint inhibitor as a treatment for said cancer.
12. The method of claim 11, wherein said mammal is a human.
13. The method of any one of claims 11-12, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
14. The method of any one of claims 11-12 wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
15. The method of any one of claims 11-12, wherein said cancer is a mesothelioma.
16. A method for selecting a treatment for a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and(b) selecting a cancer treatment other than an immune checkpoint inhibitor as a treatment for said cancer.
17. The method of claim 16, wherein said mammal is a human.
18. The method of any one of claims 16-17, wherein said cancer treatment comprises surgery and / or radiation therapy.
19. The method of any one of claims 16-17, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
20. The method of any one of claims 16-17, wherein said cancer is a mesothelioma.
21. A method for treating for a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the presence of one or more of mir-888-5p, mir-892a, and mir204-5p; and(b) administering an immune checkpoint inhibitor to said mammal.
22. The method of claim 21, wherein said mammal is a human.
23. The method of any one of claims 21-22, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
24. The method of any one of claims 21-22, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
25. The method of any one of claims 21-22, wherein said cancer is a mesothelioma.
26. A method for treating cancer, wherein said method comprises administering an immune checkpoint inhibitor to a mammal identified as having cancer cells comprising the presence of one or more of mir-888-5p, mir-892a, and mir204-5p, thereby treating cancer within said mammal.
27. The method of claim 26, wherein said mammal is a human.
28. The method of any one of claims 26-27, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
29. The method of any one of claims 26-27, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
30. The method of any one of claims 26-27, wherein said cancer is a mesothelioma.
31. A method for treating a mammal having cancer, wherein said method comprises:(a) determining that a sample obtained from said mammal and comprising cancer cells comprises the absence of each of mir-888-5p, mir-892a, and mir204-5p; and(b) administering a cancer treatment to said mammal, wherein said cancer treatment is not an immune checkpoint inhibitor.
32. The method of claim 31, wherein said mammal is a human.
33. The method of any one of claims 31-32, wherein said cancer treatment comprises surgery and / or radiation therapy.
34. The method of any one of claims 31-32, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
35. The method of any one of claims 31-32, wherein said cancer is a mesothelioma.
36. A method for treating cancer, wherein said method comprises administering a cancer treatment that is not an immune checkpoint inhibitor to a mammal identified as having cancer cells comprising the absence of each of mir-888-5p, mir-892a, and mir204-5p.
37. The method of claim 36, wherein said mammal is a human.
38. The method of any one of claims 36-37, wherein said cancer treatment comprises surgery and / or radiation therapy.
39. The method of any one of claims 36-37, wherein said cancer treatment comprises administering, to said mammal, an anti-cancer agent selected from the group consisting of a chemotherapy and an angiogenesis inhibitor.
40. The method of any one of claims 36-37, wherein said cancer is a mesothelioma.41 . A method for assessing a mammal having cancer, wherein said method comprises:(a) determining a level of one or more of mir34a-5p and mir-195-5p in a sample comprising cancer cells obtained from said mammal; and(b) classifying said mammal as being likely to experience a poor outcome when said sample comprises a low level of one or more of mir34a-5p and mir-195-5p; or(c) classifying said mammal as not being likely to experience a poor outcome when said sample lacks a low level of each of mir34a-5p and mir-195-5p.
42. The method of claim 41, wherein said mammal is a human.
43. The method of any one of claims 41 -42, wherein said poor outcome comprises poor survival and / or a poor response to an immune checkpoint inhibitor.
44. The method of claim 43, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.
45. The method of any one of claims 41-42, wherein said cancer is a mesothelioma.
46. A method for treating a mammal having mesothelioma, wherein said method comprises administering one or more of mir34a-5p and mir-195-5p to said mammal, thereby treating cancer within said mammal.
47. The method of claim 46, wherein said mammal is a human.
48. The method of any one of claims 46-47, wherein said method comprises administering said mir34a-5p and said mir-195-5p.
49. The method of any one of claims 46-47, wherein said mir34a-5p and / or said mir-195- 5p are conjugated to a targeting moiety.
50. The method of any one of claims 46-47, wherein said mir34a-5p and / or said mir-195- 5p are encapsulated within a liposome.
51. The method of claim 60, wherein said liposome comprises a targeting moiety.
52. The method of any one of claims 46-50, wherein said method further comprises administering an immune checkpoint inhibitor to said mammal.
53. The method of claim 52, wherein said immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-CTL4A antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, and an anti-VISTA antibody.
54. The method of claim 52, wherein said immune checkpoint inhibitor is selected from the group consisting of nivolumab, ipilimumab, pembrolizumab, atezolizumab, durvalumab, cemiplimab, and avelumab.