Armed dual CAR-T compositions and methods for use in cancer immunotherapy

JP2023550148A5Pending Publication Date: 2026-03-30SIMCERE INNOVATION INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2021-11-19
Publication Date
2026-03-30

AI Technical Summary

Technical Problem

Existing cancer treatments using chimeric antigen receptor (CAR) T cells face challenges with antigenic escape mutants in solid tumors, leading to recurrence and limited T cell specific spectrum, particularly in heterogeneous and dynamic antigenic environments.

Method used

Development of bispecific CARs and T cell engagers that can bind to multiple tumor-associated antigens, enhancing T cell function and persistence through co-expression of chimeric antigen receptors and T cell engagers.

Benefits of technology

The enhanced CAR-T cells demonstrate improved efficacy in targeting and killing cancer cells by binding to multiple antigens, reducing antigen escape and increasing treatment effectiveness in solid tumors.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention discloses polynucleotides and vectors comprising sequences encoding a monospecific or bispecific CAR capable of binding to a first TAA, or a T cell engager capable of binding to CD3 and a second TAA, or a combination thereof. The present invention further discloses T lymphocytes comprising one or more of the above polynucleotides or vectors, compositions (e.g., pharmaceutical compositions) and reagent kits comprising one or more of the above T lymphocytes, methods of treating cancer in a mammalian individual (e.g., a human), and methods of T cell-mediated lysis of cancer cells (e.g., solid tumor cells).
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] This application claims priority to U.S. Provisional Application No. 63 / 116,402, filed November 20, 2020, and U.S. Provisional Application No. 63 / 243,486, filed September 13, 2021, the entire contents of which are incorporated herein by reference. Material incorporated by reference into ASCII text files

[0002] This application incorporates by reference the Sequence Listing contained in the following ASCII text file filed concurrently herewith: The file name is 58011000003SequenceListing.txt, it was created on November 19, 2021, and is 1,208,885 bytes in size.

[0003] Therapies that attack tumors by engaging the immune system are already being used effectively to combat a growing number of cancers. However, in some cancer types, particularly solid tumors such as glioblastoma (GBM), antigenic escape mutants can cause tumor recurrence after treatment with chimeric antigen receptor (CAR) T cells redirected to a single tumor-associated antigen (TAA). In the face of a heterogeneous and potentially dynamic antigenic environment, a limited T cell specificity spectrum remains a major challenge for CAR T cell therapy of solid tumors. Summary of the Invention

[0004] There is an urgent need to develop cancer treatments that increase T cell function and reduce antigen escape.

[0005] The present invention is based in part on the discovery that T lymphocytes engineered to simultaneously express a chimeric antigen receptor (CAR) (e.g., a bispecific CAR capable of binding to HER2 and IL13Rα2) and a T cell engager capable of binding to CD3 and a TAA (e.g., a tumor antigen such as a glioblastoma tumor antigen) exhibit enhanced efficacy in treating some types of cancer (e.g., tumors). Accordingly, the present invention generally relates to polynucleotides, vectors (e.g., expression vectors), fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), and reagent kits comprising the polynucleotides, that include sequences encoding one or more CARs, one or more T cell engagers, or combinations thereof, as well as methods of treating cancer in a subject using the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions, and reagent kits.

[0006] In one aspect, the present invention provides a polynucleotide comprising sequences encoding a chimeric antigen receptor (CAR) and a T cell engager, wherein the CAR is capable of binding to one or more tumor-associated antigens (TAA), and the T cell engager is capable of binding to a T cell and a second TAA.

[0007] In another embodiment, the invention provides a T cell engager capable of binding to a T cell, a first TAA epitope, and a second TAA epitope, hi another embodiment, the T cell engager is a CAR T-cell generated in situ by the interaction between a CAR and a first TAA.

[0008] In another aspect, the present invention provides a polynucleotide comprising a sequence encoding a T cell engager capable of binding to a T cell, a first TAA epitope, and a second TAA epitope.

[0009] In another aspect, the present invention provides a polynucleotide comprising an amino acid sequence having at least 90% identity to at least one amino acid sequence independently selected from the amino acid sequences set forth in SEQ ID NOs: 2 to 4, SEQ ID NOs: 11 to 13 and 52, SEQ ID NOs: 15 to 17, SEQ ID NOs: 21 to 23 and 109 to 111, SEQ ID NOs: 49 and 50, SEQ ID NOs: 53 to 70, SEQ ID NOs: 72 to 82, SEQ ID NOs: 83 to 104, SEQ ID NOs: 120 to 137, SEQ ID NOs: 139 to 149, SEQ ID NOs: 150 to 171, SEQ ID NOs: 188 to 191, SEQ ID NOs: 204 and 206 to 214, SEQ ID NOs: 215 to 221, and SEQ ID NOs: 242 to 291, or a combination thereof.

[0010] In a further aspect, the present invention provides a vector comprising one or more of the polynucleotides described herein.

[0011] In another aspect, the present invention provides a fusion protein encoded by any one of the polynucleotides or vectors described herein.

[0012] In another aspect, the present invention provides a host cell comprising one or more of the polynucleotides, vectors or fusion proteins described herein.

[0013] In another aspect, the present invention provides a T lymphocyte comprising one or more of the polynucleotides, vectors or fusion proteins described herein.

[0014] In a further aspect, the present invention provides a composition comprising one or more of the polynucleotides, vectors, fusion proteins, host cells, or T lymphocytes described herein.

[0015] In another aspect, the present invention provides a pharmaceutical composition comprising one or more of the polynucleotides, vectors, fusion proteins, host cells or T lymphocytes described herein, and a pharmaceutically acceptable vector.

[0016] In another aspect, the present invention provides a reagent kit comprising a container containing one or more compositions (e.g., pharmaceutical compositions) described herein and, optionally, instructions for use.

[0017] In another aspect, the present invention provides the use of one or more polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or reagent kits described herein in the preparation of a medicament for treating cancer in a subject in need thereof.

[0018] In other aspects, the present invention provides one or more polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or reagent kits described herein for treating cancer in a subject in need thereof. In some embodiments, the present invention provides one or more T lymphocytes, compositions, pharmaceutical compositions described herein for treating cancer in a subject in need thereof. In certain embodiments, the present invention provides one or more T lymphocytes described herein for treating cancer in a subject in need thereof.

[0019] In another aspect, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective dose of one or more T lymphocytes or compositions (e.g., pharmaceutical compositions) described herein.

[0020] In another aspect, the invention provides a T cell engager (TE or BiTE) capable of binding to a T cell, a first TAA epitope, and a second TAA epitope, wherein the T cell engager is generated in situ (e.g., released or secreted by the CAR T-cell) by the interaction between the CAR and the first TAA.

[0021] In another aspect, the present invention provides polypeptides comprising an amino acid sequence having at least 90% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 2-4, 15-17, and 242-291.

[0022] In another aspect, the present invention provides a polypeptide capable of specifically binding to glucagon-3 (GPC3), the polypeptide comprising heavy chain complementarity determining region 1 (HCDR1), heavy chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3) comprising amino acid sequences having at least 90% identity to the amino acid sequences of HCDR1, HCDR2 and HCDR3, respectively, of the heavy chain variable region (VH) amino acid sequence set forth in SEQ ID NO: 284, SEQ ID NO: 286 or SEQ ID NO: 289.

[0023] Without being bound by any theory or hypothesis, it is believed that one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, or compositions (e.g., pharmaceutical compositions) described in the present invention provide superior (and sometimes unexpected) results in killing or otherwise reducing the efficacy of cancer cells compared to other polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, or compositions (e.g., pharmaceutical compositions). Similarly, without being bound by any theory or hypothesis, it is believed that one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, or compositions (e.g., pharmaceutical compositions) described in the present invention can be used to effectively treat cancer, particularly with reduced side effects. [Brief explanation of the drawings]

[0024] This patent or patent application contains at least one color drawing. Copies of this patent or patent application disclosure with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0025] The above and other aspects of the present invention will be more clearly explained through the following detailed description and drawings, in which the same reference numerals refer to the same parts in different views. The drawings are not necessarily drawn to scale, and are intended to emphasize illustrative embodiments.

[0026] [Figure 1] FIG. 1 is a schematic diagram of a non-limiting example of a dual-CAR structure according to the present invention.

[0027] [Figure 2] The average target percentages in GBM cancer cell lines are shown. U87, U87 KO, and U373 were engineered to express luciferase and EGFP. To prepare knockout cells (U87 KO), IL13Rα2 was knocked out in U87 using CRISPR-CAS9 gene editing. Triplicate FACS analyses were performed to determine the target-positive percentage for each cell line.

[0028] [Figure 3] Figure 1 shows the results of a luciferase-based killing assay. Data are the mean of repeated measurements (N=6) collected 24 hours after treatment with CAR-T at an E / T ratio of 0.5.

[0029] [Figure 4] The results of a killing assay based on RTCA (real-time cytolytic assay) are shown. The target cancer cell line was the GBM cell line U373. Each data point is the average of three replicates (N=3). This data set represents the results of CAR-T cell treatment of three donors.

[0030] [Figure 5] Results of RTCA-based killing assays are shown. The target cancer cell line was the GBM cell line T98G. Each data point is the mean of three replicates (N=3). This dataset represents the results of CAR-T cell treatment of three donors.

[0031] [Figure 6] FIG. 1 is a schematic diagram of a non-limiting example of a T cell engager structure according to the present invention.

[0032] [Figure 7] Figure 1 shows the results of a luciferase-based killing assay. Data are the average of repeated measurements collected 24 hours after treatment with BiTE at an E / T ratio of 1 (N=6, BiTE concentration: 5 ng / mL).

[0033] [Figure 8] Figure 1 shows the results of a luciferase-based killing assay. Data are the average of repeated measurements collected 24 hours after treatment with BiTE at an E / T ratio of 0.5 (N=6, BiTE concentration: 5 ng / mL).

[0034] [Figure 9] Figure 1 shows the results of a BiTE-induced T cell activation assay based on NFAT. Data are the mean values ​​of repeated measurements collected 24 hours after BiTE / NFAT treatment (N = 3, E(NFAT) / T(T98G) = 0.5, MK, mock).

[0035] [Figure 10] FIG. 1 is a schematic diagram of a non-limiting example of a dual-CAR_BiTE structure according to the present invention.

[0036] [Figure 11] Results of a luciferase-based killing assay are shown. Data are the average of repeated measurements collected 24 hours after treatment with BiTEs at an E / T ratio of 1 (N=3, BiTE concentration: 5 ng / mL). The BiTEs used here were produced by a dual-CAR-BiTE construct in 293T cells. GFP:GFP PanT cells, PT:PanT cells, NT:SR13 BiTE only, no T cells.

[0037] [Figure 12]The results of a RTCA-based killing assay are shown. The target cancer cell line was the GBM cell line U373. Each data point represents the mean value of repeated measurements (N=6, BiTE concentration: 5 ng / mL, E / T=0.5). The BiTE used here was produced by a dual-CAR-BiTE construct in 293T cells.

[0038] [Figure 13] The results of a RTCA-based killing assay are shown. The target cancer cell line was the GBM cell line T98G. Each data point represents the mean value of repeated measurements (N=6, BiTE concentration: 5 ng / mL, E / T=0.5). The BiTE used here was produced by a dual-CAR-BiTE construct in 293T cells.

[0039] [Figure 14] Figure 1 shows the results of a luciferase-based killing assay. Data are the mean values ​​of repeated measurements (N=6) collected 24 hours after treatment. The BiTE used here was produced by a dual-CAR-BiTE construct in 293T cells.

[0040] [Figure 15] Figure 1 shows the results of a NFAT-based BiTE-induced T cell activation assay. Each data point is the average of repeated measurements collected 24 hours after BiTE / NFAT treatment (N = 3, E(NFAT) / T(T98G) = 0.5, BiTE concentration: 5 ng / mL, GFP, negative control). The BiTE used here was produced by a dual-CAR-BiTE construct in 293T cells.

[0041] [Figure 16] Figure 1 shows the results of a luciferase-based killing assay after 20 hours (n=6) of treatment of GBM cell line U87 with BiTE at an E / T ratio of 0.5. Each data point is the average of six replicates (N=6, BiTE concentrations: 50 pg / mL (produced by CART) and 5 ng / mL (produced by 293T)).

[0042] [Figure 17] Figure 1 shows the results of a BiTE-induced T cell activation assay based on NFAT. Data are the average of repeated measurements collected 24 hours after BiTE / NFAT treatment (N = 6, E(NFAT) / T(T98G) = 0.5, BiTE concentrations: 50 pg / mL (produced by CART) and 5 ng / mL (produced by 293T).

[0043] [Figure 18] Figure 1 shows the results of a luciferase-based killing assay. Data are the mean of three replicates collected 24 hours after treatment of the GBM cell line U87 with CAR-T.

[0044] [Figure 19] Figure 1 shows the results of a luciferase-based killing assay. Data are the mean of three replicates collected 48 hours after treatment of the GBM cell line U87 with CAR-T.

[0045] [Figure 20] Results of RTCA-based killing assays are shown. The target cancer cell line was the GBM cell line U87. Each data point is the mean of three replicates (N=3). This data set represents CAR-T cell-treated groups from three donors.

[0046] [Figure 21] Results of RTCA-based killing assays are shown. The target cancer cell line was the GBM cell line T98G. Each data point is the mean of three replicates (N=3). This data set represents CAR-T cell-treated groups from three donors.

[0047] [Figure 22]The results of the RTCA-based killing test are shown. The target cancer cell line was the GBM cell line U87. Each data point is the average of repeated measurements (N=6). MK, Mock, UNT, and Pan T cells.

[0048] [Figure 23] Cytokine release was measured using CAR-T cells at an E / T ratio of 0.125 (total number of CAR+ T cells: 2,500) for 48 hours. Data are the mean values ​​of repeated measurements (N=3). UN, Pan T cells.

[0049] [Figure 24] Cytokine release was measured using CAR-T cells at an E / T ratio of 0.125 (total number of CAR+ T cells: 2,500) for 48 hours. Data are the mean values ​​of repeated measurements (N=3). UN, Pan T cells.

[0050] [Figure 25] The results of a luciferase-based serial killing assay are shown. Each data point is the average of repeated measurements collected 24 hours after treatment of GBM cell line U87 with CAR-T (N=18). In five serial killing experiments, the expanded CAR-T cells were diluted to the corresponding E / T ratio concentration.

[0051] [Figure 26] This figure shows the results of measuring T cell proliferation during CAR-T serial killing. Each data is the average value of repeated measurements collected 24 hours after treatment of GBM cell line U87 with CAR-T (N=18). In five consecutive killing experiments, the expanded CAR-T cells were diluted to the corresponding E / T ratio concentration. SK: serial killing.

[0052] [Figure 27]Figure 1 shows the results of an RTCA-based killing study targeting the GBM cell line U87 at an extremely low E / T ratio (E:T = 1:16) (N = 3). Compared to SR25 (single-arm BiTE CAR-T cells), SR27 (control CD19 BiTE CAR-T cells), and SR9 (dual-arm CAR-T cells), SR26 (dual-arm BiTE CAR-T cells) exhibits sustained cytolytic activity.

[0053] [Figure 28] Results of a serial killing study targeting the GBM cell line U87 at a low E / T ratio (E:T = 1:1) and an extremely low concentration ([BiTE] = 0.2 ng / mL) (N = 3) are shown. Compared to SR25, SR26 demonstrated a balance between continuous cytolytic activity and T cell persistence.

[0054] [Figure 29] Figure 1 shows FACS results characterizing tumor-associated antigens (TAA) expressed on the cell surface in the GFP- and luciferase-expressing GBM cell line U87. Anti-human EGFR, anti-Her2, and anti-IL13R2a antibody clones were used to detect EGFR, HER2, and IL13R2a.

[0055] [Figure 30] Results of an RTCA-based killing assay targeting the GBM cell line U251 at an extremely low E / T ratio (E:T = 1:16) (N = 6) are shown. Compared to SR24 and SR25, SR26 demonstrated continuous cytolytic activity.

[0056] [Figure 31A-B] Figure 1 shows FACS results characterizing cell surface expressed TAAs in the GFP- and luciferase-expressing GBM cell line U251. Anti-human EGFR, anti-Her2, and anti-IL13R2a clones are used to detect EGFR, HER2, and IL13R2a.

[0057] [Figure 32]Results of RTCA-based killing assays at a low E / T ratio (E:T = 1:8) (N = 3) are shown. The target cells were the HER2-positive breast cancer cell line A431. Compared with SR24, SR25 (single-arm BiTE CAR-T cells), and SR27 (CAR-T cells), SR26 (dual-arm BiTE CAR-T cells) demonstrated continuous cytolytic activity.

[0058] [Figure 33] 1 shows the expression levels of EGFR, HER2, and IL13Rα2 in the HER2-positive breast cancer cell line A431.

[0059] [Figure 34] Results of RTCA-based killing assays at a low E / T ratio (E:T = 1:8) (N = 3) are shown. The target cells were the HER2-positive breast cancer cell line MCF-7. Compared with SR24, SR25 (single-arm BiTE CAR-T cells), and SR27 (CAR-T cells), SR26 (dual-arm BiTE CAR-T cells) showed superior sequential cytolytic activity.

[0060] [Figure 35] 1 shows the expression levels of EGFR, HER2, and IL13Rα2 in the HER2-positive breast cancer cell line MCF-7.

[0061] [Figure 36] Figure 1 shows the results of an RTCA-based killing assay at a low E / T ratio (E:T = 1:8) (N = 3). The target cells were NSCLC cell lines (H-1944). Compared with SR24, SR25 (single-arm BiTE CAR-T cells), and SR27 (CAR-T cells), SR26 (dual-arm BiTE CAR-T cells) showed superior continuous cytolytic activity.

[0062] [Figure 37] 1 shows the expression levels of EGFR, HER2, and IL13Rα2 in the NSCLC cell line H1944.

[0063] [Figure 38] Figure 1 shows the results of an RTCA-based killing assay at a low E / T ratio (E:T = 1:4) (N = 3). The target cells were NSCLC cell lines (H-1915). Compared with SR24, SR25 (single-arm BiTE CAR-T cells), and SR27 (CAR-T cells), SR26 (dual-arm BiTE CAR-T cells) showed superior sequential cytolytic activity.

[0064] [Figure 39] 1 shows the expression levels of EGFR, HER2, and IL13Rα2 in the brain metastatic NSCLC cell line H1915.

[0065] [Figure 40A-C] The therapeutic effect of SR26 in the U87 cell line is shown. U87 is one of the most aggressive GBM models. Figure 40A: BLI results at key time points are shown. D_-1: 1 day before treatment, D_n: n days after treatment. Xenograft: 10,000 luciferase-labeled U87 cells are injected into the right forebrain. Treatment: 1, 200,000 CAR+ T cells are injected 4 days after tumor xenograft. Figure 40B: Results of BLI irradiation on individual mice are shown. Figure 40C: Survival rate is shown.

[0066] [Figure 41] The working process of the PK / distribution study of SR26 (dual-arm BiTE CAR-T cells) is shown, and the relevant abbreviations are as follows: H: heart, L: liver, Spl: spleen, Lu: lung, K: kidney, Br: brain, Spi: spinal cord, Bm: bone marrow, Bl: blood.

[0067] [Figure 42]PK / distribution are shown. Both the CAR and BiTE genes were detected only in the brain, but not in the genomic DNA of the heart, liver, spleen, lungs, kidneys, bone marrow, spinal cord, or blood, indicating that the infused CAR-T cells were brain-restricted. The CAR-T cells infiltrated into brain tissue, and due to the lack of stimulation from relevant tumor antigens, the infiltrated CAR-T cells gradually lost vitality or returned to a quiescent state in the GBM-deficient mice. M1: Mouse #1, M2: Mouse #2, M3: Mouse #3.

[0068] [Figure 43] The arrangements and working process of the toxicology study are shown, and the relevant abbreviations are as follows: H: heart, L: liver, Spl: spleen, Lu: lung, K: kidney, Br: brain, Spi: spinal cord, Bm: bone marrow, Bl: blood, UNT: untreated.

[0069] [Figure 44A-B] The therapeutic effect of SR26 in the U87 cell line is shown. U87 is one of the most aggressive GBM models. Figure 44A: BLI results at key time points are shown. Relevant abbreviations: D_-1: day 1 before treatment, D_n: day n after treatment. Figure 44B: BLI results for individual mice (top panel) and average total irradiation dose (bottom panel) are shown.

[0070] [Figure 45] Toxicology study results are summarized below: SR26 effectively eradicates GBM tumors, and no abnormal reactions are observed in SR26-treated mice in both acute (day 2) and chronic (day 14) studies.

[0071] [Figure 46] FIG. 1 is a schematic diagram of non-limiting examples of HER2 CARs.

[0072] [Figure 47] Schematic of non-limiting examples of single-arm VHH_EGFR_BiTEs (top) and dual-arm VHH_EGFR_BiTEs binding to IL13Rα2 CAR (bottom).

[0073] [Figure 48] FIG. 1 is a schematic diagram of a non-limiting example of dual-arm EGFR_BiTE armed dual CAR-Ts.

[0074] [Figure 49] Results of the RTCA-based killing assay are shown. Two rounds of CAR-T functional screening identified six core anti-HER2 VHH nanobody clones (SR72, SR78-SR80, SR82, and SR87) from 39 in-house developed candidate molecules. Each data point represents the average of three parallel experiments repeated in the second RTCA assay. Here, E / T=1 / 2, pan T cells were derived from healthy receptor 2, and SR9, a dual CAR-T targeting HER2 and IL13Rα2, served as a positive control. IL13Rα2 was positive in both U87 (45%) and U373 (42%).

[0075] [Figure 50] Cytokine release quantification results are shown. After screening with two CAR-T killing assays, the core anti-HER2 VHH nanobody clones were further validated by quantifying cytokine release. Each data point is the average of six parallel replicates of CAR-T-treated GBM cancer cell line U373, where E / T=1 / 8 and pan T cells were derived from healthy donor 2. The core clones were further restricted to SR72, SR78, SR79, and SR82, which combine cytolytic activity with the ability to induce cytokine release.

[0076] [Figure 51]The results of RTCA-based killing assays are shown to further validate the anti-HER2 VHH nanobody core clones (SR72, SR78-SR80, SR82, and SR87). The breast cancer cell line MCF-7, which has relatively low HER2 expression, was used as the target cell. Each data point represents the average of three parallel replicates measured by RTCA. Here, E / T=1 / 8, pan T cells were derived from healthy donor 2, and SRI15, a trastuzumab scFv CAR-T, served as the control.

[0077] [Fig. 52A-D] The specificity of the anti-HER2 VHH nanobody clones in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified anti-HER2 VHH nanobody core clones (SR72, SR78-SR80, SR82, and SR87), both wild-type and HER2 knockout GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are from the first study. The HER2 antibody is a commercially available primary antibody labeled with PE and used as a control.

[0078] [Fig. 53A-D] The specificity of the anti-HER2 VHH nanobody clones in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified anti-HER2 VHH nanobody core clones (SR72, SR78-SR80, SR82, and SR87), both wild-type and HER2 knockout GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are the results of a second study. The HER2 antibody is a commercially available primary antibody labeled with PE and used as a control.

[0079] [Fig. 54-D]The specificity of the anti-HER2 VHH nanobody clones in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified anti-HER2 VHH nanobody core clones (SR72, SR78-SR80, SR82, and SR87), both wild-type and HER2 knockout GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are the results of a third study. The HER2 antibody is a commercially available primary antibody labeled with PE and used as a control.

[0080] [Figure 55] Figures 52A-54E summarize the study results of the anti-HER2 VHH nanobody core clones (SR72, SR78-SR80, SR82 and SR87), with the relevant abbreviations as follows: WT: wild-type GBM cancer cell line U373, KO: HER2 knockout U373 cell line.

[0081] [Figure 56] This is a summary of the KD values ​​of the anti-HER2 VHH nanobody core clones SR72, SR78 to SR80, SR82, and SR87.

[0082] [Figure 57] The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR142 is a preferred tandem HER2 VHH CAR-T clone. Compared with these tandem CAR-T cells, the single VHH HER2 CAR-T SR82 still has potent killing activity. The target cells were the breast cancer cell line MCF-7, which has relatively low HER2 expression. Each data point is the average of four parallel replicates measured by RTCA. Here, E / T=1 / 8, and pan T cells were derived from healthy donor 2.

[0083] [Figure 58]The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR141 and SR142 are preferred tandem HER2 VHH CAR-T clones. Compared with these tandem CAR-T cells, the single VHH HER2 CAR-T SR82 still has potent killing activity. GBM cell line U373 was used as the target cell. Each data point is the average of four parallel replicates measured by RTCA. Here, E / T=1 / 8, and pan T cells were derived from healthy donor 2.

[0084] [Figure 59] The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR147 is a core clone of tandem HER2 VHH CAR-T. The target cells are the breast cancer cell line A431. Each data point is the average of six parallel replicates measured by RTCA. Here, E / T=1 / 8, and pan T cells are derived from healthy donor 2.

[0085] [Figure 60] The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR147 is a core clone of tandem HER2 VHH CAR-T. The target cells are the breast cancer cell line BT474. Each data point is the average of six parallel replicates measured by RTCA. Here, E / T=1 / 8, and pan T cells are derived from healthy donor 2.

[0086] [Figure 61] The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR147 is a core clone of tandem HER2 VHH CAR-T. NSCLC cell line H1944 is used as the target cell. Each data point is the average of six parallel replicates measured by RTCA. Here, E / T=1 / 16, and pan T cells are derived from healthy donor 2.

[0087] [Figure 62] The results of RTCA-based killing assays are shown. RTCA-based CAR-T killing assays demonstrate that SR147 is a core clone of tandem HER2 VHH CAR-T. The GBM cell line U251 is used as the target cell. Each data point is the average of six parallel replicates measured by RTCA. Here, E / T=1 / 16, and pan T cells are derived from healthy donor 2.

[0088] [Figure 63] Results of RTCA-based killing assays are shown. After two rounds of BiTE functionalization screening, two core anti-EGFR (wt and VIII) VHH nanoclones (SR56 and SR59) were identified from 44 in-house developed candidate molecules. Each data point represents the average of three parallel experiments repeated in the second RTCA assay. Here, E / T=1 / 2, pan T cells are derived from healthy receptor 2 T cells, SR26 and the dual-arm anti-EGFR BiTE serve as positive controls, SR27 and the anti-CD19 BiTE serve as negative controls, and IL13Rα2 is positive in both U87 (45%) and U373 (42%).

[0089] [Figure 64] Figure 1 shows the results of RTCA-based cell proliferation index measurements. The cell proliferation index of the wild-type GBM cell line U373 (U373_WT) is comparable to that of EGFR knockout U373 (U373_EGFR KO) cells.

[0090] [Figure 65]RTCA-based killing assay results. To verify the specificity of two core anti-EGFR (wt and VIII) VHH nanoclones, SR56 and SR59, RTCA-based BiTE-mediated killing assays were performed. Each data point represents the average of six parallel replicates measured by RTCA. Here, E / T = 1 / 1, pan T cells were derived from healthy donor 2, SR26 and the dual-arm anti-EGFR BiTE served as positive controls, anti-CD19 BiTE served as negative controls, and SR116 was a dual-EGFR BiTE. The BiTE concentration was 1 ng / mL and was produced by 293T cells.

[0091] [Figure 66] The specificity of anti-EGFR VHH nanocloning in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified EGFR VHH nanoantibody core clones (SR56, SR59 7D12, and 38G7), both wild-type and HER2 KO GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are from the first study. The EGFR Ab antibody is a commercially available primary antibody labeled with PE and used as a control.

[0092] [Figure 67] The specificity of anti-EGFR VHH nanocloning in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified EGFR VHH nanoantibody core clones (SR56, SR59 7D12, and 38G7), both wild-type and HER2 KO GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are the results of a second study. The EGFR Ab antibody is a commercially available primary antibody labeled with PE and used as a control.

[0093] [Figure 68]The specificity of anti-EGFR VHH nanocloning in the GBM cell line U373 is demonstrated. To further validate the specificity of the identified EGFR VHH nanoantibody core clones (SR56, SR59 7D12, and 38G7), both wild-type and HER2 KO GBM cancer cell lines U373 are used in parallel flow staining analysis. The above data are the results of a third study. The EGFR Ab antibody is a commercially available primary antibody labeled with PE and used as a control.

[0094] [Figure 69] Figures 66A-68E summarize the research results of the anti-EGFR VHH nanobody core clones (SR56, SR59-80, 7D12, and 38G7), and the relevant abbreviations are as follows: WT: wild-type GBM cancer cell line U373; KO: EGFR knockout U373 cell line.

[0095] [Figure 70] This shows a summary of the KD values ​​of the anti-EGFR VHH nanoantibody core clones SR56, SR59-80, 7D12, and 38G7.

[0096] [Figure 71] The results of RTCA-based killing assays are shown. RTCA-based killing assays are performed to identify core EGFR VHH dual-arm BiTE clones from suitable EGFR_BiTE candidate molecules. Each data point represents the average of six parallel replicates. The target cells are the GBM cancer cell line U87 (EGFR+:>92%), where E / T=1 / 8, and pan T cells are derived from healthy donor 2.

[0097] [Figure 72] FIG. 1 is a schematic diagram of a non-limiting example of a dual-arm EGFR_BiTE with HER2 VHH CAR-Ts.

[0098] [Figure 73] FIG. 1 is a schematic diagram of non-limiting examples of EGFR CARs.

[0099] [Figure 74] FIG. 1 is a schematic diagram of a non-limiting example of a dual-arm EGFR_BiTE with EGFR VHH CAR-Ts.

[0100] [Figure 75] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays are performed to identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells are GBM cancer cell line U87, where E / T=1 / 4, and pan T cells are derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T serve as controls.

[0101] [Figure 76] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays are performed to identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells are breast cancer cell line BT474, where E / T=1 / 4, and pan T cells are derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T serve as controls.

[0102] [Figure 77] Figure 1 shows the results of RTCA-based killing assay. RTCA-based killing assays are performed to identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells are NSCLC cell line H1944, where E / T=1 / 8, and pan T cells are derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T are used as controls.

[0103] [Figure 78]Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays are performed to identify core EGFR VHH tandem CAR-T clones from preferred EGFR VHH CAR-T candidate molecules. Each data point represents the average of three parallel replicates. The target cells are NSCLC cell line H1944, where E / T=1 / 8, and pan T cells are derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T are used as controls.

[0104] [Figure 79] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays were performed to identify core dual-arm EGFR_BiTE armed EGFR VHH tandem CAR-T clones from preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells were brain metastatic NSCLC cell line H1915, where E / T=1 / 2, and pan T cells were derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T served as controls.

[0105] [Figure 80] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays were performed to identify core dual-arm EGFR_BiTE armed EGFR VHH tandem CAR-T clones from preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells were brain metastatic NSCLC cell line H1915, where E / T=1 / 4, and pan T cells were derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T served as controls.

[0106] [Figure 81]Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays were performed to identify core dual-arm EGFR_BiTE armed EGFR VHH tandem CAR-T clones from preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells were brain metastatic NSCLC cell line H1915, where E / T=1 / 8, and pan T cells were derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T served as controls.

[0107] [Figure 82] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays were performed to identify core dual-arm EGFR_BiTE armed EGFR VHH tandem CAR-T clones from preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells were brain metastatic NSCLC cell line H1915, where E / T=1 / 16, and pan T cells were derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T served as controls.

[0108] [Figure 83] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays were performed to identify core dual-arm EGFR_BiTE armed EGFR VHH tandem CAR-T clones from preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecules. Each data point represents the average of six parallel replicates. The target cells were brain metastatic NSCLC cell line H1915, where E / T=1 / 32, and pan T cells were derived from healthy donor 2. SR126 and cetuximab_scFv-EGFR CAR-T served as controls.

[0109] [Figure 84] FIG. 1 is a schematic diagram of non-limiting examples of GPC-3 CARs.

[0110] [Figure 85] FIG. 1 is a schematic diagram of a non-limiting example of dual-arm GPC-3_BiTE armed GPC-3 CAR-Ts.

[0111] [Figure 86] The results of RTCA-based killing assays are shown. To identify suitable GPC-3 VHH CAR-T clones from the in-house developed GPC-3 nanobody candidate molecules, RTCA-based killing assays were conducted. Each data point represents the average of three parallel replicates. The target cells were the HCC cancer cell line Huh-7, where E / T=1 / 1, and pan T cells were derived from healthy donor 3. SRHC-4, GPC-3 GC-33_scFv CAR-T, and SRHCC-2, GPC-3 VHH CAR-T served as controls.

[0112] [Figure 87] The results of RTCA-based killing assays are shown. To identify suitable GPC-3 VHH CAR-T clones from the in-house developed GPC-3 nanobody candidate molecules, RTCA-based killing assays were conducted. Each data point represents the average of three parallel replicates. The target cells were the HCC cancer cell line Huh-7, where E / T=1 / 1, and pan T cells were derived from healthy donor 3. SRHC-4, GPC-3 GC-33_scFv CAR-T, VHH72-YP7 CAR-T, and SRHCC-2, GPC-3 VHH CAR-T served as controls.

[0113] [Figure 88]The results of RTCA-based killing assays are shown. To identify suitable GPC-3 VHH CAR-T clones from the in-house developed GPC-3 nanobody candidate molecules, RTCA-based killing assays were conducted. Each data point represents the average of six parallel replicates. The target cells were the HCC cancer cell line Hep3B, where E / T=1 / 2, and pan T cells were derived from healthy donor 3. SRHC-4, GPC-3 GC-33_scFv CAR-T, and SRHCC-2, GPC-3 VHH CAR-T served as controls.

[0114] [Figure 89] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays are performed to identify core dual-arm GPC-3 BiTE armed GPC-3 VHH tandem CAR-T clones from preferred GPC-3 BiTE armed GPC-3 VHH CAR-T candidate molecules. Each data point represents the average of four parallel replicates. The target cells are the HCC cancer cell line HepG2, where E / T=1 / 4, and pan T cells are derived from a healthy donor.

[0115] [Figure 90] Figure 1 shows the results of RTCA-based killing assays. RTCA-based killing assays are performed to identify core dual-arm GPC-3 BiTE armed GPC-3 VHH tandem CAR-T clones from preferred GPC-3 BiTE armed GPC-3 VHH CAR-T candidate molecules. Each data point represents the average of four parallel replicates. The target cells are the HCC cancer cell line Hep3B, where E / T=1 / 4, and pan T cells are derived from a healthy donor.

[0116] [Figure 91]The results of RTCA-based killing assays are shown. To further validate the function of the core dual-arm GPC-3 BiTE (SRHC-8_GPC3 BiTE _S1~101), RTCA-based killing assays were performed. Each data point represents the average of 12 parallel replicates. The target cells were the HCC cancer cell line Hep3B, where E / T = 1 / 1, the BiTE concentration was 4 ng / mL, and pan T cells were derived from a healthy donor.

[0117] [Figure 92] The results of RTCA-based killing assays are shown. To further validate the function of the core dual-arm GPC-3 BiTE (SRHC-8_GPC3 BiTE _S1~101), RTCA-based killing assays were performed. Each data point represents the average of 12 parallel replicates. The target cells were the HCC cancer cell line HepG2, where E / T was 1 / 1, the BiTE concentration was 4 ng / mL, and pan T cells were derived from a healthy donor.

[0118] [Figure 93] The results of NFAT cell-based luciferase assays are shown. To verify the ability of the core dual-arm GPC-3 BiTE (SRHC-8_GPC3 BiTE _S1-101) to induce T cell activation, NFAT cell-based luciferase assays were performed. Each data point represents the average of six parallel replicates. The target cells were the HCC cancer cell line Hep3B, where E / T was 1 / 1 and the BiTE concentration was 4 ng / mL.

[0119] [Figure 94] The results of NFAT cell-based luciferase assays are shown. To verify the ability of the core dual-arm GPC-3 BiTE (SRHC-8_GPC3 BiTE _S1-101) to induce T cell activation, NFAT cell-based luciferase assays were performed. Each data point represents the average of six parallel replicates. The target cells were the HCC cancer cell line HepG2, where E / T was 1 / 1 and the BiTE concentration was 4 ng / mL.

[0120] [Figure 95] The results of an NFAT cell-based luciferase assay are shown. To verify the ability of the core dual-arm GPC-3 BiTE (SRHC-8_GPC3 BiTE _S1-101) to induce T cell activation, an NFAT cell-based luciferase assay was performed. Each data point represents the average of six parallel replicates. The target cells were the HCC cancer cell line SK-Hep1, which is GPC-3-negative but EGFR-positive, with an E / T ratio of 1 / 1 and a BiTE concentration of 4 ng / mL.

[0121] [Figure 96] RTCA-based killing test results. RTCA-based killing tests were conducted to identify suitable GPC-3 VHH CAR-T clones from our in-house developed GPC-3 nanobody candidate molecules. Data are the average of four parallel replicates. The target cells were HCC cancer cell line Huh-7, where E / T=1 / 1, and pan T cells were derived from healthy donor 3. SRHC-4 and GPC-3 GC-33_scFv CAR-T served as controls. DETAILED DESCRIPTION OF THE INVENTION

[0122] Detailed Description The description of the embodiment is as follows.

[0123] Polynucleotides according to the invention Polynucleotides encoding CARs and T cell engagers (TEs or BiTEs) In one aspect, the present invention provides a polynucleotide comprising sequences encoding a chimeric antigen receptor (CAR) and a T cell engager (TE or BiTE), wherein the CAR is capable of binding to one or more first TAAs, and the T cell engager (TE or BiTE) is capable of binding to a T cell and a second TAAs. In some embodiments, the T cell engager is capable of binding to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager is capable of binding to CD2, CD3, CD31, or CD277. In certain embodiments, the T cell engager is capable of binding to CD3.

[0124] In some embodiments, the polynucleotide comprises deoxyribonucleic acid. In certain embodiments, the polynucleotide comprises ribonucleic acid. Non-limiting examples of polynucleotides include single-stranded, double-stranded, or multi-stranded DNA or RNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide may comprise sugar and phosphate groups, modified or substituted sugars or phosphate groups, polymers of synthetic subunits such as phosphoramidates, or combinations thereof.

[0125] In some embodiments, the polynucleotide is isolated (e.g., synthesized or produced by molecular cloning). In some embodiments, the polynucleotide is integrated into the genomic DNA of a host cell (e.g., a T lymphocyte). In some embodiments, the polynucleotide is extrachromosomal (e.g., on a plasmid or viral vector) within the host cell. In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is RNA. The polynucleotide can be inserted into a vector, such as a plasmid or a viral vector (e.g., a lentiviral vector). The polynucleotide may also include one or more modified nucleotides (e.g., one or more chemically modified nucleotides).

[0126] In some embodiments, the CAR is monospecific. In other embodiments, the CAR is bispecific. In some embodiments, the CAR can bind to two epitopes of the first TAA. In certain embodiments, the CAR can bind to two first TAAs.

[0127] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in hematological cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both, are expressed in hematological cancer cells selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma cells.

[0128] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in cells of a solid tumor (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, or skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in cells of a solid tumor selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.

[0129] In some embodiments, the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer. In some embodiments, the brain tumor is a glioblastoma (GBM). In certain embodiments, the GBM is primary glioblastoma multiforme. In certain embodiments, the GBM is recurrent glioblastoma multiforme. In some embodiments, the brain tumor is a metastatic brain tumor. In certain embodiments, the metastatic brain tumor is non-small cell lung cancer brain metastasis (NSCLCBM), small cell lung cancer brain metastasis (SCLCBM), HER2-positive metastatic breast cancer, or triple-negative metastatic breast cancer brain metastasis (TNBCBM). In some embodiments, the liver cancer is hepatocellular carcinoma (HCC).

[0130] In some embodiments, the one or more first TAAs are selected from the group consisting of colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphoma antigen APO-1, cancer antigen B1, B7H3, β-catenin, blood group ALeb / Ley, Burkitt's lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD4 6, CD52, CD79a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (Leb blood group), CO-514 (Lea blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T-cell antigen Gp37, melanoma antigen gp75, gpA33, HER2 antigen (e.g., pi85 HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, high molecular weight melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS 1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, p15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acidophilic phosphatase (PAH) The peptides are each independently selected from phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA-4, sTn, T cell receptor-derived peptide, T5A7, TAG-72, TL5 (blood type A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood type H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, and Y hapten, Ley.

[0131] In some embodiments, the one or more first TAAs are independently selected from interleukin-13 receptor alpha 2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor 2 (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC3), or a combination thereof.

[0132] In some embodiments, the CAR comprises a mutein, a single-chain variable fragment (scFv), a nanobody, or a combination thereof, hi certain embodiments, the CAR comprises a mutein and an scFv, two nanobodies, a mutein and two nanobodies, or an scFv and a nanobody.

[0133] In some embodiments, the CAR comprises: IL13 mutant proteins, HER2-binding scFv, IL13 muteins and HER2-binding scFvs, HER2-binding nanoantibodies, two HER2-binding nanobodies, IL13 mutein and two HER2-binding nanobodies, EGFR-binding scFv, EGFRvIII-binding scFv, EGFR-binding nanoantibodies, EGFRvIII-binding nanoantibodies, two EGFR or EGFRvIII-binding nanobodies, GPC3-binding nanoantibodies, or Includes GPC3-binding nanobodies and GPC3-binding scFvs.

[0134] In one embodiment, the CAR is the IL13 mutein, comprising an amino acid sequence having at least 60% identity with the amino acid sequence set forth in SEQ ID NO: 1; the HER2-binding scFv, which comprises an amino acid sequence having at least 60% identity with at least one of the amino acid sequences shown in SEQ ID NOs: 2 to 4; a HER2-binding Nanobody as defined above, comprising an amino acid sequence having at least 60% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 242 to 259; an EGFR-binding Nanobody as defined above, comprising an amino acid sequence having at least 60% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281; an EGFRvIII-binding Nanobody as defined above, comprising an amino acid sequence having at least 60% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281; or the GPC3-binding Nanobody as defined above, comprising an amino acid sequence having at least 60% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291; or a combination thereof.

[0135] For example, the sequence identity may be at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%.

[0136] In certain embodiments, the IL13 mutein comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 1; the HER2-binding scFv comprises an amino acid sequence having at least 90% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 2 to 4; the HER2-binding Nanobody comprises an amino acid sequence having at least 90% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 242 to 259, the EGFR-binding Nanobody comprises an amino acid sequence having at least 90% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281, said EGFRvIII-binding Nanobody comprises an amino acid sequence having at least 90% identity with at least one of the amino acid sequences set out in SEQ ID NOs: 15 to 17 and 260 to 281; or the GPC3-binding Nanobody comprises an amino acid sequence having at least 90% identity with at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291; Or a combination thereof.

[0137] In some embodiments, The IL13 mutein comprises at least one amino acid substitution with respect to the amino acid sequence set forth in SEQ ID NO: 1; The HER2-binding scFv comprises at least one amino acid substitution in at least one of the amino acid sequences shown in SEQ ID NOs: 2 to 4, the HER2-binding Nanobody comprises at least one amino acid substitution in at least one of the amino acid sequences set forth in SEQ ID NOs: 242 to 259, the EGFR-binding Nanobody comprises at least one amino acid substitution in at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281, said EGFRvIII-binding Nanobody comprises at least one amino acid substitution relative to at least one of the amino acid sequences set out in SEQ ID NOs: 15 to 17 and 260 to 281; or the GPC3-binding Nanobody comprises at least one amino acid substitution in at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291; Or a combination thereof.

[0138] The amino acid substitutions described in the CARs or T cell engagers (TEs or BiTEs) of the invention can be substitutions with typical amino acids or atypical amino acids, including but not limited to D-amino acids, such as the D-forms of typical L-amino acids.

[0139] In some embodiments, the amino acid substitutions include at least one conservative substitution.

[0140] In some embodiments, the amino acid substitutions include at least one highly conservative substitution.

[0141] In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 45 amino acid substitutions, e.g., about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12. In certain embodiments, the at least one amino acid substitution is about 1 to 25 amino acid substitutions, e.g., about 1 to 22, 2 to 22, 2 to 20, 3 to 20, 3 to 18, 4 to 18, 4 to 16, 5 to 16, 5 to 14, 6 to 14, 6 to 12, 7 to 12, 7 to 10, or 8 to 10 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1 to 12 amino acid substitutions, for example, about 1 to 11, 2 to 11, 2 to 10, 3 to 10, 3 to 9, 4 to 9, 4 to 8, 5 to 8, 5 to 7, or 6 to 7 amino acid substitutions.

[0142] In one embodiment, the IL13 mutein comprises approximately 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1; the HER2-binding scFv comprises approximately 1 to 25 amino acid substitutions in at least one of the amino acid sequences set forth in SEQ ID NOs: 2 to 4; the HER2-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 242 to 259; the EGFR-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281, the EGFRvIII-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281; or the GPC3-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291; Or a combination thereof.

[0143] In certain embodiments, The IL13 mutein comprises the amino acid sequence set forth in SEQ ID NO: 1, The HER2-binding scFv comprises an amino acid sequence shown in any one of SEQ ID NOs: 2 to 4, the HER2-binding Nanobody comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 242 to 259; the EGFR-binding Nanobody comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 15 to 17 and 260 to 281; said EGFRvIII-binding Nanobody comprising the amino acid sequence set out in any one of SEQ ID NOs: 15 to 17 and 260 to 281; or the GPC3-binding Nanobody comprises the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291;

[0144] Or a combination thereof. In some embodiments, the CAR (e.g., bispecific CAR) further comprises a linker, a CD8α signal peptide, a CD8α hinge, a CD28 transmembrane domain, a 4-1BB costimulatory domain, or a CD3ζ signal domain, or a combination thereof. In some embodiments, the bispecific CAR further comprises a CD8α signal peptide, a CD8α hinge, a CD28 transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signal domain.

[0145] In some embodiments, the linker comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:5. In some embodiments, the CD8α signal peptide comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the CD8α hinge comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the CD28 transmembrane domain comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the CD3ζ signal domain comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 10.

[0146] In one embodiment, the linker comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 5. In one embodiment, the CD8α signal peptide comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 6. In one embodiment, the CD8α hinge comprises about one to five amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 7. In one embodiment, the CD28 transmembrane domain comprises about one to three amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 8. In one embodiment, the 4-1BB costimulatory domain comprises about one to five amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 9. In one embodiment, the CD3ζ signal domain comprises about one to twelve amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 10.

[0147] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 5. In certain embodiments, the CD8α signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 6. In certain embodiments, the CD8α hinge comprises the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the CD28 transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8. In certain embodiments, the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the CD3ζ signal domain comprises the amino acid sequence set forth in SEQ ID NO: 10.

[0148] In some embodiments, the second TAA is IL13Rα2, HER2, EGFR, EGFRvIII, or GPC3.

[0149] In certain embodiments, the T cell engager (TE or BiTE) comprises an scFv, a nanobody, or a combination thereof.

[0150] In certain embodiments, the T cell engager (TE or BiTE) comprises a CD3-binding scFv. In certain embodiments, the T cell engager (TE or BiTE) comprises an epidermal growth factor receptor (EGFR)-binding scFv. In certain embodiments, the T cell engager (TE or BiTE) comprises an EGFR-binding Nanobody. In certain embodiments, the T cell engager (TE or BiTE) comprises two EGFR-binding Nanobodies. In certain embodiments, the T cell engager (TE or BiTE) comprises two EGFR-binding Nanobodies. In certain embodiments, the T cell engager (TE or BiTE) comprises two glucagon-3 (GPC3)-binding Nanobodies.

[0151] In some embodiments, the EGFR or EGFRvIII-binding Nanobody comprises an amino acid sequence that has at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the GPC3-binding Nanobody comprises an amino acid sequence that has at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291.

[0152] Illustratively, the sequence identity may be at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is approximately 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%.

[0153] In certain embodiments, the EGFR or EGFRvIII-binding Nanobody comprises an amino acid sequence that has at least 90% (e.g. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the GPC3-binding Nanobody comprises an amino acid sequence that has at least 90% (e.g. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291.

[0154] In some embodiments, the EGFR-binding Nanobody comprises at least one amino acid substitution with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the EGFRvIII-binding Nanobody comprises at least one amino acid substitution with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the GPC3-binding Nanobody comprises at least one amino acid substitution with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 282 to 291.

[0155] In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 45 amino acid substitutions, e.g., about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12. In certain embodiments, the at least one amino acid substitution is about 1 to 25 amino acid substitutions, e.g., about 1 to 22, 2 to 22, 2 to 20, 3 to 20, 3 to 18, 4 to 18, 4 to 16, 5 to 16, 5 to 14, 6 to 14, 6 to 12, 7 to 12, 7 to 10, or 8 to 10 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1 to 12 amino acid substitutions, for example, about 1 to 11, 2 to 11, 2 to 10, 3 to 10, 3 to 9, 4 to 9, 4 to 8, 5 to 8, 5 to 7, or 6 to 7 amino acid substitutions.

[0156] In some embodiments, the EGFR-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set out in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the EGFRvIII-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set out in SEQ ID NOs: 15 to 17 and 260 to 281. In some embodiments, the GPC3-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to at least one of the amino acid sequences set out in SEQ ID NOs: 282 to 291.

[0157] In certain embodiments, said EGFR or EGFRvIII-binding Nanobody comprises the amino acid sequence set forth in any one of SEQ ID NOs: 15 to 17 and 260 to 281. In certain embodiments, said GPC3-binding Nanobody comprises the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291.

[0158] In some embodiments, the T cell engager (TE or BiTE) comprises a signal peptide. In certain embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO:19.

[0159] In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 21-27, 109-111, 176-178, and 292. Illustratively, the sequence identity may be at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In specific embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 21-27, 109-111, 176-178, and 292.

[0160] In some embodiments, the T cell engager (TE or BiTE) comprises at least one amino acid substitution with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 21-23, 109-111. In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 45 amino acid substitutions, e.g., about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12. In certain embodiments, the at least one amino acid substitution is about 1 to 25 amino acid substitutions, e.g., about 1 to 22, 2 to 22, 2 to 20, 3 to 20, 3 to 18, 4 to 18, 4 to 16, 5 to 16, 5 to 14, 6 to 14, 6 to 12, 7 to 12, 7 to 10, or 8 to 10 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1 to 12 amino acid substitutions, for example, about 1 to 11, 2 to 11, 2 to 10, 3 to 10, 3 to 9, 4 to 9, 4 to 8, 5 to 8, 5 to 7, or 6 to 7 amino acid substitutions. In certain embodiments, the T cell engager (TE or BiTE) comprises about 1 to 40 amino acid substitutions with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 21 to 23, 109 to 111.

[0161] In some embodiments, the T cell engager (TE or BiTE) comprises at least one amino acid substitution with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178, and 292. In certain embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, or 70 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 70 amino acid substitutions, e.g., about 1 to 65, 1 to 60, 1 to 55, 5 to 55, 5 to 50, 10 to 50, 10 to 45, 15 to 45, 15 to 40, 20 to 40, 20 to 35, 25 to 35, or 25 to 30 amino acid substitutions. In certain embodiments, the T cell engager (TE or BiTE) comprises about 1 to 55 amino acid substitutions with respect to at least one of the amino acid sequences set forth in SEQ ID NOs: 24 to 27, 176 to 178, and 292. In specific embodiments, the T cell engager (TE or BiTE) comprises the amino acid sequence set forth in any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 109, 110, 111, 176, 177, 178, or 292.

[0162] In some embodiments, the polynucleotide sequence encoding the amino acid sequence comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 31 to 38, 106 to 108, 112 to 119, 173 to 175, 179 to 186, 192 to 203, 222 to 237, or 239 to 241, or a combination thereof. Illustratively, the sequence identity may be at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In specific embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%.

[0163] In some embodiments, the polynucleotide sequence encoding the amino acid sequence comprises an amino acid sequence that has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 31 to 38, 106 to 108, 112 to 119, 173 to 175, 179 to 186, 192 to 203, 222 to 237, or 239 to 241, or a combination thereof.

[0164] In one embodiment, the polynucleotide sequence encoding the above amino acid sequence contains at least one amino acid substitution independently selected from the amino acid sequences set forth in SEQ ID NOs: 31 to 38, 106 to 108, 112 to 119, 173 to 175, 179 to 186, 192 to 203, 222 to 237, and 239 to 241, or a combination thereof. In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, or 60 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 60 amino acid substitutions, for example, about 1 to 55, 1 to 50, 1 to 45, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12. In one embodiment, the polynucleotide sequence encoding the amino acid sequence contains about 1 to 50 amino acid substitutions with at least one independently selected from the amino acid sequences set forth in SEQ ID NOs: 31 to 38, 106 to 108, 112 to 119, 173 to 175, 179 to 186, 192 to 203, 222 to 237, and 239 to 241.

[0165] In certain embodiments, the polynucleotide sequence encodes the amino acid sequence set forth in SEQ ID NOs: 31 to 38, 106 to 108, 112 to 119, 173 to 175, 179 to 186, 192 to 203, 222 to 237, or 239 to 241.

[0166] In one aspect, the present invention provides a first polynucleotide comprising a sequence encoding a chimeric antigen receptor (CAR) and a second polynucleotide comprising a T cell engager (TE or BiTE), wherein the CAR is capable of binding to one or more first TAAs and the T cell engager (TE or BiTE) is capable of binding to a T cell and a second TAAs. In some embodiments, the first polynucleotide comprises a polynucleotide defined herein. In some embodiments, the second polynucleotide comprises a polynucleotide defined herein.

[0167] In another aspect, the present invention provides a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, wherein the bispecific CAR comprises an IL13 mutein linked to a HER2-binding scFv via a linker sequence. 1. IL13 mutant proteins

[0168] In some embodiments, the IL13 mutein comprises the amino acid sequence shown in SEQ ID NO: 1 (Table 1).

[0169] In some embodiments, the IL13 mutein comprises, consists essentially of, or consists of an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 1. Illustratively, the sequence identity to SEQ ID NO: 1 is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the IL13 mutein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:1.

[0170] In some embodiments, the IL13 mutein comprises at least one amino acid substitution relative to SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises between about 1 and 45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises about 1 to 11, 2 to 12, 2 to 11, 3 to 11, 3 to 10, 4 to 10, 4 to 9, 5 to 9, 5 to 8, 6 to 8, or 6 to 7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises about 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:1. 2.HER2-binding ScFv

[0171] In some embodiments, the HER2-binding ScFv comprises, consists essentially of, or consists of the amino acid sequence set forth in SEQ ID NO:2, 3, or 4 (Table 1). In some embodiments, the HER2-binding ScFv comprises, consists essentially of, or consists of the amino acid sequence set forth in SEQ ID NO:4.

[0172] In some embodiments, the HER2-binding ScFv comprises, consists essentially of, or consists of an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:2, 3, or 4, or a combination thereof. Illustratively, the sequence identity to SEQ ID NO:2, 3, or 4, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the HER2-binding ScFv comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4.

[0173] In some embodiments, the HER2-binding ScFv comprises, consists essentially of, or consists of an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 4. Illustratively, the sequence identity to SEQ ID NO: 4 is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the HER2-binding ScFv comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:4.

[0174] In some embodiments, the HER2-binding ScFv comprises at least one amino acid substitution relative to SEQ ID NO: 2, 3 or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95 amino acid substitutions relative to SEQ ID NO: 2, 3 or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises about 1 to 95 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises about 1 to 90, 2 to 95, 2 to 90, 4 to 90, 4 to 85, 6 to 85, 6 to 80, 8 to 80, 8 to 75, 10 to 75, 10 to 70, 15 to 70, 15 to 65, 20 to 65, 20 to 60, 25 to 60, 25 to 50, 30 to 50, or 30 to 40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises about 1 to 24, 2 to 25, 2 to 24, 3 to 24, 3 to 22, 4 to 22, 4 to 20, 5 to 20, 5 to 18, 6 to 18, 6 to 16, 7 to 16, 7 to 14, 8 to 14, 8 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding ScFv comprises up to about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution.In some embodiments, the amino acid substitutions include at least one highly conservative substitution.

[0175] In some embodiments, the HER2-binding ScFv comprises at least one amino acid substitution with respect to SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 amino acid substitutions with respect to SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises about 1 to 95 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises approximately 1 to 90, 2 to 95, 2 to 90, 4 to 90, 4 to 85, 6 to 85, 6 to 80, 8 to 80, 8 to 75, 10 to 75, 10 to 70, 15 to 70, 15 to 65, 20 to 65, 20 to 60, 25 to 60, 25 to 50, 30 to 50, or 30 to 40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises approximately 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises approximately 1 to 24, 2 to 25, 2 to 24, 3 to 24, 3 to 22, 4 to 22, 4 to 20, 5 to 20, 5 to 18, 6 to 18, 6 to 16, 7 to 16, 7 to 14, 8 to 14, 8 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding ScFv comprises up to approximately 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution. 3. Linker

[0176] In some embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 5 (Table 1). In some embodiments, the linker comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the linker comprises at least one amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) with respect to SEQ ID NO: 5. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 4. CD8α signal peptide

[0177] In some embodiments, the CD8α signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 6 (Table 1). In some embodiments, the CD8α signal peptide comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 6. In some embodiments, the CD8α signal peptide comprises at least one amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) relative to SEQ ID NO: 6. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 5. CD8α hinge

[0178] In some embodiments, the CD8α hinge comprises the amino acid sequence set forth in SEQ ID NO:7 (Table 1). In some embodiments, the CD8α hinge comprises an amino acid sequence having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the CD8α hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the CD8α hinge comprises at least one amino acid substitution (e.g., 1, 2, 3, 4, or 5 amino acid substitutions) relative to SEQ ID NO:7. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 6. CD28 transmembrane domain

[0179] In some embodiments, the CD28 transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8 (Table 1). In some embodiments, the CD28 transmembrane domain comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the CD28 transmembrane domain comprises at least one amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) relative to SEQ ID NO: 8. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 7.4-1BB costimulatory domain

[0180] In some embodiments, the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO:9 (Table 1). In some embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:9. In some embodiments, the 4-1BB costimulatory domain comprises at least one amino acid substitution (e.g., 1, 2, 3, or 4 amino acid substitutions) relative to SEQ ID NO:9. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 8. CD3ζ signaling domain

[0181] In some embodiments, the CD3ζ signal domain comprises the amino acid sequence set forth in SEQ ID NO: 10 (Table 1).

[0182] In some embodiments, the CD3ζ signal domain comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 10. Illustratively, the sequence identity with SEQ ID NO: 1 is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the CD3ζ signal domain comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 10.

[0183] In some embodiments, the CD3 zeta signal domain comprises at least one amino acid substitution with respect to SEQ ID NO: 10. In some embodiments, the CD3 zeta signal domain comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions with respect to SEQ ID NO: 10. In some embodiments, the CD3 zeta signal domain comprises between about 1 and 45 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the CD3 zeta signal domain comprises approximately 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the CD3 zeta signal domain comprises approximately 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the CD3 zeta signal domain comprises approximately 1 to 11, 2 to 12, 2 to 11, 3 to 11, 3 to 10, 4 to 10, 4 to 9, 5 to 9, 5 to 8, 6 to 8, or 6 to 7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the CD3ζ signal domain comprises about 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0184] In some embodiments, The IL13 muteins each independently comprise an amino acid sequence that has at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1; the HER2-binding scFvs each independently comprise an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof; the CD8α signal peptide comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 6; the CD8α hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 7; the CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 8; the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:9; or the CD3ζ signal domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0185] In some embodiments, the IL13 mutein comprises approximately 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1; the HER2-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof; the CD8α signal peptide comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO:6; the linker comprises one or two amino acid substitutions with respect to the amino acid sequence shown in SEQ ID NO: 3; the CD8α hinge comprises approximately 1 to 5 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 7; the CD28 transmembrane domain contains approximately 1 to 3 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 8; the 4-1BB costimulatory domain comprises about 1 to 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 9; or the CD3ζ signal domain comprises approximately 1 to 12 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0186] In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of the linker, the linker is located at the N-terminus of the HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ signal domain (Figure 1).

[0187] In some embodiments, the bispecific CAR comprises the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13 (Table 1).

[0188] In some embodiments, the bispecific CAR comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. Illustratively, the sequence identity to SEQ ID NO: 11, 12, or 13, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the bispecific CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13.

[0189] In some embodiments, the bispecific CAR comprises at least one amino acid substitution relative to SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, or 120 amino acid substitutions relative to SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1 to 120 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1 to 110, 2 to 110, 2 to 100, 4 to 100, 4 to 90, 6 to 90, 6 to 80, 8 to 80, 8 to 70, 10 to 70, 10 to 60, 15 to 60, 15 to 50, 20 to 50, 20 to 40, 25 to 40, or 25 to 30 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1 to 60 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1 to 24, 2 to 25, 2 to 24, 3 to 24, 3 to 22, 4 to 22, 4 to 20, 5 to 20, 5 to 18, 6 to 18, 6 to 16, 7 to 16, 7 to 14, 8 to 14, 8 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof.In some embodiments, the bispecific CAR comprises up to about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12, or 13, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution. Polynucleotides encoding BT cell engagers (TEs or BiTEs)

[0190] In another aspect, the invention provides a polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell, a first TAA epitope, and a second TAA epitope. In some embodiments, the first TAA epitope and the second TAA epitope are in a second TAA. In some embodiments, the first TAA epitope and the second TAA epitope are in two second TAAs.

[0191] In some embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, CD31, or CD277. In specific embodiments, the T cell engager (TE or BiTE) can bind to CD3.

[0192] In some embodiments, the T cell engager (TE or BiTE) comprises a first binding moiety and a second binding moiety. In some embodiments, the first binding moiety is capable of binding to a T cell surface antigen. In some embodiments, the second binding moiety is capable of binding to a first TAA. In some embodiments, the T cell engager (TE or BiTE) comprises a third binding moiety capable of binding to a second TAA. In some embodiments, the first TAA is the same as the second TAA. In some embodiments, the first binding moiety and the second binding moiety are capable of binding to two different epitopes. In some embodiments, the first TAA is different from the second TAA.

[0193] In some embodiments, the TAA is CEA, GPC3, MUC-1, EpCAM, HER receptor, PEM, A33, G250, carbohydrate antigens Ley, Lex, Leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, WT1, MUC1, LMP2, idiotype, HPV E6 & E7, EGFR, EGFRvIII, HER-2 / neu, MAGEA3, p53 non-mutant, p53 mutant, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA / MART1, Ras mutant, protease 3 (PR1), bcr-abl, tyrosinase, survivin, PSA, or hTERT. In some embodiments, the TAA is a glioblastoma tumor antigen. In some embodiments, the TAA is HER2, GPC3, EGFR, or EGFRvIII. In certain embodiments, the TAA is HER2. In certain embodiments, the TAA is GPC3. In certain embodiments, the TAA is EFGR. In certain embodiments, the TAA is EGFRvIII.

[0194] In some embodiments, the T cell engager (TE or BiTE) comprises a CD3-binding scFv.

[0195] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding Nanobody. In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFRvIII-binding Nanobody. In some embodiments, the T cell engager (TE or BiTE) comprises at least one GPC3-binding Nanobody. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFR-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFRvIII-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises two GPC3-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises one EGFR-binding Nanobody and one EGFRvIII-binding Nanobody. In some embodiments, the T cell engager (TE or BiTE) comprises one EGFR-binding Nanobody and one GPC3-binding Nanobody. In some embodiments, the T cell engager (TE or BiTE) comprises one GPC3-binding Nanobody and one EGFRvIII-binding Nanobody.

[0196] In some embodiments, the T cell engager (TE or BiTE) comprises a linker, a signal peptide, or a peptide tag, or a combination thereof.

[0197] In some embodiments, the polynucleotide is isolated (e.g., produced synthetically or by molecular cloning). In some embodiments, the polynucleotide is integrated into the genomic DNA of a host cell (e.g., a T lymphocyte). In some embodiments, the polynucleotide is extrachromosomal (e.g., on a plasmid or viral vector) within the host cell. In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is RNA. The polynucleotide can be inserted into a vector, such as a plasmid or a viral vector (e.g., a lentiviral vector). The polynucleotide may also include one or more modified nucleotides (e.g., one or more chemically modified nucleotides).

[0198] In some embodiments, the first Nanobody and the second Nanobody each independently comprise an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178, and 292. Illustratively, the sequence identity may be at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In certain embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In one embodiment, the first Nanobody / second Nanobody, or both, comprise an amino acid sequence that has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178 and 292.

[0199] In some embodiments, the first Nanobody and the second Nanobody each independently comprise an amino acid sequence that has at least one amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178, and 292. In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, or 60 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1 to 60 amino acid substitutions, illustratively about 1 to 55, 1 to 50, 1 to 45, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12 or 10 to 12 amino acid substitutions. In certain embodiments, the first Nanobody, the second Nanobody, or both, comprise an amino acid sequence having at least about 1 to 50 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178 and 292.

[0200] In certain embodiments, the first Nanobody, the second Nanobody, independently comprise the amino acid sequences set forth in SEQ ID NOs: 24-27, 176-178 and 292. 1.CD3-binding ScFv

[0201] In some embodiments, the CD3-binding ScFv comprises the amino acid sequence shown in SEQ ID NO: 14 (Table 2).

[0202] In some embodiments, the CD3-binding ScFv comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 14. Illustratively, the sequence identity to SEQ ID NO: 14 is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the CD3-binding ScFv comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 14.

[0203] In some embodiments, the CD3-binding ScFv comprises at least one amino acid substitution with respect to SEQ ID NO: 14. In some embodiments, the CD3-binding ScFv comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 amino acid substitutions with respect to SEQ ID NO: 1. In some embodiments, the CD3-binding ScFv comprises about 1 to 95 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding ScFv comprises approximately 1 to 90, 2 to 95, 2 to 90, 4 to 90, 4 to 85, 6 to 85, 6 to 80, 8 to 80, 8 to 75, 10 to 75, 10 to 70, 15 to 70, 15 to 65, 20 to 65, 20 to 60, 25 to 60, 25 to 50, 30 to 50, or 30 to 40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding ScFv comprises approximately 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding ScFv comprises approximately 1 to 24, 2 to 25, 2 to 24, 3 to 24, 3 to 22, 4 to 22, 4 to 20, 5 to 20, 5 to 18, 6 to 18, 6 to 16, 7 to 16, 7 to 14, 8 to 14, 8 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding ScFv comprises up to approximately 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution. 2. Tumor-specific antigens (TAA)

[0204] In some embodiments, the TAA is a glioblastoma tumor antigen.

[0205] In some embodiments, the glioblastoma tumor antigen is EGFR.

[0206] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding Nanobody.

[0207] In some embodiments, the EGFR-binding Nanobody comprises the amino acid sequence shown in SEQ ID NO: 15, 16 or 17 (Table 2).

[0208] In some embodiments, the EGFR-binding Nanobody comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the EGFR-binding Nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof.

[0209] In some embodiments, the EGFR-binding Nanobody comprises at least one amino acid substitution with respect to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises from about 1 to 45 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12 or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises about 1 to 11, 2 to 12, 2 to 11, 3 to 11, 3 to 10, 4 to 10, 4 to 9, 5 to 9, 5 to 8, 6 to 8, or 6 to 7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16, or 17, or a combination thereof. In some embodiments, the EGFR-binding Nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16, or 17, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0210] In some embodiments, the glioblastoma tumor antigen is EGFRvIII.

[0211] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFRvIII-binding Nanobody.

[0212] In some embodiments, the EGFRvIII-binding Nanobody comprises the amino acid sequence shown in SEQ ID NO: 15, 16 or 17 (Table 2).

[0213] In some embodiments, the EGFRvIII-binding Nanobody comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the EGFRvIII-binding Nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 15, 16, or 17, or a combination thereof.

[0214] In some embodiments, the EGFRvIII-binding Nanobody comprises at least one amino acid substitution with respect to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises about 1 to 45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises about 1 to 11, 2 to 12, 2 to 11, 3 to 11, 3 to 10, 4 to 10, 4 to 9, 5 to 9, 5 to 8, 6 to 8, or 6 to 7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16, or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding Nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16, or 17, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0215] In some embodiments, the T cell engager (TE or BiTE) comprises at least one GPC3-binding Nanobody.

[0216] In some embodiments, the GPC3-binding Nanobody comprises the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291. In particular embodiments, the GPC3-binding Nanobody comprises the amino acid sequence set forth in SEQ ID NOs: 284, 286 or 289.

[0217] In some embodiments, the GPC3-binding Nanobody comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the GPC3-binding Nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof.

[0218] In some embodiments, the GPC3-binding Nanobody comprises at least one amino acid substitution with respect to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acid substitutions with respect to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises about 1 to 45 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises about 1 to 40, 2 to 45, 2 to 40, 3 to 40, 3 to 35, 4 to 35, 4 to 30, 5 to 30, 5 to 25, 6 to 25, 6 to 20, 7 to 20, 7 to 15, 8 to 15, 8 to 14, 9 to 14, 9 to 12, or 10 to 12 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises about 1 to 11, 2 to 12, 2 to 11, 3 to 11, 3 to 10, 4 to 10, 4 to 9, 5 to 9, 5 to 8, 6 to 8, or 6 to 7 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the GPC3-binding Nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs: 282 to 291, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution. 3. Linker

[0219] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding Nanobody or EGFR-binding scFv, which is linked to a CD3-binding scFv via a linker sequence. In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFRvIII-binding Nanobody or EGFRvIII-binding scFv, which is linked to a CD3-binding scFv via a linker sequence. In some embodiments, the linker sequence comprises GGGGS (SEQ ID NO: 18) (Table 2).

[0220] In some embodiments, the T cell engager (TE or BiTE) comprises at least one GPC3-binding nanobody or GPC3-binding scFv, which is linked to a CD3-binding scFv via a linker sequence. 4. Signal Peptide

[0221] In some embodiments, the T cell engager (TE or BiTE) comprises a signal peptide. In some embodiments, the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 19 (Table 2).

[0222] In some embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 19. In some embodiments, the signal peptide comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 19. In some embodiments, the signal peptide comprises an amino acid sequence having at least one amino acid substitution (e.g., 1, 2 or 3 amino acid substitutions) relative to the amino acid sequence set forth in SEQ ID NO: 19. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 5. Peptide tag

[0223] In some embodiments, the peptide tag comprises a polyhistidine sequence, for example, 6xHis (SEQ ID NO: 20) (Table 2). 6. Structure

[0224] In some embodiments, the T cell engager (TE or BiTE) comprises an EGFR-binding Nanobody. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding Nanobody, the EGFR-binding Nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0225] In some embodiments, the T cell engager (TE or BiTE) comprises an EGFRvIII-binding Nanobody, in some embodiments the signal peptide is located at the N-terminus of the EGFRvIII-binding Nanobody, the EGFRvIII-binding Nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0226] In some embodiments, the T cell engager (TE or BiTE) comprises a GPC3-binding Nanobody, in some embodiments the signal peptide is located at the N-terminus of the GPC3-binding Nanobody, the GPC3-binding Nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0227] In some embodiments, the T cell engager (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO: 21, 22, 23 (Table 2), 109, 110, or 111.

[0228] In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof.

[0229] In some embodiments, the T cell engager (TE or BiTE) comprises at least one amino acid substitution with respect to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, or 160 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 160 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 140, 2 to 160, 2 to 140, 4 to 140, 4 to 120, 6 to 120, 6 to 100, 8 to 100, 8 to 80, 10 to 80, 10 to 60, 15 to 60, 15 to 50, 20 to 50, 20 to 40, 25 to 40, or 25 to 30 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof.In some embodiments, the T cell engager (TE or BiTE) comprises about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 21, 22, 23, 109, 110, or 111, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0230] In some embodiments, the T cell engager (TE or BiTE) comprises an EGFR-binding scFv, in some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding scFv, the EGFR-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0231] In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFR-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFR-binding Nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding Nanobody, the first EGFR-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second EGFR-binding Nanobody, the second EGFR-binding Nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv (Figure 6, middle panel).

[0232] In some embodiments, the T cell engager (TE or BiTE) comprises an EGFRvIII-binding scFv, in which the signal peptide is located at the N-terminus of the EGFRvIII-binding scFv, the EGFRvIII-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0233] In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFRvIII-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFRvIII-binding Nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding Nanobody, which first EGFRvIII-binding Nanobody is located at the N-terminus of a first linker, which first linker is located at the N-terminus of a second EGFRvIII-binding Nanobody, which second EGFRvIII-binding Nanobody is located at the N-terminus of a second linker, which second linker is located at the N-terminus of a CD3-binding scFv (Figure 6, middle panel).

[0234] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding Nanobody and at least one EGFRvIII-binding Nanobody. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding Nanobody, the EGFR-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the EGFRvIII-binding Nanobody, the EGFRvIII-binding Nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the EGFRvIII-binding Nanobody, the EGFRvIII-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the EGFR-binding Nanobody, the EGFR-binding Nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv.

[0235] In some embodiments, the T cell engager (TE or BiTE) comprises a GPC3-binding scFv, in which the signal peptide is located at the N-terminus of the GPC3-binding scFv, the GPC3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 6, top panel).

[0236] In some embodiments, the T cell engager (TE or BiTE) comprises at least two GPC3-binding Nanobodies. In some embodiments, the T cell engager (TE or BiTE) comprises two GPC3-binding Nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first GPC3-binding Nanobody, the first GPC3-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second GPC3-binding Nanobody, the second GPC3-binding Nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv (Figure 6, middle panel).

[0237] In some embodiments, the T cell engager (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO: 24, 25 (Table 2), 176, or 177.

[0238] In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 60% identity to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 24, 25, 176, or 177, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 24, 25, 176, or 177, or a combination thereof.

[0239] In some embodiments, the T cell engager (TE or BiTE) comprises at least one amino acid substitution with respect to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or 210 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 210 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 200, 2 to 210, 2 to 200, 4 to 200, 4 to 180, 6 to 180, 6 to 160, 8 to 160, 8 to 140, 10 to 140, 10 to 120, 15 to 120, 15 to 100, 20 to 100, 20 to 80, 25 to 80, 25 to 60, 30 to 60, or 30 to 40 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof.In some embodiments, the T cell engager (TE or BiTE) comprises about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 24, 25, 176, or 177, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0240] In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFR-binding scFvs. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFR-binding scFvs. In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second EGFR-binding scFv, the second EGFR-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv.

[0241] In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFRvIII-binding scFvs. In some embodiments, the T cell engager (TE or BiTE) comprises two EGFRvIII-binding scFvs. In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding scFv, the first EGFRvIII-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second EGFRvIII-binding scFv, the second EGFRvIII-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv.

[0242] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding scFv and at least one EGFRvIII-binding scFv. In some embodiments, the T cell engager (TE or BiTE) comprises one EGFR-binding scFv and one EGFRvIII-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding scFv, the EGFR-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the EGFRvIII-binding scFv, the EGFRvIII-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the EGFRvIII-binding scFv, the EGFRvIII-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the EGFR-binding scFv, the EGFR-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the CD3-binding scFv.

[0243] In some embodiments, the T cell engager (TE or BiTE) comprises at least two GPC3-binding scFvs. In some embodiments, the T cell engager (TE or BiTE) comprises two GPC3-binding scFvs. In some embodiments, the signal peptide is located at the N-terminus of a first GPC3-binding scFv, the first GPC3-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second GPC3-binding scFv, the second GPC3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD3-binding scFv.

[0244] In some embodiments, the signal peptide is located at the N-terminus of the first EGFR-binding Nanobody, the first EGFR-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the second EGFR-binding Nanobody (Figure 6, bottom panel).

[0245] In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding Nanobody, the first EGFRvIII-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second EGFRvIII-binding Nanobody (Figure 6, bottom panel).

[0246] In some embodiments, the signal peptide is located at the N-terminus of the first GPC3-binding Nanobody, the first GPC3-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the second GPC3-binding Nanobody.

[0247] In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding Nanobody, the EGFR-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the EGFRvIII-binding Nanobody.

[0248] In some embodiments, the signal peptide is located at the N-terminus of the EGFRvIII-binding Nanobody, the EGFRvIII-binding Nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the EGFR-binding Nanobody.

[0249] In some embodiments, the T cell engager (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO: 26, 27 (Table 2), or 178 or 292.

[0250] In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 60% identity to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 26, 27, 178, or 292, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 26, 27, 178, or 292, or a combination thereof.

[0251] In some embodiments, the T cell engager (TE or BiTE) comprises at least one amino acid substitution with respect to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or 210 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 210 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1 to 200, 2 to 210, 2 to 200, 4 to 200, 4 to 180, 6 to 180, 6 to 160, 8 to 160, 8 to 140, 10 to 140, 10 to 120, 15 to 120, 15 to 100, 20 to 100, 20 to 80, 25 to 80, 25 to 60, 30 to 60, or 30 to 40 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof.In some embodiments, the T cell engager (TE or BiTE) comprises about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 26, 27, 178, or 292, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0252] In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second EGFR-binding scFv.

[0253] In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding scFv, the first EGFRvIII-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second EGFRvIII-binding scFv.

[0254] In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding scFv, the first GPC3-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second GPC3-binding scFv.

[0255] In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second EGFRvIII-binding scFv.

[0256] In some embodiments, the signal peptide is located at the N-terminus of a first EGFRvIII-binding scFv, the first EGFRvIII-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second EGFR-binding scFv.

[0257] T cell engagers (TEs or BiTEs) In another aspect, the invention provides a T cell engager (TE or BiTE) capable of binding to a T cell, a first TAA epitope, and a second TAA epitope, wherein the T cell engager is produced in situ by a CAR T-cell and is secreted or released by the CAR T-cell upon interaction of the CAR with the first TAA, or both. In some embodiments, the T cell engager (TE or BiTE) is defined as any one of the T cell engagers (TE or BiTE) described herein.

[0258] In some embodiments, the T cell engager (TE or BiTE) is encoded by a polynucleotide comprising a sequence encoding the CAR. In some embodiments, the CAR T-cells comprise a polynucleotide comprising a sequence encoding the T cell engager (TE or BiTE). In some embodiments, the CAR T-cells comprise a polynucleotide comprising a sequence encoding the CAR. In some embodiments, the CAR T-cells comprise a polynucleotide comprising a sequence encoding the T cell engager (TE or BiTE) and a sequence encoding the CAR. In some embodiments, the CAR T-cells comprise a first polynucleotide comprising a sequence encoding the T cell engager (TE or BiTE) and a second polynucleotide comprising a sequence encoding the CAR.

[0259] In some embodiments, the CAR is capable of binding to a first TAA, which in certain embodiments is CEA, GPC3, MUC-1, EpCAM, a HER receptor, PEM, Caludi 6, Cluadi-18.2, mesothelin, A33, G250, carbohydrate antigens Ley, Lex, Leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, MUC1, LMP2, idiotype, HPV E6 & E7, EGFR, EGFRvIII, HER-2 / neu, MAGE A3, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA / MART1, CD19, CD20, CD22, CD33, CD5, CD70, or BCMA. In certain embodiments, the first TAA is HER2, GPC3, EGFR, EGFRvIII, or GPC3.

[0260] In some embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, CD31, or CD277. In specific embodiments, the T cell engager (TE or BiTE) can bind to CD3.

[0261] In some embodiments, the first TAA epitope and the second TAA epitope are in a second TAA. In some embodiments, the first TAA epitope and the second TAA epitope are in two second TAAs.

[0262] In some embodiments, the second TAA is CEA, GPC3, MUC-1, EpCAM, HER receptor, PEM, Caludi 6, Cluadi-18.2, mesothelin, A33, G250, carbohydrate antigens Ley, Lex, Leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, MUC1, LMP2, idiotype, HPV E6 & E7, EGFR, EGFRvIII, HER-2 / neu, MAGE A3, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA / MART1, CD19, CD20, CD22, CD33, CD5, CD70, or BCMA. In certain embodiments, the second TAA is HER2, GPC3, EGFR, EGFRvIII, or GPC3. In certain embodiments, each of the second TAAs is independently EGFR, EGFRvIII, or GPC3.

[0263] In some embodiments, the T cell engager (TE or BiTE) comprises a single chain variable fragment (scFv), a nanobody, or a combination thereof.

[0264] In some embodiments, the T cell engager (TE or BiTE) is produced in situ by the CAR T cell. In certain embodiments, the T cell engager (TE or BiTE) is manufactured in the vicinity of the CAR T cell. In certain embodiments, the T cell engager (TE or BiTE) is produced in the vicinity of the CAR T cell and tumor cells. In certain embodiments, the CAR T cell secretes the T cell engager (TE or BiTE).

[0265] In some embodiments, the CAR T cells are activated. In some embodiments, the CAR T cells are activated by molecules in the environment where the CAR T cells are located. In some embodiments, the CAR T cells are activated by molecules in the tumor microenvironment where the CAR T cells are located. In some embodiments, the CAR T cells are activated by antigens. In certain embodiments, the CAR T cells are activated by TAAs. In certain embodiments, the CAR T cells are activated by interaction between a surface receptor on the CAR T cells and a TAA. For example, the surface receptor on the CAR T cells may be a CAR.

[0266] In some embodiments, the CAR T cells are activated through the immune synapse. In certain embodiments, the T cell engager (TE or BiTE) is produced by the CAR T cell through the immune synapse following T cell activation by interaction of the CAR with a TAA. C. Polynucleotides encoding dual CAR and T cell engager (TE or BiTE) fusion proteins

[0267] In another aspect, the present invention discloses a polynucleotide comprising a sequence encoding a fusion protein of any one of the dual CARs described herein and any one of the T cell engagers (TEs or BiTEs) described herein.

[0268] In some embodiments, the dual CAR targets HER2 and IL13Rα2, and the T cell engager (TE or BiTE) can bind to CD3 and a TAA (e.g., a glioblastoma tumor antigen).

[0269] In some embodiments, the bispecific CAR comprises any one of the IL13 muteins described herein, linked to any one of the HER2-binding scFvs described herein via any one of the linker sequences described herein.

[0270] In some embodiments, the bispecific CAR further comprises any one of the CD8α signal peptides described herein, any one of the CD8α hinges described herein, any one of the CD28 transmembrane domains described herein, any one of the 4-1BB costimulatory domains described herein, any one of the CD3ζ domains described herein, or a combination thereof. In some embodiments, the bispecific CAR further comprises any one of the CD8α signal peptides described herein, any one of the CD8α hinges described herein, any one of the CD28 transmembrane domains described herein, any one of the 4-1BB costimulatory domains described herein, and any one of the CD3ζ domains described herein.

[0271] In some embodiments, the T cell engager (TE or BiTE) comprises any one of the CD3-binding scFvs described herein.

[0272] In some embodiments, the TAA (eg, a glioblastoma tumor antigen) is EGFR.

[0273] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFR-binding Nanobody described herein. In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFR-binding Nanobodies described herein. In some embodiments, the T cell engager (TE or BiTE) comprises any one anti-EGFR antibody described herein.

[0274] In some embodiments, the TAA (eg, glioblastoma tumor antigen) is EGFRvIII.

[0275] In some embodiments, the T cell engager (TE or BiTE) comprises at least one EGFRvIII-binding Nanobody described herein. In some embodiments, the T cell engager (TE or BiTE) comprises at least two EGFRvIII-binding Nanobodies described herein. In some embodiments, the T cell engager (TE or BiTE) comprises any one anti-EGFR antibody described herein.

[0276] In some embodiments, the TAA (eg, glioblastoma tumor antigen) is GPC3.

[0277] In some embodiments, the T cell engager (TE or BiTE) comprises at least one GPC3-binding Nanobody described herein. In some embodiments, the T cell engager (TE or BiTE) comprises at least two GPC3-binding Nanobodies described herein. In some embodiments, the T cell engager (TE or BiTE) comprises any one anti-GPC3 antibody described herein.

[0278] In some embodiments, the T cell engager (TE or BiTE) further comprises any one of the linkers described herein, any one of the signal peptides described herein, any one of the peptide tags described herein, or a combination thereof. 1. Self-cleaving peptides

[0279] In some embodiments, the double CAR_BiTE fusion protein further comprises a self-cleaving peptide, hi some embodiments, the self-cleaving peptide is a self-cleaving T2A peptide.

[0280] In some embodiments, the self-cleaving T2A peptide comprises the amino acid sequence set forth in SEQ ID NO:28 (Table 3). In some embodiments, the self-cleaving T2A peptide comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO:28. In some embodiments, the signal peptide comprises an amino acid sequence having at least one amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) relative to the amino acid sequence set forth in SEQ ID NO:28. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitution comprises at least one highly conservative substitution. 2. Structure

[0281] a. EGFR or EGFRvIII-binding scFv In some embodiments, the dual CAR_BiTE fusion protein comprises an anti-EGFR antibody or antigen-binding fragment. In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of the (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of the HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ domain, the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-EGFR antibody, the anti-EGFR antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 10, top diagram).

[0282] In some embodiments, the dual CAR_BiTE fusion protein comprises an anti-EGFRvIII antibody or antigen-binding fragment. In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of the (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of the HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ domain, the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-EGFRvIII antibody, the anti-EGFRvIII antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 10, top diagram).

[0283] GPC3-binding scFv In some embodiments, the dual CAR_BiTE fusion protein comprises an anti-GPC3 antibody or antigen-binding fragment. In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of the (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of the HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ domain, the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-GPC3 antibody, the anti-GPC3 antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv.

[0284] In some embodiments, the anti-EGFR antibody is cetuximab. In some embodiments, the antigen-binding fragment is an scFv of cetuximab.

[0285] In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 31 or 35 (Table 3).

[0286] In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 60% identity to SEQ ID NO: 31 or 35, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 31 or 35, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 31 or 35, or a combination thereof.

[0287] In some embodiments, the dual CAR_BiTE fusion protein comprises at least one amino acid substitution relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 400 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 400, 2 to 350, 2 to 300, 4 to 300, 4 to 250, 6 to 250, 6 to 200, 8 to 200, 8 to 150, 10 to 150, 10 to 100, 15 to 100, 15 to 80, 20 to 80, 20 to 60, 25 to 60, or 25 to 40 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 120 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-110, 2-110, 2-100, 4-100, 4-90, 6-90, 6-80, 8-80, 8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof.In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises up to about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 31 or 35, or a combination thereof. In some embodiments, the amino acid substitution comprises at least one conservative substitution. In some embodiments, the amino acid substitutions include at least one highly conservative substitution. b. EGFR or EGFRvIII-binding Nanobodies

[0288] In some embodiments, the dual CAR_BiTE fusion protein comprises an EGFR-binding Nanobody. In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ domain, the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFR-binding Nanobody, the EGFR-binding Nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 10, top diagram).

[0289] In some embodiments, the dual CAR_BiTE fusion protein comprises an EGFRvIII-binding Nanobody. In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3ζ domain, the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFRvIII-binding Nanobody, the EGFRvIII-binding Nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD3-binding scFv (Figure 10, top diagram).

[0290] In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 32 or 36 (Table 3).

[0291] In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 60% identity to SEQ ID NO: 32 or 36, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 32 or 36, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 32 or 36, or a combination thereof.

[0292] In some embodiments, the dual CAR_BiTE fusion protein comprises at least one amino acid substitution relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-400 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-400, 2-350, 2-300, 4-300, 4-250, 6-250, 6-200, 8-200, 8-150, 10-150, 10-100, 15-100, 15-80, 20-80, 20-60, 25-60, or 25-40 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-120 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-110, 2-110, 2-100, 4-100, 4-90, 6-90, 6-80, 8-80, 8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof.In some embodiments, the dual CAR_BiTE fusion proteins comprise about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion proteins comprise as many as about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 32 or 36, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution. c. Two EGFR or EGFRvIII-binding nanobodies

[0293] In some embodiments, the dual CAR_BiTE fusion protein comprises at least two EGFR-binding Nanobodies. In some embodiments, the dual CAR_BiTE fusion protein comprises two EGFR-binding Nanobodies. In some embodiments, the CD8α signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the CD3ζ the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the first EGFR-binding Nanobody, the first EGFR-binding Nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the second EGFR-binding Nanobody (Figure 10, bottom diagram).

[0294] In some embodiments, the dual CAR_BiTE fusion protein comprises at least two EGFRvIII-binding Nanobodies. In some embodiments, the dual CAR_BiTE fusion protein comprises two EGFRvIII-binding Nanobodies. In some embodiments, the CD8α signal peptide is located N-terminally of an IL13 mutein, which is located N-terminally of a (GGGGS)3 linker, which is located N-terminally of a HER2-binding scFv, which is located N-terminally of the CD8α hinge, which is located N-terminally of the CD28 transmembrane domain, which is located N-terminally of the 4-1BB costimulatory domain, which is located N-terminally of the CD3ζ domain. the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the first EGFRvIII-binding Nanobody, the first EGFRvIII-binding Nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the second EGFRvIII-binding Nanobody (Figure 10, bottom diagram).

[0295] In some embodiments, the dual CAR_BiTE fusion protein comprises at least one EGFR-binding Nanobody and at least one EGFRvIII-binding Nanobody. In some embodiments, the dual CAR_BiTE fusion protein comprises one EGFR-binding Nanobody and one EGFRvIII-binding Nanobody.

[0296] In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the N-terminus of the CD3 the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFR-binding Nanobody, the first EGFRvIII-binding Nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the EGFRvIII-binding Nanobody.

[0297] In some embodiments, the CD8α signal peptide is located at the N-terminus of the IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the N-terminus of the CD3 the CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFRvIII-binding Nanobody, the first EGFRvIII-binding Nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the EGFR-binding Nanobody.

[0298] Two GPC3-binding nanoantibodies In some embodiments, the dual CAR_BiTE fusion protein comprises at least two GPC3-binding Nanobodies. In some embodiments, the dual CAR_BiTE fusion protein comprises two GPC3-binding Nanobodies. In some embodiments, the CD8α signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located at the N-terminus of a (GGGGS)3 linker, the (GGGGS)3 linker is located at the N-terminus of a HER2-binding scFv, the HER2-binding scFv is located at the N-terminus of the CD8α hinge, the CD8α hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the N-terminus of the 4-1BB costimulatory domain. The CD3ζ domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the first GPC3-binding Nanobody, the first GPC3-binding Nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD3-binding scFv, the CD3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the second GPC3-binding Nanobody.

[0299] In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 33 or 37 (Table 3).

[0300] In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 60% identity to SEQ ID NO: 33 or 37, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO: 33 or 37, or a combination thereof, is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 33 or 37, or a combination thereof.

[0301] In some embodiments, the dual CAR_BiTE fusion protein comprises at least one amino acid substitution with respect to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 450 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 400, 2 to 450, 2 to 400, 4 to 400, 4 to 350, 6 to 350, 6 to 300, 8 to 300, 8 to 250, 10 to 250, 10 to 200, 15 to 200, 15 to 150, 20 to 150, 20 to 100, 25 to 80, 25 to 60, 30 to 60, or 30 to 40 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1 to 120 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-110, 2-110, 2-100, 4-100, 4-90, 6-90, 6-80, 8-80, 8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the double CAR_BiTE fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof.In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-24, 2-25, 2-24, 3-24, 3-22, 4-22, 4-20, 5-20, 5-18, 6-18, 6-16, 7-16, 7-14, 8-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises up to about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 6, or 5 amino acid substitutions relative to SEQ ID NO: 33 or 37, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.

[0302] In some embodiments, the polynucleotide comprises a nucleotide sequence that is codon-optimized for mammalian (e.g., human) cells.

[0303] In another aspect, the present invention provides a polynucleotide comprising a sequence encoding an amino acid sequence having at least 60% identity to the amino acid sequences set forth in SEQ ID NOs: 2 to 4, SEQ ID NOs: 11 to 13 and 52, SEQ ID NOs: 15 to 17, SEQ ID NOs: 21 to 23, SEQ ID NOs: 49 and 50, SEQ ID NOs: 53 to 70, SEQ ID NOs: 72 to 82, SEQ ID NOs: 83 to 104, SEQ ID NOs: 120 to 137, SEQ ID NOs: 139 to 149, SEQ ID NOs: 150 to 171, SEQ ID NOs: 188 to 191, SEQ ID NOs: 204 and 206 to 214, SEQ ID NOs: 215 to 221, or SEQ ID NOs: 242 to 291, or a combination thereof. Illustratively, the sequence identity is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60 to 99%, 65 to 99%, 65 to 95%, 70 to 99%, 70 to 98%, 70 to 95%, 70 to 90%, 75 to 98%, 75 to 97%, 75 to 90%, 75 to 85%, 80 to 97%, 80 to 96%, 80 to 85%, 85 to 96%, 85 to 95%, or 90 to 95%. In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NOs: 2-4, SEQ ID NOs: 11-13 and 52, SEQ ID NOs: 15-17, SEQ ID NOs: 21-23, SEQ ID NOs: 49 and 50, SEQ ID NOs: 53-70, SEQ ID NOs: 72-82, SEQ ID NOs: 83-104, SEQ ID NOs: 120-137, SEQ ID NOs: 139-149, SEQ ID NOs: 150-171, SEQ ID NOs: 188-191, SEQ ID NOs: 204 and 206-214, SEQ ID NOs: 215-221, or SEQ ID NOs: 242-291, or a combination thereof.In certain embodiments, the amino acid sequence is the same as the amino acid sequence shown in SEQ ID NOs: 2 to 4, 11 to 13, 15 to 17, 21 to 23, 49, 50, 52 to 70, 72 to 104, 109 to 111, 120 to 137, 139 to 171, 188 to 191, 204, 206 to 221, and 242 to 291. vector

[0304] In another aspect, the present invention provides a vector comprising any one or more of the polynucleotides described herein.

[0305] In some embodiments, the vector is a non-viral vector. Non-limiting examples of non-viral vectors include plasmids, bacterial artificial chromosomes (BACs), cosmids, and linear artificial chromosomes.

[0306] In some embodiments, the vector is a viral vector. Non-limiting examples of viral vectors include adeno-associated virus (AAV) vectors, adenovirus vectors, ring virus vectors, coronavirus vectors, herpes virus vectors, lentivirus vectors, poliovirus vectors, rabies virus vectors, recombinant simian virus 40 vectors, reovirus vectors, retrovirus vectors, rhinovirus vectors, Sindbis virus vectors, vaccinia virus vectors, vesicular stomatitis virus vectors, Semliki Forest virus vectors, and yellow fever virus vectors. In certain embodiments, the viral vector is Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), foamy virus, Friend murine leukemia virus, murine stem cell virus (MSCV), and Rous sarcoma virus (RSV), and lentivirus. Non-limiting examples of lentiviruses include human immunodeficiency virus (e.g., HIV type 1 and HIV type 2), visna-maedi virus (VMV), caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), or simian immunodeficiency virus (SIV) vectors.

[0307] In certain embodiments, the vector (eg, a viral vector) is a gene therapy vector.

[0308] In some embodiments, the vector is an expression vector.

[0309] In some embodiments, the vector (e.g., expression vector) further comprises an expression control polynucleotide sequence, a polynucleotide sequence encoding a selection marker, or both, operably linked to the polynucleotide. In some embodiments, the expression control polynucleotide sequence comprises a promoter sequence, an enhancer sequence, or both. In some embodiments, the expression control polynucleotide sequence comprises an inducible promoter sequence.

[0310] In some embodiments, the expression control polynucleotide sequence comprises an EF1α core promoter sequence, an MNDU3 promoter sequence, or a combination thereof. In some embodiments, the expression control polynucleotide sequence comprises an EF1α core promoter sequence. In some embodiments, the expression control polynucleotide sequence comprises an MNDU3 promoter sequence.

[0311] EF1α core promoter sequence (SEQ ID NO: 39) GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG MNDU3 promoter sequence (SEQ ID NO: 40) TCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAGAATAAAAGATTTTATTTAGTCTCCAGAAA AAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGGATCAAGGTTAGGAACAGAGAGACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACA GTTGGAACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCC AGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCGAGCTCAAATAAAAGAGCCCACAACCCCTCACTCGGCGCGATC fusion proteins In another aspect, the invention provides a fusion protein encoded by any one of the polynucleotides or vectors (eg, expression vectors) described herein.

[0312] In another aspect, the present invention provides a fusion protein comprising a bispecific CAR capable of binding to two different antigens expressed on the surface of a cancer cell and a T cell engager (TE or BiTE) capable of binding to a T cell (e.g., CD3) and a TAA (e.g., a tumor antigen such as a glioblastoma tumor antigen).

[0313] Fusion proteins described herein can be produced recombinantly or synthetically using conventional methods and reagents well known in the art. Illustratively, fusion proteins described herein can be produced recombinantly in suitable host cells (e.g., bacteria) using methods known in the art. See, for example, Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992, and Molecular Cloning: a Laboratory Manual, Second Edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press. Illustratively, a nucleic acid molecule containing a nucleotide sequence encoding a fusion protein described herein can be introduced into a suitable host cell (e.g., E. coli) and expressed, and the expressed fusion protein (e.g., inclusion bodies) can be isolated / purified from the host cell using conventional methods and existing reagents. Illustratively, DNA fragments encoding different protein sequences (e.g., photoresponsive domains, heterologous peptide components) can be ligated in-frame according to conventional techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques, including the use of an automated DNA synthesizer. Alternatively, PCR amplification of nucleic acid fragments can be performed using anchor primers, which generate complementary overhangs between two consecutive nucleic acid fragments that can then be annealed and reamplified to produce chimeric nucleic acid sequences (see Ausubel et al., Current Protocols in Molecular Biology, 1992).

[0314] In some embodiments, the fusion protein further comprises a self-cleaving peptide. In certain embodiments, the self-cleaving peptide is the T2A peptide (SEQ ID NO: 28). host cell

[0315] In another aspect, the present invention provides a host cell comprising any one or more of the polynucleotides or expression vectors described herein.

[0316] In some embodiments, the host cells can be used to receive, maintain, replicate and / or amplify vectors.

[0317] Non-limiting examples of expression host cells include immune cells (e.g., T lymphocytes, B lymphocytes, NK cells), hybridoma cells, mammalian cells such as Chinese hamster ovary (CHO) cells, COS cells, human embryonic kidney (HEK), yeast cells such as Pichia pastoris cells, or bacterial cells such as DH5α. T lymphocytes

[0318] In another aspect, the present invention provides a T lymphocyte comprising any one or more of the polynucleotides, expression vectors, or fusion proteins described herein.

[0319] In another aspect, the invention provides a method for producing a CAR comprising: a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs; a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell and a second TAA; or A T lymphocyte is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein between a CAR capable of binding to one or more first TAAs and a T cell and a T cell engager (TE or BiTE) capable of binding to a second TAAs.

[0320] In another aspect, the present invention provides a T lymphocyte comprising a first polynucleotide of a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, the first and second polynucleotides are each independently provided herein. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.

[0321] In some embodiments, the T cell engager is capable of binding to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager is capable of binding to CD2, CD3, CD31, CD277. In specific embodiments, the T cell engager is capable of binding to CD3.

[0322] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in hematological cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both, are expressed in hematological cancer cells selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.

[0323] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells (e.g., breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, skin tumor cells). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells selected from breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.

[0324] In some embodiments, the one or more first TAAs are selected from the group consisting of colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphocyte antigen APO-1, cancer antigen B1, B7H3, β-catenin, ALEB / LEY blood group, Burkitt lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD4 6, CD52, CD79a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (LEB blood group), CO-514 (LEA blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T cell antigen Gp37, melanoma antigen gp75, GPA33, HER2 antigen (e.g., pi85HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, polymer Human melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, P15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acid phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA- 4, sTn, T cell receptor-derived peptide, T5A7, TAG-72, TL5 (blood type A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood type H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, Y hapten, and Ley.

[0325] In some embodiments, the one or more first TAAs are independently selected from interleukin-13 receptor subunit-2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC3), and combinations thereof.

[0326] In some embodiments, the second TAA is IL13Rα2, HER2, EGFR, EGFRvIII, or GPC3.

[0327] In some embodiments, the present invention provides a method for treating a cancer cell comprising: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen); or A T lymphocyte is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen).

[0328] In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen). In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR targeting HER2 and IL13Rα2 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen).

[0329] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen). In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0330] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to HER2 and IL13Rα2.

[0331] In some embodiments, the present invention provides a method for treating a cancer cell comprising: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or A T lymphocyte is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0332] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen). In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets HER2 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0333] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0334] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to HER2.

[0335] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one HER2. In some embodiments, the bispecific CAR is capable of binding to two HER2s.

[0336] In some embodiments, the present invention provides a method for treating a cancer cell comprising: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or A T lymphocyte is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0337] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR targeting EGFR or EGFRvIII described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0338] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0339] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to EGFR or EGFRvIII.

[0340] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one EGFR or EGFRvIII. In some embodiments, the bispecific CAR is capable of binding to two EGFRs or EGFRvIIIs.

[0341] In some embodiments, the present invention provides a method for treating a cancer cell comprising: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or A T lymphocyte is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0342] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets GPC3 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0343] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0344] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to GPC3.

[0345] In some embodiments, the bispecific CAR can bind to two epitopes of one GPC3. In some embodiments, the bispecific CAR can bind to two GPC3s.

[0346] The T cells according to the present invention may be any T cells, such as cultured T cells, e.g., primary T cells, or T cells from a cultured T cell line, or T cells from a mammal. When obtained from a mammal, the T cells can be obtained from many sources, including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. The T cells may be enriched or purified. The T cells are preferably human T cells (e.g., isolated from a human). The T cells may be CD4 + / CD8 + CD4 double-positive T cells, Th and Th2 cells, etc. + Helper T cells, CD8 + T cells may be at any stage of development, including, but not limited to, CD8 T cells (e.g., cytotoxic T cells), tumor-infiltrating cells, memory T cells, naive T cells, etc. In some embodiments, T cells are CD8 + T cells or CD4 + T cells. T cell lines are available from, for example, the American Type Culture Collection (ATCC, Manassas, Virginia) and the German Collection of Microbial Cell Cultures (DSMZ), and include, for example, Jurkat cells (ATCC TIB-152), Sup-T1 cells (ATCC CRL-1942), RPMI 8402 cells (DSMZ ACC-290), Karpas 45 cells (DSMZ ACC-545), and derivatives thereof.

[0347] The T lymphocytes may be autologous, homologous or allogeneic.

[0348] One or more polynucleotides described in the present invention can be introduced into cells using physical or chemical methods such as transfection, transformation, or transduction. Many transfection techniques are known in the art, including calcium phosphate DNA co-precipitation (e.g., Murray EJ (ed.), Methods in Molecular Biology, Vol. 7, Gene Transfer and Expression Protocols, Humana Press (1991)), DEAE-dextran, electroporation, cationic liposome-mediated transfection, tungsten particle-assisted particle bombardment (Johnston, Nature, 346:776-77 (1990)), and strontium phosphate DNA co-precipitation (see Brash et al., Mol. Cell Biol., 7:2031-34 (1987)). After the infectious particles are propagated in appropriate packaging cells, the phage or viral vector can be introduced into host cells, where many packaging cells are commercially available.

[0349] In some embodiments, retroviruses are used to deliver polynucleotides encoding the bispecific CAR, T cell engager (TE or BiTE), or both, to T lymphocytes described in the present invention. Retroviruses are common tools for gene delivery (Miller, 2000, Nature 357:455-60). Non-limiting examples of retroviruses suitable for certain embodiments include Moloney murine leukemia virus (M-MULV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMUSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), foamy virus, Friend murine leukemia virus, murine stem cell virus (MSCV), and Rous sarcoma virus (RSV), and lentiviruses. Non-limiting examples of lentiviruses include human immunodeficiency viruses (e.g., HIV type 1 and HIV type 2), Visna-Maedi virus (VMV), Caprine Arthritis-Encephalitis Virus (CAEV), Equine Infectious Anemia Virus (EIAV), Feline Immunodeficiency Virus (FIV), Bovine Immunodeficiency Virus (BIV), and Simian Immunodeficiency Virus (SIV).

[0350] The T lymphocytes according to the present invention can be maintained by using cytokines such as IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21.

[0351] The T lymphocytes described herein can be contacted with a cancer cell population (e.g., GBM cells) ex vivo, in vivo, or in vitro. For example, the T lymphocytes described herein can be cultured ex vivo under conditions that express the bispecific CAR and T cell engager (TE or BiTE), and then directly transplanted into a subject (e.g., a mammal, such as a human) affected by cancer (e.g., a solid tumor such as GBM). Such cell transplantation methods are referred to in the art as "adoptive cell transfer (ACT)," in which immune-derived cells are passively transplanted into a new recipient host to transfer the function of the donor immune-derived cells to the new host.

[0352] Adoptive cell transfer methods for treating various types of cancer are all known in the art and have been described in the prior art, e.g., Gattinoni et al., Nat. Rev. Immunol, 6(5):383-93 (2006); June, J. Clin. Invest., 117(6):1466-76 (2007); Rapoport et al., Blood, 117(3):788-97 (2011); and Barber et al., Gene Therapy, 18:509-16 (2011).

[0353] The T lymphocytes described herein can be introduced into mammals, such as humans, using a variety of techniques and reagents known to those skilled in the art. In some embodiments, the T lymphocytes are introduced into a tumor site. In some embodiments, the T lymphocytes are modified to adapt to cancer. The number of cells used will depend on the specific circumstances, such as the purpose of the introduction, the lifespan of the T lymphocytes, and the number of administrations. Composition, pharmaceutical composition, and reagent kit

[0354] In another aspect, the invention provides a composition comprising any one or more of the polynucleotides, vectors, fusion proteins, host cells, or T lymphocytes described herein. In some embodiments, the composition comprises any one or more of the T lymphocytes described herein.

[0355] In another aspect, the present invention provides a pharmaceutical composition comprising any one or more compositions described herein and a pharmaceutically acceptable vector, excipient, stabilizer, diluent, or enhancer.

[0356] In certain embodiments, the composition or medicament further comprises a cryopreservation medium that comprises about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO), but is substantially serum-free.

[0357] In some embodiments, the composition or pharmaceutical composition is stored in a vial.

[0358] In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes are mutated using a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to the T cells and a second TAA; Alternatively, a composition is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell and a T cell engager (TE or BiTE) capable of binding to a second TAAs.

[0359] In another aspect, the present invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, the first and second polynucleotides are each independently provided herein. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.

[0360] In some embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager (TE or BiTE) can bind to CD2, CD3, CD31, or CD277. In specific embodiments, the T cell engager (TE or BiTE) can bind to CD3.

[0361] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in hematological cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both, are expressed in hematological cancer cells selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.

[0362] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells (e.g., breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, skin tumor cells). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells selected from breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.

[0363] In some embodiments, the one or more first TAAs are selected from the group consisting of colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphocyte antigen APO-1, cancer antigen B1, B7H3, β-catenin, ALEB / LEY blood group, Burkitt lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD4 6, CD52, CD79a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (LEB blood group), CO-514 (LEA blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T cell antigen Gp37, melanoma antigen gp75, GPA33, HER2 antigen (e.g., pi85HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, polymer Human melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, P15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acid phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA- 4, sTn, T cell receptor-derived peptide, T5A7, TAG-72, TL5 (blood type A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood type H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, Y hapten, and Ley.

[0364] In some embodiments, the one or more first TAAs are independently selected from interleukin-13 receptor subunit-2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC3), and combinations thereof.

[0365] In some embodiments, the second TAA is IL13Rα2, HER2, EGFR, EGFRvIII, or GPC3.

[0366] In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes are co-expressed with a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; The present invention provides a composition comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA, or a combination thereof.

[0367] In some embodiments, the TAA is a glioblastoma tumor antigen.

[0368] In some embodiments, the first polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR targeting HER2 and IL13Rα2. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA (e.g., a glioblastoma tumor antigen). In some embodiments, the third polynucleotide is any one of the polynucleotides described herein encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE).

[0369] In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least some of the T lymphocytes are capable of expressing a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; A composition is provided, comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA, or a combination thereof.

[0370] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets HER2. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0371] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0372] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to HER2.

[0373] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one HER2. In some embodiments, the bispecific CAR is capable of binding to two HER2s.

[0374] In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least some of the T lymphocytes are co-transfected with a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or Compositions are provided, including a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA, or a combination thereof.

[0375] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets EGFR or EGFRvIII. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0376] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE) described herein.

[0377] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to EGFR or EGFRvIII.

[0378] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one EGFR or EGFRvIII. In some embodiments, the bispecific CAR is capable of binding to two EGFRs or EGFRvIIIs.

[0379] In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least some of the T lymphocytes are capable of expressing a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; The present invention provides a composition comprising a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA, or a combination thereof.

[0380] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets GPC3. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0381] In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides described herein encoding a fusion protein of a dual CAR and a T cell engager (TE or BiTE).

[0382] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to GPC3.

[0383] In some embodiments, the bispecific CAR can bind to two epitopes of one GPC3. In some embodiments, the bispecific CAR can bind to two GPC3s.

[0384] Suitable pharmaceutically acceptable vectors, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Non-limiting examples of pharmaceutically acceptable vectors, excipients, stabilizers, diluents, or enhancers include buffers (e.g., phosphate, citrate, histidine), antioxidants (e.g., ascorbic acid or methionine), preservatives, proteins (e.g., serum albumin, gelatin, or immunoglobulins), hydrophilic polymers, amino acids, carbohydrates (e.g., monosaccharides, disaccharides, glucose, mannose, or dextrins), chelating agents (e.g., EDTA), sugars (e.g., sucrose, mannitol, trehalose, or sorbitol), salt-forming counterions (e.g., sodium), metal complexes (e.g., zinc-protein complexes), non-ionic surfactants (e.g., Tween), PLURONICS™, and polyethylene glycol (PEG).

[0385] In some embodiments, compositions (e.g., pharmaceutical compositions) described herein are prepared for use in an appropriate administration regimen and route. Non-limiting examples of administration routes include oral, rectal, mucosal, intravenous, intramuscular, subcutaneous, and topical. In some embodiments, compositions (e.g., pharmaceutical compositions) described herein are stored in the form of an aqueous solution or a dried formulation (e.g., lyophilized).

[0386] In some embodiments, the composition (eg, pharmaceutical composition) is prepared for administration by injection (eg, intracranial ventricular injection, intracranial infusion, or intravenous infusion).

[0387] In some embodiments, the composition (eg, pharmaceutical composition) is prepared for co-administration with a second therapeutic agent.

[0388] In another aspect, the present invention provides a reagent kit comprising a container containing any one or more compositions or pharmaceutical compositions described herein and optional instructions for use. How to use

[0389] In another aspect, the present invention provides the use of any one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions) or reagent kits described herein in the preparation of a medicament for treating cancer in a subject in need thereof.

[0390] In another aspect, the present invention provides the use of any one or more T lymphocytes, compositions (e.g., pharmaceutical compositions), or reagent kits described herein in the preparation of a medicament for treating cancer in a subject in need thereof.

[0391] In other aspects, the present invention provides any one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or reagent kits described herein for treating cancer in a subject in need thereof.

[0392] In another aspect, the present invention provides any one or more T lymphocytes, compositions (e.g., pharmaceutical compositions), or reagent kits described herein for treating cancer in a subject in need thereof.

[0393] In another aspect, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective dose of any one or more T lymphocytes, compositions, or pharmaceutical compositions described herein.

[0394] In some embodiments, the cancer is a solid tumor such as breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, ovarian cancer, kidney cancer, stomach cancer, colon cancer, rectal cancer, testicular cancer, head and / or neck cancer, pancreatic cancer, brain cancer, or skin cancer. Thus, in some embodiments, the cancer is a solid tumor cell selected from breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, ovarian cancer, kidney cancer, stomach cancer, rectal cancer, colorectal cancer, testicular cancer, head and / or neck cancer, pancreatic cancer, brain cancer, and skin cancer.

[0395] In some embodiments, the cancer is a blood cancer, such as leukemia, lymphoma, or myeloma. Blood cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the cancer is a blood cancer selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.

[0396] In certain embodiments, the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer. In some embodiments, the brain tumor is a glioblastoma (GBM). In certain embodiments, the GBM is a primary glioblastoma multiforme. In certain embodiments, the GBM is a recurrent glioblastoma multiforme. In some embodiments, the brain tumor is a metastatic brain tumor. In certain embodiments, the metastatic brain tumor is a non-small cell lung cancer brain metastasis (NSCLCBM), a small cell lung cancer brain metastasis (SCLCBM), a HER2-positive metastatic breast cancer, or a triple-negative breast cancer brain metastasis (TNBCBM). In some embodiments, the liver cancer is a hepatocellular carcinoma (HCC).

[0397] In another aspect, the present invention provides the use of any one of the compositions (e.g., polynucleotides, T lymphocytes) or pharmaceutical compositions described herein in the preparation of a medicament for treating a tumor (e.g., a solid tumor such as glioblastoma) in a subject in need thereof.

[0398] In another aspect, the present invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell and a second TAA; or and a third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell and a T cell engager (TE or BiTE) capable of binding to a second TAA.

[0399] In another aspect, the present invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more of the first TAAs. In some embodiments, the first and second polynucleotides are each independently provided herein. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.

[0400] In certain embodiments, the present invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a sequence encoding a T cell engager (TE or BiTE) capable of binding to T cells and a second TAA. In certain embodiments, the present invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to T cells and a second TAA, wherein the first and second polynucleotides are isolated.

[0401] In some embodiments, the T cell engager is capable of binding to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager is capable of binding to CD2, CD3, CD31, or CD277. In specific embodiments, the T cell engager is capable of binding to CD3.

[0402] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in hematological cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both, are expressed in hematological cancer cells selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.

[0403] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells (e.g., breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, skin tumor cells). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells selected from breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.

[0404] In some embodiments, the one or more first TAAs are selected from the group consisting of colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphocyte antigen APO-1, cancer antigen B1, B7H3, β-catenin, ALEB / LEY blood group, Burkitt lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD4 6, CD52, CD79a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (LEB blood group), CO-514 (LEA blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T cell antigen Gp37, melanoma antigen gp75, GPA33, HER2 antigen (e.g., pi85HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, polymer Human melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, P15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acid phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA- 4, sTn, T cell receptor-derived peptide, T5A7, TAG-72, TL5 (blood type A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood type H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, Y hapten, and Ley.

[0405] In some embodiments, the one or more first TAAs are independently selected from interleukin-13 receptor subunit-2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC3), and combinations thereof.

[0406] In some embodiments, the second TAA is IL13Rα2, HER2, EGFR, EGFRvIII, or GPC3.

[0407] In another embodiment, the present invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or The method includes a polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding to HER2 and IL13Rα2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0408] In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes are capable of expressing a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0409] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one HER2. In some embodiments, the bispecific CAR is capable of binding to two HER2s.

[0410] In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes are mutated to a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; and a third polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0411] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one EGFR or EGFRvIII. In some embodiments, the bispecific CAR is capable of binding to two EGFRs or EGFRvIIIs.

[0412] In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes are capable of expressing a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0413] In some embodiments, the bispecific CAR can bind to two epitopes of one GPC3. In some embodiments, the bispecific CAR can bind to two GPC3s.

[0414] In some embodiments, the TAA is a glioblastoma tumor antigen.

[0415] In some embodiments, the T lymphocytes are allogeneic or allogeneic T lymphocytes.

[0416] In some embodiments, the T lymphocytes are autologous T lymphocytes.

[0417] In some embodiments, the human subject is an infant (under 1 year old). In some embodiments, the human subject is under 11 years old. In some embodiments, the human subject is 11 years old or older. In some embodiments, the human subject is 12 years old or older. In some embodiments, the human subject is 12-17 years old. In some embodiments, the human subject is under 18 years old. In some embodiments, the human subject is an adult (18 years old or older). In some embodiments, the human subject is 40 years old or older, e.g., at least 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 years old. In some embodiments, the human subject is elderly (65 years old or older). In some embodiments, the human subject is 18 years old or older.

[0418] The subject to be treated according to the methods described herein may be a subject diagnosed with a particular condition or a subject at risk for developing such a condition. Diagnosis can be performed by any method or technique known in the art. Those skilled in the art will understand that the subject to be treated in the present disclosure may have undergone standard testing or may have been identified as at risk without the need for testing due to the presence of one or more risk factors associated with the disease or condition.

[0419] In some embodiments, the mammalian subject is suffering from cancer.

[0420] In some embodiments, the cancer is a hematological cancer. In some embodiments, the cancer is a hematological cancer and the bispecific CAR is capable of binding to (e.g., targeting) CD19, CD20, CD22, CD30, CD33, CD123, CD138, BCMA, or a combination thereof.

[0421] In some embodiments, the blood cancer is leukemia.

[0422] In some embodiments, the leukemia is selected from acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), hairy cell leukemia (HCL), myelodysplastic syndrome (MDS), and combinations thereof.

[0423] In some embodiments, the hematological cancer comprises lymphoma.

[0424] In some embodiments, the lymphoma comprises Hodgkin's lymphoma.

[0425] In some embodiments, the Hodgkin's lymphoma is selected from nodular sclerosing Hodgkin's lymphoma (NSCHL), mixed cellularity Hodgkin's lymphoma (MCCHL), lymphocyte-rich Hodgkin's disease (LRCHL), lymphopenic Hodgkin's disease (LDHL), and combinations thereof.

[0426] In some embodiments, the lymphoma comprises non-Hodgkin's lymphoma (NHL).

[0427] In some embodiments, the non-Hodgkin's lymphoma comprises a B-cell lymphoma.

[0428] In some embodiments, the B-cell lymphoma is selected from diffuse large B-cell lymphoma (DLBCL), primary mediastinal B-cell lymphoma (PMBCL), follicular lymphoma (FL), small lymphocytic lymphoma (SLL), marginal zone lymphoma (MZL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia (WMG), Burkitt's lymphoma (BL), and combinations thereof.

[0429] In some embodiments, the non-Hodgkin's lymphoma comprises a T-cell lymphoma.

[0430] In some embodiments, the T-cell lymphoma is selected from peripheral T-cell lymphoma (PTCL), anaplastic large cell lymphoma (ALCL), angioimmunoblastic T-cell lymphoma (AITL), cutaneous T-cell lymphoma, and combinations thereof.

[0431] In some embodiments, the hematological cancer comprises multiple myeloma.

[0432] In some embodiments, the multiple myeloma is selected from light chain multiple myeloma (LCMM), non-secretory multiple myeloma (NSMM), solitary plasmacytoma (SP), extramedullary plasmacytoma (EMP), monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma (SMM), immunoglobulin D multiple myeloma (IGDMM), immunoglobulin E (IGE) multiple myeloma, and combinations thereof.

[0433] In some embodiments, the cancer is a solid tumor.

[0434] In some embodiments, the solid tumor is a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, skin, or a combination thereof.

[0435] In some embodiments, the solid tumor is selected from bladder cancer, brain cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, fallopian tube cancer, gastric cancer, genitourinary tract cancer, head and neck cancer, liver cancer, lung cancer, melanoma, nasopharyngeal carcinoma (NPC), pancreatic cancer, prostate cancer, ovarian cancer, rectal cancer, kidney cancer, skin cancer, stomach cancer, testicular cancer, thyroid cancer, urethral cancer, and combinations thereof.

[0436] In some embodiments, the solid tumor is selected from breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, mesothelioma, renal clear cell carcinoma, papillary renal cell carcinoma, hepatocellular carcinoma (HCC), castration-resistant prostate cancer, head and neck squamous cell carcinoma, esophageal cancer, gastrointestinal cancer, endometriosis, and combinations thereof. In some embodiments, the solid tumor is selected from breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, hepatocellular carcinoma (HCC), and combinations thereof. In certain embodiments, the solid tumor is breast cancer. In certain embodiments, the solid tumor is NSCLC. In certain embodiments, the solid tumor is lung adenocarcinoma. In certain embodiments, the solid tumor is mesothelioma. In certain embodiments, the solid tumor is HCC.

[0437] In some embodiments, the solid tumor is a metastatic lesion of a cancer.

[0438] In some embodiments, the cancer is glioblastoma (GBM), breast cancer, or lung cancer. In some embodiments, the cancer is GBM. In some embodiments, the subject is newly diagnosed with glioblastoma. In some embodiments, the subject has relapsed from or is resistant to a previous glioblastoma treatment. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is HER2-positive breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the lung cancer is brain metastatic lung cancer.

[0439] In some embodiments, at least about 10% of the T lymphocytes administered to a subject express the bispecific CAR and T cell engager (TE or BiTE). For example, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the T lymphocytes administered to a subject express the bispecific CAR and T cell engager (TE or BiTE). In some embodiments, between about 10-80% of the T lymphocytes express the bispecific CAR and T cell engager (TE or BiTE). For example, approximately 10-75%, 15-75%, 15-70%, 20-70%, 20-65%, 25-65%, 25-60%, 30-60%, 30-55%, 35-55%, 35-50%, or 40-50% of the T lymphocytes express the bispecific CAR and T cell engager (TE or BiTE).

[0440] In some embodiments, at least 10% of the T lymphocytes express the bispecific CAR. For example, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the T lymphocytes express the bispecific CAR. In some embodiments, about 10-80% of the T lymphocytes express the bispecific CAR. For example, about 10-75%, 15-75%, 15-70%, 20-70%, 20-65%, 25-65%, 25-60%, 30-60%, 30-55%, 35-55%, 35-50%, or 40-50% of the T lymphocytes express the bispecific CAR.

[0441] In some embodiments, the T lymphocytes comprise 1 to 4 copies of a polynucleotide encoding each of the bispecific CAR and T cell engager (TE or BiTE) within each T lymphocyte. For example, the T lymphocytes can comprise about 0, 1, 2, 3, or 4, or 1 to 4, 1 to 3, 1 to 2, 2 to 4, or 2 to 3 copies of a polynucleotide comprising each of the bispecific CAR and T cell engager (TE or BiTE).

[0442] In some embodiments, the method is used for prophylactic treatment. In some embodiments, the method is used as a first line therapy. In some embodiments, the method is used as a second line therapy. In some embodiments, the method is used as a third line therapy.

[0443] In some embodiments, the methods are used to treat cancer.

[0444] The therapeutic agents described herein can be administered by a variety of routes of administration, including, for example, oral, ingested, topical, transdermal, rectal, parenteral (e.g., intra-arterial, intravenous, intramuscular, subcutaneous injection, intradermal injection), intravenous infusion, and inhalation (e.g., intrabronchial, intranasal, or oral inhalation, nasal instillation), as determined by the compound and the particular disease being treated. As indicated, administration may be local or systemic. The preferred method of administration may vary depending on the particular compound selected.

[0445] In some embodiments, the T lymphocytes are administered as a single infusion (e.g., a single intracranial ventricular, intracranial, or intravenous infusion). In some embodiments, the T lymphocytes are administered as two or more infusions (e.g., intracranial ventricular, intracranial, or intravenous infusions, or a combination thereof).

[0446] In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of a second therapeutic agent.

[0447] In some embodiments, the method further comprises administering a treatment (e.g., chemotherapy) to the subject before, during, or after administration of the T lymphocytes or a combination thereof. For example, a short course of chemotherapy can be administered prior to CAR-T treatment to improve efficacy.

[0448] In some embodiments, the method further comprises managing CRS and neurotoxicity associated with CAR-T therapy during or after administration of the T lymphocytes.

[0449] Administration of two or more therapeutic agents includes co-administering the therapeutic agents essentially simultaneously, e.g., by combining drugs. Optionally, such administration includes co-administration in multiple containers or in separate containers (e.g., capsules, powders, and liquids) for each therapeutic agent. Such administration further includes using each type of therapeutic agent sequentially, at about the same time or at different times. The compositions described herein and the second therapeutic agent can be administered by the same route of administration or by different routes of administration.

[0450] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes are contacted with a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to the T cells and a second TAA; or and a third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell and a T cell engager (TE or BiTE) capable of binding to a second TAA.

[0451] In another aspect, the present invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell and a T cell engager (TE or BiTE) capable of binding to a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, the present specification provides each of the first and second polynucleotides independently. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.

[0452] In certain embodiments, the present invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to the T cells and a second TAA. In certain embodiments, the present invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to the T cells and a second TAA, wherein the first and second polynucleotides are isolated.

[0453] In some embodiments, the T cell engager is capable of binding to CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell engager is capable of binding to CD2, CD3, CD31, or CD277. In specific embodiments, the T cell engager is capable of binding to CD3.

[0454] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in hematological cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated by the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both, are expressed in hematological cancer cells selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.

[0455] In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells (e.g., breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, colon, rectum, testis, head and / or neck, pancreas, brain, skin tumor cells). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed in solid tumor cells selected from breast, lung, prostate, colon, bladder, ovarian, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.

[0456] In some embodiments, the one or more first TAAs are selected from the group consisting of colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphocyte antigen APO-1, cancer antigen B1, B7H3, β-catenin, ALEB / LEY blood group, Burkitt lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD4 6, CD52, CD79a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (LEB blood group), CO-514 (LEA blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T cell antigen Gp37, melanoma antigen gp75, GPA33, HER2 antigen (e.g., pi85HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, polymer Human melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, P15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acid phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA- 4, sTn, T cell receptor-derived peptide, T5A7, TAG-72, TL5 (blood type A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood type H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, Y hapten, and Ley.

[0457] In some embodiments, the one or more first TAAs are independently selected from interleukin-13 receptor subunit-2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC3), and combinations thereof.

[0458] In some embodiments, the second TAA is IL13Rα2, HER2, EGFR, EGFRvIII, or GPC3.

[0459] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or The method includes a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0460] In some embodiments, the TAA is a glioblastoma tumor antigen.

[0461] In some embodiments, the first polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR targeting HER2 and IL13Rα2. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a glioblastoma tumor antigen. In some embodiments, the third polynucleotide is any one of the polynucleotides described herein encoding a fusion protein of a dual CAR and a T cell binder (TE or BIT).

[0462] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0463] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets HER2. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0464] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to HER2.

[0465] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one HER2. In some embodiments, the bispecific CAR is capable of binding to two HER2s.

[0466] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to EGFR or EGFRvIII and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0467] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to EGFR or EGFRvIII, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets EGFR or EGFRvIII. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0468] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to EGFR or EGFRvIII.

[0469] In some embodiments, the bispecific CAR is capable of binding to two epitopes of one EGFR or EGFRvIII. In some embodiments, the bispecific CAR is capable of binding to two EGFRs or EGFRvIIIs.

[0470] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA; or a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to GPC3 and a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0471] In some embodiments, the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to GPC3, and a second polynucleotide comprising a sequence encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets GPC3. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell engager (TE or BiTE) capable of binding to CD3 and a TAA.

[0472] In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding to GPC3.

[0473] In some embodiments, the bispecific CAR can bind to two epitopes of one GPC3. In some embodiments, the bispecific CAR can bind to two GPC3s.

[0474] In some embodiments, the tumor cells are solid tumor cells. In some embodiments, the tumor cells are glioblastoma cells, breast cancer cells, or lung cancer cells. In some embodiments, the tumor cells are glioblastoma cells. In some embodiments, the tumor cells are breast cancer cells. In some embodiments, the breast cancer cells are HER2-positive breast cancer cells. In some embodiments, the tumor cells are lung cancer cells. In some embodiments, the lung cancer cells are brain-metastatic lung cancer cells.

[0475] In some embodiments, the glioblastoma cells are present in any subject described herein, and the glioblastoma cells are contacted with an effective dose of T lymphocytes by administering an effective dose of T lymphocytes to the subject. Dual-CAR_Dual-Arm BiTE Engineered T Cells

[0476] In another aspect, the present invention provides a T lymphocyte comprising a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to two TAAs (e.g., two different antigens expressed on the cell surface) and a T cell (e.g., CD3) and a T cell engager (TE or BiTE) capable of binding to the TAAs.

[0477] In another aspect, the present invention provides a polynucleotide comprising a sequence encoding a fusion protein described herein.

[0478] In another aspect, the present invention provides an expression vector comprising a polynucleotide described herein.

[0479] In another aspect, the present invention provides a host cell comprising a polynucleotide or expression vector described herein.

[0480] In another aspect, the present invention provides a composition comprising lymphocytes, wherein at least a portion of said lymphocytes comprise a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR and a T cell engager (TE or BiTE) capable of binding to a T cell (e.g., CD3) and a TAA.

[0481] In another aspect, the invention provides a pharmaceutical composition comprising a composition described herein and a pharmaceutically acceptable vector.

[0482] In another aspect, the present invention provides a reagent kit comprising a container containing a pharmaceutical composition described herein and optional instructions for use.

[0483] In another aspect, the present invention provides the use of a composition or pharmaceutical composition as described herein in the preparation of a medicament for treating a tumor as described herein in a subject in need thereof as described herein.

[0484] In another aspect, the present invention provides a method of treating a tumor as described herein in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR and a T cell engager (TE or BiTE) capable of binding to a T cell (e.g., CD3) and a TAA (e.g., a tumor antigen such as a glioblastoma antigen).

[0485] In another aspect, the invention provides a method of inducing T cell-mediated tumor cell lysis, comprising contacting tumor cells with an effective dose of T lymphocytes, wherein at least some of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR and a T cell engager (TE or BiTE) capable of binding to a T cell (e.g., CD3) and a TAA (e.g., a tumor antigen such as a glioblastoma antigen).

[0486] In some embodiments, the bispecific CAR comprises an IL13 mutein linked to a HER2-binding scFv via a linker sequence.

[0487] In some embodiments, the bispecific CAR comprises an IL13 mutein linked to a HER2-binding scFv via a linker sequence. In some embodiments, the IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the IL13 mutein comprises the amino acid sequence set forth in SEQ ID NO: 1.

[0488] In some embodiments, the HER2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof. In some embodiments, the HER2-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the HER2-binding scFv comprises the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4. In some embodiments, the HER2-binding scFv comprises the amino acid sequence set forth in SEQ ID NO: 4.

[0489] In some embodiments, the bispecific CAR comprises: CD8α signal peptide, CD8α hinge, CD28 transmembrane domain, 4-1BB costimulatory domain, CD3ζ signal domain, or a combination thereof.

[0490] In some embodiments, The linker comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 5, the CD8α signal peptide comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 6; the CD8α hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 7; the CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 8; the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:9; or the CD3ζ signal domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0491] In some embodiments, the linker comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO:5, the CD8α signal peptide comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO:6; the CD8α hinge comprises approximately 1 to 5 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 7; the CD28 transmembrane domain contains approximately 1 to 3 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 8; the 4-1BB costimulatory domain comprises about 1 to 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 9; or the CD3ζ signal domain comprises approximately 1 to 12 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0492] In some embodiments, The linker comprises the amino acid sequence shown in SEQ ID NO: 5, the CD8α signal peptide comprises the amino acid sequence shown in SEQ ID NO: 6, the CD8α hinge comprises the amino acid sequence set forth in SEQ ID NO: 7; the CD28 transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8; The 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 9; or the CD3ζ signal domain comprises the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0493] In some embodiments, the T cell engager (TE or BiTE) comprises a CD3-binding scFv. In some embodiments, the CD3-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the CD3-binding scFv comprises the amino acid sequence set forth in SEQ ID NO: 14.

[0494] In some embodiments, the TAA is an EGFR antigen. In some embodiments, the TAA is an EGFRvIII antigen.

[0495] In some embodiments, the T cell engager (TE or BiTE) comprises: at least one EGFR-binding Nanobody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 18), or It comprises at least one EGFRvIII-binding Nanobody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 18).

[0496] In some embodiments, the T cell engager (TE or BiTE) comprises: at least two EGFR-binding nanobodies, at least two EGFRvIII-binding Nanobodies, or It comprises at least one EGFR-binding Nanobody and at least one EGFRvIII-binding Nanobody.

[0497] In some embodiments, said at least one EGFR-binding Nanobody comprising an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof; or The at least one EGFRvIII-binding Nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 15, 16 or 17, or a combination thereof.

[0498] In some embodiments, the T cell engager (TE or BiTE) further comprises a signal peptide and a 6xHis tag sequence (SEQ ID NO: 20). In some embodiments, the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 19. In some embodiments, the signal peptide comprises about one or two amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 19.

[0499] In some embodiments, the T cell engager (TE or BiTE) comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 109, 110, 111, 176, 177, 178, or 292. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 109, 110, or 111, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises about 1-55 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 24, 25, 26, 27, 176, 177, 178, or 292, or a combination thereof. In some embodiments, the T cell engager (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 176, 177, 178, or 292.

[0500] In some embodiments, the T cell engager (TE or BiTE) comprises: an EGFR antibody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 16); or It comprises an EGFRvIII antibody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 16).

[0501] In some embodiments, the EGFR antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:29; or The EGFRvIII antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:29.

[0502] In some embodiments, the EGFR antibody comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 29; or The above-mentioned EGFRvIII antibody contains about 1 to 25 amino acid substitutions with respect to the amino acid sequence shown in SEQ ID NO:29.

[0503] In some embodiments, the EGFR antibody comprises the amino acid sequence set forth in SEQ ID NO: 29; or The EGFRvIII antibody comprises the amino acid sequence shown in SEQ ID NO:29.

[0504] In some embodiments, the fusion protein further comprises a self-cleaving T2A peptide (SEQ ID NO: 28).

[0505] In some embodiments, the fusion protein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, or 38, or a combination thereof.

[0506] In some embodiments, the fusion protein comprises about 1 to 100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, or 38, or a combination thereof. In some embodiments, the fusion protein comprises about 1 to 100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 37. In some embodiments, the fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, or 38. In some embodiments, the fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 37.

[0507] In another aspect, the present invention provides polypeptides comprising an amino acid sequence having at least 60% identity to the amino acid sequences set forth in SEQ ID NOS: 2-4, 15-17, and 242-291. Illustratively, the sequence identity is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the sequence identity is about 60-99%, 65-99%, 65-95%, 70-99%, 70-98%, 70-95%, 70-90%, 75-98%, 75-97%, 75-90%, 75-85%, 80-97%, 80-96%, 80-85%, 85-96%, 85-95%, or 90-95%. In certain embodiments, the sequence identity is at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).

[0508] In some embodiments, the polypeptide comprises at least one amino acid substitution with respect to the amino acid sequences set forth in SEQ ID NOs: 2 to 4, 15 to 17, and 242 to 291. In some embodiments, the at least one amino acid substitution is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1 to 12 amino acid substitutions, illustratively about 1 to 11, 2 to 11, 2 to 10, 3 to 10, 3 to 9, 4 to 9, 4 to 8, 5 to 8, 5 to 7, or 6 to 7 amino acid substitutions.

[0509] In certain embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NOs: 2-4, 15-17, and 242-291.

[0510] Unless otherwise defined, all technical terms, symbols, and other scientific terms or terms used herein are intended to have the meanings commonly understood by those skilled in the art. In some cases, for clarity and / or ease of reference, this specification defines terms with commonly understood meanings, and such definitions contained herein should not be construed as substantially different from the meanings commonly understood in the art. It is further understood that definitions of these terms in common dictionaries should be construed as having the same meaning as in the context of the relevant art and / or as otherwise defined herein.

[0511] In another aspect, the present invention provides a polypeptide that specifically binds to GPC3, the polypeptide comprising heavy chain complementarity-determining region 1 (HCDR1), heavy chain complementarity-determining region 2 (HCDR2), and heavy chain complementarity-determining region 3 (HCDR3), each comprising an amino acid sequence at least 90% identical to the amino acid sequence of HCDR1, HCDR2, and HCDR3 of the heavy chain variable region (VH) amino acid sequence set forth in SEQ ID NO: 284, SEQ ID NO: 286, or SEQ ID NO: 289. In some embodiments, the sequence identity is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the HCDR1, HCDR2, and HCDR3 are identical to the HCDR1, HCDR2, and HCDR3, respectively, of the VH amino acid sequence set forth in SEQ ID NO: 284, SEQ ID NO: 286, or SEQ ID NO: 289.

[0512] In one embodiment, the HCDR1, HCDR2 and HCDR3 are each SEQ ID NO: 303, SEQ ID NO: 304 and SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310 and SEQ ID NO: 308, SEQ ID NO: 311, SEQ ID NO: 312 and SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318 and SEQ ID NO: 316, SEQ ID NO: 319, SEQ ID NO: 320 and SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, or It has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to the amino acid sequences of SEQ ID NO: 325, SEQ ID NO: 326 and SEQ ID NO: 324.

[0513] In some embodiments, the HCDR1, HCDR2 and HCDR3 are each SEQ ID NO: 303, SEQ ID NO: 304 and SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310 and SEQ ID NO: 308, SEQ ID NO: 311, SEQ ID NO: 312 and SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318 and SEQ ID NO: 316, SEQ ID NO: 319, SEQ ID NO: 320 and SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, or It is the same as the amino acid sequences of SEQ ID NO:325, SEQ ID NO:326 and SEQ ID NO:324.

[0514] In some embodiments, the amino acid sequence of the polypeptide has at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identity to the amino acid sequence set forth in SEQ ID NO: 284, SEQ ID NO: 286 or SEQ ID NO: 289. In certain embodiments, the amino acid sequence of the polypeptide is the same as the amino acid sequence set forth in SEQ ID NO: 284, SEQ ID NO: 286 or SEQ ID NO: 289.

[0515] In some embodiments, the polypeptide shown is a Nanobody. term

[0516] Certain terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0517] As used herein, the terms "a," "an," or "such" are to be understood to include the plural unless the context clearly indicates otherwise.

[0518] Unless the context requires otherwise, terms such as "comprises" and variations of "comprises" used herein mean, for example, the inclusion of the specified wholes or steps or combinations of wholes or steps, but not the exclusion of any other wholes or steps or combinations of wholes or steps. The term "comprises" used herein can be substituted with the terms "containing" or "included."

[0519] As used herein, the term "consisting of" excludes any element, step, or ingredient not specified in the claim element. As used herein, the term "consisting essentially of" does not exclude elements or steps that do not materially affect the basic and novel characteristics of the claim. The terms "comprise," "contain," "include," and "have," whenever used in the context of an aspect or embodiment of the present invention, can in some embodiments be replaced with "consisting of" or "consisting essentially of" to modify the scope of the invention.

[0520] As used herein, the conjunction "and / or" between many reference elements is understood as an option, including both separately and in combination. For example, when two elements are connected by "and / or," the first option refers to the absence of coverage of the second element in the first element. The second option refers to the coverage of the second element in the absence of the first element. The third option refers to the coverage of both the first and second elements. Any one of these options is understood to be included in this meaning, and therefore satisfies the requirements of the term "and / or" as used herein. The simultaneous applicability of multiple options is also understood to be included in this meaning, and therefore satisfies the requirements of the term "and / or."

[0521] In a list, unless otherwise stated, each individual element of the list and each combination of the list should be understood to be a separate embodiment. For example, a list of embodiments stated as "A, B, or C" should be interpreted to include the embodiments "A," "B," "C," "A or B," "A or C," "B or C," or "A, B, or C."

[0522] As used herein, the term "antigen" refers to a substance that can be recognized by an antibody, B cell, or T cell. As used herein, the term "tumor-associated antigen" or "TAA" refers to a protein or polypeptide antigen expressed by a cancer cell (e.g., a tumor cell). For example, a TAA may be one or more surface proteins or polypeptides, nucleoproteins, or glycoproteins, or fragments thereof, of a cancer cell (e.g., a tumor cell). Exemplary TAAs include colon cancer antigen 19.9, gastric cancer mucin, antigen 4.2, glycoprotein A33 (gpA33), ADAM-9, gastric cancer antigen AH6, ALCAM, malignant human lymphocyte antigen APO-1, cancer antigen B1, B7H3, β-catenin, ALEB / LEY blood group, Burkitt lymphoma antigen-38.13, colon adenocarcinoma antigen C14, ovarian cancer antigen CA125, carboxypeptidase M, CD5, CD19, CD20, CD22, CD23, CD25, CD27, CD30, CD33, CD36, CD45, CD46, CD52, CD7 9a / CD79b, CD103, CD317, CDK4, carcinoembryonic antigen (CEA), CEACAM5, CEACAM6, C017-iA, CO-43 (LEB blood group), CO-514 (LEA blood group), CTA-1, CTLA4, cytokeratin 8, antigen D1.1, antigen D156-22, DR5, Ei series (B blood group), EGFR (epidermal growth factor receptor), adrenergic receptor A2 (EphA2), ErbB1, ErbB3, ErbB4, GAGE-1, GAGE-2, GD2 / GD3 / GM2, lung adenocarcinoma antigen F3, and antigen FC10.2, G49, ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, GD2, GD3, GICA19-9, GM2, gpOO, glucagon-3 (GPC3), human leukemia T cell antigen Gp37, melanoma antigen gp75, GPA33, HER2 antigen (e.g., pi85HER2), human milk fat globule (HMFG), human papillomavirus E6 / human papillomavirus E7, polymer Human melanoma antigen (HMWMAA), I antigen (differentiation antigen) I (Ma), integrin α-V-β-6 integrin P6 (ITGB6), interleukin-13 receptor α2 (IL13Rα2), JAM-3, KID3, KID31, KS1 / 4 pan-cancer antigen, human lung cancer antigens L6 and L20, LEA, LUCA-2, Mi:22:25:8, M18, M39, MAGE-1, MAGE-3, MART, MUC-1, MUM-1, Myl, N-acetylglucosaminyltransferase, neoglycoprotein, NS-10, OFA-1, OFA-2, oncostatin M, P15, melanoma-associated antigen P97, polycrystalline epithelial mucin (PEM), polycrystalline epithelial mucin antigen (PEMA), PIPA, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostatic acid phosphate, R24, RORi, sphingolipid, SSEA-1, SSEA-3, SSEA-4 , sTn, T cell receptor-derived peptides, T5A7, TAG-72, TL5 (blood group A), TNF-α receptor, TNF-B receptor, TNF-γ receptor, TRA-1-85 (blood group H), transferrin receptor, tumor-specific transplantation antigen (TSTA), carcinoembryonic antigen-α-fetoprotein (AFP), VEGF, VEGFR, VEP8, VEP9, VIM-D5, and Y hapten, Ley. In some embodiments, the TAAs include, but are not limited to, CEA, GPC3, MUC-1, EpCAM, HER receptor, PEM, Caludi6, and Cluadi-18.2, mesothelin, A33, G250, carbohydrate antigens Ley, Lex, Leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, MUC1, LMP2, idiotype, HPVE6&E7, EGFR, EGFRvIII, HER-2 / neu, MAGEA3, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA / MART1, CD19, CD20, CD22, CD33, CD5, CD70, or BCMA. In some embodiments, the TAA is in a non-tumor cancer cell. In other embodiments, the TAA is in a tumor cell.

[0523] The definitions of protein, peptide, and polypeptide are well known in the art. As used herein, the term "protein" has the same meaning as the term "peptide" or "polypeptide" and is understood to refer to a chain of amino acids arranged linearly and linked by peptide bonds between the carboxy and amino groups of adjacent amino acid residues. Thus, the term polypeptide may refer to the full-length amino acid sequence of a protein, or a fragment thereof.

[0524] As used herein, the term "T cell engager" or "TE" refers to a molecule (e.g., an antibody) capable of binding to an epitope, such as one, two, or more epitopes. In many embodiments, the T cell engager is capable of binding to a surface antigen on a T cell and a TAA. In some embodiments, the T cell engager is capable of binding to a surface antigen on a T cell and at least two TAA epitopes. In certain embodiments, the at least two epitopes are in a TAA. In some embodiments, the T cell engager is capable of binding to a surface antigen on a T cell and at least two TAAs. Without limitation, exemplary surface antigens on T cells can include CD2, CD3, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In many cases, the terms "BiTE," "T cell engager," and "TE" are used interchangeably.

[0525] As used herein, the term "conservative amino acid substitution" or "conservative substitution" refers to an amino acid substitution that has a value of 0 or greater in BLOSUM62.

[0526] As used herein, the term "highly conservative amino acid substitution" or "highly conservative substitution" refers to an amino acid substitution that has a value of at least 1 (eg, at least 2) in BLOSUM62.

[0527] As used herein, the term "expression vector" refers to a replicable nucleic acid capable of expressing one or more proteins from said nucleic acid when the expression vector is transformed into an appropriate expression host cell. As used herein, the term "promoter" refers to a DNA region to which RNA polymerase binds and initiates transcription of a gene. As used herein, the term "operably linked" means positioned within a recombinant polynucleotide, such as a vector, in such a way that the nucleic acid is expressed under the control of the element (e.g., promoter) linked to it. As used herein, the term "selectable marker element" is an element that confers a property suitable for manual selection. The selectable marker element may be a negative or positive selection marker.

[0528] As used herein, the term "ex vivo" refers to methods performed in or on cells or tissues in an artificial environment outside the body with minimal alteration to natural conditions. As used herein, the term "in vivo" refers to methods performed in a normal, intact living organism. As used herein, the term "in vitro" refers to methods performed using biological components isolated from their normal biological environment.

[0529] As used herein, the term "fusion protein" refers to a synthetic, semi-synthetic, or recombinant single protein molecule. A fusion protein may contain all or part of two or more different proteins and / or polypeptides linked via a covalent bond (e.g., a peptide bond).

[0530] As used herein, the term "sequence identity" refers to the degree, expressed as a percentage, that two nucleotide sequences or two amino acid sequences share the same residue at the same position when aligned to achieve the maximum level of identity. In sequence alignment and comparison, one sequence is typically designated as a reference sequence, and a test sequence is compared to the reference sequence. The sequence identity between a reference sequence and a test sequence is expressed as a percentage of positions over the entire length of the reference sequence, where the reference sequence and the test sequence share the same nucleotide or amino acid residue to achieve the maximum level of sequence identity when aligned to the reference sequence and the test sequence. For example, when alignment reaches the maximum level of identity, two sequences are considered to have 70% sequence identity if the test sequence has the same nucleotide or amino acid residue at 70% of the same positions over the entire length of the reference sequence.

[0531] Those skilled in the art can readily align sequences using an appropriate alignment method or algorithm to obtain maximum identity. In some cases, the alignment can include gaps introduced to provide maximum identity. Examples include the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), the similarity search method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), and visual inspection (see generally Ausubel et al., Current Protocols in Molecular Biology).

[0532] When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequent coordinates are designated, if necessary, along with algorithm program parameters. The sequence comparison algorithm calculates the percentage sequence identity of the test sequence relative to the reference sequence based on the designated program parameters. A common tool for determining percent sequence identity is the Basic Local Alignment of Proteins (BLASTP) search tool, obtained from the National Library of Medicine, National Center for Biotechnology Information, National Institutes of Health (Altschul et al., 1990). As used herein, the term "subject" or "patient" refers to a mammal (e.g., a human). In some embodiments, the subject is a mammal. In some embodiments, the subject is a mammal selected from a dog, cat, mouse, rat, hamster, guinea pig, horse, pig, sheep, cow, black horse, macaque, cynomolgus monkey, and human. In some embodiments, the subject is a primate. In some embodiments, the subject is a human.

[0533] As used herein, the terms "therapeutically effective amount," "effective amount," or "effective dose" refer to an amount effective at a dosage and for a period of time necessary to achieve a desired therapeutic effect (e.g., treatment, cure, suppression, or amelioration of a physiological response or a medical condition, etc.). A single administration does not necessarily achieve the full therapeutic effect, but rather, the full therapeutic effect may be achieved only after a series of administrations. Thus, a therapeutically effective amount can be administered once or multiple times. A therapeutically effective amount can vary depending on factors such as the condition, age, sex, and weight of the mammal, the method of administration, and the ability of the therapeutic agent or combination of therapeutic agents to elicit a desired response in an individual.

[0534] Those skilled in the art can determine the effective amount of the agent to be administered using the guidance provided herein and other methods known in the art. Relevant factors include the given reagent, drug formulation, route of administration, type of disease or condition, and the identity (e.g., age, sex, weight) or host of the subject being treated. For example, an appropriate dose may be about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.01 mg / kg to about 1 mg / kg body weight per treatment. Determining the dosage for a particular reagent, subject, and disease is entirely within the capabilities of one skilled in the art. Preferably, the dosage will not cause or minimize side effects.

[0535] The desired response or desired outcome can include an effect at the cellular level, tissue level, or clinical outcome. Thus, the term "therapeutically effective amount" or its equivalents depends on the context in which it is applied. For example, in some embodiments, the amount of the composition is sufficient to produce a therapeutic response compared to the response obtained without administration of the composition. In other embodiments, this is the amount that produces a beneficial or desired outcome in a subject compared to a control group. As defined herein, a therapeutically effective amount of a composition of the present disclosure can be readily determined by one of ordinary skill in the art using conventional methods known in the art. Dosage regimens and routes of administration can be adjusted to provide the optimal therapeutic response.

[0536] As used herein, the term "treatment" refers to the medical management of a patient with the intent to improve, ameliorate, stabilize (i.e., not worsen), prevent, or cure a disease, pathological condition, or medical condition, such as the specific indications listed herein. The term includes active therapy (treatment aimed at ameliorating the disease, pathological condition, or disorder), causal therapy (treatment aimed at the cause of the associated disease, pathological condition, or medical condition), palliative therapy (treatment designed to alleviate symptoms), preventative therapy (treatment aimed at minimizing or partially or completely arresting the progression of the associated disease, pathological condition, or medical condition), and supportive therapy (treatment intended to complement another treatment). Treatment further includes reducing the extent of a disease or condition, whether detectable or not, preventing the spread of a disease or condition, delaying or slowing the progression of a disease or condition, ameliorating or remission of a disease or condition, and remission (whether partial or complete). "Treatment" can also refer to prolonging survival as compared to expected survival without treatment. Those in need of treatment include those already suffering from the condition as well as those prone to have the condition or those in need of prevention of the condition.

[0537] As used herein, the term "amelioration" or "alleviation" of a disease or condition refers to a reduction in the severity and / or undesirable clinical symptoms of said disease, condition or condition and / or a slowing or delay in the progression of said disease, condition or condition compared to the severity or course of treatment without treatment.

[0538] As used herein, the term "vector" refers to a nucleic acid molecule that can be used to introduce nucleic acid sequences or genes into cells in vitro, ex vivo or in vivo.

[0539] The present invention further provides the following embodiments.

[0540] Embodiment 1 is a T lymphocyte, a) a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding to CD3 and a TAA, or b) It comprises a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a BiTE capable of binding to CD3 and a TAA.

[0541] Embodiment 2 is the T lymphocyte of embodiment 1, wherein said T lymphocyte comprises a polynucleotide comprising a sequence encoding the bispecific CAR, and a polynucleotide comprising a sequence encoding the BiTE.

[0542] Embodiment 3 is the T lymphocyte of embodiment 1, wherein said T lymphocyte comprises a polynucleotide comprising a sequence encoding a fusion protein of said bispecific CAR and said BiTE.

[0543] Embodiment 4 is the T lymphocyte of any one of embodiments 1 to 3, wherein the bispecific CAR comprises an IL13 mutein linked to a HER2-binding single-chain variable fragment (scFv) via a linker sequence.

[0544] Embodiment 5 is the T lymphocyte of embodiment 4, wherein the IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1.

[0545] Embodiment 6 is the T lymphocyte of embodiment 4, wherein the IL13 mutein comprises about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:1.

[0546] Embodiment 7 is the T lymphocyte of embodiment 4, wherein the IL13 mutein comprises the amino acid sequence set forth in SEQ ID NO:1.

[0547] Embodiment 8 is the T lymphocyte of any one of embodiments 1 to 7, wherein the HER2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof.

[0548] Embodiment 9 is the T lymphocyte of embodiment 8, wherein the HER2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:4.

[0549] Embodiment 10 is the T lymphocyte of any one of Embodiments 1 to 7, wherein the HER2-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 2, 3, or 4, or a combination thereof.

[0550] Embodiment 11 is the T lymphocyte of embodiment 10, wherein the HER2-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:4.

[0551] Embodiment 12 is the T lymphocyte of any one of embodiments 1 to 7, wherein the HER2-binding scFv comprises the amino acid sequence shown in SEQ ID NO: 2, 3 or 4.

[0552] Embodiment 13 is the T lymphocyte of embodiment 12, wherein the HER2-binding scFv comprises the amino acid sequence set forth in SEQ ID NO:4.

[0553] Embodiment 14 is the T lymphocyte of embodiment 6, 10 or 11, wherein said amino acid substitutions are conservative substitutions.

[0554] Embodiment 15 is the T lymphocyte of embodiment 6, 10 or 11, wherein said amino acid substitutions are highly conservative substitutions.

[0555] Embodiment 16 is the T lymphocyte of any one of embodiments 1 to 15, wherein the bispecific CAR is a) CD8α signal peptide, b) CD8α hinge, c) CD28 transmembrane domain, d) 4-1BB costimulatory domain; e) CD3ζ signal domain; or a combination thereof.

[0556] Embodiment 17 is the T lymphocyte of embodiment 16, wherein: a) the linker comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 5; b) the CD8α signal peptide comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 6; c) the CD8α hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 7; d) the CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 8; e) the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 9; or f) the CD3ζ signal domain comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0557] Embodiment 18 is the T lymphocyte of embodiment 16, wherein: a) the linker comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 5; b) the CD8α signal peptide comprises one or two amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 6; c) the CD8α hinge comprises approximately 1 to 5 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 7; d) the CD28 transmembrane domain comprises about 1 to 3 amino acid substitutions with respect to the amino acid sequence set forth in SEQ ID NO: 8; e) the 4-1BB costimulatory domain comprises about 1 to 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 9; or f) the CD3ζ signal domain contains approximately 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0558] Embodiment 19 is the T lymphocyte of embodiment 16, wherein: a) the linker comprises the amino acid sequence set forth in SEQ ID NO: 5; b) the CD8α signal peptide comprises the amino acid sequence shown in SEQ ID NO: 6; c) the CD8α hinge comprises the amino acid sequence set forth in SEQ ID NO: 7; d) the CD28 transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8; e) the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 9; or f) the CD3ζ signal domain comprises the amino acid sequence set forth in SEQ ID NO: 10; Or a combination thereof.

[0559] Embodiment 20 is the T lymphocyte of any one of embodiments 1 to 19, wherein the bispecific CAR comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 11, 12 or 13, or a combination thereof.

[0560] Embodiment 21 is the T lymphocyte of any one of embodiments 1 to 19, wherein the bispecific CAR comprises about 1 to 60 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 11, 12 or 13, or a combination thereof.

[0561] Embodiment 22 is the T lymphocyte of any one of embodiments 1 to 19, wherein the bispecific CAR comprises the amino acid sequence shown in SEQ ID NO: 11, 12 or 13.

[0562] Embodiment 23 is the T lymphocyte of any one of embodiments 1 to 22, wherein said T lymphocyte expresses said bispecific CAR.

[0563] Embodiment 24 is the T lymphocyte of any one of embodiments 1 to 23, wherein said BiTE comprises a CD3-binding single-chain variable fragment (scFv).

[0564] Embodiment 25 is the T lymphocyte of embodiment 24, wherein the CD3-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:14.

[0565] Embodiment 26 is the T lymphocyte of embodiment 24, wherein the CD3-binding scFv comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:14.

[0566] Embodiment 27 is the T lymphocyte of embodiment 24, wherein the CD3-binding scFv comprises the amino acid sequence set forth in SEQ ID NO:14.

[0567] Embodiment 28 is the T lymphocyte of any one of embodiments 1 to 27, wherein said TAA is an epidermal growth factor receptor (EGFR) antigen.

[0568] Embodiment 29 is the T lymphocyte of any one of embodiments 1 to 27, wherein said TAA is an EGFRvIII antigen.

[0569] Embodiment 30 is the T lymphocyte of embodiment 28 or 29, wherein the BiTE is: a) at least one EGFR-binding Nanobody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 18), or b) comprises at least one EGFRvIII-binding Nanobody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 18).

[0570] Embodiment 31 is the T lymphocyte of embodiment 30, wherein the BiTE is: a) at least two EGFR-binding nanobodies; b) at least two EGFRvIII-binding Nanobodies, or c) comprises at least one EGFR-binding Nanobody and at least one EGFRvIII-binding Nanobody.

[0571] Embodiment 32 is the T lymphocyte of embodiment 30 or 31, wherein: a) said at least one EGFR-binding Nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 15, 16 or 17, or a combination thereof; or b) said at least one EGFRvIII-binding Nanobody comprises an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15, 16 or 17, or a combination thereof.

[0572] Embodiment 33 is the T lymphocyte of embodiment 30 or 31, wherein: a) said at least one EGFR-binding Nanobody comprises an amino acid sequence of about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof; or b) said at least one EGFRvIII-binding Nanobody comprises an amino acid sequence of about 1 to 12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 15, 16 or 17, or a combination thereof;

[0573] Embodiment 34 is the T lymphocyte of embodiment 30 or 31, wherein: a) said at least one EGFR-binding Nanobody comprises the amino acid sequence shown in SEQ ID NO: 15, 16 or 17, or b) said at least one EGFRvIII-binding Nanobody comprises the amino acid sequence shown in SEQ ID NO: 15, 16 or 17.

[0574] Embodiment 35 is the T lymphocyte of any one of embodiments 29 to 34, wherein the BiTE further comprises a signal peptide and a 6xHis tag sequence (SEQ ID NO: 20).

[0575] Embodiment 36 is the T lymphocyte of embodiment 35, wherein the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:19.

[0576] Embodiment 37 is the T lymphocyte of embodiment 35, wherein the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:19.

[0577] Embodiment 38 is the T lymphocyte of embodiment 35, wherein the signal peptide comprises about one or two amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:19.

[0578] Embodiment 39 is the T lymphocyte of embodiment 35, wherein the signal peptide comprises the amino acid sequence set forth in SEQ ID NO:19.

[0579] Embodiment 40 is the T lymphocyte of any one of embodiments 29 to 39, wherein the BiTE comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, or 27.

[0580] Embodiment 41 is the T lymphocyte of any one of Embodiments 29 to 39, wherein the BiTE comprises about 1 to 40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 21, 22, or 23, or a combination thereof.

[0581] Embodiment 42 is the T lymphocyte of any one of Embodiments 29 to 39, wherein the BiTE comprises about 1 to 55 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 24, 25, 26, or 27, or a combination thereof.

[0582] Embodiment 43 is the T lymphocyte of any one of Embodiments 29 to 39, wherein the BiTE comprises the amino acid sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, or 27.

[0583] Embodiment 44 is the T lymphocyte of embodiment 29, wherein the BiTE is: a) an EGFR antibody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 16), or b) comprises an EGFRvIII antibody linked to a CD3-binding scFv via a linker sequence comprising GGGGS (SEQ ID NO: 16).

[0584] Embodiment 45 is the T lymphocyte of embodiment 44, wherein: a) the EGFR antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 29; or b) The EGFRvIII antibody comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO:29.

[0585] Embodiment 46 is the T lymphocyte of embodiment 44, wherein: a) the EGFR antibody comprises about 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 29; or b) The EGFRvIII antibody contains approximately 1 to 25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:29.

[0586] Embodiment 47 is the T lymphocyte of embodiment 44, wherein: a) the EGFR antibody comprises the amino acid sequence set forth in SEQ ID NO: 29; or b) The EGFRvIII antibody comprises the amino acid sequence shown in SEQ ID NO:29.

[0587] Embodiment 48 is the T lymphocyte of any one of embodiments 1 to 47, wherein said T lymphocyte secretes said BiTE.

[0588] Embodiment 49 is the T lymphocyte of any one of embodiments 3 to 48, wherein the fusion protein further comprises a self-cleaving T2A peptide (SEQ ID NO: 28).

[0589] Embodiment 50 is the T lymphocyte of any one of embodiments 3 to 49, wherein the fusion protein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37 or 38, or a combination thereof.

[0590] Embodiment 51 is the T lymphocyte of any one of embodiments 3 to 49, wherein the fusion protein comprises about 1 to 100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, or 38, or a combination thereof.

[0591] Embodiment 52 is the T lymphocyte of embodiment 51, wherein the fusion protein comprises about 1 to 100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO:37.

[0592] Embodiment 53 is the T lymphocyte of any one of embodiments 3 to 49, wherein the fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37 or 38.

[0593] Embodiment 54 is the T lymphocyte of embodiment 53, wherein the fusion protein comprises the amino acid sequence set forth in SEQ ID NO:37.

[0594] Embodiment 55 is a fusion protein of a bispecific chimeric antigen receptor (CAR) capable of binding to HER2 and IL13Rα2 and a BiTE capable of binding to CD3 and a TAA.

[0595] Embodiment 56 is a polynucleotide comprising a sequence encoding the fusion protein of embodiment 55.

[0596] Embodiment 57 is an expression vector comprising the polynucleotide of embodiment 56.

[0597] Embodiment 58 is a host cell comprising the polynucleotide of embodiment 51 or the expression vector of embodiment 57.

[0598] Embodiment 59 is a composition comprising T lymphocytes, wherein at least some of the lymphocytes are a) a polynucleotide comprising a sequence encoding a bispecific chimeric antigen receptor (CAR) capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding to CD3 and a TAA; or b) It comprises a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a BiTE capable of binding to CD3 and a TAA.

[0599] Embodiment 60 is the composition of embodiment 59, further comprising a cryopreservation medium comprising about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO) and substantially serum-free.

[0600] Embodiment 61 is a composition according to embodiment 59 or 60 in a storage vial.

[0601] Embodiment 62 is a pharmaceutical composition comprising the composition of embodiment 59 or 60 and a pharmaceutically acceptable vector.

[0602] Embodiment 63 is a reagent kit comprising a container containing the pharmaceutical composition of embodiment 62 and optional instructions for use.

[0603] Embodiment 64 is the use of the composition according to embodiment 59 or 60 or the pharmaceutical composition according to embodiment 57 in the preparation of a medicament for treating glioblastoma in a subject in need thereof.

[0604]

[00197] Embodiment 65 is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of said T lymphocytes: a) a polynucleotide comprising a sequence encoding a bispecific chimeric antigen receptor (CAR) capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding to CD3 and a TAA; or b) It comprises a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a BiTE capable of binding to CD3 and a TAA.

[0605]

[00182] Embodiment 66 is a method of treating glioblastoma in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least some of the T lymphocytes: a) a polynucleotide comprising a sequence encoding a bispecific chimeric antigen receptor (CAR) capable of binding to HER2 and IL13Rα2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding to CD3 and a TAA; or b) It comprises a polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding to HER2 and IL13Rα2 and a BiTE capable of binding to CD3 and a TAA.

[0606] Embodiment 67 is the method of embodiment 65 or 66, wherein the T lymphocytes are allogeneic T lymphocytes.

[0607] Embodiment 68 is the method of any one of embodiments 65 to 67, wherein at least 10% of said T lymphocytes express said bispecific CAR and said BiTE.

[0608] Embodiment 69 is the method of embodiment 68, wherein about 15-75% of the T lymphocytes express the bispecific CAR and the BiTE.

[0609] Embodiment 70 is the method of any one of embodiments 65 to 69, wherein the T lymphocytes are administered by a single intravenous infusion.

[0610] Embodiment 71 is the method of any one of embodiments 65 to 69, wherein the T lymphocytes are administered by two or more intravenous infusions.

[0611] Embodiment 72 is the method of any one of Embodiments 65 to 71, further comprising administering chemotherapy to the subject prior to administering the T lymphocytes.

[0612] Embodiment 73 is the method of any one of embodiments 65 to 72, wherein the subject is 18 years of age or older.

[0613] Embodiment 74 is the method of any one of embodiments 65 to 73, wherein the subject has newly diagnosed glioblastoma.

[0614] Embodiment 75 is the method of any one of embodiments 65 to 73, wherein the subject has relapsed from or is ...

Claims

1. A polynucleotide comprising sequences encoding a chimeric antigen receptor (CAR) and a T cell engager, wherein the CAR can bind to a first tumor-associated antigen (TAA), and the T cell engager can bind to T cells and a second TAA. The aforementioned CAR is, Interleukin-13 (IL13) mutant protein, IL13 mutant protein and HER2-binding scFv, or IL13 mutant protein and two HER2-conjugated nanoantibodies, Includes, The IL13 mutant protein contains the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:

1. The HER2-bound scFv comprises one of the amino acid sequences of SEQ ID NOs: 4, 2, and 3, or an amino acid sequence that is at least 90% identical to at least one of the amino acid sequences of SEQ ID NOs: 4, 2, and 3. Each of the two HER2-conjugated nanoantibodies independently contains one amino acid sequence from SEQ ID NOs. 242 to 259, or an amino acid sequence that is at least 90% identical to at least one of the amino acid sequences from SEQ ID NOs. 242 to 259. Polynucleotide.

2. The polynucleotide according to claim 1, wherein the CAR can bind to two epitopes of a first TAA, or the CAR can bind to two first TAAs.

3. The polynucleotide according to claim 1, wherein the first TAA and the second TAA are each independently expressed in hematological cancer cells, or the first TAA and the second TAA are each independently expressed in solid tumor cells.

4. The polynucleotide according to claim 3, wherein the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer.

5. The polynucleotide according to claim 4, wherein the brain tumor is glioblastoma (GBM).

6. The polynucleotide according to claim 5, wherein the GBM is recurrent or primary glioblastoma multiforme.

7. The polynucleotide according to claim 4, wherein the brain tumor is a metastatic brain tumor, and the metastatic brain tumor is a non-small cell lung cancer brain metastasis (NSCLCBM), a small cell lung cancer brain metastasis (SCLCBM), a HER2-positive metastatic breast cancer, or a triple-negative breast cancer brain metastasis (TNBCBM).

8. The polynucleotide according to claim 4, wherein the liver cancer is hepatocellular carcinoma (HCC).

9. The polynucleotide according to claim 1 or 2, wherein the first TAA is selected from interleukin-13 receptor subunit α-2 (IL13Rα2), human epidermal growth factor receptor 2 (HER2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), glypican-3 (GPC3), or a combination thereof.

10. The aforementioned CAR is, Linker, CD8α signal peptide, CD8α hinge, CD28 transmembrane domain, 4-1BB co-stimulatory domain, CD3ζ signaling domain, or That combination A polynucleotide according to claim 1 or 2, comprising:

11. The linker includes the amino acid sequence of Sequence ID No. 5, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No.

5. The CD8α signal peptide comprises the amino acid sequence of SEQ ID NO: 6, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

6. The CD8α hinge includes the amino acid sequence of Sequence ID No. 7, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No.

7. The CD28 transmembrane domain includes the amino acid sequence of SEQ ID NO: 8, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

8. The 4-1BB co-stimulatory domain includes the amino acid sequence of SEQ ID NO: 9, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

9. The CD3ζ signal domain includes the amino acid sequence of SEQ ID NO: 10, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 10, or That combination is, The polynucleotide according to claim 10.

12. The polynucleotide according to claim 1 or 2, wherein the second TAA is interleukin-13 receptor subunit α-2 (IL13Rα2), HER2, EGFR, EGFRvIII, or GPC3.

13. The polynucleotide according to claim 1 or 2, wherein the T cell engager comprises a signal peptide.

14. The polynucleotide according to claim 13, wherein the signal peptide comprises the amino acid sequence shown in SEQ ID NO:

19.

15. The polynucleotide according to claim 1 or 2, wherein the T cell engager comprises the amino acid sequence shown in SEQ ID NOs: 27, 21, 22, 23, 24, 25, 26, 109, 110, 111, 176, 177, 178, or 292.

16. A polynucleotide according to claim 1 or 2, encoding an amino acid sequence independently selected from SEQ ID NOs: 33, 31, 32, 34-38, SEQ ID NOs: 106-108, SEQ ID NOs: 112-119, or SEQ ID NOs: 173-175.

17. A vector comprising the polynucleotide described in claim 1 or 2.

18. A fusion protein encoded by a polynucleotide according to claim 1 or 2, or by a vector containing the polynucleotide.

19. The fusion protein according to claim 18, wherein the fusion protein comprises a self-cleaving peptide, and the self-cleaving peptide is a T2A peptide (SEQ ID NO: 28).

20. A host cell comprising a polynucleotide according to claim 1 or 2, a vector containing the polynucleotide, or a fusion protein encoded by the polynucleotide or the vector.

21. A T lymphocyte comprising a polynucleotide according to claim 1 or 2, a vector containing the polynucleotide, a fusion protein encoded by the polynucleotide or the vector, or a combination thereof.

22. A composition comprising the T lymphocytes described in claim 21.

23. The composition according to claim 22, further comprising a cryopreservation medium containing about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO), wherein the cryopreservation medium is serum-free.

24. A pharmaceutical composition comprising the composition described in claim 22 and a pharmaceutically acceptable carrier.

25. A pharmaceutical product for treating cancer in a target area requiring the use of the same, comprising a polynucleotide according to claim 1 or 2, a T lymphocyte containing the polynucleotide, a composition containing the T lymphocyte, or a pharmaceutical composition comprising the composition and a pharmaceutically acceptable carrier.

26. The pharmaceutical product according to claim 25, wherein the cancer is a blood cancer or a solid tumor.

27. ​​The pharmaceutical product according to claim 26, wherein the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer.

28. The pharmaceutical product according to claim 27, wherein the brain tumor is glioblastoma (GBM).

29. The pharmaceutical product according to claim 28, wherein the brain tumor is a metastatic brain tumor, and the metastatic brain tumor is a non-small cell lung cancer brain metastasis (NSCLCBM), a small cell lung cancer brain metastasis (SCLCBM), a HER2-positive metastatic breast cancer, or a triple-negative breast cancer brain metastasis (TNBCBM).

30. The pharmaceutical product according to claim 27, wherein the liver cancer is hepatocellular carcinoma (HCC).

31. The pharmaceutical product according to claim 25, wherein the subject is 18 years of age or older, or the subject has been newly diagnosed with cancer, or the subject has relapsed from previous cancer treatment or is resistant to previous cancer treatment.

32. The pharmaceutical product according to claim 25, wherein the T lymphocytes are allogeneic or homogeneous T lymphocytes.

33. The pharmaceutical product according to claim 25, wherein the T lymphocytes are autologous T lymphocytes.

34. The pharmaceutical product according to claim 25, wherein approximately 15 to 75% of the T lymphocytes express bispecific CARs and T cell engagers, respectively.

35. The pharmaceutical product according to claim 25, wherein the T lymphocytes are administered by a single intravenous infusion, or the T lymphocytes are administered by two or more intravenous infusions.