Biologically relevant orthogonal cytokine / receptor pairs

JP2024037778A5Pending Publication Date: 2026-06-05THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
Filing Date
2023-12-01
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing methods for manipulating immune cells, particularly T cells, face challenges in achieving controlled activation and expansion without affecting non-target cells and are susceptible to endogenous signaling pathways, making it difficult to precisely control T cell behavior in therapeutic applications.

Method used

Engineering orthogonal cytokine receptor/ligand pairs that specifically bind and activate signaling through native cellular elements, while exhibiting reduced binding to endogenous counterparts, allowing for targeted T cell manipulation.

Benefits of technology

The engineered orthogonal cytokine receptor/ligand pairs enable precise control of T cell behavior by activating signaling pathways selectively in engineered cells, reducing off-target effects and enabling controlled expansion and activation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

To provide engineered orthogonal cytokine receptor / ligand pairs, and methods of use thereof.SOLUTION: An engineered human IL-2 polypeptide (i) has significantly reduced binding to native human CD122; (ii) comprises at least one amino acid substitution with an amino acid other than that of the native protein at residue T51, R81, or comprises amino acid substitution M23A; and (iii) comprises amino acid substitutions at each of E15, H16, L19, D20.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] Manipulation of cells, particularly immune cells, to differentiate, develop specific functions, and expand numbers is of great clinical interest. Many protein factors that affect their activity are known in the art, including cytokines and chemokines in particular. However, these signaling molecules also have pleiotropic effects on cells that are not targeted for manipulation, so a method to selectively activate signaling in a target cell population is desirable. In particular, manipulation of T cells to perform controlled behaviors is of interest. For example, in adoptive immunotherapy, T cells are isolated from blood, treated ex vivo, and reinfused into the patient. T cells have been engineered for use in therapeutic applications such as recognition and killing of cancer cells, intracellular pathogens, and cells involved in autoimmunity.

[0002] A key challenge in cell-based therapy is to engineer desired behaviors, such as activation, expansion, into adoptively transferred cells that are protected from endogenous signaling pathways, do not affect non-target endogenous cells, and can be controlled once administered to a patient. This is particularly relevant to T cell engineering because of developmental plasticity, as well as the enormous influence that environmental factors play in determining T cell fate, function, and localization.

[0003] The ability to engineer proteins to bind and respond to modified ligands in a manner independent, or orthogonal, to the influence of the native protein or ligand constitutes a significant challenge in protein engineering. To date, numerous synthetic ligand-ortholog receptor pairs have been created that are orthogonal to similar natural interactions. Among the proteins used in this work are nuclear hormone receptors and G protein-coupled receptors. Despite extensive work being done to engineer receptors that are activated by synthetic small molecule ligands, engineering biologically relevant protein pairs remains a significant challenge. Summary of the Invention

[0004] Engineered orthogonal cytokine receptor / ligand pairs and methods of use thereof are provided. The engineered (orthogonal) cytokine specifically binds to a counterpart engineered (orthogonal) receptor. Upon binding, the orthogonal receptor activates signal transduction that is transduced through native cellular elements to mimic the native response, but provide specific biological activity to the engineered cell expressing the orthogonal receptor. The orthogonal receptor exhibits greatly reduced binding to endogenous counterpart cytokines, including the native counterpart of the orthogonal cytokine, while the orthogonal cytokine exhibits greatly reduced binding to any endogenous receptor, including the native counterpart of the orthogonal receptor. In some embodiments, the affinity of the orthogonal cytokine for the orthogonal receptor is comparable to the affinity of the native cytokine for the native receptor.

[0005] The process for engineering orthogonal cytokine receptor pairs includes the steps of: (a) engineering amino acid changes into the native receptor to disrupt binding to the native cytokine; (b) generating a plurality of cytokine analogs with selective amino acid changes to the native cytokine at contact residues for receptor binding; (c) selecting for cytokine orthologs that bind to the orthologous receptor; (d) discarding orthologous cytokines that bind significantly to the native receptor, or alternatives to steps (c) and (d); (e) selecting for receptor orthologs that bind to the orthologous cytokine; (f) discarding orthologous receptors that bind to the native cytokine. In a preferred embodiment, knowledge of the structure of the cytokine / receptor complex is used to select amino acid positions for site-directed or error-prone mutagenesis. Advantageously, a yeast display system can be used for the selection process, although other display and selection methods are also useful.

[0006] In some embodiments, engineered cells are provided in which the cells are modified by the introduction of the orthogonal receptor of the present invention. Any cell may be used for this purpose. In some embodiments, the cell is a naive CD8 + T cells, cytotoxic CD8+ T cells, naive CD4 + T cells, helper T cells, e.g., T H 1. T H 2. T H 9. T H 11. T H 22, T FH , regulatory T cells, e.g. R 1, Natural T Reg , inducible T Reg In some embodiments, the engineered cells are T cells, including but not limited to, memory T cells, such as central memory T cells, effector memory T cells, NKT cells, γδT cells, and engineered variants of such T cells, including CAR-T cells. In other embodiments, the engineered cells are stem cells, such as hematopoietic stem cells, NK cells, macrophages, or dendritic cells. In some embodiments, the cells are genetically modified in an ex vivo procedure prior to transfer to the subject. The engineered cells can be provided in a unit dose for therapy and can be allogeneic, autologous, etc. with respect to the intended recipient.

[0007] In some embodiments, a vector is provided that includes a polynucleotide coding sequence that encodes an orthogonal receptor, the coding sequence being operably linked to a promoter that is active in the desired cell. A variety of vectors, e.g., viral vectors, plasmid vectors, minicircle vectors, are known in the art and can be used for this purpose, and these vectors can be integrated into the target cell genome or maintained episomally. The receptor encoding vector can be provided in a kit in combination with a vector that encodes an orthogonal cytokine that binds to and activates the receptor. In some embodiments, the coding sequence for the orthogonal cytokine can be operably linked to a high expression promoter and optimized for production. In other embodiments, a kit is provided in which a vector encoding an orthogonal receptor is provided in a purified composition of the orthogonal cytokine, packaged, e.g., in a unit dose (e.g., a pre-filled syringe), for administration to a patient. Also in some other embodiments, a kit is provided in which a vector encoding an orthogonal receptor is provided in a vector encoding an orthogonal cytokine to enable expression of the orthogonal receptor in a cell, as well as expression of an orthogonal cytokine intended for secretion by the same cell to enable autocrine orthogonal cytokine receptor signaling.

[0008] In some embodiments, a method of treatment is provided, comprising introducing an engineered cell population into a recipient in need thereof, the cell population being modified by introduction of a sequence encoding an orthogonal receptor of the invention. The cell population may be engineered ex vivo, and is usually autologous or allogeneic with respect to the recipient. In some embodiments, the introduced cell population is contacted with a cognate orthogonal cytokine in vivo after administration of the engineered cells. An advantage of the present invention is the lack of cross-reactivity between the orthogonal cytokine and the native receptor.

[0009] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to scale. Rather, dimensions of the various features have been arbitrarily expanded or reduced for clarity. The drawings include the following figures: [Brief description of the drawings]

[0010] [Figure 1] 1 shows an orthogonal IL-2 / IL-2 receptor pair for controlling T cell expansion. [Diagram 2] 1 shows a workflow for engineering an orthogonal IL-2 / IL-2Rβ pair. [Diagram 3] 1 shows the sequences of orthogonal mouse IL-2Rβ variants. [Figure 4] The mIL-2Rβ H134D Y135F mutation abrogates wt mIL-2 binding. [Diagram 5] 1 shows a workflow for engineering an orthogonal IL-2 / IL-2Rβ pair. [Figure 6] 1 shows sequences of characterized orthogonal mouse IL-2 variants. [Figure 7] The orthoIL-2 variants bind to orthoIL-2Rβ with affinity similar to or greater than the wild-type IL-2 and IL-2Rβ interaction. [Figure 8] The orthoIL-2 variants display blunted activity (phosphoSTAT5) on wild-type CD25 positive and CD25 negative splenocytes. [Figure 9] 1 shows generation of orthoIL-2R expressing murine CTLL-2 T cells. [Figure 10] The first set of orthoIL-2 variants is selective for orthoT cells. [Figure 11] orthoIL-2 mutants induce selective STAT5 phosphorylation on orthoIL-2Rβ-expressing CTLL-2 cells. [Figure 12] 1 shows primary lymph node-derived T cells engineered to express orthoIL-2Rβ(H134D Y135F). [Figure 13] orthoIL-2 variants induce selective STAT5 phosphorylation on primary mouse T cells expressing orthoIL-2Rβ. [Figure 14] orthoIL-2 mutants induce selective cell growth of orthoIL-2Rβ-expressing CTLL-2 cells compared to wild-type T cells. [Figure 15] Alignment of mouse and human reference IL-2Rβ / IL-2 sequences is shown. A partial sequence of human IL-2Rβ is provided as SEQ ID NO:1, residues 1-235, and a partial sequence of mouse IL-2Rβ is provided as SEQ ID NO:2, residues 1-238. Mouse IL-2 is provided as SEQ ID NO:3. Human IL-2 is provided as SEQ ID NO:4. [Figure 16A] Yeast evolution of orthogonal human IL-2 pairs. FACS analysis of yeast-displayed wild-type human IL-2 that binds to the wild-type (blue histogram) but not the ortho (red histogram) human IL-2Rβ H133 DY134 F mutant tetramer. [Figure 16B] Yeast evolution of an orthogonal human IL-2 pair. A library of human IL-2 mutants (approximately 18 mutants) randomizing IL-2 residues predicted to be in close proximity or contact with the human IL-2Rβ HY mutant was displayed on the surface of yeast. After a series of successive rounds of both positive (against orthohIL-2Rβ) and negative (against wild-type hIL-2Rβ) selections, we obtained yeast-displayed human IL-2 mutants that bound to the ortho (red histogram) but not the wild-type (blue histogram) human IL-2Rβ tetramer. [Figure 16C] Yeast evolution of the orthogonal human IL-2 pair. OrthohIL-2 variants were subsequently isolated and sequenced from the yeast library. A consensus set of mutations was identified that indicates convergence of ortho hIL-2 sequences capable of binding to orthohIL-2Rβ. [Figure 16D]Yeast evolution of the orthogonal human IL-2 pair. OrthohIL-2 variants were subsequently isolated and sequenced from the yeast library. A consensus set of mutations was identified that indicates convergence of ortho hIL-2 sequences capable of binding to orthohIL-2Rβ. [Figure 17] Figure 1 shows an in vivo mouse model used to demonstrate selective expansion or increased survival of orthogonal IL-2Rb-expressing T cells in mice. Donor cells were isolated from the spleens of wild-type C57BL / 6J mice expressing CD45.2, activated ex vivo with CD3 / CD28, transduced with a retrovirus encoding orthogonal IL-2Rb-IRES-YFP, expanded in 100 IU / mL mIL-2 for 2 days, and purified using a mouse CD8 T cell isolation kit (Miltenyi). An approximately 1:1 mixture of wild-type (CD45.2 positive, YFP negative) and orthogonal IL-2Rb-expressing T cells (CD45.2 positive, YFP positive) were adoptively transferred via retro-orbital injection into recipient BL6.Rag2- / - x IL2rg- / - CD45.1 mice. PBS, wild-type mIL-2 (150,000 IU / mouse), or orthoIL-2 clone 1G12 / 149 (1,000,000 IU / mouse) were injected IP daily starting immediately after T cell transfer (D0) and at 24-h intervals for 5 consecutive days (up to D4). Mice were sacrificed on D5 and D7, and total donor T cell numbers in mouse blood and spleens were quantified by flow cytometry. [Figure 18A]The gating strategy used to quantify donor T cell expansion in recipient mice is shown. Single cell suspensions from mouse blood were prepared and stained with CD45.2-Pacific Blue for 1 h at 4C to identify donor T cells. Immediately prior to flow cytometry cells were incubated with a 1:2000 dilution of propidium iodide (PI) for live / dead exclusion. Cells were gated based on forward and side scatter (SSC-A v FSC-A), singlets (FSC-A v FSC-H), live cells (PI negative), and total numbers of wild type T cells (CD45.2 positive, YFP negative) and orthogonal T cells (CD45.2 positive, YFP positive) were quantified via FACS. **p<0.01, ***p<0.001, ****p<0.0001, determined by one-way ANOVA using Prism. [Figure 18B] The gating strategy used to quantify donor T cell expansion in recipient mice is shown. Single cell suspensions from mouse spleens were prepared and stained with CD45.2-Pacific Blue for 1 h at 4C to identify donor T cells. Immediately prior to flow cytometry cells were incubated with a 1:2000 dilution of propidium iodide (PI) for live / dead exclusion. Cells were gated based on forward and side scatter (SSC-A v FSC-A), singlets (FSC-A v FSC-H), live cells (PI negative), and total numbers of wild type T cells (CD45.2 positive, YFP negative) and orthogonal T cells (CD45.2 positive, YFP positive) were quantified via FACS. **p<0.01, ***p<0.001, ****p<0.0001, determined by one-way ANOVA using Prism. [Figure 19]OrthoIL-2 clone 1G12 / 149 selectively expands orthogonal, but not wild-type, T cells in mice. The number of wild-type and orthogonal T cells in blood (103 cells / uL) and spleen (total number of cells per spleen) was quantified via flow cytometry as described in Figure 18. The ratio of orthogonal to wild-type T cells was determined by dividing the total number of orthogonal T cells by the total number of wild-type T cells in blood and spleen. A ratio greater than 1 indicates selective expansion of orthogonal T cells, which is achieved with orthoIL-2 clone 1G12 / 149. The total number of live cells in blood (left) and spleen (right) on days 5 (top) and 7 (bottom) was quantified via flow cytometry. Treatment with wild-type IL-2 results in the expansion of both wild-type and ortho T cells compared to PBS controls, whereas treatment with orthoIL-2 clone 1G12 / 149 selectively expands ortho T cells with restricted activity over wild-type T cells. [Figure 20A] Orthogonal IL-2 has selective activity on ortho IL-2Rβ T cells. FACS analysis of primary spleen-derived murine T cells isolated from IL-2KO NOD mice and virally transduced to express orthoIL-2Rβ, which can be confirmed using an IRES-YFP reporter and surface staining of IL-2Rβ. [Figure 20B] OrthoIL-2 has selective activity on orthoIL-2Rβ T cells. The T cells also retain expression of wild-type IL-2Rβ. orthoIL-2 induced selective STAT 5 phosphorylation on orthoIL-2Rβ-expressing T cells, with no activity on wild-type T cells. [Figure 21A]Orthogonal IL-2 selectively expands orthoIL-2Rβ T cells in vitro. FACS analysis of primary spleen-derived mouse T cells virally transduced to express orthoIL-2Rβ, which can be confirmed using IRES-YFP. A mixture of transduced and non-transduced T cells was cultured for 5 days with various concentrations of wild type, orthoIL-2 clone 1G12, or 3A10 and analyzed by FACS. IL-2 expands both wild type and ortho T cells, but when cultured with orthoIL-2 3A10, only ortho T cells expand, while orthoIL-2 1G12 selectively expands ortho T cells with significantly reduced activity on wild type T cells. FACS plots corresponding to culture in 100 nM IL-2, 64 pM orthoIL-2 1G12, and 10 μM orthoIL-2 3A10 are shown. [Figure 21B] Orthogonal IL-2 selectively expands ortho IL-2Rβ T cells in vitro. Wild-type and ortho T cell proliferation dose response to wild-type and orthoIL-2 clones 1G12 and 3A10 after 5 days of culture with increasing concentrations of cytokines. IL-2 expands both wild-type and ortho T cells with equal potency, orthoIL-2 1G12 selectively expands ortho T cells, and orthoIL-2 3A10 specifically expands ortho T cells. [Figure 22A]Shows ortho human IL-2 signaling through orthoIL-2R expressed in YT cells in vitro. Shows dose response of STAT5 phosphorylation after 20 min of stimulation. Phosphorylation of Stat5 was measured in YT human NK cell line expressing human CD25 (YT+) without (YFP-, WT) or with (YFP+, ortho) human orthoIL-2Rb. Mouse serum albumin (MSA) fusion of human IL-2 was titrated in RPMI complete medium and added to cells. Mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthoRb (YFP+) cells was plotted against concentration of cytokine and fitted to a log(agonist) vs. response (3 parameter) model using Prism5 (GraphPad). 1C7 was run on a separate day from other proteins and normalized to wild type IL-2 staining runs on both days. All data are presented as the mean (n=3)±SD. [Figure 22B] Shows ortho human IL-2 signaling through orthoIL-2R expressed in YT cells in vitro. Shows dose response of STAT5 phosphorylation after 20 min of stimulation. Phosphorylation of Stat5 was measured in YT human NK cell line expressing human CD25 (YT+) without (YFP-, WT) or with (YFP+, ortho) human orthoIL-2Rb. Mouse serum albumin (MSA) fusion of ortho mutant 1A1 was titrated in RPMI complete medium and added to cells. Mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthoRb (YFP+) cells was plotted against concentration of cytokine and fitted to a log(agonist) vs. response (3 parameter) model using Prism5 (GraphPad). 1C7 was run on a separate day from other proteins and normalized to wild type IL-2 staining runs on both days. All data are presented as the mean (n=3)±SD. [Figure 22C]Shows ortho human IL-2 signaling through orthoIL-2R expressed in YT cells in vitro. Shows dose response of STAT5 phosphorylation after 20 min of stimulation. Phosphorylation of Stat5 was measured in YT human NK cell line expressing human CD25 (YT+) without (YFP-, WT) or with (YFP+, ortho) human orthoIL-2Rb. Mouse serum albumin (MSA) fusion of 1C7 was titrated in RPMI complete medium and added to cells. Mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthoRb (YFP+) cells was plotted against concentration of cytokine and fitted to a log (agonist) vs. response (3 parameter) model using Prism5 (GraphPad). 1C7 was run on a separate day from other proteins and normalized to wild type IL-2 staining runs on both days. All data are presented as the mean (n=3)±SD. [Figure 22D] Shows ortho human IL-2 signaling through orthoIL-2R expressed in YT cells in vitro. Shows dose response of STAT5 phosphorylation after 20 min of stimulation. Phosphorylation of Stat5 was measured in YT human NK cell line expressing human CD25 (YT+) without (YFP-, WT) or with (YFP+, ortho) human orthoIL-2Rb. Mouse serum albumin (MSA) fusion of SQVLKA was titrated in RPMI complete medium and added to cells. Mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthoRb (YFP+) cells was plotted against cytokine concentration and fitted to a log (agonist) vs. response (3 parameter) model using Prism5 (GraphPad). 1C7 was run on a separate day from other proteins and normalized to wild type IL-2 staining runs on both days. All data are presented as the mean (n=3)±SD. [Figure 22E]Shows ortho human IL-2 signaling through orthoIL-2R expressed in YT cells in vitro. Shows dose response of STAT5 phosphorylation after 20 min of stimulation. Phosphorylation of Stat5 was measured in YT human NK cell line expressing human CD25 (YT+) without (YFP-, WT) or with (YFP+, ortho) human orthoIL-2Rb. Mouse serum albumin (MSA) fusion of SQVKqA was titrated in RPMI complete medium and added to cells. Mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthoRb (YFP+) cells was plotted against concentration of cytokine and fitted to a log (agonist) vs. response (3 parameter) model using Prism5 (GraphPad). 1C7 was run on a separate day from other proteins and normalized to wild type IL-2 staining runs on both days. All data are presented as the mean (n=3)±SD. [Figure 23A] Ortho human IL-2R preferentially expands human PBMCs expressing ortho IL-2R. Human PBMCs were isolated, activated, and transduced with a retrovirus containing ortho human IL-2Rβ with IRES YFP (YFP+). The initial ratio of YFP+ cells to total live cells was 20%. 5 × 105 cells were seeded with the indicated concentrations of MSA-human IL-2 (circles) or ortho variants MSA-SQVLKA (diamonds), MSA-SQVLqA (squares), or MSA-1A1 (triangles) on day 1 and re-fed with the same concentrations on day 3. On day 5, plates were read by flow cytometry. The ratio of YFP+ (ortho-expressing) cells to total live cells was calculated and the mean (n=4) ± SD was plotted against concentration. The orthogonal cytokines were unable to support as much total cell growth as wild-type MSA-hIL-2 at the same concentrations. [Figure 23B]Ortho human IL-2R preferentially expands human PBMCs expressing ortho IL-2R. Human PBMCs were isolated, activated, and transduced with a retrovirus containing ortho human IL-2Rβ with IRES YFP (YFP+). The initial ratio of YFP+ cells to total live cells was 20%. 5 × 105 cells were seeded with the indicated concentrations of MSA-human IL-2 (circles) or ortho mutants MSA-SQVLKA (diamonds), MSA-SQVLqA (squares), or MSA-1A1 (triangles) on day 1 and re-fed with the same concentrations on day 3. On day 5, plates were read by flow cytometry. Total live cell counts (mean (n=4) ± SD) were plotted against cytokine concentration. The orthogonal cytokines were unable to support as much total cell growth as wild-type MSA-hIL-2 at the same concentrations. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] In order that this disclosure may be more readily understood, certain terms and phrases are defined below and throughout the specification. The definitions provided herein are non-limiting and should be read in light of what would be known to one of ordinary skill in the art at the time of the invention.

[0012] definition Before the present methods and compositions are described, it is to be understood that the invention is not limited to the particular methods or compositions described, which may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0013] Where a range of values ​​is provided, it is understood that between the upper and lower limits of that range, each intervening value, to the tenth of the unit of the lower limit, is also specifically disclosed, unless the context clearly dictates otherwise. Each smaller range between any stated or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the range, and each range in which the smaller range includes any of the limits, does not include any of the limits, or includes both limits is also encompassed within the invention, subject to any specifically excluded limits in the stated range. Where a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Although any method and material similar or equivalent to the method and material described herein can be used to carry out or test this invention, some possible and preferred methods and materials are described herein.All publications mentioned herein are incorporated by reference to disclose and describe the method and / or material in relation to the cited publication.It should be understood that this disclosure will take precedence over any disclosure of the incorporated publication in case of conflict.

[0015] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the peptide" includes reference to one or more peptides and equivalents thereof, such as polypeptides known to those skilled in the art.

[0016] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0017] Cytokine receptor and ligand pairs include, but are not limited to, the following receptors:

[0018] [Table 1-1]

[0019] [Table 1-2]

[0020] "Ortholog" or "orthogonal cytokine / receptor pair" refers to an engineered protein pair that (a) exhibits greatly reduced affinity for the native cytokine or cognate receptor, and (b) is modified by amino acid changes to specifically bind to the counterpart engineered (orthogonal) ligand or receptor. Upon binding of the orthogonal ligand, the orthogonal receptor activates signaling that is transduced through native cellular elements to mimic the native response, but provides a specific biological activity to the engineered cell expressing the orthogonal receptor.

[0021] An orthogonal receptor exhibits greatly reduced binding to its cognate natural cytokine ligand, while an orthogonal cytokine exhibits greatly reduced binding to its cognate natural receptor(s). In some embodiments, the affinity of the orthogonal cytokine for its cognate orthogonal receptor is comparable to the affinity of the natural cytokine for the natural receptor, e.g., has an affinity that is at least about 1%, at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100% of the affinity for the natural cytokine receptor, and may be, e.g., at least about 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more greater than the affinity of the natural cytokine for the natural receptor.

[0022] As used herein, "does not bind" or "cannot bind" refers to detectable binding, or slight binding, i.e., having a binding affinity much lower than the natural ligand. Affinity can be determined by competitive binding experiments that measure receptor binding with a single concentration of labeled ligand in the presence of various concentrations of unlabeled ligand. Typically, the concentrations of unlabeled ligand vary over at least six orders of magnitude. Competitive binding experiments allow the determination of the IC 50 As used herein, "IC 50 " refers to the concentration of unlabeled ligand required for 50% inhibition of the association between the receptor and the labeled ligand. 50 is an indicator of ligand-receptor binding affinity. Low IC 50 represents high affinity, while high IC 50 represents low affinity.

[0023] As used herein, the term "specifically binds" refers to the degree of selectivity or affinity with which one molecule binds to another molecule. In the context of binding pairs (e.g., ligand / receptor, antibody / antigen, antibody / ligand, antibody / receptor binding pairs), a first molecule of a binding pair is said to specifically bind to a second molecule of the binding pair if the first molecule of the binding pair does not bind in significant amounts to other components present in the sample. A first molecule is said to specifically bind to a second molecule of the binding pair if the affinity of the first molecule for the second molecule is at least 2-fold greater, at least 10-fold greater, at least 20-fold greater, or at least 100-fold greater than the affinity of the first molecule for other components present in the sample. In certain embodiments where the first molecule of the binding pair is an antibody, the antibody has an affinity for the second molecule of the binding pair that is greater than about 10, as determined, for example, by Scatchard analysis. 9 Greater than liters / mole or about 10 10 Greater than 10 liters / mole 11 Greater than 10 liters / mole 12 If it is greater than liter / mole, it specifically binds to a second molecule of a binding pair (e.g., a protein, antigen, ligand, or receptor) (Munsen, et al. 1980 Analyt. Biochem. 107:220-239). Specific binding can be assessed using techniques known in the art, including, but not limited to, competitive ELISA, BIACORE® assay, and / or KINEXA® assay.

[0024] As used herein, the term "exhibits significantly reduced binding" is used in reference to the affinity of binding of an orthogonal ligand to an orthogonal receptor compared to the binding of the orthogonal ligand to the naturally occurring form of its cognate receptor. In the practice of the present invention, this term indicates that significantly reduced binding is used to describe the comparative binding and activity of an orthogonal ligand compared to a naturally occurring ligand for a naturally occurring receptor. An orthogonal ligand exhibits significantly reduced binding with respect to the native form of the ligand if the orthogonal ligand binds to the native form of the receptor at less than 20%, alternatively less than about 10%, alternatively less than about 8%, alternatively less than about 6%, alternatively less than about 4%, alternatively less than about 2%, alternatively less than about 1%, alternatively less than about 0.5% of the naturally occurring ligand. Similarly, an orthogonal receptor exhibits significantly reduced binding with respect to the native form of the ligand if the native form of the ligand binds to the orthogonal form of the receptor at less than 20%, alternatively less than about 10%, alternatively less than about 8%, alternatively less than about 6%, alternatively less than about 4%, alternatively less than about 2%, alternatively less than about 1%, alternatively less than about 0.5% of the naturally occurring receptor.

[0025] Orthogonal IL-2 polypeptides show greatly reduced activation via native IL-2Rβ. Activity may be measured, for example, in a cell proliferation assay using CTLL-2 murine cytotoxic T cells, see Gearing, AJ Hand and CB Bird (1987) in Lymphokines and Interferons, A Practical Approach. Clemens, MJ et al. (eds): IRL Press. 295. The specific activity of recombinant human IL-2 is approximately 2.1×10 4 IU / μg, calibrated against the WHO International Standard recombinant human IL-2 (NIBSC code: 86 / 500). The orthogonal human IL-2 may have less than 20%, alternatively less than about 10%, alternatively less than about 8%, alternatively less than about 6%, alternatively less than about 4%, alternatively less than about 2%, alternatively less than about 1%, alternatively less than about 0.5% of the activity of the WHO International Standard (NIBSC code: 86 / 500) human IL-2 polypeptide in an equivalent assay.

[0026] When used herein with respect to polypeptide or DNA sequences, the term "identity" refers to the sequence identity between two molecules. The similarity between two amino acid or two nucleotide sequences is a direct function of the number of identical positions. In general, sequences are aligned to obtain the highest order match. If necessary, calculations can be performed using published techniques and widely available computer programs such as the GCS program package (Devereu× et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990). Sequence identity can be measured using sequence analysis software, such as the sequence analysis software package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), using its default parameters.

[0027] The terms "polypeptide," "protein," or "peptide" refer to any chain of amino acid residues, regardless of its length or post-translation modification (eg, glycosylation or phosphorylation).

[0028] By "protein variant" or "mutant protein" or "mutant polypeptide" herein is meant a protein that differs from a wild-type protein by at least one amino acid modification. The parent polypeptide can be a naturally occurring or wild-type (WT) polypeptide, or can be a modified form of a WT polypeptide. The term mutant polypeptide can refer to the polypeptide itself, a composition comprising the polypeptide, or a nucleic acid sequence encoding it. Preferably, the mutant polypeptide contains at least one amino acid modification compared to the parent polypeptide, e.g., about 1 to about 10 amino acid modifications compared to the parent, preferably about 1 to about 5 amino acid modifications. The mutant can be at least about 99% identical, at least about 98% identical, at least about 97% identical, at least about 95% identical, at least about 90% identical to the wild-type protein.

[0029] As used herein, "parent polypeptide," "parent protein," "precursor polypeptide," or "precursor protein" refers to an unmodified polypeptide that is subsequently modified to generate a mutant polypeptide. A parent polypeptide may be a wild-type (or naturally occurring) polypeptide. A parent polypeptide may refer to the polypeptide itself, a composition that includes the parent polypeptide, or the amino acid sequence that encodes it.

[0030] As used herein, "wild-type" or "WT" or "native" refers to an amino acid or nucleotide sequence found in nature, including allelic variations. A WT protein, polypeptide, antibody, immunoglobulin, IgG, etc., has an amino acid or nucleotide sequence that has not been modified by the hand of man.

[0031] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired. "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, as well as zoo, sports, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, etc. Preferably, the mammal is a human.

[0032] As used herein, "therapeutically effective amount" refers to that amount of a therapeutic agent, e.g., an adoptive T cell or an orthogonal cytokine, sufficient to prevent, treat, or manage a disease or disorder. A therapeutically effective amount may refer to an amount of a therapeutic agent sufficient to delay or minimize the onset of a disease, e.g., to delay or minimize the spread of a cancer, or an amount effective to reduce or increase signaling from a receptor of interest. A therapeutically effective amount may also refer to an amount of a therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease. Furthermore, a therapeutically effective amount in reference to a therapeutic agent of the present invention refers to an amount of a therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease, alone or in combination with other therapies.

[0033] As used herein, the terms "prevent," "preventing," and "prevention" refer to the prevention of the recurrence or onset of one or more symptoms of a disorder in a subject as a result of administration of a prophylactic or therapeutic agent.

[0034] As used herein, the term "combination" refers to the use of two or more prophylactic and / or therapeutic agents.The use of the term "combination" does not limit the order in which prophylactic and / or therapeutic agents are administered to a subject with a disorder.A first prophylactic or therapeutic agent can be administered before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second prophylactic or therapeutic agent to a subject with a disorder.

[0035] Interleukin 2 (IL-2) is a pluripotent cytokine produced primarily by activated CD4+ T cells and plays a key role in the production of normal immune responses. IL-2 promotes the proliferation and expansion of activated T lymphocytes, enhances the growth of B cells, and activates monocytes and natural killer cells. These activities have led to IL-2 being tested and used as an approved treatment for cancer (aldesleukin, Proleukin®). Human IL-2 is synthesized as a precursor polypeptide of 153 amino acids from which 20 amino acids are removed to generate mature secreted IL-2. As used herein, "IL-2" refers to natural or wild-type IL-2. Mature human IL-2 occurs as a 133 amino acid sequence (minus a signal peptide of an additional 20 N-terminal amino acids) as described in Fujita, et.al, PNAS USA, 80, 7437-7441 (1983). The amino acid sequence of human IL-2 is found in GENBANK under the accession locator NP_000577.2. The reference sequences of human IL-2 (SEQ ID NO:4) and mouse IL-2 (SEQ ID NO:3), human IL-2Rβ (SEQ ID NO:1), and mouse IL-2Rβ (SEQ ID NO:2) are presented in FIG.

[0036] IL-2 supports the survival and differentiation of T lymphocytes by initiating cell signaling pathways upon interaction with the IL-2 receptor (IL-2R). IL-2 is used clinically to treat several human diseases, including cancer and autoimmunity, as well as as an adjuvant in adoptive T cell therapy to promote survival of transplanted T cells. However, IL-2 may also have parallel effects by activating off-target cell types.

[0037] To direct the activity of IL-2 to specific T cell subsets, the present invention provides engineered orthogonal IL-2 and IL-2 receptor pairs. When bound to the orthogonal IL-2 receptor expressed on cells, orthogonal IL-2 recapitulates the activity of wild-type IL-2 by inducing strong STAT 5 phosphorylation and in vitro proliferation of T cells engineered to express orthogonal IL-2R beta. Orthogonal IL-2 has significantly reduced binding to ex vivo cultured wild-type CD25 positive or negative mouse T cells, respectively. The work of this disclosure shows that remodeling the cytokine receptor interface to create interactions that do not exist in nature is a viable strategy to direct the activity of promiscuous cytokines to T cell subsets of interest, thereby allowing precise control of T cell function via genetic engineering.

[0038] In addition to IL-2, IL-15 and IL-7 also regulate lymphatic homeostasis and have been used as adjuvants to enhance adoptive T cell therapy. IL-2 and IL-15 share the same IL-2R-beta chain. Orthogonal IL-15 can be selected against the same orthogonal IL-2R-beta used to orthogonalize IL-2. IL-7 utilizes a separate IL-7R-alpha chain that is the target of orthogonalization.

[0039] In some embodiments, the orthogonal cytokine, e.g., orthogonal IL-2, can be conjugated to an additional molecule to provide a desired pharmacological property, e.g., extended half-life. In one embodiment, the orthogonal IL-2 can be fused to the Fc domain of an IgG, albumin, or other molecule to extend its half-life, e.g., by pegylation, glycosylation, etc., as known in the art. In some embodiments, the orthogonal cytokine is conjugated to a polyethylene glycol molecule, or "PEGylated." Molecular weights of PEG conjugated to orthogonal cytokine ligands include, but are not limited to, PEG having a molecular weight of 5 kDa to 80 kDa, in some embodiments, PEG has a molecular weight of about 5 kDa, in some embodiments, PEG has a molecular weight of about 10 kDa, in some embodiments, PEG has a molecular weight of about 20 kDa, in some embodiments, PEG has a molecular weight of about 30 kDa, in some embodiments, PEG has a molecular weight of about 40 kDa, in some embodiments, PEG has a molecular weight of about 50 kDa, in some embodiments, PEG has a molecular weight of about 60 kDa, and in some embodiments, PEG has a molecular weight of about 80 kDa. In some embodiments, the molecular weight is about 5 kDa to about 80 kDa, about 5 kDa to about 60 kDa, about 5 kDa to about 40 kDa, or about 5 kDa to about 20 kDa. In a preferred embodiment, the orthogonal ligand (polypeptide naming is performed with reference to Table 1) is a pegylated form of 1A1, a pegylated form of 1C7, a pegylated form of SQVLKA, and / or a pegylated form of SQVLqA, in each case, PEG has a molecular weight of about 5 kDa, alternatively 10 kDa, alternatively 20 kDa, alternatively 30 kDa, alternatively 40 kDa, alternatively 40 kDa, alternatively 50 kDa, alternatively 30 kDa. The PEG conjugated to the polypeptide sequence can be linear or branched. The PEG can be attached to the orthogonal polypeptide directly or via a linker molecule. The processes and chemical reactions required to achieve PEGylation of biological compounds are well known in the art.

[0040] Orthogonal IL-2 can be acetylated at the N-terminus using methods known in the art, for example, by enzymatic reaction with N-terminal acetyltransferase and, for example, acetyl-CoA. Orthogonal IL-2 can be acetylated at one or more lysine residues, for example, by enzymatic reaction with lysine acetyltransferase. See, for example, Choudhary et al. (2009). Science. 325 (5942): 834-840.

[0041] Fc fusions can also confer alternative Fc receptor-mediated properties in vivo. An "Fc region" can be a naturally occurring or synthetic polypeptide that is homologous to the IgG C-terminal domain produced by digesting IgG with papain. IgG Fc has a molecular weight of approximately 50 kDa. Orthologous IL-2 polypeptides can include the entire Fc region, or a smaller portion that retains the ability to extend the circulating half-life of the chimeric polypeptide of which it is a part. In addition, full-length or fragmented Fc regions can be variants of the wild-type molecule. That is, they can contain mutations that may or may not affect the function of the polypeptide, and native activity is not necessary or desired in all cases, as described further below.

[0042] In other embodiments, the orthogonal polypeptide can include a polypeptide that functions as an antigen tag, such as a FLAG sequence. The FLAG sequence is recognized by a highly specific anti-FLAG antibody that is biotinylated, as described herein (see also Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992). In some embodiments, the chimeric polypeptide further comprises a C-terminal c-myc epitope tag.

[0043] As mentioned above, the orthogonal protein of the present invention may be present as part of a chimeric polypeptide. In addition to or instead of the heterologous polypeptides described above, the nucleic acid molecules of the present invention may contain sequences encoding "markers" or "reporters". Examples of marker or reporter genes include β-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo1, G418r), dihydrofolate reductase (DHFR), hydromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacz (encoding β-galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT). As with many standard procedures related to the practice of the present invention, those skilled in the art will recognize additional useful reagents, such as additional sequences that can function as markers or reporters.

[0044] Orthogonal cytokines and receptors may also include conservative modifications and substitutions at other positions of the cytokine (e.g., positions other than those involved in orthogonal manipulation). Such conservative substitutions include those described by Dayhoff in The Atlas of Protein Sequence and Structure 5 (1978) and Argos in EMBO J.,8:779-785 (1989). For example, amino acids belonging to one of the following groups represent conservative changes: Group I: ala, pro, gly, gin, asn, ser, thr; Group II: cys, ser, tyr, thr; Group III: val, ile, leu, met, ala, phe; Group IV: lys, arg, his; Group V: phe, tyr, trp, his; and Group VI: asp, glu. In each case, the introduction of additional modifications may be evaluated to minimize any increase in antigenicity of the modified polypeptide in the organism to which the modified polypeptide is administered.

[0045] The term "T cell" refers to a mammalian immune effector cell that may be characterized by expression of CD3 and / or a T cell antigen receptor, and which may be engineered to express orthogonal cytokine receptors. In some embodiments, T cells are naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, e.g., T H 1. T H 2. T H 9. T H 11. T H 22, T FH , regulatory T cells, e.g. R 1, Natural T Reg , inducible T Reg , memory T cells, e.g., central memory T cells, effector memory T cells, NKT cells, γδT cells.

[0046] In one embodiment of the present invention, the orthogonal receptor expressing T cells are T cells modified to surface express a chimeric antigen receptor ("CAR-T" cell). As used herein, the terms "chimeric antigen receptor T cells" and "CAR-T cells" are used interchangeably to refer to T cells recombinantly modified to express a chimeric antigen receptor. As used herein, the CAR-T cells may be engineered to express an orthogonal IL-2Rβ polypeptide. As used herein, the terms "chimeric antigen receptor" and "CAR" are used interchangeably to refer to a polypeptide comprising multiple functional domains arranged in sequence from amino to carboxy terminus: (a) an antigen binding domain (ABD), (b) a transmembrane domain (TD), and (c) one or more cytoplasmic signaling domains (CSDs), which may be optionally linked by one or more spacer domains. The CAR may also further comprise a signal peptide sequence that is conventionally removed during post-translational processing and presentation of the CAR on the cell surface. CARs useful in the practice of the present invention are prepared according to principles well known in the art. See, for example, U.S. Patent No. 7,741,465 B1 to Eshhaar et al., issued June 22, 2010; Sadelain et al. (2013) Cancer Discovery 3(4):388-398; Jensen and Riddell (2015) Current Opinions in Immunology 33:9-15; Gross et al. (1989) PNAS (USA) 86(24):10024-10028; Curran et al. (2012) J Gene Med 14(6):405-15. Examples of commercially available CAR-T cell products that can be modified to incorporate the orthogonal receptors of the invention include axicabtagene ciloleucel (sold commercially as Yescarta® by Gilead Pharmaceuticals) and tisagenlecleucel (sold commercially as Kymriah® by Novartis).

[0047] As used herein, the term antigen binding domain (ABD) refers to a polypeptide that specifically binds to an antigen expressed on the surface of a target cell. The ABD can be any polypeptide that specifically binds to one or more antigens expressed on the surface of a target cell. In certain embodiments, the target cell antigen is a tumor antigen. Examples of tumor antigens that can be targeted by the ABD of a CAR include, but are not limited to, one or more antigens selected from the group including CD19, CD20, HER2, NY-ESO-1, MUC1, CD123, FLT3, B7-H3, CD33, IL1RAP, CLL1 (CLEC12A) PSA, CEA, VEGF, VEGF-R2, CD22, ROR1, mesothelin, c-Met, glycolipid F77, FAP, EGFRvIII, MAGE A3, 5T4, WT1, KG2D ligand, folate receptor (FRa), and Wnt1 antigen.

[0048] In one embodiment, the ABD is a single chain Fv (scFv). scFv is a polypeptide consisting of the variable regions of the immunoglobulin heavy and light chains of an antibody covalently linked by a peptide linker (Bird, et al. (1988) Science 242:423-426; Huston, et al. (1988) PNAS (USA) 85:5879-5883; Sz Hu, et al. (1996) Cancer Research, 56, 3055-3061). The generation of scFv based on monoclonal antibody sequences is well known in the art. See, for example, Kipriyanov, S., The Protein Protocols Handbook, John M. Walker, Ed. (2002) Humana Press Section 150 "Bacterial Expression, Purification and Characterization of Single-Chain Antibodies." The antibodies used to prepare scFvs can be optimized by techniques well known in the art, such as phage display and directed evolution, to select for those molecules with certain desirable characteristics (e.g., enhanced affinity). In some embodiments, the ABD comprises an anti-CD19 scFv, an anti-PSA scFv, an anti-HER2 scFv, an anti-CEA scFv, an anti-EGFR scFv, an anti-EGFRvIII scFv, an anti-NY-ESO-1 scFv, an anti-MAGE scFv, an anti-5T4 scFv, or an anti-Wnt1 scFv. In another embodiment, the ABD is a single domain antibody obtained by immunization of camels or llamas with target cell-derived antigens, particularly tumor antigens. See, for example, Muyldermans, S. (2001) Reviews in Molecular Biotechnology 74:277-302.Alternatively, ABDs can be produced entirely synthetically by generating peptide libraries and isolating compounds having the desired target cell antigen binding properties substantially according to the teachings or U.S. Pat. No. 6,303,313 B1 to Wigler et al., issued Nov. 12, 1999, U.S. Pat. No. 6,696,248 B1 to Knappik et al., issued Feb. 24, 2004, Binz, et al. (2005) Nature Biotechnology 23:1257-1268, and Bradbury, et al. (2011) Nature Biotechnology 29:245-254.

[0049] An ABD may have affinity for more than one target antigen. For example, the ABD of the present invention may comprise a chimeric bispecific binding member, i.e., capable of providing specific binding to a first target cell expressed antigen and a second target cell expressed antigen. Non-limiting examples of chimeric bispecific binding members include bispecific antibodies, bispecific conjugate monoclonal antibodies (mab), and the like. 2 , bispecific antibody fragments (e.g., F(ab) 2, bispecific scFvs, bispecific diabodies, single chain bispecific diabodies, etc.), bispecific T cell engagers (BiTEs), bispecific conjugated single domain antibodies, micabodies, and variants thereof. Non-limiting examples of chimeric bispecific binding members also include those chimeric bispecific agents described in Kontermann (2012) MAbs. 4(2): 182-197, Stamova et al. (2012) Antibodies, 1(2), 172-198, Farhadfar et al. (2016) Leuk Res. 49: 13-21, Benjamin et al. Ther Adv Hematol. (2016) 7(3): 142-56, Kiefer et al. Immunol Rev. (2016) 270(1): 178-92, Fan et al. (2015) J Hematol Oncol. 8: 130, May et al. (2016) Am J Health Syst Pharm. 73(1): e6-e13. In some embodiments, the chimeric bispecific binding member is a bivalent single chain polypeptide. See, for example, Thirion, et al. (1996) European J. of Cancer Prevention 5(6):507-511, DeKruif and Logenberg (1996) J. Biol. Chem 271(13)7630-7634, and Kay, et al. United States Patent Application Publication Number 2015 / 0315566 published November 5, 2015. In some cases, the chimeric bispecific binding member can be a bispecific T cell engager (BiTE). BiTEs are generally made by fusing a specific binding member (e.g., scFv) that binds an antigen to the specific binding member (e.g., scFv) with a second binding domain specific for a T cell molecule, such as CD3. In some cases, the chimeric bispecific binding member can be a CAR T cell adaptor.As used herein, "CAR T cell adaptor" refers to an expressed bispecific polypeptide that binds to the antigen recognition domain of the CAR and redirects the CAR to a second antigen. In general, the CAR T cell adaptor has a binding region, one specific to the epitope on the CAR to which it is directed, and a second epitope directed to a binding partner that, when bound, transduces a binding signal that activates the CAR. Useful CAR T cell adaptors include, but are not limited to, those described in, for example, Kim et al. (2015) J Am Chem Soc. 137(8): 2832-5, Ma et al. (2016) Proc Natl Acad Sci US A. 113(4): E450-8, and Cao et al. (2016) Angew Chem Int Ed Engl. 55(26): 7520-4.

[0050] In some embodiments, a linker polypeptide molecule is optionally incorporated into the CAR between the antigen binding domain and the transmembrane domain to facilitate antigen binding. See, for example, Moritz and Groner (1995) Gene Therapy 2(8)539-546. In one embodiment, the linker is a hinge region from an immunoglobulin, e.g., a hinge from any one of IgG1, IgG2a, IgG2b, IgG3, IgG4, particularly a human protein sequence. Alternatives include the CH2CH3 region of an immunoglobulin and a portion of CD3. When the ABD is an scFv, an IgG hinge may be used. In some embodiments, the linker is an amino acid sequence (G 4 S) n Includes.

[0051] CARs useful in carrying out the present invention further comprise a transmembrane domain that connects the ABD (or linker, if used) to the intracellular cytoplasmic domain of the CAR. The transmembrane domain is composed of any polypeptide sequence that is thermodynamically stable in eukaryotic cell membranes. The transmembrane spanning domain can be derived from the transmembrane domain of naturally occurring transmembrane proteins or can be synthetic. When designing synthetic transmembrane domains, amino acids that favor alpha-helical structures are preferred. Transmembrane domains useful for constructing CARs are composed of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 22, 23, or 24 amino acids that favor formation with alpha-helical secondary structures. Amino acids with a to favor alpha-helical conformations are well known in the art. See, for example, Pace, et al. (1998) Biophysical Journal 75:422-427. Particularly preferred amino acids in an alpha helical conformation are methionine, alanine, leucine, glutamic acid, and lysine. In some embodiments, the CAR transmembrane domain can be derived from a transmembrane domain from a type I transmembrane protein, such as CD3zeta, CD4, CD8, CD28, etc.

[0052] The cytoplasmic domain of the CAR polypeptide comprises one or more intracellular signal domains. In one embodiment, the intracellular signal domain comprises the cytoplasmic sequence of the T cell receptor (TCR) and co-receptor that initiates signal transduction after antigen receptor binding, and functional derivatives and subfragments thereof. Cytoplasmic signal transduction domains such as those derived from the T cell receptor zeta chain are used as part of the CAR to generate stimulatory signals for T lymphocyte proliferation and effector function after the chimeric receptor binds to the target antigen. Examples of cytoplasmic signaling domains include, but are not limited to, the cytoplasmic domain of CD27, the cytoplasmic domain S of CD28, the cytoplasmic domain of CD137 (also referred to as 4-1BB and TNFRSF9), the cytoplasmic domain of CD278 (also referred to as ICOS), the p110α, β, or δ catalytic subunits of PI3 kinase, human CD3 ζ-chain, the cytoplasmic domain of CD134 (also referred to as OX40 and TNFRSF4), the CD3 polypeptides (δ, Δ, and ε), such as the FcεR1 γ and β chains, MB1 (Igα) chain, B29 (Igβ) chain, syk family tyrosine kinases (Syk, ZAP70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transduction such as CD2, CD5, and CD28.

[0053] In some embodiments, the CAR may also provide a costimulatory domain. The term "costimulatory domain" refers to the stimulatory domain, typically the endodomain, of the CAR, which provides a secondary non-specific activation mechanism that augments the primary specific stimulation. The costimulatory domain refers to the part of the CAR that enhances the proliferation, survival, or development of memory cells. Examples of costimulation include antigen non-specific T cell costimulation after antigen-specific signaling via the T cell receptor, and antigen non-specific B cell costimulation after signaling via the B cell receptor. Costimulation, e.g., T cell costimulation, and factors involved, are described in Chen&Flies(2013)Nat Rev Immunol 13(4):227-42. In some embodiments of the disclosure, the CSD comprises one or more members of the TNFR superfamily, CD28, CD137 (4-1BB), CD134 (OX40), Dap10, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, or a combination thereof.

[0054] CARs are often referred to as first, second, third, or fourth generation. The term first generation CAR refers to CARs whose cytoplasmic domain transmits signals from antigen binding only through a single signaling domain, for example, a signaling domain derived from the high affinity receptor for IgE FcεRIγ or the CD3ζ chain. The domain contains one or three immunoreceptor tyrosine-based activation motif(s) [ITAM(s)] for antigen-dependent T cell activation. The ITAM-based activation signal confers the T cell the ability to lyse target tumor cells and secrete cytokines in response to antigen binding. Second generation CARs contain costimulatory signals in addition to the CD3ζ signal. The incidental delivery of the delivered costimulatory signal enhances cytokine secretion and antitumor activity induced by CAR-transduced T cells. The costimulatory domain is usually membrane proximal to the CD3ζ domain. Third generation CARs contain three signaling domains, including, for example, CD28, CD3ζ, OX40, or 4-1BB signaling regions. In the fourth generation, or "armored car" CAR T cells are further genetically modified to express or block molecules and / or receptors to enhance immune activity.

[0055] Examples of intracellular signaling domains that can be incorporated into the CARs of the invention include (from amino to carboxy), CD3ζ, CD28-41BB-CD3ζ, CD28-OX40-CD3ζ, CD28-41BB-CD3ζ, 41BB-CD-28--CD3ζ, and 41BB-CD3ζ.

[0056] The term CAR includes CAR variants including, but not limited to, split CARs, ON-switch CARS, bispecific or tandem CARs, inhibitory CARs (iCARs), and induced pluripotent stem (iPS) CAR-T cells.

[0057] The term "split CAR" refers to a CAR in which the extracellular portion, the ABD, and the cytoplasmic signaling domain of the CAR are present on two separate molecules. CAR variants also include ON-switch CARs, which are conditionally activatable CARs, including, for example, split CARs, in which the conditional heterodimerization of the two portions of the split CAR is pharmacologically controlled. CAR molecules and their derivatives (i.e., CAR variants) can be described, for example, in PCT Application Nos. US2014 / 016527, US1996 / 017060, US2013 / 063083, Fedorov et al. Sci Transl Med (2013); 5(215):215ra172, Glienke et al. Front Pharmacol (2015) 6:21, Kakarla & Gottschalk 52 Cancer J (2014) 20(2):151-5, Riddell et al. Cancer J (2014) 20(2):141-4, Pegram et al. Cancer J (2014) 20(2):127-33, Cheadle et al. Immunol Rev (2014) 257(1):91-106, Barrett et al. Annu Rev Med (2014) 65:333-47, Sadelain et al. Cancer Discov (2013) 3(4):388-98, and Cartellieri et al., J Biomed Biotechnol (2010) 956304, the disclosures of which are incorporated herein by reference in their entireties.

[0058] The term "bispecific or tandem CAR" refers to a CAR that contains a secondary CAR binding domain that can either amplify or inhibit the activity of the primary CAR.

[0059] The term "inhibitory chimeric antigen receptor" or "iCAR" is used interchangeably herein to refer to a CAR in which the binding of the iCAR uses dual antigen targeting to stop the activation of the active CAR through the binding of a second inhibitory receptor with an inhibitory signaling domain of the secondary CAR binding domain, resulting in the inhibition of the primary CAR activation. Inhibitory CARs (iCARs) are designed to regulate CAR-T cell activity through the activation of an inhibitory receptor signaling module. This approach combines the activity of two CARs, one of which generates a dominant-negative signal that limits the response of CAR-T cells activated by the activating receptor. iCARs can turn off the response of the counteractivator CAR when bound to a specific antigen that is only expressed by normal tissues. In this way, iCAR-T cells can distinguish cancer cells from healthy cells and reversibly block the function of transduced T cells in an antigen-selective manner. The CTLA-4 or PD-1 intracellular domains in iCARs induce inhibitory signals on T lymphocytes, resulting in reduced cytokine production, less efficient target cell lysis, and altered lymphocyte motility.

[0060] The term "tandem CAR" or "TanCAR" refers to a CAR that mediates bispecific activation of T cells through the binding of two chimeric receptors designed to deliver stimulatory or costimulatory signals in response to the independent binding of two different tumor-associated antigens.

[0061] Typically, chimeric antigen receptor T cells (CAR-T cells) are T cells that have been recombinantly modified by transduction with an expression vector encoding a CAR, substantially in accordance with the above teachings.

[0062] The cells may be prepared using the patient's own T cells for manipulation. As a result, the population of cells administered to a subject is necessarily variable. In addition, because CAR-T cell drugs are variable, responses to such drugs may differ, thus involving ongoing monitoring and management of therapy-related toxicities managed by pharmacological immunosuppression or B-cell depletion prior to administering CAR-T cell therapy. Examples of such immunosuppressive regimens include systemic corticosteroids (e.g., methylprednisolone). B-cell depletion therapies include intravenous immunoglobulin (IVIG) with established clinical dosing guidelines to restore normal levels of serum immunoglobulin levels. In some embodiments, prior to administration of the CAR-T cell therapy of the present invention, the subject may optionally undergo a lymphodepletion regimen. One example of such a lymphodepletion regimen is fludarabine (30 mg / m daily for 4 days). 2 intravenous [IV]) and cyclophosphamide (500 mg / m daily for 2 days starting with the first dose of fludarabine 2 IV) to a subject.

[0063] T cells useful for engineering with the constructs described herein include naive T cells, central memory T cells, effector memory T cells, or combinations thereof. T cells for engineering as described above collected from a subject or donor may be separated from the mixture of cells by techniques that enrich for the desired cells, or may be engineered and cultured without separation. An appropriate solution may be used for dispersion or suspension. Such solutions are generally balanced salt solutions, e.g., normal saline, PBS, Hank's balanced salt solution, etc., conveniently supplemented with fetal bovine serum or other naturally occurring factors, with low concentrations, usually 5-25 mM, of an acceptable buffer. Convenient buffers include HEPES, phosphate buffers, lactate buffers, etc. Techniques for affinity separation may include magnetic separation using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents conjugated to monoclonal antibodies or used with monoclonal antibodies, e.g., complement and cytotoxins, and "panning" with antibodies bound to solid matrices, e.g., plates, or other convenient techniques. Techniques that provide accurate separation include fluorescence-activated cell sorters, which may have various degrees of sophistication, such as multicolor channels, low-angle and obtuse-angle light scattering detection channels, impedance channels, etc. Cells may be selected against dead cells by using dyes that are associated with dead cells (e.g., propidium iodide). Any technique that is not overly detrimental to the viability of the selected cells may be used. The affinity reagents may be receptors or ligands specific for the cell surface molecules set forth above. In addition to antibody reagents, peptide-MHC antigen and T cell receptor pairs, peptide ligands and receptors, effector and receptor molecules, etc. may be used.

[0064] The separated cells can be collected in any suitable medium that maintains the viability of the cells, usually with a cushion of serum at the bottom of the collection tube. Various media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Ifcos medium, etc., frequently supplemented with fetal calf serum (FCS). The collected and optionally enriched cell population can be used immediately for genetic modification or frozen and stored at liquid nitrogen temperature, and can be thawed and reused. Usually, the cells are stored in 10% DMSO, 50% FCS, 40% RPMI1640 medium.

[0065] In some embodiments, the engineered cells comprise a complex mixture of immune cells, such as tumor infiltrating lymphocytes (TILs), isolated from an individual in need of treatment. For example, Yang and Rosenberg (2016) Adv Immunol.130:279-94, “Adoptive T Cell Therapy for Cancer, Feldman et al (2015) Semin Oncol.42(4):626-39 “Adoptive Cell Therapy-Tumor-Infiltrating Lymphocytes, T-Cell Receptors, and Chimeric Antigen Receptors”, Clinical Trial See NCT01174121, “Immunotherapy Using Tumor Infiltrating Lymphocytes for Patients With Metastatic Cancer”, Tran et al. (2014) Science 344(6184)641-645, “Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer”.

[0066] In some embodiments, the engineered T cells are allogeneic with respect to the individual being treated, see, e.g., clinical trials NCT03121625, NCT03016377, NCT02476734, NCT02746952, NCT02808442. For review, see Graham et al. (2018) Cells.7(10)E155. In some embodiments, the allogeneic engineered T cells are fully HLA-matched. However, not all patients have a fully matched donor, and a cell product suitable for all patients independent of HLA type offers an alternative. A common "off the shelf" T cell product offers advantages in uniformity of harvesting and manufacturing.

[0067] T cells for the above-mentioned manipulations collected from a subject or donor may be separated from the mixture of cells by techniques that enrich for the desired cells, or may be manipulated and cultured without separation. An appropriate solution may be used for dispersion or suspension. Such solutions are generally balanced salt solutions, e.g., normal saline, PBS, Hank's balanced salt solution, etc., conveniently supplemented with fetal bovine serum or other naturally occurring factors, with low concentrations, usually 5-25 mM, of an acceptable buffer. Convenient buffers include HEPES, phosphate buffer, lactate buffer, etc. Techniques for affinity separation may include magnetic separation using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents bound to monoclonal antibodies or used with monoclonal antibodies, e.g., complement and cytotoxins, as well as "panning" with antibodies bound to solid matrices, e.g., plates, or other convenient techniques. Techniques that result in accurate separation include fluorescence-activated cell sorters, which may have various degrees of sophistication, such as multicolor channels, low-angle and obtuse-angle light scatter detection channels, impedance channels, etc. Cells may be selected for dead cells by using a dye (e.g., propidium iodide) that is associated with dead cells. Any technique that is not overly detrimental to the viability of the selected cells may be used. The affinity reagent may be a receptor or ligand specific for the cell surface molecule indicated above. In addition to antibody reagents, peptide-MHC antigen and T cell receptor pairs, peptide ligands and receptors, effector and receptor molecules, etc. may be used. The separated cells may be collected in any suitable medium that maintains the viability of the cells, usually with a cushion of serum at the bottom of the collection tube. Various media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Ifcos medium, etc., frequently supplemented with fetal calf serum (FCS). The collected and optionally enriched cell population may be used immediately for genetic modification or may be frozen and stored at liquid nitrogen temperature and thawed and reused. Usually, the cells are stored in 10% DMSO, 50% FCS, 40% RPMI1640 medium.The engineered cells may be injected into a subject by any convenient route of administration, usually intravascularly, in any physiologically acceptable medium, although they may also be introduced by other routes where the cells may find a suitable site for growth, usually at least 1 × 10. 6 Cells / kg, at least 1 x 10 7 Cells / kg, at least 1 x 10 8 Cells / kg, at least 1 x 10 9 Cells / kg, at least 1 x 10 10 Cells / kg or more are administered and are usually limited by the number of T cells available during harvest.

[0068] The allogeneic T cells used in the practice of the present invention can be genetically modified to reduce graft-versus-host disease.For example, the engineered cells of the present invention can be TCRαβ receptor knockout, which is achieved by gene editing techniques.TCRαβ is a heterodimer, and both alpha and beta chains must be present for it to be expressed.A single gene codes for the alpha chain (TRAC), but there are two genes that code for the beta chain, and therefore the TRAC locus KO is deleted for this purpose.Several different approaches have been used to achieve this deletion, such as CRISPR / Cas9, meganuclease, engineered I-CreI homing endonuclease, etc. For example, Eyquem et al. (2017) Nature 543:113-117 (TRAC coding sequence replaced with CAR coding sequence), and Georgiadis et al. (2018) Mol. Ther. 26:1215-1227 (CAR expression coupled with clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9-mediated TRAC disruption without direct integration of the CAR into the TRAC locus). Alternative strategies to prevent GVHD modify T cells to express inhibitors of TCRαβ signaling, for example, using a truncated form of CD3ζ as a TCR inhibitory molecule.

[0069] The preparation of T cells useful in the practice of the present invention is achieved by transforming isolated T cells with an expression vector comprising a nucleic acid sequence encoding an orthogonal receptor, optionally in combination with a nucleic acid sequence encoding a CAR polypeptide as described above. The nucleic acid sequences encoding the CAR and orthogonal receptor may each be provided on a separate expression vector, each nucleic acid sequence operably linked to one or more expression control elements to achieve expression of the CAR and orthogonal receptor in the target cell, and the vectors are co-transfected into the target cell. Alternatively, the nucleic acid sequences encoding the CAR and orthogonal receptor may each be provided on a single vector, each nucleic acid sequence under the control of one or more expression control elements to achieve expression of the associated nucleic acid sequence. Alternatively, both nucleic acid sequences may be under the control of a single promoter with intermediate or downstream control elements facilitating co-expression of the two sequences from the vector.

[0070] Ex vivo T cell activation can be achieved by procedures well established in the art, including cell-based T cell activation, antibody-based activation, or activation using various bead-based activation reagents. Cell-based T cell activation can be achieved by exposing T cells to antigen-presenting cells such as dendritic cells, or artificial antigen-presenting cells such as irradiated K562 cells. Antibody-based activation of T cell surface CD3 molecules using soluble anti-CD3 monoclonal antibodies also supports T cell activation in the presence of IL-2.

[0071] In general, the T cells of the present invention are expanded by culturing the cells in contact with a surface that provides an agent that stimulates CD3 TCR complex-associated signals (e.g., anti-CD3 antibody) and an agent that stimulates costimulatory molecules on the surface of T cells (e.g., anti-CD28 antibody). Bead-based T cell activation is accepted in the art for preparing CAR-T cells for clinical use. Bead-based activation of T cells can be achieved using commercially available T cell activation reagents, including but not limited to Invitrogen® CTS Dynabeads® CD3 / 28 (Life Technologies, Inc. Carlsbad CA) or Miltenyi MACS® GMP ExpAct Treg beads or Miltenyi MACS GMP TransAct™ CD3 / 28 beads (Miltenyi Biotec, Inc.). Suitable conditions for T cell culture are well known in the art. Lin, et al. (2009) Cytotherapy 11(7):912-922; Smith, et al. (2015) Clinical & Translational Immunology 4:e31 published online 16 January 2015. Target cells are cultured under the necessary conditions to support growth, e.g., appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air + 5% CO 2 ) is maintained.

[0072] If the orthogonal receptor or orthogonal receptor expressing CAR-T cells is a growth factor receptor, the orthogonal receptor expressing CAR-T cells can also be selectively expanded from a background or mixed population of transduced and non-transduced cells by use of a ligand for the orthogonal receptor. In one embodiment, the orthogonal receptor is an orthogonal IL-2 receptor and an orthogonal IL-2 compound useful for expanding such cells is an orthogonal IL-2 selected from the group provided in Table 1.

[0073] In this method, orthogonal proteins, particularly orthogonal cytokines, can be produced by recombinant methods.Orthogonal receptors can be introduced into the cells to be engineered on expression vectors.The DNA encoding orthogonal proteins can be obtained from various sources as designed during the engineering process.

[0074] Amino acid sequence variants are prepared by introducing appropriate nucleotide changes into the coding sequence as described herein. Such variants represent residue insertions, substitutions, and / or designated deletions as described above. Any combination of insertions, substitutions, and / or designated deletions can be made to arrive at the final construct, provided that the final construct has the desired biological activity as defined herein.

[0075] To achieve recombinant protein expression, the nucleic acid encoding the orthogonal protein (and / or CAR) is inserted into a replicable vector for expression. Many such vectors are available. The components of a vector generally include, but are not limited to, one or more of the following: an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Vectors include virus vectors, plasmid vectors, integrating vectors, and the like.

[0076] The expression vector for expressing the orthogonal receptor and optionally CAR in T cells can be a viral vector or a non-viral vector. Plasmid is an example of a non-viral vector. To facilitate the transfection of target cells, target cells can be directly exposed to non-viral vectors, or exposed under conditions that facilitate the uptake of non-viral vectors. Examples of conditions that facilitate the uptake of foreign nucleic acid by mammalian cells are well known in the art, and include, but are not limited to, chemical means (such as Lipofectamine®, Thermo-Fisher Scientific), high salt, and magnetic field (electroporation).

[0077] In one embodiment, the non-viral vector can be provided in a non-viral delivery system.Non-viral delivery systems are typically complexes that facilitate the transduction of target cells with nucleic acid cargo, in which the nucleic acid is complexed with agents such as cationic lipids (DOTAP, DOTMA), surfactants, biological agents (gelatin, chitosan), metals (gold, magnetic iron), and synthetic polymers (PLG, PEI, PAMAM). Many embodiments of non-viral delivery systems are known in the art and include lipid vector systems (Lee et al. (1997) Crit Rev Ther Drug Carrier Syst. 14:173-206), polymer-coated liposomes (Marin et al., U.S. Pat. No. 5,213,804, issued May 25, 1993; Woodle et al., U.S. Pat. No. 5,013,556, issued May 7, 1991), cationic liposomes (Epand et al., U.S. Pat. No. 5,283,185, issued February 1, 1994; Jessee, JA, U.S. Pat. No. 5,578,475, issued November 26, 1996; Rose et al., U.S. Pat. No. 5,279,833, issued January 18, 1994; Gebeyehu et al., U.S. Pat. No. 5,334,761, issued August 2, 1994).

[0078] In another embodiment, the expression vector can be a viral vector. When a viral vector system is used for the expression of CAR and orthogonal receptors, retroviral or lentiviral expression vectors are preferred. In particular, viral vectors include gamma retroviruses (Pule, et al. (2008) Nature Medicine 14(11):1264-1270), self-inactivating lentiviral vectors (June, et al. (2009) Nat Rev Immunol 9(10):704-716), and N Aldini, et al. (1996) Science 272:263-267, Naldini, et al. (1996) Proc. Natl. Acad. Sci. USA Vol.93, pp.11382-11388, Dull, et al. (1998) J. Virology 72(11):8463-8471, Milone, et al. al. (2009) 17(8):1453-1464, Kingsman et al., U.S. Patent No. 6,096,538, issued August 1, 2000, and Kingsman et al., U.S. Patent No. 6,924,123, issued August 2, 2005. In one embodiment of the invention, the CAR expression vector is the Lentivector® lentiviral vector available from Oxford Biomedica.

[0079] Transduction of T cells with an expression vector can be accomplished using techniques well known in the art, including, but not limited to, co-incubation of host T cells with a viral vector, electroporation, and / or chemically enhanced delivery.

[0080] Orthogonal proteins can be produced recombinantly not only directly but also as heterologous polypeptides, for example, fusion polypeptides with signal sequences or other polypeptides that have a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence can be a component of the vector or can be part of the coding sequence inserted into the vector. The heterologous signal sequence selected is preferably a signal sequence that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell. In mammalian cell expression, the native signal sequence can be used, or other mammalian signal sequences can be suitable, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders, for example, herpes simplex gD signal.

[0081] Expression vectors usually contain a selection gene, also called a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with a vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply vital nutrients unavailable from complex media.

[0082] Expression vectors contain a promoter that is recognized by the host organism and operably linked to an orthogonal protein coding sequence. Promoters are untranslated sequences located upstream (5') of the start codon of a structural gene (generally within about 100-1000 bp) that control the transcription and translation of the specific nucleic acid sequence to which they are operably linked. Such promoters are typically divided into two classes: inducible and constitutive. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient, or a change in temperature. A large number of promoters recognized by a variety of potential host cells are well known.

[0083] Transcription from vectors in mammalian host cells can be controlled by promoters derived from the genomes of viruses such as polyomavirus, avian pox virus, adenovirus (such as adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus (such as murine stem cell virus), hepatitis B virus, and most preferably simian virus 40 (SV40), from heterologous mammalian promoters such as the actin promoter, PGK (phosphoglycerate kinase), or immunoglobulin promoters, from heat shock promoters, provided that such promoters are compatible with the host cell system. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication.

[0084] Transcription by higher eukaryotes is often increased by inserting enhancer sequences into the vector. Enhancers are cis-acting elements of DNA, usually about 10-300 bp, that act on a promoter to increase its transcription. Enhancers are relatively orientation and position independent, and have been found 5' and 3' of the transcription unit, within introns, and within the coding sequence itself. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-fetoprotein, and insulin). Typically, however, enhancers from eukaryotic cell viruses are used. Examples include the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Enhancers can be spliced ​​into the expression vector at the 5' or 3' position of the coding sequence, but are preferably located at a site 5' from the promoter.

[0085] Expression vectors used in eukaryotic host cells also contain sequences necessary for the termination of transcription and stabilization of mRNA. Such sequences are commonly available from the 5' and sometimes 3' untranslated regions of eukaryotic or viral DNA or cDNA. The construction of suitable vectors containing one or more of the components listed above uses standard techniques.

[0086] Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Examples of useful mammalian host cell lines include mouse L cells (LM[TK-], ATCC#CRL-2648), SV40 transformed monkey kidney CV1 line (COS-7, ATCC CRL 1651), human embryonic kidney lines (293 cells or 293 cells subcloned for growth in suspension culture), baby hamster kidney cells (BHK, ATCC CCL 10), Chinese hamster ovary cells / -DHFR (CHO), mouse Sertoli cells (TM4), monkey kidney cells (CV1 ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRL-1 587), human cervical carcinoma cells (HELA, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), buffalo rat liver cells (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human liver cells (Hep G2, HB 8065), mouse mammary tumor cells (MMT 060562, ATCC CCL51), TRI cells, MRC5 cells, FS4 cells, and the human hepatoma line Hep G2.

[0087] Host cells, including engineered T cells, can be transfected with the expression vectors described above for orthogonal IL-2 or IL-2R expression. Cells can be cultured in conventional nutrient media, modified appropriately to induce promoters, select transformants, or amplify genes encoding the desired sequences. Mammalian host cells can be cultured in a variety of media. Commercially available media, such as Ham's F10 (Sigma), Minimum Essential Medium ((MEM), Sigma), RPMI 1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma), are suitable for culturing host cells. Any of these media can be supplemented as needed with hormones and / or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphates), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics, trace elements, and glucose, or equivalent energy sources. Any other necessary supplements can be included at appropriate concentrations that would be known to one of skill in the art. The culture conditions, such as temperature, pH, etc., will be those previously used with the host cell selected for expression and will be apparent to one of skill in the art.

[0088] A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a signal sequence is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence, or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. Enhancers, however, do not have to be contiguous.

[0089] Recombinantly produced orthogonal polypeptides can be recovered from culture media as secreted polypeptides, but can also be recovered from host cell lysates. Protease inhibitors such as phenylmethylsulfonyl fluoride (PMSF) can also be useful to inhibit proteolysis during purification, and antibiotics can be included to prevent the growth of adventitious contaminants. Various purification steps are known in the art, for example affinity chromatography is used. Affinity chromatography uses highly specific binding sites that are usually present in biological macromolecules to separate molecules according to their ability to bind to specific ligands. Covalent binding binds the ligand to an insoluble porous support medium in a manner that unambiguously presents the ligand to the protein sample, thereby using the natural biospecific binding of one molecular species to separate and purify a second species from a mixture. Antibodies are commonly used in affinity chromatography. Size selection steps can also be used, for example gel filtration chromatography (also known as size exclusion chromatography or molecular sieve chromatography) to separate proteins according to their size. In gel filtration, a protein solution is passed through a column packed with a semipermeable porous resin. Semi-permeable resins have various pore sizes that determine the size of proteins that can be separated on the column. Also of interest is cation exchange chromatography.

[0090] Orthogonal cytokine compositions may be concentrated, filtered, dialyzed, etc., using methods known in the art. For therapeutic use, cytokines containing appropriate engineered orthogonal receptors may be administered to a mammal. Administration may be intravenous, as a bolus, or by continuous infusion over a period of time. Alternative routes of administration include intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intrathecal, oral, topical, or inhalation routes. Orthogonal cytokines are also suitably administered by intratumoral, peritumoral, intralesional, or perilesional routes, or into the lymph to exert local and systemic therapeutic effects.

[0091] Such dosage forms include physiologically acceptable carriers that are essentially non-toxic and non-therapeutic. Examples of such carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphoric acid, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, and PEG. Carriers for topical or gel-based forms of polypeptides include polysaccharides such as sodium carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-polyoxypropylene block polymers, PEG, and wood wax alcohol. For all administrations, conventional depot forms are suitably used. Such forms include, for example, microcapsules, nanocapsules, liposomes, plasters, inhalation forms, nasal sprays, sublingual tablets, and sustained release preparations. The polypeptides are typically formulated in such vehicles at a concentration of about 0.1 μg / ml to 100 μg / ml.

[0092] When orthologous IL-2 polypeptides of the disclosure are "substantially pure," they can be polypeptides that contain at least about 60% by weight (dry weight) of the polypeptide of interest, e.g., the orthologous IL-2 amino acid sequence. For example, the polypeptides can be at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% by weight of the polypeptide of interest. Purity can be measured by any appropriate standard method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0093] In another embodiment of the present invention, an article of manufacture is provided that contains materials useful for treating the above-mentioned conditions. The article of manufacture includes a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials, such as glass or plastic. The container holds a composition effective for treating the condition and can have a sterile access port (e.g., the container can be an intravenous solution bag or vial with a stopper pierceable by a hypodermic needle). The active agent in the composition is an orthogonal cytokine. A label on or associated with the container indicates that the composition is used to treat the selected condition. An additional container(s) can be provided in the article of manufacture that can hold a pharma- ceutically acceptable buffer, such as, for example, phosphate buffered saline, Ringer's solution, or dextrose solution. The article of manufacture can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

[0094] As used herein, the terms "cancer" (or "cancerous"), "hyperproliferative", and "neoplastic" refer to cells capable of autonomous growth (e.g., an abnormal stage or condition characterized by rapidly proliferating cell growth). Hyperproliferative and neoplastic disease stages can be classified as pathological (e.g., characterizing or constituting a disease stage) or they can be classified as non-pathological (e.g., as a deviation from normal, but not associated with a disease stage). The term is meant to include all types of cancerous growth or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. "Pathological hyperproliferative" cells occur in disease stages characterized by malignant tumor growth. Examples of non-pathological hyperproliferative cells include proliferation of cells associated with wound repair. The term "cancer" or "tumor" is used to refer to malignant tumors of various organ systems, including those affecting the lung, breast, thyroid, lymphatic glands and lymphatic tissue, gastrointestinal organs, and reproductive-urinary systems, as well as adenocarcinomas, which are generally considered to include malignant tumors such as most colon cancers, renal cell carcinoma, prostate and / or testicular tumors, non-small cell carcinoma of the lung, small intestine cancer, and esophageal cancer.

[0095] The term "cancer" is art-recognized and refers to malignant tumors of epithelial or endocrine tissues, including cancers of the respiratory system, gastrointestinal system, genitourinary system, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma. "Adenocarcinoma" refers to cancers originating from glandular tissue or in which the tumor cells form recognizable glandular structures.

[0096] Examples of tumor cells include AML, ALL, CML, adrenocortical carcinoma, anal cancer, aplastic anemia, biliary tract cancer, bladder cancer, bone cancer, bone metastases, brain cancer, central nervous system (CNS) cancer, peripheral nervous system (PNS) cancer, breast cancer, cervical cancer, childhood non-Hodgkin's lymphoma, colon and rectal cancer, endometrial cancer, esophageal cancer, Ewing's tumor family (e.g., Ewing's sarcoma), eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin's lymphoma, Kaposi's sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, liver cancer, lung cancer, pulmonary carcinoid tumors, non-Hodgkin's lymphoma, male breast cancer, The cancers include, but are not limited to, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, myeloproliferative disorder, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cavity and oral pharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumor, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, melanoma skin cancer, non-melanoma skin cancer, gastric cancer, testicular cancer, thymus cancer, thyroid cancer, uterine cancer (e.g., uterine sarcoma), transitional cell carcinoma, vaginal cancer, vulvar cancer, mesothelioma, squamous cell or epidermoid carcinoma, bronchial adenoma, choriocarcinoma, head and neck cancer, teratocarcinoma, or Waldenstrom's hypergammaglobulinemia.Any cancer in which cancer cells show increased expression of CD47 compared to non-cancerous cells is suitable for being treated by the subject method and composition.

[0097] The compositions and methods of the present invention can be combined with additional therapeutic agents.For example, when the disease, disorder or condition to be treated is a neoplastic disease (e.g., cancer), the methods of the present invention can be combined with conventional chemotherapeutic agents or other biological anti-cancer drugs, such as checkpoint inhibitors (e.g., PD1 or PDL1 inhibitors) or therapeutic monoclonal antibodies (e.g., Avastin, Herceptin).

[0098] Examples of chemical agents identified in the art as being useful in the treatment of neoplastic diseases include avitrexate, adriamycin, adrcil, amsacrine, asparaginase, anthracyclines, azacitidine, azathioprine, bicnu, blenoxane, busulfan, bleomycin, camptosar, camptothecin, carboplatin, carmustine, cerbidine, chlorambucil, cisplatin, cladribine, cosmegen, cytarabine, cytos ... Cytosar, cyclophosphamide, Cytoxan, dactinomycin, docetaxel, doxorubicin, daunorubicin, Elence, Elspar, epirubicin, etoposide, fludarabine, fluorouracil, fludara, gemcitabine, gemzar, hycamtin, hydroxyurea, hydrarea, idamycin, idarubicin, ifosfamide, ifex, irinotecan, rambis anvis, leukeran, leustatin, matulane, mechlorethamine, mercaptopurine, methotrexate, mitomycin, mitoxantrone, mithramycin, mutamycin, myleran, mylosar, navelbine, nipent, novantrone, oncovin, oxaliplatin, paclitaxel, paraplatin, pentostatin, platinol , plicamycin, procarbazine, purinethol, ralitrexed, taxotere, taxol, teniposide, thioguanine, tomudex, topotecan, valrubicin, velban, bepcid, vinblastine, vindesine, vincristine, vinorelbine, VP-16, and vumon.

[0099] Targeted therapeutic agents that may be co-administered include tyrosine kinase inhibitors, such as imatinib mesylate (Gleevec, also known as STI-571), gefitinib (Iressa, also known as ZD1839), erlotinib (sold as Tarceva), sorafenib (Nexavar), sunitinib (Sutent), dasatinib (Sprycel), lapatinib (Tykerb), nilotinib (Tasigna), and bortezomib (Velcade), Chacafi (ruxolitinib); Janus kinase inhibitors, e.g., tofacitinib; ALK inhibitors, e.g., crizotinib; Bcl-2 inhibitors, e.g., obatoclax, vencrekita, and gossypol; FLT3 inhibitors, e.g., midostaurin (Rydapt); IDH inhibitors, e.g., AG-221; PARP inhibitors, e.g., iniparib and olaparib; PI3K inhibitors, e.g., perifosine, VEGF receptor 2 inhibitors, e.g., apatinib; [D-Lys(6)]-LHR Braf inhibitors such as vemurafenib, dabrafenib, and LGX818; MEK inhibitors such as trametinib; CDK inhibitors such as PD-0332991 and LEE011; Hsp90 inhibitors such as salinomycin; and / or small molecule drug conjugates such as vintafolide; serine / threonine kinase inhibitors such as temsirolimus (Torisel), everolimus (Afinitor), vemurafenib (Zelboraf), trametinib (Mekinist), and dabrafenib (Tafinlar).

[0100] Examples of biological agents identified in the art as being useful in the treatment of neoplastic diseases include cytokines or cytokine antagonists, e.g., IL-12, INFα, or anti-epidermal growth factor receptor, radiation therapy, irinotecan; tetrahydrofolate antimetabolites, e.g., pemetrexed; antibodies against tumor antigens, conjugates of monoclonal antibodies and toxins, T cell adjuvants, bone marrow transplants, or antigen presenting cells (e.g., dendritic cell therapy), antitumor vaccines, replication-competent viruses, signal transduction inhibitors (e.g., erythrocyte-derived immunoglobulins) to achieve additive or synergistic suppression of tumor growth, and the like. For example, Gleevec® or Herceptin®), or immunomodulators, cyclooxygenase-2 (COX-2) inhibitors, steroids, TNF antagonists (e.g., Remicade® and Enbrel®), interferon-β1a (Avonex®), and interferon-β1b (Betaseron®), as well as combinations of one or more of the foregoing implemented in known chemotherapy treatment regimens that are readily understood by clinicians of ordinary skill in the art.

[0101] Tumor-specific monoclonal antibodies that may be administered in combination with anti-CD93 ABD polypeptides or engineered cells include, but are not limited to, rituximab (sold as MabThera or Rituxan), alemtuzumab, panitumumab, ipilimumab (Yervoy), and the like.

[0102] In some embodiments, the compositions and methods of the present invention can be combined with immune checkpoint therapy. Examples of immune checkpoint therapy include inhibitors of PD1 binding to PDL1 and / or PDL2. Inhibitors of PD1 binding to PDL1 and / or PDL2 are well known in the art. Examples of commercially available monoclonal antibodies that block PD1 binding to PDL1 and / or PDL2 include nivolumab (Opdivo®, BMS-936558, MDX1106, available from BristolMyers Squibb, Princeton NJ), pembrolizumab (Keytruda® MK-3475, lambrolizumab, available from Merck and Company, Kenilworth NJ), and atezolizumab (Tecentriq®, Genentech / Roche, South San Francisco CA). Additional examples of PD1 inhibitory antibodies include, but are not limited to, durvalumab (MEDI 4736, Medimmune / AstraZeneca), pidilizumab (CT-011, CureTech), PDR001 (Novartis), BMS-936559 (MDX1105, Bristol Myers Squibb), and avelumab (MSB0010718C, Merck Serono / Pfizer), and SHR-1210 (Incyte). Additional antibody PD1 pathway inhibitors are described in U.S. Patent No. 8,217,149 issued July 10, 2012 (Genentech, Inc.), U.S. Patent No. 8,168,757 issued May 1, 2012 (Merck Sharp and Dohme Corp.), U.S. Patent No. 8,008,449 issued August 30, 2011 (Medarex), and U.S. Patent No. 7,943,743 issued May 17, 2011 (Medarex, Inc.). Additionally, small molecule inhibitors of PD1 to PDL1 and / or PDL2 are known in the art.See, e.g., WO2016142833 A1 to Sasikumar et al. and WO2016142886 A2 to Sasikumar et al., BMS-1166 and BMS-1001 (Skalniak, et al (2017) Oncotarget 8(42):72167-72181).

[0103] In other embodiments, the method of the present invention is used to treat infectious diseases. As used herein, the term "infection" refers to any stage where at least one cell of an organism (i.e., a subject) is infected by an infectious agent (e.g., a subject has an intracellular pathogen infection, e.g., a chronic intracellular pathogen infection). As used herein, the term "infectious agent" refers to a foreign biological entity (i.e., a pathogen) that induces an increase in CD47 expression in at least one cell of the infected organism. For example, infectious agents include, but are not limited to, bacteria, viruses, protozoa, and fungi. Intracellular pathogens are of particular interest. Infectious diseases are disorders caused by infectious agents. Under certain conditions, some infectious agents do not cause recognizable symptoms or disease, but may cause symptoms or disease under altered conditions. The subject methods may be used to treat chronic pathogen infections including, but not limited to, viral infections such as retroviruses, lentiviruses, hepadnaviruses, herpes viruses, pox viruses, human papilloma viruses, and the like; intracellular bacterial infections such as Mycobacterium, Chlamydophila, Ehrlichia, Rickettsia, Brucella, Legionella, Francisella, Listeria, Coxiella, Neisseria, Salmonella, Yersinia sp, Helicobacter pylori, and the like; and intracellular protozoan pathogens such as Plasmodium sp, Trypanosoma sp., Giardia sp., Toxoplasma sp., Leishmania sp, and the like.

[0104] The treatment can be combined with other active agents. Classes of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; penicillins in combination with β-lactamase inhibitors, cephalosporins, such as cefaclor, cefazolin, cefuroxime, moxalactam, etc.; carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin, etc. Cytokines, such as interferon gamma, tumor necrosis factor alpha, interleukin 12, etc., can also be included. Antiviral agents, such as acyclovir, ganciclovir, etc., can also be used in the treatment.

[0105] In yet another embodiment, regulatory T cells are engineered to treat autoimmune diseases.The spectrum of inflammatory diseases and inflammation-related diseases is broad, including autoimmune diseases such as rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS) and autoimmune hepatitis; degenerative diseases such as insulin-dependent diabetes mellitus, osteoarthritis (OA), Alzheimer's disease (AD) and macular degeneration.

[0106] Many, if not most, autoimmune and inflammatory diseases involve multiple T cell types, such as TH1, TH2, TH17, etc. Autoimmune diseases are characterized by T and B lymphocytes that abnormally target self proteins, polypeptides, peptides, and / or other self molecules that cause damage and / or dysfunction of organs, tissues, or cell types in the body (e.g., pancreas, brain, thyroid, or gastrointestinal tract), causing the clinical symptoms of disease. Autoimmune diseases include diseases that affect specific tissues, as well as diseases that can affect multiple tissues, and these diseases may depend in part on whether the response is directed to antigens that are limited to specific tissues or antigens that are widely distributed in the body.

[0107] Engineered orthogonal cytokine receptor / ligand pairs and methods of use thereof are provided. The engineered (orthogonal) cytokine specifically binds to a counterpart engineered (orthogonal) receptor. Upon binding, the orthogonal receptor activates signal transduction that is transduced through native cellular elements to mimic the native response, but provide specific biological activity to the engineered cell expressing the orthogonal receptor. The orthogonal receptor exhibits greatly reduced binding to endogenous counterpart cytokines, including the native counterpart of the orthogonal cytokine, while the orthogonal cytokine exhibits greatly reduced binding to any endogenous receptor, including the native counterpart of the orthogonal receptor. In some embodiments, the affinity of the orthogonal cytokine for the orthogonal receptor is comparable to the affinity of the native cytokine for the native receptor.

[0108] Orthogonal cytokine and receptor pairs may be selected from any cytokine of interest. The process for engineering orthogonal cytokine receptor pairs may include (a) engineering amino acid changes into the native receptor to disrupt binding to the native cytokine, (b) engineering amino acid changes into the native cytokine at contact residues for receptor binding, (c) selecting for cytokine orthologs that bind to the orthogonal receptor, (d) discarding ortholog cytokines that bind to the native receptor, or (e) selecting for receptor orthologs that bind to the orthogonal cytokine, (f) discarding ortholog receptors that bind to the native cytokine. In a preferred embodiment, knowledge of the structure of the cytokine / receptor complex is used to select amino acid positions for site-directed or error-prone mutagenesis. Conveniently, a yeast display system can be used for the selection process, although other display and selection methods are also useful.

[0109] In some cases, the amino acid changes are obtained by affinity maturation. An "affinity matured" polypeptide is a polypeptide having one or more modification(s) in one or more residues that result in an improvement in the affinity of the orthogonal polypeptide for its cognate orthogonal receptor, as compared to a parent polypeptide that does not have the modification(s), or vice versa. Affinity maturation can be performed to increase binding affinity by at least about 10-50%, 100%, 150% or more, or 1-5 fold, as compared to the "parent" polypeptide. The engineered orthogonal cytokines of the invention activate the orthogonal receptor as discussed above, but have significantly reduced binding and activation of the native receptor, e.g., the orthogonal cytokine may exhibit less than about 5% inhibition in competitive inhibition with the corresponding native cytokine, as assessed by ELISA and / or FACS analysis using sufficient amounts of the molecule under suitable assay conditions.

[0110] In some embodiments of the invention, the orthogonal receptor is a polypeptide selected from the chains of the IL-2 receptor, i.e., interleukin 2 receptor alpha (IL-2Rα; CD25), interleukin 2 receptor beta (IL-2Rβ; CD122), and interleukin 2 receptor gamma (IL-2Rγ; CD132; common gamma chain). In some specific embodiments, the orthogonal receptor is CD132, which is involved in signaling from IL-2, IL-4, IL-7, and IL-15. In other specific embodiments, the orthogonal receptor is CD122, which is involved in signaling from IL-2 and IL-15. The orthogonal receptor is usually paired with a counterpart orthogonal cytokine, e.g., IL-2, IL-4, IL-7, IL-15, etc.

[0111] In some specific embodiments, the orthogonal receptor is CD122. In some such embodiments, the orthogonal receptor is introduced into T cells or NK cells that may also express CD25 and / or CD132. Nucleic acid coding sequences and protein compositions of modified CD122 proteins are provided. In the present invention, CD122 is engineered to disrupt the binding of native cytokines by substituting amino acids of the native sequence with non-natural amino acids or by deleting native amino acids at positions involved in binding to native IL-2. In some embodiments, amino acids are replaced with non-conservative changes. Positions of interest for substitution or deletion include, but are not limited to, R41, R42, Q70, K71, T73, T74, V75, S132, H133, Y134, F135, E136, Q214 of human CD122 (hCD122). Positions of interest for substitution or deletion include, but are not limited to, R42, F67, Q71, S72, T74, S75, V76, S133, H134, Y135, I136, E137, R215 of mouse CD122 (mCD122).

[0112] In some embodiments, CD122 is substituted at one or in combination at positions selected from Q71, T74, H134, Y135 of the mouse protein, or Q70, T73, H133, Y134 of the human protein. In some embodiments, the engineered protein comprises amino acid substitutions at mCD122 H134 and Y135, or hCD122 H133 and Y134. In some embodiments, the amino acid substitutions are to acidic amino acids, e.g., aspartic acid and / or glutamic acid. Specific amino acid substitutions include, but are not limited to, mCD122 substitutions Q71Y, T74D, T74Y, H134D, H134E, H134K, Y135F, Y135E, Y135R, and hCD122 changes Q70Y, T73D, T73Y, H133D, H133E, H133K, Y134F, Y134E, Y134R. The choice of orthogonal cytokine may depend on the choice of orthogonal receptor.

[0113] In some embodiments where the orthogonal receptor is CD122, the orthogonal cytokine is IL-2, or IL-15. Cytokines can be selected for binding to the orthogonal receptor, for example, by yeast display evolution, error-prone or targeted mutagenesis, etc. A representative set of selected orthogonal sequences is shown in FIG.

[0114] In some embodiments, the orthogonal cytokine is IL-2. In some embodiments, one or more of the amino acid residues H27, L28, E29, Q30, M33, D34, Q36, E37, R41, N103 for mouse IL-2 (mIL-2) and Q13, L14, E15, H16, L19, D20, Q22, M23, G27, R81, N88 for human IL-2 (hIL-2) are substituted with an amino acid other than that of the native protein or deleted at that position. In some such embodiments, the set of amino acid substitutions is selected from one or more of E29, Q30, M33, D34, Q36, and E37 (for mIL-2) and E15, H16, L19, D20, Q22, M23, R81 for hIL-2.

[0115] In some embodiments, the amino acid substitutions in mIL-2 are one or more of [H27W], [L28M, L28W], [E29D, E29T, E29A], [Q30N], [M33V, M33I, M33A], [D34L, D34M], [Q36S, Q36T, Q36E, Q36K, Q36E], [E37A, E37W, E37H, E37Y, E37F, E37A, E37Y], [R41K, R41S], or [N103E, N103Q]; and hIL-2 For, it is one or more of [Q13W], [L14M, L14W], [E15D, E15T, E15A, E15S], [H16N, H16Q], [L19V, L19I, L19A], [D20L, D20M], [Q22S, Q22T, Q22E, Q22K, Q22E], [M23A, M23W, M23H, M23Y, M23F, M23Q, M23Y], [G27K, G27S], [R81D, R81Y], [N88E, N88Q], and [T51I]. In some embodiments, the set of amino acid substitutions are, for mIL-2, [Q30N, M33V, D34N, Q36T, E37H, R41K], [E29D, Q30N, M33V, D34L, Q36T, E37H], [E29D, Q30N, M33V, D34L, Q36T, E37A], and [E29D, Q30N, M33V, D34L, Q36K, E37A], and For hIL-2, it includes one of a set of substitutions: [H16N, L19V, D20N, Q22T, M23H, G27K], [E15D, H16N, L19V, D20L, Q22T, M23H], [E15D, H16N, L19V, D20L, Q22T, M23A], and [E15D, H16N, L19V, D20L, Q22K, M23A], or conservative variants thereof.

[0116] In some embodiments, the amino acid substitutions in hIL-2 are one or more of [E15S, E15T, E15Q, E15H], [H16Q], [L19V, L19I], [D20T, D20S, D20M, D20L], [Q22K, Q22N], [M23L, M23S, M23V, M23T]. In some embodiments, the consensus mutation set in hIL-2 is [E15S, H16Q, L19V, D20T / S / M; Q22K; M23L / S]. In some embodiments, the consensus mutation set in hIL-2 is [E15S, H16Q, L19V, D20L, M23Q / A], and optionally Q22K.

[0117] In some embodiments, the set of amino acid substitutions are, for hIL-2, [E15S;H16Q;L19V,D20T / S;Q22K,M23L / S], [E15S;H16Q;L19I;D20S;Q22K;M23L], [E15S;L19V;D20M;Q22K;M23S], [E15T;H16Q;L19V;D20S;M23S], [E15Q;L19V;D20M;Q22K;M23S], [E15Q;H16Q;L19V;D20T;Q22K;M23V], [E15H; ,R81D,T51I], [E15S,H16Q,L19V,D20L,M23Q,R81Y], [E15S,H16Q,L19V,D20L,Q22K,M23A], [E15S,H16Q,L19V,D20L,M23A].

[0118] Methods are provided for enhancing cellular responses by engineering cells from a recipient or donor with the introduction of an orthogonal receptor of the invention and stimulating the orthogonal receptor by contacting the engineered cells with a cognate orthogonal cytokine. The subject methods include obtaining target cells, e.g., T cells, hematopoietic stem cells, etc., which may be isolated from a biological sample or obtained in vitro from a source of progenitor cells. The cells are transduced or transfected with an expression vector containing a sequence encoding the orthogonal receptor, which may be performed in any suitable culture medium.

[0119] In some embodiments, engineered cells are provided in which the cells are modified by the introduction of the orthogonal receptor of the present invention. Any cell may be used for this purpose. In some embodiments, the cell is a naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, e.g., T H 1. T H 2. T H 9. T H 11. T H 22, T FH , regulatory T cells, e.g. R 1, Natural T Reg , inducible T Reg In some embodiments, the engineered cells are T cells, including but not limited to, memory T cells, e.g., central memory T cells, effector memory T cells, NKT cells, γδT cells, etc. In other embodiments, the engineered cells are stem cells, e.g., hematopoietic stem cells or NK cells. In some embodiments, the cells are genetically modified in an ex vivo procedure prior to transfer into the subject. The engineered cells can be provided in a unit dose for therapy and can be allogeneic, autologous, etc. with respect to the intended recipient.

[0120] Cells, e.g., cells collected from a subject, may be separated from a mixture of cells by techniques that enrich for the desired cells. An appropriate solution may be used for dispersion or suspension. Such solutions are generally balanced salt solutions, e.g., normal saline, PBS, Hank's balanced salt solution, etc., conveniently supplemented with fetal bovine serum or other naturally occurring factors, with a low concentration, usually 5-25 mM, of an acceptable buffer. Convenient buffers include HEPES, phosphate buffer, lactate buffer, etc. Alternatively, engineered cell lines, expanded allogeneic cells, etc., may be used for manipulation.

[0121] Techniques for affinity separation may include magnetic separation using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents conjugated to monoclonal antibodies or used with monoclonal antibodies, e.g., complement and cytotoxins, and "panning" with antibodies bound to solid matrices, e.g., plates, or other convenient techniques. Techniques that result in accurate separation include fluorescence-activated cell sorters, which may have various degrees of sophistication, such as multicolor channels, low-angle and obtuse-angle light scatter detection channels, impedance channels, etc. Cells may be selected against dead cells by using dyes that are associated with dead cells (e.g., propidium iodide). Any technique that is not overly detrimental to the viability of the selected cells may be used. The affinity reagent may be a receptor or ligand specific for the cell surface molecules shown above. In addition to antibody reagents, peptide-MHC antigen and T cell receptor pairs, peptide ligands and receptors, effector and receptor molecules, etc. may be used.

[0122] The dissociated cells can be collected in any suitable medium that maintains the viability of the cells, usually with a cushion of serum at the bottom of the collection tube. A variety of media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Ifcos medium, etc., frequently supplemented with fetal bovine serum.

[0123] The collected and optionally enriched cell population can be used immediately or frozen and stored at liquid nitrogen temperature and can be thawed and reused. Cells are typically stored in 10% DMSO, 50% FCS, 40% RPMI1640 medium.

[0124] In some embodiments, a vector is provided that includes a coding sequence encoding an orthogonal receptor, the coding sequence being operably linked to a promoter active in the desired cell. A variety of vectors, e.g., viral vectors, plasmid vectors, minicircle vectors, are known in the art and can be used for this purpose, and these vectors can be integrated into the target cell genome or maintained episomally. The receptor encoding vector can be provided in a kit in combination with a vector encoding an orthogonal cytokine that binds to and activates the receptor. In some embodiments, the coding sequence of the orthogonal cytokine can be operably linked to a high expression promoter and optimized for production. In other embodiments, a kit is provided in which the vector encoding the orthogonal receptor is provided with a purified composition of the orthogonal cytokine, e.g., in a unit dose, packaged for administration to a patient.

[0125] In some embodiments, a method of treatment is provided, comprising introducing an engineered cell population into a recipient in need thereof, the cell population being modified by introduction of a sequence encoding an orthogonal receptor of the invention. The cell population may be engineered ex vivo, and is usually autologous or allogeneic with respect to the recipient. In some embodiments, the introduced cell population is contacted with a cognate orthogonal cytokine in vivo after administration of the engineered cells. An advantage of the present invention is the lack of cross-reactivity between the orthogonal cytokine and the native receptor.

[0126] When cells are contacted with orthogonal cytokines in vitro, the cytokines are added to the engineered cells in a sufficient dose and for a sufficient period of time to activate signaling from the receptor, which may utilize natural cellular mechanisms, e.g., accessory proteins, co-receptors, etc. Any suitable culture medium may be used. The cells thus activated may be used for any desired purpose, including experimental purposes for determining antigen specificity, cytokine profiles, etc., and for in vivo delivery.

[0127] When the contacting is performed in vivo, an effective dose of engineered cells, including but not limited to CAR-T cells modified to express an orthogonal IL-2β receptor, is infused into the recipient in combination with or prior to administration of an orthogonal cytokine, such as IL-2, to contact the T cells in their natural environment, such as lymph nodes. Dosage and frequency may vary depending on the agent, method of administration, nature of the cytokine, etc. It will be understood by those skilled in the art that such guidelines will be adjusted according to individual circumstances. Dosage may be modified for local administration, such as nasal, inhalation, etc., or systemic administration, such as im, ip, iv, etc. Generally, at least about 10 4 of engineered cells / kg, at least about 10 5 of engineered cells / kg, at least about 10 6 of engineered cells / kg, at least about 10 7 of engineered cells / kg or more are administered.

[0128] Where the engineered cells are T cells, the enhanced immune response may manifest as an increase in the cytolytic response of T cells against target cells present in the recipient, e.g., tumor cells, elimination of infected cells, reduction in symptoms of autoimmune disease, etc.

[0129] The engineered T cells can be provided in pharmaceutical compositions suitable for therapeutic use, for example, for human treatment. Therapeutic preparations containing such cells can be in the form of an aqueous solution, frozen, or prepared for administration with physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). The cells are formulated, dosed, and administered in a manner consistent with good medical practice. Factors to consider in this context include the particular disorder to be treated, the particular mammal to be treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the drug, the method of administration, the administration schedule, and other factors known to physicians.

[0130] The cells can be administered by any suitable means, usually parenterally, including intramuscular, intravenous (bolus or slow infusion), intraarterial, intraperitoneal, intrathecal, or subcutaneous administration.

[0131] The engineered T cells can be injected into a subject in any physiologically acceptable medium, usually intravascularly, but they may also be introduced into any other site where the cells may find a suitable site for growth. Typically, at least 1 × 10 6 Cells / kg, at least 1 x 10 7 Cells / kg, at least 1 x 10 8 Cells / kg, at least 1 x 10 9 Cells / kg, at least 1 x 10 10 Cells / kg or more are administered and are usually limited by the number of T cells available during harvest.

[0132] For example, a typical range of administration of cells for use in practicing the present invention is about 1×10 cells / kg of subject body weight per course of therapy. 5 ~5×10 8 Thus, when adjusted for body weight, a typical range for administration of viable cells in a human subject is approximately 1×10 per course of therapy. 6 ~Approx. 1×10 13Viable cells, or approximately 5 × 10 6 ~Approx. 5×10 12 Viable cells, or approximately 1 x 10 7 ~Approx. 1×10 12 Viable cells, or approximately 5 × 10 7 ~Approx. 1×10 12 Viable cells, or approximately 1 x 10 8 ~Approx. 1×10 12 Viable cells, or approximately 5 × 10 8 ~Approx. 1×10 12 Viable cells, or approximately 1 x 10 9 ~Approx. 1×10 12 In one embodiment, the dose of cells ranges from 2.5 to 5×10 per course of therapy. 9 Within the range of living cells.

[0133] The course of therapy may be a single dose or multiple doses over a period of time. In some embodiments, the cells are administered in a single dose. In some embodiments, the cells are administered in two or more split doses administered over a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28, 30, 60, 90, 120, or 180 days. The amount of engineered cells administered in such split dosing protocols may be the same in each administration, or may be provided at different levels. A multiple-day dosing protocol over a period of time may be provided by a person skilled in the art (e.g., a physician) who monitors the administration of cells, taking into account the subject's response to the treatment, including adverse effects of the treatment and their adjustment as discussed above.

[0134] For example, in the current clinical practice of CAR-T cell therapy, CAR-T cells are generally administered in combination with lymphodepletion (e.g., by administration of alemtuzumab (monoclonal anti-CD52), purine analogs, etc.) to facilitate expansion of CAR-T cells prior to host immune recovery. In some embodiments, CAR-T cells may be modified for resistance to alemtuzumab. In one aspect of the invention, lymphodepletion currently used in conjunction with CAR-T therapy may be eliminated or reduced by the orthogonal ligand-expressing CAR-T of the invention. As discussed above, lymphodepletion is commonly used to allow for expansion of CAR-T cells. However, lymphodepletion is also associated with a major side effect of CAR-T cell therapy. Orthogonal ligands may reduce the need for lymphodepletion prior to administration of orthogonal ligand-expressing CAR-T, as they provide a means to selectively expand specific T cell populations. The present invention allows for the implementation of CAR-T cell therapy without or with reduced lymphodepletion prior to administration of orthogonal ligand-expressing CAR-T.

[0135] In one embodiment, the invention provides a method of treating a subject suffering from a disease, disorder, or condition amenable to treatment by CAR-T cell therapy (e.g., cancer) by administering an orthogonal ligand-expressing CAR-T without lymphodepletion prior to administration of the orthogonal ligand CAR-T. In one embodiment, the present invention provides a method of treating a mammalian subject suffering from a disease, disorder associated with the presence of an abnormal cell population (e.g., a tumor), the cell population being characterized by the expression of one or more surface antigens (e.g., tumor antigen(s)), the method comprising: (a) obtaining a biological sample comprising T cells from the individual; (b) enriching the biological sample for the presence of T cells; (c) transfecting the T cells with one or more expression vectors comprising a nucleic acid sequence encoding a CAR and a nucleic acid sequence encoding an orthogonal receptor, the antigen targeting domain of the CAR being capable of binding to at least one antigen present on the abnormal cell population; (d) expanding the population of orthogonal receptor-expressing CAR-T cells ex vivo; (e) administering a pharmacologic effective amount of the orthogonal receptor-expressing CAR-T cells to the mammal; and (f) modulating the growth of the orthogonal receptor-expressing CAR-T cells using a ligand that selectively binds to the orthogonal receptor expressed on the CAR-T cells. In one embodiment, the aforementioned method is associated with lymphodepletion or immunosuppression of the mammal prior to the initiation of a course of CAR-T cell therapy. In another embodiment, the aforementioned method is performed without lymphodepletion and / or immunosuppression of the mammal.

[0136] Preferred formulations depend on the intended method of administration and therapeutic use. The composition may also contain pharma- ceutically acceptable non-toxic carriers or diluents, defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration, depending on the desired formulation. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solution, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also contain other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc.

[0137] In yet some other embodiments, the pharmaceutical compositions may also include large, slowly metabolized macromolecules such as proteins, polysaccharides such as chitosan, polylactic acids, polyglycolic acids, and copolymers (such as latex-functionalized Sepharose®, agarose, cellulose, etc.), polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes).

[0138] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; serum albumin, gelatin. or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0139] The formulations to be used for in vivo administration are typically sterile. Sterilization of the compositions of the invention can be readily accomplished by filtration through sterile filtration membranes.

[0140] Typically, the composition is prepared as an injectable, either as a liquid solution or suspension, and solid forms suitable for solution or suspension in liquid vehicles before injection can also be prepared.The preparation can also be emulsified or encapsulated in liposomes, or microparticles such as polylactide, polyglycolide, or copolymers, for enhanced adjuvant effect, as discussed above.See Langer, Science 249:1527,1990 and Hanes, Advanced Drug Delivery Reviews 28:97-119,1997.The agent of the present invention can be administered in the form of a depot injection or implant preparation, which can be formulated in such a way that it allows sustained or pulsatile release of active ingredient.The pharmaceutical composition is generally formulated as sterile, substantially isotonic, and in full compliance with all Good Manufacturing Practice (GMP) regulations of the United States Food and Drug Administration.

[0141] Kits for use in the methods are also provided. The subject kits include an expression vector encoding an orthogonal cytokine receptor, or cells containing the expression vector. The kits may further include a cognate orthogonal cytokine. In some embodiments, the components are provided in dosage forms (e.g., therapeutically effective dosage forms), liquid, or solid forms, in any convenient package (e.g., stick packs, dose packs, etc.). Reagents for cell selection or in vitro induction, such as growth factors, differentiation agents, tissue culture reagents, etc., may also be provided.

[0142] In addition to the above components, the subject kit may further comprise instructions for carrying out the subject method (in certain embodiments). These instructions may be present in the subject kit in various forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, such as a sheet of paper (or sheets) on which the information is printed, the kit's packaging, a package insert, etc. Yet another form in which these instructions may be present is a computer-readable medium on which the information is recorded, such as a diskette, a compact disc (CD), a flash drive, etc. Yet another form in which these instructions may be present is a website address that may be used via the Internet to access the information at a remote location.

[0143] In some embodiments, the subject compositions, methods, and kits are used to enhance T cell-mediated immune responses. In some embodiments, the immune response is directed to conditions where it is desirable to deplete or modulate target cells, such as cancer cells, infected cells, immune cells involved in autoimmune diseases, etc.

[0144] In some embodiments, the condition is a chronic infection, i.e., an infection that is not cleared by the host immune system within a period of up to one week, two weeks, etc. In some cases, chronic infection involves the integration of pathogen genetic elements into the host genome, e.g., retrovirus, lentivirus, hepatitis B virus, etc. In other cases, chronic infection results from pathogen cells residing within the host cell, e.g., certain intracellular bacterial or protozoan pathogens. Additionally, in some embodiments, the infection is in a latent stage, as with herpes viruses or human papilloma viruses.

[0145] The method of the present invention provides more effective killing of infected cells by T effector cells of the host organism compared to the elimination in the absence of treatment, and thus can be directed to the intracellular phase of the pathogen's life cycle.The method can further comprise monitoring the patient for the effectiveness of the treatment.Monitoring can be by measuring the clinical signs of infection, such as fever, white blood cell count, etc., and / or directly monitoring for the presence of the pathogen.

[0146] In some embodiments, the condition is cancer. The term "cancer" as used herein refers to a variety of conditions caused by abnormal, uncontrolled growth of cells. Cells capable of causing cancer, referred to as "cancer cells", have characteristic properties such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and / or certain typical morphological features. Cancer can be detected in any of several ways, including, but not limited to, detection of the presence of tumor(s) (e.g., by clinical or radiological means), examination of cells within the tumor or from another biological sample (e.g., from a tissue biopsy), measurement of blood markers indicative of cancer, and detection of genotypes indicative of cancer. However, a negative result in one or more of the above detection methods does not necessarily indicate the absence of cancer; for example, a patient who has shown a complete response to cancer treatment may still have cancer, as evidenced by a subsequent recurrence.

[0147] Although the present invention has been fully described herein, it will be apparent to one skilled in the art that various changes and modifications can be made without departing from the spirit or scope of the invention.

[0148] experiment Orthogonal IL-2 and IL-2Rβ Here we describe inventions involving engineered cytokines and receptors that allow for selective expansion of desired cell subsets in an ex vivo adoptive cell therapy setting. A specific invention is described for the cytokine interleukin-2 (IL-2) and its receptor, the IL-2Rβ chain (IL-2Rβ), which allows for the specific expansion of T cells in adoptive cell therapy, thus addressing an unmet need in immunotherapy. The approach described herein can be generalized to any setting of adoptive cell therapy where cells are stimulated by a specific receptor-ligand pair, including bone marrow and stem cell transplantation, as well as many other modalities.

[0149] Orthogonal IL-2 and IL-2Rβ ligand-receptor pairs are specifically described. Orthologous forms of IL-2 and IL-2Rβ specifically bind to each other, but not to their wild-type counterparts. Multiple orthogonal IL-2 variant sequences are provided with varying degrees of affinity for orthogonal IL-2Rβ. Orthogonal IL-2-dependent signaling and T cell proliferation of engineered T cells expressing orthogonal IL-2Rβ are shown.

[0150] IL-2 is an attractive biologic for the treatment of cancer and autoimmunity due to its ability to promote the expansion of effector T cells and regulatory T cells, respectively. However, this multifaceted nature of IL-2, as well as off-target toxicity, limits its use in the clinic. The ability to uncouple the immune stimulating and immune suppressive properties of IL-2 may provide a superior form of IL-2 immunotherapy.

[0151] Presented herein is the ability to engineer T cells to express orthogonal IL-2Rβ. These engineered T cells are shown to respond to orthogonal IL-2, resulting in phosphorylation of downstream signaling molecules (e.g., STAT5) and T cell proliferation. The activity of orthogonal IL-2 in wild-type T cells is completely suppressed or significantly blunted compared to the activity of wild-type IL-2. Thus, selective T cell expansion using orthogonal IL-2 / IL-2 receptor pairs is demonstrated.

[0152] Applications of the orthogonal IL-2 / IL-2 receptor pair include, but are not limited to, the selective expansion of tumor-reactive cytotoxic T cells for cancer therapy, NK cells for infectious diseases and / or cancer, and regulatory T cells for patients with autoimmune disorders.

[0153] IL-2 variants with blunted affinity for intermediate (IL-2Rβ and IL-2Rγ) or high affinity wild-type IL-2 receptors (IL-2Rα, Rβ, Rγ) due to mutations that do not completely eliminate binding to IL-2Rβ are also useful for selectively targeting the activity of orthologous IL-2 to IL-2Rα-high cells, for example, in the treatment of autoimmune diseases. IL-2 variants that have eliminated affinity for the IL-2Rβ chain but retain binding to IL-2Rα and thus function as competitive antagonists with wild-type IL-2 by inhibiting high affinity IL-2R formation are useful for treating autoimmune diseases or graft-versus-host disease.

[0154] The overall concept of generating and utilizing orthogonal IL-2 / IL-2 receptor pairs for controlling T cell expansion is shown in the schematic diagram in Figure 1. Figure 2 presents a workflow including steps to generate IL-2Rβ orthologs that lack binding to wild-type IL-2 using structurally informed mutagenesis. Mutations predicted to disrupt IL-2Rβ binding to wild-type IL-2 are experimentally confirmed using a yeast-based screening assay and further validated using purified recombinant protein by surface plasmon resonance. Using this approach, several IL-2Rβ point mutations that disrupt binding to wild-type IL-2 have been described, and each of these receptor variants can function as an orthogonal receptor. Single point mutations may also be combined with one, two or more additional point mutations to generate a larger library of IL-2Rβ orthologs.

[0155] The sequences of the orthogonal murine IL-2Rβ variants are shown in Figure 3. These mutations can be used as single point mutations or any combination thereof to generate IL-2Rβ orthologs with one, two, three or more point mutations, as long as the combined mutations disrupt wild-type IL-2 binding.

[0156] Figure 4 shows the characterization of mIL-2Rβ mutants containing amino acid changes H134D, Y135F that abrogate wild-type mIL-2 binding. These two residues are known IL-2 interaction hotspots (Ring A et al, Nat Immunol (2012) 13:1187-95), and the mutations were confirmed to disrupt wild-type IL-2 binding by surface plasmon resonance (SPR).

[0157] Figure 5 shows the workflow for engineering an orthogonal IL-2 / IL-2Rβ pair. An ortholog library of IL-2 is generated that randomizes residues that are proximal to or in contact with IL-2Rβ ortholog amino acid residues. Yeast display is used to select for IL-2 variants that bind to the ortholog IL-2Rβ and discard clones that bind to wild-type IL-2Rβ. This process may be repeated using site-directed or error-prone mutagenesis to generate IL-2 variants with differential binding properties to the ortholog but not to wild-type IL-2Rβ. Using this approach, we have generated a library of IL-2 orthologs that 1) retain binding to the IL-2Rα chain (green curve) indicating intact structural integrity of the yeast-displayed orthogonal IL-2 variants, 2) bind to the ortholog IL-2Rβ (orange curve) but 3) do not bind to wild-type IL-2Rβ (blue curve).

[0158] The sequences of the characterized orthogonal mouse IL-2 variants are shown in FIG. 6. The alignment of mouse IL-2 and IL-2Rβ and the human counterparts is shown in FIG. 15. These four sequences provide a reference for the natural or wild-type sequences. The amino acid residues modified to create the orthogonal mouse IL-2 / IL-2Rβ pair are largely conserved in humans. Thus, the orthogonal mouse IL-2 and IL-2Rβ sequences can be easily translated into human IL-2 and IL-2Rβ proteins.

[0159] As shown in Figure 7, orthoIL-2 variants bind to orthoIL-2Rβ with affinity similar to or greater than wild-type IL-2 and IL-2Rβ interactions. Soluble orthoIL-2 or wild-type IL-2 proteins were flowed over a sensor chip coated with wild-type or orthoIL-2Rβ. Binding was determined by surface plasmon resonance (SPR) and curves were fitted using a 1:1 binding model. As shown in Figure 8, orthoIL-2 variants show blunted activity (phosphoSTAT5) on wild-type CD25 positive and CD25 negative splenocytes.

[0160] The generation of orthoIL-2Rβ-expressing murine CTLL-2 T cells is shown in Figure 9. An immortalized murine T cell line (CTLL-2) expressing orthoIL-2Rβ (orthoCTLL-2) was generated by lentiviral transduction with a gene encoding the full-length orthogonal receptor. Transduced cells were selected with puromycin, a toxin for non-transduced cells, to obtain a stable CTLL-2 cell line expressing both wild-type and orthoIL-2Rβ. This cell line was also positive for CD25 and CD132, thus representing T cells expressing the high affinity IL-2 receptor complex. The antibody used to detect cell surface IL-2Rβ (CD122) does not distinguish between wild-type and orthoIL-2Rβ. Thus, the increase in mean fluorescence intensity between wild-type and orthoIL-2Rβ CTLL-2 cells suggests that these cells express the orthogonal receptor. This is further supported by their resistance to puromycin, which is encoded by the same vector used to express orthoIL-2Rβ.

[0161] As shown in Figure 10, the first set of orthoIL-2 variants is selective for orthoT cells. To investigate orthoIL-2 signaling, we utilized either unengineered (wild type) or transduced CTLL-2 cell models that also expressed orthoIL-2Rβ (ortho). We then determined the ability of wild type or various orthoIL-2 clones to induce phosphorylation of STAT5 (a quantitative readout of IL-2-dependent signaling). We identified several orthogonal IL-2 variants that induced selective STAT5 phosphorylation on orthoIL-2Rβ-expressing cells compared to wild type cells. The dose-response curves of selected clones are shown in Figure 11.

[0162] Primary lymph node-derived T cells engineered to express orthoIL-2Rβ (H134D Y135F). In addition to our immortalized mouse T cell model, we also generated orthoIL-2Rβ expressing primary mouse T cells by isolation of mouse lymph node and spleen cells, activation with CD3 / CD28, followed by retroviral transduction of the gene encoding the full-length orthogonal receptor. This construct also contains an IRES followed by the fluorescent protein YFP, allowing confirmation of transduction by analyzing YFP expression via FACS. Mouse T cells also express the high affinity IL-2 receptor complex (e.g., CD25, CD122, and CD132), as shown in Figure 12.

[0163] As shown in FIG. 13, orthoIL-2 variants induce selective STAT5 phosphorylation on orthoIL-2Rβ-expressing primary murine T cells.

[0164] OrthoIL-2 mutants that selectively signal through orthoIL-2Rβ (Figure 11) also induce selective expansion of CTLL-2 cells expressing orthoIL-2Rβ compared to wild-type CTLL-2 cells (Figure 14).

[0165] The orthogonal IL-2 engineering approach was also applied to human IL-2 and human IL-2Rβ. The H133D Y134F mutation used to generate mouse orthoIL-2Rβ was introduced into human IL-2Rβ because these residues are highly conserved between mouse and human. Indeed, wild-type hIL-2Rβ binds wild-type IL-2 displayed in yeast, whereas the hIL-2Rβ H133D Y134F mutant (ortho-hIL-2Rβ) lacks detectable binding to wild-type IL-2 (FIG. 15). By randomizing residues predicted to be in contact with or close to the H133D Y134F mutation, we generated a library of human IL-2 mutants displayed on the surface of yeast and selected for IL-2 mutants that bound ortho but not wild-type human IL-2Rβ. This scheme is identical to that used to engineer the mouse IL-2 orthogonal pair and was successful in the human pair. The strategy is shown in FIG. 16. As shown in FIG. 16C, a consensus set of mutations was identified that represents a convergence of ortho hIL-2 sequences capable of binding to orthohIL-2Rβ.

[0166] The polypeptides of the present invention are also active in vivo. As shown in Figures 17-19, a mouse model was used to demonstrate selective expansion or increased survival of ortho IL-2Rb expressing T cells in mice. We show that orthoIL-2 clone 1G12 / 149 selectively expands ortho but not wild-type T cells in mice. Treatment with wild-type IL-2 results in expansion of both wild-type and ortho T cells compared to PBS control, whereas treatment with orthoIL-2 clone 1G12 / 149 selectively expands ortho T cells with limited activity over wild-type T cells.

[0167] Example 2 Human IL-2 ortholog material and method Protein production. DNA encoding wild-type human IL-2 was cloned into the insect expression vector pAcGP67-A, which contains a C-terminal 8xHIS tag for affinity purification. DNA encoding mouse serum albumin (MSA) was purchased from Integrated DNA Technologies (IDT, Coralville, Iowa 52241) and cloned into pAcGP67-A as a fusion between the N-terminus of hIL-2 and the C-terminus of MSA. Mutant forms of ortho human IL-2 isolated from activity screens were synthesized as GBlocks (IDT) and cloned into the pAcGP67-A-MSA vector by overlap extension.

[0168] Insect expression DNA constructs were transfected into Trichoplusia ni (High Five®) cells (Invitrogen) using the BaculoGold® Baculovirus Expression System (BD Biosciences) for secretion, purified from clarified supernatants by Ni-NTA, followed by size-exclusion chromatography using a Superdex-200 column, and formulated in sterile phosphate-buffered saline (PBS). Proteins were concentrated and stored at -80°C.

[0169] Mammalian expression vectors. Full-length human CD25 was cloned into the lentiviral vector pCDH-CMV-MSC-EF1-Puro (System Biosciences). The cDNA encoding full-length human IL-2Rβ was used as a template to clone full-length orthoIL-2Rβ by overlap extension PCR using mutagenic primers that introduce the H133D and Y134F mutations. The resulting PCR product was cloned into the retroviral vector pMSCV-MCS-IRES-YFP.

[0170] Cell culture. The YT-NK-like cell line was generously provided by Dr. Junji Yodoi, Kyoto University. YT cells were transduced with pCDH-CMV-MSC-EF1-Puro-hCD25 lentivirus, and YT cells stably expressing full-length human CD25 (YT+) were selected in 10 μg / mL puromycin. YT+ cells were transduced with a retrovirus containing pMSCV-MCS-IRES-YFP-ortho-human-Rβ and sorted by FACS to enrich for the YFP+ (ortho) population to purity. HEK293T cells were generously provided by Dr. Irving Weissman's laboratory, Stanford University. HEK293T cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine (L-glu), and 1% penicillin and streptomycin (P / S).YT cells were maintained in RPMI complete (RPMI+GlutaMax+10% FBS, 1% L-Glu, 1% NaPyr, 1% NEAA, 18 mM HEPES, and 1% pen / strep).

[0171] Lentivirus and retrovirus production. Third generation packaging vectors were used to produce lentivirus in HEK293T cells. Briefly, HEK293T cells were cultured at 5×10 per 10 cm tissue culture dish. 6Cells were seeded at a density of 1:1 and allowed to adhere for 5-7 h in complete medium (DMEM, 10% FBS, 1% L-Glu, 1% Pen / Strep). The supernatant was removed and replenished with low FBS (5%) DMEM (10 mL), and cells were transfected with a 4:2:1 ratio of pCDH:psPAX2:pMD2G using X-tremeGENE® HP DNA Transfection Reagent (Sigma Aldrich) according to the manufacturer's recommendations and cultured overnight at 37°C in complete medium. The medium was removed and replenished with 7.5 mL of low-FBS DMEM (DMEM, 5% FBS, 1% L-Glu, 1% P / S), and lentivirus was collected from the supernatant after 24 and 48 hours, pooled, clarified through a 0.45 μm filter, precipitated with PEG-it virus precipitation solution (System Bio), pelleted, resuspended in complete medium at 1 / 100 of the original volume, flash frozen in liquid nitrogen, and stored at -80°C.

[0172] Retroviruses were produced in HEK293T cells. Briefly, HEK293T cells were cultured at 5×10 per 10 cm tissue culture dish. 6 Cells were seeded at a density of 100x and allowed to adhere for 5-7 hours in complete medium (DMEM, 10% FBS, 1% L-Glu, 1% P / S). The supernatant was removed and replenished with low FBS DMEM (10 mL), and the cells were transfected with a 1.5:1 ratio of pMSCV retroviral vector and pCL10A packaging vector (Novus Biologicals) (a generous gift of Dr. Melissa McCracken, Stanford University) using X-tremeGENE® HP according to the manufacturer's recommendations and cultured overnight in low FBS DMEM. The medium was removed and replenished with 7.5 mL of low FBS DMEM and cultured for an additional 24 hours. The medium was collected, clarified using a 0.45 μm filter, and flash frozen in liquid nitrogen for storage at -80°C. The medium was replenished (low FBS DMEM), the cells were cultured for an additional 24 hours, and the virus was collected and stored as above.

[0173] Yeast display of IL-2. Human IL-2 was displayed on the surface of yeast S. cerevisiae strain EBY100 by fusion to the C-terminus of Aga2 using the pCT302 vector carrying a 3C protease cleavage site between the C-terminus of Aga2 and the N-terminus of IL-2, as well as an N-terminal cMyc epitope tag. Briefly, competent EBY100 was electroporated with a plasmid encoding yeast-displayed hIL-2 and allowed to recover overnight in SDCAA selection medium at 30°C. The transformed yeast was passaged once in SDCAA, and the logarithmic phase yeast culture was pelleted and resuspended in SGCAA induction medium containing 10% SDCAA at an OD600 of 1.0 and grown at 20°C for 24 hours. Surface expression of functional hIL-2 was confirmed by FACS by staining yeast with AlexaFluor® 488-labeled anti-cMyc mAb (1:100 dilution; Cell Signaling) and AlexaFluor® 647-labeled streptavidin (SA) tetramer of wild-type hIL-2Rβ (500 nM SA).

[0174] Human IL-2 mutant yeast display library generation. Site-specific libraries were generated by assembly PCR using primers with degenerate codons for library 3 (E15, H16, L19, D20, Q22, M23): (SEQ ID NO: 10) 5'-CAAGTTCTACAAAGAAAACACAGCTACAACTGNHKNHKTTACTTNHKNHKTTANHKNHKATTTTGAATGGAATTAATTACAAGAATCCCAAACTC-3'; library 4 (E15, H16, L19, D20, M23, N88): (SEQ ID NO: 11) 5'-GTTCTACAAAGAAAACACAGCTACAACTGNHK NHKTTACTTNHKNHKTTACAGNHKATTTTGAATGGAATTAATAATTACAAGAATCC-3'; (SEQ ID NO: 12) 5'-CCCAGGGACTTAATCAGCNHKATCAACGTAATAGTTCTGGAACTAAAGGG-3'.

[0175] (SEQ ID NO: 13) 5'-CGGTAGCGGTGGGGGCGGTTCTCTGGAAGTTCTGTTCCAGGGTCCGAGCGGCGGA-3', (SEQ ID NO: 14) 5'-GTAGCTGTGTTTTCTTTGTAGAACTTGAAGTAGGTGCGGATCCGC CGCTCGGACCCTGG-3', (SEQ ID NO: 15) 5'-CTTAAATGTGAGCATCCTGGTGAGTTT GGGATTCTTGTAATTATTAATTCCATTCAAAAT-3', (SEQ ID NO: 16) 5'-CCAGGATGCTCA CATTTAAGTTTTACATGCCCAAGAAGGCCACAG-3', (SEQ ID NO: 17) 5'-GAGGTTTGAGTT CTTCTTCTAGACACTGAAGATGTTTCAGTTCTGTGGCCTTCTTGGGC-3', (SEQ ID NO: 18) 5'-CAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGC-3', (SEQ ID NO: 19) 5'-GATTAAGTCCCTGGGTCTTAAGTGAAAGTTTTTGCTTTGAGCTAAATT TAGCACTTCCTC-3', (SEQ ID NO: 20) 5'-CAGCATATTCACACATGAATGTTGTTTCAGATC CCTTTAGTTCCAGAACTATTACGTTG-3', (SEQ ID NO: 21) 5'-GAAACAACATTCATGTGTGAA TATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAAC-3', (SEQ ID NO: 22) 5'-GAGATG The following primers were used in all libraries: ATGCTTTGACAAAAGGTAATCCATCTGTTCAGAAATTCTACAATGGTTGCTG-3', (SEQ ID NO: 23) 5'-GATTACCTTTTGTCAAAGCATCATCTCAACACTAACTGCGGCCGCTTCTGGTGG CGAAC-3', (SEQ ID NO: 24) 5'-GATCTCGAGCAAGTCTTCTTCGGAGATAAGCTTTTGTTC GCCACCAGAAGCGG-3'.

[0176] The mutated IL-2 gene PCR product was assembled using Pfu Ultra DNA polymerase (Agilent) and an equimolar mixture of each primer. The product DNA was further PCR amplified using primers (SEQ ID NO:25) 5'-CGGTAGCGGTGGGGGCGGTTC-3' and (SEQ ID NO:26) 5'-CGAAGAAGACTTGCTCGAGATC-3' using Phusion DNA polymerase (NEB). The resulting assembled PCR product was gel purified and electroporated into EBY-100 yeast with the linearized pCT302 vector to produce approximately 2 x 10 8 A library of transformants was obtained.

[0177] Evolution of orthoIL-2. Selection of yeast clones that specifically bind to orthoIL-2R was performed using a combination of magnetic activated cell sorting (MACS) and FACS. The first round of selection yielded 2 × 10 clones, approximately 10-fold greater than the library diversity. 9 This was performed in yeast to ensure 100% coverage of all transformants. The overall strategy used was to first enrich the library for all full-length hIL-2 variants that bound orthoIL-2Rβ (rounds 1-3), and in subsequent rounds, use negative selection to remove IL-2 clones that bound wild-type IL-2Rβ and decrease the concentration of orthoIL-2Rβ to enrich for IL-2 clones that bound orthoIL-2Rβ with high affinity.

[0178] Yeast-based binding and function screens. Single yeast clones were isolated both by culture on SDCAA plates and by single colony extraction or single cell FACS into 96-well round bottom tissue culture plates containing 100 μL SDCAA and grown overnight at 30° C. in a shaking incubator. Yeast clones were further expanded in 1.5 mL SDCAA per well of 96 deep well V-bottom plates at 30° C. for another 24 hours, then induced in SGCAA medium containing 10% SDCAA in a shaking incubator at 20° C. for 72 hours, also in 1.5 mL and 96 deep well V-bottom plates, at a starting OD600 of 1.0. Induced yeast were pelleted, washed once with PBS, and resuspended in 200 μL / well cleavage medium (RPMI containing 25 mM HEPES, 0.2 mM TCEP, 20 μg / mL 3C protease) and incubated at room temperature for 5 minutes with agitation, followed by overnight incubation at 4° C. without agitation. Yeast were pelleted and the supernatant clarified through a 96-well 0.45 μm cellulose acetate filter plate (catalog 7700-2808, GE Heathcare). YT+ (wild type and ortho expressing) and YT− were plated as described in the IL-2R signaling method, 50 μL of clarified yeast supernatant containing mutant IL-2 clones was added, incubated at 37° C. for 20 minutes, reactions were terminated, and pSTAT5 was quantified as described below. The percentage of pSTAT5+ wild-type or orthoYT cells was quantified using FlowJo® (TreeStar Inc., Ashland OR) and used to select clones with selective or specific activity on orthoYT+ cells.

[0179] Retroviral transduction of human peripheral blood mononuclear cells (PBMCs). Leukapheresis chambers were obtained from Stanford Blood Center. Blood was drained into a sterile 50ml conical tube (approximately 7ml) and PBS+2% FBS was added to a total of 34ml. Density gradient medium (15ml, Ficoll-Paque Plus, GE Healthcare, 17-1440-03) was filled into two SepMate®-50 tubes (Stemcell, 15450) and 17ml of diluted cells was gently pipetted onto the top. The SepMate® tubes were spun at 1200×g for 15 minutes at room temperature. The top layer containing PBMCs was poured into a new tube and RPMI was added to 50ml. The cells were pelleted by spinning at 1200 rpm for 5 minutes. The pellet was resuspended in 10 ml of ACK lysis buffer (Gibco A10492-01) for 4 min and quenched with RPMI complete to 40 ml. The cells were pelleted again, suspended in 15 mL of RPMI complete and counted. The cells (1 x 10 6 ) were seeded into each well of a 24-well tissue culture dish and 25uL of Dynabeads® Human T-Activator CD3 / CD28 (Cat. No. 11131D) and 100U / ml of hIL-2 were added to each well. Cells were activated in an incubator at 37°C for 48 hours.

[0180] Activated human PBMCs were transduced by spinfection with non-concentrated retroviral supernatant (approximately 2 mL per well) containing 10 μg / mL polybrene and 100 IU / mL hIL-2 at 32° C. and 2500 RPM for 1.5 hours (see Berggren WT, Lutz M, Modesto V. General Spinfection Protocol. 2012 Dec 10. In: StemBook [Internet]. Cambridge (MA): Harvard Stem Cell Institute; 2008). The viral supernatant was gently aspirated and replaced with fresh RPMI complete medium containing 100 IU / mL hIL-2 and cultured for 24 hours at 37° C. Cells were harvested by gently pipetting and the Dynabeads® were removed with a magnet. Cells were pelleted by centrifugation and 1×10 cells were transferred to fresh RPMI complete medium containing 100 IU / mL hIL-2. 6 The cells were resuspended at a density of 1000 cells / mL and expanded overnight at 37°C prior to further downstream cell assays.

[0181] IL-2R signaling by phosphorylation of STAT5. Quantification of IL-2 and orthoIL-2 signaling by intracellular pSTAT5 was performed. Actively growing YT+ and YT+ortho cells were pelleted, combined in a 50 / 50 ratio, and plated in 50 μL of warm medium at 5 × 10 cells per well of an ultra-low binding 96-well round-bottom plate (catalog 7007; Costar). 5Cells were seeded at a density of 1000 x 1000, ... Data represent mean fluorescence intensity and points were fitted to a log(agonist) vs. response (three parameter) model using Prism5® (GraphPad). All data are presented as mean (n=3) ± SD.

[0182] In vitro primary human PBMC proliferation assay. Human peripheral blood mononuclear cells containing a mixture of wild-type and ortho-transduced T cells were collected by centrifugation, resuspended in RPMI complete medium lacking hIL-2, and seeded at a density of 50,000 cells (in 50 μL) per well in 96-well round-bottom tissue culture plates (day 1). Cell growth was stimulated by adding serial dilutions of wild-type or orthoIL-2 (50 μL) to a total volume of 100 μL and cultured at 37° C. for 2 days. On day 3, cells were fed with an additional 100 μL volume of fresh cytokines and cultured for another 2 days. On day 5, 50 μL of DAPI was added to a final concentration of 0.5 μg / mL, and the cell number of each test population was quantified by FACS using a CytoFLEX® with a high-throughput sampler. The total number of live cells within a set volume was obtained after gating on live cells based on FSC and SSC and DAPI negativity. Data were analyzed using FlowJo® (Tree Star Inc.). Data represent total viable cell counts plotted against cytokine concentration or as the ratio of ortho cells to total viable cells plotted against cytokine concentration. Data are presented as mean (n=4)±SD.

[0183] As shown in Figure 22, ortho human IL-2 signals through ortho IL-2R in YT cells in vitro. As shown in Figure 23, ortho human IL-2 preferentially expands human PBMCs expressing ortho IL-2R. Human PBMCs were isolated, activated, and transduced with a retrovirus containing ortho human IL-2Rβ with IRES YFP (YFP+). The initial ratio of YFP+ cells to total live cells was 20%. 5×10 5Cells were seeded with the indicated concentrations of MSA-human IL-2 (circles) or ortho variants MSA-SQVLKA (diamonds), MSA-SQVLqA (squares), or MSA-1A1 (black triangles) on day 1 and re-fed with the same concentrations on day 3. On day 5, plates were read by flow cytometry. (A) The ratio of YFP+ (ortho-expressing) cells to total live cells was calculated and the mean (n=4) ± SD plotted against concentration (left). (B) The total live cell counts (mean (n=4) ± SD) were also plotted against cytokine concentration (right). The orthogonal cytokines did not support as much cell growth as wild-type MSA-hIL-2 at the same concentrations, but were selective in robustly expanding ortho-expressing T cells.

[0184] The amino acid substitutions made in the orthogonal hIL-2 protein are shown in Table 1 below.

[0185] [Table 2]

[0186] cross reference This application claims the benefit of U.S. continuation-in-part application Ser. No. 15 / 916,689, filed Mar. 9, 2018, which is incorporated herein by reference in its entirety.

[0187] Federally Sponsored Research and Development This invention was made with Government support under Contract AI513210 awarded by the National Institutes of Health. The Government has certain rights in this invention.

Claims

[Claim 1] An engineered human IL-2 polypeptide, which (i) has significantly reduced binding to native human CD122, and (ii) contains at least one amino acid substitution at residues T51, R81 with a non-native protein amino acid or contains the amino acid substitution M23A, and (iii) contains an amino acid substitution at each of E15, H16, L19, D20.