Compositions, methods, and uses of messenger RNA

By using mRNA lipid nanoparticles encoding immunomodulatory proteins or peptides, the side effects of existing cancer treatments have been addressed, achieving effective tumor suppression and prolonged survival, thus overcoming cancer resistance.

CN114728176BActive Publication Date: 2026-06-19TRANSLATE BIO INC
View PDF 27 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TRANSLATE BIO INC
Filing Date
2020-10-09
Publication Date
2026-06-19

Smart Images

  • Figure CN114728176B_ABST
    Figure CN114728176B_ABST
Patent Text Reader

Abstract

This invention particularly provides methods and compositions for cancer treatment. The methods and compositions disclosed herein are particularly effective in reducing tumor size / volume and inhibiting tumor growth.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit and priority of U.S. Provisional Application Serial No. 62 / 913,035, filed on October 9, 2019, the contents of which are incorporated herein by reference in their entirety. Background Technology

[0003] Cancer is the leading cause of death in many parts of the world, with more than 2.5 million new cases diagnosed globally each year. Recent advances in our understanding of the molecular biology of cancer suggest that it is a genetic disease that causes abnormal growth of diseased cells. Many treatments for cancer exist, including surgery, chemotherapy, radiation therapy, gene therapy, and small molecule and protein therapies. However, these treatments often function through non-specific interactions with cellular targets, producing adverse side effects and failing to address the root cause of the disease. Cancer remains highly resistant to currently available therapies. Summary of the Invention

[0004] This invention provides an improved mRNA therapy for treating cancer. Specifically, the methods described herein provide efficient in vivo delivery of mRNA encoding immunomodulatory proteins or peptides that can be used in immuno-oncology.

[0005] In one aspect, the present invention provides a method for treating cancer, comprising administering a composition comprising mRNA encoding a protein or peptide encapsulated within lipid nanoparticles to a subject in need at an effective dose and at an interval, such that the size of the tumor is reduced or the growth of the tumor is inhibited.

[0006] In another aspect, the present invention provides a method for treating cancer, comprising administering a composition comprising two or more mRNAs at an effective dose and at an interval to a subject in need, wherein each of the two or more mRNAs encodes a protein or peptide encapsulated within one or more lipid nanoparticles to reduce tumor size or inhibit tumor growth, wherein at least two of the two or more mRNAs encode proteins or peptides that are distinct from each other.

[0007] In some embodiments, the two or more mRNAs include a first mRNA and a second mRNA, wherein the first mRNA encodes a first protein or peptide encapsulated within a first lipid nanoparticle, and the second mRNA encapsulates a second protein or peptide encapsulated within a second lipid nanoparticle.

[0008] In some embodiments, at least one of the proteins or peptides modulates the immune response. In some embodiments, at least one of the proteins or peptides is IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof.

[0009] In some embodiments, two of the two or more mRNAs encode IL-12 and STING, respectively. In some embodiments, the two or more mRNAs include at least three mRNAs encoding STING, IL-12, and GM-CSF, respectively. In some embodiments, the two or more mRNAs include at least four mRNAs encoding STING, IL-12, FLT-3L, and GM-CSF, respectively. In some embodiments, the two or more mRNAs include at least four mRNAs encoding STING, IL-12, NLRP3, and GM-CSF, respectively. In some embodiments, the two or more mRNAs include at least four mRNAs encoding STING, IL-12, IL-2, and GM-CSF, respectively.

[0010] In some embodiments, the STING is a mutant form of STING. In some embodiments, the mutant form allows STING to have constitutive activity.

[0011] In some implementations, at least one of the proteins or peptides does not regulate the immune response.

[0012] In some embodiments, 7 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 50% compared to a control. In some embodiments, 10 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 60% compared to a control. In some embodiments, 10 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 70% compared to a control. In some embodiments, 10 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 80% compared to a control. In some embodiments, 20 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 80% compared to a control. In some embodiments, 20 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 85% compared to a control. In some embodiments, 20 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 90% compared to a control.

[0013] In some embodiments, administration of the composition resulted in a weight change of less than 15% in the subject compared to a control. In some embodiments, administration of the composition resulted in a weight change of less than 10% in the subject compared to a control. In some embodiments, administration of the composition resulted in a weight change of less than 5% in the subject compared to a control.

[0014] In some embodiments, the control is a subject with the same disease condition but who has not received treatment. In some embodiments, the control is the weight of the subject before administration of the composition.

[0015] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the lipid nanoparticles also comprise cholesterol or one or more cholesterol-based lipids.

[0016] In some embodiments, the first lipid nanoparticle comprises a first cationic lipid, and the second lipid nanoparticle comprises a second cationic lipid, wherein the first cationic lipid is different from the second cationic lipid.

[0017] In some embodiments, one or more cationic lipids are selected from the group consisting of: cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazolium-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pent-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pent-2-yl)-1,4-dioxane-2,5-dione (target 24), and combinations thereof. In some embodiments, the one or more cationic lipids comprise cKK-E12.

[0018] In some embodiments, the composition is administered intratumorally. In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intravenously. In some embodiments, the composition is administered via pulmonary administration. In some embodiments, the composition is administered via nebulization.

[0019] In some embodiments, the method includes injecting a single dose. In some embodiments, the method includes periodically injecting multiple doses. In some embodiments, the single dose or the multiple doses range from 0.1 μg to 100 mg mRNA. In some embodiments, the single dose or the multiple doses range from 0.1 μg to 50 mg mRNA. In some embodiments, the single dose or the multiple doses range from 0.1 μg to 25 mg mRNA. In some embodiments, the single dose or the multiple doses range from 0.1 μg to 10 mg mRNA. In some embodiments, the single dose or the multiple doses range from 1 μg to 1 mg. In some embodiments, the single dose or the multiple doses range from 1 μg to 100 μg mRNA.

[0020] In some embodiments, the single dose or multiple doses are 0.1 μg. In some embodiments, the single dose or multiple doses are 0.3 μg. In some embodiments, the single dose or multiple doses are 0.5 μg. In some embodiments, the single dose or multiple doses are 1 μg. In some embodiments, the single dose or multiple doses are 5 μg. In some embodiments, the single dose or multiple doses are 10 μg. In some embodiments, the single dose or multiple doses are 25 μg. In some embodiments, the single dose or multiple doses are 50 μg. In some embodiments, the single dose or multiple doses are 100 μg.

[0021] In some embodiments, the single dose or multiple doses range from 0.01 μg / kg to 10 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.01 μg / kg to 8 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.01 μg / kg to 6 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.01 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.1 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.1 μg / kg to 1 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses range from 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

[0022] In some embodiments, each of the multiple doses contains the same dose of mRNA. In some embodiments, each of the multiple doses contains a different dose of mRNA.

[0023] In some embodiments, each dose of the multiple-dose regimen is administered at intervals of 1 day to 3 weeks. In some embodiments, each dose of the multiple-dose regimen is administered once daily. In some embodiments, each dose of the multiple-dose regimen is administered at intervals of 3 days. In some embodiments, each dose of the multiple-dose regimen is administered once weekly. In some embodiments, each dose of the multiple-dose regimen is administered at intervals of 10 days. In some embodiments, each dose of the multiple-dose regimen is administered every two weeks. In some embodiments, each dose of the multiple-dose regimen is administered once monthly. In some embodiments, each dose of the multiple-dose regimen is administered every two months.

[0024] In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR). In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR). In some embodiments, the mRNA comprises a 3' untranslated region (3'UTR).

[0025] In some embodiments, administration of the composition activates T cells in the subject. In some embodiments, the method further includes administering a composition containing a checkpoint inhibitor to the subject. In some embodiments, the method does not include administering a composition containing a checkpoint inhibitor to the subject. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof. In some embodiments, the checkpoint inhibitor inhibits PD1. In some embodiments, the checkpoint inhibitor inhibits PD-L1. In some embodiments, the checkpoint inhibitor inhibits CTLA-4. In some embodiments, the checkpoint inhibitor inhibits B7. In some embodiments, the checkpoint inhibitor inhibits BTLA. In some embodiments, the checkpoint inhibitor inhibits HVEM. In some embodiments, the checkpoint inhibitor inhibits TIM-3. In some embodiments, the checkpoint inhibitor inhibits GAL-9. In some embodiments, the checkpoint inhibitor inhibits LAG3. In some embodiments, the checkpoint inhibitor inhibits VISTA. In some embodiments, the checkpoint inhibitor inhibits KIR. In some embodiments, the checkpoint inhibitor inhibits 2B4. In some embodiments, the checkpoint inhibitor inhibits CD160. In some embodiments, the checkpoint inhibitor inhibits CGEN-15049. In some embodiments, the checkpoint inhibitor inhibits CHK1. In some embodiments, the checkpoint inhibitor inhibits CHK2. In some embodiments, the checkpoint inhibitor inhibits A2aR.

[0026] In some embodiments, the one or more mRNAs are encapsulated within the same lipid nanoparticle. In other embodiments, the one or more mRNAs are encapsulated within separate lipid nanoparticles.

[0027] In one aspect, the present invention provides a pharmaceutical composition for treating cancer comprising one or more mRNAs, each of which encodes IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or combinations thereof, wherein the one or more mRNAs are encapsulated within one or more lipid nanoparticles, the lipid nanoparticles comprising at least one lipid nanoparticle containing cKK-E12 as a cationic lipid.

[0028] In some embodiments, the one or more mRNAs encode IL-12 and STING. In some embodiments, the one or more mRNAs encode STING, IL-12, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, IL-2, and GM-CSF.

[0029] In some embodiments, the composition further comprises additional mRNA encoding a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof.

[0030] In some implementations, the method results in a remote effect.

[0031] In some implementations, seven days after administration of the initial dose, the method resulted in a greater than 50% inhibition of tumor growth in untreated tumors compared to a control.

[0032] In some implementations, 10 days after administration of the initial dose, the method resulted in a tumor growth inhibition percentage of more than 60%, more than 70%, or more than 80% in untreated tumors compared to a control.

[0033] In some implementations, 20 days after administration of the initial dose, the method resulted in a tumor growth inhibition percentage of more than 80%, more than 85%, or more than 90% in untreated tumors compared to a control.

[0034] In some implementations, the method increases the survival rate of subjects with cancer. Attached Figure Description

[0035] These figures are for illustrative purposes and not for limitation.

[0036] Figure 1 This is a graph depicting comparative data on the efficacy of different mRNA-LNPs in antitumor activity in vivo. Throughout the study, the mean tumor volume of each group was measured after intratumoral administration of mRNA-LNPs to MC38 mice according to dosage and frequency, as shown in Table 2.

[0037] Figure 2 This is a graph depicting the percentage of mean tumor volume in group BI compared to control group A.

[0038] Figure 3 This is a graph depicting the average tumor volume inhibition percentage in the BI group compared to the control group A.

[0039] Figure 4 This is a scatter plot depicting the tumor volume of individual mice in each group on day 46. The average tumor volume for each group is shown.

[0040] Figure 5 shows Group A ( Figure 5A Group B Figure 5B Group C Figure 5C Group D Figure 5D Group E Figure 5E Group F Figure 5F Group G Figure 5G Group H Figure 5H ) and Group I ( Figure 5I Tumor volume (mm) of each individual mouse 3 A series of tables. The mean and standard deviation values ​​are shown in the last two rows. A blank space indicates death. The sample size for each group is 10.

[0041] Figure 6 It is a graph depicting the average percentage change in weight over the entire study period compared to the weight on day 1.

[0042] Figure 7 This is a graph showing tumor growth in MC38 mouse cancer model mice after lipid-encapsulated constitutively active STING mRNA, negative control, or mediator control were applied.

[0043] Figure 8 This is a series of graphs showing the survival of MC38 cancer mice after administration of: 1) lipid-encapsulated constitutive active STING mRNA and anti-PD-1 antibody; 2) negative control mRNA and anti-PD-1 antibody; or 3) mediator control mice compared to mice with MC38 cancer.

[0044] definition

[0045] To make the invention easier to understand, certain terms are defined below. Further definitions of the following terms and other terms are set forth throughout the specification.

[0046] Animal: As used herein, the term "animal" means any member of the animal kingdom. In some embodiments, "animal" means a human being at any developmental stage. In some embodiments, "animal" means a non-human animal at any developmental stage. In some embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, an animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0047] Approximately or about: As used herein, when applied to one or more target values, the term “approximately” or “about” refers to a value similar to the stated reference value. In some embodiments, unless otherwise stated or otherwise obvious from the context (unless this number would exceed 100% of the possible value), the term “approximately” or “about” refers to a series of values ​​of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater than or less than) the stated reference value.

[0048] Delivery: As used herein, the term “delivery” encompasses both local delivery and systemic delivery. For example, mRNA delivery includes cases where mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also known as “local distribution” or “local delivery”), and cases where mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into the patient’s circulatory system (e.g., serum) and distributed systemically and absorbed by other tissues (also known as “systemic distribution” or “systemic delivery”).

[0049] Encapsulation: As used in this article, the term “encapsulation” or its grammatical equivalent refers to the process of confining individual mRNA molecules within nanoparticles.

[0050] Expression: As used herein, “expression” of a nucleic acid sequence means the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into a complete protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or a fully assembled protein (e.g., an enzyme). In this patent application, the terms “expression” and “production”, as well as their grammatical equivalents, are used interchangeably.

[0051] Half-life: As used herein, the term “half-life” is the time required for the concentration or activity of a substance such as a nucleic acid or protein to decrease to half the value measured at the beginning of a period of time.

[0052] Improvement, increase, or decrease: As used herein, the terms “improvement,” “increase,” or “decrease,” or their grammatical equivalents, refer to values ​​relative to baseline measurements, such as measurements of the same individual prior to the initiation of the treatment described herein, or measurements of control subjects (or multiple control subjects) in the absence of the treatment described herein. A “control subject” is a subject who has the same form of disease as the treated subject and whose age is approximately the same as the treated subject.

[0053] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in a cell culture, etc., rather than in a multicellular organism.

[0054] In vivo: As used herein, the term "in vivo" refers to events occurring within multicellular organisms such as humans and non-human animals. In the context of cell-based systems, the term can be used to refer to events occurring within living cells (as opposed to, for example, in vitro systems).

[0055] Local distribution or delivery: As used herein, the terms “local distribution,” “local delivery,” or their grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires the translation and expression of a protein (e.g., an enzyme) encoded by mRNA within the cell or with limited secretion, avoiding entry into the patient’s circulatory system.

[0056] Messenger RNA (mRNA): As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide encoding at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and noncoding regions. mRNA may be purified from natural sources, generated and optionally purified using recombinant expression systems, chemically synthesized, etc. Where appropriate, such as in the case of chemically synthesized molecules, mRNA may contain nucleoside analogs, such as analogs with chemically modified bases or sugars, backbone modifications, etc. Unless otherwise stated, the mRNA sequence is displayed in the 5' to 3' orientation. In some embodiments, the mRNA is or comprises a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine); or a nucleoside analogue (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5-propynyl-cytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine). Glycosides, 2-aminoadenosine, 7-deadenosine, 7-deadenosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose); and / or modified phosphate groups (e.g., thiophosphates and 5-N-phosphoramide bonds).

[0057] Patient: As used herein, the term "patient" or "subject" means any organism to which the provided composition may be administered, for example, for experimental, diagnostic, preventative, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0058] Pharmaceutically acceptable: As used herein, the term “pharmaceutically acceptable” means a substance that, in accordance with reasonable benefit / risk ratios and within the bounds of reasonable medical judgment, is suitable for contact with tissues in humans and animals without excessive toxicity, irritation, allergic reactions, or other problems or complications.

[0059] Subject: As used herein, the term “subject” means a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include both prenatal and postnatal forms. In many embodiments, the subject is a human. A subject can be a patient, which is a person who refers to a healthcare provider for diagnosis or treatment of a disease. The term “subject” is used interchangeably herein with “individual” or “patient.” A subject may have or be susceptible to a disease or condition, but may or may not show symptoms of that disease or condition.

[0060] Essentially: As used herein, the term “essentially” refers to qualitative conditions that exhibit all or nearly all of the target characteristics or properties of a particular range or degree. Those skilled in the art of biology will understand that biological and chemical phenomena rarely (if ever) complete and / or continue to complete or achieve or avoid absolute results. Therefore, the term “essentially” is used herein to capture the inherent lack of completeness in many biological and chemical phenomena.

[0061] Whole-body distribution or delivery: As used herein, the terms “whole-body distribution,” “whole-body delivery,” or their grammatical equivalents refer to a mechanism or method of delivery or distribution that affects the entire body or organism as a whole. Typically, whole-body distribution or delivery is accomplished via the body’s circulatory system (e.g., blood flow). This contrasts with the definition of “local distribution or delivery.”

[0062] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease to be treated. In some implementations, target tissue includes those tissues that exhibit disease-related pathology, symptoms, or characteristics.

[0063] Therapeutic effective amount: As used herein, the term "therapeutic effective amount" means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition when administered to a subject who has a disease, disorder, and / or condition or is susceptible to such disease, disorder, and / or condition. Those skilled in the art will recognize that a therapeutic effective amount is typically administered via a dosing regimen comprising at least one unit dose.

[0064] Treatment: As used herein, the term "treatment" refers to any method used to partially or completely relieve, improve, reduce, suppress, prevent, delay the onset of, reduce the severity of, and / or decrease the incidence of one or more symptoms or features of a particular disease, symptom, and / or condition. Treatment may be administered to subjects who do not exhibit signs of disease and / or only exhibit early signs of disease in order to reduce the risk of developing a pathology associated with the disease. Detailed Implementation

[0065] This invention provides an improved mRNA therapy for treating cancer. Specifically, the methods disclosed herein effectively reduce or decrease the size, mass, and / or volume of tumors, or inhibit or delay tumor growth in a subject in need, by administering a composition comprising one or more mRNAs encoding proteins or peptides that directly or indirectly regulate immune responses at effective doses and administration intervals. In some embodiments, the methods disclosed herein increase survival.

[0066] Various aspects of the invention are described in detail in the following sections. The use of terms is not intended to limit the invention. Each term may be applied to any aspect of the invention. In this application, unless otherwise stated, the use of "or" means "and / or".

[0067] cancer

[0068] Cancer cells express antigens that are not typically expressed by non-cancerous cells or tissues. These cancer antigens are not presented by antigen-presenting cells (APCs) in a manner similar to viral antigens, i.e., by binding to MHC-1 molecules that classify antigens as foreign. However, cytotoxic T cells are capable of differentiating and recognizing mutated autoantigens and possess the inherent property of seeking out and destroying cells carrying mutated antigens. Therefore, one goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells against mutated antigens. The methods and compositions according to the invention can effectively induce the subject's own cytotoxic T cells to produce the immune response required to destroy tumor cells.

[0069] Normal tissue homeostasis is a highly regulated process of cell proliferation and cell death. An imbalance between cell proliferation and cell death can lead to a carcinogenic state (Solyanik et al., 1995; Stokke et al., 1997; Mumby and Walter, 1991; Natoli et al., 1998; Magi-Galluzzi et al., 1998). For example, cervical cancer, kidney cancer, lung cancer, pancreatic cancer, colorectal cancer, and brain cancer are just a few examples among many cancers where this can be effective (Erlandsson, 1998;). (1998; Mangray and King, 1998; Gertig and Hunter, 1997; Mougin et al., 1998). In fact, the incidence of cancer is so high that more than 500,000 people die from it each year in the United States.

[0070] The maintenance of cell proliferation and cell death is regulated at least in part by proto-oncogenes. Proto-oncogenes can encode proteins that induce cell proliferation (e.g., sis, erbB, src, ras, and myc), proteins that inhibit cell proliferation (e.g., Rb, p53, NF1, and WT1), or proteins that regulate programmed cell death (e.g., bcl-2) (Ochi et al., 1998; Johnson and Hamdy, 1998; Liebermann et al., 1998). However, rearrangements or mutations in these proto-oncogenes can lead to their conversion into potent oncogenes. Typically, a single-point mutation is sufficient to convert a proto-oncogene into an oncogene. For example, a mutation in codon 12 or 13 in the K-ras gene can convert a proto-oncogene into an oncogene.

[0071] Currently, there are few effective treatment options for many common cancers. The treatment process for a particular individual depends on the diagnosis, the stage of disease development, and factors such as age, sex, and the patient's general health. The most traditional cancer treatment options are surgery, radiation therapy, and chemotherapy. Surgery plays a crucial role in the diagnosis and treatment of cancer. Typically, a biopsy and removal of cancerous growth require a surgical approach. However, if the cancer has metastasized and spread, surgery is unlikely to be curative, and alternative methods must be considered. Radiation therapy, chemotherapy, and immunotherapy are alternatives to surgery for cancer treatment (Mayer, 1998; Ohara, 1998; Ho et al., 1998). Radiation therapy involves the precise targeting of high-energy radiation to destroy cancer cells, much like surgical removal of cells; it is primarily effective against locally localized, non-metastatic cancer cells. Side effects of radiation therapy include skin irritation, difficulty swallowing, dry mouth, nausea, diarrhea, hair loss, and energy loss (Curran, 1998; Brizel, 1998).

[0072] Chemotherapy, the treatment of cancer with anticancer drugs, is another modality of cancer therapy. The effectiveness of anticancer drug therapy is often limited because drug administration is difficult to achieve in all (el-Kareh and Secomb, 1997) solid tumors. Chemotherapy strategies are based on the growth of solid tumors, where cancer cells targeted by selected anticancer drugs are rapidly dividing. Most chemotherapy regimens involve combinations of more than one anticancer drug and have been shown to improve response rates in a variety of cancers. A major side effect of chemotherapy drugs is that they also affect normal tissue cells, which are more susceptible to rapid division (e.g., bone marrow, gastrointestinal tract, reproductive system, and hair follicles). Other side effects of chemotherapy drugs include oral ulcers, difficulty swallowing, dry mouth, nausea, diarrhea, vomiting, fatigue, bleeding, hair loss, and infection. Other forms of chemotherapy can be used to treat non-cancerous hyperproliferative disorders. These disorders include hyperproliferative diseases such as rheumatoid arthritis and psoriasis that are treated with conventional chemotherapeutic agents such as methotrexate and cyclophosphamide. PAW chemotherapy for proliferative disorders can also include immunosuppressants such as steroids, azathioprine, cyclosporine, and immunomodulators such as fumarate derivatives.

[0073] Immunotherapy is a rapidly developing field in cancer research and offers another option for treating certain types of cancer. For example, the immune system recognizes tumor cells as foreign, thus selecting them as targets for destruction. Unfortunately, this is often insufficient to stop the growth of most tumors. However, a recent focus in immunotherapy is on developing methods to enhance or complement the immune system's natural defense mechanisms.

[0074] As previously mentioned, proto-oncogenes play a crucial role in cancer biology. For example, the Rb tumor suppressors p53, NF1, and WT1 are essential for maintaining the non-tumorigenic phenotype of cells (Soddu and Sacchi review, 1998). Approximately 50% of cancers have been found to be associated with mutations in the p53 gene, leading to the loss of p53's properties as a tumor suppressor (Levine et al., 1991; Vogelstein and Kinzler, 1992; Hartmann et al., 1996a; Hartmann et al., 1996b). The high incidence of p53 gene mutations in cancer has prompted many research groups to investigate p53 as a pathway for cancer therapy through gene transfer or replacement. The Sis proto-oncogenes erbB, src, ras, and myc, which encode proteins that induce cell proliferation, and the Bcl-2 family of proto-oncogenes that regulate programmed cell death, also play important roles in the non-tumorigenic phenotype of cells.

[0075] In some implementation schemes, cancer includes head cancer, neck cancer, ovarian cancer, breast cancer, colon cancer, prostate cancer, liver cancer, leukemia, glioma, melanoma, pancreatic cancer, testicular cancer, melanoma, bladder cancer, lung cancer, sarcoma, squamous cell carcinoma, small cell lung cancer, ductal carcinoma of the breast, lobular invasive breast cancer, intraductal carcinoma of the breast, mucinous carcinoma of the breast, promyelocytic leukemia in peripheral blood, ovarian adenocarcinoma, ovarian adenocarcinoma that has metastasized to the abdominal cavity, prostate adenocarcinoma, bladder transitional cell carcinoma, pancreatic duct epithelial carcinoma, pancreatic duct adenocarcinoma, cervical epithelial adenocarcinoma, cervical cancer, gastrointestinal cancer, genitourinary tract cancer, brain cancer, mesothelioma, renal cell carcinoma, gynecological cancer, or endometrial cancer.

[0076] Cancer treatment

[0077] In one aspect, the present invention provides a method for treating cancer. The methods disclosed herein effectively reduce or decrease the size, mass, and / or volume of tumors, or inhibit or delay tumor growth in a subject in need, by administering, at effective doses and intervals, a composition comprising one or more mRNAs encoding proteins or peptides that directly or indirectly regulate immune responses. The methods disclosed herein are also effective in increasing the survival of subjects. For example, in some embodiments, the methods and compositions described herein can increase the survival of subjects with cancer by about 1 to 12 months; 1 to 5 years; 5 to 10 years; or 10 to 15 years.

[0078] In one aspect, the present invention relates to a method of treating cancer by administering mRNA encoding an immunomodulatory protein or peptide that can be used in immuno-oncology (IO). The immunomodulatory protein or peptide includes interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-Ia, monocyte chemoattractant protein (MCP)-1, MCP-3, macrophage colony-stimulating factor (M-CSF), and granulocyte-macrophage colony-stimulating factor (GM-CSF). F), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony-stimulating factor (G-CSF), differentiation cluster (CD)80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family 1 containing the thermoprotein domain (NLRP1), NLRP3, interferon-stimulated gene (STING), melanoma deficiency factor 2 (AIM2), thermoprotein, IFN-induced protein 16 (IFI16), and OX40L.

[0079] Tumor size

[0080] Compared with a control, the methods disclosed herein for treating cancer are effective in reducing tumor size in subjects of need. In some embodiments, the control is an untreated subject with the same disease state. In some embodiments, the control is a subject prior to administration. In some embodiments, administration of the composition reduces tumor size by at least 5% to 99% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 5% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 10% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 15% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 20% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 25% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 30% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 35% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 40% compared with a control. In some embodiments, administration of the composition reduces tumor size by at least 45% compared with a control. In some embodiments, application of the composition reduces the size of the tumor by at least 50% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 60% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 70% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 80% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 85% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 90% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 95% compared to a control. In some embodiments, application of the composition reduces the size of the tumor by at least 99% compared to a control. In some embodiments, application of the composition results in tumor disappearance.

[0081] In some embodiments, the application of the composition reduces tumor size 1 day after application. In some embodiments, the application of the composition reduces tumor size 2 days after application. In some embodiments, the application of the composition reduces tumor size 4 days after application. In some embodiments, the application of the composition reduces tumor size 5 days after application. In some embodiments, the application of the composition reduces tumor size 7 days after application. In some embodiments, the application of the composition reduces tumor size 10 days after application. In some embodiments, the application of the composition reduces tumor size 12 days after application. In some embodiments, the application of the composition reduces tumor size 15 days after application. In some embodiments, the application of the composition reduces tumor size 18 days after application. In some embodiments, the application of the composition reduces tumor size 20 days after application. In some embodiments, the application of the composition reduces tumor size 25 days after application. In some embodiments, the application of the composition reduces tumor size 30 days after application.

[0082] In some embodiments, application of the composition resulted in a reduction in tumor size compared to a control throughout the treatment period. In some embodiments, application of the composition resulted in a reduction in tumor size for 5 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 7 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 10 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 15 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 20 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 25 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 30 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 35 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 40 days compared to a control. In some embodiments, application of the composition resulted in a reduction in tumor size for 45 days compared to a control.

[0083] Tumor growth inhibition

[0084] The methods disclosed herein for treating cancer are effective in inhibiting or delaying tumor growth. The percentage of tumor growth inhibition is calculated as follows: (mean (C) - mean (T)) / mean (C) × 100%, where T is the tumor volume in the test group and C is the tumor volume in the control group, where the control is an untreated subject. In some embodiments, the method results in a tumor growth inhibition percentage greater than 5% to 99% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 5% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 10% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 15% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 20% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 25% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 30% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 35% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 40% relative to the control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 45% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 50% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 60% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 70% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 75% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 85% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 90% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 95% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 99% compared to a control.

[0085] In some embodiments, the method results in inhibition of tumor growth 1 day after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 3 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 5 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 7 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 10 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 15 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 20 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 25 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 30 days after administration of the initial dose.

[0086] In some embodiments, application of the composition resulted in inhibition of tumor growth compared to a control throughout the treatment period. In some embodiments, application of the composition resulted in inhibition of tumor growth for 1 day compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 5 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 7 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 10 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 15 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 20 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 25 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 30 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 35 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 40 days compared to a control. In some embodiments, application of the composition resulted in inhibition of tumor growth for 45 days compared to a control.

[0087] In some embodiments, 5 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 50% compared to a control. In some embodiments, 7 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 50% compared to a control. In some embodiments, 5 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 60% compared to a control. In some embodiments, 7 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 60% compared to a control. In some embodiments, 10 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 50% compared to a control. In some embodiments, 5 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 70% compared to a control. In some embodiments, 10 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 70% compared to a control. In some embodiments, 5 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 80% compared to a control. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control 7 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control 10 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control 15 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control 20 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 80% compared to a control 25 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 85% compared to a control 7 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 85% compared to a control 15 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 85% compared to a control 20 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition percentage greater than 85% compared to a control 25 days after administration of the initial dose. In some embodiments, 7 days after administration of the initial dose, the method resulted in a tumor growth inhibition percentage greater than 90% compared to a control. In some embodiments, 15 days after administration of the initial dose, the method resulted in a tumor growth inhibition percentage greater than 90% compared to a control.In some embodiments, 20 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 90% compared to a control. In some embodiments, 25 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 90% compared to a control. In some embodiments, 7 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 95% compared to a control. In some embodiments, 15 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 95% compared to a control. In some embodiments, 20 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 95% compared to a control. In some embodiments, 25 days after administration of the initial dose, the method results in a tumor growth inhibition percentage greater than 95% compared to a control.

[0088] In some embodiments, the method effectively promotes antitumor effects (e.g., inducing T cell proliferation, inducing T cell infiltration in tumors, inducing memory T cell responses, increasing K cell numbers, etc.) by administering the composition as described herein. In one embodiment, the present invention provides a method for activating T cells in a subject of need, inducing T cell proliferation in a subject of need, inducing T cell infiltration in a tumor of a subject of need, and / or inducing memory T cell responses in a subject of need, the method comprising administering the composition disclosed herein to the subject. In some embodiments, the administration of the composition described herein activates T cells in the subject. T cell activation can be characterized in any manner known in the art. In some embodiments, the activated T cells express CD4. In some embodiments, the activated T cells express CD8. In some embodiments, the activated T cells express both CD4 and CD8. In some embodiments, the activated T cells include CD4. + T cells, CD8 + T cells or CD4 + T cells and CD8 + Both T cells. In some embodiments, T cell activation includes increasing the number of tumor-infiltrating T cells. In some embodiments, the number of tumor-infiltrating T cells in the tumor is increased by at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 50 times, or at least about 100 times compared to the number of tumor-infiltrating T cells in the tumor before the application of the composition.

[0089] weight change

[0090] Weight loss is common in cancer patients. Side effects, including weight loss, are an important part of cancer care and treatment. In some embodiments, the administration of the composition results in a weight change of less than 60% to 1% relative to a control. In some embodiments, the control is the subject's weight before the administration of the composition. In some embodiments, the administration of the composition results in a weight change of less than 60% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 50% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 40% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 30% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 25% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 20% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 15% relative to a control. In some embodiments, the administration of the composition results in a weight change of less than 10% relative to a control. In some embodiments, administration of the composition results in a weight change of less than 5% in the subject compared to a control. In some embodiments, administration of the composition results in a weight change of less than 1% in the subject compared to a control. In some embodiments, administration of the composition results in substantially no change in the subject's weight compared to a control.

[0091] Complete reaction

[0092] In cancer treatment, long-term efficacy is another important factor. In one embodiment, the method results in complete remission, partial remission, disease stabilization, partial response, or complete response. In some embodiments, a complete response means that cancer signs have disappeared or that inhibition of tumor growth has been maintained. In some embodiments, a partial response refers to a reduction in the extent of damage to multiple tumors in response to treatment. The complete response rate is the percentage of subjects who exhibit a complete response after administration of the composition. In some embodiments, the complete response rate is greater than 50%. In some embodiments, the complete response rate is greater than 60%. In some embodiments, the complete response rate is greater than 70%. In some embodiments, the complete response rate is greater than 80%. In some embodiments, the complete response rate is greater than 85%. In some embodiments, the complete response rate is greater than 90%. In some embodiments, the complete response rate is greater than 95%. In some embodiments, the complete response rate is greater than 99%.

[0093] Dosage and administration interval

[0094] As used herein, the term "therapeutic effective amount" is primarily based on the total amount of mRNA contained in the vaccine composition of the present invention. Generally, a therapeutic effective amount is sufficient to achieve a beneficial effect meaningful to the subject (e.g., treatment, regulation, cure, inhibition, prevention, and / or delay of cancer or its symptoms). For example, a therapeutic effective amount may be an amount sufficient to achieve the desired therapeutic and / or preventative effect. Typically, the amount of therapeutic agent (e.g., mRNA encoding a protein or peptide) administered to the subject in need will depend on the characteristics of the subject. These characteristics include the subject's condition, disease severity, general health status, age, sex, and weight. Those skilled in the art will be able to readily determine the appropriate dosage based on these and other relevant factors. Additionally, objective and subjective determinations may be optionally employed to determine the optimal dosage range.

[0095] Taking into account the subject's clinical condition, site and method of administration (e.g., local and systemic, including intratumoral, intravenous, and by injection), administration schedule, subject's age, sex, weight, and other factors relevant to clinicians of ordinary skill in the art, delivery vehicles containing mRNA may be administered and administered according to current medical practice. The "effective amount" used for the purposes of this document can be determined by relevant considerations known to those skilled in the art in experimental clinical studies, pharmacology, clinical, and medical fields. In some embodiments, the administered amount effectively achieves at least some stabilization, improvement, or symptom elimination (e.g., reduction of tumor size and / or inhibition of tumor growth) and other indicators selected by those skilled in the art as appropriate indicators of cancer progression, regression, or improvement.

[0096] In some embodiments, the method includes injecting a single dose. In some embodiments, the method includes periodically injecting multiple doses.

[0097] In some embodiments, a suitable dose range is 0.1 μg-100 mg mRNA. In some embodiments, the single or multiple doses range from 0.1 μg to 50 mg. In some embodiments, the single or multiple doses range from 0.1 μg to 25 mg. In some embodiments, the single or multiple doses range from 0.1 μg to 10 mg. In some embodiments, the single or multiple doses range from 1 μg to 1 mg. In some embodiments, the single or multiple doses range from 1 μg to 100 μg mRNA. In some embodiments, the single or multiple doses are 0.1 μg. In some embodiments, the single or multiple doses are 0.3 μg. In some embodiments, the single or multiple doses are 0.5 μg. In some embodiments, the single or multiple doses are 1 μg. In some embodiments, the single or multiple doses are 5 μg. In some embodiments, the single or multiple doses are 7.5 μg. In some embodiments, the single dose or multiple doses are 10 μg. In some embodiments, the single dose or multiple doses are 15 μg. In some embodiments, the single dose or multiple doses are 20 μg. In some embodiments, the single dose or multiple doses are 25 μg. In some embodiments, the single dose or multiple doses are 30 μg. In some embodiments, the single dose or multiple doses are 40 μg. In some embodiments, the single dose or multiple doses are 50 μg. In some embodiments, the single dose or multiple doses are 100 μg. In some embodiments, the single dose or multiple doses are 1 mg. In some embodiments, the single dose or multiple doses are 5 mg. In some embodiments, the single dose or multiple doses are 7.5 mg. In some embodiments, the single dose or multiple doses are 10 mg. In some embodiments, the single dose or multiple doses are 20 mg. In some embodiments, the single dose or multiple doses are 30 mg. In some embodiments, the single dose or the multiple doses are 50 mg. In some embodiments, the single dose or the multiple doses are 100 mg.

[0098] In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 500 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 400 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 300 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 200 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 100 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 90 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 80 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 70 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 60 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 50 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 40 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 30 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 25 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 20 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 15 mg / kg body weight. In some embodiments, the effective therapeutic dose ranges from about 0.005 mg / kg to 10 mg / kg body weight.

[0099] In some embodiments, the therapeutically effective dose of the composition is greater than about 0.1 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 0.5 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 1.0 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 3 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 5 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 10 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 15 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 20 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 30 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 40 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 50 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 60 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 70 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 80 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 90 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 100 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 150 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 200 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 250 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 300 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 350 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 400 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 450 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 500 mg / kg body weight. In some embodiments, the therapeutically effective dose is 1.0 mg / kg body weight. In some implementations, a therapeutically effective dose of 1.0 mg / kg body weight is administered subcutaneously, intramuscularly, or intravenously.

[0100] The methods provided by this invention consider both single and multiple applications of therapeutically effective amounts of the compositions described herein. The compositions can be administered at regular intervals, depending on the nature, severity, and extent of the subject's condition, such as tumor size, metastatic progression, or stage of cancer. In some embodiments, the therapeutically effective amount of the compositions of this invention can be administered periodically at regular intervals, for example, once daily, twice weekly, once every four days, once weekly, once every 10 days, once every two weeks, once monthly, once every two months, twice monthly, once every 30 days, once every 28 days, or continuously.

[0101] In some embodiments, the provided liposomes and / or compositions are formulated to suit the prolonged release of the mRNA contained therein. Such prolonged-release compositions can be conveniently administered to subjects at extended dosing intervals. For example, in some embodiments, the compositions of the present invention are administered to subjects twice daily. In some embodiments, the compositions are administered to subjects twice daily. In some embodiments, the compositions are administered to subjects once daily. In some embodiments, the compositions are administered to subjects every other day. In some embodiments, the compositions are administered to subjects twice weekly. In some embodiments, the compositions are administered to subjects once weekly. In some embodiments, the compositions are administered to subjects once every 7 days. In some embodiments, the compositions are administered to subjects once every 10 days. In some embodiments, the compositions are administered to subjects once every 14 days. In some embodiments, the compositions are administered to subjects once every 28 days. In some embodiments, the compositions are administered to subjects once every 30 days. In some embodiments, the compositions are administered to subjects once every two weeks. In some embodiments, the compositions are administered to subjects once every three weeks. In some embodiments, the compositions are administered to subjects once every four weeks. In some embodiments, the compositions are administered to subjects once monthly. In some embodiments, the compositions are administered to subjects twice monthly. In some embodiments, the composition is administered to the subject once every six weeks. In some embodiments, the composition is administered to the subject once every eight weeks. In some embodiments, the composition is administered to the subject once every month. In some embodiments, the composition is administered to the subject once every three months. In some embodiments, the composition is administered to the subject once every four months. In some embodiments, the composition is administered to the subject once every six months. In some embodiments, the composition is administered to the subject once every eight months. In some embodiments, the composition is administered to the subject once every nine months. In some embodiments, the composition is administered to the subject once a year. Formulations of compositions and liposomes for storage administration (e.g., intramuscular, subcutaneous, intravitreal) to deliver or release mRNA over extended periods are also considered. Preferably, the extended release method is combined with modifications to the mRNA to enhance stability.

[0102] Therapeutic effective doses are typically administered in dosing regimens that may comprise multiple unit doses. For any given vaccine, the therapeutic effective dose and dosing interval (and / or appropriate unit dose within an effective dosing regimen) can vary, for example, depending on the route of administration and the combination with other agents. Furthermore, the specific therapeutic effective dose (and / or unit dose) for any given patient can depend on a variety of factors, including the disorder to be treated and its severity; the activity of the specific vaccine agent used; the specific composition used; the patient's age, weight, general health, sex, and diet; the timing of administration, route of administration, and / or the rate of excretion or metabolism of the specific protein used; the duration of treatment; and similar factors well-known in the medical field.

[0103] In some embodiments, the initial dose and one or more subsequent doses are the same in amount. In some embodiments, the initial dose and one or more subsequent doses are different in amount. In some embodiments, the initial dose is greater than one or more subsequent doses. In some embodiments, the initial dose is less than one or more subsequent doses. In some embodiments, each of the multiple doses contains the same dose of mRNA. In some embodiments, each of the multiple doses contains a different dose of mRNA.

[0104] The composition of the present invention

[0105] In one aspect, the present invention relates to a method of treating cancer by administering a composition comprising one or more mRNAs encoding proteins or peptides encapsulated within lipid nanoparticles. In another aspect, the present invention provides a pharmaceutical composition for treating cancer comprising one or more mRNAs respectively encoding immunomodulatory proteins or peptides, wherein the one or more mRNAs are encapsulated within lipid nanoparticles. In some embodiments, the pharmaceutical composition comprises two or more mRNAs encoding one or more checkpoint inhibitors.

[0106] mRNA

[0107] In some implementations, one or more mRNAs encode immunomodulatory proteins or peptides that can be used in immuno-oncology (IO). Immunomodulatory proteins or peptides include interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-1a, monocyte chemoattractant protein (MCP)-1, MCP-3, macrophage colony-stimulating factor (M-CSF), and granulocyte-macrophage colony-stimulating factor (GM-CSF). F), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony-stimulating factor (G-CSF), differentiation cluster (CD)80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family 1 containing the thermoprotein domain (NLRP1), NLRP3, interferon-stimulated gene (STING), melanoma deficiency factor 2 (AIM2), thermoprotein, IFN-induced protein 16 (IFI16), and OX40L.

[0108] In some embodiments, one or more mRNAs are codon-optimized. In some embodiments, the protein or peptide encoded by the mRNA is wild-type. In some embodiments, the protein or peptide encoded by the mRNA contains a mutation or modification. In some embodiments, STING contains the R293M mutation. In some embodiments, NLRP3 contains the D301N mutation.

[0109] In some embodiments, the mRNA-encoded protein or peptide regulates the immune response. In some embodiments, the protein or peptide is a fragment or full-length cytokine. In some embodiments, a suitable protein or peptide is IL-1. In some embodiments, a suitable protein or peptide is IL-2. In some embodiments, a suitable protein or peptide is IL-3. In some embodiments, a suitable protein or peptide is IL-4. In some embodiments, a suitable protein or peptide is IL-5. In some embodiments, a suitable protein or peptide is IL-6. In some embodiments, a suitable protein or peptide is IL-7. In some embodiments, a suitable protein or peptide is IL-8. In some embodiments, a suitable protein or peptide is IL-10. In some embodiments, a suitable protein or peptide is IL-11. In some embodiments, a suitable protein or peptide is IL-12. In some embodiments, a suitable protein or peptide is IL-13. In some embodiments, a suitable protein or peptide is IL-15 / 15R. In some embodiments, a suitable protein or peptide is IL-18. In some embodiments, a suitable protein or peptide is IL-21. In some embodiments, a suitable protein or peptide is IL-27. In some embodiments, a suitable protein or peptide is MIP-Iβ. In some embodiments, a suitable protein or peptide is MIP-1a. In some embodiments, a suitable protein or peptide is monocyte chemoattractant protein (MCP)-1. In some embodiments, a suitable protein or peptide is MCP-3. In some embodiments, a suitable protein or peptide is M-CSF. In some embodiments, a suitable protein or peptide is GM-CSF. In some embodiments, a suitable protein or peptide is RANTES or CCL5. In some embodiments, a suitable protein or peptide is IFN-γ. In some embodiments, a suitable protein or peptide is TNF-α. In some embodiments, a suitable protein or peptide is G-CSF. In some embodiments, a suitable protein or peptide is CD80. In some embodiments, a suitable protein or peptide is CD86. In some embodiments, a suitable protein or peptide is EFNα. In some embodiments, a suitable protein or peptide is IFNp. In some embodiments, a suitable protein or peptide is IFN. In some embodiments, a suitable protein or peptide is FLT3L. In some embodiments, a suitable protein or peptide is NLRP1. In some embodiments, a suitable protein or peptide is NLRP3. In some embodiments, a suitable protein or peptide is STING. In some embodiments, a suitable protein or peptide is AIM2. In some embodiments, a suitable protein or peptide is a thermal protein. In some embodiments, a suitable protein or peptide is IFI16. In some embodiments, a suitable protein or peptide is OX40L.

[0110] In some embodiments, one or more mRNAs encode IL-12 and STING. In some embodiments, one or more mRNAs encode STING, IL-12, and GM-CSF. In some embodiments, one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, one or more mRNAs encode STING, IL-12, IL-2, and GM-CSF.

[0111] In one aspect, the present invention provides a method of treating cancer, comprising administering a composition comprising two or more mRNAs at an effective dose and at an interval to a subject in need, wherein each of the two or more mRNAs encodes a protein or peptide encapsulated within lipid nanoparticles to reduce tumor size or inhibit tumor growth. In some embodiments, each of the two or more mRNAs encodes an immunomodulatory enzyme and / or a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof. In some embodiments, a suitable checkpoint inhibitor inhibits PD1. In some embodiments, a suitable checkpoint inhibitor inhibits PD-L1. In some embodiments, a suitable checkpoint inhibitor inhibits CTLA-4. In some embodiments, a suitable checkpoint inhibitor inhibits B7. In some embodiments, a suitable checkpoint inhibitor inhibits BTLA. In some embodiments, a suitable checkpoint inhibitor inhibits HVEM. In some embodiments, a suitable checkpoint inhibitor inhibits TIM-3. In some embodiments, a suitable checkpoint inhibitor inhibits GAL-9. In some embodiments, a suitable checkpoint inhibitor inhibits LAG3. In some embodiments, a suitable checkpoint inhibitor inhibits VISTA. In some embodiments, a suitable checkpoint inhibitor inhibits KIR. In some embodiments, a suitable checkpoint inhibitor inhibits 2B4. In some embodiments, a suitable checkpoint inhibitor inhibits CD160. In some embodiments, a suitable checkpoint inhibitor inhibits CGEN-15049. In some embodiments, a suitable checkpoint inhibitor inhibits CHK1. In some embodiments, a suitable checkpoint inhibitor inhibits CHK2. In some embodiments, a suitable checkpoint inhibitor inhibits A2aR. In some embodiments, the checkpoint inhibitor is an antagonist against PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof. In some embodiments, the checkpoint inhibitor is an antibody or a fragment thereof. In some embodiments, the antibody or a fragment thereof is humanized. In some embodiments, the composition comprises a checkpoint inhibitor.

[0112] mRNA synthesis

[0113] The mRNA according to the invention can be synthesized according to any of a variety of known methods. For example, the mRNA according to the invention can be synthesized via in vitro transcription (IVT). Briefly, IVT is generally performed using a linear or circular DNA template containing a promoter, a library of ribonucleotide triphosphates, a buffer system possibly containing DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitors. The exact conditions will vary depending on the specific application.

[0114] Exemplary construct design for mRNA

[0115] Component design:

[0116] X-mRNA coding region - Y

[0117] 5′ and 3′ UTR sequences:

[0118] X(5′UTR sequence) =

[0119] GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG(SEQID NO:1)

[0120] Y(3′UTR sequence) =

[0121] CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU(SEQ ID NO:2)

[0122] or

[0123] GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU(SEQ ID NO:3)

[0124] This invention can be used to deliver mRNA of various lengths. In some embodiments, this invention can be used to deliver in vitro synthesized mRNA with a length equal to or greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb. In some embodiments, this invention can be used to deliver in vitro synthesized mRNA with a length in the range of about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb.

[0125] In some embodiments, to prepare the mRNA according to the invention, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence of the desired mRNA and a termination signal.

[0126] mRNA synthesis using SP6 RNA polymerase

[0127] In some implementations, mRNA is produced using SP6 RNA polymerase. SP6 RNA polymerase is a DNA-dependent RNA polymerase with high sequence specificity to the SP6 promoter sequence. SP6 polymerase catalyzes the 5′→3′ in vitro synthesis of RNA on single-stranded or double-stranded DNA downstream of the promoter; it incorporates native ribonucleotides and / or modified ribonucleotides and / or labeled ribonucleotides into the polymerized transcript. Examples of such labeled ribonucleotides include biotin, fluorescein, digoxigenin, aminoallyl, and isotopically labeled nucleotides.

[0128] The sequence of bacteriophage SP6 RNA polymerase was initially described (GenBank: Y00105.1) as having the following amino acid sequence:

[0129] MQDLHAIQLQLEEEMFNGGIRRFEADQQRQIAAGSESDTAWNRRLLSELIAPMAEGIQAYKEEYEGKKGRAPRALAFLQCVENEVAAYITMKVVMDMLNTDATLQAIAMSVAERIEDQVRFSKLEGHAAKYFEKVKKSLKASRTKSYRHAHNVAVVAEKSVAEKDADFDRWEAWPKETQLQIGTTLLEILEGSVFYNGEPVFMRAMRTYGGKTIYYLQTSESVGQWISAFKEHVAQLSPAYAPCVIPPRPWRTPFNGGFHTEKVASRIRLVKGNREHVRKLTQKQMPKVYKAINALQNTQWQINKDVLAVIEEVIRLDLGYGVPSFKPLIDKENKPANPVPVEFQHLRGRELKEMLSPEQWQQFINWKGECARLYTAETKRGSKSAAVVRMVGQARKYSAFESIYFVYAMDSRSRVYVQSSTLSPQSNDLGKALLRFTEGRPVNGVEALKWFCINGANLWGWDKKTFDVRVSNVLDEEFQDMCRDIAADPLTFTQWAKADAPYEFLAWCFEYAQYLDLVDEGRADEFRTHLPVHQDGSCSGIQHYSAMLRDEVGAKAVNLKPSDAPQDIYGAVAQVVIKKNALYMDADDATTFTSGSVTLSGTELRAMASAWDSIGITRSLTKKPVMTLPYGSTRLTCRESVIDYIVDLEEKEAQKAVAEGRTANKVHPFEDDRQDYLTPGAAYNYMTALIWPSISEVVKAPIVAMKMIRQLARFAAKRNEGLMYTLPTGFILEQKIMATEMLRVRTCLMGDIKMSLQVETDIVDEAAMMGAAAPNFVHGHDASHLILTVCELVDKGVTSIAVIHDSFGTHADNTLTLRVALKGQMVAMYIDGNALQKLLEEHEVRWMVDTGIEVPEQGEFDLNEIMDSEYVFA(SEQ ID NO:4)。

[0130] The SP6 RNA polymerase suitable for use in this invention can be any enzyme having substantially the same polymerase activity as the bacteriophage SP6 RNA polymerase. Therefore, in some embodiments, the SP6 RNA polymerase suitable for use in this invention can be modified from SEQ ID NO:4. For example, a suitable SP6 RNA polymerase may comprise one or more amino acid substitutions, deletions, or additions. In some embodiments, a suitable SP6 RNA polymerase has an amino acid sequence that is about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, or 60% identical or homologous to that of SEQ ID NO:4. In some embodiments, a suitable SP6 RNA polymerase can be a truncated protein (from the N-terminus, C-terminus, or internally) but retains polymerase activity. In some embodiments, a suitable SP6 RNA polymerase is a fusion protein.

[0131] The SP6 RNA polymerase suitable for use in this invention can be a commercially available product, such as those from Aldevron, Ambion, New England Biolabs (NEB), Promega, and Roche. SP6 can be ordered from commercial or non-commercial sources and / or custom-designed according to the amino acid sequence of SEQ ID NO:4 or a variant of SEQ ID NO:4 described herein. SP6 can be a standard fidelity polymerase or can be modified to enhance RNA polymerase activity to a high fidelity / efficiency / high capacity, such as through mutations in the SP6 RNA polymerase gene or post-translational modifications to the SP6 RNA polymerase itself. Examples of such modified SP6 include SP6 RNA Polymerase-Plus from Ambion. TM HiScribe SP6 from NEB and RiboMAX from Promega TM and Systems.

[0132] In some embodiments, a suitable SP6 RNA polymerase is a fusion protein. For example, an SP6 RNA polymerase may include one or more tags that promote the isolation, purification, or solubility of the enzyme. Suitable tags may be located at the N-terminus, C-terminus, and / or internally. Non-limiting examples of suitable tags include calmodulin-binding protein (CBP); Fasciola hepatica 8-kDa antigen (Fh8); FLAG-tagged peptide; glutathione S-transferase (GST); histidine tags (e.g., hexahistidine tags (His6)); maltose-binding protein (MBP); N-utilizing substance (NusA); small ubiquitin-associated regulator (SUMO) fusion tag; streptavidin-binding peptide (STREP); tandem affinity purification (TAP); and thioredoxin (TrxA). Other tags may be used in this invention. These and other fusion tags have been described, for example, in Costa et al. Frontiers in Microbiology 5 (2014):63 and PCT / US16 / 57044, the contents of which are incorporated herein by reference in their entirety. In some implementations, the His tag is located at the N-terminus of SP6.

[0133] SP6 Starter

[0134] Any promoter that can be recognized by SP6 RNA polymerase can be used in this invention. Typically, the SP6 promoter contains 5′ATTTAGGTGACACTATAG-3′ (SEQ ID NO:5). Variants of the SP6 promoter have been discovered and / or created to optimize the recognition and / or binding of SP6 to its promoter. Non-limiting variants include, but are not limited to: 5′-ATTTAGGGGACACTATAGAAGAG-3′; 5′-ATTTAGGGGACACTATAGAAGG-3′; 5′-ATTTAGGGGACACTATAGAAGGG-3′; 5′-ATTTAGGTGACACTATAGAA-3′; 5′-ATTTAGGTGACACTATAGAAGA-3′; 5′-ATTTAGGTGACACTATAGAAGAG-3′; 5′-ATTTAGGTGACACTATAGAAGG-3′; 5′-ATTTAGGTGACACTATAGAAGGG-3′; 5′-ATTTAGGTGACACTATAGAAGNG-3′; and 5′-CATACGATTTAGGTGACACTATAG-3′ (SEQ ID NO:6 to SEQ ID NO:15).

[0135] Furthermore, suitable SP6 promoters for use in this invention may be approximately 95%, 90%, 85%, 80%, 75%, or 70% identical or homologous to any of SEQ ID NO:5 to SEQ ID NO:15. Additionally, SP6 promoters for use in this invention may comprise one or more additional nucleotides 5′ and / or 3′ of any promoter sequence described herein.

[0136] DNA template

[0137] Typically, the DNA template is either fully double-stranded or mostly single-stranded with a double-stranded SP6 promoter sequence.

[0138] Linearized plasmid DNA (linearized by one or more restriction enzymes), linearized genomic DNA fragments (linearized by restriction enzymes and / or physical methods), PCR products, and / or synthetic DNA oligonucleotides can be used as templates for SP6 in vitro transcription, provided that they contain a double-stranded SP6 promoter located upstream (and in the correct orientation) of the DNA sequence to be transcribed.

[0139] In some implementations, the linearized DNA template has blunt ends.

[0140] In some implementations, the DNA sequence to be transcribed can be optimized to facilitate more efficient transcription and / or translation. For example, the DNA sequence can be optimized for cis-regulatory elements (e.g., TATA boxes, termination signals, and protein binding sites), artificial recombination sites, chi sites, CpG dinucleotide contents, negative CpG islands, GC contents, polymerase slip sites, and / or other elements related to transcription; the DNA sequence can be optimized for cryptic splicing sites, mRNA secondary structure, mRNA stability free energy, repetitive sequences, RNA instability motifs, and / or other elements related to mRNA processing and stability; the DNA sequence can be optimized for codon usage bias, codon fitness, internal chi sites, ribosome binding sites (e.g., IRES), premature polyA sites, Shine-Dalgarno (SD) sequences, and / or other elements related to translation; and / or the DNA sequence can be optimized for codon background, codon-anticodon interactions, translation pause sites, and / or other elements related to protein folding. Optimization methods known in the art can be used in this invention, such as ThermoFisher's GeneOptimizer and OptimumGene described in US 20110081708. TM The contents of this patent are incorporated herein by reference in their entirety.

[0141] In some embodiments, the DNA template includes 5′ and / or 3′ untranslated regions. In some embodiments, the 5′ untranslated region includes one or more elements that affect the stability or translation of the mRNA, such as iron response elements. In some embodiments, the length of the 5′ untranslated region can be between about 50 and 500 nucleotides.

[0142] In some embodiments, the 3' untranslated region includes one or more polyadenylation signals, protein binding sites that affect the localization stability of mRNA in the cell, or one or more miRNA binding sites. In some embodiments, the length of the 3' untranslated region can be between 50 and 500 nucleotides or longer.

[0143] Exemplary 3′ and / or 5′ UTR sequences may be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citrate cycling enzymes) to increase the stability of the positive mRNA molecule. For example, the 5′ UTR sequence may include a portion of the CMV Immediate Early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or increase the half-life of the polynucleotide. It is also contemplated to include a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3′ end or untranslated region of a polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Typically, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide relative to its unmodified counterpart, and include modifications, for example, to improve resistance to nuclease digestion in vivo.

[0144] Large-scale mRNA synthesis

[0145] This invention relates to the large-scale production of wild-type or codon-optimized mRNA. In some embodiments, the method according to the invention synthesizes at least 100 mg, 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 5 g, 10 g, 25 g, 50 g, 75 g, 100 g, 250 g, 500 g, 750 g, 1 kg, 5 kg, 10 kg, 50 kg, 100 kg, 1000 kg, or more of mRNA in single batches. As used herein, the term "batch" refers to the quantity or amount of mRNA synthesized at one time, for example, produced according to a single manufacturing environment. A batch can also refer to the amount of mRNA synthesized in a reaction occurring with a single aliquot of enzyme and / or a single aliquot of DNA template for continuous synthesis under a set of conditions. The mRNA synthesized in a single batch does not include mRNA synthesized at different times, which are combined to achieve the desired quantity. Typically, the reaction mixture contains SP6 RNA polymerase, a linear DNA template, and RNA polymerase reaction buffer (which may contain ribonucleotides or may require the addition of ribonucleotides).

[0146] According to the present invention, 1-100 mg of SP6 polymerase is typically used per gram (g) of mRNA produced. In some embodiments, about 1-90 mg, 1-80 mg, 1-60 mg, 1-50 mg, 1-40 mg, 10-100 mg, 10-80 mg, 10-60 mg, or 10-50 mg of SP6 polymerase is used per gram of mRNA produced. In some embodiments, about 5-20 mg of SP6 polymerase is used to produce about 1 gram of mRNA. In some embodiments, about 0.5 to 2 grams of SP6 polymerase is used to produce about 100 grams of mRNA. In some embodiments, about 5 to 20 grams of SP6 polymerase is used for about 1 kilogram of mRNA. In some embodiments, at least 5 mg of SP6 polymerase is used to produce at least 1 gram of mRNA. In some embodiments, at least 500 mg of SP6 polymerase is used to produce at least 100 grams of mRNA. In some embodiments, at least 5 grams of SP6 polymerase is used to produce at least 1 kilogram of mRNA. In some embodiments, about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of plasmid DNA is used to produce one gram of mRNA. In some embodiments, about 10-30 mg of plasmid DNA is used to produce about 1 gram of mRNA. In some embodiments, about 1 to 3 grams of plasmid DNA is used to produce about 100 grams of mRNA. In some embodiments, about 10 to 30 grams of plasmid DNA is used for about 1 kilogram of mRNA. In some embodiments, at least 10 mg of plasmid DNA is used to produce at least 1 gram of mRNA. In some embodiments, at least 1 gram of plasmid DNA is used to produce at least 100 grams of mRNA. In some embodiments, at least 10 grams of plasmid DNA is used to produce at least 1 kilogram of mRNA.

[0147] In some embodiments, the concentration of SP6 RNA polymerase in the reaction mixture may be about 1 to 100 nM, 1 to 90 nM, 1 to 80 nM, 1 to 70 nM, 1 to 60 nM, 1 to 50 nM, 1 to 40 nM, 1 to 30 nM, 1 to 20 nM, or about 1 to 10 nM. In some embodiments, the concentration of SP6 RNA polymerase is about 10 to 50 nM, 20 to 50 nM, or 30 to 50 nM. SP6 RNA polymerase can be used at concentrations of 100 to 10,000 units / mL, for example, concentrations of 100 to 9,000 units / mL, 100 to 8,000 units / mL, 100 to 7,000 units / mL, 100 to 6,000 units / mL, 100 to 5,000 units / mL, 100 to 1,000 units / mL, 200 to 2,000 units / mL, 500 to 1,000 units / mL, 500 to 2,000 units / mL, 500 to 3,000 units / mL, 500 to 4,000 units / mL, 500 to 5,000 units / mL, 500 to 6,000 units / mL, 1,000 to 7,500 units / mL, and 2,500 to 5,000 units / mL.

[0148] The concentration of each ribonucleotide (e.g., ATP, UTP, GTP, and CTP) in the reaction mixture is between about 0.1 mM and about 10 mM, for example, between about 1 mM and about 10 mM, between about 2 mM and about 10 mM, between about 3 mM and about 10 mM, between about 1 mM and about 8 mM, between about 1 mM and about 6 mM, between about 3 mM and about 10 mM, between about 3 mM and about 8 mM, between about 3 mM and about 6 mM, and between about 4 mM and about 5 mM. In some embodiments, each ribonucleotide is at about 5 mM in the reaction mixture. In some embodiments, the total concentration of rNTPs used in the reaction (e.g., a combination of ATP, GTP, CTP, and UTP) ranges from 1 mM to 40 mM. In some embodiments, the total concentration of rNTPs used in the reaction (e.g., a combination of ATP, GTP, CTP, and UTP) ranges between 1 mM and 30 mM, or between 1 mM and 28 mM, or between 1 mM and 25 mM, or between 1 mM and 20 mM. In some embodiments, the total rNTP concentration is less than 30 mM. In some embodiments, the total rNTP concentration is less than 25 mM. In some embodiments, the total rNTP concentration is less than 20 mM. In some embodiments, the total rNTP concentration is less than 15 mM. In some embodiments, the total rNTP concentration is less than 10 mM.

[0149] RNA polymerase reaction buffers typically include salts / buffers such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride.

[0150] The pH of the reaction mixture can be between about 6 to 8.5, 6.5 to 8.0, 7.0 to 7.5, and in some embodiments, the pH is 7.5.

[0151] A linear or linearized DNA template (e.g., as described above and in an amount / concentration sufficient to provide the desired amount of RNA), RNA polymerase reaction buffer, and SP6 RNA polymerase are combined to form a reaction mixture. The reaction mixture is incubated between about 37°C and about 42°C for 30 minutes to 6 hours, for example, about 60 to about 90 minutes.

[0152] In some implementations, approximately 5 mM NTP, approximately 0.05 mg / mL SP6 polymerase, and approximately 0.1 mg / mL DNA template in a suitable RNA polymerase reaction buffer (final reaction mixture pH approximately 7.5) are incubated at approximately 37°C to approximately 42°C for sixty to ninety minutes.

[0153] In some embodiments, the reaction mixture comprises a linearized double-stranded DNA template (800 mM HEPES, 20 mM spermidine, 250 mM MgCl2 pH 7.7 at 10x) with an SP6 polymerase-specific promoter, SP6 RNA polymerase, an RNase inhibitor, pyrophosphatase, 29 mM NTP, 10 mM DTT, and reaction buffer, and an RNase-free water in sufficient quantity (QS) to achieve the desired reaction volume; the reaction mixture is then incubated at 37°C for 60 minutes. The polymerase reaction is then quenched by adding DNase I and DNase I buffer (100 mM Tris-HCl, 5 mM MgCl2, and 25 mM CaCl2 pH 7.6 at 10x) to facilitate the digestion of the double-stranded DNA template in the formulation used for purification. This embodiment has been shown to be sufficient to produce 100 g of mRNA.

[0154] In some embodiments, the reaction mixture comprises NTPs at a concentration ranging from 1 to 10 mM, DNA template at a concentration ranging from 0.01 to 0.5 mg / ml, and SP6 RNA polymerase at a concentration ranging from 0.01 to 0.1 mg / ml. For example, the reaction mixture comprises NTPs at a concentration of 5 mM, DNA template at a concentration of 0.1 mg / ml, and SP6 RNA polymerase at a concentration of 0.05 mg / ml.

[0155] Nucleotides

[0156] According to the present invention, various naturally occurring or modified nucleosides can be used to generate mRNA. In some embodiments, the mRNA is or comprises a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5-propynyl-cytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-denitrified nucleosides). Adenosine, 7-denitroguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose); and / or modified phosphate groups (e.g., thiophosphates and 5-N-phosphoramide bonds).

[0157] In some embodiments, the mRNA contains one or more non-standard nucleotide residues. Non-standard nucleotide residues may include, for example, 5-methylcytidine (“5mC”), pseudouridine (“ΨU”), and / or 2-thiouridine (“2sU”). See, for example, U.S. Patent No. 8,278,036 or WO2011012316 for a discussion of such residues and their incorporation into mRNA. The mRNA may be RNA, defined as wherein 25% of the U residues are 2-thiouridine and 25% of the C residues are 5-methylcytidine. Teachings regarding the use of RNA are disclosed in U.S. Patent Publication US20120195936 and International Publication WO2011012316, which are incorporated herein by reference in their entirety. The presence of non-standard nucleotide residues may make the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In other embodiments, the mRNA may contain one or more non-standard nucleotide residues selected from the following: isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, as well as combinations of these modifications and other nucleotide modifications. Some embodiments may further include additional modifications to the furanose ring or nucleotides. Additional modifications may include, for example, sugar modifications or substitutions (e.g., 2′-O-alkyl modifications, one or more locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments where the sugar modification is a 2′-O-alkyl modification, this modification may include, but is not limited to, 2′-deoxy-2′-fluorine modifications, 2′-O-methyl modifications, 2′-O-methoxyethyl modifications, and 2′-deoxy modifications. In some implementations, any of these modifications may be present in 0-100% of the nucleotides—for example, more than 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or 100% of the constituent nucleotides, alone or in combination.

[0158] Post-synthesis processing

[0159] Typically, a 5′ cap and / or a 3′ tail can be added after synthesis. The presence of the cap is important for providing resistance to nucleases present in most eukaryotic cells. The presence of the tail protects the mRNA from degradation by exonucleases.

[0160] The 5' cap is typically added as follows: First, an RNA terminal phosphatase removes a terminal phosphate group from the 5' nucleotide, leaving two terminal phosphate groups; then, guanosine triphosphate (GTP) is added to the terminal phosphate groups by guanylate transferase, creating a 5'5'5 triphosphate bond; and finally, 7-nitromethylation of guanine is performed using a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5′)ppp(5′)A, G(5′)ppp(5′)A, and G(5′)ppp(5′)G. Further cap structures are described in U.S. Patent Application No. 2016 / 0032356 and U.S. Provisional Application No. 62 / 464,327, filed February 27, 2017, which are incorporated herein by reference.

[0161] Typically, the tail structure includes poly(A) and / or poly(C) tails. The poly-A or poly-C tail at the 3′ end of mRNA typically contains at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, or at least 500 adenosine or cytosine nucleotides, respectively. A pyridine nucleotide, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb adenosine or cytosine nucleotides. In some embodiments, the polyA or polyC tail can be about 10 to 800 adenosine or cytosine nucleotides (e.g., about 10 to 200 adenosine or cytosine nucleotides, about 10 to 300 adenosine or cytosine nucleotides, about 10 to 400 adenosine or cytosine nucleotides, about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550 adenosine or cytosine nucleotides, about 10 to 600 adenosine or cytosine nucleotides, about 50 to 600 adenosine or cytosine nucleotides, about 100 to 600 adenosine or cytosine nucleotides, about 150 to 600 adenosine or cytosine nucleotides, etc.). The number of adenosine or cytosine nucleotides may be approximately 200 to 600, approximately 250 to 600, approximately 300 to 600, approximately 350 to 600, approximately 400 to 600, approximately 450 to 600, approximately 500 to 600, approximately 10 to 150, approximately 10 to 100, approximately 20 to 70, or approximately 20 to 60. In some embodiments, the tail structure comprises a combination of poly(A) and poly(C) tails having the various lengths described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.

[0162] As described herein, the addition of a 5′ cap and / or a 3′ tail helps detect invalid transcripts generated during in vitro synthesis, because without capping and / or tailing, those prematurely invalid mRNA transcripts may be too small to be detected. Therefore, in some embodiments, a 5′ cap and / or a 3′ tail is added to the synthesized mRNA before testing the purity of the mRNA (e.g., the level of invalid transcripts present in the mRNA). In some embodiments, a 5′ cap and / or a 3′ tail is added to the synthesized mRNA before purifying the mRNA as described herein. In other embodiments, a 5′ cap and / or a 3′ tail is added to the synthesized mRNA after purifying the mRNA as described herein.

[0163] The mRNA synthesized according to the present invention can be used without further purification. Specifically, the mRNA synthesized according to the present invention can be used without the step of removing short polymers. In some embodiments, the mRNA synthesized according to the present invention can be further purified. Various methods can be used to purify the mRNA synthesized according to the present invention. For example, centrifugation, filtration, and / or chromatography can be used to purify the mRNA. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable method. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted using a standard phenol:chloroform:isoamyl alcohol solution known to those skilled in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include those described in US2016 / 0040154, US 2015 / 0376220, PCT application PCT / US18 / 19954, filed February 27, 2018, entitled “METHODS FOR PURIFICATION OF MESSENGER RNA”, and PCT / US18 / 19978, filed February 27, 2018, all of which are incorporated herein by reference and may be used in the practice of this invention.

[0164] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing.

[0165] In some implementations, the mRNA is purified by centrifugation before or after capping and tailing, or both before and after capping and tailing.

[0166] In some implementations, the mRNA is purified by filtration before or after capping and tailing, or both before and after capping and tailing.

[0167] In some implementations, the mRNA is purified by tangential flow filtration (TFF) before or after capping and tailing, or both before and after capping and tailing.

[0168] In some implementations, the mRNA is purified by chromatography before or after capping and tailing, or both before and after capping and tailing.

[0169] mRNA characterization

[0170] Full-length or invalid transcripts of mRNA can be detected and quantified using any method available in the art. In some embodiments, the synthesized mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV) or UPLC, or combinations thereof. Other detection methods known in the art are included in this invention. In some embodiments, the synthesized mRNA molecules are detected using ultraviolet absorption spectroscopy and separated by capillary electrophoresis. In some embodiments, the mRNA is denatured with glyoxal dye prior to gel electrophoresis (“glyoxal gel electrophoresis”). In some embodiments, the synthesized mRNA is characterized prior to capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.

[0171] In some embodiments, the mRNA produced by the methods disclosed herein contains less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, and less than 0.1% of impurities other than full-length mRNA. Impurities include IVT contaminants such as proteins, enzymes, free nucleotides, and / or shortmers.

[0172] In some embodiments, the mRNA generated according to the invention is substantially free of short-mers or invalid transcripts. Specifically, the mRNA generated according to the invention contains levels of short-mers or invalid transcripts that are undetectable by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the terms "short-mer" or "abnormally terminated transcript" refer to any transcript shorter than full length. In some embodiments, "short-mer" or "abnormally terminated transcript" is defined as a length of less than 100 nucleotides, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, or less than 10 nucleotides. In some embodiments, short-mers are detected or quantified after the addition of a 5′-cap and / or a 3′-polyA tail.

[0173] Delivery medium

[0174] According to the present invention, mRNA encoding proteins or peptides (e.g., full-length, fragments, or portions of proteins or peptides) as described herein can be delivered as naked RNA (unpackaged) or via a delivery medium. As used herein, the terms “delivery medium,” “transport medium,” “nanoparticle,” or grammatical equivalents are used interchangeably.

[0175] Delivery vehicles can be formulated in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizing agents, or formulated in a pharmaceutical composition in which the delivery vehicle is mixed with a suitable excipient. Techniques for formulating and administering drugs can be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa. Specific delivery vehicles are selected based on their ability to facilitate the transfection of nucleic acids into target cells.

[0176] In some embodiments, the delivery vehicle containing one or more mRNAs is administered via intravenous, intratumoral, intradermal, subcutaneous, intramuscular, intraperitoneal, epidural, intrathecal, or pulmonary delivery (e.g., including nebulization). In some embodiments, the mRNA is expressed in the tissue to which the delivery vehicle is administered. Further teachings on pulmonary delivery and nebulization are described in the applicant’s related international application PCT / US17 / 61100 and U.S. provisional application USSN 62 / 507,061, filed November 10, 2017, entitled “NOVEL ICE-BASED LIPID NANOPARTICLE FORMULATION FORDELIVERY OF mRNA,” each of which is incorporated herein by reference in its entirety.

[0177] In some embodiments, mRNA encoding a protein or peptide can be delivered using a single delivery medium. In some embodiments, mRNA encoding a protein or peptide can be delivered using one or more delivery media, each with a different composition. In some embodiments, one or more mRNAs are encapsulated within the same lipid nanoparticle. In some embodiments, the one or more mRNAs are encapsulated within separate lipid nanoparticles.

[0178] According to various implementation schemes, suitable delivery media include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, protein liposomes, both natural and synthetically derived exogens, natural, synthetic and semi-synthetic lamellar bodies, nanoparticles, calcium phosphate-silicate nanoparticles, calcium phosphate nanoparticles, silica nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly(D-arginine), sol-gel, nanodendritic polymers, starch-based delivery systems, micelles, emulsions, noisomes, multi-domain block polymers (vinyl polymers, polypropylene acrylate polymers, dynamic conjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides and other carrier tags. The use of biocapsules and other viral capsid protein assemblies as suitable transfer media is also considered. (Hum. Gene Ther. 2008 Sep; 19(9):887-95).

[0179] Liposome delivery mediators

[0180] In some embodiments, suitable delivery mediators are liposome delivery mediators, such as lipid nanoparticles. As used herein, liposome delivery mediators, such as lipid nanoparticles, are typically characterized as microvesicles having an internal water space isolated from an external medium by one or more bilayer membranes. The bilayer membranes of liposomes are typically formed of amphiphilic molecules, such as synthetic or naturally derived lipids comprising spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membranes of liposomes can also be formed of amphiphilic polymers and surfactants (e.g., polymeric vesicles, liposomes, etc.). In the context of this invention, liposome delivery mediators are generally used to transport desired mRNA to target cells or tissues. In some embodiments, the nanoparticle delivery mediator is a liposome. In some embodiments, the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. In some embodiments, the liposome comprises no more than three different lipid components. In some implementations, a different lipid component is a sterol-based cationic lipid.

[0181] cationic lipids

[0182] In some embodiments, liposomes may comprise one or more cationic lipids. As used herein, the phrase “cationic lipid” refers to any of a number of lipid substances that have a net positive charge at a selected pH (e.g., physiological pH). Several cationic lipids have been described in the literature, many of which are commercially available. Examples of suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO 2010 / 053572 (e.g., CI 2-200 described in paragraph

[00225] ) and WO 2012 / 170930, both of which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention employ lipid nanoparticles comprising ionizable cationic lipids as described in U.S. Provisional Patent Application 61 / 617,468, filed March 29, 2012 (incorporated herein by reference), such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadec-9,12-dien-1-yl)tetradec-15,18-dien-1-amine (HG T5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadec-9,12-dien-1-yl)tetradec-4,15,18-trien-1-amine (HGT5001) and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadec-9,12-dien-1-yl)tetradec-5,15,18-trien-1-amine (HGT5002).

[0183] In some embodiments, the provided liposomes comprise cationic lipids described in WO2013 / 063468 and in U.S. Provisional Application filed on the same day and concurrently with this application, entitled “Lipid Formulations for Delivery of Messenger RNA,” both of which are incorporated herein by reference.

[0184] In some embodiments, the cationic lipids include compounds of formula I-c1-a:

[0185]

[0186] Or its pharmaceutically acceptable salt, wherein:

[0187] Each R 2 Independently hydrogen or C 1-3 alkyl;

[0188] Each q is independently between 2 and 6;

[0189] Each R′ is independently either hydrogen or C. 1-3alkyl;

[0190] Each R L Independently for C 8-12 alkyl.

[0191] In some implementations, each R 2 Independently hydrogen, methyl, or ethyl. In some embodiments, each R... 2 Independently hydrogen or methyl. In some embodiments, each R 2 It is hydrogen.

[0192] In some implementations, each q is independently 3 to 6. In some implementations, each q is independently 3 to 5. In some implementations, each q is 4.

[0193] In some embodiments, each R′ is independently hydrogen, methyl, or ethyl. In some embodiments, each R′ is independently hydrogen or methyl. In some embodiments, each R′ is independently hydrogen.

[0194] In some implementations, each R L Independently for C 8-12 Alkyl group. In some embodiments, each R L Independently for nC 8-12 Alkyl group. In some embodiments, each R L Independently for C 9-11 Alkyl group. In some embodiments, each R L Independently for nC 9-11 Alkyl group. In some embodiments, each R L Independently for C 10 Alkyl group. In some embodiments, each R L Independently positive C 10 alkyl.

[0195] In some implementations, each R 2 Independently hydrogen or methyl; each q independently comprises 3 to 5; each R′ independently comprises hydrogen or methyl; and each R L Independently for C 8-12 alkyl.

[0196] In some implementations, each R 2 For hydrogen; each q is independently 3 to 5; each R′ is hydrogen; each R L Independently for C 8-12 alkyl.

[0197] In some implementations, each R 2 For hydrogen; each q is 4; each R′ is hydrogen; and each R L Independently for C8-12 alkyl.

[0198] In some embodiments, the cationic lipids include compounds of formula Ig:

[0199]

[0200] Or a pharmaceutically acceptable salt thereof, wherein each R L Independently for C 8-12 Alkyl group. In some embodiments, each R L Independently for nC 8-12 Alkyl group. In some embodiments, each R L Independently for C 9-11 Alkyl group. In some embodiments, each R L Independently for nC 9-11 Alkyl group. In some embodiments, each R L Independently for C 10 Alkyl group. In some embodiments, each R L It is positive C 10 alkyl.

[0201] In a particular embodiment, the provided liposomes comprise the cationic lipid cKK-E12, or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below:

[0202]

[0203] Other exemplary cationic lipids include those of formula I:

[0204]

[0205] and its pharmaceutically acceptable salts,

[0206] in,

[0207] R is (“OF-00”),

[0208] R is (“OF-01”),

[0209] R is (“OF-02”), or

[0210] R is ("OF-03")

[0211] (See, for example, Fenton, Owen S. et al., "Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery." Advanced Materials (2016)).

[0212] In some embodiments, one or more cationic lipids may be N-[l-(2,3-diolenoyloxy)propyl]-N,N,N-trimethylammonium chloride or “DOTMA” (Feigner et al., Proc. Nat'l Acad. Sci. 84,7413 (1987); U.S. Patent No. 4,897,355). DOTMA may be formulated alone or in combination with neutral lipids dioleoylphosphatidylethanolamine or “DOPE” or other cationic or non-cationic lipids to form liposome transfer mediators or lipid nanoparticles, and such liposomes may be used to increase the delivery of nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-carboxy-spermine-glycine di-octadecylamide or “DOGS”, 2,3-diolenoyloxy-N-[2-(spermine-carboxamine)ethyl]-N,N-dimethyl-1-propanium or “DOSPA” (Behr et al., Proc. Nat'l Acad. Sci. 86, 6982 (1989); U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761); 1,2-dioleoyl-3-dimethylammonium-propane or “DODAP”; and 1,2-dioleoyl-3-trimethylammonium-propane or “DOTAP”.

[0213] Other exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-diolenoyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinolenoyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenoyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-diolenoyl-N,N-dimethylammonium chloride or... “DODAC”, N,N-distearyl-N,N-dimethylammonium bromide or “DDAB”, N-(l,2-dimyristyloxypropyl-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or “DMRIE”, 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane or “CLinDMA”, 2-[5′-(cholest-5-en-3-β-oxy)-3′ -oxaproloxy)-3-dimethyl-l-(cis,cis-9′,l-2′-octadecadienoxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleenyloxybenzylamine or "DMOBA", 1,2-N,N′-dioleenylcarbamoyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", l,2-N,N′-dilinoleoylcarbamoyl-3 -Dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleylcarbamoyl-3-dimethylaminopropane or "DLinCDAP"), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA" and 2-(2,2-di((9Z,12Z)-octadec-9,12-dien-1-yl)-1,3-dioxolane-4-yl)-N,N-dimethylethylamine or "DLin-KC2-DMA" (see WO 2010 / 042877; Semil et al., Nature Biotech.28:172-176(2010)), or mixtures thereof. (Heyes, J. et al., J Controlled Release 107:276-287 (2005); Morrissey, DV. et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO2005 / 121348A1). In some embodiments, one or more cationic lipids comprise at least one of imidazole, dialkylamino, or guanidine moiety.

[0214] In some embodiments, one or more cationic lipids may be selected from XTC (2,2-dilinoleoyl-4-dimethylaminoethyl-1-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptadec-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2 -Di((9Z,12Z)-octadec-9,12-dienyl)tetrahydro-3aH-cyclopentadieno[d][1,3]dioxacyclopenten-5-amine), NC98-5(4,7,13-tris(3-oxo-3)-(undecylamino)propyl)-N1,N16-bisundecyl-4,7,10,13-tetraazahexahexadecane-1,16-diamide), DODAP(1,2-dioleyl-3- Dimethylammonium propane), HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), amino alcohol lipids such as those disclosed in WO2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (eyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic "lipid saturation influences intracellular delivery of encapsulated nucleic acids" J.Contr.Rel.2005,107,276-287), DLin-KC2-DMA (Semple, SC et al. "Rational Design of Cationic Lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al. "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869).

[0215] Sterol cationic lipids

[0216] In some embodiments, the sterol-based cationic lipids are sterol-based cationic lipids containing dialkylamino, imidazole, and guanidine. For example, some embodiments relate to compositions comprising one or more sterol-based cationic lipids containing imidazole, such as imidazole cholesterol esters or “ICE” lipids (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptane-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecano-1H-cyclopentadieno[a]phenanthrene-3-yl 3-(1H-imidazol-4-yl)propionate, as represented by the following structure (II). In some embodiments, lipid nanoparticles for delivering RNA (e.g., mRNA) encoding functional proteins may comprise one or more imidazole-based cationic lipids, such as imidazole cholesterol esters or “ICE” lipids (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptane-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecano-1H-cyclopentadieno[a]phenanthrene-3-yl 3-(1H-imidazol-4-yl)propionate, as represented by structure (II).

[0217]

[0218] In some embodiments, the percentage of cationic lipids in the liposomes may be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, cationic lipids constitute about 30-50% of the liposomes by weight (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, cationic lipids (e.g., ICE lipids) constitute about 30%, about 35%, about 40%, about 45%, or about 50% of the liposomes by molar ratio.

[0219] Non-cationic / helper lipids

[0220] In some embodiments, the provided liposomes contain one or more non-cationic (“auxiliary”) lipids. As used herein, the phrase “non-cationic lipid” refers to any neutral, zwitterionic, or anionic lipid. As used herein, the phrase “anionic lipid” refers to any of a variety of lipid substances that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), 4-(N-maleimidemethyl)-cyclohexane-l-carboxylic acid dioleoylphosphatidylethanolamine (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearylphosphatidylethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, l-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), or mixtures thereof.

[0221] In some embodiments, such noncationic lipids may be used alone, but are preferably used in combination with other lipids (e.g., cationic lipids). In some embodiments, the noncationic lipids may constitute about 5% to about 90%, or about 10% to about 70%, of the total lipids present in the liposomes. In some embodiments, the noncationic lipids are neutral lipids, i.e., lipids that do not carry a net charge under the conditions under which the composition is formulated and / or administered. In some embodiments, the percentage of noncationic lipids in the liposomes may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0222] Cholesterol-based lipids

[0223] In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. Suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylformamidocholesterol), 1,4-bis(3-N-oleoaminopropyl)piperazine (Gao et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipids may comprise about 2% to about 30%, or about 5% to about 20%, of the total lipids present in the liposomes in a molar ratio. In some embodiments, the percentage of cholesterol-based lipids in the lipid nanoparticles may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0224] PEG-modified lipids

[0225] The present invention also envisions the use of polyethylene glycol (PEG) modified phospholipids and derivatized lipids (such as derivatized ceramides (PEG-CER), including N-octanoylsphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide)) alone or preferably in combination with other lipid formulations (which contain transfer mediators (e.g., lipid nanoparticles)). The envisioned PEG-modified lipids include, but are not limited to, polyethylene glycol chains of a maximum length of 5kDa, said polyethylene glycol chains covalently linked to one or more C6-C6 bonds. 20 Lipids with alkyl chains of varying lengths. The addition of such components can prevent complex aggregation and can also provide a means of extending cycle life and increasing the delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or they can be selected to be rapidly exchanged from the formulation in vivo (see U.S. Patent No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention may comprise, by molar ratio, about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome transfer medium.

[0226] According to various embodiments, the selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids comprising lipid nanoparticles, and the relative molar ratios of these lipids to each other, are based on the characteristics of the selected lipids, the nature of the intended target cells, and the characteristics of the MCNA to be delivered. Other considerations include, for example, the saturation of the alkyl chain and the size, charge, pH, pKa, fusion, and toxicity of the selected lipids. Therefore, the molar ratios can be adjusted accordingly.

[0227] polymer

[0228] In some embodiments, polymers are used as carriers, alone or in combination with other carriers including the various lipids described herein, to formulate suitable delivery media. Therefore, in some embodiments, as used herein, liposome delivery media also encompass nanoparticles containing polymers. Suitable polymers may include, for example, polyacrylates, alkyl polycyanoacrylates, polylactide, polylactide-polyglycolic acid copolymers, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be a branched PEI with a molecular weight ranging from 10 to 40 kDa, such as a 25 kDa branched PEI (Sigma#408727).

[0229] Liposomes suitable for use in this invention may include one or more of the various ratios of cationic lipids, non-cationic lipids, cholesterol lipids, PEG-modified lipids and / or polymers described herein. As a non-limiting example, suitable liposome formulations may comprise combinations selected from: cKK-E12, DOPE, cholesterol and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; ICE, DOPE, cholesterol and DMG-PEG2K; or ICE, DOPE and DMG-PEG2K.

[0230] In several embodiments, cationic lipids (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitute about 30-60% of the liposomes in molar proportions (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, the percentage of cationic lipids (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) in molar proportions is equal to or greater than about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% of the liposomes.

[0231] In some embodiments, the ratios of one or more cationic lipids to one or more non-cationic lipids to one or more cholesterol-based lipids to one or more PEG-modified lipids can be between about 30-60:25-35:20-30:1-15. In some embodiments, the ratios of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids are about 40:30:20:10. In some embodiments, the ratios of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids are about 40:30:25:5. In some embodiments, the ratios of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids are about 40:32:25:3. In some embodiments, the ratios of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids are about 50:25:20:5.

[0232] The ratio of different lipid components

[0233] In embodiments where lipid nanoparticles comprise three or more different lipid components, the ratio of the total lipid content (i.e., the ratio of lipid component (1): lipid component (2): lipid component (3)) can be expressed as x:y:z, where

[0234] (y+z)=100-x.

[0235] In some implementations, each of “x”, “y” and “z” represents the molar percentage of the three different components of the lipid, and the ratio is a molar ratio.

[0236] In some implementations, each of “x”, “y” and “z” represents the weight percentage of the three different components of the lipid, and the ratio is a weight ratio.

[0237] In some implementations, the lipid component (1) represented by the variable “x” is a sterol-based cationic lipid.

[0238] In some implementations, the lipid component (2) represented by the variable “y” is an accessory lipid.

[0239] In some implementations, the lipid component (3) represented by the variable “z” is a PEG lipid.

[0240] In some embodiments, the variable “x” representing the molar percentage of lipid component (1) (e.g., sterol-based cationic lipids) is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0241] In some embodiments, the variable "x," representing the molar percentage of lipid component (1) (e.g., sterol-based cationic lipids), does not exceed about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 40%, about 30%, about 20%, or about 10%. In other embodiments, the variable "x" does not exceed about 65%, about 60%, about 55%, about 50%, or about 40%.

[0242] In some embodiments, the variable "x" representing the molar percentage of lipid component (1) (e.g., sterol-based cationic lipids) is: at least about 50% but less than about 95%; at least about 50% but less than about 90%; at least about 50% but less than about 85%; at least about 50% but less than about 80%; at least about 50% but less than about 75%; at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%. In some embodiments, the variable "x" is at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%.

[0243] In some embodiments, the variable “x” representing the weight percentage of lipid component (1) (e.g., sterol-based cationic lipids) is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0244] In some embodiments, the variable "x," representing the weight percentage of lipid component (1) (e.g., sterol-based cationic lipids), does not exceed about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 40%, about 30%, about 20%, or about 10%. In other embodiments, the variable "x" does not exceed about 65%, about 60%, about 55%, about 50%, or about 40%.

[0245] In some embodiments, the variable "x" representing the weight percentage of lipid component (1) (e.g., sterol-based cationic lipids) is: at least about 50% but less than about 95%; at least about 50% but less than about 90%; at least about 50% but less than about 85%; at least about 50% but less than about 80%; at least about 50% but less than about 75%; at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%. In some embodiments, the variable "x" is at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%.

[0246] In some embodiments, the variable “z” representing the molar percentage of lipid component (3) (e.g., PEG lipid) does not exceed about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25%. In some embodiments, the variable “z” representing the molar percentage of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In some embodiments, the variable “z” representing the molar percentage of lipid component (3) (e.g., PEG lipid) is about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 4% to about 10%, about 1% to about 7.5%, about 2.5% to about 10%, about 2.5% to about 7.5%, about 2.5% to about 5%, about 5% to about 7.5%, or about 5% to 10%.

[0247] In some embodiments, the variable "z" representing the weight percentage of lipid component (3) (e.g., PEG lipid) does not exceed about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25%. In some embodiments, the variable "z" representing the weight percentage of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In some embodiments, the variable "z" representing the weight percentage of lipid component (3) (e.g., PEG lipid) is about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 4% to about 10%, about 1% to about 7.5%, about 2.5% to about 10%, about 2.5% to about 7.5%, about 2.5% to about 5%, about 5% to about 7.5%, or about 5% to 10%.

[0248] For a composition having three and only three different lipid components, the variables “x”, “y” and “z” can be any combination, as long as the sum of these three variables is 100% of the total lipid content.

[0249] Formation of liposomes encapsulating mRNA

[0250] The liposome transfer medium used in the compositions of the present invention can be prepared by various techniques currently known in the art. The liposomes used in the provided compositions can be prepared by various techniques currently known in the art. For example, multilayer vesicles (MLVs) can be prepared according to conventional techniques, such as by dissolving lipids in a suitable solvent, depositing selected lipids onto the inner wall of a suitable vessel or container, and then evaporating the solvent to leave a film on the inside of the container or by spray drying. An aqueous phase can then be added to the vessel using vortex motion, resulting in the formation of the MLV. Monolayer vesicles (ULVs) can then be formed by homogenization, sonication, or extrusion of the multilayer vesicles. Alternatively, monolayer vesicles can be formed using detergent removal techniques.

[0251] In some embodiments, the provided composition comprises liposomes, wherein mRNA is bound to and encapsulated within the same liposome on both surfaces. For example, in the preparation of the compositions of the present invention, cationic liposomes can bind to mRNA via electrostatic interactions.

[0252] In some embodiments, the compositions and methods of the present invention comprise mRNA encapsulated in liposomes. In some embodiments, one or more mRNA substances may be encapsulated in the same liposome. In some embodiments, one or more mRNA substances may be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes that differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligands, and / or combinations thereof. In some embodiments, one or more liposomes may have different compositions of sterol-based cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes may have different molar ratios of cholesterol-based cationic lipids, neutral lipids, and PEG-modified lipids used to generate the liposomes.

[0253] The process of incorporating desired mRNA into liposomes is often referred to as “loading”. Exemplary methods are described in Lasic et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. The nucleic acid contained in the liposome may be located wholly or partially within the internal space of the liposome, within the liposome bilayer membrane, or bound to the outer surface of the liposome membrane. Incorporating nucleic acid into liposomes is also referred to herein as “encapsulation,” wherein the nucleic acid is completely contained within the internal space of the liposome. The purpose of incorporating mRNA into a transfer medium (e.g., liposomes) is often to protect the nucleic acid from environmental degradation, which may contain enzymes or chemicals that degrade nucleic acids and / or systems or receptors that facilitate rapid excretion of nucleic acids. Therefore, in some embodiments, a suitable delivery medium can enhance the stability of the contained mRNA and / or facilitate mRNA delivery to target cells or tissues.

[0254] Suitable liposomes according to the invention can be prepared in various sizes. In some embodiments, the provided liposomes can be prepared smaller than previously known liposomes encapsulating mRNA. In some embodiments, the reduction in liposome size is associated with more efficient mRNA delivery. The selection of an appropriate liposome size can take into account the target cell or tissue site, and to a certain extent, the application for which the liposomes are prepared.

[0255] In some embodiments, liposomes of appropriate size are selected to facilitate systemic distribution of polypeptides encoded by mRNA. In some embodiments, it may be desirable to restrict the transfection of mRNA to certain cells or tissues. For example, to target hepatocytes, the size of the liposomes may be set such that their dimensions are smaller than the fenestrations in the endothelial layer lining the hepatic sinusoids; in this case, the liposomes can easily penetrate these endothelial fenestrations to reach the target hepatocytes.

[0256] Alternatively, the size of liposomes can be set such that the liposomes have a sufficient diameter to limit or explicitly prevent their distribution into certain cells or tissues.

[0257] Various alternative methods known in the art can be used to determine the size of liposome populations. One such size determination method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. Sonicating liposome suspensions by bath or probe sonication produces a progressive size reduction down to small ULVs with diameters less than about 0.05 micrometers. Homogenization is another method that relies on shear energy to break large liposomes into smaller ones. In a typical homogenization procedure, the MLV is recirculated through a standard emulsion homogenizer until a selected liposome size, typically between about 0.1 and 0.5 micrometers, is observed. Liposome size can be determined by quasi-electro-optical scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS evaluation to guide efficient liposome synthesis.

[0258] Example

[0259] Although certain compounds, compositions and methods of the present invention have been specifically described according to some embodiments, the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0260] Example 1. Formulation of mRNA-loaded LNPs for cancer treatment

[0261] This embodiment provides an exemplary lipid nanoparticle (LNP) loaded with mRNA for in vivo efficacy studies in the treatment of cancer.

[0262] Messenger RNAs encoding codon-optimized wild-type or mutant IL-2, IL-12, STING, GM-CSF, FLT-3L, NLRP3, or combinations thereof were prepared and encapsulated in LNPs containing cKK-E12, as shown in Table 1. As a negative control, firefly luciferase (FFL) mRNA was encapsulated in LNPs.

[0263] Table 1. mRNA constructs used in in vivo studies

[0264]

[0265]

[0266] *CO: Codon optimization; msc: Mesenchymal stem cells; m: Mouse; Mutation in parentheses

[0267] Example 2. Study Design of In Vivo Efficacy of mRNA-LNP in MC38 Mouse Model

[0268] This embodiment describes a study design for preclinical evaluation of the in vivo therapeutic efficacy of mRNA-LNP in a subcutaneous MC38 mouse model of colon cancer.

[0269] MC-38 (a mouse colorectal cancer cell line) tumors were subcutaneously transplanted into immunocompetent mice. Serum was collected 3-4 days before tumor inoculation and at sacrifice. When the transplanted tumors grew to 60-80 mm... 3 When the tumor reached its maximum size (day 1), mice were intratumorally injected with various mRNA-LNPs prepared as described in Example 1. As shown in Table 2, six injections were administered over 20 days at 4-day intervals. Groups B and C received a single agent, while group DH received a combination of drugs. Groups A and I received saline and FFL mRNA-LNP as negative controls, respectively. Mice were monitored and tumor volume was measured throughout the study, until day 46 or until the tumor size exceeded 3000 mm. 3 .

[0270] Table 2. Study design of the MC-38 colorectal cancer mouse model

[0271]

[0272]

[0273] *: Constitutive activity; Chimeric H9; #: D301N mutation

[0274] Example 3. In vivo antitumor efficacy of mRNA-LNP in the MC38 mouse model

[0275] This embodiment demonstrates the in vivo efficacy of the mRNA-LNP prepared according to the present invention in reducing tumor size and inhibiting tumor growth.

[0276] like Figure 1 Tumor volume was measured at specified time points as shown in Table 3. The study endpoint was animal death or tumor volume reaching 3000 mmHg. 3 .

[0277] Figure 1 The average tumor volume of mice in the BH group was significantly smaller than that of mice in groups A or I. Most mice in groups A and I died or had tumor volumes greater than 3000 mmHg before the study was completed. 3 At the end of the study (d46), the complete response (CR) rate was 100% in group B, 30% in group C, 90% in group D, 80% in group E, 90% in group F, 70% in group G, and 70% in group H (see [reference]). Figure 5B-5GNotably, tumor growth was significantly delayed in the BH group mice compared to the negative control group. See Tables 3-6. Additionally, the percentage change in body weight was significantly lower in the BH group compared to groups A or I. Figure 6 ).

[0278] Table 3. Mean tumor volume (mm3) for each group measured at different time points.

[0279]

[0280]

[0281] The mean tumor volume of each group was compared with that of the control group (Group A). ​​Specifically, at each time point, the tumor volume of the test group (T) was divided by the control group (C) and the percentage was plotted, as shown below. Figure 2 As shown. Additionally, the tumor volume inhibition percentage for each group was calculated using the following formula: (mean (C) - mean (T)) / mean (C)) × 100%, and plotted on [the graph / plot]. Figure 3 And in Table 4. The tumor volume of each mouse in the BH group, measured on day 46, is plotted in Table 4. Figure 4 The middle section shows the average value for each group.

[0282] Table 4. Mean tumor volume inhibition percentage (%) for each group measured at different time points

[0283]

[0284] Average inhibition percentage = (average (C) - average (T)) / average (C)) × 100%

[0285] Table 5. %ΔT / ΔC, tumor volume measured at different time points for each group.

[0286]

[0287]

[0288] %ΔT / C = (Average (T) - Average (T0)) / (Average (C) - Average (C0)) × 100%

[0289] T0 - Initial value of the test group

[0290] C0 - Initial value of the control group

[0291] Table 6. Mean tumor volume inhibition %ΔT / ΔC for each group measured at different time points.

[0292]

[0293] Average %Δinhibition = ((average(C) - average(C0)) - (average(T) - average(T0))) / (average(C) - average(C0)) × 100%

[0294] In summary, this embodiment demonstrates the efficacy of the mRNA-LNP prepared according to the present invention in in vivo antitumor activity and cancer treatment.

[0295] μμ

[0296] Example 4. Administration of constitutively active STING mRNA encapsulated in lipid nanoparticles in an animal model delayed tumor growth and increased survival.

[0297] The effects of lipid-encapsulated constitutively active STING mRNA on tumor growth and in animals were evaluated. For these studies, mouse models (N=10) were inoculated with MC38 tumor cells and allowed to proliferate and form tumors in the animal models. The lipid-encapsulated mRNA, containing codon-optimized constitutively active STING, was then administered to the animal models. The lipid nanoparticles were formulated with cationic lipids of Formula I (as described above) and 1.5% PEG. Animals received an intratumoral dose of 5 μg of lipid-encapsulated mRNA every four days. Data from these studies showed… Figure 7 In the middle. For example Figure 7 As shown, animals receiving constitutively active STING mRNA exhibited less tumor growth compared to the mediator-only control and other negative controls. These data indicate that administration of lipid-encapsulated constitutively active STING leads to reduced tumor growth and a delayed tumor growth curve. These data also suggest that lipid-encapsulated mRNA encoding constitutively active STING is a promising standalone therapy for cancer treatment.

[0298] Other studies were also conducted using the aforementioned MC38 mouse tumor model to evaluate the survival of animal models after administration of lipid-encapsulated constitutively active STING. For these studies, the research groups consisted of one group of animals administered lipid-encapsulated constitutively active STING mRNA and another group of mice administered a combination of constitutively active STING mRNA and a PD-1 monoclonal antibody. Data from these studies indicated that administration of lipid-encapsulated constitutively active STING mRNA increased the survival of animal models without the addition of PD-1 monoclonal antibody. Figure 8 Overall, these data suggest that administration of lipid-encapsulated constitutively active STING mRNA reduces and delays tumor growth and increases survival.

[0299] equivalent

[0300] Those skilled in the art will recognize that many equivalent forms of the specific embodiments of the invention described herein can be determined using only conventional experiments. The scope of the invention is not intended to be limited to the foregoing description, but rather as set forth in the following claims.

Claims

1. A pharmaceutical composition comprising at least two mRNAs encoding IL-12 and STING, wherein the at least two mRNAs are encapsulated within one or more lipid nanoparticles, wherein each of the one or more lipid nanoparticles comprises a cationic lipid, a non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid, and wherein at least one of the one or more lipid nanoparticles comprises cKK-E12, OF-00, OF-01, OF-02, or OF-03 as a cationic lipid.

2. The pharmaceutical composition of claim 1, wherein the composition further comprises additional mRNA encoding a checkpoint inhibitor.

3. The pharmaceutical composition according to claim 1 or 2, wherein the at least two mRNAs further comprise mRNAs encoding IL-2, IL-6, IL-15, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or combinations thereof.

4. The pharmaceutical composition according to claim 1 or 2, wherein the at least two mRNAs comprise at least three mRNAs encoding STING, IL-12 and GM-CSF, respectively.

5. The pharmaceutical composition according to claim 1 or 2, wherein the at least two mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L and GM-CSF, respectively.

6. The pharmaceutical composition according to claim 1 or 2, wherein the at least two mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3 and GM-CSF respectively.

7. The pharmaceutical composition according to claim 1 or 2, wherein the at least two mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2 and GM-CSF, respectively.

8. The pharmaceutical composition according to any one of claims 1-7, wherein the STING is a mutant form of the STING.

9. The pharmaceutical composition of claim 8, wherein the mutant form allows STING to have constitutive activity.

10. The pharmaceutical composition according to any one of claims 1-9 further comprises additional mRNA encoding a protein or peptide that does not regulate an immune response.

11. The pharmaceutical composition according to any one of claims 2-10, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof.

12. The pharmaceutical composition according to any one of claims 1-11, further comprising second lipid nanoparticles, the second lipid nanoparticles not containing cKK-E12 and containing cationic lipids, said cationic lipids being selected from the group consisting of: OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazol-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pent-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pent-2-yl)-1,4-dioxane-2,5-dione (target 24), and combinations thereof.

13. Use of a composition in the preparation of a medicament for treating colorectal cancer, said composition comprising an effective dose of two or more mRNAs, each encoding a protein or peptide, encapsulated within one or more lipid nanoparticles; wherein, Two of the two or more mRNAs encode IL-12 and STING, respectively; wherein the one or more lipid nanoparticles each comprise cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids; and the composition is prepared to be suitable for application intervals that reduce tumor size or inhibit tumor growth.

14. The use according to claim 13, wherein the two or more mRNAs comprise a first mRNA and a second mRNA, the first mRNA being encapsulated within a first lipid nanoparticle encoding a first protein or peptide, and the second mRNA being encapsulated within a second lipid nanoparticle encoding a second protein or peptide.

15. The use according to claim 13 or 14, wherein the two or more mRNAs comprise at least three mRNAs encoding STING, IL-12 and GM-CSF, respectively.

16. The use according to claim 13 or 14, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L and GM-CSF, respectively.

17. The use according to claim 13 or 14, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3 and GM-CSF, respectively.

18. The use according to claim 13 or 14, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2 and GM-CSF, respectively.

19. The use according to any one of claims 13-18, wherein the STING is a mutant form of the STING.

20. The use according to claim 19, wherein the mutant form allows STING to have constitutive activity.

21. The use according to any one of claims 13-20, wherein, The one or more lipid nanoparticles comprise: at least one lipid nanoparticle, wherein the at least one lipid nanoparticle comprises a cationic lipid selected from cKK-E12, OF-00, OF-01, OF-02 and OF-03.

22. The use according to any one of claims 13-21, wherein, 7 days after administration of the initial dose, the treatment results in a tumor growth inhibition percentage greater than 50% relative to the control.

23. The use according to any one of claims 13-22, wherein, 10 days after administration of the initial dose, the treatment results in a tumor growth inhibition percentage greater than 60% compared to the control.

24. The use according to any one of claims 13-23, wherein 20 days after administration of the initial dose, the treatment results in a tumor growth inhibition percentage greater than 80% relative to the control.

25. The use according to any one of claims 13-24, wherein the administration of the composition results in a percentage change in the subject's body weight of less than 15% relative to a control.

26. The use according to claim 23 or 24, wherein the control is a subject with the same disease state but who has not been treated.

27. The use according to claim 26, wherein the control is the weight of the subject prior to administration of the composition.

28. The use according to claim 14, wherein the first lipid nanoparticle comprises a first cationic lipid, and the second lipid nanoparticle comprises a second cationic lipid, wherein the first cationic lipid is different from the second cationic lipid.

29. The use according to any one of claims 13-28, wherein the composition is administered intratumorally.

30. The use according to any one of claims 13-29, wherein the composition is administered subcutaneously.

31. The use according to any one of claims 13-30, wherein the composition is administered intradermally.

32. The use according to any one of claims 13-31, wherein the composition is administered intravenously.

33. The use according to any one of claims 13-32, wherein the composition is administered by pulmonary application.

34. The use according to any one of claims 13-33, wherein the composition is applied by atomization.

35. The use according to any one of claims 13-34, wherein the treatment comprises injecting a single dose.

36. The use according to any one of claims 13-34, wherein the treatment comprises periodic injection of multiple doses.

37. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 0.1 μg-100 mg mRNA.

38. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 0.1 μg-50 mg mRNA.

39. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 0.1 μg-25 mg mRNA.

40. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 0.1 μg-10 mg mRNA.

41. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 1 μg-1 mg mRNA.

42. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses is 1 μg-100 μg mRNA.

43. The use according to claim 35 or 36, wherein the single dose is or the multiple doses are selected from 0.1 μg, 0.3 μg, 0.5 μg, 1 μg, 5 μg, 10 μg, 25 μg, 50 μg or 100 μg.

44. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.01 μg / kg to 10 mg / kg.

45. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.01 μg / kg to 8 mg / kg.

46. ​​The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.01 μg / kg to 6 mg / kg.

47. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.01 μg / kg to 5 mg / kg.

48. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.1 μg / kg to 5 mg / kg.

49. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.1 μg / kg to 1 mg / kg.

50. The use according to claim 35 or 36, wherein the range of the single dose or the multiple doses of mRNA / body weight is 0.1 μg / kg to 0.5 mg / kg.

51. The use according to any one of claims 36-50, wherein each of the multiple doses comprises the same dose of mRNA.

52. The use according to any one of claims 36-51, wherein each of the multiple doses comprises a different dose of mRNA.

53. The use according to any one of claims 36-51, wherein each dose in the multiple doses is injected at intervals of 1 day to 3 weeks.

54. The use according to any one of claims 36-53, wherein each dose in the multiple doses is injected once a week.

55. The use according to any one of claims 13-54, wherein the mRNA comprises one or more modified nucleotides.

56. The use according to any one of claims 13-55, wherein the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR).

57. Use of a composition comprising an effective dose of two or more mRNAs, each encoding a protein or peptide, encapsulated within one or more lipid nanoparticles, in the preparation of a medicament for activating T cells in a subject, wherein the one or more lipid nanoparticles each comprise cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids; wherein two of the two or more mRNAs encapsulate STING and IL-12, respectively, and wherein the medicament is prepared to be suitable for administration intervals that result in reduction of tumor size or inhibition of tumor growth.

58. The use according to any one of claims 13-57, wherein the application further comprises applying a composition containing a checkpoint inhibitor.

59. The use according to any one of claims 13-57, wherein the application does not include the application of a composition comprising a checkpoint inhibitor.

60. The use according to claim 59, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof.

61. The use according to any one of claims 13-60, wherein the application results in a far-reaching effect.

62. The use according to claim 61, wherein 7 days after administration of the initial dose, the administration results in a greater than 50% inhibition of tumor growth in untreated tumors compared to a control.

63. The use according to claim 61, wherein 10 days after administration of the initial dose, the administration results in a tumor growth inhibition percentage of more than 60% in untreated tumors compared to a control.

64. The use according to claim 61, wherein 20 days after administration of the initial dose, the administration results in a tumor growth inhibition percentage of more than 80% in untreated tumors compared to a control.

65. The use according to any one of claims 13-59 or 61-64, wherein the administration increases the survival of a subject with cancer.

Citation Information

Patent Citations

  • Method of Sequence Optimization for Improved Recombinant Protein Expression using a Particle Swarm Optimization Algorithm

    US20110081708A1

  • RNA with a combination of unmodified and modified nucleotides for protein expression

    US20120195936A1

  • Methods for purification of messenger RNA

    US20150376220A1

  • Quantitative assessment for cap efficiency of messenger RNA

    US20160032356A1

  • Methods for purification of messenger RNA

    US20160040154A1