Oligonucleotides conjugated to oleic acid and uses thereof

Abstract

To provide improved anti-miRs conjugated to oleic acid.SOLUTION: The invention provides oligonucleotide and / or oligonucleotide analogue molecules that are antagonists of a microRNA, preferably antagonists of human microRNAs hsa-miR-23b-3p and hsa-miR-218-5p, that comprise a mixture of phosphorothioate and phosphodiester linkages, and that are conjugated to at least one oleic acid molecule. Inhibiting these microRNAs allows the endogenous levels of the corresponding proteins MBNL1 and / or MBNL2 to be increased. The present invention further provides compositions comprising the oligonucleotides and / or oligonucleotide analogue molecules and their uses for the treatment and prevention of DM in a subject in need thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to the field of medicine. More specifically, the present invention relates to oligonucleotide antagonists of endogenous microRNAs, particularly hsa-miR-218-5p and hsa-miR-23b-3p, conjugated to oleic acid and uses thereof. [Background technology]

[0002] Myotonic dystrophy type 1 (DM1) is a rare genetic disorder for which there is currently no effective treatment. DM1 is associated with a substantial disease burden that results in disability across many different patient systems and tissues. Muscle weakness and fatigue constitute the two most common disease manifestations, reported by 93% and 90% of patients, respectively, followed by muscle locking (73%). Other phenotypes include cardiac dysfunction, cataracts, insulin resistance, and cognitive impairment. DM1 disease is based on a CTG repeat expansion in the DM1 protein kinase (DMPK) gene, which is transcribed into pathogenic mRNA. It is now well established that the CUG expansion binds with high affinity to the muscleblind-like (MBNL1, 2, and 3) family of proteins, thereby inhibiting their normal function; however, other alterations may contribute to the depletion of MBNL1 and MBNL2. MBNL1 and MBNL2 are preferentially expressed in skeletal muscle and the brain, respectively, whereas MBNL3 is primarily expressed during embryonic development and adult tissue regeneration.

[0003] The MBNL1 and MBNL2 proteins control alternative splicing and polyadenylation of several transcripts, particularly by causing a shift from fetal to adult patterns. In splice regulation, they act antagonistically against the CUGBP Elav-like family member 1 (CELF) protein, which is found to be upregulated and mislocated in DM1. Furthermore, genetic redundancy between the MBNL1 and MBNL2 genes has been shown, as deletion of only one gene resulted in upregulation of the other and occupancy of its binding site on target RNAs (see Lee 2013. Compound loss of muscleblind-like function in myotonic dystrophy. EMBO Mol Med 5:1887-900). Loss of MBNL1 protein function has been shown to be a critical factor in the course of the disease. Indeed, loss of MBNL1 function accounts for more than 80% of missplicing events and nearly 70% of expression defects. Upregulation of MBNL genes and / or MBNL proteins in DM1 mouse and patient-derived fibroblasts is well tolerated, rescues several symptoms, such as myotonia and mis-splicing events, and reduces lesion formation, paving the way for the development of therapeutic approaches aimed at increasing the expression of these genes. Depletion of MBNL1 and MBNL2 also affects several other gene expression processes, for example, impairing membrane-bound mRNA transport or miRNA biogenesis.

[0004] MicroRNAs (also referred to herein as "miRNAs" or "miRs") are a class of small non-coding RNAs that play an important role in regulating gene expression, particularly gene silencing. In human cells, expression of hsa-miR-23b-3p and hsa-miR-218-5p has been shown to directly regulate MBNL1 and MBNL2 transcripts by luciferase reporter assay (Cerro-Herreros et al. 2018 Nat. Commun. 9, 2482). Silencing of hsa-miR-23b-3p and hsa-miR-218-5p increases muscleblind-like protein expression and alleviates myotonic dystrophy phenotypes in mammalian models. Meanwhile, antimiRs are a class of oligonucleotides that prevent other molecules, such as microRNAs, from binding to target sites on RNA, particularly messenger RNA (mRNA) molecules. The use of conventional antimiRs as therapeutic molecules has limitations to their development as drug candidates, including a short lifespan due to degradation in the cellular environment, poor cellular uptake from the extracellular medium, and a narrow therapeutic window, expressed as the ratio of concentrations at which a compound reaches median toxicity and efficacy (TC50 / EC50), where the higher the ratio, the better. Therefore, methods aimed at increasing the stability, potency, tissue-specific uptake, and therapeutic window of antimiRs, among other pharmacological parameters, need to be further developed to maximize the potential of antimiRs in inhibiting their targets hsa-miR-218-5p and hsa-miR-23b-3p.

[0005] On the other hand, albumin is one of the most abundant proteins in plasma, and provides transport of fatty acids, drugs, ions, and other metabolites.Conjugation of oligonucleotides with fatty acids can increase the albumin binding affinity of oligonucleotides, enhance their ability to cross the endothelial barrier, and improve their functional uptake into muscle, thereby enhancing the efficacy of oligonucleotides in vivo.However, the wide variety of saturated and unsaturated fatty acids with different structures may in turn affect the protein binding or activity of fatty acid conjugates, and it is unclear what fatty acids are optimal for enhancing oligonucleotide efficacy.

[0006] On the other hand, other chemical modifications can be included in oligonucleotides to increase their pharmacological parameters. Among these modifications, phosphorothioate (PS) linkages continue to show promising results as first-generation antisense oligos, but present important limitations that still hinder the development of fully modified (fully PS) therapeutic oligonucleotides. These limitations include the toxicity of PS-oligonucleotides, which has been reported in several studies in mice, rats, monkeys, and humans. In mice and rats, these side effects include thrombocytopenia, elevated liver transaminases, reticuloendothelial cell hyperplasia in various organs, and renal tubular changes (U. M. Sarmiento, et al. In vivo toxicological effects of rel A antisense phosphorothioates in CD-1 mice. Antisense Res Dev. 1994 Summer;4(2):99-107. doi:10.1089 / ard.1994.4.99. PMID:7950306; S. Agrawal et al. Mixed-backbone oligonucleotides as second-generation antisense oligonucleotides: In vitro and in vivo studies. Proceedings of the National Academy of Sciences Mar 1997,94(6)2620-2625; DOI:10.1073 / pnas.94.6.2620). In monkeys, the observed side effects were complement activation (Agrawal, Sudhir, et al., "Novel enzymatic and immunological responses to oligonucleotides," Toxicology Letters 82 (1995): 431-434) and prolongation of the activated partial thromboplastin time (aPTT). Since similar side effects have been observed after administration of dextran sulfate, it is speculated that these side effects are caused by the polyanionic nature of PS-oligonucleotides and are not nucleotide sequence specific. Therefore, it is necessary to develop oligonucleotides with low toxicity but high stability.

[0007] The present invention overcomes these limitations by providing improved antimiRs that are conjugated to oleic acid. [Brief explanation of the drawings]

[0008] [Figure 1] Figure 1. Evaluation of toxicity and efficacy against DM1 cells. Shown are the toxicity (percent cell growth inhibition, black) and efficacy (percent increase in MBNL1 expression compared to mock-transfected cells, gray) against DM1 myotubes after lipofection with (A) MD23b-2, (B) 5'-23b-oleic acid, (C) unconjugated 23b, or (D) 218-D / LNA2 at five different concentrations (10 nM, 50 nM, 200 nM, 1 μM, and 5 μM for MD23b-2, 5'-23b-oleic acid, and unconjugated 23b; and 0.08 nM, 0.4 nM, 2 nM, 10 nM, and 50 nM for 218-D / LNA2). Dotted lines indicate TC50 and EC50 levels. Each concentration was tested in triplicate. Error bars = standard error of the mean (SEM). Dose-response curves were fitted using the Graphpad formula "bell-shaped dose-response." [Figure 2] FIG. 1 shows functional efficacy assays in HSALR mice 5 days after injection of the indicated treatments. (A) Force / body weight and (B) muscle rigidity grade were analyzed 5 days after a single injection (AI) of different antimiRs at 3 mg / Kg. Data in A were analyzed by unpaired Student's t-test compared to HSALR mice treated with PBS (PBS). p-values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM). [Figure 3]Figure 1. MiRNA levels in muscle tissue. (A) miR-23b-3p and (B) miR-218-5p expression levels were quantified by qRT-PCR in the gastrocnemius (gt) and quadriceps (qd) muscles, relative to the U1 and U6 snRNA endogenous controls. HSALR mice were injected intravenously into the tail vein with either PBS or different antimiRs, all at the same concentration (3 mg / Kg). Five days after injection, mice were sacrificed, and muscles were dissected and processed for RNA extraction. All statistical comparisons were performed against PBS-treated HSALR values ​​using Student's t-test. p-values: ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM). [Figure 4] Figure 1. Expression of Mbnl1 and Mbnl2 in skeletal muscle of treated HSALR mice. (A) Mbnl1 and (B) Mbnl2 transcript levels were quantified by qRT-PCR relative to the endogenous control Gapdh in the gastrocnemius (gt) and quadriceps (qd) muscles. (C) Mbnl1 protein levels compared to the endogenous tubulin control using quantitative dot blot. HSALR mice were intravenously injected with PBS or different antimiRs, all at the same concentration (3 mg / kg) via the tail vein. Five days after injection, the gastrocnemius and quadriceps muscles were dissected, and the tissues were processed for RNA and protein analysis. All statistical comparisons were performed relative to PBS-treated HSALR values ​​using Student's t-test. p-values: ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM). [Figure 5]AntimiRs improved Mbnl-dependent mis-splicing of transcripts. HSALR mice were injected intravenously into the tail vein with PBS or different antimiRs, all at the same concentration (3 mg / kg). Five days after injection, the gastrocnemius and quadriceps muscles were dissected, and the tissues were processed for RNA extraction. (A) RT-PCR semiquantitative analysis of splicing of (A) Atp2a1 exon 22, (B) Nfix exon 7, (C) Mbnl1 exon 5, and (D) Clcn1 exon 7a in the gastrocnemius (gt) and quadriceps (qd) muscles. Exon inclusion levels in healthy control mice (FVB) are also included for comparison. All statistical comparisons were performed against PBS-treated HSALR values ​​using Student's t-test. p-values: ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM). [Figure 6] Representative agarose gels used for the quantification summarized in Figure 5 of Atp2a1, Clcn1, Nfix, and Mbnl1 transcripts in gastrocnemius and quadriceps muscles. Effect of treatment with the indicated oligonucleotides on miR-23b-3p (A, B) and miR-218-5p (C, D). Splicing patterns in wild-type (FVB) and PBS-treated HSALR mice are also shown for comparison. [Figure 7] 1A-1B are spider graphs showing the effects of the indicated treatments on several DM1-associated molecular or functional phenotypes in HSALR mice. The values ​​shown are the recovery index (RI), which measures how close the different values ​​of treated HSALR mice are to the parameters of FVB controls, which are expressed as 1 (solid black line). Panel (A) summarizes the RI for antimiRs against miR-23b-3p, while panel (B) focuses on the RI for antimiRs against miR-218-5p. For more details on the representation, see "Radar Chart" in the "Materials and Methods" section. [Figure 8]Chemical structures of different linkers used to connect the MD23b-2 V2 oligo and oleic acid. A diagram of the resulting entire molecule, excluding the oligonucleotide components, was generated with ChemDraw software. [Figure 9] Quantification of MBNL1 protein in DM1 cells treated with the indicated concentrations of oligo MD23b-2 V2 conjugated to oleic acid in the 3′ using different linkers depicted in Figure 8. Protein levels were quantified by quantitative dot blot analysis (QDB) and normalized to endogenous GAPDH. Protein levels obtained from DM1 cells treated with transfection reagent only (DM1) were given a value of 1, and the remaining data were normalized accordingly. All statistical comparisons shown were performed relative to DM1 cells treated with transfection reagent by Student's t-test. p-values: ns = not significant, *p<0.05, **p<0.01, and ***p<0.001. Error bars = standard error of the mean (SEM). [Figure 10] A) Chemical structure of MD23b-2 V2 3'Ol oligo. The complete molecular diagram was generated using ChemDraw software. B) Chemical structure of MD23b-2-PS / PO 3'Ol oligo. The complete molecular diagram was generated using ChemDraw software. C) Chemical structure of 218 MOE oleic acid 3' oligo. The complete molecular diagram was generated using ChemDraw software. [Figure 11] Determination of MD23b-2 V2 3'01 and MD23b-2 V2 (ng / g) in brain, gastrocnemius, quadriceps, kidney, and liver by ELISA. Statistical comparisons between MD23b-2 V2 3'01 and MD23b-2 V2 for specific tissues were performed using Student's t-test. Statistical significance was set at p<0.05 (**p<0.01, ***p<0.001). Error bars = SEM. [Figure 12]Figure 1 shows relative MBNL1 levels. Phase I and II. Quantification of MBNL1 levels by Western blot in protein extracts from NHP brains. Comparison of MBNL1 protein levels in brain NHPs from Phase I, 2 weeks after the last dose, and Phase II, 3 weeks after the last dose. In Western blots, GAPDH levels were used as an internal standard, and data were normalized to MBNL1 protein levels in PBS-treated NHPs (Group 2), which were given a value of 1. Data are mean ± SEM. Summary of the Invention

[0009] In one aspect, the present invention relates to an oligonucleotide molecule, or a mixture of two or more such molecules, wherein the oligonucleotide molecule is 10-30 nucleotides in length, the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate bond, and the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' and / or 5' end. Preferably, the molecule is an antagonist of a microRNA, more preferably the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0010] In one embodiment, the oligonucleotide molecule of the first aspect comprises 15 to 30 nucleotides in length and comprises at least two nucleotides linked by phosphodiester bonds, and the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0011] In one embodiment, the oligonucleotide molecule according to the first aspect comprises a length of 15 to 30 nucleotides, and the oligonucleotide molecule also comprises a fragment consisting of at least 15 consecutive nitrogenous bases of nucleotides that is at least 80% identical to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NO: 52 to 110.

[0012] In one embodiment, the oligonucleotide molecule according to the first aspect comprises a length of 15 to 30 nucleotides, and the oligonucleotide molecule also comprises a fragment consisting of at least 15 consecutive nitrogenous bases of nucleotides that are identical to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p).

[0013] In one embodiment, the oligonucleotide molecule according to the first aspect comprises at least one chemical modification, the chemical modification being i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) an additional bridge connecting the 2' oxygen and the 4' carbon (LNA) Only the group consisting of:

[0014] In one embodiment, the oligonucleotide molecule of the first aspect comprises a length of 15 to 30 nucleotides, and the oligonucleotide molecule also comprises a fragment consisting of at least 15 consecutive nitrogenous bases of nucleotides that are at least 80% identical to the sequence of a region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonists of hsa-miR-218-5p).

[0015] In one embodiment, the oligonucleotide molecule of the first aspect comprises a length of 15 to 30 nucleotides, and the nucleotide sequence of the oligonucleotide consists solely of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0016] In another aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in the first aspect or any of its embodiments, or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0017] In another aspect, the invention relates to a composition as defined in the second aspect or any of its embodiments, for use in therapy.

[0018] In another aspect, the invention relates to a composition as defined in the second aspect or any of its embodiments, for use in targeting muscle cells in a subject in need thereof.

[0019] In another aspect, the invention relates to a composition as defined in the second aspect or any of its embodiments for use in the prevention or treatment of a muscle disease or the prevention or treatment of RNAopathies.

[0020] Preferably, the disease is myotonic dystrophy, more preferably the myotonic dystrophy is type 1.

[0021] General definition It should be noted that, as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Further, unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element of the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0022] The term "about" when referring to a given amount or quantity indicates that the number may vary by ±20% around the indicated value. Preferably, "about" means ±10% around that value, more preferably, "about" means ±10, 8, 6, 5, 4, 3, 2% around that value, or even "about" means ±1% around that value.

[0023] As used herein, the conjunctive term "and / or" between multiple listed elements is understood to encompass both individual and combined alternatives. For example, when two elements are joined by "and / or," the first alternative refers to the applicability of the first element without the second element. The second alternative refers to the applicability of the second element without the first element. The third alternative refers to the applicability of the first and second elements together. Any one of these alternatives is understood to be within the meaning and therefore meets the requirements of the term "and / or" as used herein. The simultaneous applicability of two or more alternatives is also understood to be within the meaning and therefore meets the requirements of the term "and / or."

[0024] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise," and variations such as "comprises" and "comprising," will be understood to mean the inclusion of the stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps. As used herein, the term "comprising" can be replaced with the terms "containing" or "including," or, sometimes, when used herein, with the term "having." Any of the foregoing terms (comprising, containing, including, having), whenever used herein in the context of an aspect or embodiment of the invention, can be replaced, but is less preferred, with the term "consisting of."

[0025] As used herein, "consisting of" excludes elements, steps, or ingredients not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0026] As used herein, names referring to mouse genes are typed in italics with a capital letter followed by all lowercase letters. Mouse protein designations follow the same convention as mouse gene symbols, but are not italicized. When referring to human genes or proteins, capital letters are always used, and genes are italicized. Nevertheless, one skilled in the art will be able to infer the exact nature of the biomolecules (proteins, genes, transcripts) and species from the technical context of this specification.

[0027] As used herein, "oligonucleotide" refers to any short segment of DNA, RNA, or DNA / RNA, including both natural and synthetic nucleotides. As used herein, the term "oligonucleotide molecule" includes both oligonucleotides themselves and "oligonucleotide analogs." "Oligonucleotide analogs" are molecules derived therefrom that incorporate some chemical modification in at least one of the nucleotide units that form them, either in the phosphate group, pentose, or one of the nitrogenous bases, and also include modifications consisting solely of the addition of non-nucleotide groups at the 5' and / or 3' ends. These include phosphorodiamidate morpholino oligomers, peptide nucleic acids (PNAs; DNA mimics in which the deoxyribose phosphate backbone is replaced with a pseudo-peptide polymer linked to nucleobases), and the like. Furthermore, for purposes of the present invention and as used herein, the terms "oligonucleotide molecule" and "oligonucleotide analog" or "oligonucleotide analog molecule" also include sponges of microRNAs or microRNA sponges, which can be considered to have tandem repeats of oligonucleotides as their main component, each of which is either itself or contains a binding site for a microRNA of interest. For clarity, it is noted that oligonucleotide sequences disclosed herein and numbered as "SEQ ID NOs." include the nucleobase sequence along with chemical modifications and / or fatty acid conjugation, if present. For example, SEQ ID NO: 3 refers to the nucleobase sequence "ATCCCTGGCAATGTGA," along with, among other things, LNA, phosphorothioate linkages, and 5-methyl-2'-O-methylcytidine modifications. Thus, this sequence is represented herein as SEQ ID NO: 3: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCms-AbAmTbGbTmsGbsAb(NHC6)(oleic acid).

[0028] As used herein, the term "antagonist oligonucleotide" refers to an oligonucleotide that can block or inhibit the natural function of a molecule, in this case, a microRNA. Thus, antagonist oligonucleotides of the present invention are inhibitor molecules that prevent the activation, stability, or function of the antimiR to which they bind. In the context of the present invention, "antagonist" is synonymous with "inhibitor" and can therefore be used interchangeably. For example, an "antagonist oligonucleotide of hsa-miR-23b-3p" refers to an oligonucleotide molecule that inhibits the function of hsa-miR-23b-3p.

[0029] The "percent sequence identity" of polynucleotides and polypeptides is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence within the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions within the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Optimal alignment of sequences for comparison can be performed by computerized implementation of known algorithms (such as BLAST in the Wisconsin Genetics Software Package, a resource of the National Center for Biotechnology Information, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., and CLUSTAL, GAP, BESTFIT, FASTA, and TFASTA in the resource of the European Bioinformatics Institute) or by inspection. It should be noted that "percent identity" as used herein is determined in the context of local alignment, i.e., based on the alignment of the area of ​​local similarity between nucleic acid base sequences, as opposed to a global alignment that aims to align two sequences over their entire span.Therefore, in the context of the present invention, percent identity is preferably calculated based only on a local alignment comparison algorithm.

[0030] In many cases, particularly in the case of antimiRs, chemical modifications are incorporated into the corresponding nucleotide units, primarily affecting the ribose moiety and / or phosphate, modifications that are difficult to depict in the usual representation of a nucleotide sequence, in which the nucleotide present at a given position is identified by the abbreviation of the nitrogenous base of which it is a part. Thus, in the present invention, molecules of microRNA antagonists are compared, which refers to the percentage of identity between the sequences of the nitrogenous bases or nucleic acid bases of the nucleotide or nucleotide analog units present in these units, as this indicates whether two molecules or sequence fragments are designed from the same original basic nucleotide sequence, regardless of the different chemical modifications that the nucleotides may contain in each case.

[0031] As used herein, two strands of a nucleotide molecule are understood to be 100% complementary if the nucleotide or nucleotide analog sequence of one strand, read in the 5'-3' sense, is a sequence of nucleotides or nucleotide analogs that presents a nitrogenous base that pairs with the nitrogenous base of the nucleotide or nucleotide analog of the other strand, read in the 3'-5' sense. That is, the sequence 5'-UAGC-3' is complementary to the sequences 3'-AUCG-5' and 3'-ATCG-5', which are the sequences 5'-GCUA-3' and 5'-GCTA-3', respectively, read in the 5'-3' sense. In one embodiment, the antagonist molecule preferably contains a fragment in its sequence that is identical to the complementary sequence of the seed region of the microRNA to be antagonized, at least in terms of nitrogenous base complementarity.

[0032] As used herein, "antimiR" refers to an oligonucleotide, preferably an oligoribonucleotide, that is complementary to and binds with high affinity to its target microRNA, preferably mature microRNA, thereby inhibiting it. Thus, an antimiR refers to an oligonucleotide that is typically chemically modified and complementary to a corresponding oligomer composed only of nucleotide units, and is therefore an inhibitor of the target microRNA. In a specific case of the present invention, the antimiR described herein is preferably at least partially complementary to the human microRNA hsa-miR-23b-3p or hsa-miR-218-5p.

[0033] As used herein, "microRNA sponges" are typically designed to inhibit microRNAs to which they have a complementary heptameric or octameric fragment (seed region), such that a single sponge construct can be used to block an entire family of microRNAs that share the same motif, but they can also contain the entire target sequence of a particular microRNA or only the microRNA-specific region lacking the seed region to make it specific.

[0034] The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse allergic or other reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable vehicles" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, fatty acids such as oleic acid, and similar acceptable agents for use in formulating pharmaceuticals, e.g., pharmaceuticals suitable for administration to humans.

[0035] "Prevent," "preventing," or "prevention" includes, but is not limited to, reducing, lowering, or ameliorating the risk of a symptom, disorder, condition, or disease, as well as protecting an animal from a symptom, disorder, condition, or disease. Prevention may be applied or administered prophylactically.

[0036] "Treat," "treating," or "treatment" includes, but is not limited to, inhibiting, slowing, arresting, reducing, ameliorating, or reversing the progression or severity of an existing symptom, clinical sign, disorder, condition, or disease. Treatment may be applied or administered therapeutically.

[0037] "TC50" or "half maximal inhibitory concentration," as used herein, refers to the concentration of an inhibitor administered to a test organism or test cell line that produces a toxic effect in 50% of a population of organisms or cell lines exposed for a given period of time.

[0038] "EC50" or "half maximal effective concentration," as used herein, refers to the concentration of an antagonist or inhibitor required to produce a response halfway between baseline and maximum during a given period of time. That is, the EC50 is the concentration required to produce 50% of the effect elicited by a treatment.

[0039] "Emax" is referred to herein as the maximum achievable response from an applied or administered agent, in this case, an antagonist molecule. Emax is measured as the maximum fold change in target protein, e.g., MBNL1 protein, obtained after transfection with a particular antimiR-23b-3p or antimiR-218-5p compared to mock (vehicle-transfected or untransfected).

[0040] "Tindex" or "therapeutic index / ratio" is a quantitative measure of the relative safety of a drug. In the present invention, Tindex is defined as the ratio of the amount of a therapeutic agent that causes 50% toxicity (TC50) to the amount that causes 50% therapeutic effect (EC50), multiplied by the maximum achievable response. Tindex=(TC50 / EC50)*Emax

[0041] As used herein, the term "3' end" refers to the end of a nucleotide chain having a hydroxyl group on the third carbon of the terminal sugar ring. As used herein, the term "5' end" refers to the end of a nucleotide chain having a fifth carbon of the terminal sugar ring.

[0042] As described above, there is a need to develop improved oligonucleotides containing chemical modifications that reduce toxicity but enhance therapeutic efficacy. Therefore, two main objectives are addressed by the present invention. On the one hand, the objective of the present invention was to evaluate the best fatty acid to conjugate to an oligonucleotide and design an oligonucleotide with the maximum tolerated amount of PS bonds that provides beneficial effects to the molecule without being too toxic for in vivo administration. On the other hand, the present invention also provides specific microRNA inhibitors, particularly oligonucleotide molecules or analogs thereof, aimed at correcting the insufficient function of MBNL (Muscleblind-like) protein, which is partially due to the overexpression of hsa-miR-23b-3p and hsa-miR-218-5p in patients with myotonic dystrophy (DM), preferably myotonic dystrophy 1 (DM1).

[0043] First, we tested the effects of conjugating the previously published antagomiR-23b and antagomiR-218 oligonucleotides (Cerro-Herreros et al. 2018 Nat. Commun. 9, 2482) with different hydrophobic moieties (including lipids and fatty acids) in vitro on toxicity, efficacy (MBNL1 protein levels), and therapeutic index (Tindex) (Table 1). The antagomiR sequences used in this study contained all 2'OME-modified nucleotides and a mixture of phosphorothioate (PS) and phosphodiester (PO) linkages. Surprisingly, for both antagomiR-23b and antagomiR-218 oligonucleotides, conjugation with oleic acid was found to result in the most significant improvement in Tindex.

[0044] Next, we tested the ability of oleic acid to act as a carrier, and the experiments shown in Figure 11 and Example 9 demonstrated that oleic acid is an excellent carrier or vehicle for delivering oligonucleotides to tissues such as muscle and the central nervous system (CNS). Furthermore, Figures 12-13 and Example 10 demonstrate that vehicleization of oligonucleotide molecules by oleic acid occurs not only in animal models with the DM1 phenotype, but also in healthy animals (in this case, monkeys). These results pave the way for the therapeutic use of oleic acid as a carrier when conjugated to oligonucleotide molecules, particularly in the context of diseases affecting muscle and / or the CNS, two of the primary tissues where oleic acid enhanced oligonucleotide delivery.

[0045] DM1 is a neuromuscular disease that affects not only muscle tissue but also the central nervous system. Therefore, we screened a pool of antimiRs ranging in length from 15 to 22 nucleotides, containing nucleotides with different chemical modifications, such as LNA, 2'OME, and 2'MOE, for antimiR sequences with the best Tindex in DM1 cells. In this study, the best-performing antagonist of human hsa-miR-23b-3p was MD23b-2, and the oligo with the best Tindex for antagonist of human hsa-miR-218-5p was 218-D / LNA2 (see Tables 2 and 3, Figure 1). Modified versions of each of these two molecules were combined with oleic acid, and the resulting molecules were used in a mouse model of DM1 (HSA). LRThe conjugation of oleic acid to oligonucleotides containing a mixture of PS / PO moieties increased the therapeutic efficacy of the oligonucleotides (see Tables 4, 5, and 6). Overall, the results of this study led the authors to conclude that oleic acid is the best fatty acid to conjugate to oligonucleotide molecules to improve MBNL1 levels in DM1 cells and mouse models of the disease, and that this conjugation improves the therapeutic index of the oligonucleotide when a mixture of PS / PO moieties is present in the molecule.

[0046] In view of these results, in a first aspect, the present invention relates to an oligonucleotide and / or oligonucleotide analog molecule, or a mixture of two or more of such molecules, wherein the oligonucleotide and / or oligonucleotide analog molecule is conjugated to at least one oleic acid molecule at the 3'-end and / or 5'-end of the oligonucleotide and / or oligonucleotide analog molecule. Preferably, the oligonucleotide and / or oligonucleotide analog is an antagonist of a microRNA. Preferably, the oligonucleotide and / or oligonucleotide analog is an antagonist of a microRNA selected from the group consisting of human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0047] The microRNAs hsa-miR-23b-3p and hsa-miR-218-5p are repressors of the expression of the MBNL gene, among other gene transcripts, and therefore their repressive ability is reduced by the presence of their antagonists. In the context of the present invention, inhibitors, silencers, or blockers are compounds that can reduce the endogenous activity of the hsa-miR-23b-3p and hsa-miR-218-5p, and therefore these three terms are included under the name "antagonist." Strictly speaking, the term "silencing" can be interpreted as the absolute abolition of such activity, but the difference in such abolition or non-absolute reduction of repression activity may depend on the concentration of the compound used, so that a compound may reduce the repression activity of the microRNA and be considered an inhibitor, silencer, blocker, or, in short, its antagonist. In addition, given the knowledge about the possibility of inhibiting microRNA function by targeting mature microRNA, precursor microRNA (pre-microRNA or pre-miRNA) or primary microRNA (pri-microRNA or pri-miRNA), a compound can be considered as a microRNA inhibitor, silencer, blocker or antagonist according to the present invention if it can reduce the endogenous activity of the microRNA, not only when it targets the mature microRNA, but also when it targets the precursor microRNA or primary microRNA transcript. Therefore, as used herein, the four terms (inhibitor, silencer, blocker or antagonist) are used synonymously herein.

[0048] It is important to note that the nucleotide sequences of the antagonists of the present invention must be sufficiently complementary to the endogenous molecules to which they must bind. The endogenous molecules are preferably microRNA molecules, more preferably hsa-miR-23b-3p or hsa-miR-218-5p molecules. Human hsa-miR-218-5p and hsa-miR-23b-3p differ in the sequence of nucleotides, which must be considered when designing the antagonist sequence and its microRNA-binding site. A "microRNA-binding site" is a nucleotide sequence contained in an antagonist that is complementary or partially complementary to at least a portion of its target microRNA. Preferably, the microRNA-binding site of the antagonist defined herein is complementary or partially complementary to at least a portion of hsa-miR-23b-3p or hsa-miR-218-5p. The sequence of the binding site may be a perfect match, meaning that it has perfect complementarity to the microRNA. Alternatively, the sequences may be partially complementary, meaning that one or more mismatches may occur when the microRNA base pairs with the antagonist's binding site. Importantly, when an antagonist is partially complementary to a target microRNA (preferably, hsa-miR-23b-3p or hsa-miR-218-5p), its binding site preferably contains perfect or near-perfect complementarity (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or preferably 100% complementarity) to the seed region of the target microRNA (preferably, hsa-miR-23b-3p or hsa-miR-218-5p). The "seed region" of a microRNA typically comprises or consists of nucleotides 2 through 7 from the 5' end of the microRNA.

[0049] Therefore, in designing the antimiRs of the present invention, the sequences of the mature forms of the target microRNAs and their seed regions can be taken into consideration. The sequences of these mature forms are shown below, where their respective seed regions are shown in bold, and their access codes (Mimat) are given in the miRbase database (www.mirbase.org). Hsa(homosapiens)-miR-218-5p (MIMAT0000275): 5'-UUGUGCUUGAUCUAACCAUGU-3' (SEQ ID NO: 10); seed region: UGUGCU (SEQ ID NO: 12) hsa-miR-23b-3p (MIMAT0000418): 5'-AUCACAUUGCCAGGGAUUACCAC-3' (SEQ ID NO: 11); seed region: UCACAU (SEQ ID NO: 13)

[0050] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecules are inhibitors, blockers or antagonists of the classes known as antimiRs and microRNA sponges. Preferably, the oligonucleotide and / or analogue thereof according to the first aspect or any of its embodiments is an antimiR, more preferably an antimiR of hsa-miR-218-5p or hsa-miR-23b-3p.

[0051] In one embodiment, the oligonucleotides and / or analogs thereof are at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides in length. In one embodiment, the oligonucleotides and / or analogs thereof are 10-50 nucleotides in length, more preferably 10-30 or 15-25 nucleotides in length. Preferably, the oligonucleotide molecule and / or analog thereof is an antimiR that comprises, consists of, or essentially consists of a fragment consisting of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units whose sequence is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complementary sequence of a region present in SEQ ID NO: 10 (hsa-miR-218-5p) or 11 (hsa-miR-23b-3p). More preferably, the sequence of nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the complementary sequence of SEQ ID NO: 10 (hsa-miR-218-5p) or 11 (hsa-miR-23b-3p).

[0052] In one embodiment, the antagonist is an antimiR, the sequence of which comprises a fragment consisting of a series of at least 5-8 nucleotide or nucleotide analog units, and the sequence of nitrogenous bases of the nucleotide or nucleotide analog units is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13. Preferably, the antimiR comprises a fragment consisting only of a series of at least 5-8 nucleotide or nucleotide analog units that is 100% complementary to the seed region set forth in SEQ ID NO: 13. In one embodiment, the antagonist is an antimiR whose sequence comprises a first fragment and a second fragment, wherein the first fragment is composed of a series of at least 5-8 nucleotide or nucleotide analog units, the sequence of nitrogenous bases of the first fragment being at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13, and the second fragment is The second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is composed of a run of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 11. "Adjacent" herein refers to being immediately adjacent to the first fragment, i.e., there are no nucleotides between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and / or downstream of the first fragment. More preferably, the second fragment is located 1, 2, 3, 4 or 5 nucleotides upstream and / or downstream of the first fragment.

[0053] In one embodiment, the antagonist is an antimiR, the sequence of which comprises a fragment consisting of a series of at least 5 to 8 nucleotide or nucleotide analog units, and the sequence of nitrogenous bases of the nucleotide or nucleotide analog units is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12. Preferably, the antimiR comprises a fragment consisting only of a series of at least 5 to 8 nucleotide or nucleotide analog units that is 100% complementary to the seed region set forth in SEQ ID NO: 12. In one embodiment, the antagonist is an antimiR whose sequence comprises a first fragment and a second fragment, wherein the first fragment is composed of a series of at least 5 to 8 nucleotide or nucleotide analog units, the sequence of nitrogenous bases of the first fragment being at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12, and the second fragment is The second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is composed of a run of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 10. "Adjacent" herein refers to immediately following the first fragment, i.e., there are no nucleotides between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and / or downstream of the first fragment. More preferably, the second fragment is located 1, 2, 3, 4 or 5 nucleotides upstream and / or downstream of the first fragment.

[0054] Also included within the concept and scope of oligonucleotide and / or oligonucleotide analog molecules useful for the purposes of the present invention are microRNA inhibitors, blockers, or antagonists that act on pri- or pre-microRNAs, typically altering microRNA biogenesis and having a negative effect on microRNA activity primarily due to a reduction in available active microRNAs. In animal cells, immature pri-miRNAs are processed into pre-miRNAs by the microprocessor complex in the nucleus, then transported to the cytoplasm for further processing into mature miRNAs. Therefore, it should be understood that targeting the pri- and / or pre-microRNAs of hsa-miR-23b-3p or hsa-miR-218-5p and altering their biogenesis so that their levels are reduced should also result in a reduction in their activity. Therefore, for the purposes of the present invention, antagonists of hsa-miR-23b-3p or hsa-miR-218-5p should be understood to include not only molecules that can act on the mature forms, but also molecules that can act on the pri- or pre-microRNA and reduce the levels of the mature forms of hsa-miR-23b-3p or hsa-miR-218-5p. In order to design them, the following should be taken into consideration: The major microRNA (pri-microRNA) of -hsa-miR-23b-3p is the transcript of the gene AOPEP (ENSG00000148120; chr9:97488983-97849441). The microRNA precursor (pre-microRNA) of hsa-miR-23b-3p corresponds to genomic location hg19chr9:97847490-97847586[+] and the sequence: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC (SEQ ID NO: 19). Because this sequence is longer than hsa-miR-23b-3p, it is possible to design pre-microRNA-specific antagonists. -hsa-miR-218-5p has two genomic locations encoding it and two precursor pre-microRNAs, Pre-hsa-mir-218-1 (chr4:20529898-20530007):GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA (SEQ ID NO: 20) and Pre-mir-218-2 (chr5:1681951SI-168195260):GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA (SEQ ID NO: 21). Both precursors can be used to design antagonists. hsa-miR-218-5p-1 is derived from an intramolecular hairpin structure located inside the transcript of the gene SLIT2 (ENSG00000145147, chr4:20254883-20621284), and hsa-miR-218-5p-2 is derived from the gene SLIT3 (ENSG00000184347, chr5:168088745-168728133 of hsa-miR-218-5p-2), and they can be considered pri-miRNAs. Other mature microRNAs are not part of the same cluster. In the case of hsa-miR-218-5p, both the pre-miRNA and the pri-miRNA could be considered targets for antagonists to reduce the mature miRNA and increase MBNL protein levels.

[0055] As shown in the following Examples, particularly Tables 1 and 4, the authors of the present invention have developed and optimized several antimiRs against hsa-miR-23b-3p and hsa-miR-218-5p, whose Tindex was significantly improved by the addition of oleic acid. Among these, the specific sequences of antimiRs containing SEQ ID NO: 1 (antagonist of human hsa-miR-218-5p) and SEQ ID NO: 2 (antagonist of human hsa-miR-23b-3p) are particularly mentioned due to their optimal characteristics and efficiency in DM1 cells, as shown in the Examples section.

[0056] Additionally, functional equivalents of SEQ ID NO: 1 or 2 are contemplated herein, where specific changes in specific nucleobases do not significantly destabilize the molecule, thus maintaining its therapeutic efficacy. Such functionally equivalent sequences are set forth in SEQ ID NOs: 52-79 (functional equivalents of antimiR-23b-3p of SEQ ID NO: 2) and SEQ ID NOs: 80-110 (functional equivalents of antimiR-218-5p of SEQ ID NO: 1). "Functional equivalent," as used herein, refers to other oligonucleotides that differ from the nucleobase sequence of SEQ ID NO: 1 or 2, but perform the same function and provide the same utility or technical effect as SEQ ID NO: 1 or 2.

[0057] Thus, in one embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment consisting of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 1 (TTAGATCAAGCACAA) or SEQ ID NOs: 80-110. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogue is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotides of SEQ ID NO: 1 or SEQ ID NOs: 80 to 110.

[0058] In a further embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment consisting of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 2 (ATCCCTGGCAATGTGA) or SEQ ID NOs: 52-79. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogue is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of SEQ ID NO: 2 or the oligonucleotides of SEQ ID NOs: 52 to 79.

[0059] It should be noted that in the oligonucleotide molecules and / or analogs thereof according to the present invention, each uracil base and thymine base within the entire length of the oligonucleotide molecule and / or analog, preferably each uracil base and thymine base within the seed region, can be optionally replaced with a thymine or uracil base, respectively. This applies to all "T" nucleobases contained in all oligonucleotides disclosed herein, except for SEQ ID NOs: 52-110, where "U" is preferred instead of "T" at certain positions. Thus, U is included instead of T at those specific positions.

[0060] Similarly, each guanosine base within the entire length of the oligonucleotide molecule and / or analog, preferably within the seed region, can be optionally replaced by a respective hypoxanthine base. This applies to all oligonucleotides disclosed herein.

[0061] In one embodiment, oligonucleotides and / or oligonucleotide analogs that are antagonists of human hsa-miR-23b-3p or human hsa-miR-218-5p are capable of increasing endogenous levels of MBNL proteins, preferably MBNL1 and / or MBNL2 proteins. Preferably, the oligonucleotides and / or oligonucleotide analogs are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NOs: 52-110, and are capable of increasing endogenous levels of MBNL proteins, preferably MBNL1 and / or MBNL2 proteins. Preferably, the increase in endogenous levels of MBNL protein is a statistically significant increase compared to untreated cells or tissues, and preferably, the statistical comparison is performed using Student's t-test (see, e.g., FIG. 4). Most preferably, the increase in endogenous levels of MBNL protein, preferably a statistically significant increase, is at least a 1.2-fold, 1.3-fold, 1.4-fold, or 1.5-fold change in treated cells of muscle tissue (more preferably, quadriceps and gastrocnemius) compared to untreated cells of muscle tissue. Preferably, the increase in endogenous levels of MBNL protein in treated cells or tissues is at least 15%, 20%, 30%, 40%, 50%, or more, compared to untreated cells or tissues. "Untreated cells or tissues," as used herein, refer to one or more cells or tissues, including whole animals, such as mice, that are healthy or exhibit a DM1 phenotype and that have not been treated with the oligonucleotides and / or oligonucleotide analogs of the first aspect or any of its embodiments. Preferably, the untreated cells are muscle cells and the untreated tissue is muscle tissue.

[0062] AntimiRs of the present invention, including those defined by SEQ ID NO: 1 or 2, can be further optimized to improve their in vivo stability and efficacy. To this end, several modifications to their chemical structure have been described (for a review, see Mckenzie et al., Recent progress in non-native nucleic acid modifications. Chem. Soc. Rev., 2021, 50, 5126-5164). These modifications can occur at the pentose (in preferred embodiments where the oligonucleotide is an oligoribonucleotide, the modification can occur within the ribose), the internucleotide bond, or the nucleobase, or a combination thereof. When oligonucleotides or oligoribonucleotides of the present invention are chemically modified, they are considered oligonucleotide analogs or oligoribonucleotide analogs, respectively, in the context of the present invention. In one embodiment, an antimiR is an oligonucleotide analog and contains at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 chemical modifications along the entire molecule. In one embodiment, an antimiR is an oligoribonucleotide analog in which all nucleotides are chemically modified.

[0063] Modifications in internucleotide bonds: Possible modifications that may result in the oligonucleotide analogs of the present invention include modifications that result in phosphorothioate bonds, which affect the phosphate group that is part of the "backbone" of the polynucleotide chain and result in the introduction of a sulfur atom in place of the oxygen atom of the phosphate group that is not acting as a bridge between nucleotides. These modifications make the internucleotide bond resistant to degradation by nucleases, in addition to other desirable pharmacological properties, and are therefore generally inserted between the last 3 to 5 nucleotides at the 5' or 3' end of the oligonucleotide to inhibit degradation by exonucleases and increase their stability.

[0064] In a preferred embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more than 15 nucleotides contained in an oligonucleotide or oligonucleotide analog molecule according to the first aspect or any of its embodiments are chemically linked by phosphorothioate bonds. Preferably, the oligonucleotide and / or oligonucleotide analog according to the first aspect or any of its embodiments comprises a length of 10 to 30 nucleotides and comprises at least two nucleotides chemically linked by phosphorothioate bonds, the oligonucleotide and / or oligonucleotide analog being conjugated at its 3'-end and / or 5'-end to at least one oleic acid molecule. In an even more preferred embodiment, the oligonucleotide or oligonucleotide analog molecule comprises a mixture of PS and phosphodiester (PO) linkages, at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages and at least two nucleotides of the molecule are linked by phosphodiester linkages. In a more preferred embodiment, the number of nucleotides chemically linked by phosphorothioate (PS) bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds. In one embodiment, the oligonucleotide molecule and / or its analog is 13 to 17 nucleotides in length and contains at least 7, 8, 9, or 10 nucleotides chemically linked by phosphorothioate (PS) bonds. In one embodiment, the PS:PO ratio in the oligonucleotide molecule and / or its analog is 1.2:1, 1.5:1, 1.7:1, 2:1, 2.2:1, 2.5:1, 2.7:1, or 3:1. Preferably, the PS:PS ratio in the oligonucleotide molecule and / or its analog is 1.2:1 to 2.7:1, more preferably 1.5:1 or 2.5:1. The "PS:PO ratio" herein refers to the number of PS bonds per PO bond. For example, if an oligonucleotide molecule consists of 15 nucleotides and has 10 PS linkages and 4 PO linkages (see, e.g., SEQ ID NO: 7), the molecule is said to have a PS:PO ratio of 2.5:1.In one embodiment, more than 50%, 55%, preferably 60%, 70% or 75% of the internucleotide linkages are PS linkages.

[0065] In one embodiment, all nucleotides contained in the oligonucleotide or oligonucleotide analog molecule are chemically linked by phosphorothioate linkages. As described above, preferably, the oligonucleotide or oligonucleotide analog molecule is an antagonist of a microRNA (i.e., an antimiR).

[0066] Modifications on the pentose, preferably the ribose: The most widely used sugar modifications are those located on the 2'-OH group. Among these, the most important in the context of the present invention are the 2'fluoro (2'F: introduction of a fluorine atom at the 2'-position of the ribose), 2'-O-methoxyethyl (MOE), or 2'O-methyl (OMe) modifications. Thus, in one embodiment, an oligonucleotide or oligonucleotide analog molecule according to the present invention, preferably an antimiR, is chemically modified to contain at least one pentose with one of the following modifications: 2'fluoro (2'F: introduction of a fluorine atom at the 2'-position of the ribose), 2'-O-methoxyethyl (MOE), and / or 2'O-methyl (OMe). In one embodiment, all nucleotides in the oligonucleotide molecule are 2'OME-modified nucleotides.

[0067] Another modification that can be made in the oligonucleotide or oligonucleotide analog molecules of the present invention, preferably antimiRs, is the formation of a bicyclic 2'-4' modification. Various ribose derivatives exist that lock the carbohydrate ring in a 3'-endo conformation by forming a bicyclic structure with a bridge between the 2' oxygen and the 4' position. In one embodiment, the formation of a bridge between the 2' oxygen and the 4' carbon locks the ribose in the 3'-endo conformation, resulting in a modification called locked nucleic acid, or LNA. The introduction of an LNA modification greatly increases the stability of the antimiR-target miRNA hybrid, making it significantly more thermodynamically stable and resistant to degradation, especially when the modification is located at the end of the molecule. In one embodiment, the first nucleotide starting from the 3' region contains an LNA modification. In another embodiment, each of the two first oligonucleotides starting from the 5' region contains an LNA modification. Further modifications of bicyclic nucleotides include bridged nucleic acids with varying affinities for target sequences, ethyl bridges (ENA), constrained ethyl (cEt) nucleic acids, bicyclic (bicyclic DNA) and tricyclic (tricyclic DNA) structures, and conformationally restricted nucleotides (CRN).

[0068] Further modifications include the so-called PMOs (nucleic acids in which the ribose is replaced by a morpholino group). "Morpholino" is understood to mean bases attached to a backbone of methylenemorpholine rings linked via phosphorodiamidate groups. Another backbone modification is the so-called PNA ("peptide nucleic acid": a peptide nucleic acid in which the ribose-phosphate group is replaced by an amino acid moiety, so that the backbone of the nucleotide analogues is a structure of repeating units of N-(2-aminoethyl)-glycine linked by peptide bonds).

[0069] In one embodiment, an oligonucleotide or oligonucleotide analog molecule according to the invention, preferably an antimiR, is chemically modified to include at least one pentose of the nucleotides forming the antimiR, and comprises a morpholino nucleic acid (PMO) or a peptide nucleic acid (PNA).

[0070] Modifications at the nucleobase: Due to its frequent use, also included among the chemical modifications resulting in oligonucleotides, preferably oligoribonucleotide analogs of the invention, preferably antimiRs, is 5-methylation of the nitrogenous base cytosine (C), which reduces detection of the oligonucleotide analog by the immune system. Thus, in one embodiment, at least one, two, three, four, five, or more than five of the nucleotides contained in an oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any of its embodiments, preferably an antimiR, contain methylated cytosines. In a preferred embodiment, all cytosines in an oligonucleotide or oligonucleotide analog molecule according to the first aspect or any of its embodiments, preferably an antimiR, are methylated.

[0071] Another possible modification is 2,6-diaminopurine, which can base pair with thymidine or uridine with an additional H-bond (3 H-bonds instead of the 2 present in the natural A:T base pair).Thus, in one embodiment, at least 1, 2, 3, 4, 5 or more than 5 of the nucleotides comprised in the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprise 2,6-diaminopurine.

[0072] As can be inferred from the definitions of "oligonucleotide molecule" and "oligonucleotide analogue," the definition of oligonucleotide analogue also includes hybrid molecules in which some units display modifications and others do not, as well as hybrid molecules between nucleic acid and peptide analogues, or hybrid molecules in which some of the nucleotide units are nucleotides (or analogues thereof) and other units are deoxynucleotides (nucleotides in which the sugar is deoxyribose), and analogues of the latter, i.e., RNA-DNA hybrids and analogues thereof. Other chemical modifications are possible and known and are included among the possible modifications resulting in oligonucleotide analogues.

[0073] With regard to possible chemical modifications contained in oligonucleotide and / or oligonucleotide analogue molecules, the term is applied in particular in the case of one or more of the usual modifications known to those skilled in the art of molecular biology, from the standpoint of basic research, in particular in the search for therapeutic uses for these molecules. Information about such modifications can be found in general common knowledge.

[0074] Modification of oligonucleotide and / or oligonucleotide analog molecules with other non-nucleotide molecules.

[0075] As described above, the first aspect of the present invention provides oligonucleotide and / or oligonucleotide analog molecules that are preferably antagonists of antimiR, more preferably antagonists of human hsa-miR-23b-3p or human hsa-miR-218-5p, or a mixture of two or more of such molecules, wherein the oligonucleotide and / or oligonucleotide analog molecules are conjugated to at least one oleic acid molecule at the 3' and / or 5' end of the oligonucleotide and / or oligonucleotide analog molecule. Accordingly, all oligonucleotides encompassed by the present invention are conjugated to at least one oleic acid molecule at their 3' and / or 5' ends.

[0076] In some embodiments, other non-nucleotide molecules, such as organic compounds, can be conjugated to the 3' and / or 5' ends of the oligonucleotide and / or oligonucleotide analog molecules. The conjugation can be direct or via a spacer molecule. The term "spacer molecule" as used herein refers to any one or more molecules that connect an oligonucleotide or oligonucleotide analog, on the one hand, and a non-nucleotide molecule, preferably oleic acid, on the other. One or more spacer molecules can be linked at the 3' or 5' end of the oligonucleotide or oligonucleotide analog. Preferably, the spacer molecule(s) are covalently attached to the oligonucleotide. Preferably, the spacer molecule(s) are attached at one end via a bond between the terminal carbon on the spacer and the oxygen group in the 3'-terminal phosphate group of the oligonucleotide, and at the other end via a bond between the terminal nitrogen group on the linker, which forms an amide bond with the carboxy group of the oleic acid, as shown, for example, in FIG. 8.

[0077] In preferred embodiments, the spacer molecule is selected from the group consisting of 3-aminopropyl (NHC3), 5-aminopentyl (NHC5), 6-aminohexyl (NHC6), threoninol, or a derivative thereof. In other embodiments, one or more spacer molecules may comprise the thiol modifier C6S-S (C6SSC6). In further embodiments, the spacer may comprise the thiol modifier C6S-S (C6SSC6) directly attached to the oligonucleotide, followed by 3-aminopropyl (NHC3), 6-aminohexyl (NHC6), threoninol, or a derivative thereof (see Figure 8).

[0078] In some embodiments, oligonucleotides may be provided as prodrugs and may include a spacer molecule that comprises or consists solely of a self-immolative group. A "self-immolative" group, as used herein, refers to a molecule that spontaneously and irreversibly decomposes from the molecule to which it is conjugated, in this case, the oligonucleotide. In one embodiment, the self-immolative group is a disulfide bond that is reduced intracellularly by naturally occurring thiols, such as glutathione, resulting in release of the oligonucleotide.

[0079] The spacer may be an aliphatic linear or branched hydrocarbon chain, cyclohexylphenyl and other aromatic spacers, and polar spacers based on one or several units of ethylene glycol, glycerol, amino acids, peptides, or carbohydrates. In some cases, oleyl derivatives can be covalently bound to amino groups by amide bonds or directly to nucleobases with amine bonds and phosphate bonds as oleyl phosphate.

[0080] Preferably, oleic acid is conjugated to the oligonucleotide at its 3'-end. More preferably, oleic acid is conjugated via a spacer molecule, preferably NHC6, threoninol, or NHC3, as shown in Figure 8. Note that the addition of a spacer molecule as a connector between the oligonucleotide and oleic acid is not essential, see, for example, SEQ ID NO: 51. Here, oleic acid is conjugated at the 5'-end of the oligonucleotide and / or oligonucleotide analog molecule by direct conjugation.

[0081] Preferably, all oligonucleotide molecules disclosed in the present invention are conjugated to at least one oleic acid molecule at their 3' and / or 5' ends, and the oligonucleotide molecules further comprise at least two nucleotides chemically linked by phosphorothioate bonds. Preferably, the oligonucleotide molecules further comprise at least two nucleotides chemically linked by phosphorothioate bonds, and at least two nucleotides of the molecules are linked by phosphodiester bonds. More preferably, the number of nucleotides chemically linked by phosphorothioate (PS) bonds is greater than the number of nucleotides chemically linked by phosphodiester (PO) bonds.

[0082] Various means known in the art can be used to prepare the oligonucleotides of the present invention. In particular, oligonucleotides can be synthesized by solid-phase or solution-phase methods. Oligonucleotides functionalized with spacer molecules and oleyl oligonucleotide conjugates can be prepared using solid-phase oligonucleotide synthesis protocols. In this methodology, a solid support such as controlled pore glass (CPG) is functionalized with the first nucleotide at the 3' end of the oligonucleotide sequence, and the oligonucleotide is typically synthesized in the 3' to 5' direction. Introduction of the spacer molecule at the 5' position is achieved by using a phosphoramidite derivative of the spacer molecule, which introduces the spacer molecule via a phosphate bond to the 5' position of the oligonucleotide. Introduction of the spacer molecule at the 3' position requires the preparation of a solid support functionalized with a linker molecule, which is a molecule used to attach nucleotides to the support. Examples of linker molecules are labile compounds such as phthalimide or succinyl linkers. It is noteworthy that while the spacer is conjugated to the oligonucleotide molecule and remains conjugated thereto, the linker is a temporary conjugation intended to immobilize the oligonucleotide during synthesis using solid-phase methods.

[0083] In the case of solution phase preparation methods, protecting groups such as benzoyl or acetyl may be used instead of the type of linkers specified in the solid phase method.

[0084] Among all the oligonucleotides disclosed in the context of the present invention, the following embodiments, including modifications and combinations of modifications, are considered preferred:

[0085] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprises a length of 10 to 30 nucleotides, is an antimiR-type oligonucleotide analogue, and at least two nucleotides of the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides of the molecule are linked by phosphodiester bonds, preferably the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, a. the sequence of nitrogenous bases of the monomeric units of nucleotides or nucleotide analogs is at least 85%, 90%, 93%, 95%, 98%, or 100% complementary to the endogenous molecule to which they must bind (preferably a microRNA molecule, more preferably hsa-miR-23b-3p of SEQ ID NO: 11 or hsa-miR-218-5p of SEQ ID NO: 10); b. It is conjugated at the 5' and / or 3' end to at least one oleic acid molecule, preferably by means of a spacer molecule.

[0086] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprises a length of 10 to 30 nucleotides, is an antimiR-type oligonucleotide analogue, and at least two nucleotides of the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides of the molecule are linked by phosphodiester bonds, preferably the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, a. The sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is composed of a contiguous sequence of at least 5 to 8 nucleotide or nucleotide analog units that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13, and the second fragment is adjacent to the first fragment (i.e., , located upstream and / or downstream of the first fragment), consisting of a run of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or 100% identical to the complementary sequence of a region present in SEQ ID NO: 11; b. It is conjugated at the 5' and / or 3' end to at least one oleic acid molecule, preferably by means of a spacer molecule.

[0087] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprises a length of 10 to 30 nucleotides, is an antimiR-type oligonucleotide analogue, and at least two nucleotides of the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides of the molecule are linked by phosphodiester bonds, preferably the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, a. The sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is composed of a contiguous sequence of at least 5 to 8 nucleotide or nucleotide analog units that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12, and the second fragment is adjacent to the first fragment (i.e., , located upstream and / or downstream of the first fragment), consisting of a run of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or 100% identical to the complementary sequence of a region present in SEQ ID NO: 10; b. It is conjugated at the 5' and / or 3' end to at least one oleic acid molecule, preferably by means of a spacer molecule.

[0088] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprises between 10 and 30 nucleotides in length, wherein a. at least two nucleotides of the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides of the molecule are linked by phosphodiester bonds, preferably the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds; b. the sequence comprises, consists of, or consists essentially of a fragment made up of a run of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 1 or 2 or SEQ ID NOs: 52 to 110; c. It is conjugated at the 5' and / or 3' end to at least one oleic acid molecule, preferably via a spacer molecule.

[0089] In one embodiment, the oligonucleotide and / or oligonucleotide analogue molecule according to the first aspect or any of its embodiments is an antimiR-type oligonucleotide analogue comprising 10 to 30 nucleotides in length, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate bonds and at least two nucleotides of the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphorothioate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, a. at least one of the monomer units is a nucleotide analog exhibiting one or more chemical modifications in the pentose moiety, preferably the ribose, the internucleotide bond, the nitrogenous base, or all of these; b. the sequence of nitrogenous bases of the monomeric units of the nucleotide or nucleotide analog is at least 85%, 90%, 93%, 95%, 98%, or 100% identical to the sequence of nitrogenous bases of the monomeric units of the nucleotides of the oligonucleotide of SEQ ID NO: 1 or the oligonucleotide of SEQ ID NO: 2, or their functional equivalents, SEQ ID NOs: 52 to 110; c. It is conjugated at the 5' and / or 3' end to at least one oleic acid molecule, preferably via a spacer molecule.

[0090] In a preferred embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more than 15 of the nucleotides comprised in the oligonucleotide or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprise at least one modification selected from the group including or consisting of locked nucleic acid, 2'-methoxy, 2'-O-methoxyethyl-, 2'fluoro, BNA, PMO, PNA, CRN, 2,6-diaminopurine, methylated cytosine and / or any combination thereof.

[0091] In a preferred embodiment, the oligonucleotide and / or oligonucleotide analog molecule is 10 to 30 nucleotides in length, is an antagonist of human hsa-miR-23b-3p or hsa-miR-218-5p, and comprises at least two nucleotides chemically bonded by phosphorothioate bonds and at least two nucleotides chemically bonded by phosphodiester bonds, preferably, the number of nucleotides chemically bonded by phosphorothioate bonds is greater than the number of nucleotides chemically bonded by phosphodiester bonds, and the oligonucleotide is conjugated to at least one oleic acid molecule, which is conjugated to the 3' end and / or 5' end of the oligonucleotide and / or its analog. Preferably, the oligonucleotides and / or oligonucleotide analogs conjugated at their 3' and / or 5' ends to at least one molecule of oleic acid and containing more PS than PO linkages comprise, consist of, or consist essentially of a fragment made up of a run of at least 15 consecutive nitrogenous bases of nucleotide or nucleotide analog units, at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequence is identical to a region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or any of their functional equivalents in SEQ ID NOs: 52 to 110.

[0092] In a preferred embodiment, at least 3, 4, 5, 6, 7, 8, or more than 8 nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule are chemically modified, and the chemical modifications are selected from the group consisting of i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA), and / or any combination thereof. In a further embodiment, the nucleotides contained in the oligonucleotide analog molecule are chemically modified to include an extra bridge connecting the 2' oxygen and 4' carbon (LNA) of at least the nucleotides located at the 3' and 5' ends of the oligonucleotide. More preferably, the LNA modification is introduced into at least the fourth, third, or preferably the second or last nucleotide located at the 3' and 5' ends of the oligonucleotide. Also preferably, at least one of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule is 2,6-diaminopurine and / or at least a methylated cytosine.

[0093] In a further embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a region present in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3'Ol), and the oligonucleotide molecule and / or analog thereof comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or analogue thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3'O1), and the oligonucleotide molecule and / or analogue thereof comprises at least oleic acid conjugated at the 3'-end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 3 or SEQ ID NO: 22.

[0094] In a further embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2PS / PO 3'Ol), and the oligonucleotide molecule and / or analog thereof comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or its analogue is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2PS / PO 3'O1), and the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated at the 3'-end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 4 or SEQ ID NO: 23.

[0095] In a further embodiment, the oligonucleotide molecule and / or analogue thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2PS / PO 5'Ol), and the oligonucleotide molecule and / or analogue thereof comprises at least an oleic acid conjugated to the 5' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or analogue thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2PS / PO 5'O1), and the oligonucleotide molecule and / or analogue thereof comprises at least oleic acid conjugated at the 5'-end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51.

[0096] In a further embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3'Ol with C6SSC6), and the oligonucleotide molecule and / or analog thereof comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analogue units contained in the oligonucleotide molecule and / or analogue thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3'01 with C6SSC6), and the oligonucleotide molecule and / or analogue thereof comprises at least oleic acid conjugated at the 5'-end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3'01 with C6SSC6).

[0097] In a further embodiment, the oligonucleotide molecule and / or analog thereof is an antagonist of hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), and the oligonucleotide molecule and / or analog thereof comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), and the oligonucleotide molecule and / or its analog contains at least an oleic acid conjugated at the 3' end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 7 or SEQ ID NO: 25.

[0098] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD oleic acid 3'), and the oligonucleotide molecule and / or its analogue comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD oleic acid 3'), and the oligonucleotide molecule and / or its analog contains at least oleic acid conjugated at the 3' end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 8 or SEQ ID NO: 26.

[0099] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), and the oligonucleotide molecule and / or its analogue comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), and the oligonucleotide molecule and / or its analog contains at least an oleic acid conjugated at the 3' end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 9 or SEQ ID NO: 27.

[0100] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment made up of a stretch of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of a region present in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), and the oligonucleotide molecule and / or its analogue comprises at least an oleic acid conjugated to the 3' end. Preferably, the full-length sequence of nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the full-length sequence of nitrogenous bases of the oligonucleotide in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), and the oligonucleotide molecule and / or its analog contains at least an oleic acid conjugated at the 3' end. In one embodiment, the oligonucleotide consists solely of SEQ ID NO: 14 or SEQ ID NO: 28.

[0101] Preferably, the oligonucleotide molecule and / or analogue thereof of the first aspect comprises or consists solely of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p), or a sequence having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28.

[0102] Preferably, the oligonucleotides and / or oligonucleotide analogs are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical to any of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28, preferably SEQ ID NOs: 3, 4, 7, 22, 23 or 25, and are capable of increasing, preferably statistically increasing, endogenous levels of MBNL protein, preferably MBNL1 and / or MBNL2 protein, compared to untreated cells or tissues. Most preferably, the oligonucleotide molecules and / or analogs thereof of the first aspect consist solely of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28. It should be noted that in the context of the present invention, when an oligonucleotide molecule and / or analog thereof is said to be specific from a particular SEQ ID NO, it is understood that the oligonucleotide molecule and / or analog thereof also consists only of the chemical modifications, spacer molecules, and oleic acid conjugations set forth in that SEQ ID NO. For example, if an oligonucleotide molecule and / or analog thereof consists only of SEQ ID NO: 3, 4, or 7, it is understood that the oligonucleotide molecule and / or analog thereof consists only of the nucleotide sequence defined in SEQ ID NO: 3, 4, or 7, and the chemical modifications, spacers, and oleic acid conjugations set forth in SEQ ID NO: 3, 4, or 7. A detailed description of the chemical modifications included in each SEQ ID NO is included in the "Sequence Listing" section.

[0103] Additionally, the present invention includes compounds such as oligonucleotide molecules and / or analogs thereof in prodrug form, i.e., compounds that are not fully active but that are in a form or nature that, upon administration, are converted or metabolized in the body to yield the fully pharmacologically active oligonucleotide molecules and / or analogs thereof described herein.

[0104] The cellular expression of the inhibited microRNA should also be considered. According to miRGator v3.0 (miRGator v3.0: a microRNA portal for deep sequencing, expression profiling, and mRNA targeting. Sooyoung Cho et al., Nucleic Acids Research, Volume 41, Issue D1, 1 January 2013, Pages D252-D257, https: / / doi.org / 10.1093 / nar / gks1168), hsa-miR-218-5p is expressed in adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testis, uterus, and joints. On the other hand, hsa-miR-23b-3p is expressed in the central nervous system, gastrointestinal tract, adipose tissue, breast, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphoid cells, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testis, thyroid, and uterus. Thus, possible embodiments of the present invention are preferably antimiRs, more preferably antagonists of hsa-miR-218-5p or hsa-miR-23b-3p, or mixtures of two or more of such molecules, and are oligonucleotide and / or oligonucleotide analog molecules whose target miRNA is expressed in at least one or more organs selected from the group consisting of the brain, cerebellum, hippocampus or central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testes, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphocyte system, or in one or more cells of primary culture from one of these organs, or in established cell lines derived from one of these organs (including induced pluripotent stem cells, known by the acronym IPSC) or stem cells from one of these organs. The choice of the specific microRNA to be antagonized, in particular the specific choice between human hsa-miR-218-5p or human hsa-miR-23b-3pp, also determines the range of tissues in which the antagonizing effect can be exerted.

[0105] In a second aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in the first aspect or any of its embodiments, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients. Preferably, the composition comprises an antimiR as defined in the first aspect or any of its embodiments, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3p. In one embodiment, a composition comprising one of these anti-microRNAs or a mixture thereof, as well as any other anti-microRNA against human hsa-miR-218-5p or human hsa-miR-23b-3p or a mixture thereof, or generally any oligonucleotide and / or oligonucleotide analog molecule that is an inhibitor of one of these microRNAs or another microRNA that downregulates the expression of the human genes MBNL1 and / or MBNL2, includes a composition that also comprises a pharmaceutically acceptable carrier and / or excipient.

[0106] In one possible embodiment, the pharmaceutical composition comprises an effective amount of an inhibitor or antagonist, preferably an antimiR, more preferably an antagonist, of human hsa-miR-218-5p or human hsa-miR-23b-3pp, or a mixture thereof, as defined in the first aspect or any of its embodiments. Preferably, the inhibitor / antagonist of human hsa-miR-218-5p present in the composition is the antimiR-type inhibitor used in the examples of the present invention represented by SEQ ID NO: 1 or its functional equivalents as set forth in SEQ ID NOs: 80-110, and the inhibitor / antagonist of human hsa-miR-23b-3p present in the composition is the antimiR-type inhibitor represented by SEQ ID NO: 2 or its functional equivalents as set forth in SEQ ID NOs: 52-79, wherein the inhibitor is conjugated at its 3'-end and / or 5'-end to at least one oleic acid molecule. More preferably, the inhibitor(s) / antagonist(s) contained in the composition are present in a concentration that allows for the administration of a therapeutically effective dose.

[0107] An "effective amount" or "therapeutically effective dose" is an amount sufficient to achieve a beneficial or desired clinical outcome. Effective amounts of microRNA inhibitors / antagonists may be about 0.5 mg / kg to about 100 mg / kg in mice, preferably about 1.5 mg / kg to 100 mg / kg, or about 0.75 mg / kg to 50 mg / kg in rats, based on previous results obtained with molecules against other microRNAs. However, the precise determination of what would be considered an effective dose in humans may depend on individual factors for each patient, including size, age, and the nature of the inhibitor or antagonist (e.g., if it is an expression construct, antimiR, or oligonucleotide analog, etc.). Nevertheless, dosages can be readily determined by those skilled in the art based on this description and their own knowledge.

[0108] For its clinical use, the compositions according to the use of the present invention are then considered as pharmaceutical compositions of the present invention, and they can be prepared in a suitable form for the desired use.During a certain treatment period, it may be necessary or convenient to administer multiple doses to the subject, and administer the dose daily, weekly, monthly, every two months, every three months, or every six months.In certain embodiments, the subject initially receives an initial dose that is greater than one or more subsequent doses or maintenance doses.In certain embodiments, the subject receives periodic or chronic administration, particularly in the case of treating chronic diseases such as DM1.

[0109] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, pearls, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, other oligonucleotide-based delivery vehicles, and liposomes, can be used as administration vehicles for the inhibitors / antagonists of the present invention to form pharmaceutical compositions of the present invention. Another possibility is to prepare the pharmaceutical compositions of the present invention using appropriate salts and buffers to stabilize the administration vehicle and assist its uptake by target cells. The compositions of the present invention can be aqueous compositions containing an effective amount of an administration vehicle and an oligonucleotide molecule of the present invention, either independently or in a liposome or other complex, or its expression vector, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.

[0110] Additional active ingredients can also be incorporated into the compositions, provided they do not inactivate the molecules of the invention or their expression vectors.

[0111] Solutions of the active compounds as free bases or pharmacologically acceptable salts can be prepared in water, suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary storage and use conditions, these preparations generally contain a preservative to prevent the growth of microorganisms. Oligonucleotides can also be prepared in a solution of phosphate-buffered saline and sodium chloride. For example, oligonucleotides can be prepared in phosphate-buffered saline at a pH of 6.5-8, preferably about 6.8-7, and sodium chloride at a concentration of about 150 mM.

[0112] The compositions of the present invention can generally be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid), etc. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide) or organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0113] In a third aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in therapy. Preferably, oleic acid conjugated to an oligonucleotide molecule and / or its analog acts as a vehicle for delivering the oligonucleotide molecule and / or its analog to relevant tissues, such as muscle and / or the CNS. Thus, an oligonucleotide molecule or its analog according to the first aspect, conjugated at its 3' and / or 5' end to at least one oleic acid molecule, may be for use in a method of therapeutic treatment in a human subject in need thereof, wherein the oligonucleotide molecule and / or its analog is an active ingredient of the therapeutic treatment, and the oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier for the oligonucleotide molecule and / or its analog. The term "active ingredient" is used herein to refer to a substance that is pharmaceutically active and responsible for the therapeutic effect. In the case of an antimiR antagonist, the active ingredient is a molecule, preferably an oligonucleotide molecule, that targets an endogenous miR. Most preferably, the term "active ingredient" is used herein to refer to an oligonucleotide molecule and / or analogues thereof as defined in the first aspect of the invention.

[0114] In a fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in the prevention or treatment of a muscle and / or nervous system disease accompanied by structural and / or functional changes in the brain and / or other tissues of the CNS, preferably a muscle disease accompanied by weakness and wasting of muscle tissue, in particular a muscle disease accompanied by muscle weakness, increased disability and deformity, and / or preferably a nervous system disease. Preferably, the muscle disease is a muscular dystrophy disease. Preferably, the muscular dystrophy disease is selected from the group consisting of Becker muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, and pharyngeal muscular dystrophy. Preferably, the muscle disease is myotonic dystrophy, preferably type 1 and / or type 2. Preferably, the use according to the fourth aspect comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analogue thereof for delivery of said oligonucleotide molecule and / or analogue thereof to relevant tissues such as muscle and / or the CNS.

[0115] In an alternative fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in the prevention or treatment of a disease characterized by insufficient amount or function of the MBNL gene and / or protein in a subject in need thereof. Preferably, the use comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analog thereof for delivering the oligonucleotide molecule and / or analog thereof to relevant tissues such as muscle and / or the CNS. "Insufficient amount or function of the MBNL gene and / or protein," as used herein, refers to a statistically significantly lower amount or function of the MBNL gene and / or protein compared to healthy subjects. In a further alternative fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in targeting muscle and / or CNS cells in a subject in need thereof, preferably muscle cells in a subject suffering from DM or DM1. "Targeting muscle and / or CNS cells," as used herein, refers to increasing the amount of insufficient MBNL protein and / or gene in the cells. CNS cells preferably include neurons, but also glial cells (astrocytes, oligodendrocytes, ependymal cells, and microglia), choroid plexus cells, blood vessels, and cells associated with the lining. Muscle cells include smooth cells, preferably skeletal cells, and cardiac cells. Preferably, the increase is statistically significant, preferably compared to control or untreated cells.

[0116] In a further alternative fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in the prevention or treatment of diseases characterized by the expression of toxic RNA (also called RNAopathies or RNA-mediated / RNA-dominant diseases). Preferably, the use comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analogue thereof for delivering the oligonucleotide molecule and / or analogue thereof to relevant tissues such as muscle and / or the CNS. Such diseases are usually characterized by the expansion of unstable microsatellite repeats caused by aberrant mutational mechanisms, and the expression of expanded repetitive elements creates a sink for RNA-binding proteins by, among other mechanisms, increasing the mass of target RNA per nucleus and by increasing the avidity of RNA-protein interactions due to a higher local concentration of binding sites in each mutant transcript. Preferably, the RNAopathies or RNA-mediated / RNA-dominant diseases are neuromuscular or neurodegenerative diseases, more preferably selected from the group consisting of DM type 1 (ORPHA:273) or type 2 (ORPHA:606); Fragile X-associated tremor / ataxia syndrome (ORPHA:93256; FXTAS); C9ORF72 amyotrophic lateral sclerosis and / or frontotemporal dementia (ORPHA:275872; ALS / FTD); spinocerebellar ataxia (SCA) or benign adult familial myoclonic epilepsy (BAFME).

[0117] In a further alternative fourth aspect, the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiments, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments, for use in the prevention or treatment of a disease characterized by an excess amount or function of miR-23b-3p and / or miR-218-5p. "Excess amount or function of miR-23b-3p and / or miR-218-5p" refers herein to a statistically significantly higher amount or function of miR-23b-3p and / or miR-218-5p compared to the amount or function in healthy subjects. Preferably, the disease characterized by an excess amount or function of miR-23b-3p and / or miR-218-5p is myotonic dystrophy, preferably type 1 and / or type 2. Preferably, the use comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analogue thereof for delivery of the oligonucleotide molecule and / or analogue thereof to relevant tissues such as muscle and / or the CNS.

[0118] Preferably, the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspect is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having SEQ ID NO: 1 or 2, respectively, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1 or 2. Preferably, the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspect is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having SEQ ID NO: 80-110 or SEQ ID NO: 52-79, respectively, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 80-110 or SEQ ID NO: 52-79.

[0119] More preferably, the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspect is an antagonist comprising or consisting of SEQ ID NO: 3, 4, or 5 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9, or 14 (antimiR against hsa-miR-218-5p), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3, 4, or 5 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9, or 14 (antimiR against hsa-miR-218-5p). More preferably, the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspect is an antagonist comprising or consisting of a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22, 23, 24, 49, 50 or 51 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 25, 26, 27 or 28 (antimiR against hsa-miR-218-5p), or SEQ ID NO: 3, 4 or 5 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (antimiR against hsa-miR-218-5p). As described above in the first aspect, the oligonucleotides or analogues thereof for use according to the third and fourth aspects also comprise at least one oleic acid molecule conjugated at their 3' and / or 5' ends.

[0120] In one embodiment of the fourth aspect, the treatment is palliative treatment of one or more symptoms of myotonic dystrophy type 1 and / or type 2, or palliative treatment of one or more muscle disorders that are part of the symptoms of myotonic dystrophy type 1 and / or type 2. In a preferred embodiment of the fourth aspect, the treatment is for chronic myotonic dystrophy type 1 and / or type 2. In a preferred embodiment, the therapy is a therapeutic treatment. Preferably, the use comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analogue thereof for delivery of said oligonucleotide molecule and / or analogue thereof to relevant tissues such as muscle and / or the CNS.

[0121] In one embodiment of the third and fourth aspect, the subject in need thereof is a mammal, preferably a human, more preferably a human suffering from DM, preferably DM1.

[0122] Administration of the antagonist via its possible expression vector allows for targeting of expression to a tissue or a specific group of tissues according to the tropism of the base vector itself and / or by selecting regulatory elements that cause expression of the coding sequence linked to them only in specific tissues. Furthermore, some specific dosage forms may support greater access to one or other organ. Therefore, possible embodiments, which can be combined with any other of the third and fourth aspects of the invention that refer more directly to therapeutic applications, can also be defined as the use of one of the oligonucleotide and / or oligonucleotide analogue molecules of the invention, a mixture of two or more thereof, or a composition comprising at least one of said molecules, for the manufacture of a medicament for treating myotonic dystrophy type 1 by inhibiting or antagonizing the action of human hsa-miR-218-5p or hsa-miR-23b-3p in at least one or more organs selected from the group consisting of the brain, cerebellum, hippocampus or other central nervous system organs, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or stem cells derived from one or more of these organs. Other organs that may also be targeted by the oligonucleotides of the present invention are, as desired or appropriate, selected from the group consisting of the brain, cerebellum, hippocampus or another organ of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testes and uterus, gastrointestinal tract, breast, bladder, prostate, skin, or keratinocytes and lymphoid cells or stem cells from one or more of these organs, or a combination thereof.

[0123] Given the stability of antimiRs, direct administration to mammals, preferably humans, can be contemplated, e.g., via subcutaneous or systemic routes, preferably intravenous or intrathecal routes, dissolved or suspended in a pharmaceutically acceptable carrier, e.g., water or an aqueous solution, e.g., saline or phosphate buffer, or intra-articular delivery. The compositions in which they are administered can contain pharmaceutically acceptable excipients.

[0124] The active compositions of the present invention can be administered by any common route, so long as the target tissue is available through that route. This includes oral, nasal, intrathecal, or buccal routes; preferably, administration may be via intradermal, transdermal, subcutaneous, intramuscular, intraperitoneal, or intravenous routes. As mentioned above, compositions containing antimiRs are typically formulated for intravenous or subcutaneous administration. However, because oleic acid enhances delivery of oligonucleotide molecules and / or analogs thereof to muscle and / or CNS cells when administration is intravenous (see Examples 9 and 10), preferred embodiments involve intravenous, intraarterial, or subcutaneous administration. Furthermore, it is also preferred that the intravenous, intraarterial, or subcutaneous administration is chronic, meaning that it is administered regularly (extending the overall lifespan of the patient in need thereof).

[0125] Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as injectable solutions, drug release capsules, and the like.

[0126] A further aspect provides a method for treating DM, preferably DM1, in a subject in need thereof, comprising administering an oligonucleotide or pharmaceutical composition of the present invention to a patient in need thereof. In some embodiments, the oligonucleotide is present at a concentration that allows for the administration of a therapeutically effective dose. Preferably, the treatment method comprises the use of at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and / or analog thereof for delivering the oligonucleotide molecule and / or analog thereof to relevant tissues, such as muscle, and / or the CNS.

[0127] As explained above, the examples provide evidence of how oleic acid can increase delivery to target tissues such as muscle and brain. This leads to the conclusion that oleic acid not only reduces toxicity when a molecule contains a higher amount of PS relative to PO, but also serves as an efficient vehicle for transporting oligonucleotide molecules and / or analogs thereof to target tissues such as muscle and / or CNS. In light of this, a fifth aspect of the present invention relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier when conjugated to an oligonucleotide molecule and / or analog thereof, preferably conjugated to the 3' or 5' end of the oligonucleotide molecule and / or analog. Importantly, the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier refers to the use of the oleic acid molecule to transport, deliver, or carry the oligonucleotide molecule and / or analog to which it is conjugated to a specific target tissue, preferably muscle and / or CNS tissue. In this context, "vehicle" and "carrier" are considered synonymous and are therefore used interchangeably.

[0128] Those skilled in the art know how to test whether oleic acid acts as a vehicle for the oligonucleotide molecule and / or its analogue to which it is conjugated. For example, a method for assessing whether at least one oleic acid is used as a vehicle is to measure the amount of the oligonucleotide molecule and / or its analogue that reaches the target tissue (preferably CNS and / or muscle tissue) after intravenous, intraarterial or subcutaneous administration, and compare this amount with the amount present in the tissue when the oligonucleotide molecule and / or its analogue is administered without being conjugated with at least one oleic acid.

[0129] Preferably, the oligonucleotide molecule and / or its analogue to which oleic acid is conjugated is an oligonucleotide molecule and / or its analogue as defined in the first aspect of the present invention or any of its embodiments. Accordingly, a preferred embodiment of the fifth aspect refers to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier, where the oleic acid conjugated to the 3'- or 5'-end of the oligonucleotide molecule and / or its analogue as defined in the first aspect is preferably an active ingredient in a therapeutic method of treatment as defined in the third or fourth aspect of the present invention or any of its embodiments. It should be noted that the conjugation between the oligonucleotide molecule and / or its analogue can be direct conjugation or conjugation across a spacer molecule, as described in the first aspect of the present invention. Preferably, the oleic acid used as a vehicle is conjugated to the oligonucleotide molecule and / or its analogue via a spacer molecule selected from the group consisting of NHC3, NHC5, NHC6, threoninol, and derivatives thereof.

[0130] In one embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the 5'-end or 3'-end of the oligonucleotide molecule and / or analogue thereof of the first aspect or any of its embodiments, such that the single oleic acid molecule acts as a vehicle for said oligonucleotide molecule and / or analogue thereof. In one embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the oligonucleotide molecule and / or analogue thereof of the first aspect or any of its embodiments, such that the single oleic acid molecule acts as a vehicle for said oligonucleotide molecule and / or analogue thereof, and the oligonucleotide molecule as defined in the first aspect and / or analogue thereof acts as the active ingredient in a method of treatment by therapy as defined in the third or fourth aspect.

[0131] In a preferred embodiment, at least one oleic acid molecule conjugated to an oligonucleotide molecule and / or analogue thereof as defined in the first aspect of the invention or any of its embodiments is capable of transporting said oligonucleotide molecule and / or analogue thereof to a tissue of interest, such as muscle and / or CNS, more efficiently than when said oligonucleotide molecule and / or analogue thereof is not conjugated to oleic acid, as shown in Example 9 or 10. Thus, the oleic acid molecule is used as an active ingredient delivery vehicle, the active ingredient being an oligonucleotide molecule and / or analogue thereof as defined in the first aspect or any of its embodiments.

[0132] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' or 5' end of the oligonucleotide molecule and / or analogue thereof of the first aspect or any of its embodiments, wherein the oligonucleotide molecule and / or analogue thereof comprises a mixture of phosphorothioate and phosphodiester linkages chemically linking the nucleotides, and preferably the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages.

[0133] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' or 5' end of an oligonucleotide molecule and / or analogue of the first aspect or any of its embodiments, wherein the oligonucleotide molecule and / or analogue thereof is an antagonist of a microRNA, preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0134] In one embodiment, at least one oleic acid molecule, when conjugated to the 3' or 5' end of the oligonucleotide molecule and / or analogue thereof of the first aspect or any of its embodiments, is used as a pharmaceutically acceptable vehicle or carrier, and the oleic acid used as a vehicle delivers the oligonucleotide molecule and / or analogue thereof to muscle and / or CNS cells in a subject in need thereof when the oligonucleotide molecule and / or analogue thereof is administered via intravenous, intra-arterial or subcutaneous routes.

[0135] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' or 5' end of an oligonucleotide molecule and / or analogue thereof as defined in the first aspect or any of its embodiments, wherein said oligonucleotide molecule and / or analogue thereof is an active ingredient in a therapeutic method of treatment, including prevention or treatment of muscular disorders, nervous system disorders, and / or RNAopathies.

[0136] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3' or 5' end of an oligonucleotide molecule or analogue thereof as defined in the first aspect or any of its embodiments, and said oligonucleotide molecule and / or analogue thereof is an active ingredient in a method of treatment by therapy including prevention or treatment of myotonic dystrophy, preferably myotonic dystrophy type 1.

[0137] In a fifth aspect, the present invention also provides a conjugate consisting of at least one oleic acid conjugated to the 3' or 5' end of an oligonucleotide molecule or analogue thereof as defined in the first aspect or any of its embodiments, wherein said oligonucleotide molecule or analogue thereof is used as an active ingredient in a method of treatment by therapy as defined in the third or fourth aspect or any of those embodiments, and wherein the at least one oleic acid is used as a pharmaceutically acceptable vehicle for delivering said oligonucleotide molecule or analogue thereof to a target tissue, such as the CNS and / or muscle tissue.

[0138] The following provisions are also included in the present invention: 1. An oligonucleotide molecule, or a mixture of two or more of such molecules, wherein the oligonucleotide molecule comprises 10-30 nucleotides in length, the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate bond, and the oligonucleotide molecule is conjugated at its 3' and / or 5' end to at least one oleic acid molecule. 2. The oligonucleotide molecule of clause 1, wherein the molecule is an antagonist of a microRNA. 3. The oligonucleotide molecule of clause 2, wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p. 4. The oligonucleotide molecule of any one of clauses 1 to 3, wherein the oligonucleotide molecule comprises 15 to 30 nucleotides in length, at least two nucleotides of the molecule are joined by phosphodiester bonds, and the number of nucleotides chemically joined by phosphorothioate bonds is greater than the number of nucleotides chemically joined by phosphodiester bonds. 5. The oligonucleotide molecule of any one of clauses 1 to 4, wherein the oligonucleotide molecule comprises a fragment consisting of a run of at least 15 consecutive nitrogenous bases of nucleotides that is at least 80% identical to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NO: 52 to 110, comprising a length of 15 to 30 nucleotides. 6. The oligonucleotide molecule of any one of clauses 1 to 5, wherein the oligonucleotide molecule comprises a fragment consisting of a run of at least 15 consecutive nitrogenous bases of nucleotides that is 15 to 30 nucleotides in length and that is identical to a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p). 7. Contains at least one chemical modification, wherein the chemical modification is i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) an additional bridge connecting the 2' oxygen and the 4' carbon (LNA) 7. The oligonucleotide molecule of any one of clauses 1 to 6, selected from the group consisting of: 8. The oligonucleotide molecule of any one of clauses 1 to 7, wherein the oligonucleotide molecule comprises a fragment consisting of a run of at least 15 consecutive nitrogenous bases of nucleotides that is at least 80% identical to the sequence of a region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, or 51 (antagonists of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p). 9. The oligonucleotide molecule according to any one of clauses 1 to 8, wherein the oligonucleotide molecule comprises 15 to 30 nucleotides in length and the nucleotide sequence of the oligonucleotide consists solely of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p). 10. A composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in any one of clauses 1 to 9, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients. 11. A composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in any one of clauses 1 to 9, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients, for use in therapy. 12. A composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in any one of clauses 1 to 9, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients, for use in targeting muscle cells in a subject in need thereof. 13. A composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in any one of clauses 1 to 9, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients, for use in the prevention or treatment of a muscular disease or the prevention or treatment of RNAopathies. 14. A composition, preferably a pharmaceutical composition, for use according to clause 13, wherein the disease is myotonic dystrophy. 15. A composition, preferably a pharmaceutical composition, for use according to clause 14, wherein the myotonic dystrophy is type 1.

[0139] Sequence List (5' to 3' direction) As noted above, the SEQ ID NOs listed below and referred to throughout this application also include nucleobase sequences and, for those of oligonucleotides that deviate from their natural chemical nature, their chemical modifications and / or fatty acid conjugations. Throughout this specification, the following nomenclature is used to define the chemical modifications contained in the SEQ ID NOs disclosed herein: - LNA nucleotides are indicated by uppercase and lowercase letters: Ab, Gb, Tb, Cb. -Phosphorothioate linkages are indicated by a small "s" letter. -2'-O-MOE RNA nucleotides are designated by the following uppercase and lowercase letters: Am, Cm, Gm, Tm. -2'-O-methyl-nucleotides are indicated by small letters: a, g, c, u. -2'-fluoro RNA nucleotides are designated by the following uppercase and lowercase letters: Af, Cf, Gf, Tf. The -2'-O-methyl-2,6-diaminopurine modification is represented by the formula (dap). - Deoxynucleotides are designated by a combination of lowercase and uppercase letters: dA, dC, dG, dT. -2'-OMe-5-methyluridine or 2'-OMe-ribothymidine is represented by a small letter "t". -5-methyl-2'-O-methylcytidine is represented by the formula (5Mc). The term -(oleic acid) means that the oligonucleotide is conjugated to oleic acid. The term -(palmitic acid) means that the oligonucleotide is conjugated to palmitic acid. -(Spacer molecule) is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof. Preferably, the spacer molecule is NHC6 or NHC3. - "Y" is used for any pyrimidine (C or U / T). - "I" is used for hypoxanthine because hypoxanthine is the nucleobase of inosine. SEQ ID NO: 1: Antagonist of human hsa-miR-218-5p: TTAGATCAAGCACAA SEQ ID NO: 2: Antagonist of human hsa-miR-23b-3p: ATCCCTGGCAATGTGA SEQ ID NO: 3: MD23b-2 V2 3'Ol: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(oleic acid) SEQ ID NO: 4: MD23b-2-PS / PO 3'Ol: AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(NHC6)(oleic acid) SEQ ID NO: 5: MD23b-2-PS / PO 5'Ol: (Oleic acid) (NHC6) Abs Tms (5Mc) s (5Mc) (5Mc) Tb gs gs (5Mc) sAb Am Tb Gbs Tms Gbs Ab SEQ ID NO: 6: MD23b-2-PS / PO: AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb SEQ ID NO:7:218 MOE Oleic Acid 3': TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(NHC6)(Oleic Acid) SEQ ID NO: 8:218 MOE DD Oleic Acid 3': TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(NHC6)(Oleic Acid) SEQ ID NO: 9:218 OME / MOE Oleic Acid 3': TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(Oleic Acid) SEQ ID NO: 10: hsa-miR-218-5p: UUGUGCUUGAUCUAACCAUGU SEQ ID NO: 11: hsa-miR-23b-3p: AUCACAUUGCCAGGGAUUACCAC SEQ ID NO: 12: Seed region of hsa-miR-218-5p: UGUGCU SEQ ID NO: 13: Seed region of hsa-miR-23b-3p: UCACAU SEQ ID NO: 14:218 OME / MOE Oleic Acid 3'2: TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(Oleic Acid) SEQ ID NO: 15:218 MOE: TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb SEQ ID NO: 16MD23b-2 V2 3'Pal: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(Palmitic acid) SEQ ID NO: 17: MD23b-2 V2: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb SEQ ID NO: 18: MD23MOE: AbsTbsCmsCmCmsTmsGmGmsCmAmAmsTbGmsTmGbsAb SEQ ID NO: 19: MicroRNA precursor (pre-microRNA) of hsa-miR-23b-3p: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC SEQ ID NO: 20: Pre-hsa-miR-218-5p-1 (chr4: 20529898-20530007): GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA SEQ ID NO: 21: Pre-miR-218-2 (chr5:1681951SI-168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA SEQ ID NO: 22: MD23b-2 V2 3'Ol without a specific spacer molecule: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 23: MD23b-2-PS / PO 3'Ol without a specific spacer molecule: AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 24: MD23b-2-PS / PO 5'Ol without a specific spacer molecule: (oleic acid) (spacer molecule) AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 25: 218 MOE oleic acid 3' without a specific spacer molecule: TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 26: 218 MOE DD Oleic Acid 3' without a specific spacer molecule: TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 27: 218 OME / MOE Oleic Acid 3' without a specific spacer molecule: TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 28: 218 OME / MOE Oleic Acid 3'2 without a specific spacer molecule: TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(spacer molecule)(oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 29: MD23b-2 V2 3'Pal without specific spacer molecule: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer molecule)(palmitic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or derivatives thereof). SEQ ID NO: 49: MD23b-2 V2 3'Ol with C6SSC6 and NHC6 AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC6)(oleic acid) SEQ ID NO: 50: MD23b-2 V2 3'Ol with C6SSC6 and NHC3 AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC3)(oleic acid) SEQ ID NO: 51: MD23b-2-PS / PO 5'01 without a spacer molecule: (Oleic acid)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb. SEQ ID NO: 52: Functionally equivalent sequence of antimiR-23b-3p: YTCCCTGGCAATGTGA SEQ ID NO: 53: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTYGCAATGTGA SEQ ID NO: 54: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGYCAATGTGA SEQ ID NO: 55: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCYATGTGA SEQ ID NO: 56: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAYTGTGA SEQ ID NO: 57: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATYTGA SEQ ID NO: 58: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTYA SEQ ID NO: 59: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGY SEQ ID NO: 60: Functionally equivalent sequence of antimiR-23b-3p: GTCCCTGGCAATGTGA SEQ ID NO: 61: Functionally equivalent sequence of antimiR-23b-3p: ATUCCTGGCAATGTGA SEQ ID NO: 62: Functionally equivalent sequence of antimiR-23b-3p: ATCUCTGGCAATGTGA SEQ ID NO: 63: Functionally equivalent sequence of antimiR-23b-3p: ATCCUTGGCAATGTGA SEQ ID NO: 64: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGUAATGTGA SEQ ID NO: 65: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCGATGTGA SEQ ID NO: 66: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAGTGTGA SEQ ID NO: 67: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGG SEQ ID NO: 68: Functionally equivalent sequence of antimiR-23b-3p: ITCCCTGGCAATGTGA SEQ ID NO: 69: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCIATGTGA SEQ ID NO: 70: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAITGTGA SEQ ID NO: 71: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGI SEQ ID NO: 72: Functionally equivalent sequence of antimiR-23b-3p: AICCCTGGCAATGTGA SEQ ID NO: 73: Functionally equivalent sequence of antimiR-23b-3p: ATCCCIGGCAATGTGA SEQ ID NO: 74: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAAIGTGA SEQ ID NO: 75: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGIGA SEQ ID NO: 76: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTIGCAATGTGA SEQ ID NO: 77: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGICAATGTGA SEQ ID NO: 78: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATITGA SEQ ID NO: 79: Functionally equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTIA SEQ ID NO: 80: Functionally equivalent sequence of antimiR-218-5p: TTYGATCAAGCACAA SEQ ID NO: 81: Functionally equivalent sequence of antimiR-218-5p: TTAYATCAAGCACAA SEQ ID NO: 82: Functionally equivalent sequence of antimiR-218-5p: TTAGYTCAAGCACAA SEQ ID NO: 83: Functionally equivalent sequence of antimiR-218-5p: TTAGATCYAGCACAA SEQ ID NO: 84: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAYGCACAA SEQ ID NO: 85: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAYCACAA SEQ ID NO: 86: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCYCAA SEQ ID NO: 87: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACYA SEQ ID NO: 88: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAY SEQ ID NO: 89: Functionally equivalent sequence of antimiR-218-5p: TTGGATCAAGCACAA SEQ ID NO: 90: Functionally equivalent sequence of antimiR-218-5p: TTAGGTCAAGCACAA SEQ ID NO: 91: Functionally equivalent sequence of antimiR-218-5p: TTAGATUAAGCACAA SEQ ID NO: 92: Functionally equivalent sequence of antimiR-218-5p: TTAGATCGAGCACAA SEQ ID NO: 93: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAGGCACAA SEQ ID NO: 94: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGUACAA SEQ ID NO: 95: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCGCAA SEQ ID NO: 96: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCAUAA SEQ ID NO: 97: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACGA SEQ ID NO: 98: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAG SEQ ID NO: 99: Functionally equivalent sequence of antimiR-218-5p: TTIGATCAAGCACAA SEQ ID NO: 100: Functionally equivalent sequence of antimiR-218-5p: TTAGITCAAGCACAA SEQ ID NO: 101: Functionally equivalent sequence of antimiR-218-5p: TTAGATCIAGCACAA SEQ ID NO: 102: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAIGCACAA SEQ ID NO: 103: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCICAA SEQ ID NO: 104: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACIA SEQ ID NO: 105: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAI SEQ ID NO: 106: Functionally equivalent sequence of antimiR-218-5p: ITAGATCAAGCACAA SEQ ID NO: 107: Functionally equivalent sequence of antimiR-218-5p: TIAGATCAAGCACAA SEQ ID NO: 108: Functionally equivalent sequence of antimiR-218-5p: TTAGAICAAGCACAA SEQ ID NO: 109: Functionally equivalent sequence of antimiR-218-5p: TTAIATCAAGCACAA SEQ ID NO: 110: Functionally equivalent sequence of antimiR-218-5p: TTAGATCAAICACAA SEQ ID NO: 111: TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester

[0140] The following examples merely illustrate the invention. [Example]

[0141] Materials and Methods Cell culture experiments Immortalized MyoD-inducible (doxycycline) DM1 and control fibroblasts (Arandel L., et al. (2017) "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds," Dis Model Mech 10(4):487-497) were grown in DMEM containing 4.5 g / L glucose, 1% P / S, and 10% FBS (Sigma, Saint Louis, Missouri). Fibroblast transdifferentiation into myotubes was performed as described (Cerro-Herreros et al. (2018) "miR-23b and miR-218 silencing increases muscleblind-like expression and alleviates myotonic dystrophy phenotypes in mammalian models," Nat. Commun. 9, 2482).Transdifferentiation was induced on day 0, and test compounds were added at different concentrations (MD23b-2, MD23b-8, MD23b-4, MD23b-13, MD23b-7, MD23b-14, MD-23b-1, 23-LNA4, MD23b-10, MD23b-3, AntimiR-23b, MD23b-6, MD23b-12, MD23b-9, MD23b-5, MD23b b-11, 23-LNA6, unconjugated 23b, 5'-23b-oleic acid, 5'-23b-linoleic acid, 5'-23b-MeToc, 5'-23b-MeChol, 5'-23b-MePal, 5'-23b-elaidic acid, 5'-23b-estearic acid, OL-MD23b-2, MD23b-2-PS / PO, MD23b-2-PS / PO 10 nM, 50 nM, 200 nM, 1 μM, and 5 μM for 5'Ol, unconjugated 218, Ax-218, 5'-218-oleic acid, 5'-218-MeChol, 5'-218-linoleic acid, 5'-218-MePal, 5'-218-MeToc, Sc-oleic acid, MD218-12, MD218-6, MD218-11, unconjugated 218, MD218-13, MD218-5, MD218-4, MD218-15, MD218-10, and MD218-3; 23-LNA8, AX-23b, MD23b-2 V2 3'Ol, MD23b-2 V2 3'Ol(C6SSC6)(NHC6), and MD23b-2 V2 The 3'OL(C6SSC6)(NHC3) and MD23b-2V2 3'OL(threoninol) were added to the cell culture medium by lipofection using X-tremeGENE™ HP (Roche, Basel, Switzerland) at concentrations of 2 nM, 10 nM, 50 nM, 200 nM, and 1 μM; 23-D / LNA1, 23-D / LNA2, and 218-2F / LNA1: 0.4 nM, 2 nM, 10 nM, 50 nM, and 200 nM; and 218-D / LNA2, 218-2F / MOE: 0.08 nM, 0.4 nM, 2 nM, 10 nM, and 50 nM. The differentiation medium was then replaced with fresh differentiation medium after 4 hours. Cells were harvested on day 4 in differentiation medium and processed for protein extraction.

[0142] Cell proliferation assay 10 in a 96-well plate5 Cells seeded at 1000 cells / ml were transfected with antimiR after 24 hours as previously described, and cell proliferation was measured after 96 hours using the CellTiter96® Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, Wisconsin). TC50 values ​​were calculated using nonlinear least-squares regression, and absorbance levels were determined using an Infinite M200 PRO plate reader (Tecan, Mannedorf, Switzerland).

[0143] Quantitative dot blot (QDB) assay For activity assays, cells were plated in 6-well plates at 8 x 10 4Cells were seeded at a density of 1000 cells / well and transfected with antimiR 24 hours later as previously described. For total protein extraction, mouse muscles (gastrocnemius and quadriceps) were homogenized in Pierce® RIPA buffer (Thermo Scientific, Waltham, Massachusetts) supplemented with a protease and phosphatase inhibitor cocktail (Roche Applied Science, Penzberg, Germany), while human muscle cells were sonicated. Total protein quantification was performed using the Pierce® BCA Protein Assay Kit (Thermo Scientific, Waltham, Massachusetts) with bovine serum albumin as the standard. For immunodetection assays, 1 μg / well of cell samples and 2 μg / well of mouse samples were denatured (100°C for 5 min) and loaded onto QDB plates (Quanticision Diagnostics Inc, Research Triangle Park, North Carolina). Each cell sample was loaded in quadruplicate onto two different plates, one for MBNL1 detection and the other for GAPDH, which was used here as an endogenous control. For mouse samples, each sample was loaded in quadruplicate onto three different plates, one for MBNL1 detection, one for tubulin, which was used as an endogenous control, and one for anti-mouse IgG secondary antibody as a negative control for background subtraction. For the QDB protocol, protein was prepared at 2 μg / well. Each sample was loaded at 2 μg / well. Four different plates were loaded in quadruplicate, one for MBNL1 detection and the other for GAPDH, which serves as an endogenous control. To prepare the sample mixture (enough for 10 samples to account for pipetting error), protein extract was brought to the indicated concentration, 10.4 μl of 4X loading buffer was added, and finally, 50 μl of ddH2O was added to complete the mixture. Once the sample was prepared, it was boiled in water for 5 minutes to denature the protein, and then placed on ice. To load the sample, a QDB plate (Quanticision Diagnostics, Inc.) was placed upside down.Each membrane circle was filled with 5 μl of the previously prepared protein mix. The loaded QDB plate was dried at room temperature in a well-ventilated space for 30 minutes to completely dry the membrane. After drying, the QDB plate was immersed in transfer buffer (0.039 M glycine, 0.048 M Tris, 0.37% SDS, 20% methyl alcohol) and gently shaken for 1 minute. The plate was rinsed three times with TBST (137 mM NaCl, 2.7 mM KCl, 20 mM Tris, pH 7.4 + 0.1% Tween-20) and blotted with blocking buffer (5% nonfat milk in TBST) in a single container. The plate was incubated overnight at 4°C in a 96-well plate with primary mouse anti-MBNL1 (1:1000, ab77017, Abcam) or mouse anti-GAPDH (1:500, clone G-9, Santa Cruz). The plate was washed three times with TBST and reincubated with the secondary antibody anti-mouse-POD (1:200, Sigma-Aldrich) for 2 h, after which the plate was washed three times again with TBST. The plate was inserted into a 96-well plate loaded with 100 μL / well of ECL substrate (Pierce) solution for 1 min, and then inserted into a white 96-well plate for chemiluminescence signal quantification using a Tecan Infiniti200 Pro microplate reader, with the option "Plate with cover" selected in the user interface.

[0144] Plates were incubated overnight at 4°C with primary mouse anti-MBNL1 (1:200, MB1a (4A8)) (DSHB, Iowa City, Iowa) and rabbit anti-α-tubulin (1:1000, PA5-16891, Thermo Fisher Scientific) antibodies. Primary antibodies were detected using goat horseradish peroxidase (HRP)-conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies (1:3500, Sigma-Aldrich, Saint Louis, Missouri), respectively. Immunoreactions were detected using Pierce™ ECL Western reagent (Thermo Scientific, Waltham, Massachusetts), and luminescence was acquired using an Infinite M200 PRO plate reader (Tecan, Mannedorf, Switzerland).

[0145] RNA extraction, reverse transcription PCR (RT-PCR) and real-time quantitative reverse transcription PCR (qRT-PCR) Total RNA from mouse gastrocnemius and quadriceps muscles was isolated using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One microgram of RNA was digested with DNase I (Invitrogen, Carlsbad, California) and reverse transcribed with SuperScript II (Invitrogen, Carlsbad, California) using random hexanucleotides. For subsequent PCR reactions, 20 ng of cDNA was used with GoTaq polymerase (Promega, Madison, Wisconsin). Specific primers were used to analyze alternative splicing of Atp2a1, Nfix, Mbnl1, and Clcn1 in mouse samples (both muscles). Gapdh levels were established as endogenous baseline levels using 0.2 ng of cDNA. PCR products were separated on a 2% agarose gel and quantified using ImageJ software (NIH, Bethesda, Maryland). Splice recovery rate (PSR) is the value % SI Minus X% DSI X% DSI Minus X%HSI The ratio was defined as the ratio of the splicing inclusion ratio (SI: splicing inclusion ratio for each sample; DSI: disease splicing inclusion ratio; HSI: healthy splicing inclusion ratio; in all cases, splicing inclusion ratio refers to the inclusion of the indicated alternative exon). This ratio was calculated for ATP2A1, NFIX, MBNL1, and CLCN1. The primer sequences and exons analyzed are available in (Cerro-Herreros et al. 2018 2018 Jun 26;9(1):2482. doi:10.1038 / s41467-018-04892-4.) and are reproduced below. SEQ ID NO: 30: GapdhFwd:ATCAACGGGAAGCCCATCAC SEQ ID NO: 31: GapdhRv:CTTCCACAATGCCAAAGTTGT SEQ ID NO: 32: Atp2aFwd: GCTCATGGTCCTCAAGATCTCAC SEQ ID NO: 33: Atp2aRv:GGGTCAGTGCCTCAGCTTTG SEQ ID NO: 34: Clcn1Fwd:GTCCTCAGCAAGTTTATGTCC SEQ ID NO: 35: Clcn1Rv:GAATCCTCGCCAGTAATTCC SEQ ID NO: 36: NfixFwd:TCGACGACAGTGAGATGGAG SEQ ID NO: 37: NfixRv:CAAACTCCTTCAGCGAGTCC SEQ ID NO: 38: Mbnl1 ex5F: AGGGGAGATGCTCTCGGGAAAAGTG SEQ ID NO: 39: Mbnl1 ex5R: GTTGGCTAGAGCCTGTTGGTATTGGAAAATAC

[0146] One ng of mouse tissue cDNA was used as a template for multiplex qRT-PCR using QuantiFast Probe PCR Kit reagents. Commercially available TaqMan probes (Qiagen, Hilden, Germany) were used for mouse (MBNL1 and MBNL2; FAM-labeled probes) and reference (GAPDH; MAX-labeled probe) genes. Results were normalized to Gapdh endogenous gene expression. The primers used were as follows: SEQ ID NO: 40: Probe Mbnl1: / 56-FAM / TCGCAAATCAGCTGTGAGGAGATTCCCT / 3IAbRQSp / SEQ ID NO: 41: Mbnl1 F: TACCGATTGCACCACCAAAC SEQ ID NO: 42: Mbnl1 R:GCTGCTTTCAGCAAAGTTGTC SEQ ID NO: 43: Mbnl2 probe: / 56-FAM / CCCGGCAGACAGCACCATGATCGA / 3IAbRQSp / SEQ ID NO: 44: Mbnl2 F: GAGACAGACTGCCGCTTTG SEQ ID NO: 45: Mbnl2 R: GGTTACGGTGTTGTCGTTTGT SEQ ID NO: 46: Gapdh probe: / 5MAXN / -CGCCTGGTCACCAGGGCTGCT- / 3BHQ_1 / SEQ ID NO: 47: Gapdh_For: CAACGGATTTGGTCGTATTGG SEQ ID NO: 48: Gapdh_Rev:TGATGGCAACAATATCCACTTTACC

[0147] miRNA expression in muscle tissue was quantified using specific miRCURY™ locked nucleic acid microRNA PCR primers (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Relative gene expression was normalized to U1 (YP00203909) and U6 (YP00203907) snRNAs.

[0148] Expression levels were measured using a QuantStudio5 real-time PCR system (Applied Biosystems, Foster City, California). Expression relative to endogenous genes and controls was measured at 200 bp. -ΔΔCt The mean mean was calculated using the σ method. Pairs of samples were compared using a two-tailed t-test (α=0.05) with Welch's correction applied where appropriate. Statistical differences were estimated by Student's t-test (p<0.05) on normalized data.

[0149] Animal experiments and oligonucleotide administration Mouse handling and experimental procedures were in accordance with the European legislation on the care and experimentation of laboratory animals (2003 / 65 / CE) and were approved by the Conselleria de Agricultura, Generalitat Valenciana. Homozygous transgenic HSALR (line 20b) mice (Mankodi et al. 2000 Science:289(5485):1769-73. doi:10.1126 / science.289.5485.1769) were provided by Prof. C. Thornton (University of Rochester Medical Center, Rochester, NY, USA). Experimental groups included HSALR mice treated with all experimental oligonucleotides, as well as FVB as a normal control and HSALR treated with PBS as a negative control. Sample sizes were four mice per treatment group, 12 mice for PBS, and 18 mice for FVB. All groups were injected intravenously (tail vein) with 150 μl of 1x PBS (vehicle) or specific oligonucleotides (see Figures 2-5) at a single dose of 3 mg / kg. Four days after injection, mice were sacrificed and tissues of interest were frozen in liquid nitrogen for molecular assays.

[0150] Electromyography Electromyography was performed before treatment and at the time of sacrifice under general anesthesia, as previously described (Kanadia et al. 2006 Proc Natl Acad Sci US A. 2006 Aug 1;103(31):11748-53. doi:10.1073 / pnas.0604970103). The determinations were blinded to eliminate bias. Five needle insertions were performed in each quadriceps muscle of both hind limbs, and myotonic discharges were scored on a 5-point scale: 0, no myotonic discharge; 1, occasional myotonic discharges in 50% or less of the needle insertions; 2, myotonic discharges in >50% of the insertions; 3, myotonic discharges in almost all of the insertions; and 4, myotonic discharges in all insertions.

[0151] Forelimb grip strength test Forelimb grip strength was measured using a grip strength meter (BIO-GS3; Bioseb, Pinellas Park, Florida). The peak tensile force (measured in grams) when the mouse grasped the rod was recorded using a digital force transducer. The force transducer gauge was reset to 0 g after each measurement. The gauge recorded the tension when the mouse released its forepaws from the rod. We performed three consecutive measurements at 30-second intervals. Body weight measurements were performed in parallel. The final value was the average grip strength divided by the mouse's body weight. Body weight measurements were performed in parallel, and experiments were performed using animals identified by code to eliminate experimental bias.

[0152] Radar chart The values ​​obtained are expressed as recovery index (RI), which is the recovery index of the treated HSA. LR The RI measures how close the different parameter values ​​obtained in mice are to those of the FVB control. This RI is calculated by this formula: value %MT - X%MNT, divided by X%MH - X%MNT (where MT is the value for each mouse treated (PBS or oligonucleotide) and MNT is the value for HSA treated with PBS (PBS). LRThe values ​​obtained for different parameters (Mbnl1 protein, Mbnl1 / 2 expression level, splicing recovery rate, Mbnl1 ex5 inclusion recovery rate, and functional recovery rate) for each mouse after treatment with HSA (where MH is the value for healthy mice (FVB)) are in the range of 0 to 1, with 0 being the value for untreated mice (HSA). LR -PBS) and 1 is a healthy mouse (FVB).

[0153] Mbnl1 protein refers to the average of the values ​​obtained by quantitative dot blot of both muscles (quadriceps and gastrocnemius) of each treatment group.

[0154] Mbnl1 / 2 expression levels refer to the average of the mRNA values ​​of the genes Mbnl1 and Mbnl2 obtained by real-time PCR in both muscles (quadriceps and gastrocnemius) and in each treatment group to which the formula was applied.

[0155] Splicing recovery refers to the average percentage of inclusion for Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in both muscles of each treatment group.

[0156] Recovery of Mbnl1 exon 5 inclusions refers to the percentage of inclusions relative to Mbnl1 exon 5 in both muscles of each group of treatment.

[0157] Functional recovery refers to the average values ​​obtained by the force / weight of each mouse after treatment and the grade of myotonic discharge for each treatment group. Force was obtained using the forelimb grip test, and the grade of myotonic discharge was obtained using electromyography.

[0158] Example 1 We previously demonstrated that inhibiting miR-23b-3p or miR-218-5p could be therapeutic in myotonic dystrophy by using commercially available antagomiRs with antagomiR constructs directed against miR-23b-3p (AX-23b) or miR-218-5p (AX-218) (Cerro-Herreros et al. 2018 Nat. Commun. 26;9(1):2482. doi:10.1038 / s41467-018-04892-4.). Transfection of human DM1 cells with these antagomiRs and their injection into a mouse model of the disease resulted in downregulation of target miRNA expression and simultaneous upregulation of their direct target, MBNL1. The antagomiRs used were long (22 nt), contained nearly the entire complement of the miRNA, and were composed entirely of 2' OME nucleotides. They carried phosphorothioate bridges between the nucleotides at the 3' and 5' ends of the molecule to improve stability, and were conjugated to cholesterol at the 3' end as a carrier to enhance pharmacokinetic behavior and cellular internalization. To find the most effective and safe carrier, we combined the polynucleotide portion of Ax-23b (sequence name: unconjugated-23b in Table 1) with different lipid carriers at either the 3' or 5' end of the molecule, including the sterols cholesterol and tocopherol; and the fatty acids palmitoyl acid, stearic acid, elaidic acid, linoleic acid, and oleic acid (list of molecules in Table 1). We performed screening in human DM1 cells (Arandel L., et al. (2017). Dis Model Mech 10(4):487-497). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4):487-497. were transfected with these conjugated antagomiRs and their effects on toxicity (cell viability studies) and MBNL1 protein levels were examined.

[0159] Each of these molecules was transfected into DM1 human myotubes at a range of five different concentrations, and cell viability and MBNL1 protein levels were quantified. We ranked antimiRs according to their therapeutic index (TI), defined as follows: TI=(TC50 / EC50)*Emax where: TC50 is the concentration of compound that reduces cell viability to 50% of mock. EC50 is the concentration of compound that produces 50% of the Emax.

[0160] Emax is the maximum fold change in MBNL1 protein obtained after transfection with a particular antimiR compared to mock (vehicle transfected).

[0161] From these experiments, the inventors concluded the following: Conjugation with 5'-oleic acid (a cis-monounsaturated fatty acid with 18 carbon atoms) produced the highest Tindex (see Table 1). Toxicity and efficacy (MBNL1 protein levels) curves for molecules designated "unconjugated-23b" and "5'-23b-oleic acid" are shown in Figures 1C and 1B for direct comparison. Importantly, the low Tindex of the scrambled oligo conjugated to oleic acid ("Sc-oleic acid") indicates that oleic acid itself does not affect the Tindex. -linoleic acid (a cis-polyunsaturated fatty acid with 18 carbon atoms) was the second most effective carrier. Surprisingly, the Tindex results obtained with elaidic acid (the trans-isomer of oleic acid), palmitic acid (a saturated, non-esterified fatty acid with 16 carbon atoms), and stearic acid (a saturated fatty acid with a carbon chain of 18 carbon atoms) were significantly lower. Thus, our data indicate that cis-unsaturated fatty acids are better carriers of antimiR in our DM1 cells. -Cholesterol was the only carrier tested that was conjugated at two different positions, 3' and 5'. Based on our data, conjugation at 3' appeared to work more efficiently than 5'. The use of cholesterol derivatives such as tocopherol did not improve Tindex.

[0162] We performed the same experiment conjugating the nucleotide moiety of Ax-218 (sequence name: unconjugated-218 in Table 1) to different lipid carriers (Table 1). Oleic acid was identified as the best carrier among all the tested fatty acids, and cholesterol performed better at the 3' position than at the 5' position. However, it should be noted that cholesterol is associated with liver toxicity in mice, even though liver changes can be reversible after a recovery period (see Cholesterol Registration Dossier ECHA, April 4, 2017, available at https: / / echa.europa.eu / es / registration-dossier / - / registered-dossier / 11031 / 7 / 6 / 1#). However, because oligonucleotide therapeutics are intended for chronic treatment, cholesterol as a linker may increase the risk of liver toxicity. In contrast, oleic acid has a good safety profile and has been used as a food additive with beneficial effects in humans (see FDA Response Letter to the Health Claim Petition Concerning Oleic Acid, November 19, 2018, available at https: / / www.fda.gov / food / cfsan-constituent-updates / fda-completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease).

[0163] Once we found a suitable carrier, our next step was to optimize the sequence and chemical modifications included in the antimiR molecule conjugated to the carrier. Therefore, we also performed the same in vitro screen to find the most effective sequence and chemical modifications to improve the Tindex of unconjugated antimiR in DM1 cells. We generated a series of different single-stranded molecules (lengths ranging from 16 to 22 nucleotides) complementary to different portions of human miR-23b-3p or miR-218-5p. The molecules included in this screen had different chemical modifications, including LNA, 2'OME, and 2'MOE oligonucleotides, and all internucleotide linkages were phosphorothioate (PS) (Tables 2 and 3 list the molecules tested).

[0164] The molecule with a better Tindex score for miR-23b-3p was MD23b-2, and for antimiR molecules designed to inhibit miR-218-5p, the best-scoring molecule was 218-D / LNA2 (see Tables 2 and 3). Importantly, MD23b-2 showed significantly greater effects on MBNL1 levels (Emax) and Tindex than 218-D / LNA2. The toxicity and efficacy (MBNL1 protein levels) curves of these molecules are shown in Figures 1A and 1D.

[0165] Next, we tested the effect of oleic acid conjugation on the best-scoring antimiR sequence MD23b-2 (Table 4). Surprisingly, the conjugated molecule (O1-MD23b-2) showed a reduced Tindex compared to MD23b-2. On the other hand, we observed that oleic acid conjugation to oligonucleotides with a PS / PO mixture increased their Tindex (Table 4). This data confirms that the effect of oleic acid on the Tindex is surprisingly significant in mixed PS / PO oligonucleotides. [Table 1] NOTE: (Pro)(Chol) represents hydroxyprolinol C5-alkyl cholesterol. (Teg)(Chol) represents 15 atom triethylene glycol cholesterol depending on the spacer used. [Table 2] [Table 3] [Table 4]

[0166] Example 2 Next, we selected the oligos that performed best in vitro against miR-23b-3p (MD23b-2) and miR-218-5p (218-D / LNA2) and used them in a mouse model of DM1 (HSA LR To evaluate their in vivo therapeutic potential in rheumatoid arthritis, several modifications were applied to these molecules to improve their ADMET (absorption, distribution, metabolism, excretion and toxicity) properties. The rationale behind the modifications introduced was as follows: (1) Cytosine methylation is a well-known method for inhibiting immune system activation by in vivo treatment with antisense oligonucleotides (Joseph J. Senn, et al. Non-CpG-Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88. Journal of Pharmacology and Experimental Therapeutics September 1, 2005, 314(3)972-979; DOI: https: / / doi.org / 10.1124 / jpet.105.084004). (2) Chemically modified nucleotides such as LNA and 2'MOE modified nucleotides are known to be more stable than standard RNA, DNA, or 2'OME modified oligos (W. Brad Wan and Punit P. Seth. 2016. The Medicinal Chemistry of Therapeutic Oligonucleotides). (3) In all molecules tested in vitro, the internucleotide phosphodiester (PO) linkages have been replaced by phosphorothioate (PS) linkages to enhance their stability and efficacy. Fully modified PS oligos have been widely used in in vitro studies. However, some in vivo toxicity associated with excessive PS conjugation within a single molecule has been previously reported (e.g., Smith and Zain, 2019. Therapeutic oligonucleotides: State of the Art. Annual Review of Pharmacology and Toxicology, and Hu et al., 2020. Therapeutic siRNA: State of the Art. Signal transduction and targeted therapy), and mixed oligo-PS / PO has been proven to be more stable in vivo (Zhang, et al., In vivo stability, disposition, and metabolism of a 'hybrid' oligonucleotide phosphorothioate in rats. Biochemical Pharmacology. Volume 50, Issue 4, 1995, Pages 545-556, ISSN 0006-2952, https: / / doi.org / 10.1016 / 0006-2952(95)00159-W). Therefore, to design antisense oligos that could be tested in in vivo models, we decided to reduce the amount of PS binding in subsequent in vivo studies.

[0167] Taking these three criteria into consideration, we generated four antisense oligos. -MD23b-2PS / PO preserves the same chemical modifications found in MD23b-2, but with a lower PS content and all cytosines are methylated. -MD23b-2 V2 has the same sequence as MD23b-2, but some OME modifications in the 2' are replaced by MOE, the PS content is lower, and all cytosines are methylated. -218 MOE has the sequence of 218-D / LNA2, all natural DNA nucleotides substituted with 2'MOE, all cytosines methylated, and a lower PS content. -218 OME / MOE has the sequence of 218-D / LNA2, all natural DNA nucleotides substituted with 2'MOE or 2'MOE, all cytosines methylated, and a lower PS content.

[0168] HSA LRTo evaluate their therapeutic potential in mice, these molecules were used unconjugated (excluding the 218 OME / MOE) and conjugated with oleic acid (a model of DM1; see Mankodi, A., et al. (2000) "Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat." Science 289(5485):1769-1773). Specifically, to evaluate the effect of the conjugation site with oleic acid on therapeutic efficacy, MD23b-2PS / PO was used unconjugated, conjugated with 3' oleic acid (MD23b2PS / PO 3'01), and conjugated with 5' oleic acid (MD23b-2PS / PO 5'01). MD23b-2 V2 was used unconjugated, conjugated to oleic acid at the 3' (MD23b-2 V2 3'Ol), and conjugated to palmitic acid at the 3' (MD23b-2 V2 3'Palm) to determine whether conjugation to oleic acid similarly resulted in stronger antimiR effects than conjugation to palmitic acid in vivo. Two antimiRs against miR-218-5p were both conjugated to oleic acid at the 3'.

[0169] All of these molecules were detected in 3- to 5-month-old HSA LRAntimiRs were injected intravenously into the tail vein of mice at a concentration of 3 mg / kg. Strength and muscle tone of these mice were assessed immediately before injection and 5 days after the single injection, immediately before sacrifice. Figure 2 shows grip strength normalized to body weight (A) and muscle tone (B) levels measured immediately before sacrifice. Strength was improved in all mice treated with antimiRs compared to PBS-injected mice, but this difference was only statistically significant for some antimiRs. Similarly, muscle stiffness was reduced in antimiR-treated mice. The most significant reduction in muscle tone was achieved by the molecules MD23b-2 V2 3'Ol and 218 MOE oleic acid 3'. For both molecules, the oleic acid-conjugated molecules provided stronger relief than the unconjugated versions, with the 3'-conjugated molecules providing a stronger effect.

[0170] Example 3 At the time of sacrifice, we dissected the quadriceps and gastrocnemius muscles of the mouse hind limbs and processed them for protein and RNA extraction. qPCR analysis after reverse transcription of the extracted RNA using specific probes to detect the levels of miR-23b-3p (Figure 3A) or miR-218-5p (Figure 3B) demonstrated that all antimiRs efficiently reduced the levels of their corresponding miRNAs. Importantly, the unconjugated forms of antimiRs tended to be less effective than the conjugated forms. In the case of antimiRs against miR-218-5p, 218 MOE was the least effective.

[0171] Example 4 We used qRT-PCR to quantify the expression levels of Mbnl1 (Figure 4A) and Mbnl2 (Figure 4B) transcripts in quadriceps and gastrocnemius muscles, and total protein extracted from these muscles was processed for Mbnl1 protein detection by quantitative dot blot analysis (Figure 4C). Although small differences were detected between antimiR-23b-3p and antimiR-218-5p in terms of Mbnl1 transcript levels, the miR-23b-3b antimiR had a stronger effect on Mbnl protein. Importantly, we observed no difference between placing the oleic acid carrier at either the 3' or 5' end of the MD23b-2PS / PO molecule. In the case of MD23b-2V2, the unconjugated form was significantly less efficient than the forms conjugated with oleic acid or palmitoyl acid, with oleic acid having a stronger effect, particularly on Mbnl2 transcript and Mbnl1 protein levels.

[0172] Example 5 We also used total RNA to analyze the missplicing of transcripts regulated by Mbnl1 protein, such as Atp2a1 exon 22, Nexix exon 7, Mbnl1 exon 5, and chloride channel (Clcn1) exon 7a (Figures 5 and 6).

[0173] Nfix, Clcn1, Atp2a1, and Mbnl1 transcripts were expressed in HSA LR Mice showed abnormally increased inclusion of exons 7, 7a, 22, and 5, which was restored to between 30% and 50% of normal values ​​in muscle after treatment with MD23-b V2 3'Ol and other similar molecules at 3 mg / kg.

[0174] Example 6 To analyze all DM1-related functional and molecular phenotypes that we measured in our model mice, we used this formula:

number

[0175] These values ​​range from 0 to 1, with 0 being the value for untreated mice (HSA LR Mbnl1 protein refers to the average of the values ​​obtained by quantitative dot blot analysis of both muscles (quadriceps and gastrocnemius) in each treatment group. Mbnl1 / 2 expression levels refer to the average of the values ​​obtained by real-time PCR of both muscles (quadriceps and gastrocnemius) and genes (Mbnl1 and Mbnl2) in each treatment group, using the formula. Splicing recovery refers to the average percentage of inclusions in Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in both muscles in each treatment group. Mbnl1 exon 5 inclusion recovery refers to the percentage of inclusions in Mbnl1 exon 5 in both muscles in each treatment group. Functional recovery refers to the average of the values ​​obtained by force / body weight and myotonic discharge grade for each mouse after treatment.

[0176] The representation of these graphs in Figure 7 and Tables 5 and 6 shows that MD23b-2V 23'01 was the antimiR molecule that provided the strongest rescue of all phenotypes tested. Notably, the difference in efficacy when this same antimiR sequence was unconjugated or conjugated with palmitic acid confirms our surprising results in vitro and confirms the clearly more potent therapeutic effect of the molecule when conjugated with oleic acid. The second best-performing molecule was MD23b-2PS / PO 3'01, which performed slightly better than MD23b-2PS / PO 5'01. These data also support the results obtained in vitro using cholesterol conjugation, confirming that 3'-position carrier conjugation is beneficial. As observed in vitro, antimiRs against miR-218-5p provided less phenotypic rescue. The data support the stronger therapeutic effect of miR-23b-3p inhibition (Figure 7B and Table 5) compared with miR-218-5p inhibition (Figure 7B and Table 6). In the case of molecule 218 MOE (Figure 7B), conjugation with oleic acid also improves its activity in vivo. This confirms that the effect of oleic acid conjugation on in vivo therapeutic efficacy is not limited to specific nitrogenous base sequences but applies more generally. [Table 5] [Table 6]

[0177] Example 7 In all tested antimiRs, we always conjugated oleic acid at either the 3' or 5' end, using an amino group-containing spacer to form an amide bond between the oleic acid and the oligonucleotide. The first spacer was a 6-aminohexyl group (NHC6 spacer) introduced at both the 3' and 5' ends. Next, we tested whether adding other types of spacers (NHC6, NHC3, or threoninol) and spacers of different sizes (either 3 or 6 carbon atoms) between the oligonucleotide sequence MD23b-2 V2 and oleic acid (Figure 8) could improve the effect of the resulting conjugated molecule on MBNL1 protein levels. We observed that all generated antimiRs (a total of 4 in Tables 7, 8, and 9) were able to upregulate MBNL1 protein. Notably, the molecule conjugated with threoninol was the most active, reaching EC50 at the lowest concentration, while the molecule with a six-carbon spacer (NHC6) was the molecule that produced the most robust maximal upregulation of protein. This data demonstrates that modifications in the spacer can further modulate the efficacy and pharmacodynamics of the oleic acid-conjugated antimiRs of the invention. [Table 7] [Table 8]

[0178] Example 8 Although methods for synthesizing oligonucleotides are widely known in the art, we provide an example of the synthesis of MD23b-2 V2 3'Ol herein. MD23b-2 V2 3'Ol is a 16-nt-long oligonucleotide consisting exclusively of LNA, 2'-O-MOE, and 2'-O-Me modified components linked by phosphodiester or phosphorothioate linkages. Its 3'-end is modified with an oleic acid moiety (Figure 10). This oleic acid is introduced by coupling an activated carboxylic acid to a hexylamino spacer at the 3'-end of the precursor oligonucleotide. The synthesis of MD23b-2 V2 3'Ol is based on solid-phase synthesis using the building block and spacer -GPG. This process consists of only two major steps.

[0179] First, an unconjugated oligonucleotide (precursor) is synthesized with the sequence AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NH2C6). The first phosphoramidite, which will be the building block of the chain, is attached to the solid surface via a catalytic condensation reaction. This process is repeated as many times as the nucleotide length of the final sequence—in this case, 16 times. Once solid-phase synthesis is complete, production involves the following steps: cleavage and deprotection, purification, and desalting.

[0180] Second, oleic acid is conjugated. Once the desalted, unconjugated oligonucleotide from the last step is conjugated with oleic acid, it is purified, desalted, and lyophilized.

[0181] Example 9 1.1 Quantification of MD23b-2 V2 3'OL by ELISA MD23b-2 V2 and MD23b-2 V2 3'01 were used. The compound was administered at a dose of 12 mg / kg to HSA LRMice were administered intravenously. After 14 days, all mice were euthanized, and the brain, kidney, liver, gastrocnemius, and quadriceps muscles were removed, weighed, and frozen for further processing. The experiment was conducted in a blinded manner by an investigator unaware of group assignment. Samples from brain, muscle (quadriceps and gastrocnemius), kidney, and liver were collected during necropsy procedures from all experimental groups. Samples were weighed to three decimal places in grams at the time of collection. Each piece was placed in an RNase-free tube and flash-frozen (e.g., 2 ml Eppendorf tubes, RNase-free).

[0182] 1.1.1 Sample preparation 1) Remove the tissue and wash it with phosphate buffered saline. 2) Dry the tissue with absorbent paper and weigh (20 mg per tissue; for the brain, obtain 30 mg per tissue). 3) Add 100 μL of RIPA buffer supplemented with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet of each per 10 mL of RIPA buffer) for every 10 mg of tissue. 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue dissolver for 20 seconds at 5000 RPM four times until the tissue is completely homogenized. 5) Incubate the homogenate at 55°C overnight. 6) The homogenate is centrifuged at 15000 rpm for 15 minutes and the supernatant is aliquoted and stored at -20°C ready for analysis.

[0183] For muscle lysates, 1 / 10 of the actual homogenate in oligonucleotide dilution buffer was used. If the sample was above the limit of quantitation, a 1:40 dilution was applied.

[0184] A 1 / 5 dilution was used for the brain and a 1:400 dilution for the liver and kidney.

[0185] 1.1.2 Preparation of stock for the standard curve For the preparation of the standard curve stock, a 20 μM stock of MD23b-2 V2 3'Ol was first prepared. A 1 μM concentration was used for the standard curve preparation. Therefore, the 20 μM stock was diluted with water to a final volume of 1 μM and stored in different aliquots. A fresh standard curve was prepared for each experiment; for this, the 1 μM stock needed to be heated at 65°C for 15 minutes each time. Meanwhile, after preparing the tissue homogenate, 55 μL of the homogenate was added to 5445 μL of compound dilution buffer to prepare the control tissue homogenate.

[0186] 1.1.3 Creating a calibration curve To do this, a control tissue homogenate is required to prepare standard dilutions. Next, to prepare serial dilutions, 1 μM of the desired compound was denatured at 65°C for 15 minutes and vortexed for at least 30 seconds. 32 μL of this denatured compound was then diluted into 968 μL of control homogenate. This is the first point of the standard curve (32000 pM). For the next point, 500 μL of 32000 pM was then diluted with 500 μL of compound dilution buffer (16000 pM). Using this same method, 8000 pM, 4000 pM, 2000 pM, and 1000 pM were prepared. Table 9: ELISA design [Table 9]

[0187] 1.1.4 QC Three QC levels (L, M, H) in triplicate for each run Pass / fail criteria: · ≥ 67% of QC should be ± 30% of the nominal (theoretical) value.

[0188] 1.1.5 ELISA Protocol - Probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (stock is 100 μM in water, prepare 1 uM for this stock in water) needs to be heated at 65 °C for 15 min and vortexed for 30 s. - Prepare sample homogenates and oligonucleotide serial dilutions before starting the experiment. - The probe (1 μM) is diluted in hybridization buffer at a concentration of 0.5 nM. - 70 μL of each dilution of the desired compound is added in triplicate, and in the case of sample homogenates, in duplicate. Then 70 μL of probe is added at a concentration of 0.5 nM. - Seal the plate with PCR film and incubate at 37°C for 30 minutes (a crucial step for hybridization of the probes with the compounds!) - Up to this step, you can use a regular clear 96-well plate. - 100 μL of the hybridized solution is then immediately transferred to a black neutravidin coated plate. -The plate is then resealed with PCR film and incubated at 37°C for 30 minutes (critical step for binding of biotin to the avidin coated plate). During the incubation step, prepare the micrococcal nuclease in micrococcal nuclease dilution buffer (1.6 μL nuclease + 16 ml buffer). This calculation is done for the entire plate. First, remove the liquid and wash the plate 6 times with 100 μL of washing buffer, then, leaving the plate upside down, dry the plate using absorbent paper and add 150 μL of micrococcal nuclease per well (final amount 30 U / well). After adding micrococcal nuclease, seal the plate with PCR film and incubate the plate at 37° C. for 1 hour (this step is sufficient to cleave at least 99% of the single-stranded probe). Prepare TBS buffer containing 0.25% Tween 20 and antibody (anti-digoxigenin antibody, Roche #11093274910), vortex thoroughly, and leave at RT. Any remaining amount not needed can be aliquoted and stored in the freezer. First, remove the liquid, then wash the plate 6 times with 100 μL of washing buffer, dry the plate and add 150 μL of anti-digoxigenin antibody (conjugated with alkaline phosphatase) at a 1 / 5,000 dilution in TBS buffer (containing 0.25% v / v Tween 20). - Seal the plate with PCR film and incubate at 37°C for 30 minutes. - To prepare Attophos substrate, dilute 36 mg of powder (from the bottle) by adding 60 ml of Attophos buffer and store in the refrigerator protected from light (preferably wrapped in aluminum foil). - Remove the liquid and wash the plate 6 times with 100 μL of washing buffer, dry the plate and add 150 μL of Attophos substrate (diluted in a 1:1 ratio with Attophos buffer). The plate is sealed with PCR film, then wrapped in aluminum foil and incubated at room temperature (RT) for 40 minutes. A Synergy H1 (Biotek) is then used to determine the fluorescence intensity. An excitation of 444 nm and an emission of 555 nm are used. Sequential readings are taken at 60, 70, 80, and 90 minutes with a 1 second delay per well. Table 10: Mean values ​​(ng / g) of MD23b-2 V2 3'01 and MD23b-2 V2 in brain, gastrocnemius, quadriceps, kidney and liver. [Table 10] [Table 11] *Fold change was calculated relative to the amount of compound MD23b-2 V2.

[0189] Results and Figure 11 We observed the presence of both compounds in muscle (gastrocnemius and quadriceps), liver, and kidney 14 days after administration. In all tissues, the control group was below the limit of quantification. Meanwhile, compound MD23b-2 V2 3'Ol was the only compound capable of reaching the brain. In terms of tissue delivery, the MD23b-2 V2 3'Ol compound is superior to MD23b-2 V2 because it can more efficiently reach all tissues, including gastrocnemius, quadriceps, liver, kidney, and brain. We detected higher amounts of MD23b-2 V2 3'Ol in all tissues, but its delivery to gastrocnemius and quadriceps was 9.5- and 8.8-fold higher, respectively, than MD23b-2 V2. In contrast, delivery to kidney and liver was only 4- and 4.5-fold, respectively, indicating enhanced delivery to muscle compared to less disease-relevant tissues. MD23b-2 V2 3'Ol reaches the brain, but MD23b-2 V2 does not, indicating that conjugation with oleic acid favors delivery to this tissue. From this, we conclude that oleic acid improves delivery of our compounds, particularly to tissues involved in pathology, such as muscle and brain.

[0190] Example 10: Determination of MD23b-2 V2 3'Ol and MBNL1 protein levels in non-human primary brain The objective of this study was to determine brain exposure in animals treated with MD23b-2 V2 3'Ol using an enzyme-linked immunosorbent assay (ELISA). Furthermore, target engagement in the brains of treated animals was measured by quantifying Muscleblind-like type 1 (MBNL1) protein levels from non-human primate brains.

[0191] 1. Experimental Design 1.1 Experimental groups and medication For these purposes, a total of eight cynomolgus monkeys (four males and four females), aged approximately 24 to 50 months, were distributed into three experimental groups and further assigned to Phase 1 (maximum tolerated dose (MTD) group assignment) and Phase 2 (fixed dose (FD) group assignment). During Phase 1 (maximum tolerated dose [MTD] phase), one male and one female cynomolgus monkey of Asian origin were assigned to Group 1 and administered a single dose of MD23b-2 V2 3'Ol intravenously (slow bolus [10 min]) under non-fasting conditions at 5, 10, 15, and 20 mg / kg on days 1, 15, 29, and 43 of the MTD phase in a dose volume of 5 mL / kg in an escalating dose design.

[0192] After the completion of the MTD phase, three male and three female cynomolgus monkeys of Asian origin were assigned to groups 2 and 3 of phase 2 (fixed-dose phase) and were administered vehicle (phosphate buffer [PBS, pH: 7.4]) or 20 mg / kg MD23b-2 V2 3'Ol intravenously (slow bolus [10 min]) at a dose volume of 5 mL / kg under non-fasting conditions on days 1 and 22 of phase 2.

[0193] On the day of sacrifice, samples were taken from the brain during the necropsy procedure.

[0194] Group assignment and dose level Table 12: Phase 1: Maximum Tolerated Dose (MTD) Group Assignment [Table 12] [Table 13]

[0195] 2. Experimental Data 2.1 Experimental procedure 2.1.1 Sampling Brains from all animals in groups 1-3 were collected for ELISA quantification, MBNL1 investigation, and potential off-target determination, two weeks after the animals' last dose from Phase 1 and three weeks after the end of the treatment period from Phase 2. Each piece was placed in a separate RNase-free Eppendorf tube, frozen in liquid nitrogen, and stored at -80 ± 10°C. A total of eight brain samples were generated.

[0196] 2.1.2 ELISA quantification 2.1.2.1 Sample preparation 1) Remove the tissue and wash it with phosphate buffered saline. 2) Dry the tissues with absorbent paper and weigh them (20 mg per tissue). 3) Add 100 μL of RIPA buffer supplemented with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet of each per 10 mL of RIPA buffer) for every 10 mg of tissue. 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue dissolver for 20 seconds at 5000 RPM four times until the tissue is completely homogenized. 5) Incubate the homogenate at 55°C overnight. 6) The homogenate is centrifuged at 15000 rpm for 15 minutes and the supernatant is aliquoted and stored at -20°C ready for analysis.

[0197] For brain lysates, a 1 / 5 dilution of the actual homogenate (80 μL + 320 μL of oligonucleotide dilution buffer) was used.

[0198] 2.1.2.2 Preparation of standard curve stock To prepare the stock for the standard curve, first make a 20 μM stock of MD23b-2 V2 3'OL. This can be stored at -20°C for a longer period. From this 20 μM stock, several dilutions can be made as needed. For the preparation of the standard curve, 1 μM is required. Therefore, the 20 μM stock was diluted with water to a final volume of 1 μM and stored in different aliquots. The standard curve must be prepared fresh for each experiment; to do this, the 1 μM stock must be heated at 65°C for 15 minutes each time. After preparing the tissue homogenate, add 55 μL to the 5445 Compound Dilution Buffer to obtain the control tissue homogenate.

[0199] 2.1.2.3 Preparation of the calibration curve To do this, a control tissue homogenate is required to prepare standard dilutions. Then, to prepare serial dilutions, first take 1 μM of the desired compound, denature it at 65°C for 15 minutes, and vortex for at least 30 seconds. Then, take 16 μL of this denature compound and dilute it into 984 μL of control homogenate. This is the first point of the standard curve (16000 pM). Then, for the next point, take 500 μL of 16000 pM and dilute it with 500 μL of PMO dilution buffer (8000 pM). In this same manner, 4000 pM, 2000 pM, 1000 pM, and 500 pM are created. [Table 14]

[0200] 2.1.2.4 QC Three QC levels (L, M, H) in triplicate for each run. Acceptance criteria: · ≥ 67% of the QCs should be ± 20% of the nominal (theoretical) value, and ≥ 50% of the QCs per level should be ± 20% of their nominal concentration.

[0201] 2.1.2.5 ELISA Protocol - Probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (stock is 100 μM in water, prepare 1 uM for this stock in water) needs to be heated at 65 °C for 15 min and vortexed for 30 s. - Prepare sample homogenates and oligonucleotide serial dilutions before starting the experiment -Dilute the probe (1 uM) in hybridization buffer to a concentration of 0.5 nM - 70 μL of each dilution of the desired compound is added in triplicate, and in the case of sample homogenates, in duplicate. Then 70 μL of probe is added at a concentration of 0.5 nM. Seal the plate with PCR film and incubate at 37°C for 30 minutes (this is an important step for hybridization of the probe and compound!) - this step can be done in a regular clear 96-well plate. -100 μL of the hybridized solution is then immediately transferred to a black neutravidin-coated plate -The plate is then resealed with PCR film and incubated at 37°C for 30 minutes (critical step for the biotin to bind to the avidin-coated plate!) During the incubation step, prepare the micrococcal nuclease in micrococcal nuclease dilution buffer (1.6 μL nuclease + 16 ml buffer). This calculation is done for the entire plate. First, remove the liquid and wash the plate 6 times with 100 μL of washing buffer, then turn the plate upside down and dry it using absorbent paper, then add 150 μL of micrococcal nuclease per well (final amount 30 U / well) After adding micrococcal nuclease, seal the plate with PCR film and incubate the plate at 37°C for 1 hour (this step is sufficient to cleave at least 99% of the single-stranded probe). Prepare TBS buffer containing 0.25% Tween 20 and antibody, vortex them thoroughly and leave them at RT. For the remaining amount that is not needed, they can be stored in aliquots in the freezer. First, remove the liquid, then wash the plate 6 times with 100 μL of washing buffer, dry the plate and add 150 μL of anti-digoxigenin antibody (conjugated with alkaline phosphatase) at a 1 / 5,000 dilution in TBS buffer (containing 0.25% v / v Tween 20). - Seal the plate with PCR film and incubate at 37°C for 30 minutes. - To prepare the Attophos substrate, dilute 36 mg of powder (as it came in the bottle) by adding 60 ml of Attophos buffer and store them in the refrigerator protected from light (preferably wrapped in aluminum foil). - Remove the liquid and wash the plate 6 times with 100 μL of washing buffer, dry the plate and add 150 ul of Attophos substrate (diluted in a 1:1 ratio with Attophos buffer). The plate is sealed with PCR film, then wrapped in aluminum foil and incubated at room temperature (RT) for 40 minutes. A Synergy H1 (Biotek) is then used to determine the fluorescence intensity. An excitation of 444 nm and an emission of 555 nm are used. Successive readings are taken at 40, 50, 60, 70, 80, and 90 minutes with a 1 second delay per well.

[0202] 2.1.2.6 Acceptance Criteria for ELISA Assays The precision of an analytical method represents the closeness of the average test result obtained by the method to the analytical true value (concentration). Precision is estimated by the relative error of measurement (RE%). The true values ​​of the reference controls for both ELISA assays did not correspond to the theoretical concentrations based on calculation alone. Therefore, the nominal concentration of the control is calculated as the average of the pool of all references at each concentration level from all analytical batches.

number

[0203] The precision of an analytical method describes the closeness of individual measurements of an analyte when the procedure is applied repeatedly to multiple aliquots of a single uniform volume of biological matrix. Precision is estimated by the coefficient of variation (CV%).

number

[0204] 2.1.3 MBNL's Decision 2.1.3.1 Protein extraction NHP brain samples were mechanically disaggregated using a TissueLyser II (QIAGEN) and homogenized in RIPA buffer (Thermo Scientific, Catalog No. 89900) supplemented with protease and phosphatase inhibitors (Roche, Catalog Nos. 11873580001 and 4906845001). Total protein was quantified using the Pierce™ BCA Protein Assay Kit (Cat. No. 23225) using bovine serum albumin as the standard.

[0205] 2.1.3.2 Western Blot: For immunodetection of MBNL1 and GAPDH (internal control for normalization) proteins, 15 μg of total protein for each animal sample was denatured by heat treatment at 100°C for 5 min, separated by electrophoresis on a 12% SDS-PAGE gel, and subsequently transferred to a 0.45 μm nitrocellulose membrane (GE Healthcare).

[0206] The membrane was blocked for 1 hour using 5% skim milk in PBS-T (8 mM NaHPO, 150 mM NaCl, 2 mM KHPO, 3 mM KCl, 1% Tween 20, pH 7.4). After blocking, the membrane was incubated overnight at 4°C with primary anti-MBNL1 mouse antibody (1:200, MB1a (4A8) (DSHB, Iowa City, Iowa)). Following incubation with the primary antibody, incubation with a horseradish peroxidase-conjugated anti-mouse secondary antibody (1:3500, (HRP)-conjugated anti-mouse IgG secondary antibody, Sigma-Aldrich, Saint Louis, Missouri) was performed at room temperature for 1 hour. Finally, visualization was performed using enhanced chemiluminescence substrate (ECL, Pierce), and images were acquired using an ImageQuant 800 Amersham instrument (GE Healthcare).

[0207] After detecting the immunoreactive band corresponding to MBNL1, the membrane was stripped to remove the previously used antibodies, and a band corresponding to GAPDH protein, used as a normalizer, was detected. This detection was performed using an anti-GAPDH antibody conjugated with HRP (1:3500, clone G-9, Santa Cruz) after blocking (as described above). For the HRP-conjugated anti-GAPDH antibody, the incubation time lasted 1 hour and was performed at room temperature. Analysis was performed in duplicate.

[0208] 2.1.3.3 Quantification: All images were quantified using the analysis software ImageJ. Results for MBNL1 protein amount were first normalized to GAPDH for all samples, and this ratio was normalized to the average ratio (relative protein level) of untreated animals.

[0209] 3.Results 3.1 Determination of MD23b-2 V2 3′OL from NHP brain. Table 16: Concentrations of MD23b-2 V2 3'OL (nM, ng / mg, ng / g) in the brain of cynomolgus monkeys 14 days (group 1) and 21 days (groups 2 and 3) after the last treatment [Table 16]

[0210] For determination of MD23b-2 V2 3'OL by ELISA, eight samples from eight animals were analyzed on one plate in one analytical run. All samples were measured in triplicate. The analytical run met the acceptance criteria.

[0211] All treated animals from Phase I and II showed some levels of the test item during analysis. Control animals did not have quantifiable levels of MD23b-2 V2 3'Ol in the brain.

[0212] All animals treated with 20 mg / kg during the fixed dose showed levels of the test item in all brains examined. For animals from the MTD, a male (P0001) showed levels above the limit of quantitation.

[0213] 3.2 MBNL1 relative levels Table 17: MBNL1 relative levels. Mean values ​​Phase I and II. [Table 17]

[0214] MBNL1 protein levels from Group 1 were quantified in samples collected two weeks after the last dose. Results showed higher MBNL1 protein levels in the tested brains compared to samples from untreated animals (Table 18, Figure 12). Protein levels in the brain were two-fold higher than in the control group. The test article produced a pharmacological effect in the brain that resulted in an increase in MBNL protein when compared to untreated animals, and the increase was still present two and three weeks after dosing. Results were similar in males and females.

[0215] 4. Discussion and Conclusion ELISA quantification results showed that the treatment groups (Groups 1 and 3) had quantifiable levels of MD23b-2 V2 3'Ol in the brain 2 and 3 weeks after the last intravenous administration of MD23b-2 V2 3'Ol. Furthermore, treated animals had higher MBNL1 protein levels in the brain compared to untreated animals 2 and 3 weeks after the last administration. These results demonstrated evidence of the presence and activity of the test item in the brains of animals treated with MD23b-2 V2 3'Ol.

Claims

1. An oligonucleotide molecule consisting solely of SEQ ID NO: 22 (MD23b-2 V2 3'Ol), 23 (MD23b-2-PS / PO 3'Ol) or 25 (218 MOE Oleic Acid 3'), wherein the 3' end of SEQ ID NO: 22, 23 or 25 is conjugated to a spacer molecule, respectively, which is conjugated to oleic acid, and which spacer molecule is selected from the group consisting of NHC3, NHC5, NHC6 and threoninol.

2. The oligonucleotide molecule according to claim 1, which consists solely of SEQ ID NO: 3 (MD23b-2 V2 3'Ol).

3. The oligonucleotide molecule according to claim 1, which consists solely of SEQ ID NO: 4 (MD23b-2-PS / PO 3'Ol).

4. 2. The oligonucleotide molecule of claim 1, which consists solely of SEQ ID NO: 7 (218 MOE oleic acid 3').

5. 13. A pharmaceutical composition comprising one or more oligonucleotide molecules as defined in claim 1 and a pharma- ceutically acceptable carrier or excipient, or a combination thereof.

6. The pharmaceutical composition described in claim 5, comprising an oligonucleotide molecule consisting only of sequence number 3.

7. The pharmaceutical composition described in claim 5, comprising an oligonucleotide molecule consisting only of sequence number 4.

8. The pharmaceutical composition described in claim 5, comprising an oligonucleotide molecule consisting only of sequence number 7.

9. The pharmaceutical composition described in claim 5, which is a therapeutic agent for type 1 myotonic dystrophy.

10. The pharmaceutical composition described in claim 9, comprising an oligonucleotide molecule consisting only of sequence number 3.

11. The pharmaceutical composition described in claim 9, comprising an oligonucleotide molecule consisting only of sequence number 4.

12. The pharmaceutical composition described in claim 9, comprising an oligonucleotide molecule consisting only of sequence number 7.

13. The oligonucleotide molecule described in claim 1, wherein the oligonucleotide molecule is an antimiR.

14. The pharmaceutical composition of claim 5, used for delivery to muscle and / or the CNS.

15. The pharmaceutical composition described in claim 14, comprising an oligonucleotide molecule consisting only of sequence number 3.

16. The pharmaceutical composition described in claim 14, comprising an oligonucleotide molecule consisting only of sequence number 4.

17. The pharmaceutical composition described in claim 14, comprising an oligonucleotide molecule consisting only of sequence number 7.

Images