Compounds and methods for reducing atn1 expression

Abstract

Provided are oligomeric agents, methods, and pharmaceutical compositions for reducing the amount or activity of ATN1 RNA in a cell or a subject, and in certain instances reducing the amount of atrophin-1 protein in a cell or a subject. Such oligomeric agents, methods, and pharmaceutical compositions are useful to treat a polyglutamine (polyQ) disease or disorder associated with ATN1.

Description

[0001] COMPOUNDS AND METHODS FOR REDUCING ATN1 EXPRESSION Sequence Listing The present application is being filed concurrently with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0472SEQ.xml, created on August 5, 2023, which is 47 KB in size. The contents of the electronic format of the sequence listing are incorporated herein by reference in their entirety. Field Provided are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of ATN1 RNA in a cell or subject, and in certain instances reducing the amount of atrophin-1 protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom of a polyglutamine (polyQ) disease or disorder associated with ATN1. Such symptoms include seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on magnetic resonance imaging (MRI), hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Such polyQ diseases or disorders include dentatorubral-pallidoluysian atrophy (DRPLA). Background Dentatorubral-pallidoluysian atrophy (DRPLA) is an autosomal dominant neurodegenerative disorder caused by an extended CAG repeat in the ATN1 gene, which encodes atrophin-1 protein. In certain instances, a mutation in the ATN1 gene extends the CAG repeat to 48 times or more, resulting in an aberrant structure of atrophin-1 protein and subsequent accumulation of the protein in the neurons. The number of CAG repeats further influences the severity of the symptoms as well as the age at onset of DRPLA. For example, about 48 to 65 CAG repeats can lead to the development of adult DRPLA while a number of CAG repeats higher than 62 can lead to the development of juvenile DRPLA (Carroll, et al., “Dentatorubral-pallidoluysian Atrophy: An Update.” Tremor and other hyperkinetic movements (New York, N.Y.), vol.8, 577.1 Oct.2018). DRPLA is characterized by a variety of symptoms including, but not limited to, seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, and neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. The ataxia includes, for example, progressive cerebellar ataxia, gait ataxia, limb ataxia, and truncal ataxia. Currently there is a lack of acceptable options for treating polyglutamine (polyQ) diseases or disorders associated with ATN1 such as DRPLA. It is therefore an objective herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases or disorders. Summary Provided herein are oligomeric agents, pharmaceutical compositions, and methods of use for reducing the amount or activity of ATN1 RNA, and in certain embodiments modulating the expression of ATN1 protein in a cell or a subject. In certain embodiments, the subject has or is at risk for developing a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the subject has or is at risk for developing DRPLA. In certain embodiments, oligomeric agents, pharmaceutical compositions, and methods reduce the amount or activity of ATN1 RNA and expression of ATN1 protein. In certain embodiments, oligomeric agents useful for reducing the amount or activity of ATN1 RNA comprise modified oligonucleotides. In certain embodiments, oligomeric agents useful for reducing the amount or activity of ATN1 RNA comprise oligomeric duplexes and / or antisense oligonucleotides. Additionally provided herein are methods for reducing ATN1 expression, ATN1 RNA levels, ATN1 protein levels, and / or ATN1 activity in a cell or subject. In certain embodiments, the methods include contacting a cell or subject with a composition provided herein, comprising an oligomeric agent, a modified oligonucleotide, and / or an oligomeric duplex. In certain embodiments, the subject is a human who has or is at risk of developing a polyglutamine (polyQ) disease or disorder associated with ATN1. In particular embodiments, the subject is a human who has or is at risk of having DRPLA. In certain particular embodiments, the subject is a human who has or is at risk of having seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Also provided herein are methods of treating a disease (including, for example, a disorder or condition) associated with ATN1 or a mutation in ATN1. In certain embodiments, methods provided herein include methods of ameliorating at least one symptom or hallmark of a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, methods provided herein include methods of treating DRPLA. In certain embodiments, such methods comprise administering a composition provided herein, comprising an oligomeric agent, a modified oligonucleotide, and / or an oligomeric duplex to a subject having or at risk for developing DRPLA. In certain such embodiments, such treating results in amelioration of at least one symptom of DRPLA. In certain such embodiments, treating results in amelioration of at least one symptom selected from seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. DEFINITIONS The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant invention. Unless specific definitions are provided herein, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, certain terms have the following meanings: As used herein, a substituent at the “2’-position” means that the substituent is directly attached to the carbon at the 2’-position of a furanosyl sugar moiety. As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside which comprises a 2’-β-D-deoxyribosyl sugar moiety, which is in the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). A 2’-deoxynucleoside or a nucleoside comprising an unmodified 2’-deoxyribosyl sugar moiety may be abasic, comprise a modified nucleobase, or may comprise an RNA nucleobase (uracil). As used herein, “2’-deoxy sugar moiety” means a 2’-H(H) deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2’-deoxy sugar moiety is a 2’-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl stereochemical configuration as found in naturally occurring deoxyribonucleic acids (DNA). As used herein, “2’-MOE” means a 2’-OCH2CH2OCH3group at the 2’-position of a furanosyl sugar moiety. A “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH2CH2OCH3group at the 2’-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the β-D-ribosyl stereochemical configuration. “MOE” means O-methoxyethyl. As used herein, “2’-MOE nucleoside” or “2’- OCH2CH2OCH3nucleoside” means a nucleoside comprising a 2’-MOE sugar moiety (or 2’-OCH2CH2OCH3furanosyl sugar moiety). As used herein, “2’-OMe” or “2’-O-methyl” means a 2’-OCH3group at the 2’-position of a furanosyl sugar moiety. A “2’-OMe sugar moiety” or “2’-O-methyl sugar moiety” means a sugar moiety with a 2’-OCH3group at the 2’- position of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the β-D-ribosyl stereochemical configuration. As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety. As used herein “2’-NMA” means a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-NMA sugar moiety” means a sugar moiety with a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. As used herein, “2’-NMA nucleoside” means a nucleoside comprising a 2’- NMA sugar moiety. As used herein, “2’-substituted nucleoside” means a modified nucleoside comprising a 2’-substituted furanosyl sugar moiety. As used herein, “2’-substituted sugar moiety” means a modified furanosyl sugar moiety wherein the 2’-position has at least one 2’-substituent other than H or OH . A 2’-substituted sugar moiety includes a bicyclic sugar moiety where the second ring is joined to the furanosyl ring at the 2’-position. 2’-substituted sugar moieties include, but are not limited to, 2’-OMe sugar moieties, 2’-MOE sugar moieties, 2’-F sugar moieties, 2’-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties. As used herein, “3’ stop site” refers to the 3’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide, when the oligonucleotide is hybridized to the target nucleic acid. As used herein, “5’ stop site” refers to the 5’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide, when the oligonucleotide is hybridized to the target nucleic acid. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the 5 position. A 5-methylcytosine is a modified nucleobase. As used herein, “ameliorate” with reference to a symptom of a disease, means improvement in, or lessening, or preclusion of at least one symptom of the disease. As used herein, “disease” includes disorders, conditions, and injuries. Amelioration may be a reduction in severity or frequency of a symptom or the delayed onset, prevention of occurrence of, or slowing of progression in the severity or frequency of, a symptom. Progression, frequency, or severity indicators may be determined by subjective or objective measures known in the art and / or described herein. As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to hybridization of an antisense oligonucleotide to a target nucleic acid. Herein, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the oligonucleotide. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay or, for example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide. As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region”) that is complementary to a target nucleic acid and is capable of antisense activity. An antisense oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”), may be an unpaired antisense oligonucleotide (herein, a single-stranded antisense oligonucleotide), or may be a “hairpin oligonucleotide” that has at least one region that is self- complementary. As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that has affinity for a particular cell type or particular cell types. For example, a cell-targeting moiety may have affinity for a surface moiety, such as a surface receptor on a particular cell type. As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. As used herein, “cleavable moiety” means a bond or a group of atoms comprising at least one bond that is cleaved under physiological conditions, that is, in a cell or a subject. For example, a cleavable moiety is cleaved inside a cell or a sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases. As used herein, “complementary nucleobases” means nucleobases that form hydrogen bonds with one another when two strands of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid; or two oligonucleotides) or, alternatively, two regions of a single strand of linked nucleosides (e.g., as in a “hairpin oligonucleotide”) are aligned. Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I), can pair with adenine, cystine, thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). As used herein, “complementary” in reference to a nucleobase sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two nucleobase sequences are complementary nucleobases when the sequences are aligned. Each of the two nucleobase sequences may be a sequence corresponding to the nucleobase sequence of any strand of linked nucleosides or region thereof. For example, complementary nucleobase sequences may be the nucleobase sequences of two separate strands of linked nucleosides or region thereof (e.g., an oligonucleotide and a region of a target nucleic acid, or an antisense oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be nucleobase sequences of two regions of a single strand of linked nucleosides (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked nucleosides (e.g., an oligonucleotide) or region thereof is described as being complementary to a second strand of linked nucleosides or region thereof (e.g., a target nucleic acid or another oligonucleotide), it means that the nucleobase sequence of the first strand of linked nucleosides or region thereof is complementary to the nucleobase sequence of the second strand of linked nucleosides or region thereof. As used herein, when an oligonucleotide or region thereof is described as being complementary to a region of a target nucleic acid, it means that the nucleobase sequence of the oligonucleotide or region thereof is complementary to the nucleobase sequence of the region of the target nucleic acid. Not every pair of nucleobases in the aligned nucleobase sequences needs to be complementary for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where complementarity is expressed as a percent, such percent represents the percent of nucleobases within one nucleobase sequence that are complementary to nucleobases within an equal length second sequence when the sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if the nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches when the sequences are aligned. If the nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of the two nucleobase sequences is complementary when the equal length sequences are aligned. As used herein, “complementary region” in reference to a strand of linked nucleosides (e.g., an oligonucleotide or a target nucleic acid) is a region of the strand of linked nucleosides in which the nucleobase sequence of the region is complementary with the nucleobase sequence of an equal-length region of a separate strand of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid, or an antisense oligonucleotide and a sense oligonucleotide), or the nucleobase sequence of an equal-length region within the same strand of linked nucleosides (e.g. in a “hairpin oligonucleotide”). A complementary region of a strand of linked nucleosides may be a region of a strand of linked nucleosides or may include the entire strand of linked nucleosides. A complementary region may include a mismatch, but the nucleobases of the terminal nucleosides of a complementary region are complementary to the nucleobases of the terminal nucleosides of the equal-length region of the separate strand of linked nucleosides or to the nucleobases of the terminal nucleosides of the equal-length region within the strand of linked nucleosides. A “targeting region” of, for example, an oligonucleotide, is a complementary region in which the nucleobase sequence of the region is complementary to the nucleobase sequence of a target region of a target nucleic acid. A targeting region of a strand of linked nucleosides may be a region of the strand of linked nucleosides or may include the entire strand of linked nucleosides. A “duplexing region” is a complementary region of an oligonucleotide (e.g., an antisense or sense oligonucleotide) having a nucleobase sequence that is complementary to the nucleobase sequence of a second oligonucleotide or region thereof. A duplexing region may be a region of a strand of linked nucleosides or may include the entire strand of linked nucleosides. As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. A conjugate groups comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. As used herein, “deoxy region” means a region of 5-12 contiguous nucleosides, wherein at least 70% of the nucleosides are DNA nucleosides. Each nucleoside of the deoxy region is selected from a 2’-deoxynucleoside and a 2’- substituted nucleoside. A deoxy region supports RNase H activity. As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise a uracil nucleobase or a modified nucleobase, or may be an abasic nucleoside. As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety. As used herein, “double-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) or a region thereof, means that the strand of linked nucleosides or region thereof is paired with a complementary strand of linked nucleosides or a region thereof. Paired complementary regions of two separate strands of linked nucleosides form a duplex of the separate strands. Paired complementary regions of a single strand of linked nucleosides form a “hairpin”. As used herein, “duplex” means a structure formed by hybridization of complementary base pairs between two strands of linked nucleosides or regions thereof (e.g., two separate oligonucleotides or an oligonucleotide and a target nucleic acid). For clarity, herein a “hairpin oligonucleotide” is a single strand of linked nucleosides that comprises a region that is double stranded and is not considered a duplex. As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring, and is numbered according to the structure below, with optional additional substituents at any of the 1’, 2’, 3’, 4’, and 5’ positions. A apmer” means a modified oligonucleotide comprising an internal region positioned between external reg g e or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’-β-D-deoxynucleoside. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’-β-D-deoxynucleosides and wings comprising 2’-MOE nucleosides. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications. As used herein, a “hairpin oligonucleotide” is a strand of linked nucleosides comprising a double stranded region formed by hybridization of complementary nucleobases of a first region of the strand of linked nucleosides and a second region of the strand of linked nucleosides. A hairpin oligonucleotide that comprises at least one region that is complementary to a target nucleic acid is an antisense oligonucleotide. As used herein, “hotspot region” is a range of nucleobases on an ATN1 nucleic acid that is amenable to reduction of the amount or activity of the ATN1 nucleic acid by the action of an oligomeric agent. As used herein, “hybridize” or “hybridization” means the process of two complementary regions of strands of linked nucleosides (e.g., oligonucleotides, nucleic acids) annealing together to form a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, “internucleoside linkage” means the covalent linkage between immediately adjacent nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, and in the context of linked nucleosides each comprising a furanosyl sugar moiety, an internucleoside linkage joins the 3’-carbon of one furanosyl sugar moiety to the 5’-carbon of the other furanosyl sugar moiety. As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). As used herein, a “mismatch” between two aligned strands of linked nucleosides means that the two nucleobases at a specified position of the two aligned nucleobase sequences are not complementary nucleobases. As used herein, “modified nucleoside” means a nucleoside where the sugar moiety is modified and / or the nucleobase is modified or absent. As used herein, “modified sugar moiety” means a group of atoms other than an unmodified sugar moiety that forms the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a cyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic. As used herein, a “modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” (mC) is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine. As used herein, “motif” means a pattern of independently unmodified and / or independently modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, “the nucleobase sequence of” a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO. A “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification. As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside”. As used herein, “nucleoside overhang” or “overhang” refers to unpaired nucleosides at either or both ends of an oligomeric duplex. The nucleosides of an overhang are not part of the “duplexing region” of either of the two strands of linked nucleosides. As used herein, "oligomeric agent" means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides. As used herein, “oligonucleotide” means a strand of linked nucleosides, wherein each nucleoside and / or internucleoside linkage of the strand of linked nucleosides may be independently modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 12-50 linked nucleosides. Unless otherwise indicated, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired. As used herein “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. A pharmaceutical composition may show activity in certain cell lines. As used herein, “pharmaceutically acceptable carrier or diluent” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “carrier” or “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemical present in cells or tissues and / or by physiologic conditions. The first form of the prodrug may be less active than the second form. As used herein, “RNA sugar moiety” means an unmodified RNA sugar moiety. As used herein, “RNA nucleoside” means a nucleoside comprising an unmodified RNA sugar moiety. An RNA nucleoside may comprise a modified or unmodified nucleobase. An RNA nucleoside may comprise a thymine nucleobase or a modified nucleobase or may be an abasic nucleoside. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2. As used herein, “single-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) means that the strand or region is unpaired; that is, the strand of linked nucleosides is not part of a duplex or part of a double- stranded region. For clarity, herein a “hairpin oligonucleotide” is not a “single-stranded oligonucleotide”, though it may comprise a portion that is unpaired (e.g., a loop or terminal region) as well as portions that are double-stranded. Single- stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing to complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. As used herein, “stabilized phosphate moiety” means a 5’-phosphate analog that is metabolically more stable than a 5’-phosphate as naturally occurs on DNA or RNA. As used herein, “standard cell assay” means the assays described in the Examples and reasonable variations thereof. As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. The absolute stereochemical configuration of a chiral center can be controlled by using stereochemically-pure starting materials, e.g., using β-D-ribosyl nucleoside monomers for oligonucleotide synthesis. In contrast, the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). The stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside linkage. As used herein, a “strand” or “strand of linked nucleosides” means contiguous linked nucleosides connected via internucleoside linkages. A strand of linked nucleosides has a nucleobase sequence. As used herein, “subject” means a human or a non-human animal. The subject may be a human. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2’-OH(H) β-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position and 2 hydrogens, or a hydrogen and an OH at the 2’ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, “symptom” of a disease means any manifestation, indication, sign, hallmark, or evidence of a disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones. Symptoms may include seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on magnetic resonance imaging (MRI), hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. As used herein, “target nucleic acid” means a ATN1 nucleic acid that an antisense oligonucleotide is designed to affect. As used herein, “target RNA” means an ATN1 RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified. As used herein, “target region” means a portion of a target nucleic acid (e.g., ATN1) that is complementary to the targeting region of an antisense oligonucleotide. As used herein, “therapeutic index” means the ratio of a measure of toxicity or intolerability divided by a measure of potency or activity. Typically, the therapeutic index is expressed as the ratio between the concentration (or dose) at which a compound becomes toxic or induces unacceptable adverse effects (or the highest concentration or dose at which a compound is not toxic, or is tolerated, before it becomes toxic or induces unacceptable adverse effects) to a subject and the concentration (or dose) at which the compound is pharmacologically effective or produces the desired effect. As used herein, “treating,” or “treatment,” with respect to a disease, means administering a compound or an oligomeric agent to a subject having or at risk for developing such disease. Treating a disease may result in amelioration of at least one symptom of such disease. Treatment may reduce, improve, and / or prevent one or more symptom(s) such that a symptom of the disease is diminished or is no longer apparent. As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates at least one symptom of a disease. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom such that a symptom of the disease is diminished, is no longer apparent, or is never apparent. As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase. As used herein, “unmodified sugar moiety” means a 2’-OH(H) β-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, two hydrogens at the 5’ position and two hydrogens (DNA) or a hydrogen and an OH (RNA) at the 2’ position.

[0002] EMBODIMENTS Embodiment 1. A modified oligonucleotide according to the following chemical structure: Embodiment 2. The modified oligonucleotide of embodiment 1, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. Embodiment 3. The modified oligonucleotide of embodiment 2, which is the sodium salt or the potassium salt.

[0003] Embodiment 4. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 10).

[0004] Embodiment 5. A modified oligonucleotide according to the following chemical structure: ONH2O N NH N NH O O Embodiment 6. The modified oligonucleotide of embodiment 5, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. Embodiment 7. The modified oligonucleotide of embodiment 6, which is the sodium salt or the potassium salt.

[0005] Embodiment 8. A modified oligonucleotide according to the following chemical structure: wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase; G = a guanine nucleobase; T = a thymine nucleobase; e = a 2’-MOE sugar moiety; d = a 2’-β-D-deoxyribosyl sugar moiety; s = a phosphorothioate internucleoside linkage; and o = a phosphodiester internucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group. Embodiment 11. A population of modified oligonucleotides of any one of embodiments 1-8 or an oligomeric agent of any one of embodiments 9-10, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. Embodiment 12. A pharmaceutical composition comprising a modified oligonucleotide of any one of embodiments 1-8, an oligomeric agent of any one of embodiments 9-10, or a population of embodiment 11, and a pharmaceutically acceptable diluent. Embodiment 13. The pharmaceutical composition of embodiment 12, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline. Embodiment 14. The pharmaceutical composition of embodiment 12 or embodiment 13, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid. Embodiment 15. The pharmaceutical composition of any one of embodiments 12-14, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric agent, or the population and phosphate-buffered saline. Embodiment 16. The pharmaceutical composition of any one of embodiments 12-14, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric agent, or the population and artificial cerebrospinal fluid. Embodiment 17. A method comprising administering to a subject a modified oligonucleotide of any one of embodiments 1-8, a subject an oligomeric agent of any one of embodiments 9-10, a population of embodiment 11, or a pharmaceutical composition of any one of embodiments 12-16. Embodiment 18. The method of embodiment 17, wherein the subject has or is at risk for developing a disease or disorder associated with ATN1. Embodiment 19. The method of embodiment 17 or embodiment 18, wherein administering the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease or disorder associated with ATN1 in the subject. Embodiment 20. The method of embodiment 17 or embodiment 18, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition reduces or slows progression of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Embodiment 21. The method of any one of embodiments 17-20, wherein ATN1 protein levels in the subject are reduced. Embodiment 22. The method of any one of embodiments 17-21, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder. Embodiment 23. The method of any one of embodiments 17-22, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1. Embodiment 24. The method of any one of embodiments 17-23, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA). Embodiment 25. A method of treating a disease or disorder associated with ATN1 comprising administering to a subject having or at risk for developing a disease or disorder associated with ATN1 a therapeutically effective amount of a modified oligonucleotide of any one of embodiments 1-8, an oligomeric agent of any one of embodiments 9-10, a population of embodiment 11, or a pharmaceutical composition of any one of embodiments 12-16, thereby treating the disease or disorder associated with ATN1. Embodiment 26. The method of embodiment 25, wherein administering the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease or disorder associated with ATN1. Embodiment 27. The method of embodiment 26, wherein the symptom is seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Embodiment 28. The method of any one of embodiments 25-27, wherein the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition is administered to the central nervous system or systemically. Embodiment 29. The method of any one of embodiments 25-28, wherein ATN1 protein levels in the subject are reduced. Embodiment 30. The method of any one of embodiments 25-29, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder. Embodiment 31. The method of any one of embodiments 25-30, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1. Embodiment 32. The method of any one of embodiments 25-31, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA). Embodiment 33. The method of any one of embodiments 25-32, wherein the subject is human. Embodiment 34. A method of reducing expression of ATN1 in a cell comprising contacting the cell with a modified oligonucleotide of any one of embodiments 1-8, an oligomeric agent of any one of embodiments 9-10, a population of embodiment 11, or a pharmaceutical composition of any one of embodiments 12-16. Embodiment 35. The method of embodiment 34, wherein the cell is a brain cell. Embodiment 36. The method of embodiment 34 or embodiment 35, wherein the cell is a human cell. Embodiment 37. Use of a modified oligonucleotide of any one of embodiments 1-8, an oligomeric agent of any one of embodiments 9-10, a population of embodiment 11, or a pharmaceutical composition of any one of embodiments 12-16 for treating a disease or disorder associated with ATN1. Embodiment 38. Use of a modified oligonucleotide of any one of embodiments 1-8, an oligomeric compound of any one of embodiments 9-10, a population of embodiment 11, or a pharmaceutical composition of any one of embodiments 12-16 in the manufacture of a medicament for treating a disease or disorder associated with ATN1. Embodiment 39. The use of any one of embodiments 37-38, wherein the disease or disorder is associated with an elevated level of ATN1. Embodiment 40. The use of any one of embodiments 37-39, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder. Embodiment 41. The use of any one of embodiments 37-40, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder. Embodiment 42. The use of any one of embodiments 37-41, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA). I. Oligomeric Agents Provided herein are oligomeric agents comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotide, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate group, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal group. In some embodiments, provided herein are oligomeric agents comprising or consisting of a modified antisense oligonucleotide complementary to ATN1 RNA. In certain such embodiments, an oligomeric agent consists of a modified antisense oligonucleotide complementary to ATN1 RNA and a conjugate group attached to the modified antisense oligonucleotide. In some embodiments, provided herein are oligomeric agents comprising an oligomeric duplex comprising or consisting of an antisense oligonucleotide complementary to ATN1 RNA, and a sense oligonucleotide complementary to the antisense oligonucleotide, wherein one or both of the antisense and sense oligonucleotides is / are modified. In certain such embodiments, an oligomeric agent consists of an antisense oligonucleotide complementary to ATN1 RNA, a sense oligonucleotide complementary to the antisense oligonucleotide, and a conjugate group and / or terminal group attached to one or both of the antisense and sense oligonucleotides. Modified antisense and / or sense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified antisense and / or sense oligonucleotides are described herein. A. Modified Nucleosides Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or a combination thereof. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified antisense and / or sense oligonucleotides described herein. 1. Modified Sugar Moieties Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the 2’, 3’, 4’, and / or 5’ positions, as numbered based on ribose: the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modified sugar moieties are 2’-substituted sugar moieties and comprise a substituent group at the 2’-position. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: F, OCH3(“OMe” or “O-methyl”), and O(CH2)2OCH3(“MOE” or “O- methoxyethyl”). In certain embodiments, 2’-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10alkoxy, O-C1-C10substituted alkoxy, O-C1-C10alkyl, O-C1-C10substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, -O(CH2)2ON(CH3)2(“DMAOE”), or -O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). Synthetic methods for some of these 2’-substituent groups may be found, e.g., in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)- N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted sugar moiety comprises a 2’-substituent group selected from: OCH3and OCH2CH2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2’-deoxyfuranosyl sugar moiety (i.e., 2’-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified furanosyl sugar moieties are described in, e.g., WO 2020 / 072991, incorporated by reference herein. A 2’-modified furanosyl sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the β-D-ribosyl stereochemical configuration unless otherwise specified. Certain modified furanosyl sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'- CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2- N(R)-2’, 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof , 4'-CH2-O-N(CH3)-2' , 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)- 2' and analogs thereof , 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S.7,741,457; Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; and Seth et al., U.S.8,278,426. 2. Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides contain no abasic nucleosides. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Unless otherwise indicated, modified adenine has structure (I):   I wherein: alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1-C6 thioalkyl, C1-C6or R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais H, C1-C6alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare each independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine). Unless otherwise indicated, modified guanine has structure (II): II R1Gis H, or R6Gis O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis H, C1-C6alkyl, or N(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7- membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =O (unmodified guanine). Unless otherwise indicated, modified thymine or modified uracil has structure (III): O or S and R5Uis H, OH, halogen, O-C1-C20alkyl, O-C1-C12substituted alkyl, C1-C12alkyl, substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl, C1-C12alkynyl, or substituted C1-C12alkynyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively). Unless otherwise indicated, modified cytosine has structure (IV): R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1- C12alkyl , C1-C12alkenyl, or substituted C1-C12alkenyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, C1-C12alkynyl, substituted C1-C12alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2and R5Cis H (unmodified cytosine). As used herein, a “5-methylcytosine nucleobase” is a modified cytosine where X is O, R4Cis NH2, and R5Cis methyl. Hypoxanthine has structure (V): adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, 2A R is H, and oxo. In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O- 6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N- methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CºC- CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5- trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7- deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N- benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2- aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, Rogers et al., U.S.5,134,066 ; Benner et al., U.S.5,432,272; Matteucci et al., U.S.5,502,177; Froehler et al., U.S.5,594,121 ; and Cook et al., U.S.5,681,941. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, andmC. In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U. 3. Modified Internucleoside Linkages In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified internucleoside linkage. The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Herein, all internucleoside linkages between furanosyl sugar moieties are 3’ to 5’ internucleoside linkages unless otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides are linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus- containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linkages include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester linkages, may be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage has the formula: wherein for each internucleoside linkage of the modified oligonucleotide: X is O or S; R1is H, C1-C6alkyl, or substituted C1-C6alkyl; and T is SO2R2, C(=O)R3, or P(=O)R4R5, wherein: R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, substituted C1-C6alkyl, substituted C1-C6alkenyl, substituted C1-C6alkynyl, and a conjugate group; R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4is selected from OCH3, OH, C1-C6alkyl, substituted C1-C6alkyl, and a conjugate group; and R5is selected from OCH3, OH, C1-C6alkyl, and substituted C1-C6alkyl. In certain embodiments, a modified oligonucleotide comprises a mesyl phosphoramidate linkage having the formula: . Certain having reduced charge (referred to as “neutral internucleoside linkages”) have been described. linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP) (see US 9,926,556), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage having a formula: which or may be enriched for the Rp or Sp configuration. In certain embodiments, internucleoside linkages are not 3’-to-5’ internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 3’ to 3’ and / or 5’ to 5’, as shown below:

[0006] , wherein cleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide. In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside may be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleosides are linked 2’ to 5’ rather than the 3’ to 5’ linkage. Such a linkage between two nucleosides is illustrated below. , wherein In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non-furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’, as shown below in the context of 3 linked nucleosides:

[0007] In certai ucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates. The mesyl phosphoramidate internucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase: . chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

[0008] Modified oligonucleotides comprising internucleoside linkages having a chiral center may be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising internucleoside linkages containing chiral centers in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate and / or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate and / or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration. In certain embodiments, the chiral center is at positions 1’, 2’, 3’, and / or 4’ of a furanosyl sugar moiety. In certain embodiments, each chiral center of each furanosyl sugar moiety is enriched such that the sugar moieties have the β-D ribosyl stereochemical configuration. In certain embodiments, modified oligonucleotides of a population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom and all of the mesyl phosphoramidate internucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for β-D ribosyl sugar moieties, at least one particular phosphorothioate internucleoside linkage in a particular stereochemical configuration is enriched, and all of the mesyl phosphoramidate internucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for β-D ribosyl sugar moieties, at least one particular mesyl phosphoramidate internucleoside linkage in a particular stereochemical configuration is enriched, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration and at least one particular mesyl phosphoramidate internucleoside linkage in a particular stereochemical configuration is enriched. B. Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In certain such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the nucleobase sequence). 1. Sugar Motifs In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, the sugar moiety of at least one nucleoside of an antisense oligonucleotide is a modified sugar moiety. In certain embodiments, the sugar moiety of at least one nucleoside of a sense oligonucleotide is a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2’-substituted nucleoside comprising the same 2’-substituent. In certain embodiments, every other nucleoside of a fully modified oligonucleotide comprises the same 2’-substitutent, resulting in alternating 2’-substituents. In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, at least one nucleoside of the deoxy region comprises a 2’-OMe sugar moiety. In certain embodiments, exactly one nucleoside of the deoxy region comprises a 2’-OMe sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’ external region consisting of linked 5’-region nucleosides and on the 3’-side by a 3’ external region consisting of linked 3’ external region nucleosides, wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety and the 5’-most nucleoside of the 3’ external region is comprises a modified sugar moiety. The three regions (the 5’ external region, the deoxy region, and the 3’ external region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3’-most nucleoside of the 5’ external region and the sugar moiety of the 5’-most nucleoside of the 3’ external region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5’ external region, the deoxy region, and the 3’ external region. In certain embodiments, each nucleoside of the 5’ external region and each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of the 5’ external region and at least two nucleosides of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of the 5’ external region and at least three nucleosides of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each nucleoside of the 5’ external region and each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, each of the nucleosides within the 5’ external region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 5’ external region comprise two or more different modified sugar moieties. In certain embodiments, each of the nucleosides within the 3’ external region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 3’ external region comprise two or more different modified sugar moieties. In certain embodiments, the 5’ external region and the 3’ external region of a modified oligonucleotide each independently comprises 1, 2, 3, 4, 5, 6, 7, 8 or 1-8 nucleosides. In certain embodiments, the 5’ external region and the 3’ external region of a modified oligonucleotide each consist of 1-8 nucleosides. In certain embodiments, the 5’ external region consists of 1-7 nucleosides. In certain embodiments, the 5’ external region consists of 1-6 nucleosides. In certain embodiments, the 5’ external region consists of 1-5 nucleosides. In certain embodiments, the 5’ external region consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 5’ external region consists of 1, 2, 3, 4, 5, 6, 7, 8, or 1-8 nucleosides. In certain embodiments, the 5’ external region consists of 4, 5, or 6 nucleosides. In certain embodiments, the 3’ external region consists of 1-7 nucleosides. In certain embodiments, the 3’ external region consists of 1-6 nucleosides. In certain embodiments, the 3’ external region consists of 1-5 nucleosides. In certain embodiments, the 3’ external region comprises 4, 5, or 6 nucleosides. In certain embodiments, the 3’external region consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 3’ external region consists of 1, 2, 3, 4, 5, 6, 7, 8, or 1-8 nucleosides. In certain embodiments, the deoxy region consists of 8, 9, 10, 11, or 12 nucleosides, with each nucleoside comprising a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. Herein, the lengths (number of nucleosides) of the 5’-region, the deoxy region, and the 3’-region of an oligonucleotide may be provided using the notation [# of nucleosides in the 5’-region] – [# of nucleosides in the deoxy region] – [# of nucleosides in the 3’-region]. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-region (or “wing”), 10 linked 2’- β-D-deoxynucleosides in the deoxy region (or “gap”), and 5 linked 2’-MOE nucleosides in the 3’-region (or “wing”). Thus, a 6-10-4 gapmer consists of 6 linked nucleosides comprising a modified sugar moiety in the 5’-region, 10 linked 2’-β-D-deoxynucleosides in the deoxy region, and 4 linked nucleosides comprising a modified sugar moiety in the 3’-region. A 6-10-4 mixed gapmer has at least two differently modified sugar moieties in the 5’- and / or the 3’-regions. In certain embodiments, modified oligonucleotides disclosed herein are modified by a specific sugar motif. In certain embodiments, modified oligonucleotides have a sugar motif (from 5’ to 3’) of: eeeeeeddddddddddeeee; wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety. 2. Nucleobase Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, at least one purine and / or at least pyrimidine is modified. In certain embodiments, at least one adenine is modified. In certain embodiments, at least one guanine is modified. In certain embodiments, at least one thymine is modified. In certain embodiments, at least one uracil is modified. In certain embodiments, at least one cytosine is modified. In certain embodiments, at least one of the cytosine nucleobases in a modified oligonucleotide is 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, one or two of the cytosine nucleobases are 5- methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. 3. Internucleoside Linkage Motifs In certain embodiments, oligonucleotides comprise modified and unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a mesyl phosphoramidate internucleoside linkage, and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a mesyl phosphoramidate internucleoside linkage and a phosphorothioate internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, each mesyl phosphoramidate internucleoside linkage is independently selected from a stereorandom mesyl phosphoramidate, a (Sp) mesyl phosphoramidate, and a (Rp) mesyl phosphoramidate. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif (from 5’ to 3’) of: sooooossssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. C. Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist modified oligonucleotides consist of 18-22 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19-20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 22 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23 linked nucleosides. In certain embodiments, the modified oligonucleotides have no more than 1 to 3 mismatches to a target nucleic acid. D. Oligomeric Agent Modifications Provided oligomeric agents comprise one or more modifications (e.g., a modified sugar moiety, a modified nucleobase, a modified internucleoside linkage, and / or combinations thereof) incorporated into a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, internucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the internucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the internucleoside linkages or internucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence. Furthermore, each modification, whether internucleoside linkage, modified sugar moiety, or modified nucleobase, of an antisense oligonucleotide is independent of each modification of a paired sense oligonucleotide unless specifically indicated otherwise. E. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid) or a region thereof. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of a second strand of linked nucleosides or region thereof. F. Oligomeric Duplexes In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide having a targeting region having a nucleobase sequence complementary to a sequence in a ATN1 target nucleic acid paired with a second oligonucleotide to form an oligomeric duplex. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a ATN1 target nucleic acid and a second oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the second oligonucleotide is a modified oligonucleotide. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a ATN1 target nucleic acid and a second modified oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the oligomeric duplex is part of an oligomeric agent, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide, (2) a second oligonucleotide, and (3) optionally a terminal group and / or a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may comprise a terminal group. Each modified oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging nucleosides. In certain embodiments, the nucleobase of the non-complementary or unpaired overhanging nucleosides is adenine or thymine. In certain embodiments, the two modified oligonucleotides have at least one mismatch relative to one another. In certain embodiments, an oligomeric duplex comprises: a first modified oligonucleotide containing a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal-length region of a ATN1 nucleic acid; and a second modified oligonucleotide containing a duplexing region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 90%, at least 95%, at least 98% or 100% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, modified furanosyl sugar moieties such as, for example, a non-bicyclic modified sugar moiety, such as a 2′-MOE sugar moiety, a 2′-F sugar moiety, a 2′-OMe sugar moiety, or a 2′-NMA sugar moiety; or a bicyclic sugar moiety, such as a furanosyl sugar moiety comprising a 4′-2′ bridge selected from -CH2-O- and -CH(CH3)- O-. In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2’-F sugar moiety, a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, and a 2’-NMA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′- NMA sugar moiety, and an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, and an unmodified DNA sugar moiety. In certain embodiments, in an oligomeric duplex provided herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, cyclic sugar surrogates, e.g., morpholino, hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (FHNA), and acyclic sugar surrogates, e.g., glycol nucleic acid (GNA) and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a cyclic sugar surrogate, which is FHNA. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, an unmodified DNA sugar moiety, and FHNA. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, an unmodified DNA sugar moiety, and FHNA. G. Conjugates In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides and one or more conjugate groups. In certain embodiments, an oligomeric agent optionally further comprises one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker. A conjugate group may be attached at the 3’ end and / or the 5’ end of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker. A. Conjugate Groups A conjugate group comprises a conjugate moiety and a conjugate linker. A conjugate moiety modifies one or more properties of an attached oligonucleotide compared to the same oligonucleotide lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, a conjugate moiety imparts a new property on the attached oligonucleotide. In some embodiments, the conjugate group comprises a small molecule drug substance (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide, a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camelid antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter molecule, a small molecule, or an alkyl moiety, e.g., a C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugate group comprises a 6- palmitamidohexyl moiety or a 2-(hydroxymethyl)-6-palmitamidohexyl moiety. In certain embodiments, the conjugate group comprises a cell-targeting moiety. In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620). In certain embodiments, the conjugate group comprises a lipophilic moiety. In certain embodiments, the lipophilic moiety is selected from the group consisting of alkyl moiety, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In certain embodiments, the alkyl moiety is a saturated straight chain C16 hydrocarbon. Methods of preparing conjugated oligonucleotides are known in the art and / or described herein. For example, in one non-limiting solid phase method for large-scale synthesis of conjugated oligonucleotides, monomethyoxytrityl (MMT)-protected 5’ or (3’)-amino-modified oligonucleotide intermediates are generated using the phosphoramidate monomer coupling method and detritylated as described in U.S. Patent No.10,450,342. The 5’ (or 3’) MMT-protected amino group may be linked to the oligonucleotide through a linker group such as an alkyl phosphate group, and the MMT group may be removed from the oligonucleotide via solution-phase detritylation conducted at certain temperatures and pH. In certain embodiments, the detritylated oligonucleotide is then reacted with a conjugate group (e.g., a GalNAc3) to generate a conjugated oligonucleotide. 2. Certain Cell-targeting Moieties In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety has affinity for a cell surface receptor on a cell. In certain embodiments, a cell- targeting moiety has affinity for a cell surface moiety on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface receptor on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface moiety on a cell. In certain embodiments, an oligomeric agent comprising a cell-targeting moiety is capable of being internalized by the cell when the cell-targeting moiety interacts with and / or binds a cell surface receptor and / or cell surface moiety. In certain embodiments, a cell surface receptor is not expressed ubiquitously (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and a cell-targeting moiety selectively delivers an oligomeric agent, a modified oligonucleotide, or an oligomeric duplex to a tissue of interest or a cell of interest. By way of non-limiting example, the tissue of interest may be any one or more of brain, spinal cord, retina, heart, kidney, liver, lung, skeletal muscle, cardiac muscle, smooth muscle, adipose, white adipose, brown adipose, spleen, bone, intestine, colon, testes, breast, ovary, placenta, uterus, bladder, pancreas, pituitary, prostate, skin, adrenal gland, and thyroid. By way of non-limiting example, the cell of interest may be any one or more of a myocyte, adipocyte, hepatocyte, cardiomyocyte, vascular smooth muscle cell, endothelial cell, neuron, blood cell, macrophage, lymphocyte, cancer cell, and immune cell. In certain embodiments, the cell of interest may be any one or more of neurons and oligodendrocytes. Asialoglycoprotein Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for the hepatic asialoglycoprotein receptor (ASGP- R). In certain embodiments, the cell-targeting moiety comprises more than one ligand, and each ligand has affinity for the ASGP-R. In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is N-acetyl galactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell-targeting moiety is any one of those described in US 9,127,276. GLP-1 Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for a GLP-1 receptor. In certain embodiments, the cell-targeting moiety is any one of those described in US 2019 / 0134214. GABA Transporter & Sortilin Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for neurons. In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter receptor. In certain embodiments, a cell-targeting moiety has affinity for a Sortilin receptor. In certain embodiments, the cell-targeting moiety is any one of those described in WO2021 / 236599. In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257. Angiotensin II Type 1 Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for an Angiotensin II Type I (AGTR1) receptor. In certain embodiments, the cell-targeting moiety is any one of those described in US 2022 / 0243210. Integrin Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for an integrin. In certain embodiments, the cell- targeting moiety has affinity for integrin αvβ3 and / or αvβ5. In certain embodiments, the cell-targeting moiety is any one of those described in any of WO 2019 / 210200, WO 2019 / 210308. In certain embodiments, the cell-targeting moiety has affinity for integrin αvβ6. In certain embodiments, the cell-targeting moiety is any one of those described in any of WO 2018 / 085415, WO 2019 / 089765, WO 2022 / 056269, WO 2022 / 056277, or WO 2022 / 056286. Transferrin Receptor Ligands In certain embodiments, a cell-targeting moiety is has affinity for the type 1 transferrin receptor (TfR1, also known as CD71). In certain embodiments, a cell-targeting moiety comprises an anti-TfR1 antibody or antigen-binding fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or antigen-binding fragment thereof may be any known in the art including but not limited to those described in WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; US 10,550,188; and US 11,512,136. In certain embodiments, a fragment of an anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, scFv, VHH, or VNAR. In certain embodiments, an antibody binds to TfR1 through an engineered Fc domain rather than through the antigen- binding portion, as described in, e.g., US 2020 / 0223935. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1 that does not include the antigen-binding fragment of an antibody. In certain embodiments, the protein or peptide capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; WO 2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In certain embodiments, the peptide is a cyclic peptide, as described in WO 2021 / 167107. In certain embodiments, the peptide is a bicyclic peptide known as a ‘bicycle ligand’ selected from those described in WO 2022 / 101633 and WO 2023 / 056388, each of which is incorporated by reference herein. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198. 3. Conjugate Linkers In certain embodiments, oligomeric agents comprise a modified oligonucleotide and a conjugate group, wherein the conjugate group consists of a conjugate moiety and a conjugate linker. The conjugate linker links the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described herein, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate moieties to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on a parent compound and the other is selected to react with a conjugate moiety. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise chemical groups that are formed upon a reaction between a first functional group and a second functional group. In certain embodiments, an oligonucleotide (e.g., a modified oligonucleotide) is attached to the first functional group during synthesis, and a conjugate moiety is attached to a second functional group during synthesis. Then, the two compounds are mixed under specific conditions to yield the oligonucleotide covalently linked to the conjugate moiety. Such reactions that are compatible with both oligonucleotide and peptide chemistry have been previously described and are often called “bioconjugation” reactions. These reactions include strain promoted azido-alkyne cycloaddition (SPAAC), copper-catalyzed click reaction (CuAAC), active ester conjugation to an amino modified oligonucleotide, maleimide-thiol Michael addition, ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thio ether formation, disulfide formation, reductive alkylation, catalyst-free N- arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels Alder reaction. Certain such reactions are described in, e.g., Jbara, et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”, Angew. Chem. Int. Ed.2021, 60(21)12109-12115; Dong, et al., “Sulfur(VI) Fluoride Exchange (SuFEx): Another Good Reaction for Click Chemistry,” Angew. Chem. Int. Ed.2014, 53(36):9430-9448.4; Zhang, et al., “Arylation Chemistry for Bioconjugation,” Angew. Chem. Int. Ed. Engl. 2019; 58(15): 4810–4839; Walsh, et al., “Site-selective modification strategies in antibody-drug conjugates” Chem. Soc. Rev., 2021, 50: 1305-1353; Tiefenbrunn, et al., “Chemoselective ligation techniques: modern applications of time-honored chemistry”, Biopolymers, 2010, 94(1):95-106; Drake, et al., Bioconjug. Chem. 2014, 25(7):1331-1341; Bode, Acc. Chem. Res., 2017, 50, 9, 2104–2115; J. Magano, B. Bock, et al, Org. Proc. Res. Dev. 2014, 18:142-151; Craig S. McKay and M.G. Finn, “Click Chemistry in Complex Mixtures: Bioorthogonal Bioconjugation”, Chemistry & Biology 2014; Mitchell P. Christy et al., Org. Lett.2020, 22: 2365; Ren et al., Angew. Chem. Int. Ed. Engl.2009, 48, 9658–9662; Rohrbacher, F. et al., Helv. Chim. Acta.2018, 101; Baalmaan, et al, “A Bioorthogonal Click Chemistry Toolbox for Targeted Synthesis of Branched and Well-Defined Protein–Protein Conjugates”, Angew. Chem. Int. Ed.2020 (59): 12885-12893; Lang, et al, “Biorthogonal Reactions for Labeling Proteins”, J. Am. Chem. Soc, 2014, 9(1):16-20; Nair, et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry”, Chem. Mater. 2013 26(1):724-744; Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew. Chem. Int. Ed., 2008, 47:7523-7526. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, it is desirable for a conjugate moiety to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate moiety be cleaved to release the unconjugated oligonucleotide or oligomeric duplex. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety. In certain embodiments, a cleavable moiety may be part of the oligonucleotide and comprises or consists of one or more linked nucleosides. In certain such embodiments, the one or more linked nucleosides are linked to one another and / or to the remainder of the oligonucleotide through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is either the 3' or 5'-terminal nucleoside of an oligonucleotide linked by a phosphodiester internucleoside linkage to an adjacent nucleoside of the oligonucleotide and covalently attached to the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety comprises 2'- deoxyadenosine. In certain embodiments, oligomeric agents described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligonucleotide is attached to the conjugate moiety using Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligonucleotide attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc.2012, 134(28), 11618-11631, which is incorporated by reference herein in its entirety). Additional conjugate linkers suitable for oligonucleotide conjugates are prepared by Click chemistry described in “Click Chemistry for Biotechnology and Materials Science” Ed. Joerg Laham, Wiley 2009, which is incorporated by reference herein in its entirety. H. Terminal Groups In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides and one or more terminal groups. As used herein, “terminal group” means a group of atoms that is covalently linked to a terminus of an oligonucleotide. Examples of a terminal group include, but are not limited to, a capping group, a phosphate moiety, a stabilized phosphate group, and a protecting group, wherein one or more groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’ and / or 5’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide and one or more terminal groups is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’ and / or 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 3’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide and a terminal group is attached at the 5’-end of the oligonucleotide. In certain embodiments, an oligonucleotide is linked to a terminal group comprising a stabilized 5’-phosphate. In certain embodiments, in an oligomeric duplex provided herein, the first modified oligonucleotide is linked to a terminal group comprising a stabilized phosphate moiety attached to the 5’ end of the oligonucleotide. The stabilized phosphate moiety results in stabilization of a 5’-phosphate moiety of the 5’-terminal nucleoside of an oligonucleotide, relative to the stability of an unmodified 5’-phosphate of an unmodified nucleoside under biologic conditions. Such stabilization of a 5’-phosphate group includes but is not limited to resistance to removal by phosphatases. Stabilized phosphate moieties, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonate, 5’- methylphosphonate, and 5’ cyclopropyl phosphonate. In certain embodiments, the stabilized phosphate moiety is a cyclopropyl phosphonate or an (E)-vinyl phosphonate. II. Target Nucleic Acids A. ATN1 In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of a target nucleic acid, wherein the target nucleic acid is ATN1. In certain embodiments, ATN1 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000012.12 truncated from nucleosides 6923463 to 6943321). In certain embodiments, contacting a cell with an oligomeric agent comprising a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of SEQ ID NO: 1 reduces the amount of ATN1 RNA in the cell, and in certain embodiments reduces the amount of atrophin-1 protein produced in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 results in reduced aggregation of atrophin-1 protein. In certain embodiments, the modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of a modified oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, the antisense oligonucleotide comprises the same number of nucleosides as the number of nucleosides in the target region of the ATN1 nucleic acid. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an ATN1 nucleic acid. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an ATN1 nucleic acid, and a sense oligonucleotide comprising a duplexing region that is complementary to the antisense oligonucleotide, or a region thereof. In certain embodiments, the target nucleic acid is an endogenous ATN1 RNA molecule. In certain embodiments, the ATN1 nucleic acid encodes atrophin-1 protein. In certain embodiments, the ATN1 nucleic acid is a precursor to a nucleic acid that encodes atrophin-1 protein. In certain such embodiments, the ATN1 nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the ATN1 RNA is a mature mRNA. In certain embodiments, the ATN1 nucleic acid is a pre-mRNA. In certain embodiments, an oligomeric agent is an RNAseH agent. In certain embodiments, antisense oligonucleotides provided herein are complementary to a target region of a ATN1 nucleic acid over the entire length of the modified oligonucleotide. In certain embodiments, antisense oligonucleotides are at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal length portion of the ATN1 nucleic acid. In certain embodiments, antisense oligonucleotides are at least 80% complementary to a target region of the ATN1 nucleic acid over the entire length of the antisense oligonucleotide and comprise a targeting region that is 100% or fully complementary to the target region of the ATN1 nucleic acid. In certain embodiments, a targeting region is from 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 nucleobases in length. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases. In certain embodiments, the targeting region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region constitutes all of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region of the antisense oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to a target region of the ATN1 nucleic acid. In certain embodiments, the targeting region of the antisense oligonucleotide is 100% complementary to a target region of the ATN1 nucleic acid. In certain embodiments, antisense oligonucleotides comprise one or more mismatches relative to the target region of the ATN1 nucleic acid. In certain embodiments, antisense activity against the target is reduced by such a mismatch, and activity against a non-target is reduced. In certain embodiments, activity against the non-target is reduced by a greater amount than activity against the target. Thus, in certain embodiments selectivity of the antisense oligonucleotides is improved. In certain embodiments, antisense oligonucleotides are at least 80% complementary to the target region of the ATN1 nucleic acid over the entire length of the antisense oligonucleotide and comprise no more than one to three mismatches with the ATN1 nucleic acid. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80% complementary to a target region of the ATN1 nucleic acid over the entire length of the targeting region, and the targeting region comprises no more than one to three mismatches with the target region. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target region of the ATN1 nucleic acid over the entire length of the targeting region. In certain embodiments, additional mismatches may be present at the termini of the antisense oligonucleotide, outside of the targeting region. In certain embodiments, a mismatch is specifically positioned within an antisense oligonucleotide. In certain embodiments, a mismatch is at position 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’- end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 from the 3’-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 1, 2, 3, or 4 from the 5’-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 4, 3, 2, or 1 from the 3’-end of the antisense oligonucleotide. In certain embodiments, contacting a cell with an oligomeric agent described herein complementary to SEQ ID NO: 1 reduces the amount of ATN1 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric agent described herein complementary to SEQ ID NO: 1 reduces the amount of ATN1 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell in a subject with an oligomeric agent described herein complementary to SEQ ID NO: 1 ameliorates one or more symptoms of a neurodegenerative disease or disorder associated with ATN1. In certain embodiments, the neurodegenerative disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the neurodegenerative disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA). In certain embodiments, the symptom is any of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, and abnormal pyramidal sign. In certain embodiments, an oligomeric agent described herein complementary to SEQ ID NO: 1 is capable of reducing the detectable amount of ATN1 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard cell assay. In certain embodiments, an oligomeric agent described herein complementary to SEQ ID NO: 1 is capable of reducing the detectable amount of ATN1 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound described herein complementary to SEQ ID NO: 1, is capable of reducing the detectable amount of ATN1 RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound described herein complementary to SEQ ID NO: 1, is capable of reducing the detectable amount of atrophin-1 protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. B. Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to a target region in an ATN1 nucleic acid, wherein the ATN1 nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the ATN1 nucleic acid is expressed in the cortex, spinal cord, globus pallidus, subthalamic nucleus, thalamus, inferior olive, substantia nigra, and the cerebellum. In certain embodiments, the cells are brain cells. In certain embodiments, the cells include neurons and oligodendrocytes. C. Oligonucleotide sequences Provided herein are oligomeric agents comprising modified oligonucleotides complementary to a target region in a ATN1 nucleic acid, such as, for example, a human ATN1 nucleic acid, such as SEQ ID NO: 1 (GenBank Accession No. NC_000012.12 truncated from nucleosides 6923463 to 6943321) and compositions comprising such oligomeric agents. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a targeting region that is 100% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is 100% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of any of SEQ ID NOs: 8 or 9. III. Methods and Uses A. Antisense Activity In certain embodiments, oligomeric agents provided herein comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric agents are antisense agents. In certain antisense activities, hybridization of an antisense oligonucleotide to a target nucleic acid results in recruitment of a protein, e.g., RNase H or Argonaute, that cleaves the target nucleic acid. Certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, oligomeric agents are antisense agents that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the antisense agent are tolerated and RNase H activity is retained. In certain embodiments, such antisense agents reduce or inhibit expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain antisense activities, an antisense oligonucleotide is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense agents that comprise an antisense oligonucleotide that is loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In certain embodiments, RNAi agents are capable of RISC-mediated modulation of a target nucleic acid in a cell. In certain embodiments, such RNAi agents reduce or inhibit the expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, RNAi agents selectively affect one or more target nucleic acid. Such RNAi agents comprise a modified oligonucleotide having a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity. In certain embodiments, an RNAi agent comprises a modified oligonucleotide that does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid (e.g., miRNA, lncRNA, sncRNA). In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in modulation of translation of the target nucleic acid. In certain embodiments, hybridization of an oligomeric compound to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in increased translation of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in reduced translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or a subject. B. Treatment, Prophylaxis In certain embodiments, provided herein are methods of reducing and / or inhibiting ATN1 expression, ATN1 RNA levels, and / or atrophin-1 protein levels and / or activity, in a subject having, or at risk of having, a disease or disorder associated with ATN1 and / or atrophin-1 protein, such as a polyglutamine (polyQ) disease or disorder associated with ATN1, wherein the method includes administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of an ATN1 nucleic acid thereby reducing expression of ATN1 nucleic acid in the subject. In certain embodiments, expression of ATN1 nucleic acid is reduced. In certain embodiments, administering such an oligomeric agent reduces ATN1 expression, ATN1 RNA levels, and / or atrophin-1 protein levels and / or activity in the plasma / serum blood, cerebrospinal fluid (CSF), spinal cord, or brain of the subject. In certain embodiments, administering such oligomeric agent reduces ATN1 expression, ATN1 RNA levels, and / or atrophin-1 protein levels and / or activity in the cortex, spinal cord, globus pallidus, subthalamic nucleus, thalamus, inferior olive, substantia nigra, and / or cerebellum of the subject. In some instances, such an oligomeric agent is administered parenterally. In some instances, an oligomeric agent is administered intravenously, subcutaneously, intramuscularly, or intrathecally. In some instances, an oligomeric agent is administered intrathecally. In certain embodiments, the detectable amount of the ATN1 RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of SEQ ID NO: 1 is capable of decreasing or reducing a detectable amount of atrophin- 1 protein in a cell, organ or tissue, e.g., the spinal cord or brain of the subject, when the compound is administered to the cell, a tissue, and / or subject. In certain embodiments, the detectable amount of atrophin-1 protein may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, provided herein are methods for preventing, treating, or delaying or preventing the development or progression of a disease or disorder associated with ATN1 and / or atrophin-1, such as a polyglutamine (polyQ) disease or disorder associated with ATN1, wherein the method comprises administering to a subject an oligomeric agent described herein comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of an ATN1 nucleic acid. Also provided are methods of ameliorating, preventing, or delaying the onset of, one or more symptoms associated with a disease or disorder associated with ATN1 and / or atrophin-1, such as a polyglutamine (polyQ) disease or disorder associated with ATN1, wherein the method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a nucleobase sequence complementary to a nucleobase sequence in an ATN1 nucleic acid. In certain embodiments, the polyglutamine (polyQ) disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA). In certain embodiments, a method of modulating expression of ATN1 or modulating atrophin-1 protein levels and / or activity in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of an ATN1 nucleic acid. In certain embodiments, a method of reducing expression of ATN1 or reducing atrophin-1 protein levels and / or activity in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region having a nucleobase sequence complementary to a target region of an ATN1 nucleic acid. In certain embodiments, the cell is a neuron or oligodendrocyte. In certain embodiments, the cell is a human cell. A polyglutamine (polyQ) disease or disorder associated with ATN1 is associated with neurological diseases or disorders, such as, for example, dentatorubral-pallidoluysian atrophy (DRPLA). Symptoms of a neurological disease or disorder include seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, and / or abnormal pyramidal sign. In certain embodiments, the polyglutamine (polyQ) disease or disorder is dentatorubral-pallidoluysian atrophy (DRPLA). In some embodiments, materials and methods provided herein improve at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign in the subject. In certain embodiments, the compounds, methods, and pharmaceutical compositions are useful in reducing a progression of dentatorubral-pallidoluysian atrophy (DRPLA). In certain embodiments, a method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a ATN1 nucleic acid. In certain embodiments, the subject has or is at risk for developing a neurological disease or disorder. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with ATN1. In certain embodiments, at least one symptom of the neurological disease or disorder is ameliorated. In certain embodiments, the at least one symptom is selected from seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, and abnormal pyramidal sign. In certain embodiments, administration of an oligomeric agent provided herein to the subject reduces or delays the onset or progression of at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. In certain embodiments, a method of treating a disease or disorder associated with ATN1 in a subject, such as a polyglutamine (polyQ) disease or disorder associated with ATN1, comprises administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of an ATN1 nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with ATN1. In certain embodiments, administering the therapeutically effective amount of the oligomeric agent improves at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign in the subject. In certain embodiments, at least one symptom of the polyglutamine (polyQ) disease or disorder associated with ATN1 is ameliorated. In certain embodiments, the at least one symptom is selected from seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, and abnormal pyramidal sign. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent to the subject reduces or delays the onset or progression of at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. In certain embodiments, a method of modulating expression of ATN1 nucleic acid, such as RNA, in a subject having or at risk of a disease or disorder associated with ATN1 comprises administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a ATN1 nucleic acid, thereby modulating expression of ANT1 nucleic acid in the subject. In certain embodiments, administering the oligomeric agent modulates expression of ATN1 in the spinal cord and / or brain. In certain embodiments, expression of ATN1 nucleic acid is inhibited and / or reduced. In certain embodiments, the subject has, or is at risk of having a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the subject has, or is at risk of having DRPLA. In certain embodiments, the polyglutamine (polyQ) disease or disorder associated with ATN1, such as DRPLA, is genetic, including extended CAG repeats (48 or more) in the ATN1 gene . In certain embodiments, administering the oligomeric agent improves seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. In certain embodiments, at least one symptom of the polyglutamine (polyQ) disease or disorder associated with ATN1 is ameliorated. In certain embodiments, the at least one symptom is selected from seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, and abnormal pyramidal sign. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent to the subject reduces or delays the onset or progression of at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a ATN1 nucleic acid, for use in treating a disease or disorder associated with ATN1 and / or atrophin-1. In certain embodiments, the disease or disorder associated with ATN1 is a neurological disease or disorder. In certain embodiments, the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the polyQ disease or disorder associated with ATN1 is DRPLA. In certain embodiments, DRPLA is genetic, including extended CAG repeats (48 or more) in the ATN1 gene. In certain embodiments, an oligomeric agent is for use in improving at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of an ATN1 nucleic acid, for the manufacture or preparation of a medicament for ameliorating, or delaying or preventing development or progression of a disease or disorder associated with ATN1 and / or for ameliorating, preventing or delaying the onset of one or more symptoms of a disease or disorder associated with ATN1, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder. In certain embodiments, the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the polyQ disease or disorder associated with ATN1 is DRPLA. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. In certain embodiments, DRPLA is genetic, including extended CAG repeats (48 or more) in the ATN1 gene. Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of an ATN1 nucleic acid, for the manufacture or preparation of a medicament for treating a disease or disorder associated with ATN1, for example, a polyglutamine (polyQ) disease or disorder associated with ATN1. In certain embodiments, the polyQ disease or disorder associated with ATN1 is DRPLA. In certain embodiments, DRPLA is genetic, including extended CAG repeats (48 or more) in the ATN1 gene. In certain embodiments, prophylactic administration of an oligomeric agent provided herein to a subject at risk for DRPLA, is able to prevent, ameliorate, postpone, or delay a symptom and / or development or progression of DRPLA. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving at least one of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign. In any of the methods or uses described herein, the oligomeric agent may be any oligomeric agent (e.g., an oligomeric agent comprising or consisting of a modified oligonucleotide, an antisense oligonucleotide, or oligomeric duplex, and optionally one or more conjugate and / or terminal groups) described herein. In certain embodiments, contacting a cell with an oligomeric agent reduces the amount of ATN1 RNA and / or atrophin-1 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. Methods of detecting the level of and / or measuring the amount of ATN1 RNA and / or atrophin-1 protein in a cell, organ, tissue, system or subject (e.g., subject) are described herein and / or known in the art. In some embodiments, the amount of ATN1 RNA is reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% in a cell (e.g., neuron and / or oligodendrocyte), organ (e.g., brain, spinal cord), tissue, system or subject (e.g., subject) that has been contacted with or administered an oligomeric agent provided herein (or a composition comprising such an oligomeric agent) compared to a control (e.g., a cell, organ, tissue, system or subject that has not been contacted with or administered the oligomeric agent, or was contacted with or administered a control substance (e.g., PBS)). In some embodiments, the percentage of ATN1 RNA decrease or reduction in a cell (e.g., a neuron or oligodendrocyte), organ (e.g., brain or spinal cord), tissue, system, or subject (e.g., subject) contacted with or administered an oligomeric agent or composition provided herein is 0.1% to 30% greater than or less than, 0.1% to 25% greater than or less than, 0.1% to 20% greater than or less than, 0.1% to 15% greater than or less than, 0.1% to 10% greater than or less than, or 0.1% to 5% greater than or less than, 0.1% to 1% greater than or less than, 5% to 40% greater than, 5% to 35% greater than, 10% to 40% greater than, at least 5% greater than, at least 10% greater than, at least 15% greater than, at least 20% greater than, at least 25% greater than, or at least 30% greater than the percentage of ATN1 RNA decrease or reduction in a cell (e.g., a cardiomyocyte), organ (e.g., a heart), tissue, system or subject (e.g., subject) contacted with or administered the same concentration or dose of a comparator agent. In some embodiments an oligomeric agent has ATN1 RNA and / or atrophin-1 protein reduction activity, and in particular embodiments, ATN1 RNA and / or atrophin-1 protein reduction activity in a target cell / organ / tissue / system that is comparable to or greater than the ATN1 RNA and / or atrophin-1 protein reduction activity of a comparator agent in the same target cell / organ / tissue / system. In certain embodiments, the comparator agent is an oligomeric agent that comprises a comparator modified oligonucleotide having a targeting region complementary to a target region of ATN1. In certain embodiments, the comparator modified oligonucleotide is complementary to the same or a similar target region as the modified oligonucleotide of the oligomeric agent. In certain embodiments, the comparator modified oligonucleotide is complementary to a different target region from the modified oligonucleotide of the oligomeric agent. In certain embodiments an oligomeric agent has neuron and / or oligodendrocyte ATN1 RNA and / or atrophin-1 protein reduction activity that is comparable to, or greater than, the neuron and / or oligodendrocyte ATN1 RNA and / or atrophin- 1 protein reduction activity of a comparator agent. In certain embodiments, an oligomeric agent has greater ATN1 RNA and / or atrophin-1 protein reduction activity (i.e., greater specificity of action) in a neurological target cell / organ / tissue / system (e.g., neuron, oligodendrocyte, cortex, spinal cord, globus pallidus, subthalamic nucleus, thalamus, inferior olive, substantia nigra, and the cerebellum) than ATN1 RNA and / or atrophin-1 protein reduction activity in a non-target (e.g., cardiovascular) cell / organ / tissue / system. For example, in some embodiments, administration of an oligomeric agent provided herein reduces the amount or activity of target cell / organ / tissue / system (e.g., neuron, oligodendrocyte, cortex, spinal cord, globus pallidus, subthalamic nucleus, thalamus, inferior olive, substantia nigra, and the cerebellum) ATN1 RNA and / or atrophin-1 protein at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control and has no, or a non-significant, effect on (e.g., reduction in) the amount or activity of ATN-1 RNA and / or atrophin-1 protein in a non-target cell / organ / tissue / system (e.g., cardiovascular, lung, liver). In some embodiments administration of an oligomeric agent reduces the amount or activity of target cell / organ / tissue / system (e.g., neuron, oligodendrocyte, cortex, spinal cord, globus pallidus, subthalamic nucleus, thalamus, inferior olive, substantia nigra, and the cerebellum) ATN-1 RNA and / or atrophin-1 protein 15% - 90% or more, 20% or more, 25% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more than it reduces the amount or activity of ATN-1 RNA and / or atrophin-1 protein in non-target cells / tissue. IV. Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agent described herein, wherein each oligomeric agent comprises or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agents comprise or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent consists of or comprises an antisense oligonucleotide. In certain embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable diluent. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and an oligomeric agent. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and phosphate-buffered saline (PBS). In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and water. In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and water. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and water. In certain embodiments, the water is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and water. In certain embodiments, the water is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent comprising or consisting of a modified oligonucleotide and sterile saline. In certain such embodiments, a pharmaceutical composition consists of such oligomeric agent and sterile saline. In certain embodiments, a pharmaceutical composition consists essentially of such oligomeric agent and sterile saline. In certain embodiments, the sterile saline is sterile PBS. In certain embodiments, the sterile saline is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and aCSF. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agent and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, an oligomeric agent may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salts of the oligomeric agent, esters of the oligomeric agent, or salts of such esters. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent comprising or consisting of one or more modified oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents provided herein, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide , wherein the conjugate group is cleaved, for example by endogenous nucleases, within the body. In certain embodiments, oligomeric agents are lyophilized and isolated, e.g., as sodium salts. In certain embodiments, a sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises saline, water, PBS, or aCSF. In certain embodiments, a sodium salt of an oligomeric agent is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric agent is a sodium salt of a modified oligonucleotide. Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, a nucleic acid, such as an oligomeric agent comprising a modified oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to muscle tissue. In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more oligomeric agents to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier or diluent and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, diluents, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” herein is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of a solution is adjusted with NaOH and / or HCl to achieve a desired pH. Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex, antisense agent) in milligrams indicates the mass of the free acid form of the compound. As described herein, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) is in solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. V. Agents A. Compound No.1744767 Compound No.1744767 is characterized as a 6-10-4 MOE gapmer consisting of 20 linked nucleosides and having a nucleobase sequence of (from 5’ to 3’) CCAAATCCCTATAGCCAGCT (SEQ ID NO: 8), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’-β-D- deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine. Compound No.1744767 is represented by the following chemical notation (from 5’ to 3’):mCesmCeoAeoAeoAeoTeomCdsmCdsmCdsTdsAdsTdsAdsGdsmCdsmCdsAeoGesmCesTe(SEQ ID NO: 10), wherein, A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’ MOE sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0009] Compound No.1744767 is represented by the following chemical structure: In certain embodiments, Compound 1744767 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, Compound 1744767 is a sodium salt or a potassium salt.

[0010] The sodium salt of Compound No.1744767 is represented by the following chemical structure: B. Compound No.1744769 Compound No.1744769 is characterized as a 6-10-4 MOE gapmer consisting of 20 linked nucleosides and having a nucleobase sequence of (from 5’ to 3’) TTATCCAAATCCCTATAGCC (SEQ ID NO: 9), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine. Compound No. 1744769 is represented by the following chemical notation (from 5’ to 3’): TesTeoAeoTeomCeomCeoAdsAdsAdsTdsmCdsmCdsmCdsTdsAdsTdsAeoGesmCesmCe(SEQ ID NO: 11), wherein, A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’ MOE sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage. Compound No.1744769 is represented by the following chemical structure: In certain embodiments, Compound 1744769 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, Compound 1744769 is a sodium salt or a potassium salt. The sodium salt of Compound No.1744769 is represented by the following chemical structure: Nonlimiting disclosure and incorporation by reference Each of the literature and patent publications listed herein is incorporated by reference in its entirety. While certain compounds, compositions, and methods have been described herein with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety. The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (i.e., 2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (i.e., thymine (5-methyl uracil) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither OH nor H. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds. Herein, the description of compounds as having “the nucleobase sequence of” a SEQ ID NO. describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or internucleoside linkage modifications or presence or absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of” a SEQ ID NO. include such compounds having modified forms of the identified nucleobases as described herein. Herein, the description of compounds by chemical notation (subscripts and / or superscripts to indicate chemical modifications) without reference to a specific Compound No. include only each noted modification, but may include additional substituents, such as a conjugate group, unless otherwise indicated. For example, the chemical notation of “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group. Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and internucleoside linkage of such specific compound is modified only as indicated. Accordingly, in the context of a description of a specific compound having a particular Compound No., “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents. Herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds). Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds. While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description. The compounds described herein include variations in which one or more atoms are replaced with a non- radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging. Examples The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated. Example 1: Design of modified oligonucleotides complementary to a human ATN1 RNA Modified oligonucleotides complementary to a human ATN1 RNA were designed and synthesized as indicated in the tables below. “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GenBank Accession No. NC_000012.12 truncated from nucleosides 6923463 to 6943321). The modified oligonucleotides in the table below are 6-10-4 MOE gapmers with mixed PS / PO internucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeeddddddddddeeee; wherein “e” represents a ribo-2’-MOE sugar moiety and each “d” represents a 2’-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooooossssssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. Table 1 6-10-4 MOE gapmers with mixed PS / PO internucleoside linkages complementary to human ATN1 SEQ ID SEQ ID Compound No. NO: 1 NO: 1 Start Stop Sequence (5' to 3') SEQ ID NO Example 2: Activity of modified oligonucleotides complementary to human ATN1 in transgenic mice, 8 weeks Modified oligonucleotides from the above example were analyzed for their effects on ATN1 mRNA in humanized ATN1 mice where the human ATN1 gene is knocked into the mouse Atn1 locus via CRISPR / Cas-9-mediated gene editing on a C57BL / 6NTac background. The line was generated by Taconic and is called C57BL / 6NTac- Atn1em7219(ATN1)Tac, and is herein referred to as ATN1 transgenic mice. ATN1 transgenic mice were divided into groups of 4 mice. Each mouse received a single ICV bolus of 300 µg. A group of 4 mice received a single ICV bolus with PBS as a negative control. Eight weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for quantitative real-time RTPCR analysis of RNA expression of ATN1 using human primer probe set RTS40640 (forward sequence AGGAGACCAATGCACCAAA, designated herein as SEQ ID NO: 2; reverse sequence GCTTCGGTTGTCCTGGTC, designated herein as SEQ ID NO: 3; probe sequence CCGAGGGAGTTCCTGCTCAGTTT, designated herein as SEQ ID NO: 4). ATN1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 5; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 6; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 7). Results are presented as percent human ATN1 RNA relative to the amount of ATN1 RNA in PBS treated animals, (% control). Table 2 Reduction of human ATN1 RNA in ATN1 transgenic mice ATN1 RNA (% control) Example 3: Effect of modified oligonucleotides on human ATN1 in vitro, multiple doses Modified oligonucleotides described above were tested at various doses in A431 cells. Cultured A431 cells plated at a density of 20,000 cells / well were treated with modified oligonucleotides at various concentrations as indicated in the tables below using free uptake. After a treatment period of approximately 72 hours, RNA was isolated from the cells and ATN1 RNA levels were measured by quantitative real-time PCR. ATN1 RNA levels were measured by the human primer probe set RTS40640 (forward sequence AGGAGACCAATGCACCAAA, designated herein as SEQ ID NO: 2; reverse sequence GCTTCGGTTGTCCTGGTC, designated herein as SEQ ID NO: 3; probe sequence CCGAGGGAGTTCCTGCTCAGTTT, designated herein as SEQ ID NO: 4). ATN1 RNA levels were normalized to human GAPDH. Human GAPDH was amplified using human primer probe set RTS104 (described herein above). Results are presented as percent ATN1 RNA, relative to the amount of ATN1 RNA in untreated control cells (%UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using GraphPad Prism software (GraphPad Software, San Diego, CA) and is presented in the table below. Table 3 Dose-dependent reduction of ATN1 RNA by modified oligonucleotides in A431 cells Compound ATN1 RNA (% UTC) IC50(µM) No. 5nM 13nM 33nM 82nM 205nM 512nM 1280nM 3200nM 8000 nM 20000nM

Claims

CLAIMS 1. A modified oligonucleotide according to the following chemical structure:

2. The modified oligonucleotide of claim 1, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

3. The modified oligonucleotide of claim 2, which is the sodium salt or the potassium salt.

4. A modified oligonucleotide according to the following chemical structure:

5. A modified oligonucleotide according to the following chemical structure: ONH2O N NH N NH N O O6. The modified oligonucleotide of claim 5, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

7. The modified oligonucleotide of claim 6, which is the sodium salt or the potassium salt.

8. A modified oligonucleotide according to the following chemical structure:

9. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation:mCesmCeoAeoAeoAeoTeomCdsmCdsmCdsTdsAdsTdsAdsGdsmCdsmCdsAeoGesmCesTe(SEQ ID NO: 10), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase; G = a guanine nucleobase; T = a thymine nucleobase; e = a 2’-MOE sugar moiety; d = a 2’-β-D-deoxyribosyl sugar moiety; s = a phosphorothioate internucleoside linkage; and o = a phosphodiester internucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

10. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: TesTeoAeoTeomCeomCeoAdsAdsAdsTdsmCdsmCdsmCdsTdsAdsTdsAeoGesmCesmCe(SEQ ID NO: 11),wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase; G = a guanine nucleobase; T = a thymine nucleobase; e = a 2’-MOE sugar moiety; d = a 2’-β-D-deoxyribosyl sugar moiety; s = a phosphorothioate internucleoside linkage; and o = a phosphodiester internucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

11. A population of modified oligonucleotides of any one of claims 1-8 or an oligomeric agent of any one of claims 9-10, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

12. A pharmaceutical composition comprising a modified oligonucleotide of any one of claims 1-8, an oligomeric agent of any one of claims 9-10, or a population of claim 11, and a pharmaceutically acceptable diluent.

13. The pharmaceutical composition of claim 12, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

14. The pharmaceutical composition of claim 12 or claim 13, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.

15. The pharmaceutical composition of any one of claims 12-14, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric agent, or the population and phosphate-buffered saline.

16. The pharmaceutical composition of any one of claims 12-14, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric agent, or the population and artificial cerebrospinal fluid.

17. A method comprising administering to a subject a modified oligonucleotide of any one of claims 1-8, a subject an oligomeric agent of any one of claims 9-10, a population of claim 11, or a pharmaceutical composition of any one of claims 12-16.

18. The method of claim 17, wherein the subject has or is at risk for developing a disease or disorder associated with ATN1.

19. The method of claim 17 or claim 18, wherein administering the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease or disorder associated with ATN1 in the subject.

20. The method of any one of claims 17-19, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition reduces or slows progression of seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception,nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign.

21. The method of any one of claims 17-20, wherein ATN1 protein levels in the subject are reduced.

22. The method of any one of claims 17-21, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder.

23. The method of any one of claims 17-22, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1.

24. The method of any one of claims 17-23, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA).

25. A method of treating a disease or disorder associated with ATN1 comprising administering to a subject having or at risk for developing a disease or disorder associated with ATN1 a therapeutically effective amount of a modified oligonucleotide of any one of claims 1-8, an oligomeric agent of any one of claims 9-10, a population of claim 11, or a pharmaceutical composition of any one of claims 12-16, thereby treating the disease or disorder associated with ATN1.

26. The method of claim 25, wherein administering the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease or disorder associated with ATN1.

27. The method of claim 26, wherein the symptom is seizures, ataxia, myoclonus, choreoathetosis, dementia, epilepsy, intellectual impairment, psychiatric symptoms, neuronal atrophy and dysfunction, action tremor, fetal cystic hygroma, atrophy of the dentate nucleus, dysarthria, dysdiadochokinesis, dysmetria, dyssynergia, hyperintensity of cerebral white matter on MRI, hyporeflexia, impaired proprioception, nystagmus, ophthalmoparesis, optic neuropathy, saccadic smooth pursuit, blepharospasm, memory impairment, oromandibular dystonia, or abnormal pyramidal sign.

28. The method of any one of claims 25-27, wherein the modified oligonucleotide, the oligomeric agent, the population, or the pharmaceutical composition is administered to the central nervous system or systemically.

29. The method of any one of claims 25-28, wherein ATN1 protein levels in the subject are reduced.

30. The method of any one of claims 25-29, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder.

31. The method of any one of claims 25-30, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder associated with ATN1.

32. The method of any one of claims 25-31, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA).

33. The method of any one of claims 25-32, wherein the subject is human.

34. A method of reducing expression of ATN1 in a cell comprising contacting the cell with a modified oligonucleotide of any one of claims 1-8, an oligomeric agent of any one of claims 9-10, a population of claim 11, or a pharmaceutical composition of any one of claims 12-16.

35. The method of claim 34, wherein the cell is a brain cell.

36. The method of claim 34 or claim 35, wherein the cell is a human cell.

37. Use of a modified oligonucleotide of any one of claims 1-8, an oligomeric agent of any one of claims 9- 10, a population of claim 11, or a pharmaceutical composition of any one of claims 12-16 for treating a disease or disorder associated with ATN1.

38. Use of a modified oligonucleotide of any one of claims 1-8, an oligomeric compound of any one of claims 9-10, a population of claim 11, or a pharmaceutical composition of any one of claims 12-16 in the manufacture of a medicament for treating a disease or disorder associated with ATN1.

39. The use of any one of claims 37-38, wherein the disease or disorder is associated with an elevated level of ATN1.

40. The use of any one of claims 37-39, wherein the disease or disorder associated with ATN1 is a neurological disease or disorder.

41. The use of any one of claims 37-40, wherein the disease or disorder associated with ATN1 is a polyglutamine (polyQ) disease or disorder.

42. The use of any one of claims 37-41, wherein the disease or disorder associated with ATN1 is dentatorubral-pallidoluysian atrophy (DRPLA).

Images