Pharmaceutical preparations for treating bietti's crystalline dystrophy

Abstract

Pharmaceutical formulations for the treatment of crystalline-like retinal degeneration (BCD) comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate and water for injection, and having a pH of 7.0-7.6. The pharmaceutical preparation has extremely good virus titer stability, extremely few AAV aggregates, high mRNA expression of target genes after multiple freezing and thawing and / or excellent high-temperature stability, animal in-vivo experiments prove that the formula preparation has excellent performance in the aspect of reducing local inflammatory response of retina, and further clinical tests prove that the formula preparation has good clinical application prospects in the aspect of reducing local inflammatory response of retina. The pharmaceutical preparation provided by the invention conforms to the technical specifications of related safety and effectiveness of Chinese pharmacopoeia and United States Pharmacopoeia (USP).

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202380101102.X (22) Application Date 2023.08.09 (85) PCT International Application Entering National Phase Date 2026.02.04 (86) PCT International Application Application Data PCT / CN2023 / 111972 2023.08.09 (87) PCT International Application Publication Data WO2025 / 030426 EN 2025.02.13 (71) Applicant Beijing Zhongyin Technology Co., Ltd. Address Building 1, No. 27, Life Science Park Road, Changping District, Beijing 102206 (72) Inventors Zhong Xiancheng, Chen Shaohong, Zhang Shixian (74) Patent Agency Beijing Qingmai Intellectual Property Agency (General Partnership) 16371 Patent Attorney Wu Xiaoming (51) Int.Cl. A61K 48 / 00 (2006.01) A61K 38 / 44 (2006.01) A61K 9 / 08 (2006.01) A61K 47 / 10 (2006.01) A61K 47 / 02 (2006.01) A61P 27 / 02 (2006.01) (54) Invention Title: Pharmaceutical Preparation for Treating Crystalline Retinal Degeneration (57) Abstract: A pharmaceutical preparation for treating crystalline retinal degeneration (BCD) comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate and water for injection, and having a pH of 7.0 to 7.6. The pharmaceutical formulation of the present invention exhibits excellent viral titer stability, minimal AAV aggregates, high mRNA expression of the target gene after multiple freeze-thaw cycles, and / or excellent high-temperature stability. Furthermore, in vivo animal experiments have demonstrated that the formulation of the present invention performs excellently in reducing local retinal inflammation. Further clinical trials have shown that the pharmaceutical formulation of the present invention complies with the relevant safety and efficacy technical specifications of the Chinese Pharmacopoeia and the United States Pharmacopeia (USP). Claims: 2 pages; Description: 22 pages; Sequence Listing (electronic publication); Figures: 7 pages. CN 121646483 A 2026.03.10 CN 1 21 64 64 83 A 1. A pharmaceutical formulation comprising: a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, wherein the pH of the pharmaceutical formulation is approximately 7.0 to 7.6. 2. The pharmaceutical formulation according to claim 1, wherein the recombinant AAV virus comprises an AAV vector encoding a polynucleotide of CYP4V2 expressed via a promoter as a genomic sequence, preferably the AAV vector comprising, in a 5' to 3' direction,:The pharmaceutical formulation of claim 2, wherein the CAG promoter comprises the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of the CYP4V2 comprises the amino acid sequence shown in SEQ ID NO: 2, preferably the polynucleotide encoding the CYP4V2 comprises the nucleotide sequence shown in SEQ ID NO: 3; and / or the polyadenylated nucleotide signal site comprises a BGH polyA signal, preferably the nucleotide sequence shown in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as shown in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding the CYP4V2; most preferably the AAV vector further comprises the same or different inverted terminal repeat (ITR) sequences on the 5' side of the CAG promoter and on the 3' side of the polyadenylated nucleotide signal site, preferably the ITR sequence is from AAV2. 4. The pharmaceutical formulation according to any one of claims 2 to 3, wherein the AAV vector comprises, in the 5' to 3' orientation, the following genomic sequence: ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably comprising the genomic sequence shown in SEQ ID NO: 6; and / or the serotype of the capsid protein of the recombinant AAV virus is AAV8. 5. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the capsid protein of the recombinant AAV virus is the AAV8 capsid protein, which is composed of 60 capsid protein subunits, wherein the capsid protein subunits comprise an amino acid sequence of VP1 as shown in SEQ ID NO: 7, an amino acid sequence of VP2 as shown in SEQ ID NO: 8, and an amino acid sequence of VP3 as shown in SEQ ID NO: 9, in a ratio of 1:1:10. 6. The pharmaceutical formulation according to any one of claims 1 to 5, wherein the pharmaceutical formulation is in the form of an injectable aqueous solution, and / or the titer of the recombinant AAV virus in the pharmaceutical formulation is about 1.0 × 10¹¹ vg / ml to about 1.0 × 10¹³ vg / ml, preferably about 2.0 × 10¹¹ vg / ml to about 8.0 × 10¹² vg / ml, more preferably about 2.5 × 10¹¹ vg / ml to about 2.0 × 10¹² vg / ml, for example, about 2.5 × 10¹¹ vg / ml, about 1.0 × 10¹² vg / ml and about 2.0 × 10¹² vg / ml, and even more preferably about 2.5 × 10¹¹ vg / ml, about 5.0 × 10¹¹ vg / ml or about 1.0 × 10¹² vg / ml.7. The pharmaceutical formulation according to any one of claims 1 to 6, wherein the poloxamer comprises poloxamer 188, preferably at a concentration of about 0.0001% to 0.01% by weight, more preferably about 0.0002% to 0.005% by weight, and most preferably about 0.001% by weight, based on the weight of the pharmaceutical formulation. 8. The pharmaceutical formulation according to any one of claims 1 to 7, wherein the concentration of sodium chloride in the pharmaceutical formulation is about 120 mM to 360 mM, preferably about 150 mM to 180 mM, and most preferably 150 mM. 9. The pharmaceutical formulation according to any one of claims 1 to 8, wherein 1) the phosphate is selected from disodium hydrogen phosphate or its hydrate, sodium dihydrogen phosphate or its hydrate, dipotassium hydrogen phosphate or its hydrate, potassium dihydrogen phosphate or its hydrate, sodium phosphate or its hydrate, potassium phosphate or its hydrate, or any combination thereof, preferably a combination of disodium hydrogen phosphate or its hydrate and sodium dihydrogen phosphate or its hydrate, or a combination of dipotassium hydrogen phosphate or its hydrate and potassium dihydrogen phosphate or its hydrate, more preferably a combination of disodium hydrogen phosphate or its hydrate (e.g., disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or its hydrate (e.g., sodium dihydrogen phosphate monohydrate), preferably a molar ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2; and / or 2) the concentration of the phosphate in the pharmaceutical formulation, based on all phosphates in the pharmaceutical formulation, is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, and most preferably about 10 mM. Claims 1 / 2 Page 2 CN 121646483 A 10. A pharmaceutical preparation according to any one of claims 1 to 9, wherein it is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 120 to about 360 mM sodium chloride, about 0.001 wt% poloxamer 188, about 10 mM phosphate and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH of the pharmaceutical preparation is about 7.3. 11. A pharmaceutical preparation according to claim 10, comprising the recombinant AAV virus, about 150 mM sodium chloride, about 0.001 wt% poloxamer 188, about 10 mM phosphate and water for injection, and the pH of the pharmaceutical preparation is about 7.3, wherein the phosphate comprises about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate. 12. The pharmaceutical preparation according to any one of claims 1 to 11, wherein it is a colorless, clear, and transparent liquid, and has an osmotic pressure of about 270 to about 330 mOsmol / kg. 13. A method for treating, alleviating, and / or preventing diseases or conditions associated with retinal pigment epithelium (RPE) atrophy.The method comprises administering to a subject a therapeutically effective amount of the pharmaceutical preparation according to any one of claims 1 to 12. 14. The method according to claim 13, wherein the disease or condition is crystalline retinal degeneration (BCD), preferably the subject is a human. 15. The method according to claim 14, wherein the pharmaceutical preparation is for subretinal intravenous injection, preferably the injection volume is about 50 to 300 μL; the dosage is about 1 x 10¹⁰ vg / eye to 1 x 10¹² vg / eye, preferably about 5 x 10¹⁰ vg / eye to about 2.5 x 10¹¹ vg / eye. Claims 2 / 2 Page 3 CN 121646483 A Pharmaceutical Preparation for Treating Crystalline Retinal Degeneration Technical Field

[0001] The present invention relates to a pharmaceutical composition for subretinal intravenous injection to treat crystalline retinal degeneration (BCD), comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer and phosphate buffer. Background Art

[0002] Bietti's crystalline dystrophy (BCD) is a rare retinal degeneration disease. Its symptoms mainly include the lens (a transparent covering) in the cornea, small, yellow or white crystalline deposits in the light-sensitive tissues of the retina, and progressive atrophy of the retina, choroidal capillaries, and choroid. The deposits damage the retina, leading to gradual vision loss. Studies have shown that BCD is a genetic disease caused by mutations in the CYP4V2 gene. It is generally believed that mutations in the CYP4V2 gene disrupt the function of enzymes involved in fatty acid metabolism, thereby affecting lipid breakdown.

[0003] The applicant previously filed Chinese patent CN113106124B, which discloses a recombinant AAV virus expressing CYP4V2, comprising an AAV (adeno-associated virus) vector that expresses a polynucleotide encoding CYP4V2 via a promoter. Experiments have shown that this recombinant AAV vector can have good expression effects, fast expression speed, and more stable expression intensity. It can not only be expressed in RPE cells of the retina, but also effectively expressed in the photoreceptor cell layer, with a wide expression range. It can effectively reduce lipid deposition in RPE cells with CYP4V2 gene mutation, thus it can be used to treat BCD.

[0004] In the development and application of drugs, the formulation components play a crucial role in the stability and compatibility of the biologically active components of the drug. For formulations containing recombinant AAV virus, unsuitable formulations may cause instability of AAV capsid proteins, leading to the release of the genome, which can be reflected in the viral titer stability; or it may cause AAV aggregation to form aggregates, which can be reflected in the AAV particle size (see Figure 1). At the same time, formulations containing recombinant AAV virus inThe manufacturing, transportation, and use processes may involve repeated freeze-thaw cycles and high-temperature processes, which pose challenges to the stability of the formulation.

[0005] In July 2021, the US gene therapy company Adverum suspended its clinical trial of the AAV gene therapy drug ADVM-022 for the treatment of diabetic retinopathy macular edema (DME) due to serious adverse reactions such as inflammation in the subjects. Therefore, recombinant AAV virus formulations, especially when used for ocular administration, must have low immunostimulatory activity to be suitable for clinical application. In addition, immune responses can significantly reduce transduction efficiency, which can reduce the efficacy of the administered gene therapy and / or require higher doses.

[0006] For gene therapy products using AAV as a vector, there is no fixed formulation and excipients in the art, because the effects of various excipients on the stability, safety, and efficacy of different types of AAV products are often irregular. It is necessary to design and conduct experimental studies based on the specific properties of the recombinant AAV virus in order to find a suitable, safe, stable, and effective formulation.

[0007] Regarding the recombinant AAV viral vector for treating BCD in the aforementioned Chinese patent CN113106124B, since it is usually administered via subretinal injection, there is a need to develop a pharmaceutical formulation / injection composition for treating crystalline retinal degeneration that has good stability, safety (e.g., low retinal irritation) and efficacy. Summary of the Invention

[0008] Therefore, the problem solved by this invention is to provide a pharmaceutical formulation for treating crystalline retinal degeneration that has excellent viral titer stability, very few AAV aggregates, high mRNA expression of the target gene after multiple freeze-thaw cycles, and / or excellent high-temperature stability. Furthermore, in vivo animal experiments have demonstrated that the formulation of this invention performs excellently in reducing local retinal inflammation. Further clinical trials have demonstrated that the pharmaceutical formulation of this invention complies with the relevant safety and efficacy specifications of the Chinese Pharmacopoeia and the United States Pharmacopeia (USP).

[0009] The solution to this problem is based on the fact that the inventors have discovered that, for the AAV gene therapy drug of the present invention, specific types of buffer systems (such as phosphate buffer systems), specific types of stabilizers (such as poloxamer, especially poloxamer 188), specific salt ion concentrations, specific pH values, or combinations thereof are crucial for obtaining a stable, safe, and minimally irritating ocular (retinal) formulation.

[0010] Therefore, a first aspect of the present invention relates to a pharmaceutical preparation comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, wherein the pH of the pharmaceutical preparation is approximately 7.0 to 7.6.

[0011] In some embodiments, the recombinant AAV virus comprises an AAV vector (i.e., a packaged recombinant AAV genome) that expresses a polynucleotide encoding CYP4V2 via a promoter. Preferably, the AAV vector comprises, in a 5' to 3' orientation, a promoter, a polynucleotide encoding CYP4V2, and a polyadenylate signal site, wherein the promoter is operatively linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0012] In some embodiments, the CAG promoter comprises the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence shown in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence shown in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence shown in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as shown in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably the AAV vector further comprises the same or different ITR sequences on the 5' side of the CAG promoter and on the 3' side of the polyadenylation signal site, preferably the ITR sequence is from AAV2.

[0013] In some embodiments, the AAV vector comprises the following genomic sequence in the 5' to 3' direction: ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably including the genomic sequence shown in SEQ ID NO: 6; and / or the serotype of the capsid protein of the recombinant AAV virus is AAV8. In a preferred embodiment, the capsid protein of the recombinant AAV virus is the AAV8 capsid protein, which is composed of 60 capsid protein subunits, the capsid protein subunits comprising the amino acid sequences VP1 as shown in SEQ ID NO: 7, VP2 as shown in SEQ ID NO: 8, and VP3 as shown in SEQ ID NO: 9 in a ratio of 1:1:10.

[0014] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, and / or the titer of the recombinant AAV virus in the pharmaceutical preparation is about 1.0 × 10¹¹ vg / ml to about 1.0 × 10¹³ vg / ml, preferably about 2.0 × 10¹¹ vg / ml to about 8.0 × 10¹² vg / ml, more preferably about 2.5 × 10¹¹ vg / ml to about 2.0 × 10¹² vg / ml, for example, about 2.5 × 10¹¹ vg / ml, about 1.0 × 10¹² vg / ml and about 2.0 × 10¹² vg / ml, and even more preferably about 2.5 × 10¹¹ vg / ml and about 5.0 × 10¹¹ vg / ml.vg / ml or about 1.0 × 10¹² vg / ml.

[0015] In some embodiments, the poloxamer includes poloxamer 188, preferably at a concentration of about 0.0001% by weight to about 0.01% by weight, preferably about 0.0002% by weight to about 0.005% by weight, and most preferably about 0.001% by weight, based on the weight of the pharmaceutical preparation.

[0016] In some embodiments, the concentration of sodium chloride in the pharmaceutical preparation (injectable aqueous solution) is about 120 to about 360 mM, preferably about 150 mM to about 180 mM, and most preferably about 150 mM.

[0017] In some embodiments, the phosphate is selected from disodium hydrogen phosphate or its hydrate, sodium dihydrogen phosphate or its hydrate, dipotassium hydrogen phosphate or its hydrate, potassium dihydrogen phosphate or its hydrate, sodium phosphate or its hydrate, potassium phosphate or its hydrate, or any combination thereof, preferably a combination of disodium hydrogen phosphate or its hydrate and sodium dihydrogen phosphate or its hydrate, or a combination of dipotassium hydrogen phosphate or its hydrate and potassium dihydrogen phosphate or its hydrate, more preferably a combination of disodium hydrogen phosphate or its hydrate (disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or its hydrate (sodium dihydrogen phosphate monohydrate), preferably with a molar ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2; and / or the concentration of the phosphate in the pharmaceutical preparation, based on all phosphates in the pharmaceutical preparation, is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM. mM, most preferably about 10 mM.

[0018] In some embodiments, the pH of the pharmaceutical preparation of the present invention is about 7.0 to 7.6, preferably about 7.0, about 7.2, about 7.3 or about 7.6, most preferably about 7.3.

[0019] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 120 to about 360 mM of sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM of phosphate and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH is about 7.3.

[0020] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, approximately 150 mM sodium chloride, approximately 0.001% by weight of poloxamer 188, approximately 10 mM phosphate, and water for injection, and having a pH of approximately 7.3, wherein the phosphate comprises approximately 8 mM disodium hydrogen phosphate dodecahydrate and approximately 2 mM sodium dihydrogen phosphate monohydrate.

[0021] In some embodiments, the pharmaceutical preparation is a colorless, clear, transparent liquid, and / or has an osmotic pressure of approximately 270 to approximately 330 mOsmol / kg.

[0022] In a second aspect, the present invention relates to a method for treating, alleviating, and / or preventing a disease or condition associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical preparation described above.

[0023] In some embodiments, the disease or condition is crystalline retinal degeneration (BCD).

[0024] In some embodiments, the subject is a human.

[0025] In some embodiments, the pharmaceutical preparation is administered via subretinal intravenous injection, preferably in a volume of about 50 to 300 μL; the dosage is about 1 x 10¹⁰ vg / eye to about 1 x 10¹² vg / eye, preferably about 5 x 10¹⁰ vg / eye to about 2.5 x 10¹¹ vg / eye.

[0026] The present invention also provides the pharmaceutical preparation described above for treating, alleviating, and / or preventing a disease or condition associated with retinal pigment epithelium (RPE) atrophy in a subject, preferably for treating, alleviating, and / or preventing crystalline retinal degeneration (BCD), more preferably in a human subject.

[0027] Other aspects and advantages of this application will be readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive.

[0028] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which: Figure 1 is a schematic diagram of the release of the genome due to the instability of the AAV capsid protein in the formulation and the formation of aggregates by AAV aggregation; Figure 2 is the particle size detection results of ZVS101e in different formulations; Figure 3 is the denaturation curve of ZVS101e in different formulations; Figure 4 is the aggregation curve of ZVS101e in different formulations; Figure 5 is the mRNA expression of the target gene (CYP4V2) after freeze-thaw in different formulations; Figure 6 is the mRNA expression of the target gene (CYP4V2) after high-temperature storage in different formulations; Figure 7 is a color photograph of the fundus of mice 2 weeks after subretinal intracavitary administration in Example 4; Figure 8 is a color photograph of the fundus and OCT of mice 2 weeks after subretinal intracavitary administration in Example 5; Figure 9 is the mRNA expression level of transgenic hCYP4V2 (human CYP4V2) in the retina and RPE layer of mice in each group in Example 5; Figure 10 shows the mRNA expression levels of endogenous mCYP4V3 in the retina and RPE layer of mice in each group in Example 5; Figure 11 shows the mRNA expression levels of inflammatory factors mCD11b and mNLRP3 in the retina and RPE layer of mice in each group in Example 5.Figure 12 shows the improvement in the number of ETDRS letters in some patients in Example 7. Detailed Description

[0029] Terminology Definitions Unless otherwise indicated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in the art, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0030] In this application, the term “AAV” is the standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells, where some functions are provided by co-infected helper viruses. General information and reviews of AAV can be found, for example, in Carter, 1989, *Handbook of Parvoviruses*, Vol. 1, pp. 169–228, and Berns, 1990, *Virology*, pp. 1743–1764, Raven Press, (New York).

[0031] In this application, the term “AAV vector” generally refers to a vector containing one or more polynucleotides (or transgenes) of interest flanked by an AAV terminal repeat sequence (ITR). When present in a host cell that has been transfected with a vector encoding and expressing the rep and cap gene products, such AAV vectors can be replicated and packaged into infectious viral particles. The terms “recombinant AAV virus” or “recombinant AAV viral particle” or “AAV vector particle” refer to a viral particle composed of at least one AAV capsid protein and a capsidated polynucleotide AAV vector. If the particle contains heterologous polynucleotides (i.e., polynucleotides other than the wild-type AAV genome, such as transgenes to be delivered into mammalian cells), then it is generally referred to as an "AAV vector particle" or simply an "AAV vector." Therefore, the production of an AAV vector particle necessarily includes the production of an AAV vector such that the vector is contained within the AAV vector particle.

[0032] In this application, the term "promoter" generally refers to a deoxyribonucleic acid (DNA) sequence that enables the transcription of a specific gene. A promoter can be recognized by RNA polymerase and initiate transcription to synthesize RNA. In ribonucleic acid (RNA) synthesis,Promoters can interact with transcription factors that regulate gene transcription, controlling the initiation time and extent of gene expression (transcription). A promoter contains a core promoter region and a regulatory region, located in the regulatory sequence controlling gene expression, upstream of the gene transcription start site (5' direction of the DNA antisense strand), and does not itself have a coding function.

[0033] In this application, the term "operable linking" generally refers to placing a regulatory sequence necessary for the expression of a coding sequence in an appropriate position relative to the coding sequence to achieve the expression of the coding sequence. For example, the first nucleic acid sequence is operably linked to the second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. In some embodiments, page 4 / 22 of the specification 7 CN 121646483 A can represent the arrangement of coding sequences and transcriptional control elements in an expression vector. The control elements may include promoters, enhancers, and termination elements. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. In some embodiments, "operable linking" can also refer to the linking of the target gene to a vector, enabling the transcription and translation control sequences within the vector to perform their intended functions of regulating the transcription and translation of the target gene.

[0034] In this application, the term "CYP4V2" generally refers to a protein, which is member 2 of subfamily V of the cytochrome P450 family 4. The term "cytochrome P450," also known as cytochrome P450 or CYP450, generally refers to a family of heme proteins, belonging to a class of monooxygenases, which participate in the metabolism of endogenous substances or exogenous substances including drugs and environmental compounds. According to the degree of homology of amino acid sequences, its members are divided into three levels: family, subfamily, and enzyme individual. The cytochrome P450 enzyme system can be abbreviated as CYP, where the family is represented by Arabic numerals, the subfamily by uppercase English letters, and the enzyme individual by Arabic numerals, such as CYP4V2 in this application. The human CYP4V2 gene (HGNC: 23198) is 19.28 kb in length, located at 4q35, and has 11 exons. It plays an important role in fatty acid metabolism (Kumar S., Bioinformation, 2011, 7:360-365). CYP4V2 is expressed in almost all tissues, but is expressed at high levels in the retina and retinal pigment epithelium, while it is expressed at slightly lower levels in the cornea. Mutations in the CYP4V2 gene may be associated with crystalline retinal degeneration and / or retinitis pigmentosa.

[0035] In this application, the term "polyadenylation sequence," also known as the polyadenylation tail, generally refers to a single adenosine chain of tens to hundreds of nucleotides added to the 3' end of the transcribed mRNA. Polyadenylation usually occurs during de-oxidation.During and after the transcription of ribonucleic acid (DNA) into ribonucleic acid (RNA) in the cell nucleus, this reaction is usually carried out by polyadenylate polymerase. In eukaryotes, polyadenylation is a mechanism that can interrupt the 3' end of the mRNA molecule. The polyadenylate sequence can protect the mRNA from exonuclease attack and is very important for the nuclear export, translation and stability of mRNA.

[0036] In this application, the term "polyadenylate signal site" generally refers to a base sequence located at the 3' end of messenger RNA (mRNA) that can be recognized by polyadenylation-associated cleavage factors. It is usually also a cis-regulatory signal on the mRNA. Generally, the tailing process (i.e., polyadenylation) begins after transcription termination. Under the regulation of the polyadenylate signal site, the polyadenylation-associated cleavage factor adds tens to hundreds of single adenosine nucleotides to the 3'UTR of the mRNA. Common tailing signals include SV40, BGH, HSV, TK signals, etc.

[0037] In this application, the term "prevention" generally refers to the prophylactic administration of a pharmaceutical preparation to a healthy subject to prevent the occurrence of a disease or condition. It may also include the prophylactic administration of a pharmaceutical preparation to a patient in the pre-treatment stage of an allergic disease to be treated. "Prevention" does not require 100% elimination of the possibility of the disease or condition occurring; in other words, "prevention" generally means that the possibility of the disease or condition occurring is reduced in the presence of the administered pharmaceutical preparation.

[0038] In this application, the term "relief" means reduction, shortening, or delay of a symptom, disease, condition, or phenotype. The symptom, disease, condition, or phenotype may include subjective perceptions of the subject, such as pain, dizziness, or other physiological disturbances, or medically detectable indicators, such as lesions detected by medical testing.

[0039] In this application, the term "treatment" generally refers to a clinical intervention used to alter the natural processes of the treated individual or cells in a clinicopathological process. It may include improving the disease state, eliminating lesions, or improving the prognosis.

[0040] In this application, the term “about” includes the numerical value and refers to a range of acceptable deviations from a particular value, taking into account errors associated with the measurement of the numerical value (i.e., limitations of the measurement system), as determined by a person skilled in the art. For example, “about” may mean within one or more standard deviations of the value, or within ±30%, ±20%, ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, or ±0.5% of the numerical value.

[0041] Detailed Description of the Invention 5 / 22 pages 8 CN 121646483 A CYP4V2 The AAV vector in this application may contain a polynucleotide encoding CYP4V2. In this application, CYP4V2 may contain a class of proteins whose dysfunction or mutations in their encoding genes may lead to crystalline retinal degeneration, including but not limited to human...The polynucleotide encoding CYP4V2 or its functional variants from animals such as chimpanzees, gorillas, rhesus monkeys, dogs, cattle, mice, rats, chickens, fruit flies, nematodes, or frogs. For example, the CYP4V2 may include human CYP4V2. In this application, the polynucleotide encoding CYP4V2 may encode the amino acid sequence shown in SEQ ID NO: 2. For example, the polynucleotide encoding CYP4V2 may encode an amino acid sequence that is at least 90% homologous to the amino acid sequence shown in SEQ ID NO: 2, such as any one of the following amino acid sequences that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0042] In some cases, the polynucleotide encoding CYP4V2 in this application may comprise a sequence that is a synonymous mutation of a naturally occurring polynucleotide encoding CTP4V2. In some cases, the polynucleotide encoding CYP4V2 in this application may comprise the nucleotide sequence shown in SEQ ID NO: 3. For example, the polynucleotide encoding CYP4V2 may contain a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 3, such as any polynucleotide sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0043] The 5' end of the polynucleotide encoding CYP4V2 in this application may contain a kozak sequence, for example, the kozak sequence may contain the nucleotide sequence shown in SEQ ID NO: 5.

[0044] Promoter The AAV vector described in this application may contain a promoter. In this application, the promoter may contain an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, an ocular cell-specific promoter, or a constitutive promoter. The promoter may also contain a mammalian β-actin promoter or a viral promoter. The promoter may also include a CAG promoter (hybrid CMV early enhancer / chicken β-actin promoter, also known as a CAGGS promoter, CB promoter, or CBA promoter), a human β-actin promoter, a small CBA (smCBA) promoter, a CBS promoter or a CBh promoter, a short elongation factor 1α (EFS) promoter, an elongation factor 1α (EF-1α) promoter, a CMV promoter, a PGK promoter, a UBC promoter, a GUSB promoter, a UCOE promoter, a VMD2 (also known as BEST1) promoter, an OPEFS promoter, a CYP4V2 autopromoter, an RPE65 promoter, or a hybrid or derivative thereof. For example, the promoter may be a CAG promoter.

[0045] For example, the promoter may contain the nucleotide sequence shown in SEQ ID NO: 1. For example, the promoter may contain a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 1, for example, at least 95%, at leastAny polynucleotide sequence with at least 96%, at least 97%, at least 98%, or at least 99% homology.

[0046] In this application, the promoter can be operatively linked to the polynucleotide encoding CYP4V2. In some cases, the promoter can be located at the 5' end of the polynucleotide encoding CYP4V2.

[0047] Polyadenylate signal site In this application, the AAV vector may also contain a polyadenylate signal site. The polyadenylate signal site may contain an SV40 signal site, a BGH signal site, a WPRE signal site, a WPRE-SV40 signal site, a WPRE-BGH signal site, or a derivative thereof.

[0048] In some cases, the polyadenylate signal site can be recognized by polyadenylation-associated cleavage factors to generate SV40 polyadenylate sequences, BGH signal polyadenylate sequences, HSV signal polyadenylate sequences, TK signal polyadenylate sequences, WPRE signal polyadenylate sequences, etc. For example, the polyadenylated signal site may be a BGH signal site, which may contain the nucleotide sequence shown in SEQ ID NO: 4. For example, the polyadenylated signal site may contain a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 4, such as any polynucleotide sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous. Specification 6 / 22 page 9 CN 121646483 A

[0049] In some cases, the polyadenylated signal site may be located at the 3' end of the polynucleotide encoding CYP4V2.

[0050] In the pharmaceutical formulation of the present invention, the recombinant AAV virus expressing CYP4V2 includes an AAV vector expressing a polynucleotide encoding CYP4V2 via a promoter, wherein the AAV vector comprises, in a 5' to 3' direction, a promoter, a polynucleotide encoding CYP4V2, and a polyadenylation signal site, wherein the promoter is operatively linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0051] In a preferred embodiment, the CAG promoter comprises the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence shown in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence shown in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence shown in SEQ ID NO: 4; more preferably, the AAV vector further comprises, between the CAG promoter and the polynucleotide encoding CYP4V2, a signal as shown in SEQ ID NO: 1.The Kozak sequence shown in SEQ ID NO: 5; most preferably, the AAV vector further includes the same or different ITR sequences on the 5' side of the CAG promoter and on the 3' side of the polyadenylate signal site, preferably the ITR sequence is from AAV2.

[0052] In a more preferred embodiment, the AAV vector includes the following genomic sequence in the 5' to 3' direction: ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably including the genomic sequence shown in SEQ ID NO: 6.

[0053] In a preferred embodiment, the serotype of the capsid protein of the recombinant AAV virus is AAV8.

[0054] In a preferred embodiment, the capsid protein of the recombinant AAV virus expressing CYP4V2 of the present invention is the AAV8 capsid protein (see WO 03 / 052051A2). In a more preferred embodiment, the capsid protein of the recombinant AAV virus expressing CYP4V2 of the present invention is the AAV8 capsid protein, which is composed of 60 capsid protein subunits, wherein the capsid protein subunits include (for example, in a ratio of 1:1:10) three capsid proteins, namely VP1 with the amino acid sequence shown in SEQ ID NO: 7, VP2 with the amino acid sequence shown in SEQ ID NO: 8, and VP3 with the amino acid sequence shown in SEQ ID NO: 9.

[0055] The method for producing recombinant AAV virus using the above-described recombinant AAV virus vector is well known to those skilled in the art. In short, the method generally involves (a) introducing the AAV vector of the present invention (including a genome construct expressing CYP4V2, i.e., the recombinant AAV genome to be packaged) into a host cell, (b) introducing an AAV helper construct into the host cell, wherein the helper construct includes viral functions lacking relative to the wild-type rAAV genome, and (c) introducing a helper viral construct into the host cell. All functionalities required for AAV vector replication and packaging (such as AAV rep protein and AAV cap protein) need to be present to enable AAV genome replication and packaging into the AAV vector. The introduction of the host cell described above can be accomplished using standard molecular biology techniques and can be done simultaneously or sequentially. Finally, the host cells are cultured to produce the AAV vector and purified using standard techniques. Typically, a three-plasmid system comprising (a), (b), and (c) above is co-transfected into host cells (e.g., 293F cells) and cultured in suspension without serum. Purification methods can be performed using steps such as lysis clarification, affinity chromatography, ion exchange chromatography ultrafiltration, filtration, etc.

[0056] In a preferred embodiment, the recombinant AAV virus expressing CYP4V2 of the present invention can be prepared according to the methods described in CN113106124B and US17 / 812,425, and is a recombinant AAV2 / 8 virus.

[0057] Adjuvant (a) Sodium chlorideIn injectable formulations, sodium chloride typically plays a role in regulating osmotic pressure. In this invention, the inventors unexpectedly discovered through animal experiments that the concentration of sodium chloride in the AAV formulation has a significant impact on local irritation of the animal retina. AAV formulations containing inappropriate concentrations of sodium chloride can lead to a local immune response in the eye, causing vitreous cavity inflammation and cell infiltration, resulting in cell damage, as confirmed by the mRNA expression levels of inflammatory factors.

[0058] Therefore, in a preferred embodiment, the concentration of sodium chloride in the pharmaceutical formulation (injection) of this invention is about 120 mM to about 360 mM, preferably about 150 mM to about 180 mM, and most preferably about 150 mM.

[0059] (b) Poloxamer Poloxamer, commercially known as Pluronic, is a high molecular weight nonionic surfactant. It is a triblock copolymer of polyoxyethylene-polyoxypropylene-polyoxyethylene (PEO-PPO-PEO), commercially known as Pluronic, with the general formula HO(C2H4O)a-(C3H6O)b-(C2H4O)aH. The polyoxyethylene chain has relative hydrophilicity, and the polyoxypropylene chain has relative lipophilicity. The physical properties of the compound vary depending on the molecular weight and the proportion of ethylene oxide or propylene oxide in the molecule. Therefore, it is a nonionic high molecular weight surfactant.

[0060] Poloxamer 407 is composed of about 70% ethylene oxide and 30% propylene oxide, with an average molecular weight of 11,500 Da, a melting point of 56°C, odorless and tasteless, easily soluble in water, acids and alkalis, and stable to metal ions. It has a special reverse thermal gelling effect, that is, it is a liquid at low temperature and becomes a gel at body temperature. It has low toxicity, low irritation, and good biocompatibility, making it an ideal drug controlled-release material. It is widely used in many fields such as medicine and pharmacy. Poloxamer 407 has been used in ciprofloxacin lactate ophthalmic gel, levofloxacin ophthalmic gel, diclofenac sodium ophthalmic gel, etc.

[0061] Poloxamer 188 is commonly used in the pharmaceutical field as a lubricant for emulsions, ointments and suspensions, a solubilizer and dispersant for tablets or capsules, and can also be used as a carrier for solid dispersions. The average molecular weight is 7680-9510 Da, and it is easily soluble in water regardless of molecular weight. Poloxamer 188 is easily soluble in water, but it is insoluble or has very low solubility in propylene glycol. It has strong surface activity and gelling effect. Poloxamer 188 is both lipophilic and water-soluble, and can dissolve in the aqueous phase and be uniformly dispersed in the lipophilic polycaprolactone in a molecular state, forming a uniform porous structure on the surface of the microspheres.

[0062] In this invention, the inventors unexpectedly discovered through formulation design and screening experiments that, for the surface of the present invention...Regarding recombinant AAV virus reaching CYP4V2, in the formulation of the present invention, poloxamer 188 shows significantly better performance than poloxamer 407 in terms of virus titer determination, freeze-thaw stability, high-temperature stability, and bioactivity detection.

[0063] Therefore, in a preferred embodiment of the present invention, the pharmaceutical formulation of the present invention includes poloxamer as an excipient, particularly poloxamer 188, preferably at a concentration of about 0.0001% by weight to about 0.01% by weight, preferably about 0.0002% by weight to about 0.005% by weight, and most preferably about 0.001% by weight.

[0064] (c) Buffer solutions Buffer solutions (buffered salt solutions) in pharmaceutical formulations are generally used to maintain the pH of the solution system from significant changes due to the addition of small amounts of acid or base. Commonly used buffer solutions include inorganic salt buffers (phosphates, carbonates, etc.) and organic salt buffers (acetates, citrates, succinates, glycines, maleates, etc.).

[0065] In this invention, the inventors unexpectedly discovered through formulation design and screening experiments that, for the recombinant AAV virus expressing CYP4V2 of this invention, phosphates showed significantly better performance than citrates in terms of virus titer determination, freeze-thaw stability, high-temperature stability, and bioactivity detection in the formulation of this invention.

[0066] Therefore, in a preferred embodiment of this invention, the pharmaceutical preparation of this invention comprises phosphates as excipients, preferably selected from disodium hydrogen phosphate or its hydrate, sodium dihydrogen phosphate or its hydrate, dipotassium hydrogen phosphate or its hydrate, potassium dihydrogen phosphate or its hydrate, sodium phosphate or its hydrate, potassium phosphate or its hydrate, or any combination thereof, preferably a combination of disodium hydrogen phosphate or its hydrate and sodium dihydrogen phosphate or its hydrate, or a combination of dipotassium hydrogen phosphate or its hydrate and potassium dihydrogen phosphate or its hydrate, more preferably a combination of disodium hydrogen phosphate dodecahydrate and sodium dihydrogen phosphate monohydrate, preferably a molar ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2. In another preferred embodiment, the phosphate concentration in the pharmaceutical preparation, calculated based on all phosphates in the pharmaceutical preparation, is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, and most preferably about 10 mM.

[0067] (d) pH value The pH value of the injectable pharmaceutical preparation is generally equivalent to the physiological pH value of the human body, and is generally in the range of about 7.0 to about 7.6.

[0068] In this invention, the inventors discovered through formulation design and screening tests that, for the recombinant AAV virus expressing CYP4V2 of this invention, in the formulation of this invention, the preparation with pH 7.3 has good virus titer determination, freeze-thaw stability, and high temperature stability.The qualitative and bioactivity assays showed significantly better performance. In particular, the inventors unexpectedly discovered that the formulation of the present invention exhibited the highest expression level of the target gene (CYP4V2) mRNA after repeated freeze-thaw cycles (e.g., 5 times) at pH 7.3.

[0069] Therefore, in a preferred embodiment of the present invention, the pH of the pharmaceutical preparation of the present invention is approximately 7.0 to 7.6, preferably approximately 7.0, approximately 7.2, approximately 7.3, or approximately 7.6, and most preferably approximately 7.3.

[0070] Pharmaceutical Preparation The present invention provides a pharmaceutical preparation for treating crystalline retinal degeneration (BCD), comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and having a pH of approximately 7.0 to 7.6.

[0071] In a preferred embodiment of the present invention, the pharmaceutical preparation of the present invention is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 120 to about 360 mM sodium chloride, about 0.001 wt% poloxamer 188, about 10 mM phosphate, and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH is about 7.3.

[0072] In a preferred embodiment of the present invention, the pharmaceutical preparation of the present invention is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 150 mM sodium chloride, about 0.001 wt% poloxamer 188, about 10 mM phosphate, and water for injection, and the pH is about 7.3, wherein the phosphate comprises about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate. The sodium chloride, disodium hydrogen phosphate dodecahydrate, and sodium dihydrogen phosphate monohydrate in the above-mentioned formulation of the present invention can maintain the stability of the pH value of the preparation and ensure that the osmotic pressure of the preparation is isotonic with that of plasma, thus ensuring the stability of the injection itself and the safety of medication. The dosage of each excipient in the above-mentioned formulation is within the maximum limit specified by NMPA / FDA and complies with the standards of Part II and Part IV of the 2020 edition of the Chinese Pharmacopoeia.

[0073] In a preferred embodiment of the present invention, the pharmaceutical preparation of the present invention is a colorless, clear, and transparent liquid with an osmotic pressure of about 270 to about 330 mOsmol / kg.

[0074] In a preferred embodiment of the present invention, the pharmaceutical formulation of the present invention is in the form of an injectable aqueous solution, and / or the titer of the recombinant AAV virus in the pharmaceutical formulation is about 1.0 × 10¹¹ vg / ml (vg / ml represents the number of viral genome copies contained per milliliter) to about 1.0 × 10¹³ vg / ml, preferably about 2.0 × 10¹¹ vg / ml to about 8.0 × 10¹² vg / ml, more preferably about 2.5 × 10¹¹ vg / ml to about 2.0 × 10¹² vg / ml, for example, about 2.5 × 10¹¹ vg / ml, about 1.0 × 10¹² vg / ml and about 2.0 × 10¹² vg / ml.The concentration is vg / ml, preferably about 2.5 × 10¹¹ vg / ml, about 5.0 × 10¹¹ vg / ml, or about 1.0 × 10¹² vg / ml.

[0075] In a particularly preferred embodiment, the pharmaceutical preparation of the present invention has the composition shown in Table A: Specification 9 / 22 pages 12 CN 121646483 A

[0076] Treatment Method The present invention also provides a method for treating, alleviating, and / or preventing a disease or condition associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical preparation according to the present invention. Preferably, the pharmaceutical preparation is an injectable.

[0077] In a preferred embodiment of the present invention, the disease or condition is crystalline retinal degeneration (BCD).

[0078] In a preferred embodiment of the present invention, the subject is a human.

[0079] In another preferred embodiment of the present invention, the pharmaceutical preparation is used for subretinal intravenous injection, preferably with an administration volume of about 50 to 300 μL; the dosage is about 1 x 10¹⁰ vg / eye to 1 x 10¹² vg / eye, preferably about 5 x 10¹⁰ vg / eye to about 2.5 x 10¹¹ vg / eye. Subretinal intravenous administration requires one or more fine needles, one or more syringes, and may be accompanied by vitrectomy.

[0080] For example, the dosage form of the pharmaceutical preparation of the present invention can be an injection, with a strength of about 1.0 x 10¹² vg / ml, 0.3 ml / vial; or about 2.5 x 10¹¹ vg / ml, 0.3 ml / vial. Example

[0081] For gene therapy products for treating BCD that express CYP4V2 using AAV8 as a vector, the inventors screened the types and concentrations of buffer salt ions, types of surfactants, pH, etc. of the injection formulation, involving a total of 18 different formulation combinations. The recombinant AAV virus (ZVS101e) expressing CYP4V2 in different formulation systems was tested for virus titer, freeze-thaw stability, high temperature stability and bioactivity to determine the final formulation.

[0082] Example 1. Screening of formulation components 1) Preparation of recombinant AAV virus expressing CYP4V2 The recombinant AAV virus expressing CYP4V2 was prepared according to the method described in CN113106124B or US17 / 812,425 to obtain the recombinant AAV2 / 8 virus ZVS101e.

[0083] The product information for ZVS101e is as follows: Vector: AAV8 genome sequence (ITR sequences at both ends, both derived from AAV2): ITR-CAG-kozak-CYP4V2-BGH-ITR Wherein the CAG promoter contains the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 contains SEQ ID NO: 1.The amino acid sequence shown in NO: 2 encodes the polynucleotide sequence of CYP4V2, which is the nucleotide sequence shown in SEQ ID NO: 3; the BGH polyA signal is the nucleotide sequence shown in SEQ ID NO: 4; the Kozak sequence is shown in SEQ ID NO: 5; the ITR sequence is from AAV2. The above genomic sequence is shown in SEQ ID NO: 6. Specification 10 / 22 pages 13 CN 121646483 A

[0084] Capsid protein: AAV8 is composed of 60 capsid protein subunits, which contain amino acid sequences in the ratio of 1:1:10, such as VP1 shown in SEQ ID NO: 7, VP2 shown in SEQ ID NO: 8, and VP3 shown in SEQ ID NO: 9.

[0085] 2) Formulation design and screening Two aqueous buffer systems were designed first: a phosphate buffer system and a sodium citrate buffer system; two surfactant formulations were also tried: poloxamer 188 and poloxamer 407 (BASF). Based on different salt ion concentrations, the following 12 formulations were designed for ZVS101e:

[0086] After preparation, ZVS101e virus (target titer of 2.0 × 10¹² vg / mL) was ultrafiltered into the above 12 formulation buffers using a 100 kDa ultrafiltration tube. Specific ultrafiltration procedure: Take 0.5 mL of the original virus solution, fill with buffer to 15 mL, centrifuge until 0.5 mL remains, fill again, centrifuge until 0.5 mL remains. Finally, add buffer to 1.2 mL, aliquot into 0.1 mL vials, for a total of 12 vials.

[0087] (1) According to the method reported in the literature (Martinez-Fernandez de la Camara, C., et al. (2021). "Accurate Quantification of AAV Vector Genomes by Quantitative PCR." Genes (Basel) 12(4)), the viral titer of ZVS101e in different formulations was detected: Instructions 11 / 22 pages 14 CN 121646483 A

[0088] The results showed (Table 2) that the viral titer of ZVS101e in citrate buffer (formulations 15 and 16) was significantly different from the target titer; the viral titer of ZVS101e in formulations using poloxamer 407 as surfactant (formulations 10 and 11) was significantly different from the target titer (such differences not only cause the experimental results to be distorted and affect quantification, but also seriously affect product quality control); while the viral titer of ZVS101e in formulations using phosphate and poloxamer 188 as surfactants was significantly different from the target titer.The difference between the titer and the target titer is small, making it more suitable as a component of the ZVS101e formulation.

[0089] (2) The particle size of ZVS101e in different formulations was analyzed using an Unchained Labs Uncle all-purpose protein stability analyzer (brand: Unchained Labs; model: Uncle). Dynamic light scattering (DLS) results showed (see Figure 2) that the particle sizes of formulations 01, 03, 04, 05, 09, 10, 15 and 16 were between 26 and 29 nm, with only slight aggregation peaks; while the particle size distribution of formulations 06, 07, 08 and 11 was relatively discrete, with more obvious aggregation peaks.

[0090] (3) The denaturation curves and aggregation curves of ZVS101e in different formulations were detected using an Unchained Labs Uncle all-purpose protein stability analyzer. The test results showed (see Figures 3 and 4) that the denaturation curves were similar, suggesting that the AAV conformation, denaturation process, titer, and buffer conditions were similar; there was a significant upward trend near 70℃, suggesting that AAV aggregation occurred. The aggregation curves showed that the aggregation degree of formulations 4, 6, and 8 increased significantly, suggesting the formation of larger aggregates.

[0091] (4) Summary From the above experiments, the viral titer stability, particle size distribution, and aggregation of ZVS101e in different formulations were evaluated (see Table 3), among which formulations 01, 03, 05, and 09 performed better. Therefore, further screening can be carried out under the conditions of 10 mM~20 mM PB (phosphate buffer), 120~360 mM NaCl, 0.001% poloxamer 188, and pH 7.2. Instructions for Use, Page 12 / 22, 15 CN 121646483 A

[0092]

[0093] Example 2. Screening of Salt Ion Concentration and pH in Formulation To further determine the salt ion concentration and pH in the formulation, we designed 6 formulations and conducted experiments with 2.0 × 10¹² vg / mL as the target titer of ZVS101e injection, as shown in the table below:

[0094] (pH 7.3 solution preparation: 10 mM PB includes approximately 8 mM disodium hydrogen phosphate dodecahydrate and approximately 2 mM sodium dihydrogen phosphate monohydrate; the remaining pH solutions are adjusted to pH 7.0 or pH 7.6 by adding appropriate amounts of 1M NaOH solution or 1M HCl solution to the pH 7.3 solution; P188 is poloxamer 188) We replaced the purified ZVS101e stock solution with Millipore 50 kD ultrafiltration centrifuge tubes respectively to Table 4 In six different aqueous solutions, the target titer was 2.0 × 10¹² vg / mL, 0.22 μmAfter filtration with a PVDF syringe filter, the total volume was approximately 5 ml, which was dispensed into 3 vials, each containing approximately 1.4 ml. Freeze-thaw tests (1 freeze-thaw cycle and 5 freeze-thaw cycles) and high-temperature stability tests (37°C for 7 days) were performed. The stability of the samples was determined by detecting genomic titer and target gene mRNA expression.

[0095] 1) Freeze-thaw test A) Genomic titer: Genomic titers were detected after 1 freeze-thaw cycle and 5 freeze-thaw cycles, as shown in Table 5. The results showed that the genomic titers of all 6 solutions were normal after freeze-thaw replacement, and there was no significant difference between the 6 formulations. Instruction manual, pages 13 / 22, 16, CN 121646483 A

[0096]

[0097] B) mRNA expression of the target gene (CYP4V2): Samples subjected to one freeze-thaw cycle and five freeze-thaw cycles were used to detect mRNA expression. MOI=1e5, 293T cells were infected, and lysed cells were harvested after 3 days. RNA was extracted (TaKaRa, MiniBEST Universal RNA Extraction Kit) to detect the expression levels of the target gene mRNA and the internal reference gene mRNA (internal reference gene is ACTB-β actin). The detection instrument was ABI 7500. The reverse transcription and qPCR detection kit was HiScript II U+ One Step qRT-PCR Probe Kit, Vazyme, Q222-CN-00. Primers and probes were synthesized by Anhui General Biotechnology, and their sequences are as follows (5'→3'): CYP4V2-qPCR-F ATTGTGAAGTGGCAGGTTACA (SEQ ID NO: 10) CYP4V2-qPCR-R GGGAAGTATCTCGGATCTCTG (SEQ ID NO: 11) CYP4V2-qPCR-P CATAGGGAATGATGACGGCTT (SEQ ID NO: 12) ACTB-qPCR-F CTCGGCCACATTGTGAACTT (SEQ ID NO: 13) ACTB-qPCR-R AACGGTGAAGGTGACAGCA (SEQ ID NO: 14) ACTB-qPCR-P ATGCTCGCTCCAACCGAC (SEQ ID NO: 15) The mRNA expression results of the freeze-thaw experiment are shown in Figure 5.

[0098] mRNA detection results showed that the mRNA expression in solution 18 (formulation 18, 150 mM NaCl, pH 7.3) and solution 19 (formulation 19, 150 mM NaCl, pH 7.6) was slightly higher, with the highest expression level observed in solution 150 mM NaCl and pH 7.3.

[0099] 2) High-temperature stability test A) Genomic titerThe genomic titers of the six formulations at point 0 and after being placed at 37°C for 7 days were detected, as shown in Table 6. The results showed that the titer of formulation 17 decreased slightly after being placed at 37°C for 7 days, while the other formulations showed no significant difference.

[0100]

[0101] B) mRNA expression of the target gene (CYP4V2) The mRNA expression of the six formulations at point 0 and after being placed at 37°C for 7 days was detected. MOI=1e5, 293T cells were infected, and lysed cells were harvested after 3 days. RNA was extracted and reverse transcribed to detect the expression levels of the target gene mRNA and the internal reference gene mRNA. The mRNA expression results of different formulations after being placed at high temperature are shown in Figure 6.

[0102] From the mRNA expression results, mRNA was expressed under all conditions. After being placed at 37°C for 7 days, the expression levels of the 180 mM NaCl experimental groups (formulas 20, 21, and 22) gradually decreased with increasing pH; while the expression levels of the 150 mM NaCl experimental groups (formulas 17, 18, and 19) remained relatively stable.

[0103] Considering the results of the above formulation stability screening tests, we selected formulation 18 as the formulation for further research on ZVS101e.

[0104] Example 3. Stability Comparison Study of ZVS101e and AAV8-Cas9 in Formulation Formulation 18 To explore whether formulation 18 is applicable to all AAV viruses with AAV8 as the serotype, or only applicable to ZVS101e (AAV8 viral capsid and CYP4V2 expression vector), we conducted a comparative study on the stability of ZVS101e and AAV8-Cas9 (the construction of AAV8-Cas9 is described in CN113038972B) in formulation formulation 18 (stability test conditions: < -60°C storage). The results are shown in Table 7.

[0105]

[0106] The above results show that after a 3-month stability study, ZVS101e has good stability in formulation 18, while the genomic titer of AAV8-Cas9 in the same formulation has a significant decrease.

[0107] Example 4. Comparison of short-term irritation of different excipient solutions after subretinal injection in wild-type mice We also evaluated the local ocular irritation of different formulations after subretinal injection in mice. Since the local retinal inflammatory reaction caused by injection operation or formulation can be reflected by fundus photography, the main observation index in this experiment was fundus photography.

[0108] The experimental system was 4-8 week old wild-type C57BL / 6J mice (commercially purchased from Vital River). The specific grouping and administration are shown in the table below:

[0109] (10 mM PB includes about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate; P188 is page 18 of the instruction manual 15 / 22.Two weeks after the completion of subretinal administration of poloxamer 188 (CN 121646483 A), fundus photography was performed to assess local retinal irritation. The fundus photography results (Figure 7) showed localized pigmentary degeneration in the fundus of mice in all experimental groups, with slightly more severe degeneration in groups 1, 2, and 4. In other words, compared to the formulation (10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3), the formulation (10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3) caused significantly less irritation to the mouse retina, which was unexpected given that the only difference was the NaCl concentration.

[0110] Example 5. Short-term safety comparison of different formulations of ZVS101e injected subretinally into BCD mice. To investigate whether the differences in retinal inflammatory response caused by the above formulations still exist when AAV virus is present, we prepared two batches of ZVS101e injection using two different formulations. Batch 1 used a formulation of 10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3; Batch 2 used a formulation of 10 mM PB, 180 mM NaCl, 0.001% P188, pH 7.3. To compare the safety of the two batches of drugs and their corresponding formulations, two weeks after subretinal injection into BCD mice (purchased from Beijing Biocytogen Gene Biotechnology Co., Ltd., Cyp4v3- / -), fundus photography was used to observe local retinal inflammation, OCT was used to observe changes in retinal structure, and ERG was used to observe the visual function of the mice. After the above in vivo testing was completed, the mice were euthanized, and the left eyeball was used for paraffin sectioning to observe the retinal tissue structure; the right eyeball was used to extract RNA and detect the mRNA expression levels of transgenic hCYP4V2 and inflammatory factors.

[0111]

[0112] The fundus photography results (Figure 8) showed that, compared with the non-injected simulated control group, the injected mice had local physical damage to the retina at the injection site, and local pigment degeneration was also visible in the fundus of the mice. Among them, the degree of retinal degeneration in the excipient-2 and batch-2 groups was more severe than that in the excipient-1 and batch-1 groups, respectively.

[0113] The retina and RPE layer of the right eye of each group of mice were separated, and RNA was extracted (TaKaRa, MiniBEST Universal RNA Extraction Kit), reverse transcribed (TaKaRa, PrimeScript™ RT reagent Kit with gDNA Eraser), and the mRNA expression levels of transgenic hCYP4V2, endogenous mCYP4V3 and inflammatory factors were detected. Testing instrument (ABI, 7500), PCR detection kit (ABI, Real-Time PCR SYBR Master)Mix), PCR primers were synthesized at Suzhou Genewise Biotechnology Co., Ltd., and their sequences are as follows: CYP4V2-qPCR-F AGTTCCAGCCTGAGCGGTTCTT (SEQ ID NO: 16) CYP4V2-qPCR-R CCTCAGGATGCACGAAAGAATGG (SEQ ID NO: 17) mCYP4V3-qPCR-F CTTAGCGAGGACTGTGAAGTGG (SEQ ID NO: 18) mCYP4V3-qPCR-R GAAAGAACCGCTCTGGTCGGAA (SEQ ID NO: 19) mACTB-qPCR-F CATTGCTGACAGGATGCAGAAGG (SEQ ID NO: 20) mACTB-qPCR-R TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO: 21) (Instructions for Use, Pages 16 / 22, 19, CN 121646483 A, mCD11b-qPCR-F) TACTTCGGGCAGTCTCTGAGTG (SEQ ID NO: 22) mCD11b-qPCR-R ATGGTTGCCTCCAGTCTCAGCA (SEQ ID NO: 23) mNLRP3-qPCR-F TCACAACTCGCCCAAGGAGGAA (SEQ ID NO: 24) mNLRP3-qPCR-R AAGAGACCACGGCAGAAGCTAG (SEQ ID NO: 25) As shown in Figures 9, 10, and 11, RNA level detection results showed that both batch-1 and batch-2 could successfully express hCYP4V2 mRNA in mouse retina and RPE cells, with batch-1 showing higher expression efficiency; endogenous mCYP4V3 among the groups There was no significant difference in expression levels; the results of inflammatory factor detection showed that, compared with excipient-1 and batch-1 groups, the expression levels of inflammatory factor mNLRP3 in the retina and RPE of mice in excipient-2 and batch-2 groups were higher, and the levels of macrophage marker mCD11b in the retina of mice in excipient-2 and batch-2 groups were increased.

[0114] The above results once again prove that, for the gene therapy AAV product of the present invention, the formulation of 10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3 is a safer, more stable and effective formulation.

[0115] Example 6. GLP safety pharmacology, pharmacokinetics and toxicology studies of ZVS101e with formulation 18 as the formulation in cynomolgus monkeys and rats.Based on the above formulation stability screening test and mouse test, we selected formulation 18 as the formulation of ZVS101e.

[0116] To further verify its safety and efficacy in clinical application, we conducted GLP safety pharmacology, pharmacokinetics and toxicology studies in cynomolgus monkeys and BN rats (related GLP tests were completed by Zhaoyan (Suzhou) New Drug Research Center Co., Ltd.).

[0117] Cynomolgus monkeys were given a single bilateral subretinal injection of the excipient (separate formulation), low and high doses of ZVS101e injection, with a recovery period of 13 weeks (see Table 10). No abnormal changes related to the test product were observed in the cardiovascular, respiratory and nervous systems of the animals. At 4 and 13 weeks after administration to cynomolgus monkeys, the viral genome was widely distributed in the eye tissues, with the highest distribution in the retina and choroid; and mRNA was expressed in most eye tissues, with a large amount of mRNA expressed in the choroid and retina. Histopathological results showed no gross abnormalities in the cynomolgus monkeys, except for mild or slight lymphocytic infiltration, local retinal layer disorder, atrophy, or hyperplasia in the high-dose group.

[0118]

[0119] In rats, a single bilateral subretinal injection of excipients (separate formulation), low and high doses of ZVS101e injection (see Table 11) was administered, with a recovery period of 13 weeks. At 4 and 13 weeks post-administration, the viral genome was widely distributed in ocular tissues, with the highest distribution in the retina / choroid and sclera, and mRNA was expressed in most ocular tissues, with abundant mRNA expression in the retina / choroid, sclera, and iris. No systemic toxicity was observed. Mild or slight dose-related retinal morphological or structural abnormalities were observed in the eyes. Instructions for Use, Pages 17 / 22, 20 CN 121646483 A

[0120]

[0121] The above results show that the formulation has good safety and local ocular tolerance when injected subretinally in rats and monkeys; at the same time, the diluted ZVS101e of the formulation also has good safety and can effectively infect and express the target gene mRNA in the retina.

[0122] Example 7. Human clinical safety and efficacy study of ZVS101e using formulation 18 as the formulation. Using formulation 18 as the formulation of ZVS101e, after GMP-level production and strict QC quality control, and after sufficient scientific in vivo and in vitro pharmacodynamic studies and GLP toxicology studies, ZVS101e showed significant preclinical safety and efficacy, which can effectively support its clinical application.

[0123] In 2021, we initiated a clinical trial (NCT04722107) at Beijing Tongren Hospital, Capital Medical University, for patients with BCD to administer ZVS101e subretinally (7.5 × 10¹⁰ vg / eye, dosing volume 150 μL / eye). This is the world's largest clinical trial of ZVS101e subretinal administration.This is the first clinical trial targeting BCD within the scope. All 12 patients have been enrolled, with 6 patients followed up for more than one year. No serious adverse drug reactions occurred during the study, demonstrating the good clinical safety of ZVS101e. Simultaneously, visual function improved, with significant improvements in indicators such as best-corrected visual acuity (BCVA) (Chaikitmongkol, V., et al. (2018). "Repeatability and Agreement of Visual Acuity Using the ETDRS Number Chart, Landolt C Chart, or ETDRS Alphabet Chart in Eyes With or Without Sight-Threatening Diseases." JAMA Ophthalmol 136(3): 286-290), demonstrating the good clinical efficacy of ZVS101e (see Figure 12 for results of some patients).

[0124] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of this invention, and the resulting equivalent implementation schemes are all within the scope of this invention. Specification page 18 / 22, 21 CN 121646483 A

[0125]

[0126] Specification page 19 / 22, 22 CN 121646483 A

[0127]

[0128] Specification page 20 / 22, 23 CN 121646483 A

[0129]

[0130] Specification page 21 / 22, 24 CN 121646483 A

[0131]

[0132] Specification page 22 / 22, 25 CN 121646483 A Figure 1 Figure 2 Specification Figure 1 / 7, 26 CN 121646483 A Figure 3 Specification Figure 2 / 7, 27 CN 121646483 A Figure 4 Figure 5 Specification Figure 3 / 7, 28 CN 121646483 A Figure 6 Figure 7 Specification Figure 4 / 7, 29 CN 121646483 A Figure 8 Instruction Manual Appendix 5 / 7 Page 30 CN 121646483 A Figure 9 Figure 10 Instruction Manual Appendix 6 / 7 Page 31 CN121646483 A FIG. 11 FIG. 12 DESCRIPTION OF DRAWINGS 7 / 7 pages 32 CN 121646483 A Abstract Provided is a pharmaceutical preparation for treating Bietti's crystalline dystrophy (BCD), comprising a recombinant AAV expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and having a pH between 7.0 to 7.6. The pharmaceutical preparation has an excellent virus titer stability, very few AAV aggregates, a high mRNA expression of the target gene after multiple times of freezing and thawing, and / or an excellent high temperature stability. Moreover, the animal experiments in vivo demonstrate that the preparations with the formulations have an excellent property in reducing local inflammatory response of the retina, and further clinical trials demonstrate that the pharmaceutical preparations conform to the relevant technical specifications for safety and effectiveness in the Chinese Pharmacopoeia and the United States Pharmacopoeia (USP).

Claims

1. A pharmaceutical preparation comprising: a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and the pH of the pharmaceutical preparation is about 7.0-7.

6.

2. The pharmaceutical preparation according to claim 1, wherein the recombinant AAV virus comprises an AAV vector expressing a polynucleotide encoding CYP4V2 as a genomic sequence through a promoter, preferably the AAV vector comprises, in the 5’ to 3’ direction, in order: a promoter, a polynucleotide encoding CYP4V2, and a polyadenylation signal site, wherein the promoter is operably linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

3. The pharmaceutical preparation according to claim 2, wherein the CAG promoter comprises the nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence set forth in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence set forth in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence set forth in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as set forth in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably the AAV vector further comprises identical or different inverted terminal repeat (ITR) sequences from AAV2 on the 5’ side of the CAG promoter and on the 3’ side of the polyadenylation signal site.

4. The pharmaceutical preparation according to any one of claims 2-3, wherein the AAV vector comprises the genomic sequence set forth in ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably the genomic sequence set forth in SEQ ID NO: 6, in the 5’ to 3’ direction; and / or the capsid protein of the recombinant AAV virus is of serotype AAV8.

5. The pharmaceutical preparation according to any one of claims 1-4, wherein the capsid protein of the recombinant AAV virus is an AAV8 capsid protein, which is composed of 60 capsid protein subunits comprising VP1 with the amino acid sequence set forth in SEQ ID NO: 7, VP2 with the amino acid sequence set forth in SEQ ID NO: 8, and VP3 with the amino acid sequence set forth in SEQ ID NO: 9, in a ratio of 1:1:

10.

6. The pharmaceutical preparation according to any one of claims 1 to 5, wherein the pharmaceutical preparation is in the form of an aqueous solution for injection, and / or the titer of the recombinant AAV virus in the pharmaceutical preparation is from about 1.0 x 10 11 vg / ml to about 1.0 x 10 13 vg / ml, preferably from about 2.0 x 10 11 vg / ml to about 8.0 x 10 12 vg / ml, more preferably from about 2.5 x 10 11 vg / ml to about 2.0 x 10 12 vg / ml, for example, about 2.5 x 10 11 vg / ml, about 1.0 x 10 12 vg / ml and about 2.0 x 10 12 vg / ml, also preferably about 2.5 x 10 11 vg / ml, about 5.0 x 10 11 vg / ml or about 1.0 x 10 12 vg / ml.

7. The pharmaceutical preparation according to any one of claims 1-6, wherein the poloxamer comprises poloxamer 188, preferably at a concentration of about 0.0001 wt% to 0.01 wt%, preferably about 0.0002 wt% to 0.005 wt%, most preferably about 0.001 wt%, by weight of the pharmaceutical preparation.

8. The pharmaceutical formulation of any one of claims 1 to 7, wherein the concentration of the sodium chloride in the pharmaceutical formulation is about 120 mM to 360 mM, preferably about 150 mM to 180 mM, most preferably 150 mM.

9. The pharmaceutical formulation of any one of claims 1 to 8, wherein 1) the phosphate salt is selected from disodium hydrogen phosphate or a hydrate thereof, sodium dihydrogen phosphate or a hydrate thereof, dipotassium hydrogen phosphate or a hydrate thereof, potassium dihydrogen phosphate or a hydrate thereof, sodium phosphate or a hydrate thereof, potassium phosphate or a hydrate thereof, or any combination thereof, preferably a combination of disodium hydrogen phosphate or a hydrate thereof and sodium dihydrogen phosphate or a hydrate thereof, or a combination of dipotassium hydrogen phosphate or a hydrate thereof and potassium dihydrogen phosphate or a hydrate thereof, more preferably a combination of disodium hydrogen phosphate or a hydrate thereof (e.g. disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or a hydrate thereof (e.g. sodium dihydrogen phosphate monohydrate), preferably in a molar concentration ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2; and / or 2) the concentration of the phosphate salt in the pharmaceutical formulation is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, most preferably about 10 mM, based on all phosphate salts in the pharmaceutical formulation.

10. The pharmaceutical formulation of any one of claims 1 to 9, in the form of an aqueous solution for injection, comprising the recombinant AAV virus, about 120 to about 360 mM sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM phosphate salt, and water for injection, the phosphate salt comprising disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH of the pharmaceutical formulation is about 7.

3.

11. The pharmaceutical formulation of claim 10, comprising the recombinant AAV virus, about 150 mM sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM phosphate salt, and water for injection, and the pH of the pharmaceutical formulation is about 7.3, wherein the phosphate salt comprises about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate.

12. The pharmaceutical formulation of any one of claims 1 to 11, which is a colorless, clear, transparent liquid, and the osmotic pressure is about 270 ~ about 330 mOsmol / kg.

13. A method of treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical formulation of any one of claims 1 to 12.

14. The method of claim 13, wherein the disease or disorder is Best’s crystalline retinopathy (BCD), preferably the subject is a human.

15. The method of claim 14, wherein the pharmaceutical preparation is for administration by subretinal cavity injection, preferably in a volume of about 50 to 300 μL; in an amount of about 1 x 10 10 vg / eye ~ 1 x 10 12 vg / eye, preferably about 5 x 10 10 vg / eye ~ about 2.5 x 10 11 vg / eye.

Images