Trinucleotide Cap Analogs, Their Preparation, and Uses

Abstract

This specification relates generally to trinucleotide RNA cap analogs, methods for their use, and kits containing them. In particular, the trinucleotide cap analogs provided herein enable rapid detection and / or isolation of capped RNA transcripts in vitro and translation of capped mRNAs in vivo.

Description

[Technical Field]

[0001] This specification generally relates to trinucleotide RNA capping analogs, methods of using them, and kits containing them. In particular, the trinucleotide capping analogs provided herein enable rapid in vitro detection and / or isolation of capped RNA transcripts, as well as in vivo translation of capped mRNA.

[0002] Sequence List This application includes an electronically submitted sequence listing in ASCII format, which is incorporated herein by reference in its entirety. A copy of the ASCII file, created on June 24, 2021, is named LT01530PCT_SL.txt and is 195,611 bytes in size. [Background technology]

[0003] Eukaryotic mRNA has a "cap" structure at its 5' end, which is well known to play an important role in translation. The naturally occurring cap structure is ligated to the 5' end of the first transcribed nucleotide via a triphosphate crosslink, m 7 It consists of 7-methylguanosine, resulting in G(5')ppp(5')N (where N is any nucleotide). The mRNA cap plays a crucial role in gene expression. It protects mRNA from degradation by exonucleases, enables RNA transport from the nucleus to the cytoplasm, and is involved in the construction of the translation initiation complex. 7Dinucleotides in the form G(5')ppp(5')G(mCAP) have been used as primers in in vitro T7 or SP6 RNA polymerase transcription to obtain RNA with a cap structure at the 5' end. In vivo, the cap is added enzymatically. However, over the past 20 years or so, numerous studies have required the synthesis of proteins in in vitro translation extracts supplemented with in vitro synthesized mRNA. A common method for in vitro synthesis of capped mRNA is to use mCAP as a transcription initiator. The disadvantage of using mCAP, a pseudosymmetric dinucleotide, is always G or m 7 G(m 7 The 3'-OH group of any of the Guo) moieties tends to act as a nucleophile for transcription elongation initiation, resulting in only about 50% of capped RNA being translateable. This drawback is that the capped RNA m 7 This was addressed by providing a modified cap analog (e.g., ARCA) that blocks the 3'-OH group at the G portion, preventing transfer from that position.

[0004] Caps can be attached to RNA molecules by the intracellular enzyme guanylyltransferase, but caps are first attached to RNA during in vitro transcription, where the cap is used as a primer for RNA polymerase. The 5' terminal nucleoside is usually guanine and is oriented in the opposite direction to all other nucleotides, i.e., 5'Gppp5'GpNpNp..., and in most cases the cap contains two nucleotides connected by a 5'-5' triphosphate bond.

[0005] RNA transcription typically begins with a nucleoside triphosphate (usually purine, A or G). When transcription occurs in vitro, it typically involves a DNA template containing phage RNA polymerases such as T7, T3, and SP6, a phage polymerase promoter, nucleotides (ATP, GTP, CTP, and UTP), and a buffer containing magnesium salts. The 5' cap structure enhances mRNA translation by assisting binding to eukaryotic ribosomes and ensuring recognition of the appropriate AUG start codon. This function can vary depending on the translation system and the specific mRNA being synthesized.

[0006] During translation, the cap is bound by the translation initiation factor eIF4E, and the cap-binding complex (CBC) recruits additional initiation factors. Cap removal is catalyzed by the proteins dcp1 and dcp2, which compete with eIF4E for cap binding. Translation, which is encoded by mRNA and results in amino acids that bind together to form a peptide, occurs as three processes: initiation, elongation, and termination. Initiation in eukaryotes involves the addition of ribosomes scanning the mRNA for the first methionine codon. Elongation proceeds through the sequential addition of amino acids until the termination codon is reached, ending translation.

[0007] Capped RNA encoding a specific gene can be transfected into eukaryotic cells or microinjected into cells or embryos to study the effects of the translation product in those cells or embryos. When uncapped RNA is used, it degrades rapidly in these experiments, resulting in a significantly reduced yield of translated proteins.

[0008] Capped RNA can also be used to treat diseases. Dendritic cells isolated from patients can be transfected with capped RNA encoding an immunogen. The dendritic cells translate the capped RNA into a protein that induces an immune response to this protein. In small human studies, immunotherapy with dendritic cells filled with CEA-capped RNA has been shown to be safe and viable for pancreatic patients (Morse et al., Int. Cancer, 32, 1-6, (2002)). It has also been noted that introducing a single capped RNA species into immature dendritic cells induces a specific T cell response (Heiser et al., J. Clin. Invest., 109, 409-417 (2002)).

[0009] However, capped RNAs known in this art still have limitations in terms of intracellular stability and the efficiency of in vitro transcription using substrates such as T7-RNA polymerase. Therefore, mRNA capping analogs, such as cross-linked capped RNAs, that can provide high levels of capping efficiency, improved translation efficiency, and improved intracellular molecular stability of 5'-capped mRNA are still needed. [Overview of the Initiative]

[0010] This disclosure relates to novel modified trinucleotide cap analogs of formula (I) as defined herein. [ka]

[0011] The trinucleotide capping analogs disclosed herein may result in high levels of capping efficiency and improved translation efficiency. In at least one embodiment, the trinucleotide capping analogs disclosed herein are improved substrates for T7-RNA polymerase, resulting in better transcription yield.

[0012] The trinucleotide cap analogs disclosed herein can result in improved intracellular molecular stability of 5'-capped mRNA. In at least one aspect, the trinucleotide cap analogs disclosed herein increase the intracellular stability of mRNA in vaccines.

[0013] In at least one aspect, the trinucleotide cap analogs disclosed herein can also function as a reporter moiety. In at least one aspect, the trinucleotide cap analogs disclosed herein improve transfection into a particular cell line.

[0014] The present disclosure also relates to compositions containing cap analogs, compositions containing RNA to which the cap analogs described herein are covalently bound, methods for using mRNA species containing such analogs, and kits containing novel cap analogs.

[0015] In a first aspect, the present disclosure is directed to a trinucleotide cap analog of formula (I),

Chemical formula

[0016] In a second aspect, the disclosure relates to compositions comprising a trinucleotide cap analog of formula (I) or any of the embodiments thereof described herein.

[0017] In a third aspect, the disclosure relates to compositions comprising RNA having a trinucleotide cap analog of formula (I) or any of the embodiments thereof described herein.

[0018] In a fourth aspect, the disclosure relates to a kit comprising a trinucleotide cap analog of formula (I) or any of the embodiments thereof described herein, a nucleotide triphosphate molecule, and an RNA polymerase.

[0019] In a fifth aspect, the disclosure relates to a method for producing trinucleotide-capped RNA, comprising contacting a nucleic acid substrate with an RNA polymerase and a trinucleotide cap analog of formula (I) or any of its embodiments described herein, in the presence of nucleotide triphosphates, under conditions and for a period of time sufficient to produce trinucleotide-capped RNA.

[0020] In a sixth aspect, the disclosure relates to a method comprising contacting a cell with a trinucleotide cap analog of formula (I) or any of the embodiments thereof described herein.

[0021] In a seventh aspect, the disclosure relates to a method for increasing the intracellular stability of RNA, which involves incorporating a trinucleotide cap analogue of formula (I) or any of the embodiments thereof described herein into RNA.

[0022] In the eighth aspect, the Disclosure relates to a method for introducing RNA into cells, comprising contacting the cells with a composition of the Disclosure comprising a trinucleotide cap analogue according to formula (I) or any of the embodiments thereof described herein. In some examples, the cells are dendritic cells, tumor cells, stem cells (iPSCs, HSCs, adult stem cells), etc.

[0023] In a ninth aspect, the Disclosure relates to a method for inhibiting RNA translation in cells, comprising contacting cells with a composition of the Disclosure comprising a trinucleotide cap analog of formula (I) or any of the embodiments thereof described herein.

[0024] Furthermore, this specification also provides transcription initiation complexes comprising (a) a nucleic acid molecule comprising a promoter region, wherein the promoter region comprises a transcription initiation site, and the transcription initiation site comprises a template strand, and (b) a capped primer comprising two or more bases (e.g., about 2 to about 12, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 6, about 3 to about 8, etc.) hybridized to a transcription initiation site comprising the template strand at least at positions -1 and +1, +1 and +2, or +2 and +3. In some cases, at least one nucleotide (e.g., one, two, three, four, etc.) located at adjacent positions (5' and / or 3') on one or both of the non-template strands of the initiation site is a transcription initiation blocking nucleotide. In some cases, one or more transcription initiation blocking nucleotides are selected from the group consisting of (A) thymidine, (B) cytosine, (C) adenosine, and (D) chemically modified nucleotides. Furthermore, the initiation complex may include a template chain that hybridizes (e.g., partially hybridizes) to a complementary non-template chain. Additionally, the template and / or non-template chains may include nucleotides chemically modified at position -1 and / or +1 (e.g., deoxythymidine residues, 2'-deoxycytidine, etc.).

[0025] The non-template chain positions -1, +1, and +2 of the promoter and transcription initiation complex described herein may contain nucleotide sequences selected from the group consisting of AGT, AAT, AGC, AAC, AGA, AAA, GAT, GAC, GAA, GGT, GGC, GGA, ATT, ATC, and ATA.

[0026] Furthermore, this specification also provides a transcription initiation complex comprising (a) a nucleic acid molecule having a promoter region, wherein the promoter region includes a transcription initiation site, and the transcription initiation site includes a template strand, and (b) a capped primer that does not exist in nature and contains three or more bases hybridized to a DNA template at at least nucleotide positions -1 and +1, +1 and +2, or +2 and +3. Moreover, the initiation complex described herein may include a capped primer that does not exist in nature and is the capped primer described herein.

[0027] Furthermore, this specification provides nucleic acid molecules comprising a promoter, the promoter comprising the following non-template strand nucleotide sequence:TATY1Y2Z, where Y1 is at position -1, Y2 is at position +1, Z is at position +2, and Z is a transcription initiation blocking nucleotide. Furthermore, Z may be adenosine, cytosine, thymidine, or a chemically modified nucleotide. Such nucleic acid molecules may comprise nucleic acid sequences selected from the group consisting of (a) 5'-TATAGT-3', (b) 5'-TATAGC-3', and (c) 5'-TATAAC-3'.

[0028] Furthermore, this specification provides a method for producing mRNA molecules. Such a method may involve contacting a DNA template with a capped primer and an RNA polymerase under conditions that allow for the production of mRNA molecules by a transcription reaction, the DNA template comprising (a) a nucleic acid molecule comprising a promoter region, wherein the promoter region comprises a transcription start site, and the transcription start site comprises a template strand, and (b) a capped primer comprising two or more bases hybridized to a transcription start site comprising the template strand at at least positions -1 and +1, +1 and +2, or +2 and +3, wherein at least a nucleotide adjacent to the 5' position of the template strand at the start site is a transcription start blocking nucleotide. Furthermore, RNA polymerases used in such a method include bacteriophage, bacterial, and eukaryotic (e.g., mammalian) RNA polymerases. In some cases, bacteriophage RNA polymerases or variants thereof, such as T7 bacteriophage, T3 bacteriophage, SP6 bacteriophage, or K11 bacteriophage RNA polymerase, may be used in the methods described herein.

[0029] Furthermore, mRNA molecules produced by the methods described herein may contain nucleotide sequences encoding one or more proteins. Also, mRNA molecules produced by the methods described herein may be produced by in vitro or in vivo transcription reactions. Furthermore, mRNA molecules produced by the methods described herein can be translated, for example, by a coupled transcription / translation system to produce proteins.

[0030] In some cases, at least 70% of the mRNA molecules produced by the method described herein (e.g., about 70% to 100%, about 75% to 100%, about 80% to 100%, about 85% to 100%, about 90% to 100%, about 70% to 98%, about 80% to 98%, etc.) are capped.

[0031] In many cases, the yield of mRNA molecules (e.g., capped mRNA molecules) produced by the method described herein exceeds 3 mg / ml of reaction mixture.

[0032] Those skilled in the art will understand that the drawings described below are for illustrative purposes only. The drawings are not intended in any way to limit the scope of this instruction. [Brief explanation of the drawing]

[0033] [Figure 1] An exemplary synthetic scheme for the trinucleotide cap analog described herein is illustrated. In this figure, the synthetic scheme combines the imidazolide salt of 7-methyl(LNA)guanosine 5'-diphosphate (Imm7(LNA)GDP) (A) with (B) to form the exemplary trinucleotide analog (C) of the present disclosure. [Figure 2] Figure 1 shows an exemplary synthesis scheme for producing the imidazolide salt of 7-methyl(LNA)guanosine 5'-diphosphate (Imm7(LNA)GDP), which is part (A) of Figure 1. [Figure 3] Figure 1 shows an exemplary synthesis scheme for producing dinucleotides such as pApG and 5'-phosphate dinucleotides (part B). [Figure 4] An exemplary synthetic scheme for the 3'-O-propargyl-containing trinucleotide cap analog described herein is illustrated. B1 = G, A, U, or C; B2 = G, A, U, or C [Figure 5] Figure 4 illustrates an exemplary synthetic scheme for the imidazolide salt of 7-methyl3'-O-propargylguanosine 5'-bisphosphate (Imm7,3'-O-propargylGDP) used in the synthetic scheme of the 3'-O-propargyl-containing trinucleotide cap analogue. [Figure 6] Figure 4 illustrates an exemplary synthetic scheme for producing dinucleotides used in the synthesis of trinucleotide caps, including a trinucleotide cap analog containing 3'-O-propargyl. B1=G, A, U, or C; B2=G, A, U, or C [Figure 7] An exemplary synthetic scheme for producing trinucleotide cap analogs containing the dyes described herein is illustrated. B1 = G, A, U, or C; B2 = G, A, U, or C [Figures 8A-8B] Figure 7 illustrates an exemplary synthesis scheme for producing the Imm7GDP-containing dye used in the synthesis scheme of the trinucleotide cap analog containing the dye. [Figure 9] An exemplary synthetic scheme for producing the isopropylidene moiety-containing trinucleotide cap analogs described herein is illustrated. B1 = G, A, U, or C; B2 = G, A, U, or C [Figure 10] Exemplary chemical structures of trinucleotide cap analogs containing linker-bound cell-permeable peptides disclosed herein are illustrated. [Figure 11] This is a bar graph showing the mRNA yield of IVT reactions performed in the presence of different mRNA CAP analogues, as shown and described in Example 3. [Figure 12] This bar graph shows the mRNA capping efficiency of mRNA capped with ARCA, GAG caps, or LNA-modified GAG caps. [Figure 13] This bar graph shows the percentage of GFP-positive cells when transfected with crude or HPLC-purified mRNA having no cap, ARCA, GAG cap, or LNA-modified GAG cap, as described in Example 4. [Figure 14] This bar graph shows the median fluorescence intensity (MFI) of cells transfected with "crude" or "HPLC-purified" mRNA preparations capped with uncapped, ARCA cap analogues, GAG cap analogues, or LNA-modified GAG cap analogues, as described in Example 4. [Figure 15]The general structure of exemplary 7-methylguanosine trinucleotide cap structures, including cap 0 (R1=H) and cap 1 (R1=CH3) types, is shown. B1 and B2 are bases that may be the same or different. R2 represents one or more additional nucleosides linked by intercalating phosphate. [Figure 16] These are schematic diagrams of the non-template strands of four exemplary wild-type bacteriophage promoters. Each of these promoters is 23 base pairs long. Furthermore, each promoter contains an AT-rich region, a polymerase-specificity loop region, a rewind region (positions -4 to -1), and an initiation region (positions +1 to +6). The "N" at position +5 of the SP6 promoter can be any nucleotide, but is often G or A. From top to bottom are SEQ ID NOs: 591, 592, 593, and 594. "UTR" refers to the DNA that forms the untranslated region of the transcription mRNA molecule. [Figure 17] This is a schematic diagram of three different mRNA caps that bind to the transcription start site. CAP1 is a dinucleotide cap where both bases are guanine. CAP2 is a trinucleotide cap where two bases are guanine with an intervening adenine base. CAP3 is a trinucleotide cap where all three bases are guanine. In all three cases, the first base (guanine) is shown above another base because this first base does not directly interact with the promoter. The lower part of this diagram shows the non-template (5' to 3') and template strand (3' to 5') which are part of the promoter where the four bases (underlined) of the unwind region meet the transcription start site. CAP1, CAP2, and CAP3 are positioned in the diagram to be complementary to the template strand of the start region (+1, -1 to +1, and +1 to +2, respectively, for each cap). Figure 17 discloses Sequence ID No. 595. [Figure 18]Figure 18 is a schematic diagram similar to Figure 17, but differs in the following ways: CAP4 is a dinucleotide cap with the first base being guanine and the second base being adenine. CAP5 is a trinucleotide cap with the first base being guanine and the next two bases being adenine. CAP2 is the same as that shown in Figure 17. Furthermore, the base at position +1 of the non-template chain is adenine, not guanine. Figure 18 discloses Sequence ID No. 596. [Figure 19] This is a schematic diagram similar to Figure 17. This diagram shows CAP2 associated with positions -1 to +1 in the start region (see dashed box). Furthermore, the base pair at position +2 on the non-template strand is thymine (see downward arrow), and adenine is present on the template strand (not shown). Figure 19 discloses sequence number 597. [Figure 20] This figure shows the RNA yields produced with different promoter sequences and position-1 starts for HB-WT, HB-MOD2, HB-MOD4, and HB-MOD29. AGG caps and +1 start sites were used for WT-MOD. The HB-WT template was designed for +1 starts, but the reaction mixture did not contain caps. The data used to create this figure is listed in Table 5. HB-GFP refers to a template consisting of the 5' and 3' untranslated regions (UTRs) of human betaglobin.

[0034] Array description Table 1 provides a list of sequences used in this specification. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16] [Table 1-17] [Modes for carrying out the invention]

[0035] This disclosure relates in part to trinucleotide cap analogs, compositions comprising trinucleotide cap analogs, and methods of using them, for example, for use in transcription, for use in intracellular stability, for use in detection and isolation of capped RNA, and for use of isolated RNA obtained by both in vitro and in vivo translation. The trinucleotide cap analogs disclosed herein may have the advantage of being improved substrates for T7-RNA or other RNA polymerases, which may result in better in vitro transcription yield, improved intracellular molecular stability of 5'-capped mRNA, improved translation efficiency compared to other anti-reverse cap analog (ARCA) substrates, and improved transfection into specific cell lines.

[0036] In addition to the caps themselves, this disclosure relates to compositions and methods for producing capped mRNA molecules. Such compositions and methods include those in which the cap is designed to match the nucleotide sequence of the start site, and the formulation (e.g., an in vitro transcription formulation) is designed to facilitate efficient mRNA (e.g., capped mRNA) production. Such efficient mRNA production includes compositions and methods for producing mRNA molecules in which a high percentage of mRNA molecules are capped mRNA (e.g., the total number of mRNA molecules produced is about 75% to about 99%, about 80% to about 99%, about 85% to about 99%, about 90% to about 99%, about 95% to about 99%, about 80% to about 96%, about 85% to about 96%, about 90% to about 96%), and mRNA is produced in high yield (i.e., 3 milligrams of RNA per milliliter of reaction mixture).

[0037] RNA yield (e.g., mRNA yield) can be determined by comparing the amount of RNA produced with the amount of one or more components of the reaction mixture used to produce the RNA. One possible formula is the amount of RNA produced per a given volume of the reaction mixture relative to a given amount of a single reaction mixture component. For example, using 20 μl of reaction mixture with a 7.5 mM CTP concentration for in vitro transcription yields over 80 μg of RNA. In a second example, using 20 μl of reaction mixture with a 10 mM CTP concentration yields 120 μg of RNA.

[0038] The compositions and methods described herein enable the production of RNA in amounts greater than 40 μg / 20 μl (for example, about 40 μg to about 200 μg, about 40 μg to about 160 μg, about 40 μg to about 120 μg, about 80 μg to about 200 μg, about 80 μg to about 200 μg, about 80 μg to about 180 μg, about 80 μg to about 160 μg, about 80 μg to about 120 μg, about 100 μg to about 150 μg, etc.).

[0039] RNA yield is expressed as the amount of RNA produced as a function of the volume of the reaction mixture. For example, 100 μg of RNA produced in 20 μl is equivalent to 5 mg of RNA produced in 1 milliliter of the reaction mixture. After correcting for volume, the compositions and methods described herein enable the production of RNA in amounts of 2 mg / ml or more (for example, about 2 mg / ml to about 20 mg / ml, about 2 mg / ml to about 16 mg / ml, about 2 mg / ml to about 10 mg / ml, about 2 mg / ml to about 7 mg / ml, about 4 mg / ml to about 20 mg / ml, about 4 mg / ml to about 20 mg / ml, about 5 mg / ml to about 20 mg / ml, about 6 mg / ml to about 20 mg / ml, about 4 mg / ml to about 20 mg / ml, about 7 mg / ml to about 20 mg / ml, about 4 mg / ml to about 16 mg / ml, about 4 mg / ml to about 18 mg / ml, about 4 mg / ml to about 14 mg / ml, about 6 mg / ml to about 16 mg / ml, about 7 mg / ml to about 19 mg / ml, etc.).

[0040] In one embodiment, it is a trinucleotide cap analog of the following formula (I), [ka] During the ceremony, B3 consists of -OH, halogen, dye, and -OR. 1 Selected from, R 1 These are selected from propargyl, tert-butyldimethylsilyl, and methylene crosslinking with 4'C. B4 consists of -OH, dyes, and -OR 2 Selected from, R 2 This is selected from propargyl and tert-butyldimethylsilyl, or R 1 R 2 It binds with B3 and B4, and as a result B3 and B4 form -2',3'-O-isopropylidine, Under the condition that both B3 and B4 cannot be -OH, X is selected from -H and -CH3. B1 and B2 were independently selected from adenine, guanine, cytosine, and uracil, respectively. R is selected from H, a linker-bound cell-permeable peptide, a linker-bound cell-permeable peptide covalently bound to a dye, and a linker-bound dye. In some embodiments, R is selected from a linker-bound cell-permeable peptide selected from any of SEQ ID NOs: 1 to 583, and the linker bound to the cell-permeable peptide is biotin, 3′ maleimidebenzoic acid N-hydroxysuccinimide, or [ka] It can be selected from commercially available products such as the following. In some embodiments, R is [ka] In some embodiments, R is selected from a linker-bound cell-permeable peptide covalently bonded to the dye, and the cell-permeable peptide is selected from any of SEQ ID NOs: 1 to 583. In some embodiments, R is a linker-bound dye.

[0041] In some embodiments, each dye is independently selected from azobenzene dyes, naphthalene-containing dyes, cyanine dyes, rhodamine dyes, coumarin, and pyrene dyes. In some embodiments, each dye is [ka] It is selected independently of others.

[0042] In some embodiments, B3 is -OR 1 And B4 is -OR 2 And R 1 R 2 It combines with, and as a result B3 and B4 form -2',3'-O-isopropylidene, where X is -CH3 and R is H. In some embodiments, B3 is -OR 1 And B4 is -OR 2 And R 1 R 2 It binds to B3 and B4, and as a result, B3 and B4 form -2',3'-O-isopropylidene, and R is covalently bonded to the dye. [ka] Selected from. In some embodiments, B3 is -OR 1 Selected from, R 1 B4 is selected from propargyl and tert-butyldimethylsilyl, B4 is -OH, and R is H. In some embodiments, B3 is -OR 1 Selected from, R 1 B4 is selected from propargyl and tert-butyldimethylsilyl, B4 is -OH, and R is covalently bonded to the dye. [ka] Selected from. In some embodiments, each dye is independently selected from azobenzene dyes, naphthalene-containing dyes, cyanine dyes, rhodamine dyes, coumarin, and pyrene dyes. In some embodiments, each dye is, [ka] It is selected independently of others.

[0043] In some embodiments, B3 is a dye, B4 is -OH, and R is H. In some embodiments, B3 is a dye, B4 is -OH, and R is covalently bonded to the dye. [ka] Selected from. In some embodiments, each dye is independently selected from azobenzene dyes, naphthalene-containing dyes, cyanine dyes, rhodamine dyes, coumarin, and pyrene dyes. In some embodiments, each dye is, [ka] It is selected independently of others.

[0044] In some embodiments, B3 is -OH and B4 is -OR 2 Selected from, R 2 B is selected from propargyl and tert-butyldimethylsilyl, and R is H. In some embodiments, B3 is -OH and B4 is -OR 2 Selected from, R 2 R is selected from propargyl and tert-butyldimethylsilyl, and R is covalently bonded to the dye. [ka] Selected from. In some embodiments, B3 is -OH, B4 is a dye, R is H, and X = -CH3. In some embodiments, B3 is -OH, B4 is a dye, and R is covalently bonded to the dye. [ka] Selected from. In some embodiments, each dye is independently selected from azobenzene dyes, naphthalene-containing dyes, cyanine dyes, rhodamine dyes, coumarin, and pyrene dyes. In some embodiments, each dye is, [ka] It is selected independently of others.

[0045] In some embodiments of the trinucleotide cap analog of formula (I), B3 is -OR 1 And R 1 It forms a methylene bridge with 4'C, and as a result, the trinucleotide cap analog of formula (I) is a cross-linked trinucleotide cap analog of formula (II) below. [ka] In some embodiments, R is selected from linker-bound cell-permeable peptides, and the cell-permeable peptide is selected from any of SEQ ID NOs: 1 to 583. In some embodiments, R is selected from linker-bound cell-permeable peptides covalently bound to the dye, and the cell-permeable peptide is selected from any of SEQ ID NOs: 1 to 583. In some embodiments, B4 is -OH and R is H. In some embodiments, B4 is -OH and R is covalently bound to the dye [ka] Selected from. In some embodiments, B4 is a dye and R is H. In some embodiments, each dye is independently selected from azobenzene dyes, naphthalene-containing dyes, cyanine dyes, rhodamine dyes, coumarin, and pyrene dyes. In some embodiments, each dye is, [ka] It is selected independently of others.

[0046] Another aspect of this disclosure is a composition comprising a trinucleotide cap analog of formula (I) or any of the embodiments thereof disclosed herein.

[0047] Another aspect of the present disclosure is a method for producing lipid nanoparticles, comprising combining a composition comprising a trinucleotide cap analog of formula (I) or any embodiment thereof disclosed herein with at least one cationic lipid, optionally one or more neutral lipids, optionally one or more conjugated lipids that prevent aggregation (e.g., PEG lipids and / or polyglycol lipids), and optionally one or more cell-permeable peptides, or any combination thereof.

[0048] Another aspect of the present disclosure is a composition comprising RNA, wherein RNA has a trinucleotide cap analog of formula (I) or any of the embodiments disclosed herein covalently bound thereto. In some embodiments, the composition further comprises at least one RNA delivery agent. In some embodiments, the at least one RNA delivery agent comprises at least one cationic lipid. In some embodiments, the at least one RNA delivery agent further comprises at least one neutral lipid. In some embodiments, the at least one RNA delivery agent is selected from cell-permeable peptides.

[0049] In some embodiments, at least one cationic lipid is 2,3-Dioleyloxy-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propaneaminium trifluoroacetate (DOSPA), 1,3-Dioleyloxy-2-(6-carboxy-spermyl)propylamide (DOSPER), Dioctadecylamide-Glycylpermine (DOGS), Tetramethyltetrapalmitylspermine (TMTPS), Tetramethyltetrapalmitoylspermine (TMTOS), Tetramethyltetralaurylspermine (TMTLS), Tetramethyltetramyristylspermine (TMTMS), Tetramethyldioleylspermine (TMDOS), N-1-dimethyl-N-1-(2,3-diaoleoyloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diamyristyloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl-N -1-(2,3-diapalmityloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diaoleoyloxypropyl))-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diamyristyloxypropyl)-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, N-1-dimethyl- N-1-(2,3-diapalmityloxypropyl)-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, L-spermine-5-carboxyl-3-(DL-1,2-dipalmitoyl-dimethylaminopropyl-β-hydroxyethylamine, 3,5-(N,N-dilysyl)-diaminobenzoyl-glycyl-3-(DL-1,2-dipalmitoyl-dimethylaminopropyl-β-hydroxyethylamine), L-lysine-bis(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, L-lysine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-alkylamino)-2-hydroxypropyl)piperazine, L-lysine-bis-(O,O'-myristoyl-β-hydroxyethyl)amide dihydrochloride, L-ornithine-bis-(O,O'-myristoyl-β-hydroxyethyl)amide dihydrochloride, L-ornithine-bis-(O,O'- '-Oleoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-oleylamino)-2-hydroxypropyl]piperazine, L-ornithine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-amino-2-hydroxypropyl)-oleylamino]-butane-2,3-diol, 1,4-bis[(3-amino-2-hydroxypropyl)-palmitylamino]-butane-2,3-diol, 1,4-bis[(3 [-amino-2-hydroxypropyl)-myristylamino]-butane-2,3-diol, 1,4-bis[(3-oleylamino)propyl]piperazine, L-arginine-bis-(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, bis[(3-(3-aminopropyl))-myristylamino)2-hydroxypropyl]piperazine, L-arginine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, L-serine-bis-(O,O'-oleoyl-β-hydroxyethyl) 1,4-Ciethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-palmitylamino)-2-hydroxypropyl]piperazine, glycine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, sarcosine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, L-histidine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, cholesteryl-3β-carboxyl-amide ethylenetrimethylammonium iodide, 1,4-Bis[(3-Myristylamino)propyl]piperazine, 1-Dimethylamino-3-trimethylammonio-DL-2-propyl-cholesterylcarboxylate iodide, Cholesteryl-3β-carboxyamide ethyleneamine, Cholesteryl-3β-oxysuccinaamide ethylenetrimethylammonium iodide, 1-Dimethylamino-3-trimethylammonio-DL-2-propyl-cholesteryl-3β-oxysuccinatoio Compounds, 2-[(2-trimethylammonio)-ethylmethylamino]ethyl-cholesteryl-3β-oxysuccinate iodide, 3β[N-(N′,N′-dimethylaminoethane)carbamoyl]cholesterol, and 3β[N-(polyethyleneimine)-carbamoyl]cholesterol, 1,4-bis[(3-palmitylamino)propyl]piperazine, L-ornitylglycyl-N-(1-heptadecyloctadecyl)glycinamide, N, 2 ,N 5 -Bis(3-aminopropyl)-L-ornitylglycyl-N-(1-heptadecyloctadecyl)glycinamide, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-alkylamino)-2-hydroxypropyl]piperazine N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-dioctadecyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioctadecyl-L-α-glutamine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-oleylamino)2-hydroxypropyl]piperazine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioctadecyl-L-α-asparagine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5-Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dioctadecyl-L-glutaminyl]-L-glutamic acid, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-diolyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioleyl-L-α-glutamine, 4-bis[(3-(3-amino-2-hydroxypropyl)-myristylamino)-2-hydroxypropyl]piperazine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioleyl-L-α-asparagine,N-[N 2 -N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dioleyl-L-glutaminyl]-L-glutamic acid, 1,4-bis[(3-(3-aminopropyl)-oleylamino)propyl]piperazine, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-dipalmytil-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-N--dipalmytil-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dipalmytil-L-α-asparagine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5-Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornithyl-N-N-dipalmitoyl-L-glutaminyl]-L-glutamic acid, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornithyl]-N,N-dimyristyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornithyl]-N-N-dimyristyl-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornithyl]-N-N-dimyristyl-L-α-asparagine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-palmitoylamino)-2-hydroxypropyl]piperazine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornithyl-N-N-dimyristyl-L-glutaminyl]-L-glutamic acid, 1,4-bis[(3-(3-aminopropyl)-myristylamino)propyl]piperazine, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornithyl]-N,N-dilauroyl-L-glutamine, N 2 -8N 2 ,N 5 -Bis(aminopropyl)-L-ornithyl]-N-N-dilauroyl-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornithyl]-N-N-dilauroyl-L-α-asparagine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy])carbonyl]-N 2 ,N 5-Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-N--dilaureyl-L-glutaminyl]-L-glutamic acid, 3-[N',N''-bis(2-tertbutyloxycarbonylaminoethyl)guanidino]-N,N-dioctadeca-9-enylpropionamide, 3-[N',N''-bis(2-tertbutyloxycarbonylaminoethyl)guanidino]-N,N-dipalmytilpropionamide, 3-[N',N''-bis(2-t [ert butyloxycarbonylaminoethyl)guanidino]-N,N-dimyristylpropionamide, 1,4-bis[(3-(3-aminopropyl)-palmitylamino)propyl]piperazine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-oleylamino)propyl]piperazine, N,N-(2-hydroxy-3-aminopropyl)-N-2-hydroxypropyl-3-N,N-diolylaminopropane, N,N-(2-hydroxy-3-aminopropyl)-N-2- Hydroxypropyl-3-N,N-dipalmitylaminopropane, N,N-(2-hydroxy-3-aminopropyl)-N-2-hydroxypropyl-3-N,N-dimyristylaminopropane, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-myristylamino)propyl]piperazine, [(3-aminopropyl)-bis-(2-tetradecyloxyethyl)]methylammonium bromide, [(3-aminopropyl)-bis-(2-oleyloxyethyl)]methylammonium Ammonium bromide, [(3-aminopropyl)-bis-(2-palmityloxyethyl)]methylammonium bromide, oleoyl-2-hydroxy-3-N,N-dimethylaminopropane, 2-didecanoyl-1-N,N-dimethylaminopropane, palmitoyl-2-hydroxy-3-N,N-dimethylaminopropane, 1,2-dipalmitoyl-1-N,N-dimethylaminopropane, myristoyl-2-hydroxy-3-N,N-dimethylaminopropane, 1,2-dimyristoyl-1-N,N-dimethylaminopropane, (3-aminopropyl)->4-(3-amino-propylamino)-4-tetradecylcarbamoyl-butylcarbamate cholesteryl ester, (3-amino-propyl)->4-(3-amino-propylamino-4-carbamoyl-butylcarbamate cholesteryl ester, (3-amino-propyl)->4-(3-amino-propylamino)-4-(2-dimethylamino-ethylcarbamoyl)-butylcarbamate cholesteryl ester, spermine-5-carboxyglycine(N'-stearyl- N'-Oleyl)amide tetratrifluoroacetate, spermine-5-carboxyglycine (N'-stearyl-N'-elaidyl)amide tetratrifluoroacetate, agmatinyl carboxycholesterol acetate, spermine-5-carboxy-β-alanine cholesteryl ester tetratrifluoroacetate, 2,6-diaminohexanoyl β-alanine cholesteryl ester bistrifluoroacetate, 2,4-diaminobutyroyl β-alanine cholesteryl ester bistrifluoroacetate, N,N-bis(3-aminopropyl) -3-aminopropionyl β-alanine cholesteryl ester tristrifluoroacetate, [N,N-bis(2-hydroxyethyl)-2-aminoethyl]aminocarboxycholesteryl ester, stearyl carnitine ester, palmityl carnitine ester, myristyl carnitine ester, stearyl stearoyl carnitine ester chloride, L-stearyl stearoyl carnitine ester, stearyl oleoyl carnitine ester chloride, palmityl palmitoyl carnitine ester chloride, myristyl myristoyl carnitine Nitine ester chloride, L-myristylmyristoylcarnitine ester chloride, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-palmitylamino)propyl]piperazine, N-(3-aminopropyl)-N,N'-bis-(dodecyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N,N'-bis-(oleyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N,N'-bis-(palmityloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N,N'-bis-(myristyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-dodecyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-oleyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-palmityloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-myristyloxyethyl)-piperazinium bromide are selected, and useful phospholipids in the composition and method are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine ( DOPE), 1,2-Dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Diundecanoyl-sn-glycero-phosphocholine (DUP C), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-Didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-Dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), Dipalmitoylphosphatidylglycerol (DPPG), Palmitoyloleoylphosphatidylethanolamine (POPE), Distearoylphosphatidylethanolamine (DSPE), Dipalmitoylphosphatidylethanolamine (DPPE), Dimyristoylphos Phosphatidylethanolamine (DMPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), 1-stearoyl-2-oleoylphosphatidinecholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), compound 1 [ka] , compound 2 [ka] , compound 3 [ka] , compound 4 [ka] , compound 5 [ka] , compound 6 [ka] compound 7 [ka] , compound 8 [ka] , compound 9 [ka] , compound 10 [ka] , compound 11 [ka] , compound 12 [ka] , compound 13 [ka] , compound 14 [ka] , compound 15 [ka] , and compound 16 [ka] Selected from.

[0050] In some embodiments, at least one neutral lipid is selected from cholesterol, dioleoylphosphatidylethanolamine (DOPE), dioleoylphosphatidylcholine (DOPC), and diphytanoylphosphatidylethanolamine (DDhPE).

[0051] In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable carrier.

[0052] Another aspect of the present disclosure is a kit comprising a trinucleotide cap analog of formula (I), any component of the compositions described herein (e.g., one or more RNAse inhibitors), a nucleotide triphosphate molecule, and an RNA polymerase.

[0053] Another aspect of the present disclosure is a method for producing trinucleotide-capped RNA, comprising contacting a nucleic acid substrate with RNA polymerase and a trinucleotide cap analog of formula (I) or any embodiment thereof disclosed herein, in the presence of nucleotide triphosphates, under conditions and for a period of time sufficient to produce trinucleotide-capped RNA.

[0054] Further embodiments of the present disclosure include methods comprising contacting cells with a trinucleotide cap analog, including a trinucleotide cap analog of formula (I), or any embodiment thereof disclosed herein. In some embodiments, the method is for increasing the intracellular stability of RNA, comprising incorporating a trinucleotide cap analog of formula (I), or any embodiment thereof disclosed herein, into RNA. In some embodiments, the method is for introducing RNA into cells, comprising contacting cells. In some embodiments, the method is for inhibiting RNA translation in cells.

[0055] For the purpose of interpreting this specification, the following definitions apply, and where appropriate, a term used in the singular also includes the plural, and vice versa. If any definition set forth below conflicts with the use of that term in other documents, the definition set forth below shall always prevail for the purpose of interpreting this specification, unless the opposite meaning is explicitly intended (for example, when interpreting the document in which the term first appears). In this specification, "or" means "and / or" unless otherwise stated, or unless the use of "and / or" is clearly inappropriate. In this specification, "a" means "one or more" unless otherwise stated, or unless the use of "one or more" is clearly inappropriate. The uses of "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and not intended to be limiting.

[0056] As used herein, the terms “part” and “group” are typically used interchangeably to refer to a part of a molecule having a particular functional or structural feature, such as a linking group (a part of a molecule that connects two other parts of a molecule) or an ethyl moiety (a part of a molecule having a structure closely related to ethane).

[0057] As used herein, "Me" is equivalent to "CH3", "OCH3" or "OMe" represents an oxygen atom bonded to a methyl group, "CHO" represents a carbon atom C(O=CH-) bonded to a hydrogen atom H and double-bonded to an oxygen atom O, and "Et" represents "C2H5".

[0058] As used herein, the names of the bases adenine, guanine, cytosine, and uracil are interchangeable with their respective uppercase initials "A", "G", "C", and "U".

[0059] As used herein, the term “cap” refers to a non-elongating dinucleotide (also referred to herein as a “dimer”) that facilitates translation or localization and / or, when incorporated at the 5' of an RNA transcript typically having an m7GpppG or m7GpppA structure, prevents the degradation of the RNA transcript. The cap generally refers to a modified base 7-methylguanosine, i.e., PI-guanosine-5'-yl P3-7-methylguanosine-5'-yl triphosphate (m 7 It consists of G5'ppp5'G).

[0060] As used herein, the term “cap analog” refers to a structural derivative of an RNA cap that may differ by only one element. Cap analogs may be trinucleotides (also referred herein as “trimers”), as well as pentamers and longer polymers (e.g., nucleic acid polymers having a length of 5, 6, 7, 8, or 9 nucleotides).

[0061] As used herein, the terms “capped oligonucleotide” or “capped primer” refer to transcription initiation primers containing a cap 0, cap 1, cap 2, or 2,2,7-trimethylguanosine (TMG)-cap structure at the 5' end of the primer. Capped primers generally have an unmodified or open 3'-OH group and can be extended by RNA polymerase by incorporating an NTP at the 3' end of the primer. Such oligonucleotides can generally initiate in vitro transcription under the control of a promoter in a transcription system. The terms “capped oligonucleotide” or “capped primer” include caps, such as those described herein, that can be used to generate capped RNA molecules by transcription (see, for example, the cap analogues produced in the workflow described in Figure 9). Also as used herein, “initiation primer” or “initiation oligonucleotide primer” refer to oligonucleotides having a terminal 3'-OH group that can function as a substrate for RNA polymerase in initiating RNA synthesis (e.g., template-directed RNA synthesis). As an example, naturally occurring caps that can be added to RNA molecules by transcription are capped primers. Therefore, the cap primer may include naturally occurring caps or cap analogues, such as the caps or cap analogues described herein.

[0062] As used herein, the term “nucleotide” includes naturally occurring nucleotides, synthetic nucleotides, and modified nucleotides, unless otherwise indicated.

[0063] The term “trinucleotide cap analog” refers to a cap or cap analog containing three nucleotides. For example, the cap analog produced in the workflow shown in Figure 9 is a trinucleotide cap analog in which the first nucleotide (left) is separated from the other two nucleotides (right) by three phosphate groups. At least one of the two nucleotides on the right is generally designed to hybridize to an initiation site and act on RNA polymerase-driven primer transcription. The caps and cap analogs described and used herein may be longer than three nucleotides. For example, there may be three or more nucleotides similar to the one on the right in Figure 9. In particular, the caps and cap analogs may contain a range of 4 to 20 nucleotides, of which 3 to 19 (e.g., about 3 to about 16, about 3 to about 12, about 4 to about 16, about 4 to about 10, about 5 to about 10, etc.) may be capable of hybridizing to an initiation site and acting on RNA polymerase-driven primer transcription.

[0064] As used herein, the term “promoter” refers to a nucleic acid region that is recognized by RNA polymerase, functions as an initiation template for an operablely linked nucleic acid region, and can result in the transcription of a portion of the entire operablely linked nucleic acid region. Promoters may be of eukaryotic, prokaryotic, viral, or organelle origin. Furthermore, promoters may be naturally occurring, modified naturally occurring, or synthetic (e.g., a fusion of two naturally occurring promoters, or a promoter designed from the consensus sequences of naturally occurring promoters). One category of promoters is the “T7-like” promoter, such as the one shown in Figure 16.

[0065] In most cases, promoters are double-stranded nucleic acids consisting of a template strand and a non-template strand. Figure 16 shows the non-template strands of four different promoters, and Figure 17 shows both the template and non-template strands of some bacteriophage promoters.

[0066] In some cases, a promoter is a single-stranded nucleic acid consisting of a template strand or a non-template strand. Examples of such promoters are those of RNA and DNA single-stranded viruses (e.g., alphaviruses, hantaviruses, and flaviviruses).

[0067] The promoter is typically located immediately adjacent to (or partially overlapping with) the nucleic acid being transcribed. The nucleotide position in the promoter is generally specified relative to the transcription start site and is usually referred to as position +1 (see Figure 16) in the wild-type system. At least one base of the initiation oligonucleotide primer (e.g., mRNA cap or cap analogue) is complementary to the template strand of the start site of the promoter sequence used to initiate transcription (e.g., positions +1, -1, and +1, or +1 and +2, as shown in Figure 16).

[0068] In this specification, the term “initiation complex” refers to the association of a primer with a nucleic acid template strand under conditions that enable the initiation of RNA molecule transcription by RNA polymerase. Often, the primer is a cap analog (e.g., the mRNA cap analogs provided herein). An exemplary cap analog RNA initiation complex structure is schematically shown in Figure 17.

[0069] In this specification, the term “start site” refers to the base(s) on the promoter template strand to which a capped primer binds for the initiation of RNA transcription. Often, the start site is identified by the nucleotide sequence of the non-template strand (see, e.g., Figure 16). The numerical values ​​in this specification for both the start site and the surrounding nucleic acid refer to the native start site (see, e.g., Figure 16). Thus, using Figure 17 for reference, the native transcription initiation based on the T7 promoter with a GG-capped primer (CAP3) is considered to typically begin at position +1. Therefore, the hybridization of an AG-capped primer (CAP2) at positions -1 and +1 in Figure 17 means that the capped primer hybridizes to one base of the “TATA box” and the native start site at position +1. In such a case, transcription initiation begins at position -1. Furthermore, if the capped primer hybridizes to positions -1 and +1, the start site is located at positions -1 and +1.

[0070] As used herein, the term “in vitro transcription and translation (IVTT)” refers to the generation of messenger RNA (mRNA) molecules and the production of proteins from these mRNA molecules. Typically, IVTT uses a cell extract containing the “machine” of transcription and translation (e.g., ribosomes, tRNA synthetase, charged and uncharged tRNA molecules, RNA polymerase). These are cellular components capable of carrying out transcription and translation reactions. Along with transcription components including T7 RNA polymerase and nucleotides, IVTT can be used to transcribe and translate genes supplied in the form of purified DNA molecules. The cellular components used in IVTT reactions can be obtained for virtually any cell type and can be supplemented with various reagents (e.g., buffers, amino acids, tRNA molecules, etc.).

[0071] The IVTT reaction consists of two subcomponents: (1) "in vitro transcription" (IVTr, or IVT) and (2) "in vitro translation" (IVTl). These processes can occur in a single reaction mixture or in separate reaction mixtures.

[0072] As used herein, the term “cationic lipid” refers to a lipid that has at least one positive charge under physiological conditions.

[0073] The term "ARCA" or anti-reverse cap analogue is m 7 This refers to a modified cap analog in which either the 3'-OH group or the 2'-OH group of the G residue is modified. This modification allows RNA polymerase to initiate transcription at the remaining -OH group of the G residue of the cap, synthesizing an exclusively capped RNA transcript in the correct orientation. Thus, using the cap analogs provided herein enables the synthesis of 100% functional capped RNA, in contrast to transcription reactions using conventional cap analogs in which only half of the cap analog is incorporated in the correct orientation. The capped mRNAs provided herein can be used for protein synthesis in reticulocyte lysates, wheat germ lysates, and other in vitro systems, or can be microinjected, electroporated, or transfected into cells or organisms for in vivo studies, for example. They can also be used in RNA splicing and stability studies.

[0074] As used herein, the term “cell-permeable peptide” refers to a modified peptide or other entity that facilitates the uptake of RNA into cells, for example, by facilitating the movement of cargo molecules from the membrane to the cytoplasm and nucleus. Non-limiting examples of suitable cell-permeable peptides useful in the embodiments disclosed herein include the peptides listed in Table 2, and optionally the peptides listed in Table 2 covalently bound to a dye. [Table 2-1] [Table 2-2] Table 2-3 Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17

[0075] As used herein, the term “linker-bound cell-permeable peptide” refers to a modified peptide or other entity that facilitates the cellular uptake of RNA by facilitating the movement of cargo molecules from the membrane to the cytoplasm and nucleus, for example, by being bound to a linking portion that enables the cell-permeable peptide to conjugate or bind to the trinucleotide cap analogs described herein. Those skilled in the art will recognize that the linker bound to the cell-permeable peptide may be biotin, 3'maleimidebenzoate N-hydroxysuccinimide, and [ka] You will understand that you can choose from commercially available products such as these.

[0076] In some embodiments, the cell-permeable peptides disclosed herein may be covalently bound to the RNA caps disclosed herein. For example, in some embodiments, the cell-permeable peptides may be incorporated into a fluorescent label bound to the RNA caps disclosed herein. In some embodiments, the cell-permeable peptides are not covalently bound to the RNA caps disclosed herein. For example, in some embodiments, compositions are provided that include an RNA molecule having a CAP described herein in combination with one or more cell-permeable peptides.

[0077] As used herein, the terms “click” or “click chemistry” refer to hysgene cycloaddition or 1,3-dipolar cycloaddition between an azide and an alkyne to form a 1,2,4-triazole.

[0078] As used herein, the term “enzymatically incorporateable” means that a nucleotide can be enzymatically incorporated into the end of a polynucleotide chain, for example, the 3' end, or internally via nic translation of the polynucleotide chain, through the action of a template-dependent or template-independent polymerase enzyme. Nucleotide-5'-triphosphate is an example of an enzymatically incorporateable nucleotide.

[0079] As used herein, the terms “enzymatically elongable” or “3' elongable” mean a nucleotide or polynucleotide that can be added to a nucleotide or polynucleotide by enzymatic action. Polynucleotides containing a 3' hydroxyl group are examples of enzymatically elongable polynucleotides.

[0080] As used herein, the term "halogen" refers to the nonmetallic elements of Group 7A of the periodic table, including fluorine (F), chlorine (Cl), bromine (Br), iodine (I), and astatine (At). Halogens are monovalent and readily form anions, occurring as compounds or ions.

[0081] As used herein, the terms “intracellular molecular stability” and “intracellular stability” refer to the ability of RNA to exist within a cell without degradation that results in loss of function. Therefore, increased intracellular stability means an increase in the period of time that RNA exists within a cell. As a non-limiting example, uncapped RNA can exist within a cell for an average of 4–6 hours, while capped RNA can exist for an average of 10–48 hours, depending on the capping.

[0082] As used herein, the term “crosslinked nucleic acid” (LNA) refers to a crosslink between a 2'O and a 4'C methylene bicyclonucleotide monomer.

[0083] As used herein, the term “nucleic acid base” refers to a nucleic acid base of a nitrogen-containing heterocyclic moiety. Non-limiting examples of suitable nucleic acid bases include adenine, cytosine, guanine, thymine, uracil, 5-propynyluracil, 2-thio-5-propynyluracil, 5-methylcytosine, pseudoisocytosine, 2-thiouracil, 2-thiothymine, 2-aminopurine, N9-(2-amino-6-chloropurine), N9-(2,6-diaminopurine), hypoxanthine, N9-(7-deaza-guanine), N9-(7-deaza-8-aza-guanine), and N8-(8-aza-7-deazaadenine).

[0084] As used herein, the term "nucleoside" refers to a compound consisting of a nucleic acid base bonded to the C-1' carbon of a ribose sugar or its analogue. The ribose or analogue may be substituted or unsubstituted. A substituted ribose sugar may have one or more carbon atoms, preferably the 3'-carbon atoms, bonded to -R, -OR, -NRR, or halogen (e.g., fluoro, chloro, bromo, or iodine) (each R group independently being -H, C1-C6 alkyl, or C3-C 14 This includes, but is not limited to, ribose substituted with one or more identical or different substituents (such as aryl ribose). In particular, ribose includes ribose, 2'-deoxyribose, 2',3'-dideoxyribose, 3'-haloribose (such as 3'-fluororibose or 3'-chlororibose), and 3'-alkylribose. Typically, when the nucleic acid base is A or G, the ribose sugar is N of the nucleic acid base. 9 It is bonded to the N position. When the nucleic acid base is C, T, or U, the pentose sugar is bonded to the N of the nucleic acid base. 1 It is bonded at the position (Kornberg and Baker, DNA Replication, 2 nd Ed., Freeman, San Francisco, Calif., (1992). Examples of ribose analogs include arabinose, 2'-O-methylribose, and bridged nucleoside analogs (e.g., WO99 / 14226), but many other analogs are also known in the art.

[0085] As used herein, the term "nucleotide" refers to a monomeric unit or a phosphate ester of a nucleoside within a polynucleotide.

[0086] As used herein, the term “nucleotide triphosphate” refers to a nucleotide having a triphosphate ester group at the 5' position.

[0087] When used herein, the nucleosides and / or nucleotides of this instruction may include “natural sugars” (i.e., 2'-ribose, 2'-deoxyribose, etc.) or sugar analogs.

[0088] The terms “reporter moiety” and “reporter” refer to interchangeable and detectable moieties. In some embodiments, the reporter is specifically bound by an affinity moiety. In some embodiments, the interaction between the reporter moiety and the affinity moiety provides isolation of 1,4-triazole-derivative RNA bound to the reporter moiety. Examples include, but are not limited to, biotin or imino-biotin and avidin or streptavidin. A subclass of reporter moiety is “epitope tag,” which refers to a tag that is recognized and specifically bound by an antibody or its antigen-binding fragment. Other reporters include, but are not limited to, tags (with affinity partners), epitope tags (with antibodies), and enzyme substrates (with enzymes). The reporter moiety can enable binding to a solid support for the purification of capped RNA. The reporter may be, for example, a dye, biotin, or a peptide. An example of a biotin molecule that may contain a reporter moiety is C5-C 20 Examples include O-biotin, SS-biotin, XX-biotin ((6-((6-((biotinoyl)amino)hexanoyl)amino)succinimidyl hexanoate), and NHS esters. For use in certain methods herein, the reporter contains an azide group to enable use in “click” technology.

[0089] As used herein, the term “sugar analog” refers to an analog of the sugar ribose. Exemplary ribose sugar analogs include, but are not limited to, substituted or unsubstituted furanoses having more or fewer than five ring atoms, such as erythroses and hexoses, and substituted or unsubstituted 3- to 6-carbon acyclic sugars. Typical substituted furanoses and acyclic sugars have one or more carbon atoms that are the same or different -R, -OR, -NRR, or halogen group (each R independently being -H, (C1-C6)alkyl, or (C1-C 14 Substituted with one or more aryl atoms. Examples of substituted furanoses having five ring atoms include 2'-deoxyribose, 2'-(C1-C6)alkylribose, 2'-(C1-C6)alkoxyribose, and 2'-(C5-C 14 ) Aryloxyribose, 2',3'-dideoxyribose, 2',3'-didehydroribose, 2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose, 2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose, 2'-deoxy-3'-(C1-C6)alkylribose, 2'-deoxy-3'-(C1-C6)alkoxyribose, 2'-deoxy-3'-(C5-C 14 ) Aryloxyribose, 3'-(C1-C6)alkylribose-5'-triphosphate, 2'-deoxy-3'-(C1-C6)alkylribose-5'-triphosphate, 2'-deoxy-3'-(C1-C6)alkoxyribose-5'-triphosphate, 2'-deoxy-3'-(C5-C 14 Examples of sugar analogs include, but are not limited to, ethyloxyribose-5'-triphosphate, 2'-deoxy-3'-halolibose-5'-triphosphate, 2'-deoxy-3'-aminoribose-5'-triphosphate, 2',3'-dideoxyribose-5'-triphosphate, or 2',3'-didehydroribose-5'-triphosphate. Further sugar analogs include, structural [ka] Also included are so-called bridged nucleic acids (LNA) having this, and those described in Wengel et al., WO99 / 14226.

[0090] As used herein, the terms "polynucleotide", "oligonucleotide", and "nucleic acid" are used interchangeably and refer to single-stranded and double-stranded polymers of nucleotide monomers, including ribonucleotides (RNA) and 2'-deoxyribonucleotides (DNA) linked by internucleotide phosphodiester bond linkages. Polynucleotides can be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or a chimeric mixture thereof.

[0091] As used herein, the term "terminator" means an enzymatically incorporable nucleotide that prevents the incorporation of subsequent nucleotides into the resulting polynucleotide chain, thereby stopping polymerase-mediated elongation. Typical terminators lack a 3'-hydroxyl substituent and include, for example, 2',3'-dideoxyribose, 2',3'-didehydroribose, and 2',3'-dideoxy-3'-haloribose, such as 3'-deoxy-3'-fluoro-ribose, or 2',3'-dideoxy-3'-fluororibose. Alternatively, ribofuranoses such as 2',3'-dideoxy-β-D-ribofuranosyl, β-D-arabinofuranosyl, 3'-deoxy-β-D-arabinofuranosyl, 3'-amino-2',3'-dideoxy-β-D-ribofuranosyl, and 2',3'-dideoxy-3'-fluoro-β-D-ribofuranosyl can be used (see, for example, Chidgeavadze et al., Nucleic Acids Res., 12:1671-168, and Chidgeavadze et al., FEB. Lett., 183:275-278). Nucleotide terminators also include reversible nucleotide terminators (Metzker et al., Nucleic Acids Res., 22(20):4259).

[0092] As used herein, the term "TBDMS" refers to tert-butyldimethylsilyl.

[0093] As used herein, the term "RNA delivery agent" refers to one or more compounds (e.g., lipids, peptides, etc.) that facilitate the uptake of RNA molecules, such as the capped RNA molecules described herein, by cells (in vitro or in vivo). Non-limiting examples of RNA delivery agents include cationic lipids and cell-permeable peptides, which may be optionally combined with one or more neutral lipids, one or more PEG lipids, or any combination thereof.

[0094] Examples of cationic lipids useful in the embodiments disclosed herein include 2,3-dioleyloxy-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propaneaminium trifluoroacetate (DOSPA), 1,3-dioleyloxy-2-(6-carboxy-spermyl)propylamide (DOSPER), dioctadecylamide-glycylpermine (DOGS), tetramethyltetrapalmitylspermine (TMTPS), tetramethyltetrapalmitoylspermine (TMTOS), and tetramethyltetra Tralaurylspermine (TMTLS), Tetramethyltetramyristylspermine (TMTMS), Tetramethyldioleylspermine (TMDOS), N-1-dimethyl-N-1-(2,3-diaoleoyloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diamyristyloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diapalmityloxypropyl)-2-hydroxypropane-1,3-diamine, N-1-dimethyl -N-1-(2,3-diaoleoyloxypropyl))-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diamyristyloxypropyl)-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, N-1-dimethyl-N-1-(2,3-diapalmityloxypropyl)-2-(3-amino-2-hydroxypropyloxy)propane-1,3-diamine, L-spermine-5-carboxyl-3-(DL-1,2-dipalmitoyl -Dimethylaminopropyl-β-hydroxyethylamine, 3,5-(N,N-dilysyl)-diaminobenzoyl-glycyl-3-(DL-1,2-dipalmitoyl-dimethylaminopropyl-β-hydroxyethylamine), L-lysine-bis(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, L-lysine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-alkylamino)-2-hydroxypropyl)piperazine, L-lysine-bis-(O,O'-Myristoyl-β-hydroxyethyl)amide dihydrochloride, L-ornithine-bis-(O,O'-myristoyl-β-hydroxyethyl)amide dihydrochloride, L-ornithine-bis-(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-oleylamino)-2-hydroxypropyl]piperazine, L-ornithine-bis-(O,O'-palmitoyl-β-hydroxyethyl) Cethyl)amide dihydrochloride, 1,4-bis[(3-amino-2-hydroxypropyl)-oleylamino]-butane-2,3-diol, 1,4-bis[(3-amino-2-hydroxypropyl)-palmitylamino]-butane-2,3-diol, 1,4-bis[(3-amino-2-hydroxypropyl)-myristylamino]-butane-2,3-diol, 1,4-bis[(3-oleylamino)propyl]piperazine, L-arginine-bis-(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, bis[(3-(3-aminopropyl))-myristylamino)2-hydroxypropyl]piperazine, L-arginine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, L-serine-bis-(O,O'-oleoyl-β-hydroxyethyl)amide dihydrochloride, 1,4-bis[(3-(3-aminopropyl)-palmi [Tylamino)-2-hydroxypropyl]piperazine, glycine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, sarcosine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, L-histidine-bis-(O,O'-palmitoyl-β-hydroxyethyl)amide dihydrochloride, cholesteryl-3β-carboxyl-amide ethylenetrimethylammonium iodide, 1,4-bis[( [3-Myristylamino)propyl]piperazine, 1-dimethylamino-3-trimethylammonio-DL-2-propyl-cholesterylcarboxylate iodide, cholesteryl-3β-carboxyamide ethyleneamine, cholesteryl-3β-oxysuccinate ethylenetrimethylammonium iodide, 1-dimethylamino-3-trimethylammonio-DL-2-propyl-cholesteryl-3β-oxysuccinate iodide, 2-[(2-trimethylammonio)-ethylmethylamino]ethyl-cholesteryl-3β-oxysuccinate iodide, 3β[N-(N′,N′-dimethylaminoethane)carbamoyl]cholesterol, and 3β[N-(polyethyleneimine)-carbamoyl]cholesterol, 1,4-bis[(3-palmitylamino)propyl]piperazine, L-ornitylglycyl-N-(1-heptadecyloctadecyl)glycinamide, N 2 ,N 5 -Bis(3-aminopropyl)-L-ornitylglycyl-N-(1-heptadecyloctadecyl)glycinamide, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-alkylamino)-2-hydroxypropyl]piperazine N 2 -[N 2 ,N 5-Bis(3-aminopropyl)-L-ornityl]-N,N-dioctadecyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioctadecyl-L-α-glutamine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-oleylamino)2-hydroxypropyl]piperazine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioctadecyl-L-α-asparagine,N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dioctadecyl-L-glutaminyl]-L-glutamic acid, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-diolyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioleyl-L-α-glutamine, 4-bis[(3-(3-amino-2-hydroxypropyl)-myristylamino)-2-hydroxypropyl]piperazine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dioleyl-L-α-asparagine,N-[N 2 -N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dioleyl-L-glutaminyl]-L-glutamic acid, 1,4-bis[(3-(3-aminopropyl)-oleylamino)propyl]piperazine, N 2 -[N 2,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-dipalmytil-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-N--dipalmytil-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dipalmytil-L-α-asparagine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dipalmytil-L-glutaminyl]-L-glutamic acid, N 2 -[N 2 ,N 5 -Bis(3-aminopropyl)-L-ornityl]-N,N-dimyristyl-L-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dimyristyl-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dimyristyl-L-α-asparagine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-palmitylamino)-2-hydroxypropyl]piperazine, N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy)carbonyl]-N 2 ,N 5 -Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-NN-dimyristyl-L-glutaminyl]-L-glutamic acid, 1,4-bis[(3-(3-aminopropyl)-myristylamino)propyl]piperazine, N 2 -[N 2 ,N 5-Bis(3-aminopropyl)-L-ornityl]-N,N-dilaureyl-L-glutamine, N 2 -8N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dilaureyl-L-α-glutamine, N 2 -[N 2 ,N 5 -Bis(aminopropyl)-L-ornityl]-NN-dilaureyl-L-α-asparagine,N-[N 2 -[N 2 ,N 5 -Bis[(1,1-dimethylethoxy])carbonyl]-N 2 ,N 5-Bis[3-[(1,1-dimethylethoxy)carbonyl]aminopropyl]-L-ornityl-N--dilaureyl-L-glutaminyl]-L-glutamic acid, 3-[N',N''-bis(2-tertbutyloxycarbonylaminoethyl)guanidino]-N,N-dioctadeca-9-enylpropionamide, 3-[N',N''-bis(2-tertbutyloxycarbonylaminoethyl)guanidino]-N,N-dipalmytilpropionamide, 3-[N',N''-bis(2-t [ert butyloxycarbonylaminoethyl)guanidino]-N,N-dimyristylpropionamide, 1,4-bis[(3-(3-aminopropyl)-palmitylamino)propyl]piperazine, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-oleylamino)propyl]piperazine, N,N-(2-hydroxy-3-aminopropyl)-N-2-hydroxypropyl-3-N,N-diolylaminopropane, N,N-(2-hydroxy-3-aminopropyl)-N-2- Hydroxypropyl-3-N,N-dipalmitylaminopropane, N,N-(2-hydroxy-3-aminopropyl)-N-2-hydroxypropyl-3-N,N-dimyristylaminopropane, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-myristylamino)propyl]piperazine, [(3-aminopropyl)-bis-(2-tetradecyloxyethyl)]methylammonium bromide, [(3-aminopropyl)-bis-(2-oleyloxyethyl)]methylammonium Ammonium bromide, [(3-aminopropyl)-bis-(2-palmityloxyethyl)]methylammonium bromide, oleoyl-2-hydroxy-3-N,N-dimethylaminopropane, 2-didecanoyl-1-N,N-dimethylaminopropane, palmitoyl-2-hydroxy-3-N,N-dimethylaminopropane, 1,2-dipalmitoyl-1-N,N-dimethylaminopropane, myristoyl-2-hydroxy-3-N,N-dimethylaminopropane, 1,2-dimyristoyl-1-N,N-dimethylaminopropane, (3-aminopropyl)->4-(3-amino-propylamino)-4-tetradecylcarbamoyl-butylcarbamate cholesteryl ester, (3-amino-propyl)->4-(3-amino-propylamino-4-carbamoyl-butylcarbamate cholesteryl ester, (3-amino-propyl)->4-(3-amino-propylamino)-4-(2-dimethylamino-ethylcarbamoyl)-butylcarbamate cholesteryl ester, spermine-5-carboxyglycine (N'-stearyl-N'-oleyl)amidetetratrifluoroacetate, spermine-5-carboxyglycine (N'-stearyl-N'-elaidyl)amidetetrato Difluoroacetate, agmatinyl carboxycholesterol acetate, spermine-5-carboxy-β-alanine cholesteryl ester tetratrifluoroacetate, 2,6-diaminohexanoyl β-alanine cholesteryl ester bistrifluoroacetate, 2,4-diaminobutyroyl β-alanine cholesteryl ester bistrifluoroacetate, N,N-bis(3-aminopropyl)-3-aminopropionyl β-alanine cholesteryl ester tristrifluoroacetate, [N,N-bis(2-hydroxyethyl)-2-aminoethyl]aminocarboxycholesteryl ester, stearylcarnitine ester, palmitylcarnitine ester, myristylcarnitine ester, Stearyl stearoyl carnitine ester chloride salt, L-stearyl stearoyl carnitine ester, stearyl oleoyl carnitine ester chloride, palmityl palmitoyl carnitine ester chloride, myristyl myristoyl carnitine ester chloride, L-myristyl myristoyl carnitine ester chloride, 1,4-bis[(3-(3-amino-2-hydroxypropyl)-palmitylamino)propyl]piperazine, N-(3-aminopropyl)-N,N'-bis-(dodecyloxyethyl) -Piperadinium bromide, N-(3-aminopropyl)-N,N'-bis-(oleyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N,N'-bis-(palmityloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N,N'-bis-(myristyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-dodecyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N ,N'-(bis-2-oleyloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-palmityloxyethyl)-piperazinium bromide, N-(3-aminopropyl)-N'-methyl-N,N'-(bis-2-myristyloxyethyl)-piperazinium bromide are selected, and useful phospholipids in the composition and method are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dioleoyl-sn-glycero-3-phosphocholine Foethanolamine (DOPE), 1,2-Dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-difytanol-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE ), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), 1-stearoyl-2-oleoylphosphatidinecholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), , compound 1 [ka] , compound 2 [ka] , Compound 3

change

change

change

change

change

change

change

change

change

change

change

[0095] In some embodiments, the RNA delivery agents described herein may comprise one or more neutral or uncharged lipids. Neutral lipids useful in the embodiments described herein include, for example, cholesterol, dioleoylphosphatidylethanolamine (DOPE), dioleoylphosphatidylcholine (DOPC), and diphytanoylphosphatidylethanolamine (DDhPE), fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, or combinations thereof.

[0096] The RNA delivery agents described herein may include one or more agents that inhibit the aggregation of lipid / RNA particles. Examples of agents that inhibit the aggregation of lipid / RNA particles include, for example, PEG lipids or PEGylated lipids, or polyglyceryl lipids, as described in Fiedl, et al. (2020) Nanomedicine 15(19), 1829-1841.

[0097] The RNA delivery agents described herein may contain one or more PEG lipids. As used herein, “PEG lipid” or “PEGylated lipid” refers to a lipid containing polyethylene glycol components. PEG lipids may be selected from a non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, and mixtures thereof. For example, PEG lipids may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipids.

[0098] RNA can be transfected into cells so that it can be translated into cells. Methods of transfection are known to those skilled in the art and include microinjection, electroporation, transfection, chemical treatment, etc. In some embodiments, the RNA compositions provided herein are delivered to cells in vitro. In some embodiments, the RNA compositions provided herein may be used for ex vivo delivery of mRNA to cells. In other embodiments, the RNA compositions provided herein can be used for in vivo delivery of mRNA to cells, for example, in connection with mRNA vaccines. Cells for use in in vivo translation include any patient cells that are desired to express the protein of interest. Non-limiting examples of cells useful in the embodiments disclosed herein include immune cells (e.g., T cells, B cells, NK cells, dendritic cells, macrophages, etc.), hepatocytes, lung cells, pancreatic cells, bone marrow cells, tissue culture cells, germ cells, stem cells such as induced pluripotent stem cells (iPSCs), human embryonic stem cells (hESCs), mesenchymal stem cells (MSCs), adipose-derived stem cells (ADSCs), etc.

[0099] Suitable dyes for use are known to those skilled in the art, including coumarin, cyanine, benzofuran, quinoline, quinazolinone, indole, benzazole, borapoliazindacene, and xanthenes (including fluorescein, rhodamine, and rhodol), as well as RICHARD P. HAUGLAND, MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (11 th This includes, but is not limited to, other pigments described in edition, January 2010.

[0100] The fluorescent dyes used herein include, but are not limited to, pyrene (including any of the corresponding derivative compounds disclosed in U.S. Patent Nos. 5,132,432 and 8,039,642), anthracene, naphthalene, acridine, stilbene, indole or benzindole, oxazole or benzoxazole, thiazole or benzothiazole, 4-amino-7-nitrobenz-2-oxa-1,3-diazole (NBD), cyanine (U.S. Patent Nos. 6,977,305, 6,974,873, 6,664, No. 047, No. 4,981,977, No. 5,268,486, No. 5,569,587, No. 5,569,766, No. 5 ,486,616, No.5,627,027, No.5,808,044, No.5,877,310, No.6,002,003 , No. 6,004,536, No. 6,008,373, No. 6,043,025, No. 6,127,134, No. 6,130, No. 094, No. 6,133,445, No. 7,446,202, No. 7,598,390, No. 7,776,529, PCT country (including any corresponding compounds in International Publications WO02 / 26891, WO97 / 40104, WO99 / 51702, WO01 / 21624, WO2018 / 085449, and European Patent Application Publication 1065250A1), benzocyanines (including any corresponding compounds in Nos. 9,249,307, 9,751,868, 10,000,467, 10,053,447, 10,125,120, 10,351,551, 10,526,317, and US2017 / 0158858) (including substances), carbostyryl, porphyrin, salicylate, anthranylate, azulene, perylene, pyridine, quinoline, borapolyazindacene (including any corresponding compounds disclosed in U.S. Patent Nos. 4,774,339, 5,187,288, 5,248,782, 5,274,113 and 5,433,896), xanthene (U.S. Patent Nos. 6,162,931, 6,130,101, 6,229,055, 6,339,392, 5,451,343 and 6,716,This includes any corresponding compound disclosed in U.S. Patent No. 979), oxazine (including any corresponding compound disclosed in U.S. Patent No. 4,714,763), or benzoxazine, carbazine (including any corresponding compound disclosed in U.S. Patent No. 4,810,636), phenalenone, coumarin (including the corresponding compounds disclosed in U.S. Patents No. 5,696,157, No. 5,459,276, No. 5,501,980, and No. 5,830,912), benzofuran (including the corresponding compounds disclosed in U.S. Patents No. 4,603,209 and No. 4,849,362), and benzphenalenone (including any corresponding compound disclosed in U.S. Patent No. 4,812,409), and their derivatives. As used herein, oxazines include resolphins (including any corresponding compounds disclosed in U.S. Patent No. 5,242,805), aminooxazinones, diaminooxazines, and their benzo-substituted analogs.

[0101] If the dye is xanthene, the dye is optionally fluorescein, rhodol (including any corresponding compound disclosed in U.S. Patents Nos. 5,227,487 and 5,442,045), or rhodamine (including any corresponding compound disclosed in U.S. Patents Nos. 5,798,276, 5,846,737, 6,562,632, 7,256,292, 7,985,602, 8,729,267, 9,040,674, 9,315,859, 9,745,336, 9,783,560, 9,790,544, and 10,131,936).

[0102] Typically, the fluorescent dye comprises one or more aromatic or heteroaromatic rings that are optionally substituted one or more times with various substituents, including, but not limited to, halogens, nitro, cyano, alkyl, perfluoroalkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, arylalkyl, acyl, aryl or heteroaryl ring systems, benzos, or other substituents typically present on fluorescent dyes known in the art.

[0103] Caps / cap analogues and promoters (1) RNA caps and cap analogues, and (2) compositions and methods thereof in which a promoter functions to produce capped RNA, such as messenger RNA (mRNA). In some cases, these compositions and methods relate to mRNA caps or cap analogues that interact with a specific promoter (e.g., a modified naturally occurring promoter) in a manner that enables the production of capped RNA.

[0104] In some cases, the compositions and methods provided herein are designed to interact in a manner that results in high yield production of mRNA with high capping efficiency. As used herein, high yield production of mRNA refers to 3 mg / ml (60 μg / 20 μl) or more of RNA. As used herein, RNA capping efficiency refers to the percentage of RNA present in a composition containing caps. For example, if an uncapped population of RNA molecules is subjected to a process in which caps or cap analogs are attached to these molecules, the capping efficiency is determined by the percentage of RNA molecules in the resulting composition containing caps. Similarly, if capped mRNA is formed by transcription, the capping efficiency is also determined by the percentage of RNA molecules in the resulting composition containing caps. High capping efficiency refers to the production of RNA populations where the percentage of capped RNA molecules (e.g., target RNA molecules) compared to uncapped RNA molecules (e.g., target RNA molecules) is 70% or higher (e.g., approximately 75% to 99%, 80% to 99%, 85% to 99%, 90% to 99%, 95% to 99%, 75% to 95%, 75% to 90%, 80% to 95%, 85% to 95%, 75% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, etc.). The term "target RNA molecule" refers to the RNA molecule that is the desired target of the capping process. For example, when a bound transcription / translation system is used, ribosomal RNA molecules present for translation are not considered "target RNA molecules." In other words, capping efficiency is related to the RNA molecule being capped (for example, an RNA molecule encoding a specific protein) and does not involve other RNA molecules in the reaction mixture.

[0105] Figure 15 shows the structure of an exemplary 7-methylguanosine trinucleotide capped analog that can function as a capped primer in many of the cases described herein. This schematic diagram of the capped analog shows where the bases can be located at B1 and B2. The three bases of this capped analog are labeled with the circled numbers 1, 2, and 3. Of course, any number of variations of the capped analog may be present in the composition and may be used in the methods described herein.

[0106] The cap and cap analogues may differ substantially with respect to the nucleotide sequence. Using the cap analogue structure shown in Figure 15 for illustrative purposes, the first base labeled with circled number 1 is generally G. The other two bases labeled with circled numbers 2 and 3 are generally complementary to one or more bases of the start site of the nucleic acid molecule in the reaction mixture in which transcription is desired. Furthermore, the start site may differ from the position marked as shown in Figure 16.

[0107] The nucleotide sequence of one exemplary capped primer is shown as GAG in Figure 19. This AG portion of the capped primer (positions 2 and 3 of the capped analogue) is complementary to positions -1 and +1 of the start region of the shown template chain. In this case, positions -1 and +1 of the start region are referred to herein as the start site. Exemplary capped primer nucleotide sequences and the start sites to which they are complementary are listed in Table 3. [Table 3]

[0108] RNA caps and cap analogues included in the compositions and usable in the methods described herein include those presented herein, and specifically include commercially available trimer caps and cap analogues such as those sold by TriLink Biotechnologies (San Diego, CA) (e.g., CLEANCAP® Reagent GG, catalog no. N-7133; CLEANCAP® Reagent AU, catalog no. N-7114; CLEANCAP® Reagent GG (3' OMe), catalog no. N-7433; CLEANCAP® Reagent AG (3' OMe), catalog no. N-7413; and CLEANCAP® Reagent AG, catalog no. N-7113).

[0109] As shown in Table 3, capped primers containing four or more nucleotides may be used in the implementation of the subject matter described herein. Such caps and cap analogues may contain about 3 to about 20 bases (e.g., about 3 to about 19, about 3 to about 18, about 3 to about 15, about 3 to about 12, about 3 to about 10, about 3 to about 8, about 3 to about 6, about 3 to about 4, about 4 to about 10, about 4 to about 8, etc.). Furthermore, such caps and cap analogues may have sequence complementarity to the template strand of the promoter start site.

[0110] Figure 16 shows a comparison of four bacteriophage promoters for T7, T3, SP6, and K11 phages. Each of the bacteriophage promoters shown in Figure 16 is 19 nucleotides long and contains a 10-nucleotide start region at positions -4 to +6. Nucleotides +1 to +6 are referred to herein as the transcription start region, and the start typically begins at position +1. In bacteriophage promoters, position +1 is conserved as G, and positions +2 to +5 are conserved as purines (A and G). Therefore, pyrimidines (T and C) are not usually found at these positions. Furthermore, Figure 16 shows only purine bases present at positions -1 to +5. Also, the only promoter shown to contain a purine (i.e., C) at position +6 is the K11 promoter.

[0111] The promoter regions -5 to -12 interact with the T7 RNA polymerase structural domain located near the carboxyl terminus of the protein. The AT-rich region (positions -17 to -13) is thought to interact with the T7 RNAP structural domain located near the amino terminus of the protein.

[0112] Figure 17 shows three different caps designed to have sequence complementarity to or near the transcription start region. CAP1 is a dinucleotide cap with sequence complementarity to the +1 position of the transcription start region. CAP2 is a trinucleotide cap with sequence complementarity to the -1 and +1 positions of the transcription start region. CAP3 is a trinucleotide cap with sequence complementarity to the +1 and +2 positions of the transcription start region.

[0113] Ishikawa et al., “Preparation of eukaryotic mRNA having differently methylated adenosine at the 5'-terminus and the effect of the methyl group in translation”, Nucleic Acids Symposium Series No. 53, pages 129-130, Oxford University Press (2009), conducted a study using several different mRNA caps similar to CAP2 shown in Figure 17, and demonstrated that these caps can initiate transcription on a template having 2'-deoxycytidine residues at template positions +1 and +2 ("CC" template; Nucleic Acids Symposium Series No. 53:129(2009)). The authors stated, m7 The results differed when using G5'pppG. m7 "This may be due to base pairing between the additional adenosine (N1) at G5'pppN1pG and the 2'-deoxythymidine at the -1 position of the T7 promoter," he states.

[0114] Figure 18 is similar to Figure 17, but the base pair at position +1 in the start region has been changed from G / C to A / T. Also, CAP4, CAP5, and CAP2 are located above their respective complementary hybridization start sequences.

[0115] Figure 19 is similar to Figures 17 and 18, but shows only a single mRNA cap CAP2 and its complementary hybridization start sequences at positions -1 and +1. Furthermore, the start region is structured such that neither of the two bases of the cap hybridized to the start region is complementary to the immediately adjacent bases at positions -2 and +2.

[0116] Several promoters and modified promoters are present in the composition and can be used in the manner provided herein. Using the schematic diagram in Figure 16 for reference, the promoters present in the composition and used in the manner provided herein may be wild-type promoters or may be modified in some way. Such modifications include (1) 5' and 3' cleavage, and / or (2) internal substitution and / or deletion.

[0117] If transcription initiation at position -1 or +1 is desired, promoters can be designed to facilitate such initiation. For example, when a trinucleotide-capped primer is used for initiation at position -1, a promoter with the following non-template strand nucleotide sequence may be used: TATY1Y2Z. In this context, Y1 is at position -1, Y2 is at position +1, and Z is at position +2, "adjacent" to the +1 end of the initiation site. "Adjacent" means that the base is located as the first base before and / or after the initiation site. Furthermore, when a trinucleotide-capped primer is used for initiation at position +1, a promoter with the following non-template strand nucleotide sequence may be used: TATA Y1Y2Z. In these cases, Y1 and Y2 are the same bases as the second and third bases of the trinucleotide-capped primer. Thus, the template strand contains bases at positions corresponding to Y1 and Y2, which are complementary to the bases of the trinucleotide-capped primer. Furthermore, Z is a transcription-blocking nucleotide, and its base can independently be A, T, or C, as well as chemically modified nucleotides.

[0118] As an example, when a GAG primer is used for initiation at position -1, suitable promoters include those containing the following nucleotide sequences: (1) 5'-TATA GA-3', (2) 5'-TATA GT-3', and (3) 5'-TATA GC-3'.

[0119] If transcription initiation at position +2 is desired, the promoter may be designed to facilitate such initiation. For example, if a trinucleotide-capped primer is used for initiation, a promoter having the following non-template-chain nucleotide sequence may be used: TATA X1Y1Y2X2 (wherein Y1 and Y2 (located at positions +2 and +3) are the same as the second and third bases of the trinucleotide-capped primer). Furthermore, X1 and X2 are transcription-blocking nucleotides (located at positions +1 and +4), and their bases can independently be A, T, or C, or chemically modified nucleotides. In this context, Y1 is at position +2, Y2 is at position +3, and X1 and X2 at positions +1 and +4 are said to be "adjacent" to each end of the +2 / +3 start site. Furthermore, in some cases, X1 may be a transcription-blocking nucleotide, while X2 is not.

[0120] As an example, when a GAG primer is used for transcription initiation at position +2, suitable promoters include those containing the following nucleotide sequences: (1) 5'-TATA TAGA-3', (2) 5'-TATA TAGT-3', (3) 5'-TATA TAGC-3', (4) 5'-TATA AAGA-3', (5) 5'-TATA AAGT-3', (6) 5'-TATA CAGC-3', and (7) 5'-TATA CAGA-3'.

[0121] Compositions for the production of RNA in which transcription initiation occurs at a position other than the native +1 transcription initiation site, and methods for using such compositions are provided herein. For example, initiation may occur at the -2 / -1, -1 / +1, +2 / +3, -1 / +1 / +2, -1 / +1 / +2 / +3, or +2 / +3 / +4 positions. Often, bases A, T, or C may be located at one or both positions adjacent to one or both ends of the initiation site. Furthermore, other transcription initiation blocking nucleotides may be located at the same positions.

[0122] Furthermore, compositions comprising a primer capped with a polymer containing three or more nucleotides (e.g., nucleotides such as about 3 to about 10, about 3 to about 8, about 3 to about 7, about 3 to about 5, about 3 to about 4, about 4 to about 8, etc.) and a promoter containing a transcription start site whose template strand is complementary to the bases of the capped primer, and methods for using such compositions are also provided herein. Often, the capped primer is designed to hybridize to a transcription start site located at a position other than the +1 / +2 position, or in addition to the +1 / +2 position. In many further examples, the bases A, T, or C are located at one or both positions adjacent to the start site (e.g., positions +1 and +4 when a +2 / +3 start site is used). Furthermore, compositions comprising a trimer cap and a promoter containing a +1 / +2 transcription start site where the base at position +3 is A, T, or C, and methods for using such compositions are also provided herein.

[0123] Furthermore, compositions for transcription initiation using primers capped with a multimer exceeding 3 nucleotides in length, and methods for using such compositions are provided herein. An exemplary tetramer-capped primer has the nucleotide sequence GAGG. When transcription is initiated at the +1 / +2+3 position using this capped primer, the promoter used for transcription initiation may include one of the following nucleotide sequences: (1) 5'-TATA AGGA-3', (2) 5'-TATA AGGT-3', (3) 5'-TATA AGGC-3', (4) 5'-TATA GAGGT-3', (5) 5'-TATA GAGGA-3', and (6) 5'-TATA GAGGC-3'.

[0124] In some embodiments, promoters are provided herein that include a transcription initiation blocking nucleotide adjacent to a transcription initiation site. A “transcription initiation blocking nucleotide” is a nucleotide that is undesirable for transcription initiation at the site where it is located. For example, with respect to the T7 RNA polymerase promoter, if located at position +2 and followed by the sequence AG, and if a GAG-capped primer is used for RNA capping, the capping efficiency can be increased by using a thymine base on the non-template strand. In this case, the thymidine at position +2 is the transcription initiation blocking nucleotide.

[0125] A transcription initiation-blocking nucleotide can be any nucleotide that does not significantly affect transcription initiation at a desired start site, but does not readily initiate transcription. The transcription initiation-blocking nucleotide functions in conjunction with the promoter, capped primer, and reaction conditions used. In some cases, the transcription initiation-blocking nucleotide may be deoxythymidine, thymidine, cytidine, adenosine, guanosine, and / or uridine. The transcription initiation-blocking nucleotide can also be chemically modified. Furthermore, such chemical modifications may involve bases, sugars, phosphate links, or combinations thereof.

[0126] By using transcription initiation blocking nucleotides, capping efficiency can be increased by at least 20% (e.g., approximately 20% to 200%, 20% to 180%, 20% to 150%, 20% to 120%, 20% to 100%, 20% to 80%, 20% to 60%, 20% to 40%, 30% to 100%, 40% to 90%, 50% to 150%, 30% to 60%, etc.). One exemplary assay to measure the increase in capping efficiency is by comparing capping efficiency under two different conditions. Under these exemplary conditions, capped mRNA with two different promoters is produced using GAG-capped primers. The non-template strand of one promoter contains the nucleotide sequence TATA AGG, and the other promoter contains the nucleotide sequence TATA AGT, the difference being the presence of T at the +2 position.

[0127] Transcription initiation blockade nucleotides can be used in several different ways. Along these methods, the position and number of transcription initiation blockade nucleotides may vary. For example, two or more (e.g., one, two, three, etc.) transcription initiation blockade nucleotides may be adjacent to one or both ends of the transcription start site. One exemplary promoter sequence is as follows: 5'-TATA TAGTT-3' (where AG is the start site). In this case, one transcription initiation blockade nucleotide is adjacent to the 5' end of the start site, and two transcription initiation blockade nucleotides are adjacent to the 3' end of the start site.

[0128] Transfer reaction mixture In addition to caps and capping analogs for RNA molecules and promoters, which can affect the yield and capping efficiency of capped mRNA, variables include the composition of the reaction mixture used in the RNA production process (e.g., the mRNA production process).

[0129] Several conventional methods for producing capped mRNA through the use of capped primers utilize reagent mixtures in which the amount of GTP present is less than the amounts of the cap and the other three NTPs. This is because, when a high concentration of GTP is used with a dimerized cap that starts transcription at the +1 position with G, the GTP efficiently competes with the dimerized cap for initiation from the +1 nucleotide at an NTP concentration close to Kd (2 mM), producing the majority of RNA starting at pppG. Reducing the GTP concentration increases capping efficiency but also lowers the yield of capped mRNA. Compositions and methods for producing capped RNA molecules with both high yield and high capping efficiency are provided herein.

[0130] Several embodiments provided herein relate to IVT reaction mixtures that contribute to the production of mRNA populations in which a high percentage of present RNA molecules are capped (high capping efficiency). In some embodiments, the IVT reaction mixtures and methods described herein may be designed to result in high yield production of RNA. In further embodiments, the IVT reaction mixtures and methods described herein may be designed to result in both high capping efficiency and high yield production of RNA.

[0131] Reaction mixtures that can be used to achieve both high RNA capping efficiency and high yield production may, for example, include chemically modified RNA components that enhance mRNA production and / or stabilize RNA present in the reaction mixture and / or increase translated or reduced immunogenicity.

[0132] IVT reaction mixtures generally consist of the following components: (1) one or more RNA polymerases, (2) one or more caps (e.g., one or more capping primers), (3) all four standard nucleotide triphosphates (i.e., GTP, ATP, CTP, and UTP), and (4) one or more nucleic acid templates (e.g., one or more DNA templates, one or more RNA templates, a combination of one or more DNA templates and one or more RNA templates).

[0133] The IVT reaction mixture used in the method described herein also comprises the following components: (1) one or more buffers (e.g., phosphoric acid, histidine, citric acid, maleic acid, tartaric acid, acetic acid, tris-(hydroxytyl)-aminomethane, bicarbonate, etc.), and (2) one or more divalent metal ions (e.g., Ca 2+ Mg 2+ Mn 2+ Co 2+ Ni 2+ (3) One or more chemically modified nucleotide triphosphates (e.g., pseudouridine(ψ) triphosphate, 1-methylpsoiduridine(m) 1 ψ) Triphosphate, 5-methoxyuridine (mo 5 U) Triphosphate, 5-methylcytidine (m5 C) Triphosphates, α-thio-guanosine triphosphates, α-thio-adenosine triphosphates, etc., (4) One or more polyamines (e.g., spermidine, spermine, tris(2-aminoethyl)amine, diethylenetriamine, etc.), (5) One or more reducing agents (e.g., DTT (2,3-dihydroxybutane-1,4-dithiol / also called "dithiothreitol"), DTE (2,3-dihydroxybutane-1,4-dithiol), thioglycolates, cysteine, sulfites, bisulfites, sulfides, disulfides, TCEP (tris(2-carboxyethyl)phosphine), 2-mel (6) One or more nonionic detergents (e.g., octylphenoxypolyethoxyethanol (nonidet P-40); polyoxyethylene glycol sorbitan alkyl esters, e.g., polysorbate 20 or polysorbate 80; polyethylene glycol and polypropylene glycol block copolymers (poloxamer) such as poloxamer 407; polyethoxylated tallow amine (POEA) salts; nonoxynol such as nonoxynol-9; Triton X-100; Tween 80, etc.), (7) One or more crowding agents (8) may comprise one or more of the following: (e.g., polyethylene glycol, dextran, and Ficol), and / or (8) one or more RNAse inhibitors (e.g., one or more vanadyl ribonucleoside complexes (VRCs), one or more nucleotide analogs, SUPERASE-IN® (Thermo Fisher Scientific, catalog no. AM2696), RNASEOUT® (Thermo Fisher Scientific, catalog no. 10777019), inorganic pyrophosphatases (e.g., Thermo Fisher Scientific, catalog no. EF0221)).

[0134] The concentrations of nucleoside triphosphates and cap analogs present in the IVT reaction mixture can vary. In some embodiments, NTPs and cap analogs are present in the reactants at equimolar concentrations. In some embodiments, the molar ratio of cap analogs (e.g., trinucleotide caps) to nucleoside triphosphates in the reactants is greater than 1:1. For example, the molar ratio of a cap analog to any one nucleoside triphosphate (e.g., ATP) in the reactant may be approximately 1.1:1 to 25:1, 2:1 to 25:1, 3:1 to 25:1, 5:1 to 25:1, 1.1 to 15:1, 2:1 to 15:1, 4:1 to 15:1, 6:1 to 15:1, 8:1 to 15:1, 1.1 to 10:1, 2:1 to 10:1, 3:1 to 10:1, 4:1 to 10:1, or 2:1 to 6:1. In many cases, the molar ratio of the cap analog to any one nucleoside triphosphate (e.g., ATP) in the reactant can be approximately 1:1 to approximately 10:1 (e.g., approximately 1.5:1 to approximately 8:1, approximately 2:1 to approximately 8:1, approximately 2:1 to approximately 6:1, approximately 2:1 to approximately 5:1, approximately 1.5:1 to approximately 5:1, approximately 2:1 to approximately 4:1, etc.).

[0135] In some embodiments, the molar ratio of the cap analog (e.g., trinucleotide cap) to any one nucleoside triphosphate in the reactant is less than 1:1. For example, the molar ratio of the cap analog (e.g., trinucleotide cap) to nucleoside triphosphate in the reactant may be about 1:1.1 to about 1:25, about 1:2 to about 1:25, about 1:4 to about 1:25, about 1:5 to about 1:25, about 1:1.1 to about 1:10, about 1:2 to about 1:10, about 1:4 to about 1:10, about 1:2 to about 1:6, or about 1:3 to about 1:6.

[0136] The concentrations of individual NTPs (e.g., "standard" NTPs (ATP, UTP, CTP, GTP)) present in the IVT reactant may also vary. Furthermore, such variations may be due to factors such as the cap nucleotide sequence, the start site sequence, and / or the presence of "non-standard" NTPs (e.g., pseudouridine (ψ) triphosphate, 1-methylpsoiduridine (m1ψ) triphosphate, 5-methoxyuridine (mo5U) triphosphate, etc.).

[0137] For illustrative purposes, when a dimer cap is used in an IVT reaction, the concentration of the NTP that can hybridize at position +1 of the start site may be lower than that of other NTPs in the reaction mixture. Therefore, compositions and methods are provided herein in which three standard NTPs are present in equimolar amounts and one standard NTP is present in a smaller amount. Using the promoter sequence of Figure 17 for specific illustration, the base at position +1 of the template strand is C. Therefore, in some such cases, the IVT reaction mixture contains equimolar amounts of ATP, UTP, and CTP, but a lower amount of GTP. Furthermore, the ratio of the other three NTPs to GTP can range from approximately 1:0.1 to 1:0.95 (e.g., approximately 1:0.1 to 1:0.9, 1:0.2 to 1:0.9, 1:0.25 to 1:0.9, 1:0.3 to 1:0.9, 1:0.4 to 1:0.9, 1:0.2 to 1:0.7, 1:0.25 to 1:0.6, 1:0.15 to 1:0.6, etc.). Additionally, for example, if the dimer cap has the nucleotide sequence GA, the amount of ATP present in the transcription reaction mixture may be lower than that of the other three NTPs.

[0138] In some cases, GTP, CTP, and UTP can be used in excess of ATP in the transcription reaction mixture. As a non-limiting example, the IVT reactant may contain 7.5 mmol of GTP, 7.5 mmol of CTP, 7.5 mmol of UTP, and 3.75 mmol of ATP. The same IVT reaction mixture may contain 3.75 mmol of a cap analog (e.g., a trimer cap). In some cases, the molar ratio of G:C:U:A:cap may be 1:1:1:0.5:0.5, 1:1:0.5:1:0.5, 1:0.5:1:1:0.5, 0.5:1:1:1:0.5, 0.9:0.9:1:1:0.5, or 0.9:0.9:1:0.5:0.5. In some cases, the ratio of one or both NTPs (GTP and CTP) that form three hydrogen bonds with a congener base may be lower than that of NTPs (ATP and UTP) that form two hydrogen bonds. Furthermore, the ATP / UTP to CTP / UTP ratio present in the IVT reaction mixture may be 1.5 to 1 to 1.1 to 1.

[0139] RNA molecules with chemical modifications In some cases, it is desirable to generate RNA molecules containing one or more chemical modifications. In this context, chemical modifications refer to chemical changes not typically found in RNA generated by the IVT system containing the four standard NTPs. Therefore, chemical modifications include well over 100 naturally occurring RNA chemical modifications, such as N6-methyladenosine (m6A), pseudouridine, 3-methylcytidine (m3C), and 2'-O-methyl modifications.

[0140] Examples of naturally occurring nucleotides used for RNA production in IVT reactions, as provided herein, include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m). 5Examples include UTP. In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used. One method for generating a chemically modified RNA molecule (e.g., mRNA molecule) is to include a chemically modified nucleoside or other component in the IVT reaction mixture.

[0141] Examples of nucleotide analogs that can be used in IVT reactions using the compositions described herein include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble, immobilized hydrolyzable, or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, for example, cap analogs or precursors / substrates (vaccinia or ligase) for enzymatic capping, nucleotides labeled with functional groups to facilitate ligation / conjugation of the cap or 5' portion (IRES), nucleotides labeled with 5'PO4 to facilitate ligation of the cap or 5' portion, or nucleotides labeled with functional groups / protecting groups that can be cleaved chemically or enzymatically. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, ganciclovir, entecavir, terbivudine, vidarabine, and cidofovir.

[0142] Modified nucleotides may contain modified nucleic acid bases. For example, the RNA transcripts of this disclosure (e.g., mRNA transcripts) may contain pseudouridine (ψ) and 1-methylpsoiduridine (m 1ψ), 1-ethylpsoiduridine, 2-thiouridine, 4'-thiouridine, 2-thio-1-methyl-1-deaz-psoiduridine, 2-thio-1-methyl-psoiduridine, 2-thio-5-aza-uridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-1-methyl-psoiduridine, 4-thiopsoiduridine, 5-aza-uridine, dihydropsoiduridine, 5-methyluridine, 5-methoxyuridine (mo 5 It may include U) and 2'-O-methyluridine. In some embodiments, the RNA transcript (e.g., mRNA transcript) contains a combination of at least two (e.g., two, three, four or more) of the modified nucleic acid bases described above.

[0143] The nucleoside triphosphates (NTPs) provided herein may include unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, the NTP in the IVT reactant includes unmodified ATP. In some embodiments, the NTP in the IVT reactant includes modified ATP. In some embodiments, the NTP in the IVT reactant includes unmodified UTP. In some embodiments, the NTP in the IVT reactant includes modified UTP. In some embodiments, the NTP in the IVT reactant includes unmodified GTP. In some embodiments, the NTP in the IVT reactant includes modified GTP. In some embodiments, the NTP in the IVT reactant includes unmodified CTP. In some embodiments, the NTP in the IVT reactant includes modified CTP.

[0144] In some embodiments, the RNA transcript (e.g., mRNA transcript) is pseudouridine (ψ), 1-methylpsoiduridine (m 1 ψ), 5-methoxyuridine (mo 5 U), 5-methylcytidine (m 5C) comprises a modified nucleic acid base selected from α-thio-guanosine and α-thio-adenosine. In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises a combination of at least two (e.g., two, three, four or more) modified nucleic acid bases, such as the modified nucleic acid bases described herein.

[0145] In some embodiments, the RNA transcript (e.g., mRNA transcript) contains pseudouridine (ψ). In some embodiments, the RNA transcript (e.g., mRNA transcript) contains 1-methylpsoiduridine (m 1 It contains ψ). In some embodiments, the RNA transcript (e.g., mRNA transcript) contains 5-methoxyuridine (mo 5 It contains U). In some embodiments, the RNA transcript (e.g., mRNA transcript) contains 5-methylcytidine (m 5 Includes C). In some embodiments, the RNA transcript (e.g., mRNA transcript) contains α-thio-guanosine. In some embodiments, the RNA transcript (e.g., mRNA transcript) contains α-thio-adenosine.

[0146] In some embodiments, a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) is uniformly modified for a specific modification (e.g., completely modified, modified throughout the entire sequence). For example, a polynucleotide may be 1-methylpsoiduridine (m 1 It can be uniformly modified with ψ), which means that all uridine residues in the mRNA sequence can be modified with 1-methylpsoiduridine (m1 ψ This means that it is replaced by ). Similarly, a polynucleotide can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue such as one of those listed above. Alternatively, a polynucleotide (e.g., RNA polynucleotides such as mRNA polynucleotides) does not have to be uniformly modified (e.g., partially modified, a portion of the sequence modified).

[0147] Capped RNA preparation While we do not wish to be bound by any particular theory, using capped RNA (e.g., capped mRNA molecules) preparations with a high ratio of capped / uncapped RNA may increase expression compared to preparations with a low ratio of capped / uncapped RNA. Therefore, in many cases, it is desirable to separate capped RNA molecules (e.g., capped mRNA molecules) from uncapped RNA (e.g., uncapped mRNA molecules) before introducing them into cells. Such separation can be achieved by any number of methods, including purification of capped RNA (e.g., capped mRNA molecules) by methods such as high-performance liquid chromatography (HPLC) or electrophoresis, and / or selective degradation of uncapped RNA molecules.

[0148] The methods and compositions described herein provide a method for generating RNA incorporating the cap analogs described herein. The efficiency of mRNA produced in an IVT reaction using the cap analogs described herein may be at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more, or any value in between, of the yield of mRNA produced in an IVT reaction under identical conditions, except for the inclusion of the cap analogs described herein.

[0149] The methods and compositions provided herein provide a method for generating RNA that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the total mRNA produced in an IVT capped with the cap analogs described herein, or any value in between. In other words, the capping efficiency is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95% or more (e.g., about 50% to about 99%, about 60% to about 99%, about 70% to about 99%, about 80% to about 99%, about 85% to about 99%, about 85% to about 95%, about 90% to about 96%, etc.).

[0150] The methods provided herein for preparing RNA preparations incorporating the caps provided herein may, advantageously, include the step of degrading uncapped RNA and thereby purifying or concentrating the capped RNA species. Removal of uncapped RNA can be achieved by any means known to those skilled in the art, including but not limited to enzymatic digestion. For example, an RNA preparation may be treated with RNA 5' polyphosphatase, which removes pyrophosphate from 5' triphosphorylated RNA, leaving the monophosphate 5' end. The preparation can then be treated with 5'→3' exoribonuclease, which requires 5' monophosphate RNA as a substrate. One category of such enzymes is XRN 5'→3' exoribonuclease (see Nagarajan et al., “XRN 5'→3' exoribonucleases: Structure, mechanisms and functions”, Biochim Biophys Acta., 1829:590-603. (2013)). Therefore, processing with these two enzymes selectively degrades uncapped RNA while leaving capped RNA intact.

[0151] Methods described herein include methods for preferentially degrading uncapped RNA molecules (e.g., mRNA molecules) over capped RNA molecules (e.g., capped mRNA molecules), and compositions used to carry out such methods. Such methods may or may not involve processing of RNA present in the reaction mixture prior to the preferential degradation of uncapped RNA. When the reaction mixture is processed to prepare a subpopulation of RNA molecules for degradation (e.g., uncapped RNA molecules), this preparation may be carried out before or simultaneously with the degradation of RNA by 5'→3' exoribonuclease. Thus, both the preparation of RNA molecules for degradation by 5'→3' exoribonuclease and the degradation of RNA molecules may occur in the same reaction mixture at different times or simultaneously. In some cases, the 5' end of the RNA molecule to be degraded may need to be modified so that the 5'→3' exoribonuclease acts on the end. An example of this is the degradation of uncapped RNA molecules using XRN1 exoribonuclease.

[0152] XRN1 is a progressive XRN1 exoribonuclease that degrades the ends of RNA molecules containing a single 5' phosphate group. One commercially available XRN1 exoribonuclease is available from New England Biolabs (catalog number M0338S). If some or all of the RNA molecules to be degraded contain two or more 5' phosphate groups, it is usually desirable to reduce the number of phosphate groups to one. Several methods can be used to remove 5' phosphate groups from RNA, including methods that use phosphatases for enzymatic removal of these groups. One category of such enzymes is RNA 5' polyphosphatases (e.g., Lucigen, catalog number RP8092H).

[0153] Methods described herein include methods that increase the amount of capped RNA by at least 50% compared to uncapped RNA (e.g., at least about 50% to about 500%, about 100% to about 500%, about 150% to about 500%, about 200% to about 500%, about 250% to about 500%, about 300% to about 500%, about 50% to about 1,000%, about 150% to about 1,000%, about 300% to about 1,000%, about 400% to about 1,000%, etc.). The following is an example of a method in which the rate of increase can be calculated. Assume that there are 100 mg of capped RNA and 50 mg of uncapped RNA in a sample. If the amount of uncapped RNA is reduced to 25 mg, the total amount of uncapped RNA is reduced by half. Furthermore, the ratio of capped RNA to uncapped RNA changes from 2:1 to 4:1, and the amount of capped RNA increases by 21% compared to uncapped RNA.

[0154] Compositions comprising trinucleotide-capped RNA as described herein can be used, for example, in in vitro transcription, in vitro translation, and in vivo translation. Current biotechnological efforts for protein production in vitro, in sights, and in vivo will also benefit from these methods and compositions. Furthermore, the compositions provided herein are useful for therapeutic purposes. For example, this technology may be useful for producing vaccines against infectious diseases or cancer, protein replacement therapies, and the like. Those skilled in the art will readily understand that the capping techniques and compositions described herein can generally be used in mRNA vaccines. For example, the RNA caps described herein are US20180318409A1, US20190351040, US20180271970, US20190054112, US20190336595, US20180311336, US20180303929, WO2017 / 070601, WO2019 / 202035, WO2020 / 002525, WO2019 / 19 These sequences may be incorporated into vaccine-useful RNA sequences, including but not limited to those described in 3183, WO2019 / 115635, WO2019 / 038332, WO2019 / 008001, WO2018 / 167320, WO2018 / 115527, WO2018 / 115525, WO2018 / 115507, WO2018 / 104538, and WO2018 / 104540.

[0155] Using alkyne-derived capped RNA, non-infectious viral particles containing immunogen-encoding RNA can be generated. These non-replicating viral particles can be injected into humans, allowing them to enter host cells. Upon entering the host cell, the viral particles dissociate, and the immunogen-encoding mRNA is translated into proteins. These proteins can trigger an immune response.

[0156] RNA-based vaccines can be used for vaccination against infectious agents such as viruses, including coronaviruses (MERS, SARS-CoV, and SARS-CoV-2), human immunodeficiency virus (HIV), feline immunodeficiency virus, human papillomavirus type 16, tumors, Lassa virus, Ebola virus, Marburg virus, anthrax toxin derived from Bacillus anthraces, and botulinum toxin. Therefore, non-limiting examples of viruses for which RNA vaccines can be used include adeno-associated virus, Aichi virus, Australian bat lyssavirus, BK polyomavirus, Bannavirus, Balma forest virus, Bunyamwella virus, Bunyavirus lacrosse, Bunyavirus snowshoe rabbit, Cercopa herpesvirus, Chandipla virus, Chikungunya virus, Cosavirus A, cowpox virus, Coxsackievirus, Crimean-Congo hemorrhagic fever virus, dengue virus, Dorivirus, Dugbe virus, Duvenhage virus, Eastern equine encephalitis virus, Ebola virus, Echovirus, Encephalomyocarditis virus, Epstein-Barr virus, European bat lyssavirus, GB virus, Hepatitis C / G virus, Hantan virus, Hendra virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus Hepatitis E virus, human herpesvirus type 1, type s, type delta hepatitis virus, horsepox virus, human adenovirus, human astrovirus, human coronavirus, human cytomegalovirus, human herpesvirus type 1, human herpesvirus type 2, human herpesvirus type 6, human herpesvirus type 7, human herpesvirus type 8, human immunodeficiency virus, human papillomavirus type 1, human papillomavirus type 2, human papillomavirus types 16, 18, human parainfluenza, human parvovirus B19, human polynuclear respiratory virus, human rhinovirus, human SARS coronavirus, human spuma retrovirus, human T-lymphotropic virus, human trovirus, influenza A virus, influenza B virus, influenza C virus, Isfahan virus, JC polyomavirus, Japanese encephalitis virus, Junin arenavirus,KI Polyomavirus, Kunzin Virus, Lagos Bat Virus, Lake Victoria Marburg Virus, Langat Virus, Lassa Virus, Rosedale Virus, Looping Ill Virus, Lymphocytic Choriomeningitis Virus, Machupo Virus, Mayarovirus, MERS Coronavirus, Measles Virus, Mengo Encephalomyocarditis Virus, Merkel Cell Polymer Virus, Mocola Virus, Molluscum Contagiosum Virus, Monkeypox Virus, Mumps Virus, Murray Valley Encephalitis Virus, New York Virus, Nipah Virus, Norwalk Virus, Onyonnyon Virus, Aarf Virus, Oropushé Virus, Pichinde Virus, Poliovirus, Punta Trophlebovirus, Pumara Virus, Rabies Virus, Rift Valley Fever Virus, Rosavirus A, Ross River Virus, Rotavirus A, Rotavirus B, Rotavirus C, Rubella Virus This includes Sagiyama virus, Sari virus A, Sicilian sandfly fever virus, Sapporo virus, SARS coronavirus type 2, Semlik Forest virus, Seoul virus, monkey foam virus, monkey virus type 5, Sindbis virus, Southampton virus, St. Louis encephalitis virus, tick-borne Poissant virus, Torkutenovirus, Tuscany virus, Ukniemi virus, Vaccinia virus, varicella-zoster virus, smallpox virus, Venezuelan equine encephalitis virus, varicella stomatitis virus, Western equine encephalitis virus, WU polyomavirus, West Nile virus, Yabasal tumor virus, Yabasal disease virus, yellow fever virus, and Zika virus.

[0157] These vaccine strategies may require large quantities of capped RNA. This method facilitates the synthesis and subsequent purification of such capped RNA to make these vaccines commercially viable. Similarly, since human use typically requires highly pure components, strategies that increase the percentage of full-length capped RNA in the transcription reaction, resulting in a more uniform product, are preferred in the vaccine industry. In addition, researchers prefer to use the purest possible product to minimize the number of variables in their experiments. Likewise, the purer the product, the more potent it becomes.

[0158] Additional embodiments relate to the administration of compositions generally comprising an active ingredient (e.g., trinucleotide-capped RNA) formulated with pharmaceutically acceptable excipients. Excipients may include, for example, sugars, starches, cellulose, gums, and proteins. Various formulations are generally known and are discussed in detail in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing, Easton Pa.). Such compositions may include novel cap analogs, antibodies against novel cap analogs, and mimics, agonists, antagonists, or inhibitors of novel cap analogs.

[0159] In various embodiments, compositions described herein, such as pharmaceutical compositions, may be administered by any number of routes, including but not limited to oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, percutaneous, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.

[0160] Embodiments of this disclosure may be further understood in light of the following embodiments, which should not be construed as limiting the scope of this disclosure in any way.

[0161] Those skilled in the art will understand that many modifications, substitutions, and equivalents are possible. All such modifications, substitutions, and equivalents are intended to be incorporated herein. [Examples]

[0162] The following examples provide a method for producing trinucleotide cap analogs.

[0163] Reagents: Unless otherwise specified, reagents and solvents are used as is without further purification. 3'-O-propargylguanosine was purchased from Chemgenes, USA. 1 1H NMR and 31P NMR spectra were recorded in D2O using a Burker 400 MHz instrument. ESI mass spectra were recorded using an Applied Biosystems / Sciex API 150 model. HPLC was performed using a Waters 2996 (Waters Corporation) with an anion exchange column. Ion exchange chromatography was performed using an AKTA purifier (Amersham Biosciences, GE Healthcare) with a DEAE Sepharose column. Gel shift assays were performed using a pTriβ actin template, and IVT reactions were performed using a linearized AmbLuc poly(A)DNA template and the MEGASCRIPT kit (Thermo Fisher Scientific). Emission of the target gel band was quantified by a phosphorimager (GE Healthcare). Purification of RNA from these transcription reactions was performed using the MEGACLEAR Kit (Life Technologies Corporation) according to the manufacturer's protocol. The 96-well plate luminometer (POLARstar OPTIMA.BMG Labtech) is used for reading luciferase assays according to the manufacturer's protocol.

[0164] Example 1: Intermediate synthesis scheme An exemplary synthetic route for obtaining intermediates used in trinucleotide synthesis is described below.

[0165] Intermediate scheme A: Imm 7 (LNA)GDP(8) synthesis: [ka] Intermediate Example 1: Synthesis of DMF-protected LNA guanosine (2): To a stirred solution of 50 mL of 3% trichloroacetic acid in dichloromethane, 5'-DMT-N-DMF LNA guanosine 1 (5.00 g, 7.48 mmol) was added, and the reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was evaporated to dryness under a rotary evaporator. To the resulting orange solid, 50 mL of diethyl ether was added, and the mixture was stirred at room temperature for 30 minutes. The resulting mixture was filtered and dried under vacuum to obtain a white solid 2 (yield: 2.67 g, 95%). This crude material was used in the next step without further purification.

[0166] Intermediate Example 2: Synthesis of LNA guanosine (3): To a 40 mL stirred solution of a 1:1 mixture of 40% aqueous methylamine and 28% ammonium hydroxide, DMF-protected LNA guanosine 2 (2.67 g, 7.04 mmol) was added, and the reaction mixture was stirred at room temperature for 2 hours. After 2 hours, the reaction mixture was evaporated under rotavapor to obtain a white solid 3 (yield, 1.98 g, 95%). This crude material was used in the next step without further purification.

[0167] Intermediate Example 3: Synthesis of LNA-GMP(4): Under an argon atmosphere, at 0°C, LNA guanosine 6 (1.10 g, 3.72 mmol) was added to a stirred solution of POCl3 (1.69 g, 11.19 mmol) and (MeO)3P (15.0 mL), and the reaction mixture was stirred at 0°C for 4 hours. After 4 hours, 50.0 mL of water was added to the reaction mixture. The resulting reaction mixture was washed with ethyl acetate (2 × 50 mL) to remove the phosphorylating agent. The collected aqueous solution was adjusted to pH 1.5 and stirred at 4°C for 15 hours. After 15 hours, the aqueous solution was adjusted to pH 5.5 and loaded onto a DEAE Sepharose column. The desired product was eluted using a linear gradient of 0-1 M TEAB (triethylammonium bicarbonate, pH 7.5), the fraction containing the product was pooled, evaporated, and dried on phosphorus pentoxide in a vacuum desiccator to obtain a fine white powder 4 (yield: 1.43 g, 78%). Data for 4. 1H NMR(D2O,400 MHz)δ 8.01(s,1H),5.91(s,1H),4.63(s,1H),4.58(s,1H),4.16(m,3H),4.03(d,J=8.4Hz,1H),3.20(q,J=7.6Hz,6H),1.28(t,J=7.2Hz,9H); 31 P NMR(D2O,162MHz)δ-5.40(s,1P);MS(m / z):374[MH] - .

[0168] Intermediate Example 4: Synthesis of ImLNA-GMP(5): To a stirred solution of LNA-GMP TEA salt 4 (1.35 g, 2.84 mmol) in 20 mL of dry DMF, imidazole (0.97 g, 14.24 mmol), triphenylphosphine (1.50 g, 5.70 mmol), aldrithiol (1.25 g, 5.70 mmol), and triethylamine (0.29 g, 2.84 mmol) were added. The reaction mixture was stirred at room temperature under an argon atmosphere for 15 hours. The above reaction mixture was slowly added over 5 minutes to a solution of sodium perchlorate (2 g) in 100 mL of acetone in a centrifuge tube at 0°C. The resulting mixture was centrifuged and the supernatant was removed. The solid was pulverized with a fresh volume of acetone (100 mL), cooled, and centrifuged again. This process was repeated two more times, and the resulting solid was dried on P2O5 in a vacuum desiccator to obtain a white powder 5 (yield: 1.05 g, 83%). MS(m / z): 424[MH] - .

[0169] Intermediate Example 5: Synthesis of LNA-GDP(6): To a stirred solution of ImLNA-GMP5 (1.00 g, 2.23 mmol) and zinc chloride (0.61 g, 4.46 mmol) in 10.0 mL of dry DMF, 15 mL of 1 M tris(tributylammonium) phosphate in DMF was added under an argon atmosphere. The reaction mixture was stirred at room temperature for 5 hours. After 5 hours, the reaction mixture was diluted with 50.0 mL of water. The resulting reaction mixture was washed with ethyl acetate (2 × 50 mL) to remove the phosphorylating agent. The collected aqueous solution was adjusted to pH 5.5 and loaded onto a DEAE Sepharose column. The desired product was eluted using a linear gradient of 0–1 M TEAB, the fraction containing the product was pooled, evaporated, and dried on phosphorus pentoxide in a vacuum desiccator to obtain a fine white powder 6 (yield 1.10 g, 75%). Data for 6. 1 H NMR(D2O,400 MHz)δ 8.00(s,1H),5.95(s,1H),4.63(s,2H),4.37(m,2H),4.14(d,J=8.4Hz,1H ),4.04(d,J=8.4Hz,1H),3.20(q,J=7.2Hz,12H),1.28(t,J=7.6Hz,18H); 31 P NMR(D2O,162 MHz)δ-8.94(d,J=20.9 Hz,1P),9.99(d,J=21.3Hz,1P);MS(m / z):454[MH] - .

[0170] Intermediate Example 6: m 7(LNA) Composition of GDP(7): Acetic acid was slowly added to a stirred solution of LNA-GDP6 (1.00 g, 1.52 mmol) in 20.0 mL of water to adjust the pH of the solution to 4.0. Dimethyl sulfate (2.0 mL) was added dropwise to this mixture over 30 minutes, and the reaction mixture was stirred at room temperature for 5 hours. As methylation progressed, the pH decreased to approximately 2.0, and the pH was readjusted to 4.0 using a 1 M NaOH solution. After 5 hours, the reaction mixture was extracted with ethyl acetate (3 × 50 mL) to remove unreacted excess dimethyl sulfate. The collected aqueous solution was adjusted to pH 5.5 and loaded onto a DEAE Sephadex column. The desired product was eluted using a linear gradient of 0–1 M TEAB, the fraction containing the product was pooled, evaporated, and dried on phosphorus pentoxide in a vacuum desiccator to obtain a fine white powder 7 (yield 0.70 g, 68%). Data for 7. 1 H NMR(D2O,400 MHz)δ 6.05(s,1H),4.73(s,1H),4.55(s,1H),4.42(m,1H),4.32(m,1H),4.13(s,3H),4.11(d ,J=6.0Hz,1H),4.00(d,J=8.8Hz,1H),3.20(q,J=7.2Hz,12H),1.28(t,J=7.2Hz,18H); 31 P NMR(D2O,162MHz)δ-6.18(d,J=23.0Hz,1P),-9.56(d,J=22.8Hz,1P);MS(m / z):468[MH] - .

[0171] Intermediate Example 7: Imm 7(LNA) Composition of GDP(7): m in 15 mL of dry DMF 7(LNA)To a stirred solution of GDP TEA salt 7 (0.65 g, 0.96 mmol), imidazole (0.33 g, 4.84 mmol), triphenylphosphine (0.51 g, 1.93 mmol), aldrithiol (0.43 g, 1.93 mmol), and triethylamine (0.10 g, 0.96 mmol) were added. The reaction mixture was stirred at room temperature under an argon atmosphere for 15 hours. The above reaction mixture was slowly added over 5 minutes to a solution of sodium perchlorate (2 g) in 100 mL of acetone in a centrifuge tube at 0°C. The resulting mixture was centrifuged and the supernatant was removed. The solid was pulverized with a fresh volume of acetone (100 mL), cooled, and centrifuged again. This process was repeated two more times, and the resulting solid was dried on P2O5 in a vacuum desiccator to obtain a white powder 8 (yield: 0.42 g, 80%). MS (m / z): 517 [MH] - .

[0172] Intermediate scheme B: Synthesis of dinucleotide pAmpG(13): [ka] Intermediate Example 8: Synthesis of dinucleotide pAmpG(13): In a typical reaction, MMT-2'-O-methyladenosine (n-bz)CED phosphoramidite 9 (2.0 mmol) and 2',3'-diacetylguanosine (n-ibu) 10 (2.0 mmol) are reacted in 20 mL of acetonitrile containing 4.5 molar equivalents of an activator (tetrazole in acetonitrile). After stirring at room temperature for 2 hours, the intermediate product is oxidized from P(III) to P(V) with iodine / pyridine / THF / water and extracted with dichloromethane (400 mL) and brine (400 mL). The resulting organic layer is dried over sodium sulfate and evaporated to the solid intermediate 11.

[0173] To remove the 5'-MMT group, intermediate 11 is dissolved in 20 mL of 80% acetic acid, and the resulting reaction mixture is stirred at room temperature for about 2-3 hours. After the reaction is complete, the mixture is evaporated and the acetic acid is removed by co-evaporation with methanol (6 × 60 mL). The crude 5'-OH dimer 12 is isolated and purified by silica gel chromatography using 5% methanol in dichloromethane as the eluent.

[0174] 5'-OH dimer 12 (2.0 mmol) was phosphytylated with 4 equivalents of bis-cyanoethyl-N,N-diisopropyl-phosphoramidite and 4 equivalents of activator (tetrazole in 20 mL of acetonitrile). After stirring at room temperature for 45 minutes, the 5'-phosphytylated dimer was oxidized from P(III) to P(V) with iodine / pyridine / THF / water and extracted with dichloromethane (300 mL) and brine (300 mL). The organic layer was evaporated to an oily residue, co-evaporated with methanol (2 × 60 mL), dissolved in 25 mL of methanol, and concentrated ammonia (25 mL) was added. The resulting mixture was kept at room temperature for 48 hours until the deprotection of pAmpG dimer 13 was complete. The mixture was evaporated and co-evaporated with methanol, and the resulting dimer was analyzed by LC / MS (MS (m / z): 705 [MH]). - Characterized by ) and used for further conjugation to synthesize trinucleotide cap analogs.

[0175] Example 2: Synthesis of LNA trinucleotide cap analog (14): The following general trinucleotide schemes illustrate combinations of intermediates from intermediate scheme (A) and intermediate scheme (B) that lead to the exemplary trinucleotide cap analogs described herein. In these illustrations, the trinucleotide analog (14) of the disclosure is a cross-linked cap analog.

[0176] [ka] Example 1 of Trinucleotide Cap Analogues -- Synthesis of LNA Trinucleotide Cap Analogue (14): Imm 7(LNA) Zinc chloride (0.15 g, 1.10 mmol) was added to a stirred solution of GDP8 (0.10 g, 0.18 mmol) and pAmpGN,N-dimethylisopropylammonium salt 13 (0.14 g, 0.18 mmol) in 10.0 mL of dry DMF under an argon atmosphere, and the reaction mixture was stirred at room temperature for 80 hours. The reaction mixture was added at 0°C to a solution of disodium EDTA (0.55 g, 1.48 mmol) in 100.0 mL of water. The resulting aqueous solution was adjusted to pH 5.5 and loaded onto a DEAE Sephadex column. The desired product was eluted using a linear gradient of 0-1 M TEAB, the fraction containing the product was pooled, evaporated, and concentrated to 10.0 mL of the TEA salt of 14. The TEA salt of the product was dissolved in water (5 mL) and then poured into a solution of sodium perchlorate (2.0 g) in acetone (50 mL). The resulting mixture was centrifuged, and the supernatant was discarded. The obtained solid was washed with acetone (2 × 50 mL) and dried in vacuum to obtain the sodium salt of LNA trinucleotide cap analog 14. (Yield: 0.12 g, 55%)14 data. 1 H NMR (D2O,400 MHz)δ 8.39(s,1H),7.94(s,1H),7.84(s,1H),6.01(d,J=6.0Hz,1H),5.87(d,J=6.0Hz,1H),5.55(s,1H),4.83(m,1 H),4.43(m,4H),4.31(m,2H),4.23(m,4H),4.10(m,3H),3.99(m,1H),3.93(m,1H),3.91(s,3H),3.29(s,3H); 31 P NMR(D2O,162MHz)δ-0.92(s,1P),-11.11(d,J=19.4Hz,1P),-10.42(d,J=17.8Hz,1P),-22.91(t,J=17.8Hz,1P);MS(MALDI,m / z):1156[MH] - .

[0177] Example 3: In vitro transfer using LNA-trinkle leotide CAP analogues The following examples demonstrate that the synthetic CAP described herein can be incorporated into mRNA in vitro. Briefly, linearized DNA containing the coding sequence for GFP under the control of the T7 promoter was used in an in vitro transcription reaction using buffers and enzymes from the MMESSAGE MMACHINE® T7 Kit (Thermo Fisher Scientific, catalog no. AM1344) and an NTP / cap mixture. The NTP / cap mixture consisted of a mixture of NTPs and either no cap, an ARCA cap analog (Thermo Fisher Scientific, catalog no. AM8045), a GAG cap analog (CLEANCAP® AG, Trilink Biotechnologies, catalog no. N-7113), or a compound (14) described herein. Reactions with ARCA or no cap were performed using a DNA template containing a wild-type T7 promoter with a GGG start. A DNA template containing a modified T7 promoter with an AGG start was used in a reaction with a GAG Cap analog or an LNA-modified GAG Cap (compound 14). In all reactions except the reaction with ARCA, the concentrations of each NTP and cap were 5 mM. The reaction with ARCA included the following cap / NTP concentrations: 6 mM ARCA, 1.5 mM GTP, and 7.5 mM ATP, CTP, and UTP, respectively. The reactions were carried out according to the manufacturer's instructions. Each reaction produced a full-length RNA transcript of approximately 1000 nucleotides, containing approximately 120 nt of poly(A) tail. The RNA transcripts were purified using the MEGACLEAR® RNA purification kit (Thermo Fisher Scientific, catalog no. AM1908) according to the manufacturer's instructions, and the RNA yield was quantified by measuring the absorbance at 260 nm using a NANODROP® 2000C spectrometer (Thermo Fisher Scientific, catalog no. ND-2000C). As shown in Figure 11, the RNA yield in the reactions containing the LNA Cap analog was superior to that of the ARCA cap reaction.

[0178] Example 4: Capping efficiency using LNA cap analogues The capping efficiency of the LNA cap analog was compared with that of an uncapped control, an ARCA cap analog, and a CLEANCAP (commercial) cap analog. Briefly, the in vitro transcription reaction was performed as described in Example 3. For example, to enable the separation of uncapped and capped mRNA using a bioanalyzer, 1-2 μg of RNA sample from the in vitro transcription reaction was treated with DNAzyme oligonucleotide to a total volume of 16 μl. In a reaction mixture containing 5 μl of 200 mM Tris-HCl, pH 7.5, 1 μl of 10 μM DNAzyme oligonucleotide TTGAGGTTGCTAGTGAAGGCTAGCTACAACGAACAGTTGTGTCAGAAGC (SEQ ID NO: 584) and water, the RNA was trimmed from the 5' end (uncapped) to 30 nucleotide lengths, 31 nucleotide lengths (ARCA, GAG-cap (GpppAG)), and an LNA cap analog (GAG-cap modified with LNA). The mixture was preheated at 85°C for 30 seconds and then equilibrated at 37°C for 5 minutes. 4 μl of 50 mM MgCl2 was added to the mixture and incubated at 37°C for 1 hour. To stop the reaction, 2 μl of TURBO® DNAse (Thermo Fisher Scientific, catalog no. AM2238) was added and incubated at 37°C for 30 minutes. 1–2 μl of the reaction mixture was packed into a bioanalyzer tip (Agilent, San Jose, CA) using a small RNA Analysis kit (Agilent, catalog no. 5067-1548) according to the manufacturer's protocol. Uncapped mRNA molecules were each one base shorter than mRNA species successfully capped with ARCA or LNA-cap analogues. Capping efficiency was calculated as the amount of capped mRNA / total mRNA by measuring the area under the peak corresponding to the capped or uncapped species.

[0179] As shown in Figure 13, the capping efficiency of the LNA cap analog is lower than that of the ARCA cap analog and the GAG ​​cap analog.

[0180] Example 5: Transfection efficiency and expression efficiency of mRNA capped with an LNA cap analog. The transfection and expression efficiencies of LNA cap analogs were compared with those of uncapped mRNA, ARCA cap analogs, and GAG cap (CLEANCAP®) analogs. JAWSII mouse immortalized dendritic cell lines were used for analysis. Transfection was performed with either "crude" mRNA or "HPLC-purified mRNA." For "crude" mRNA, transcripts were used immediately after purification using the MEGACLEAR® RNA purification kit described in Example 3. For "HPLC-purified" mRNA, uncapped mRNA was removed by mixing 10 μg of mRNA with 20 units of RNA 5' polyphosphatase (Lucigen, catalog RP8092H) (which dephosphorylates uncapped mRNA but does not dephosphorylate capped mRNA, leaving a monophosphate 5' end) and incubating at 37°C for 1 hour. RNA transcripts were purified using the GeneJET RNA Cleanup and Concentration Micro kit (Trademark) (Thermo Fisher Scientific, catalog number K0842) according to the manufacturer's instructions. This purified mRNA was added to 2 units of XrnI (New England Biolabs, catalog number M0338S, a processable 5'->3' exoribonuclease requiring 5'-monophosphate as a substrate) and incubated at 37°C for 1 hour. The mRNA transcripts were purified using the GeneJET RNA Cleanup and Concentration Micro kit (Trademark) (Thermo Fisher Scientific, catalog number K0842) according to the manufacturer's instructions. Removal of uncapped transcripts was confirmed by performing the capping assay described in Example 4. Double-stranded RNA (dsRNA) was removed from the samples processed above using an Agilent Technologies Series 1260 Infinity HPLC with a Clarity® 5μm Oligo-RP 150x4.6mm column set to 65°C.A linear gradient of 38% to 70% Buffer B (0.1M triethylammonium acetate, pH 7.0 and 25% acetonitrile) in Buffer A (0.1M triethylammonium acetate, pH 7.0) was applied at a rate of 1 ml / min for 10 minutes. RNA was recovered from the collected fraction using the GeneJET RNA Cleanup and Concentration Micro kit. The concentration of the recovered mRNA was determined using Nanodrop, and dsRNA depletion was confirmed by dot blotting with anti-dsRNA J2 antibody. The quality of the transcript was also checked using a bioanalyzer with the RNA Nano 6000 kit.

[0181] Next, JAWS II cells were transfected with crude mRNA and HPLC-purified mRNA. Cells were cultured according to the protocol outlined by the American Tissue Cell Collection (ATCC) organization. 50,000 cells were seeded into 96-well plates until the cells reached 70–90% confluence the following day (the day of transfection). Cells were transfected using LIPOFECTAMINE® MESSENGERMAX® transfection reagent (Thermo Fisher, catalog LMRNA001). 25 ng of crude mRNA or HPLC-purified mRNA was mixed with 0.3 μL of MESSENGERMAX® transfection reagent according to the manufacturer's protocol, the mix was added to the cells, and incubated at 37°C. Twenty-four hours after transfection, the culture medium containing suspension cells was removed and added to a clean plate. Adherent cells were detached using 50 μL of TRYPLE® Express Enzyme (Thermo Fisher catalog no. 12604013). The detached cells were transferred to a plate containing suspension cells. This cell mixture was passed through an ATTUNE NxT® flow cytometer (Thermo Fisher catalog no. A29004), and the GFP fluorescence of 10,000 cells was measured for each sample. Cells were gated with raw single cells based on forward and side scattering. GFP gating was determined using GFP-free cells. Transfection efficiency was measured by determining the percentage of cells in the GFP-positive gate, and GFP expression was quantified by obtaining the median fluorescence intensity (MFI) for each sample in the GFP-positive gate. Data were analyzed using FLOWJO® software.

[0182] As shown in Figure 13, mRNA transcripts capped with LNA cap analogs showed significantly higher transfection efficiency compared to uncapped mRNA, mRNA capped with ARCA cap analogs, and mRNA capped with GAG-cap (CLEANCAP® AG) cap analogs. Furthermore, Figure 14 shows that the expression efficiency of mRNA capped with LNA cap analogs was more than four times higher than that of uncapped mRNA transcripts, mRNA transcripts capped with ARCA cap analogs, and mRNA transcripts capped with GAG-cap (CLEANCAP® AG) cap analogs.

[0183] Example 6: Fabrication of in vitro transfer molds Various in vitro transcription (IVT) templates were prepared by PCR using DNA plasmids containing wild-type (WT) T7 promoter, 5'-UTR, eGFP, and 3'-UTR sequences, using PLATINUM® SUPERFI® II Green PCR Master Mix (Thermo Fisher Scientific, catalog number 12369010). The modified T7 promoter was added by site-directed mutagenesis via forward primers (Table 4). The PCR products were purified using PURELINK® PCR Purification kit (Thermo Fisher Scientific, catalog number K310001) and diluted to 100 ng / μL in water.

[0184] In vitro transcription A 20-microliter (20 μL) IVT reaction was performed using 500 ng of DNA template, 10 μL of 2X NTP / cap mix (described below), 2 μL of 10X T7 reaction buffer, and 2 μL of T7 Enzyme Mix. The reaction buffer and enzyme mix were from the MMESSAGE MMACHINE® T7 Ultra kit (Thermo Fisher Scientific, catalog number AMB13455). The reaction mixture was incubated at 37°C for 2 hours to synthesize RNA transcripts. At the end of the reaction, 1 μL of TURBO® DNase (Thermo Fisher Scientific, catalog number AM2239) was added, and the DNA template was degraded by incubation at 37°C for 15 minutes. The RNA transcripts were purified using the MEGACLEAR® Transcription Clean-Up kit (Thermo Fisher Scientific, catalog number AM1908). The concentration of the purified RNA sample was measured using a NANODROP® spectrophotometer (Thermo Fisher Scientific, catalog number ND-2000C).

[0185] Depending on the cap used, a 2X NTP / cap mixture was prepared. The ARCA mixture with an ARCA:GTP ratio of 4:1 consisted of 3 mM GTP, 15 mM each of ATP / CTP / UTP, and 12 mM ARCA. The CLEANCAP® mixture contained 10 mM each of GTP / ATP / CTP / UTP and 10 mM of CLEANCAP® (TriLink Biotechnologies, catalog number N-7113). For tests with different CLEANCAP®:NTP ratios, the CLEANCAP® concentration was varied relative to the NTP concentration (for example, a 4:1 CLEANCAP®:NTP ratio meant that the 2X NTP / cap mixture contained 10 mM each of GTP / ATP / CTP / UTP and 40 mM of CLEANCAP®). In the reaction without a cap, a 2X NTP mixture containing 10 mM of each NTP was used.

[0186] Capping efficiency assay The 10-23 DNAzyme was designed to cleave the RNA transcript 30 nucleotides from the expected transcription start site (Cairns et al., “Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites”, Nucleic Acids Res. 31(11):2883-2889 (2003)). The DNAzyme reaction was performed in a 20 μl reaction containing 1-2 μg of RNA and 0.5 μM of DNAzyme in 50 mM Tris-HCl, pH 7.5. The reaction mixture was preheated at 85°C for 30 seconds, equilibrated at 37°C for 5 minutes, and magnesium chloride was added to 10 mM to bring the total volume to 20 μl. The reaction mixture was incubated at 37°C for 1 hour, stopped by adding 2 μL of TURBO DNase and incubating at 37°C for 30 minutes.

[0187] The DNAzyme reaction mixture was prepared for gel analysis by mixing with 2X NOVEX® TBE-Urea sample buffer (Thermo Fisher Scientific, catalog no. LC6876) and heating at 70°C for 2 minutes. The sample was loaded onto NOVEX® 15% TBE-urea gel (Thermo Fisher Scientific, catalog no. EC68855BOX) and run at 15V, 15mA for 1 hour and 40 minutes, or until the bromophenol blue dye migrated to the bottom of the gel. The gel was removed from the cassette, washed with water, and stained with SYBR® Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, catalog no. S11494) for 5–10 minutes. After a short rinse with water, the gel was visualized with UV light and images were acquired using the IBRIGHT® system (Thermo Fisher Scientific). Capping efficiency was determined using ALPHAVIEW® software (ProteinSimple), and the band intensity of fast-moving and slow-moving transfers was measured (uncapped transfers move faster because they are longer than uncapped transfers).

[0188] result The results of several experiments are shown in Figure 20 and Tables 6-8. [Table 4]

[0189] Table 4 lists the PCR forward and reverse primers used to create GFP templates with different promoter modifications. [Table 5]

[0190] Table 5 lists the modified promoters and their sequences. The base after the space in the sequence is at the natural +1 position. [Table 6]

[0191] Table 6 lists the IVT yield and capping efficiency of various modified promoters when using a 1:1 NTP-to-capping ratio. The -1 start promoter, HB-MOD2, HB-MOD4, and HB-MOD29 yield high yields and high capping efficiency. [Table 7] [Table 8]

[0192] As shown in Tables 7 and 8, the cap:NTP ratio using a modified promoter affects IVT yield and capping efficiency.

[0193] All of the following documents are incorporated herein by reference in their entirety: U.S. Patent Publication 2018 / 0318409A1, U.S. Patent Publication 2019 / 0351040, U.S. Patent Publication 2018 / 0271970, U.S. Patent Publication 2019 / 0054112, U.S. Patent Publication 2019 / 0336595, U.S. Patent Publication 2018 / 0311336, U.S. Patent Publication 2018 / 0303929, PCT Publication WO2002 / 26891, PCT Publication WO1997 / 40104, PCT Publication WO1999 / 51702, PCT Publication WO200 1 / 21624, PCT published WO1999 / 14226, PCT published WO2018 / 085449, PCT published WO2017 / 070601, PCT published WO2019 / 202035, PCT published WO2020 / 002525, PCT published WO2019 / 193183, PCT published WO2019 / 115635, PCT published WO2019 / 038332, PCT published WO2019 / 008001, PCT published WO2018 / 167320, PCT published WO2018 / 115527, PCT published WO2018 / 115525, WO2018 / 115507, PCT Public Issue WO2018 / 104538, PCT Public Issue WO2018 / 104540, U.S. Patent No. 5,132,432, U.S. Patent No. 8,039,642, U.S. Patent No. 5,227,487, U.S. Patent No. 5,442,045, U.S. Patent No. 4,603,209, U.S. Patent No. 4,849,362, U.S. Patent No. 5,696,157, U.S. Patent No. 5,459,276, U.S. Patent No. 5,501,980, U.S. Patent No. 5,830,912, U.S. Patent No. 5,798,276, U.S. Patent No. 5,846,737, U.S. Patent No. 6,562,632, U.S. Patent License No. 7,256,292, US No. 7,985,602, US No. 8,729,267, US No. 9,040,674, US No. 9,315,859, US No. 9,745,336, US No. 9,783,560, US No. 9,790,544, US No. 10,131,936, US No. 6,977,305, US No. 6,974,873, US No. 6,664,047, US No. 4,774,339, US No. 4,810,636, US No. 4,714,763, US No. 5,187,U.S. Patent No. 288, U.S. Patent No. 5,248,782, U.S. Patent No. 5,274,113, U.S. Patent No. 5,433,896, U.S. Patent No. 4,981,977, U.S. Patent No. 5,268,486, U.S. Patent No. 5,569,587, U.S. Patent No. 5,569,766, U.S. Patent No. 5,486,616, U.S. Patent No. 5,627,027, U.S. Patent No. 5,808,044, U.S. Patent No. 5,877,310, U.S. Patent No. 6,002,003, U.S. Patent No. 6,004,536, U.S. Patent No. 6,008,373, U.S. Patent No. 6,043,025, U.S. Patent No. 6,162,931, U.S. Patent No. 6,130,101, U.S. U.S. Patent Nos. 6,229,055, 6,339,392, 5,451,343, 6,716,979, 6,127,134, 6,130,094, 6,133,445, 7,446,202, 7,598,390, 7,776,529, 9,249,307, 9,751,868, 10,000,467, 10,053,447, 10,125,120, 10,351,551, 10,526,317, and RICHARD P. HAUGLAND,MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (11, th (Edition, January 2010).

Claims

1. A trinucleotide cap analog of formula (I), 【Chemistry 1】 During the ceremony, B 3 is -OH, halogen, dye, -OR 1 is selected from R 1 is selected from propargyl, tert-butyldimethylsilyl, and a methylene bridge to 4′C; B 4 is -OH, a dye, and -OR 2 is selected from R 2 is selected from propargyl and tert-butyldimethylsilyl; Or R 1 R 2 As a result, B 3 and B 4 forms -2',3'-O-isopropylidene, B 3 and B 4 cannot both be —OH, X is -H or -CH 3 is selected from B 1 and B 2 are each independently selected from adenine, guanine, cytosine, and uracil; R is selected from H, a linker-linked cell-penetrating peptide, a linker-linked cell-penetrating peptide covalently attached to a dye, and a linker-linked dye;

2. R is, (a) a linker-linked cell-penetrating peptide, wherein the cell-penetrating peptide is selected from any one of SEQ ID NOs: 1 to 583; (b) a linker-conjugated cell-penetrating peptide covalently attached to a dye, wherein the cell-penetrating peptide is selected from any of SEQ ID NOs: 1-583; and (c) a linker-linked dye.

3. B 3 But, -OR 1 And B 4 But, -OR 2 and R 1 R 2 As a result, B 3 and B 4 forms -2',3'-O-isopropylidene, X is -CH 3 and 2. The trinucleotide cap analog of claim 1, wherein R is H.

4. B 3 But, -OR 1 is selected from R 1 is selected from propargyl and tert-butyldimethylsilyl; B 4 is —OH, 2. The trinucleotide cap analog of claim 1, wherein R is H.

5. B 3 is a pigment, B 4 is —OH, 2. The trinucleotide cap analog of claim 1, wherein R is H.

6. B 3 is —OH, B 4 But, -OR 2 is selected from R 2 is selected from propargyl and tert-butyldimethylsilyl; 2. The trinucleotide cap analog of claim 1, wherein R is H.

7. B 3 is —OH, B 4 is a pigment, R is H, X is -CH 3 The trinucleotide cap analog of claim 1, wherein

8. B 3 But, -OR 1 and R 1 forms a methylene bridge with the 4′C, such that the trinucleotide cap analog has the formula (II): 【Chemistry 10】 The trinucleotide cap analog of claim 1 ,

9. R is, a. a linker-linked cell-penetrating peptide, wherein the cell-penetrating peptide is selected from any of SEQ ID NOs: 1-583; and b. The trinucleotide cap analog of claim 8, wherein the cell-penetrating peptide is selected from a linker-conjugated cell-penetrating peptide covalently attached to a dye, the cell-penetrating peptide being selected from any of SEQ ID NOs: 1-583.

10. A composition comprising a trinucleotide cap analogue according to any one of claims 1 to 9.

11. A composition comprising an RNA having a trinucleotide cap analogue according to any one of claims 1 to 9 covalently attached thereto.

12. The composition of claim 10, further comprising at least one RNA delivery agent.

13. The composition of claim 12 , wherein the at least one RNA delivery agent comprises at least one cationic lipid.

14. The composition of claim 13 , wherein the at least one RNA delivery agent further comprises at least one neutral lipid.

15. The composition of any one of claims 12 to 14, wherein the RNA delivery agent comprises one or more cell penetrating peptides.

16. The composition of claim 11, further comprising one or more of a cationic lipid, a neutral lipid, and a phospholipid.

17. The composition of any one of claims 10 to 16, further comprising a pharma- ceutically acceptable carrier.

18. 1. A method for increasing intracellular stability of RNA, comprising: A method comprising incorporating a trinucleotide cap analog of any one of claims 1 to 9 into said RNA.

19. 1. A method of making lipid nanoparticles, comprising:

11. A method comprising combining the composition of claim 10 with one or more cationic lipids, optionally one or more neutral lipids, and optionally one or more PEG-lipids, and optionally one or more cell-penetrating peptides, or any combination thereof.

20. A method for introducing RNA into a cell, comprising contacting said cell with a composition according to any one of claims 10 to 17.

21. A method for inhibiting RNA translation in a cell, comprising contacting said cell with a composition according to any one of claims 10 to 17.

22. Use of a composition according to any one of claims 10 to 17 in the preparation of a vaccine.

Images