Adeno-associated viral vectors for the treatment of best disease

Abstract

To provide methods and compositions useful for treating bestrophinopathies, such as Best Disease.SOLUTION: The present invention relates to methods and compositions useful for treating bestrophinopathies, such as Best Disease.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing dates of U.S. Provisional Application No. 62 / 726,184, filed August 31, 2018, U.S. Provisional Application No. 62 / 749,622, filed October 23, 2018, and U.S. Provisional Application No. 62 / 754,530, filed November 1, 2018, the entire contents of each of which are incorporated by reference. Government support This invention was made with Government support under Grant No. EY021721 awarded by the National Institutes of Health. The Government has certain rights in the invention. [Background technology]

[0002] background Mutations in the BEST1 gene (also called VMD2) cause several forms of retinal degeneration, including Best vitelliform macular degeneration, also known as Best disease. (Best disease is also called Best macular degeneration, vitelliform degeneration, and vitelliform macular degeneration.) Bestrophinopathy is caused by more than 200 different mutations in the human BEST1 gene, which encodes a protein (bestrophin, or BEST1) that functions as a calcium-dependent chloride channel associated with the basolateral membrane of the retinal pigment epithelium. In bestrophinopathy, defects in fluid transport across the RPE impair the interaction between the RPE and photoreceptor cells. This damage leads to detachment of the retina from its supporting layer and accumulation of oxidized proteolipids (lipofuscin) in the RPE and subretinal space. Eventually, photoreceptors die, primarily in the macular region (which provides central vision). In humans, BEST1 mutations are usually autosomal dominant, meaning that one defective copy leads to disease regardless of the presence of a normal (wild-type) gene inherited from the other parent, however, autosomal recessive bestrophinopathy (ARB) has also been reported.

[0003] Best's disease, a rare disease, is a slowly progressive macular degeneration that typically begins in childhood and occasionally in the late teens. Affected individuals initially have normal vision, then central vision is reduced and metamorphopsia occurs. Individuals retain normal peripheral vision and dark adaptation. Individuals develop a mass resembling an egg yolk on the macula. This mass eventually breaks down and spreads throughout the macula, leading to reduced central vision. Best's disease may be diagnosed based on family history or ophthalmic examination, e.g., fundus appearance or electrooculogram (EOG). Inherited retinal degenerations (IRDs) encompass a large group of molecularly heterogeneous and pathophysiologically distinct blinding conditions. Genetic defects often affect primarily rod or cone photoreceptors (PRs) or both, and specific defects may involve phototransduction, ciliary transport, morphogenesis, neurotransmission, or others. Primary defects involving the retinal pigment epithelium (RPE) are less common but are receiving increased attention due to high-profile clinical trials.

[0004] The most common IRD due to primary RPE defects is caused by mutations in BEST1, which encodes a transmembrane protein associated with the basolateral portion of the RPE. BEST1 (bestrophin) is a multifunctional channel protein that mediates transepithelial ion transport, intracellular calcium signaling and regulation of RPE cell volume, and the homeostatic environment of the subretinal space. In eukaryotic cells, BEST1 forms a stable homopentamer with four transmembrane helices, cytosolic N- and C-termini, and a continuous central pore that is sensitive to calcium-dependent control of chloride permeation.

[0005] In humans, BEST1 mutations result in a wide range of IRDs collectively grouped as bestrophinopathies that are often accompanied by characteristic macular involvement. Retinal areas distant from the lesion tend to appear grossly normal, despite the presence of global retinal electrophysiological defects on EOG reflecting abnormalities in the ocular standing potential. Naturally occurring biallelic mutations in the canine BEST1 gene (cBEST1) cause canine IRD with clear phenotypic similarities to both dominant and recessive forms of human bestrophinopathy, including a pronounced bias of subretinal involvement towards canine foveal-like regions.

[0006] Proper anatomical apposition and sustained interaction between RPE apical microvilli (MV) and PR outer segments (OS) are thought to be critical for normal vision. Both ionic composition and volume regulation of the subretinal space are essential to maintain the precise molecular proximity of this complex and homeostasis of the RPE-PR interface. In vitro and ex vivo studies have long shown that genetic mutations, metabolic perturbations, as well as light stimulation, alter the ionic composition of the subretinal space and the physiological response of the RPE and / or PR. More recently, in vivo studies of the microanatomy of the outer retina in health and disease and its response to light have become increasingly informative with modern retinal imaging modalities.

[0007] Mutations in the BEST1 gene cause retinal detachment and photoreceptor (PR) cell degeneration due to a primary channelopathy in adjacent retinal pigment epithelial (RPE) cells. The pathophysiology of the interactions between RPE and PR cells that precede the formation of retinal detachment remains poorly understood. Summary of the Invention

[0008] Summary of the Invention Aspects of the disclosure relate to compositions for treating bestrophinopathy (e.g., Best vitelliform macular degeneration) in a subject (e.g., in a human). Aspects of the disclosure are designed to suppress the expression of endogenous BEST1 mRNA (e.g., both mutant and normal copies). In some embodiments, expression is suppressed using RNA interference. In some embodiments, endogenous BEST1 mRNA is simultaneously replaced with normal BEST1 mRNA to produce only normal protein. In some embodiments, adeno-associated virus (AAV) is used to deliver the gene for small hairpin RNA (shRNA), which leads to the production of small interfering RNA (siRNA), in addition to an intronless copy of the BEST1 gene.

[0009] In some embodiments, one or both alleles of the BEST1 gene of a subject (e.g., a human) are silenced by administering a small hairpin RNA (shRNA) molecule to the subject (e.g., a subject with Best disease, e.g., a human with Best disease). In some embodiments, a replacement BEST1 coding sequence is also administered to the subject to provide functional bestrophin protein, e.g., to restore photoreceptor function to the subject. In some embodiments, the replacement BEST1 coding sequence has one or more nucleotide substitutions with respect to the endogenous gene allele(s) that render the replacement gene resistant to the effect of interfering RNA. In some embodiments, the replacement BEST1 coding sequence is a human BEST1 coding sequence (e.g., a wild-type human BEST1 coding sequence) that contains one or more (e.g., 1, 2, 3, 4, or 5 or more) substitutions that render the gene resistant to shRNA-mediated degradation. In some embodiments, the replacement BEST1 coding sequence contains one or more silent mutations (base changes at the third position of the codon) at the target site, rendering the gene "detargeted" to shRNA-mediated degradation.

[0010] In some aspects, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:2), an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO:7).

[0011] In some aspects, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO:6), an antisense strand comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO:5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO:8).

[0012] In some embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising an antisense strand that comprises the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3). In some aspects, the disclosure provides vectors comprising a genetic sequence encoding an shRNA described in the preceding paragraph. In some aspects, the disclosure provides a vector further comprising a recombinant functional (e.g., wild-type) BEST1 coding sequence that does not contain a sequence targeted by an shRNA. In some aspects, the vector further comprises a recombinant functional BEST1 coding sequence that is codon-optimized for expression in human cells.

[0013] In some aspects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 9. In some aspects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 10. In some aspects, the disclosure provides a vector that is a plasmid or a viral vector. In some aspects, the viral vector is a recombinant adeno-associated viral (rAAV) vector. In some aspects, the rAAV vector is self-complementary. In some aspects, the disclosure provides rAAV viral particles that are AAV serotype 2 viral particles. In some aspects, the disclosure provides a composition comprising a vector or rAAV particle and a pharma- ceutically acceptable carrier.

[0014] In some aspects, the disclosure provides a method of regulating BEST1 expression in a subject, the method comprising administering to a subject, such as a human subject, a composition comprising a vector or rAAV particle and a pharma- ceutically acceptable carrier. In some aspects, the disclosure provides a method of treating a bestrophinopathy (e.g., Best's disease and ARB) in a subject, the method comprising administering a composition. In some embodiments, a vector encoding a functional BEST1 sequence is provided to complement or correct (e.g., at least partially) BEST1 function in a cell without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.

[0015] In some embodiments, a vector encoding a functional BEST1 sequence is provided to complement or correct (for example, at least partially) cell BEST1 function, and a shRNA sequence is provided to knock down endogenous BEST1 gene expression. In some embodiments, endogenous BEST1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be shRNA-resistant. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.

[0016] In some aspects, the disclosure provides compositions for use in treating Best's disease and compositions for use in the manufacture of a medicament for treating Best's disease. In some aspects, the disclosure provides compositions comprising a vector or rAAV particle, where the vector encodes a functional BEST1 sequence for use in treating an ARB, and compositions for use in the manufacture of a medicament for treating an ARB. These and other aspects are set forth in the following drawings, examples and claims. [Brief description of the drawings]

[0017] BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of this specification and are included to further demonstrate certain aspects of the disclosure, which may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It should be understood that the data illustrated in the drawings are not intended to limit the scope of the disclosure in any way.

[0018] [Figure 1A-D] Figures 1A-1D show whole-retina pathology of RPE apical microvilli processes associated with canine BEST1 mutations. Figures 1A and 1B show confocal images showing molecular pathology in cBest (R25* / R25*; 89 weeks) (Figure 1B) compared to wild type (Figure 1A) (42 weeks). Retinal cryosections were immunolabeled with anti-EZRIN and human cone arrestin and combined with peanut agglutinin lectin and DAPI labeling. Figure 1C shows representative photomicrographs of 6-week-old canine wild type and cBest mutant (R25* / P463fs) retinas immunolabeled with anti-BEST1 and anti-SLC16A1. White arrows point to subsets of cone-MVs. Figure 1D shows quantification of whole-retina cone-MV numbers between cBest mutant and age-matched control eyes. The y-axis represents the average number of cone-MVs per square millimeter in each color-coded retinal region examined. Abbreviations: H&E, hematoxylin & eosin stain; PRL, photoreceptor IS / OS layer; i, inferior; N, nasal; S, superior; T, temporal.

[0019] [Figure 2A-C] Figures 2A-2F show light-mediated changes in outer retinal structures in wild type and cBest(R25* / P463fs) mutants. Figure 2A shows cross-sectional imaging along the horizontal meridian through the central retinal foveal field (fovea-like region) of 15-week-old normal (WT) dogs and 11-week-old cBest(R25* / P463fs) with weaker and stronger light adaptation (LA). Thin white arrows indicate the superotemporal location of the OCT. Figure 2B shows longitudinal reflectance profiles (LRPs) (average of 85 single LRPs) at 3° nasal from the fovea-like region (T, temporal retina) and the nasal edge of the optic disc (N, nasal retina) in WT dogs (12 eyes, 15-17 weeks old) compared to cBest-treated dogs (6 eyes, 11 weeks old) with weaker and stronger LA. Arrows indicate IS / OS and RPE / T peaks. Single and double arrows indicate an additional hyporeflective layer in cBest. Figure 2C shows the distance between the IS / OS peak and the RPE / T peak in WT and cBest eyes under the two LA conditions. Symbols with error bars represent the mean (±2SD) distance of each group's eyes at both locations. Figure 2D is a schematic of the dark and light adaptation protocols. Animals were dark adapted overnight (D / A) and subjected to OCT imaging. Five increasing exposures (L1 to L5) were then used. [Fig. 2D-F] Figure 2D also shows a close-up of the cBest OCT scan with overlapping LRP after overnight dark adaptation (left) and after maximum exposure (right). Figure 2E shows the results using a simplified protocol with only L4 and L5 exposure in a different subset of cBest eyes (n=3; colored traces). Figure 2F shows the spatial tissue distribution of IS / OS to RPE / T distance in the mean WT compared to two representative cBest eyes [panels; EM356-OS: 297-week-old cmr1 / cmr3(R25* / P463fs); LH30-OD: 12-week-old cmr3(P463fs / P463fs)].

[0020] [Figure 3A-B]Figures 3A-3D show that BEST1 gene augmentation therapy results in sustained reversal of foveomacular pathology and restoration of RPE-PR interface structure in cBest mutants. Figure 3A shows the natural history of central subretinal detachment documented by in vivo imaging in the right eye of a cBest dog (EM356-OD; R25* / P463fs) at three time points. Insets show autofluorescence and OCT images. Figure 3B shows fundus images taken before (52 weeks of age) and after a subretinal injection of AAV2-cBEST1 (1.5x1010vg / mL) was performed in the eye shown in Figure 3A. The subretinal bleb area is indicated by the dashed circle. Images acquired at 43 and 245 weeks post-injection show sustained reversal of central pathology, and fully reattached retina within the treated area. Center and right insets show autofluorescence and OCT images. [Figure 3C-D] Figures 3C and 3D show the restoration of RPE-photoreceptor interface structure after AAV-hBEST1 treatment in the cBest(R25* / R25*) model compared to controls. The bleb border is indicated by a dashed circle. The location of the corresponding OCT scan passing through the subretinal lesion before injection or the matching location mapped after injection is indicated by a horizontal line. The retinotomy site is indicated by an arrow.

[0021] [Figure 4A-B]Figures 4A-4F show reversal of microdetachment of the entire retinal area after subretinal gene therapy in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] subretinally injected with BSS or AAV-hBEST1. Figure 4A shows a map of the tissue distribution of IS / OS-RPE / T distances in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] subretinally injected with BSS or AAV-hBEST1. Treatment boundaries are based on fundus photographs of the bleb taken at the time of injection (dotted lines) and, where indicated, the boundaries evident at the time of imaging (dashed lines). All eyes are shown as equivalent right eyes with the optic nerve and major vessels (black), tapetum border (white), and fovea-like region (white oval) superimposed to facilitate comparison. Figure 4B shows the difference in IS / OS-RPE / T distances of WT at superior and inferior retinal locations in the cBest eye within the treated bleb (Tx; filled symbols) and untreated outer bleb (Ctrl; open symbols) regions. The dashed line delimits the 95th percentile of normal variability. The tissue distribution of IS / OS-RPE / T distances is shown pre-treatment (left) and post-treatment (right). [Figure 4C-F] Figures 4C and 4E show grayscale maps of the difference between each cBest eye and the average WT control. White represents total retinal detachment. Figures 4D and 4F show colocalized difference measurements of IS / OS-RPE / T distance between WT and pre-treatment (PreTx) and post-treatment (Tx) cBest for the eyes shown in Figures 4C and 4E, respectively.

[0022] [Figure 5A-C]Figures 5A-5G show retinal site phenotypes in two human subjects with ARB. Figure 5A shows RPE health across the retina of two ARB patients, P1 and P2, imaged with short-wavelength low-intensity autofluorescence imaging (SW-RAFI) utilizing the native RPE fluorophore lipofuscin. White arrows indicate the location of the perimetry profile and OCT scan. Rectangles indicate the regions of interest shown in the other panels. Black arrows indicate the transition from disease to health in the mid-peripheral nasal retina. Figure 5B shows perimetry light sensitivity of dark-adapted (top) rods and light-adapted (bottom) cones of the eye measured across the horizontal meridian. The grey area represents normal sensitivity except for the physiological blind spot corresponding to the optic nerve (ONH). Figure 5C shows a retinal cross section with OCT along the horizontal meridian crossing the fovea. [Fig. 5D-G] Figures 5D and 5E show details of the patient's outer retinal lamination compared to normal at two regions of interest: the parapapillary retina (Figure 5D) and the mid-peripheral nasal retina (Figure 5E). Colors indicate the COS near-apical interface and the ROS near-apical interface and the RPE apical process, while bricks indicate the RPE and near-Bruch's membrane interfaces. Figures 5F and 5G show dark adaptation kinetics measured at P1 at the peripapillary locus (Figure 5F) and P2 at the mid-peripheral nasal locus (Figure 5G). Time 0 indicates the end of light adaptation.

[0023] [Figure 6A-D]Figures 6A-6D show the RPE-PR mating zone in a canine model of CNGB3-associated color vision deficiency (ACHM3). Figures 6A and 6B show representative fluorescent microscopy images of 6-week-old CNGB3-D262N mutant (Figure 6A) and CNGB3 null (Figure 6B; CNGB3- / -) retinas, demonstrating normal expression of BEST1, restricted to the basolateral plasma membrane of RPE cells, and SLC16A1, a marker that labels RPE apical processes. Arrows point to a subset of cone-associated RPE apical microvilli (c-MVs). Figures 6A and 6B also show anti-CNGB3 and anti-EZRIN co-labeling, and for reference, age-matched wild-type retinas are shown. Figures 6C and 6D show immunohistochemical assessment of the RPE-PR interface in CNGB3 mutant retinas from affected dogs at 85 weeks of age (Figure 6C) and 57 weeks of age (Figure 6D). The apical aspect of the RPE and its microvilli extensions are immunolabeled with EZRIN, and a subset of c-MVs is indicated by arrows.Abbreviations: ACHM3, achromatopsia; cCNGB3, canine CNGB3 gene; c-MV, cone-associated RPE apical microvilli; CNGB3, cyclic nucleotide-gated channel beta 3 protein; hCAR, human cone arrestin; SLC16A1, solute carrier family 16 member 1.

[0024] [Figure 7] Figure 7 shows the recovery of light-mediated microablation. Two cBest-onset (R25* / P463fs) eyes [43 weeks old (right) and 52 weeks old (left)] were dark adapted overnight and imaged similarly to the results shown in Figure 2A. [Figure 8A-B]Figures 8A-8B show in cBest eyes ultra-thick ONL in retinal regions with microdetachments and its correction by gene therapy. Figure 8A shows that uninjected cBest eyes (shown as IS / OS-RPE / T thickness maps in Figures 2A-2F and 4A-4F) demonstrate ultra-thick ONL corresponding to large areas of retinal microdetachments, and localized thinning of the ONL over the gross lesion and near the foveal-like region in some eyes. Figure 8B shows that treated cBest eyes (shown as IS / OS-RPE / T thickness maps in Figures 4A-4F) demonstrate normal ONL thickness in AAV-treated regions surrounded by ultra-thick, normal, or thinned ONL in untreated regions. OD, right eye; OS, left eye.

[0025] [Figure 9A-F] Figures 9A-9F show the evolution of a focal macular lesion in a cBest-onset (R25* / P463fs) dog (EM356-OS). Figure 9A shows the progression of discrete separation of the photoreceptor layer from the underlying RPE to form a larger subretinal macrodetachment (vitellopyon-like lesion) evident en face, and Figure 9B shows the corresponding OCT scan at 23 weeks of age. Figure 9C shows that the first signs of hyperautofluorescent material accumulating within the subretinal lesion were observed 8 weeks later (31 weeks; early pseudohypopyon lesion). Figure 9D shows that at 66 weeks of age, a typical pseudohypopyon appearance is noted, followed by vitellopyon-like lesions with dispersion of autofluorescent material at 172 and 297 weeks of age (inset, enlarged). Figures 9E and 9F show that significant thinning of the ONL is evident by OCT scan. The dark lines indicate the location of the corresponding SD-OCT scans.

[0026] [Figure 10] FIG. 10 shows retinal preservation following AAV-hBEST1 treatment in three cBest models [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), and cmr3(P463fs / P463fs)] compared to wild-type control eyes and cBest-untreated eyes. [Figure 11A-D]Figures 11A-11D show the dose-response effect of BEST1 transgene expression on RPE cytoskeleton rescue in cBest(R25* / P463fs) retinas. Figure 11A shows a cross-sectional overview from the surgical bleb area (left), through the adjacent border zone area (center), to the contiguous extent outside the injection zone (right). Figure 11B shows a marked expansion of RPE apical processes in the area treated with enhanced BEST1. Figure 11C shows a patchy distribution of BEST1 (weak signal within individual RPE cells) and the presence of vestigial microvilli and rod MVs in the bleb border zone associated with RPE-PR microdetachment. Figure 11D shows the formation of subretinal lesions in the absence of both BEST1 expression and RPE apical processes outside the treatment zone.

[0027] [Figure 12A-B] 12A-12B show interocular symmetry of rod and cone function ARB patients P1 (FIG. 12A) and P2 (FIG. 12B). Rod (RSL) and cone sensitivity loss (CSL) maps of both eyes of two patients with ARB. [Figure 13] FIG. 13 shows the map of the 6262 bp plasmid, pTR-VMD2-hBest, human bestrophin. [Figure 14] FIG. 14 shows the map of the 6222 bp plasmid, pTR-VMD2-cBest, canine bestrophin.

[0028] [Figure 15] FIG. 15 shows the map of the 6209 bp plasmid, pTR-SB-VMD2-HBest1-shRNA05, which contains the resistant Best1. [Figure 16] FIG. 16 shows a map of the 6145 bp plasmid, pTR-SB-VMD2-DTBest1-shRNA744, containing detargeted Best1. [Figure 17]Figure 17 shows that the VMD2 promoter functions well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using the chicken beta actin promoter (CBA) or the VMD2 promoter. Protein lysates were separated on polyacrylamide gels, and the expression of bestrophin (Best1) was detected by Western blot and normalized to the expression of beta tubulin to show uniform loading of the gel.

[0029] [Figure 18A-B] Figures 18A-18B show that Best1-specific siRNA is functional. Band intensities shown in Western blot (Figure 18A) and quantified in bar graph (Figure 18B) show that transfection of HEK293T stably expressing BEST1 resulted in a 75% reduction in bestrophin (Best1) protein. [Figure 19A-B] 19A-19B show that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the indicated plasmids. [Figure 20] Figure 20 shows detargeting of Best1. A silent mutation (a base change at the third position of the codon) was used to remove the siRNA target site from Best1 mRNA. The example disclosed is for shRNA744. SEQ ID NOs: 15-17 correspond to the following sequences from top to bottom: wild type BEST1 target site; (complementary) shRNA744 target site, and detargeted DTBEST1 siRNA target site.

[0030] Detailed Description Aspects of the application provide methods and compositions that are useful for treating Best's disease in a subject (e.g., a human subject having Best's disease). In some embodiments, the disclosure provides a method and composition for delivering functional bestrophin protein to a subject having one or more mutated BEST1 genes. In some embodiments, a recombinant BEST1 gene (e.g., a coding sequence, e.g., a cDNA or an open reading frame) is provided on a viral vector (e.g., an rAAV vector). In some embodiments, the expression of one or both alleles of the endogenous BEST1 gene is also knocked down. For example, in some embodiments, an siRNA (e.g., an shRNA) is delivered to a subject together with the recombinant BEST1 gene. In some embodiments, a viral vector (e.g., an rAAV vector) encodes both a recombinant BEST1 gene and one or more siRNAs that target the endogenous BEST1 gene. In some embodiments, the recombinant BEST1 gene is modified to include one or more nucleotide substitutions that confer resistance to targeting by one or more siRNAs. In some embodiments, the recombinant BEST1 gene is codon-optimized (e.g., for expression in a subject, e.g., a human subject).

[0031] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:2), an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO:7). In other embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO:6), an antisense strand comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO:5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO:8). In some embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising an antisense strand that comprises the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3).

[0032] In some embodiments, the shRNA can be delivered using a vector as the shRNA driven by a promoter (e.g., human H1 RNA promoter). In some embodiments, the vector is a plasmid. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the vector is a double-stranded or self-complementary AAV vector. In some embodiments, the vector sequence encoding the shRNA comprises a BEST1 sequence. Thus, in some embodiments, the shRNA comprises the sequence TTCAAGAGA It can be encoded on a DNA vector (e.g., a viral vector) by a nucleic acid having the sequence ACACTGTGAAGCTTTGACG (SEQ ID NO: 18) (loop sequence underlined). In some embodiments, various loop sequences are substituted for the loop sequence shown in SEQ ID NO: 7.

[0033] Also, in some embodiments, the shRNA is CTCGAG It can be encoded on a DNA vector (e.g., a viral vector) by a nucleic acid having the sequence AAGAACTCGCCATATAGCAGC (SEQ ID NO: 19) (loop sequence underlined). In some embodiments, various loop sequences are substituted for the loop sequence shown in SEQ ID NO: 8. In some embodiments, the same vector contains a coding sequence that encodes a normal (eg, wild-type) Best1 protein but is resistant to the action of an shRNA expressed by the vector.

[0034] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:9. In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10. In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 11.

[0035] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:15. The wild type BEST1 sequence of 1757 bp is defined as follows (SEQ ID NO: 9): [ka]

[0036] In some embodiments, the BEST1 coding sequence includes a short detargeting sequence that corresponds to a region of the wild-type BEST1 gene. An exemplary detargeting sequence that can be used with the vector sequence encoding the shRNA744 sequence is defined as follows (SEQ ID NO: 10): CTACTGTACGGAGAATTTCT.

[0037] Other nucleotide substitutions can be made to detarget the BEST1 sequence.For example, in some embodiments, detargeting sequences are located at various positions on the BEST1 coding sequence and correspond to various regions of wild-type BEST1 gene.An exemplary detargeting sequence that can be used with the vector sequence encoding shRNA05 sequence is defined as follows (SEQ ID NO:11): CCAGCAAGCTGCACAGCGT.

[0038] In some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising the sequence of SEQ ID NO:1 (and / or its complement) is transcribed in a host cell (e.g., in a subject, e.g., in a human subject) treated with the vector. In some embodiments, two or more different shRNAs (e.g., having different start and / or stop sites, e.g., differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in the host cell.

[0039] In some embodiments, the BEST1 coding sequence is driven by a promoter (e.g., the human opsin proximal promoter). In some embodiments, the promoter comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:12 below.

[0040] In some embodiments, the promoter driving the shRNA expression comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 13 below. In some embodiments, the promoter driving the shRNA expression comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14 below.

[0041] An exemplary promoter sequence is as follows: VMD2 promoter, 623 bp fragment (SEQ ID NO: 12) [ka]

[0042] H1 promoter (SEQ ID NO: 13) [ka] U6 promoter (SEQ ID NO: 14) [ka]

[0043] In some embodiments, the BEST1 coding sequence is in a vector, such as an AAV vector or a plasmid. In some embodiments, the vectors described herein comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the detargeted BEST1 sequence, SEQ ID NO:10.

[0044] In some embodiments, a vector encoding a functional BEST1 sequence is provided to complement or correct (e.g., at least partially) BEST1 function in a cell without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, vectors encoding functional BEST1 sequence and shRNA sequence are provided to complement or correct (for example, at least partially) cell BEST1 function and knock down endogenous BEST1 gene expression. In some embodiments, endogenous BEST1 expression is knocked down using shRNA. In some embodiments, BEST1 sequence is codon-optimized. In some embodiments, BEST1 sequence is modified to be shRNA-resistant. In some embodiments, BEST1 and shRNA sequence are encoded on the same AAV vector.

[0045] In some embodiments, the disclosure provides a method of regulating BEST1 expression in a subject, the method comprising administering to a subject, such as a human subject, a composition comprising a vector or rAAV particle and a pharma- ceutically acceptable carrier. In some aspects, the disclosure provides a method of treating a bestrophinopathy (e.g., Best's disease and ARB) in a subject, the method comprising administering a composition.

[0046] In some embodiments, the disclosure provides compositions for use in treating Best's disease, and compositions for use in the manufacture of a medicament for treating Best's disease. In some aspects, the disclosure provides compositions comprising a vector or rAAV particle for use in treating an ARB, where the vector encodes a functional BEST1 sequence, and compositions for use in the manufacture of a medicament for treating an ARB.

[0047] Aspects of the disclosure relate to recombinant adeno-associated virus (rAAV) particles for delivery of the rAAV vectors described herein (e.g., encoding shRNA and / or substituted BEST1) to various tissues, organs, and / or cells. In some embodiments, the rAAV particles comprise capsid proteins described herein, e.g., AAV2 capsid proteins. In some embodiments, the vector contained within the rAAV particle encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO:1) and comprises a substituted BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO:10).

[0048] The recombinant AAV (rAAV) vector contained within the rAAV particle may include at least (a) one or more heterologous nucleic acid regions (e.g., encoding an shRNA and / or Best1 protein) and (b) one or more regions including an inverted terminal repeat (ITR) sequence (e.g., a wild-type ITR sequence or an engineered ITR sequence) flanking the one or more heterologous nucleic acid regions (or transgenes). In some embodiments, the heterologous nucleic acid region encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO:3) and includes a substituted BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO:10). In some embodiments, the rAAV vector is between 4 kb and 5 kb in size (e.g., 4.2-4.7 kb in size). The rAAV vector may be encapsidated by a viral capsid, such as an AAV2 capsid. In some embodiments, the rAAV vector is single-stranded. In some embodiments, the rAAV vector is double-stranded. In some embodiments, a double-stranded rAAV vector can be a self-complementary vector, e.g., that contains a region of the vector that is complementary to another region of the vector, initiating the formation of a double strand of the vector.

[0049] As disclosed herein, analysis of Best1 constructs with targeted mutations showed that loss of apical microvilli of the retinal pigment epithelium and resulting retinal microdetachment represent the earliest hallmarks of canine bestrophinopathy. The retina expands in light exposure and contracts in dark adaptation, resulting in microdetachment. Subretinal adeno-associated virus-based gene therapy corrects both the vitellogenic lesions and the light-modulated microdetachment.

[0050] Studies of molecular pathology in a canine BEST1 disease model revealed retinal-wide abnormalities at the RPE-PR interface associated with defects in the RPE microvillar ensheathment and cone PR-associated insoluble interphotoreceptor matrix. In vivo imaging demonstrated retinal-wide RPE-PR microdetachments that contracted with dark adaptation and expanded upon exposure to moderate light intensity. Subretinal BEST1 gene enhancement treatment using adeno-associated virus 2 reversed not only clinically detectable subretinal lesions but also diffuse microdetachments. Immunohistochemical analysis showed correction of structural alterations at the RPE-PR interface in areas with BEST1 transgene expression. Successful treatment efficacy was observed with a coverage of 0.1 × 10 per mL. 11 ~5×10 11 A vector titer of 10 ...

[0051] As further disclosed herein, it has been discovered that adeno-associated virus (AAV)2-mediated BEST1 gene augmentation corrects this primary asymptomatic defect as well as the disease.

[0052] The rAAV particles can be of any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, or 2 / 9). As used herein, the serotype of the rAAV particles refers to the serotype of the capsid protein. In some embodiments, the rAAV particles are AAV2. Non-limiting examples of derivatives and pseudotypes include rAAV2 / 1, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6 .2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShH10, AAV2(Y→F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A1, Schaffer DV, Samulski RJ.). In some embodiments, the rAAV particle is a pseudotyped rAAV particle that includes (a) a nucleic acid vector that includes ITRs from one serotype (e.g., AAV2), and (b) a capsid composed of capsid proteins from another serotype (e.g., AAV5).Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).

[0053] Methods for producing rAAV particles and vectors are also known in the art and commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Nos. US 2007 / 0015238 and US 2012 / 0322861, which are incorporated herein by reference, and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing an rAAV vector can be combined with one or more helper plasmids containing, for example, the rep genes (encoding, for example, Rep78, Rep68, Rep52 and Rep40) and the cap genes (encoding, for example, VP1, VP2, and VP3 (including the modified VP3 regions described herein)) and transfected into a producer cell line such that the rAAV particles can be packaged and subsequently purified.

[0054] In some embodiments, the one or more helper plasmids include a first helper plasmid that includes the rep and cap genes (e.g., encoding the rAAV capsid proteins described herein), and a second helper plasmid that includes the E1a, E1b, E4, E2a, and VA genes. In some embodiments, the rep gene is from AAV2 and the cap gene is from AAV2 and can include modifications to the gene to produce the modified capsid proteins described herein. Helper plasmids, and methods for making such plasmids, are known in the art and commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from PlasmidFactory (Bielefeld, Germany); other products and services available from Vector Biolabs (Philadelphia, PA); Cellbiolabs (San Diego, CA); Agilent Technologies (Santa Clara, Ca); and Addgene (Cambridge, MA); pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081.;Grimm et al.(2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy,Vol. 7, 839-850;Kronenberg et al. (2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296-5303;およびMoullier, P. and Snyder, R.O. (2008), International efforts for recombinant adeno-associated viral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188)。.

[0055] Exemplary, non-limiting rAAV particle production methods are described below. One or more helper plasmids are produced or obtained, which contain the rep and cap ORFs of the desired AAV serotype and the adenovirus VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters. The cap ORF may also contain one or more modifications to produce modified capsid proteins as described herein. HEK293 cells (available from ATCC®) are transfected with the helper plasmid(s) and a plasmid containing a heterologous nucleic acid vector as described herein (for example, a plasmid containing a heterologous nucleic acid containing a wild-type or mutant cBEST1 or hBEST1 gene as shown in Figures 13, 14, 15, or 16) via CaPO4-mediated transfection, lipids, or polymer molecules such as polyethyleneimine (PEI). The HEK293 cells are then incubated for at least 60 hours to allow for the production of rAAV particles. Alternatively, in another example, an Sf9-based producer stable cell line is infected with a single recombinant baculovirus containing the nucleic acid vector. As a further alternative, in another example, an HEK293 or BHK cell line is infected with an HSV containing the nucleic acid vector, and optionally with one or more helper HSVs containing the adenovirus VA, E2A (DBP), and E4 genes under the transcriptional control of the rep and cap ORFs and their native promoters described herein. The HEK293, BHK, or Sf9 cells are then incubated for at least 60 hours to allow the production of rAAV particles. The rAAV particles can then be purified using any method known in the art or described herein, for example, by iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.

[0056] The disclosure also contemplates a host cell comprising the shRNA, vector, or rAAV particle described herein. Such host cells include mammalian host cells, preferably human host cells, and can be isolated, for example, in cell or tissue culture. In some embodiments, the host cell is an ocular cell. In some aspects, the disclosure provides formulations of one or more rAAV-based compositions disclosed herein in a pharma- ceutically acceptable solution for administration to a cell or animal, and in particular for the treatment of human cells, tissues, and diseases that occur in humans, alone or in combination with one or more other modalities of treatment.

[0057] Thus, in some embodiments, a composition is provided that includes the shRNA, vector, or rAAV particle described herein, and optionally a pharma- ceutically acceptable carrier. In some embodiments, the composition described herein can be administered to a subject in need of treatment. In some embodiments, the subject has or is suspected of having one or more brain and / or eye conditions, diseases, or disorders (e.g., Best's disease). In some embodiments, the subject has or is suspected of having one or more conditions, diseases, and disorders (e.g., Best's disease) disclosed herein. In some embodiments, the subject has one or more endogenous mutant BEST1 alleles (e.g., associated with or causing eye or retinal diseases or disorders). In some embodiments, the subject has at least one autosomal dominant mutant BEST1 allele (e.g., that causes Best's disease). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human animal of the primate order. Non-limiting examples of non-human animal subjects of the primate order include macaques (e.g., cynomolgus or rhesus monkeys), marmosets, tamarins, spider monkeys, night monkeys, savannah monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. Other exemplary subjects include domesticated animals such as dogs and cats, farm animals such as horses, cows, pigs, sheep, goats, and chickens, and other animals such as mice, rats, guinea pigs, and hamsters.

[0058] In some embodiments, the dose of rAAV particles administered to a cell or subject is 10 6 ~10 14 particles / mL or 10 3 ~10 15 on the order of particles / mL, or any value therebetween in any range (e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In one embodiment, the concentration may be 10 13 In some embodiments, the dose of rAAV particles administered to the subject is greater than 10 particles / mL. 6 ~10 14 Vector genomes (vg) / mL or 10 3 ~10 15 vg / mL, or any value therebetween in any range (e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In one embodiment, the concentration may be 10 13 More than 10 ...

[0059] In some embodiments, the rAAV particle titer is 1×10 10 ~5×10 13In some embodiments, the rAAV particle titer is in the range of about 1×10 10 , 2.5×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 2.5×10 11 , 5×10 11 , 1×10 12 , 2.5×10 12 , 5×10 12 , 1×10 13 , 2.5×10 13 , or 5 × 10 13 In some embodiments, the particle titer can be 1×10 10 In some embodiments, the rAAV particle titer is less than 1×10 15 In some embodiments, the rAAV particle titer is greater than 5×10 13 In a specific embodiment, the rAAV particle titer is greater than about 2×10 11 or 2.5×10 11 In some embodiments, the rAAV particles are administered (e.g., subretinally or intravitreally) via methods further described herein.

[0060] The rAAV particles can be administered as a single dose or divided into two or more doses as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, 1 to 500 microliters of the composition described in the present application (including, for example, rAAV particles) is administered to one or both eyes of the subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters can be administered to each eye. However, it should be understood that in some embodiments, lesser or greater amounts can be administered.

[0061] If necessary, the rAAV particles or nucleic acid vectors may be administered in combination with other agents, such as proteins or polypeptides or various pharma- ceutically active agents (including systemic or local administration of one or more of a therapeutic polypeptide, biologically active fragment, or variant thereof). Indeed, there is virtually no limit to the other components that may be included, given that the additional agents do not cause significant adverse effects upon contact with target cells or host tissues. Thus, the rAAV particles may be delivered with a variety of other agents, as required in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.

[0062] In another aspect, the disclosure provides formulations of one or more plasmids encoding the shRNAs disclosed herein in a pharma- ceutically acceptable solution for administration to cells or animals, and in particular for the treatment of human cells, tissues, and diseases occurring in humans, alone or in combination with one or more other modalities of treatment. The disclosure also provides methods of administration of the plasmids encoding the shRNAs disclosed herein. Exemplary methods include methods of administration of the plasmids to mammals (e.g., humans).

[0063] In some embodiments, the disclosed plasmid formulations for administration to a mammal (e.g., a human) comprise a DNA plasmid vector in phosphate buffered saline (PBS). The concentration of the vector can be between 1 mg / ml and 3 mg / ml. In some embodiments, the concentration is about 2 mg / ml. In other embodiments, the concentration is about 1.6 mg / ml, about 1.7 mg / ml, about 1.75 mg / ml, about 1.8 mg / ml, about 1.85 mg / ml, about 1.9 mg / ml, about 1.95 mg / ml, about 2.05 mg / ml, about 2.1 mg / ml, or about 2.15 mg / ml.

[0064] The formulation of pharma- ceutically acceptable excipients and carrier solutions will be well known to those of skill in the art, as will the development of appropriate dosing and treatment regimens for use with the particular compositions described herein in a variety of treatment regimens, including, by way of example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administrations and formulations.

[0065] Typically, these formulations will contain at least about 0.1% of a therapeutic agent (e.g., rAAV particles or plasmids) or more, although the percentage of active ingredient(s) may of course vary and may conveniently be between about 1 or 2% and about 70% or 80% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent(s) (e.g., rAAV particles) in each therapeutically useful composition may be adjusted to obtain a suitable dosage in any given unit dose of compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be taken into account by those skilled in the art of preparing such pharmaceutical formulations, and therefore various dosages and treatment regimens may be desired.

[0066] In certain situations, it may be desirable to deliver the shRNA, vector, or rAAV particles described herein in a suitably formulated pharmaceutical composition as disclosed herein, either subcutaneously, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, orally or nasally, or by direct injection into one or more cells, tissues, or organs.

[0067] Pharmaceutical forms of compositions suitable for injectable use (including, for example, shRNA, vectors, or rAAV particles described herein) include sterile aqueous solutions or dispersions. In some embodiments, the forms are sterile and fluid to the extent that easy syringability exists. In some embodiments, the forms are stable under the conditions of manufacture and storage and are preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, saline, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0068] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the shRNA, vector, or rAAV particle described herein is administered. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum-based oils such as mineral oil, vegetable oils such as peanut oil, soybean oil, and sesame oil, animal oils, or synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers.

[0069] The compositions of the present disclosure can be delivered to the eye through various routes. They can be delivered intraocularly by topical application to the eye or by intraocular injection, for example, into the vitreous (intravitreal injection) or subretinal (subretinal injection) interphotoreceptor space. In some embodiments, they are delivered to rod photoreceptor cells. Alternatively, they can be delivered locally by insertion or injection into tissues surrounding the eye. They can be delivered systemically through oral routes or by subcutaneous, intravenous, or intramuscular injection. Alternatively, they can be delivered using a catheter or using an implant, such as a porous, non-porous, or gelatinous material, including membranes such as silastic membranes or fibers, biodegradable polymers, or proteinaceous materials. They can be administered before the onset of symptoms, for example, during eye surgery, or immediately after the onset of a pathology, or during the onset of acute or long-term symptoms to prevent their onset.

[0070] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered if necessary, and the liquid diluent is first made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous medium that can be used will be known to those skilled in the art in light of this disclosure. For example, one dosage can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion or injected at the proposed injection site (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Moreover, for administration for humans, preparations should meet sterility, pyrogenicity, and general safety and purity standards (e.g., as required by FDA Office of Biologics standards).

[0071] Sterile injection can be prepared by incorporating the shRNA, vector or rAAV particles described herein in the required amount in a suitable solvent with some other components listed above as necessary, followed by filtration sterilization.Generally, dispersion is prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains basic dispersion medium and other necessary components listed above.For the preparation of sterile powder for sterile injection, the preferred preparation method is vacuum drying and freeze-drying technology, which produces powder of active ingredient and any additional desired ingredients from the solution that has been previously sterile-filtered.

[0072] The amount of composition (including, for example, shRNA, vector, or rAAV particles described herein) and the administration time of such composition are within the scope of a person skilled in the art having the benefit of the present teachings. However, administration of a therapeutically effective amount of the disclosed composition can be achieved by a single administration, such as, for example, a single injection of a sufficient number of rAAV particles to provide a therapeutic benefit to a patient undergoing such treatment. Alternatively, in some situations, it may be desirable to provide multiple or continuous administrations of the composition, either over a relatively short or a relatively long period of time, as can be determined by the physician supervising the administration of such composition.

[0073] In some embodiments, rod cells remain structurally intact and / or viable when silencing cellular BEST1 gene expression.In some embodiments, rod cells in which cellular BEST1 gene expression is silenced may have shortened outer segments that would normally contain BEST1.In some embodiments, the length of the outer segments can be maintained or restored (for example, partially or completely) using an exogenously added (hardened) BEST1 gene, whose expression is resistant to silencing using the compositions described in this application.

[0074] "Treating" a disease as the term is used herein means reducing the frequency or severity of at least one sign or symptom of a disease or disorder (e.g., Best's disease) experienced by a subject. The above compositions are typically administered to a subject in an effective amount, i.e., an amount capable of producing a desired result. The desired result will depend on the active agent administered. For example, an effective amount of rAAV particles can be the amount of particles capable of transferring heterologous nucleic acid to a host organ, tissue, or cell.

[0075] The toxicity and efficacy of the compositions utilized in the disclosed methods can be determined by standard pharmaceutical procedures using either cultured cells or experimental animals to determine the LD50 (the dose lethal to 50% of the population). The dose ratio between toxicity and therapeutic index of efficacy can be expressed as the ratio LD50 / ED50. Those compositions that exhibit large therapeutic indexes are preferred. Those that exhibit toxic side effects can also be used, but care should be taken to design a delivery system that minimizes the potential damage of such side effects. The dosage of the compositions described herein generally falls within a range that includes the ED50 with little or no toxicity. Dosage can vary within this range depending on the dosage form employed and the route of administration utilized.

[0076] Without further elaboration, it is believed that one skilled in the art can utilize the present disclosure to its fullest extent based on the above description. The following specific aspects are therefore to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way. All publications cited herein are incorporated by reference for the purpose or subject matter referenced herein.

[0077] example Example 1 Early global retinal pathology at the RPE-PR interface. To understand the pathophysiology behind impaired RPE-PR interactions, we evaluated cBest retinas with clinically evident disease. Key features of the RPE apical membrane involved in direct interaction with PR OS were examined by immunohistochemistry (IHC) for EZRIN, a membrane-cytoskeleton linker protein essential for the formation of RPE apical MVs, combined with human cone arrestin (hCAR) and peanut agglutinin lectin (PNA) labeling to distinguish the cone-PR matrix-specific interface. Confocal microscopy of wild-type (WT) retinas and analysis of 3D reconstructed images exposed a complex sheet-like structure of cone- and rod-associated MVs, both intrinsic components of the RPE apical membrane. Cone-MVs (also known as the RPE apical cone sheath) were more prominent than rod-MVs, forming a highly organized wrapping that connected individual cone outer segments (COS) to the RPE apical surface (Figure 1A). In the subretinal space, this intercellular complex was further enveloped by a similarly complex cone-specific insoluble extracellular matrix sheath (cone-IPM) detected by selective binding of PNA lectin (Figure 1A). However, in diseased cBest retinas, such complex extracellular compartmentalization of COS was lost, and the absence of a microvillar sheath was accompanied by enlarged RPE cells overloaded with lipofuscin granules and with impaired insoluble cone-IPM (Figure 1B). These findings were consistent with previous studies of three different cBEST1 genotypes (R25 * / R25 * , P463fs / P463fs, and R25 * / P463fs).

[0078] To evaluate the possibility that structural cone-MV abnormalities may be secondary to cone dysfunction and disease, we investigated RPE-COS interactions in different canine IRD models (primary cone photoreceptor channelopathy, CNGB3-related color vision deficiency). RPE-COS complexes were first examined at 6 weeks of age. CNGB3 mutant retinas containing either missense or locus deletion mutations did not show obvious irregularities at the RPE-PR interface, and proper localization of RPE apical markers was associated with specific anti-BEST1 labeling (Figure 6A and 6B). Double immunostaining showed a specific distribution of EZRIN along the cone-MVs interdigitating with hCAR-positive but CNGB3-negative COS. As a consequence of CNGB3 channel subunit dysfunction in older (57 and 85 weeks old) mutant retinas that gradually undergo cone PR degeneration, the RPE apical microvillar sheath was still found to remain largely intact (Figure 6C and 6D).

[0079] Findings in CNGB3 mutant retinas suggested that structural changes associated with the cone-MV sheath in cBest are not secondary to cone defects but are specific to RPE channelopathy caused by mutations in BEST1. The 6-week time point, well before the onset of clinical disease in dogs and near the end of postnatal retinal differentiation, was the focus of these experiments (Figures 1C and 1D). In contrast to age-matched WT controls, the lack of specific basolateral BEST1 immunolabeling in cBest RPE was associated with a rather smooth apical surface and apparently underdeveloped (vestigial) apical microvilli (Figure 1C, arrows). Quantification of the spatial density of cone-MVs and the length of cone-MVs and rod-MVs was performed on deconvolved 3D Z-stack projection images at four retinal locations (Figure 1D). Significant differences (P<0.0001) in the mean number of cone-MVs were found between cBest and WT in each retinal region examined (Figure 1D). Although the number of cone photoreceptors was comparable to controls, cBest cone-MVs were much fewer in number, more sparsely distributed, and appeared consistently shorter and much finer than controls, regardless of topographic location. In control (WT) eyes, the mean length of cone-MVs was 17.4 (±0.25) μm in the tapetum superior temporal quadrant and 12.3 (±0.23) μm in the inferior non-tapetal retina, whereas the length of rod-MVs was 6.7 (±0.11) μm and 5.3 (±0.27) μm in the tapetum and non-tapetal parts of the retina, respectively. However, in cBest, the mean length of the identified rare cone-MV extensions was significantly shortened (6.0 ± 0.31 and 6.5 ± 0.74 μm in the central tapetum and inferior non-tapetal parts, respectively). Quantitative assessment of fine rod-MVs in cBest exceeded the limits of optical resolution.

[0080] cBEST1 mutant eyes have total retinal microdetachments that expand with exposure to light. To determine the in vivo correlates of early RPE-PR interface abnormalities detected by IHC, noninvasive imaging with optical coherence tomography (OCT) was used to evaluate cBest eyes at a young age, well before ophthalmoscopic lesions were detected. Qualitatively, the central retina of all eyes evaluated showed an additional low-scattering layer in the outer retina located distal to the outer nuclear layer (ONL) that was not detectable in WT eyes (Figure 2A, arrow and double arrow). Unexpectedly, the low-scattering layer varied across repeated recordings in the same eye within a single experimental session. Further analysis revealed that the width of the low-scattering layer was wider in scans obtained towards the end of the imaging session when the retina was exposed to greater retinal irradiance due to intervening autofluorescence imaging performed with bright short-wavelength light (Figure 2A, double arrow, more LA). The width of the low-scattering layer was smaller in scans obtained earlier in the imaging session, before autofluorescence imaging was performed (Figure 2A, arrow, less LA).

[0081] Quantitative studies were performed by acquiring longitudinal reflectance profiles and performing measurements at both nasal and temporal retinal locations. WT eyes (n = 12, 15-17 weeks old) showed outer retinal high-scattering peaks in the outer plexiform layer (OPL) and external limiting membrane (ELM), with an intervening low-scattering layer defined as the ONL (Figure 2B). Distal to the ELM was a high-scattering peak corresponding to the junction between the inner and outer segments of photoreceptors (IS / OS), a major peak occurring near the RPE-tapetum interface (RPE / T), and a few intervening high-scattering peaks corresponding to the photoreceptor OS tips (which are often difficult to resolve) (Figure 2B). An abnormal low-scattering layer (Figure 2B, arrow) was detectable in cBest eyes (n = 6, 11 weeks old) at lower exposures. At greater exposures, the low-scattering layer became deeper and more distinct (Figure 2B, double arrow). Both nasal and temporal retinal locations showed the same effect. The distance between the IS / OS peak and the RPE / T peak (Figures 2A and 2B, arrows) was measured. In WT eyes, the distance was 41.3 (±4.5) μm, whereas in cBest eyes, this distance was significantly greater (P<0.001) at 46.8 (±6.7) μm and 45.2 (±6.8) μm (lower exposure) and 55.8 (±10.5) μm and 53.5 (±6.3) μm (higher exposure) for the nasal and temporal retinal regions, respectively (Figure 2C).

[0082] To better understand the low-scattering layer thickness as a function of light exposure, two types of experiments were performed. In the main experiment (WT, n = 12, 15-17 weeks old; cBest, n = 3, 13 weeks old), eyes were dark-adapted overnight and then imaged sequentially in the dark over 2 h with five intervening brief 488 nm exposures of gradually increasing intensity, ranging from extremely dim to moderate light produced by standard clinical ophthalmic equipment (Figure 2D). In the shorter experimental protocol, only the two highest exposures were used in different eyes (cBest, n = 3, 13 weeks old). After overnight dark adaptation, IS / OS-RPE / T distances were 40.0 (± 4.5) μm in WT eyes, but 47.1 (± 4.8) μm in cBest eyes (Figure 2E). The difference was statistically significant (P < 0.001). Increasingly brighter light exposure resulted in a monotonic widening of the IS / OS-RPE / T distance in cBest eyes, reaching an apparent plateau of 59.4 (± 8.7) μm (Figure 2E). In WT eyes, the effect of light exposure was either negligible or small, with the IS / OS-RPE / T distance reaching a plateau of 40.9 (± 4.3) μm. Thus, light exposure appeared to cause acute retinal microdetachments of up to 18.4 (± 8.7) μm in cBest eyes within minutes at an age before any detectable ophthalmoscopic findings. Light-mediated microdetachments resolved over a period of less than 24 h (Figure 7).

[0083] In preparation for local gene therapy, the retinal site distribution of light-driven microdetachments was assessed in fully light-adapted cBest and WT eyes (Figure 2F). The mean IS / OS-RPE / T distance across WT eyes (n=4, 104 weeks old) was relatively uniform in the superior and inferior retinal regions, with a clear boundary corresponding to the transition between tapetal retina and pigmented (non-tapetal) retina. The greater distance in the tapetal retina in WT eyes could be due to differences in the primary contributing factors to the high scattering peak (tapetal vs. pigmented RPE in tapetal retina ... *In the 12-week-old cBest eye (P463fs / P463fs), in addition to the grossly obvious retinal detachment in the foveal-like region, there was relatively diffuse global retinal microdetachment (Figure 2F, shown in darker colors). In the 12-week-old young cBest eye (P463fs / P463fs), no ophthalmoscopic abnormalities were evident, but there was a clear band of large microdetachment along the visual streak and surrounding the optic nerve head. Difference maps between mutant eyes and the average WT showed the spatial distribution of the extent of microdetachment (Figure 2F, right).

[0084] To assess potential adverse events to photoreceptors, ONL thickness was topographically mapped across retinal regions with microdetachments (Figures 8A and 8B). Microdetachments did not result in ONL thinning as expected from photoreceptor degeneration. Instead, the ONL in cBest tended to be more uniformly thicker than in WT. The hyperthickened regions typically involved the central-superior tapetal retina but sometimes extended into the inferior non-tapetal retina (Figure 8A). Importantly, the hyperthickened regions of ONL had comparable numbers of PR nuclei to controls when examined microscopically. This suggests an expansion of the internuclear spacing as a possible cause of the hyperthickened ONL observed by imaging.

[0085] The natural history of canine bestrophinopathies. As a prerequisite for evaluating the outcome of gene therapy, the natural history of cBest was determined in a group of 18 dogs [12 males (M) and 6 females (F); range 6–297 weeks of age] (Table 1). cBest dogs were serially monitored by ophthalmoscopy and noninvasive imaging to detect the earliest disease onset and understand disease progression. Based on systematic in vivo imaging, the first disease signs were detected as early as 11 weeks of age (mean age 15 weeks) as a slight focal retinal prominence in the foveal-like area of ​​the dog (Figure 9A). This discrete separation of the photoreceptor layer from the underlying RPE progressed to form a larger subretinal macrodetachment (vitellogenic lesion), evident in the en face and in the corresponding OCT scan at 23 weeks of age (Figure 9B). This discrete RPE-PR detachment in cross-sectional imaging, although less noticeable in en face imaging, was found to be consistent among the examined cBest eyes (n=34), regardless of genotype. From the asymptomatic stage, the disease progressed to form macrodetachments (vitelliform stage) confined to the canine fovea and surrounded by microdetachments (Figure 3A, left panel). The primary lesion gradually evolved to appear as a characteristic bullous detachment within the retinal foveal field, including a foveal-like region (Figure 3A, middle and right panels, and Figures 9B-9D). The presence of characteristic hyperautofluorescence was evident in the lower part of the lesion (Figure 3A, middle inset panel; pseudohypopyon stage). Advanced disease stages were associated with a significant thinning of the ONL, with partial uptake and dispersion of the hyperautofluorescent material within the central lesion (Figures 9E and 9F).

[0086] In all cases, serial imaging ensued (Table 1) and cBest appeared bilaterally, with variable rates of progression but almost always with remarkable symmetry (Figure 3A and Figures 9A-9F). Total retinal detachments visible ophthalmoscopically in both eyes either remained confined to the central retina or became more extensive with extracentral disease scattered throughout, still with a strong bias toward central cone-rich areas and associated with an ultrathick ONL. [Table 1-1] [Table 1-2] [Table 1-3]

[0087] Key: BSS, balanced salt solution; cBEST1, canine transgene; hBEST1, human transgene; Inj., injected; OD, right eye; OS, left eye; OU, bilateral; pi, post-injection; UnTx, untreated; vg, vector genome; WT, wild type. cBEST1 mutation: R25 * / R25 * , p.Arg25Ter- homozygote; P463fs / P463fs, p.Pro463fs- homozygote; R25 * / P463fs, p.Arg25Ter / p.Pro463fs compound heterozygote.

[0088] Subretinal BEST1 gene augmentation therapy stably corrects the disease. To evaluate the proof-of-concept of AAV2-mediated subretinal gene augmentation therapy, 22 cBest eyes were injected at 27–69 weeks with canine (cBEST1) or human (hBEST1) transgenes driven by the human VMD2 promoter [0.1–5 × 10 11 vector genomes (vg) / mL range of vector titers or balanced salt solution (BSS) control] (Table 1). Maps of exemplary AAV vectors containing hBEST1 and cBEST1 heterologous nucleic acids used to generate the disclosed rAAV particles are shown in Figures 13 and 14, respectively. cBest dogs exhibiting various stages of focal or multifocal retinal detachment were either injected unilaterally with AAV and not the other eye, or injected with AAV in one eye and a control (BSS) injection in the other eye. Three cases presenting with multifocal disease were injected bilaterally with AAV targeting the superior temporal quadrant, while retinal areas outside the surgical bleb served as internal controls (Table 1).

[0089] Representative results show that compound heterozygotes (R25 *AAV-BEST1-treated eyes were injected with AAV-BEST1 in one eye (P463fs) (Figure 3B, left panel) but not in the other eye (EM356-OS) (Figure 9A-9F). Both eyes were monitored clinically and by in vivo imaging. Disease reversal was first evident in the injected eye at 4 weeks post-injection (pi) and retained a sustained effect over time, as shown at 43 and 245 weeks pi (Figure 3B). In this and other cases of progressive disease that showed extensive accumulation of autofluorescent material within subretinal macrodetachments (n=13 eyes), the hyperautofluorescent signal was still detectable for several months after AAV injection but gradually weakened over time (Figure 3B, inset panel). Based on noninvasive imaging, both focal lesions within the AAV-BEST1-treated area as well as extracentral lesions resolved by 4-12 weeks pi, and localized retinal reattachment remained stable thereafter (Table 1). There was no evidence of an inflammatory response in any of the AAV-treated eyes, and longitudinal in vivo evaluation did not reveal any adverse effects on the RPE or neural retina.

[0090] AAV-mediated treatment with hBEST1 also resulted in reversal of lesions and long-term disease correction (n=13 eyes). * / R25 * Representative in vivo imaging results and IHC evaluation (Figures 3C and 3D) from a study eye (EMC3-OS) show that the initial bilateral lesions present before treatment were reduced by the administration of AAV-hBEST1 (2 × 10 11We showed that the lesions in the contralateral control eye (EMC3-OD) injected with BSS disappeared after treatment with 100 mg / mL of erythropoietin (vg / mL) (Figure 3D), whereas the lesions in the contralateral control eye (EMC3-OD) injected with BSS continued to expand (Figure 3C). Based on fundus examination, in the described case as well as all other cases, the transient retinal detachment associated with vector or BSS delivery resolved within 24-48 hours p.i. However, the BSS-injected retinal lesions recurred as early as 1 week p.i. and progressed in line with the natural disease course (Figure 3C). This was in sharp contrast to the AAV-treated eye, in which both early and more advanced lesions resolved within the first 6 weeks after hBEST1 gene therapy and the treated areas remained disease-free thereafter (Figure 3D). Ophthalmic examination and IHC evaluation using RPE- and PR-specific markers showed no adverse effects on the retina up to 207 weeks p.i. (Figures 3, 10 and 11). Of particular importance, evaluation of retinal preservation pi revealed a striking restoration of retinal architecture at the RPE-PR interface, including expansion of cone-MVs and actin cytoskeleton rescue, which corresponds to bleb regions treated with vectors bearing either the canine or human BEST1 transgene (Figures 3C and 3D, bottom panels and Figures 10 and 11). No differences were observed in the clinical picture or response to AAV-BEST1 treatment between the sexes.

[0091] The retinas were significantly higher in the three cBest models [cmr1(R25 * / R25 * ), cmr1 / cmr3(R25 * The cBest eye was then treated with AAV-hBEST1 (2 × 10 11vg / mL) and evaluated by IHC at 103, 51, or 207 weeks pi, respectively (Figure 10). No obvious abnormalities were detected within the treated areas up to 207 weeks pi. Note the RPE apical expansion protruding into the subretinal space in all treated eyes (EZRIN). Untreated cBest controls (far right panel) show absence of RPE apical microvilli, RPE hypertrophy (EZRIN, RPE65), and accumulation of lipofuscin granules within the RPE monolayer along with autofluorescent deposits in the subretinal space.

[0092] Representative confocal micrographs are taken from a 10-well plate containing 100 μg / mL of AAV-hBEST1 injected mice (2.5 × 10 11 vg / mL) at 79 weeks cBest (R25 * A cross-sectional overview from the surgical bleb area (Figure 11B), through the adjacent border zone area (Figure 11C), and towards the adjacent area outside the injection zone (Figure 11D) is shown in Figures 11B-11D. As highlighted in the magnified images, a direct correlation was observed between the degree of restoration of the RPE-PR interface structure and the expression of the BEST1 transgene. We observed a marked expansion of RPE apical processes within the treated area with enhanced BEST1 (Figure 11B); patchy distribution of BEST1 (weak red signal within individual RPE cells) and presence of vestigial microvilli [c-MVs (light arrows) and rod-MVs (darker arrows)] in the bleb border zone associated with RPE-PR microdetachment (Figure 11C); and formation of subretinal lesions in the absence of both BEST1 expression and RPE apical processes outside the treated zone (Figure 11D). A scalloped, less elaborated RPE apical surface and abundant intracellular deposits appeared as granular aggregates within cBest mutant RPE (Figure 11A, top panel, non-injected; Figure 11D, enlarged). In the detached zone, cellular debris (asterisks) burrowing into the subretinal space correspond to Müller glia and reflect retinal remodeling in response to stress. [Scale bars, 100 μm (top) and 10 μm (Figures 11A-11D).]

[0093] Photoregulated microablation correction by gene therapy. To understand the outcome of BEST1 gene augmentation therapy on retinal areas without ophthalmoscopically detectable retinal detachment, IS / OS-RPE / T distances were measured topographically both within and outside the subretinal bleb. 。 cBest(R25 * Representative results from control subretinal BSS injections at 69 weeks of age in (P463fs) dogs showed uniform microdetachments covering all retinas imaged at 87 weeks of age (Figure 4A). The mean microdetachment extent (IS / OS-RPE / T distance in BSS-injected mutant dogs subtracted from colocalization measurements performed in WT eyes) was 11.6 μm in the superior retina and 16.7 μm in the inferior retina (Figure 4B), consistent with uninjected cBest eyes. On the other hand, subretinal AAV gene therapy resulted in a significant shortening of the IS / OS-RPE / T distance in the treated area. EMC3-OS, EML4-OS, and LH21-OS were approximately 2 × 10 11 Results are shown for the three genotypes treated with gene therapy using the human BEST1 transgene with a titer of 10 ...

[0094] The effective area of ​​subretinal gene therapy has often been shown to extend beyond the bleb formed at the time of surgery and include border zone areas. In the cBest dog that was successfully gene-treated, there was also a border zone area, but it appeared qualitatively larger than what has typically been encountered thus far (Figure 4A). In some of the most extreme cases, a pretreatment map of microdetachment throughout the retina was found to be necessary to show the extent of border zone extension. For example, EML9-OD showed whole-retinal microdetachment at 29 weeks of age, most extreme along the line of sight, including several areas with total retinal detachment (Figure 4C). Gene therapy was performed at 69 weeks. At 87 weeks, microdetachment throughout the imaged retina, as well as the majority of total retinal detachment, had resolved (Figure 4C), and quantitative measurements showed normal or thinner IS / OS-RPE / T distances in superior and inferior retinal locations (Figure 4D). Importantly, IS / OS-RPE / T distances showed significant improvement in retinal locations corresponding to the bleb formed at the time of injection, as well as in nasal retinal control areas of the same eyes. This extreme example of border zone expansion may be explained by a greater diffusion of the vector through the microdetachments in cBest eyes, which resulted in transduction of the RPE at sites substantially more distant than in the initial bleb. For comparison, a more typical example using delimited border zone expansion is shown. EML13-OS at 37 weeks of age showed microdetachments throughout the retina, which were particularly prominent in the temporal retina and along the line of sight; there were also some total retinal detachments along the line of sight (Figure 4E). Gene therapy was performed at 45 weeks of age. At 81 weeks of age, both the temporal retina above and below the optic nerve were devoid of microdetachments and macrodetachments, whereas the untreated nasal retina retained microdetachments and formed numerous macrodetachments (Figure 4E). Quantitative results confirmed the treatment effect, which, unlike EML9-OD, did not reach the nasal retina (Figure 4F).

[0095] To understand the potential outcomes of gene therapy for retinal degeneration, ONL thickness was mapped across treated eyes (Figure 8B). Treated retinal areas showing disappearance of microdetachments also tended to correspond to normal ONL thickness, whereas untreated areas retaining microdetachments tended to show hyperthick or normal, or in some areas, thinned ONL (Figure 8B). In summary, AAV-mediated gene augmentation therapy in canine bestrophinopathy appears to promote sustained reversal of total retinal detachment, re-establishment of close contact between the RPE and PR, and return of ONL thickness to normal values.

[0096] Human autosomal recessive bestrophinopathy: structure and function. To facilitate clinical translation of successful gene therapy in BEST1 mutant dogs, we performed a study to better understand the human pathophysiology of autosomal recessive bestrophinopathy (ARB) and to gain insight into the distribution of disease throughout the retina beyond the previously described ophthalmoscopically detectable gross lesions. Data from two patients are shown (Figure 5A-5G): P1 was a 39-year-old female with a biallelic BEST1 mutation (c.341T>C / c.400C>G) and a best-corrected visual acuity of 20 / 100, whereas P2 was a 36-year-old male with a biallelic mutation in BEST1 (c.95T>C / c.102C>T) and a best-corrected visual acuity of 20 / 60. In both patients, the mutant alleles segregated with the clinically unaffected parent. Ultra-wide imaging of RPE health utilizing the natural autofluorescence of the lipofuscin granules they contain demonstrated widespread and abundant abnormalities consisting of areas of relative high or low autofluorescence and focal heterogeneity. Of note, there was a clear transition zone ( Fig. 5A , arrows) in the nasal mid-peripheral retina that distinguished the healthier nasal peripheral retina.

[0097] Rod and cone function was sampled at high density along the horizontal meridian to better understand the tissue distribution of vision loss and its response to retinal structural abnormalities. Both patients showed profound (>3log) loss of rod-mediated sensitivity in the central part of the long-term dark-adapted eye; there was relative preservation of rod function in the temporal fields (nasal retina) of both patients and in the peripapillary region of one patient (Figure 5B, top panel). Surprisingly, cone-mediated function in the light-adapted eye showed only moderate loss (<1log) or normal or near-normal results (Figure 5B, bottom panel). Rod and cone function sampled across the entire range of the visual field substantiated and extended these findings, showing strong interocular symmetry (Figures 12A and 12B). Rod sensitivity loss (RSL) and cone sensitivity loss (CSL) maps of both eyes of two patients with ARB. Large, symmetric central areas of severe RSL were surrounded by relatively preserved function in the temporal fields. Cone function is relatively unaffected, and the CSL is relatively uniform across the visual field. The physiological blind spot is shown as a black square at 12° in the temporal area.

[0098] Cross-sectional imaging with OCT was performed to evaluate retinal lamination abnormalities along the horizontal meridian across the fovea (Figure 5C). There was no consistent exposure history at the time of OCT imaging. Both patients showed significant loss of ONL and abnormalities at the level of the photoreceptor IS / OS of the outer retina over most of the central retina. In addition, P2 showed intraretinal cystic cavities and detachment of the central retina from the RPE, likely due to accumulation of subretinal fluid. Retinal lamination showed relative normalization in the peripapillary region (Figure 5C, dark rectangle) and beyond the nasal mid-peripheral transition (Figure 5C, light rectangle). Analysis of the two regions of interest showed detectable but abnormally thinned ONL, and detectable IS / OS and cone outer segment tips (COST), which were accompanied by low peak signals in both patients (Figure 5D and 5E). In P1, the distance from the ELM to the IS / OS and the distance from the IS / OS to the COST were comparable to normal. There appeared to be a low-scattering layer distal to COST, and the RPE appeared to be ultrathick (Fig. 5D, middle panel). In P2, the ELM to IS / OS appeared shorter than normal, but the distance from IS / OS to COST was comparable to normal. The distance from COST to ROST / RPE appeared longer than normal, due to an indistinct low-scattering layer intervening; the RPE appeared comparable to normal in thickness (Fig. 5D, right panel). Analysis of the outer retina in the mid-nasal peripheral region of P1 showed that the distances from ELM to IS / OS, IS / OS to COST, and COST to ROST / RPE were greater than normal, and the RPE thickness was comparable to normal (Fig. 5E, middle panel). The features of P2 appeared intermediate between P1 and normal (Fig. 5E, right panel).

[0099] To understand the impact of structural abnormalities at the level of the outer retina and RPE on the kinetics of retinoid transfer between these cell layers, dark adaptation studies were performed. In the peripapillary location shown in Figure 5D, the dark adaptation threshold of P1 was rod-mediated but elevated by 1.3 log units (Figure 5F). By 22.5 min after exposure, the P1 outcome remained cone-mediated on the plateau, while the normal one was already within 1 log unit of the final dark adaptation threshold. By 50 min, the P1 rod outcome was still elevated by 1 log, but normal recovery was complete (Figure 5F). In the mid-peripheral nasal retina location shown in Figure 5E, the dark adaptation threshold of P2 was rod-mediated and elevated by approximately 0.5 log units compared to the normal one (Figure 5G). By 14.5 min after exposure, there was the first evidence of rod function, which was gradually slower than the 11 min cone-rod disruption of the normal one. The rate of rod recovery was similar to the normal one (Figure 5G). In summary, rod dark adaptation kinetics in P1 at the peripapillary locus showed a very slow time course, whereas dark adaptation kinetics of rod function in P2 at the central-peripheral locus was close to normal (Figures 5F and 5G).

[0100] The RPE plays a key role in maintaining a metabolically active environment in the subretinal space. Due to its dynamic relationship with adjacent retinal layers, mutations in RPE-specific genes often adversely affect adjacent sensory neurons, resulting in loss of visual function and PR degeneration. Mutations in BEST1 are known to disrupt transepithelial ion and fluid transport in response to abnormal levels of intracellular calcium. Abnormal RPE calcium signaling is driven by Ca 2+ It is also believed that this leads to dysregulation of other pathways through changes in the expression and interactions of sensitive proteins. Based on the findings of cBest, one such protein is EZRIN, a membrane-cytoskeleton linker that is essential for the formation and proper maturation of the RPE apical MV. Activation of the membrane-F-actin cross-linking function of EZRIN is associated with Ca 2+It has been demonstrated that Ezrin-KO mice exhibit a significant reduction in the generation of RPE MVs, which occur in direct response to neurotransmitters. The apparent underdevelopment of RPE apical MVs seen in BEST1 mutant RPE is consistent with these findings. Furthermore, comparative IHC evaluation with other IRD models demonstrated that these major structural changes associated with the microvillar sheath are specific to primary RPE channelopathy caused by BEST1 mutations and are not secondary to cone dysfunction and degeneration.

[0101] The structural elements of RPE apical processes are significantly different from those of non-motile intestinal microvilli. The presence of contractile proteins (such as myosin) in RPE apical microvilli, as well as molecules typically found at cell attachment sites, suggest that the RPE actively attaches and exerts tension on the neural retina. The lack of an adequate microvillar sheath at the RPE-PR interface in cBest, and therefore the absence of physical and electrostatic support by these processes to the PR OS, would be expected to weaken adhesion and lead to the separation of the RPE-PR complex across the retina. The microdetachment of the PR layer from the underlying RPE seen in cBest at the earliest stages of the disease would be consistent with this process. Furthermore, the presence of contractile elements in RPE apical processes, and the fact that they evolved from cells in which pigment migration occurred, indicates that MVs are capable of active contraction while mating with the PR OS, destined to facilitate circadian phagocytic activity. A single RPE cell can house approximately 30–50 PRs, depending on their location in the retina and their packing density; an elaborate network of microvilli allows each RPE cell to routinely handle such a high metabolic load. Insights from proteomic profiling support this argument. Numerous channel proteins and transporters (e.g., Na+ ... + / K +Along with BEST1 ATPase, there is an enriched fraction of retinoid processing proteins expressed along the RPE apical MVs. Given the topographical differences in RPE cell size and the density and length of MVs quantified in this study, MV expansion expands the functional surface of a single RPE cell by 20-30 fold in the central retina, which is consistent with previous estimates. This number is even higher (~50 fold) in the small RPE cells of the macular region that have adapted to a higher turnover rate of shed POS while facing the most densely packed PRs. Such a dramatic reduction in the total apical surface area of ​​BEST1 mutant RPE leads to a chronic delay in metabolite processing and halts the ability of the RPE to maintain both an adequate cell volume as well as chemical composition and physiological pH levels in the subretinal space. As these factors are essential for retinal adhesion, limitations in the RPE transport system alter the hydrostatic balance and reduce the osmoelastic properties of the RPE-PR complex, which subsequently separates from the neural retina. Indeed, primary serous detachment in human and canine bestrophinopathy is first evident in the fovea, the central region of highest metabolic activity. The absence of a high-extent RPE apical process, tightly enveloping the COS up to the ellipsoid in a structurally intact retina, would explain the bias of this cone-rich structure towards its primary detachment in bestrophinopathy. There would be an almost exclusive dependency on frictional interactions with the MV. This is in line with findings with cBest, which also document the formation of focal previtellogenic lesions within the canine foveal-like region of the retinal field, and the susceptibility of other central cone-rich areas (such as the line of sight) to subretinal detachment.

[0102] The predominant expansion of microdetachments in cBest upon exposure to dim and moderate light intensity was an unexpected result. In normal eyes, light exposure is known to alter the molecular composition of the subretinal space. There is also evidence that light exposure produces measurable structural changes in the normal outer retina, including changes in the length of the outer segments, hydration of the subretinal space, increased actin staining along the RPE apical MV, and light directionality of the outer segments. However, all of the normal changes are significantly smaller than those measured with cBest. For example, compared to the approximately 18 μm expansion of the subretinal space driven by cBest light, normal human eyes showed approximately 1 μm of change and normal mouse eyes showed approximately 4 μm of change in the outer retina. Human ARBs have only recently been recognized, and the literature on the earliest disease stages is limited. Recessive cBest disease appears to have phenotypic similarities to both dominant and recessive human bestrophinopathies. In patients with Best's disease (BVMD), there has been some controversy regarding the structural features of the retinal regions surrounding the vitelloid or late lesions, or the retina in the previtelloid stage of the disease. Some studies have shown minor abnormalities at the level of the RPE-PR interface, while results from others have not supported detectable structural defects. The source of this controversy could be the genotype, the resolution of the various methodological approaches used, or the light history preceding the imaging. Indeed, light-dependent outer retinal changes have been described in BVMD using methods such as those disclosed herein; yet, the magnitude of changes in our patients was smaller (approximately 2 μm) than in cBest. However, in general, the abnormal response of the affected retina to light stimuli could be associated with a significantly reduced electrooculogram light peak / dark valley ratio, a consistent finding in all Best's disease patients, even in presymptomatic Best's disease patients.

[0103] Importantly, both cBest micro- and macro-detachments had adverse effects on photoreceptor health: areas of microdetachment tended to correspond to hyperthick ONL, whereas larger lesions with total macro-detachment showed ONL thinning. The sampling method used herein did not allow for evaluation of smaller lesions with macro-detachment. The ONL contains all rod and cone nuclei, and classical studies in animal models and human eye donors have shown that the ONL generally thins as the disease progresses. Some of the earliest stages of retinal disease that show ONL thickening are poorly known, which has only become measurable with advances in in vivo imaging methods. Human studies have previously shown such ONL thickening in early stages of retinal disease. There is also evidence in animal studies of ONL thickening associated with retinal stress. cBest-mapped ONL hyperthick areas when examined microscopically showed numbers of PR nuclei comparable to controls, suggesting greater internuclear spacing within the ONL, which may correspond to levels of retinal stress below the apoptotic threshold. Total retinal detachment, on the other hand, can cause greater retinal stress and progressive degeneration.

[0104] To prevent photoreceptor and vision loss associated with BEST1 mutations, we performed subretinal gene augmentation therapy targeted to retinal areas with macro- and microdetachments. Results showed that AAV-mediated BEST1 gene augmentation was safe, reversed clinically evident lesions, improved diffuse microdetachments, and resulted in normalization of ultrathick ONL. Furthermore, gene therapy was successful in three different BEST1 genotypes with both focal and multifocal symptoms, confirming the long-term persistence of treatment effects. At the molecular level, we confirmed the ability of canine as well as human BEST1 transgenes to correct the apposition of the RPE-PR complex and restore the cytoarchitecture of this critical interface. This study suggests that early as well as more advanced stages of autosomal recessive disease may be prudent to approach with this treatment. Further studies utilizing human induced pluripotent stem cell (hiPSC)-derived RPE models derived from patients with autosomal Best1 mutations will determine whether gene augmentation approaches may also benefit BVMD patients.

[0105] To facilitate clinical translation of successful gene augmentation therapy, we studied ARB patients to gain insight into their entire retina disease. Consistent with most, but not all, previous descriptions, retinal disease in ARB patients extended well beyond the macula into the midperiphery. En face and cross-sectional imaging and retinotopic mapping of rod and cone function demonstrated the presence of a clear transition from disease to health in the midperiphery, a feature not previously highlighted. Within diseased areas, severe abnormalities in retinal structure were associated with severe loss of rod function; unexpectedly, cone function was relatively preserved. Rod dysfunction within the central retina was also associated with an extreme slowing of the retinoid cycle, whereas the healthier periphery showed near-normal recycling of retinoids. There are at least two retinoid cycles that provide 11-cis-retinal chromophores to photoreceptor pigments. The canonical retinoid cycle operates in the RPE to generate chromophores for rod and cone PR. On the other hand, the retinal retinoid cycle is thought to regenerate chromophores within the retina for cone-specific use. The abnormal RPE-PR interface in Best's disease would most likely affect the delivery of chromophores from the canonical RPE retinoid cycle; the retinal retinoid cycle may be relatively unaffected, thus explaining the greater preservation of cone function.

[0106] In summary, as disclosed herein, we surprisingly uncovered a novel molecular contribution to the pathophysiology of bestrophinopathy at the RPE-PR interface. We found the earliest manifestation of the disease—diffuse microdetachments enhanced by light exposure that were easily detectable by in vivo imaging. AAV-mediated BEST1-enhanced gene therapy reversed both grossly evident lesions and microdetachments and restored the cytoarchitecture of the RPE-PR interface. Evaluation of ARB patients showed retinotopic distribution and structural and functional defects characteristic of those expected from PR degeneration. Such visual dysfunction can be expected to improve with successful application of BEST1 gene-enhanced therapy to patients who develop bestrophinopathy.

[0107] Example 2 The vector technology of Example 2 was designed to use RNA interference to suppress the expression of endogenous BEST1 mRNA (both mutant and normal copies). These vectors simultaneously replace the endogenous BEST1 mRNA with normal BEST1 mRNA to produce only normal protein. The technology uses adeno-associated viruses to deliver an intronless copy of the BEST1 gene, plus a gene for a small hairpin RNA (shRNA) that leads to the production of a small interfering RNA (siRNA). The BEST1 gene is resistant to siRNA because of a silent mutation in its reading frame. Two shRNAs, and therefore two modified human BEST1 genes, were designed. Both BEST1 genes are driven by a 623 bp fragment of the human VMD2 promoter. The BEST1 cDNA is preceded by a synthetic intron and followed by a polyadenylation sequence, both derived from the SV40 virus. In one case, shRNA05 is driven by the RNA polymerase III (pol III) H1 promoter, and in the other case, shRNA744 teeth Driven by the pol III U6 promoter. A sequence of six thymidines serves as the termination sequence for each shRNA. To identify these active shRNAs, nine potential siRNA or shRNA sequences were screened.

[0108] The gene sequence encoding the shRNA is as follows: [ka] Maps of exemplary AAV vectors containing heterologous nucleic acids encoding shRNA05 and shRNA744, as well as the hBEST1 gene containing a detargeting sequence (e.g., one of SEQ ID NOs: 10 or 11) used to generate the disclosed rAAV particles are shown in Figures 15 and 16, respectively. Both sequences are driven by the VMD2 promoter.

[0109] In some embodiments, the disclosure provides an shRNA05 sense strand that comprises the nucleotide sequence of SEQ ID NO:2 plus an additional nucleotide immediately preceding the first cytosine in the sequence. In some embodiments, the additional nucleotide comprises a cytosine (C). In some embodiments, the disclosure provides shRNA05, comprising an antisense strand comprising the nucleotide sequence of SEQ ID NO:3.

[0110] An exemplary gene sequence corresponding to the region of the vector encoding the pol III H1 promoter, shRNA05, and termination sequences is as follows: [ka] (SEQ ID NO:20). This sequence further comprises a BamHI endonuclease site (ggatcc) to facilitate screening and ensure that the start site of shRNA05 is located 25 nucleotides downstream of the H1 promoter TATA box (TATAA). Thus, in some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising this sequence (and / or its complement) is transcribed in a host cell (e.g., treated with the vector in a subject, e.g., a human subject). In some embodiments, two or more different shRNAs (e.g., having different start and / or stop sites, e.g., differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.

[0111] Figure 17 shows that the VMD2 promoter works well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using the chicken beta actin promoter (CBA) or the VMD2 promoter. Protein lysates were separated on polyacrylamide gels, and the expression of bestrophin (Best1) was detected by Western blot and normalized to the expression of beta tubulin to show uniform loading of the gel. Figures 18A and 18B show that Best1-specific siRNA is functional. Transfection of HEK293T stably expressing BEST1 resulted in a 75% reduction in bestrophin (Best1) protein. Using 20 nM siRNA death,Cells were analyzed 48 hours after transfection. Western blot (Figure 18A), knockdown of BEST1 was compared by normalization of band intensity between Best1 and tubulin (Best1 / tubulin) (Figure 18B). Figures 19A and 19B show that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the indicated plasmids. Cells were harvested 48 hours after transfection. Expression of BEST1 was determined by Western blot (Figure 19A). Knockdown of BEST1 was compared by normalization of band intensity between Best1 and tubulin (Best1 / tubulin) (Figure 19B). Figure 20 shows detargeting of Best1. A silent mutation (base change at the third position of the codon) was used to remove the siRNA target site from Best1 mRNA. The disclosed example is for shRNA744. SEQ ID NOs: 15-17 correspond to the sequence from top to bottom.

[0112] material and method Canine BEST1 model and in vivo retinal imaging. Homozygous (c.73C>T) (p.R25 * / R25 * ) or (c.1388delC)(p.P463fs / P463fs) or cBEST1(GB * NM_001097545 (c.73C>T / 1388delC) (p.R25 *cBest mutant dogs (n=18) of both sexes (12M and 6F) carrying either the cmr1, cmr3, or cmr1 / cmr3 mutation were included. To facilitate annotation of multipanel figures, the three genotypes are referred to as cmr1, cmr3, and cmr1 / cmr3, respectively. The study was performed in comparison to control crossbred dogs (n=12; 7M and 5F) (Table 1). All animals were bred and maintained at the Retinal Disease Research Facility (RDSF). The study was performed in strict accordance with the recommendations in the NIH Guide for the Care and Use of Laboratory Animals and in compliance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol was approved by the Institutional Animal Care and Use Committee at the University of Pennsylvania (IACUC numbers 804956 and 803422). Frontal and retinal cross-sectional imaging was performed with dogs under general anesthesia as previously described.

[0113] Human subjects. Light-adapted and dichromatic dark-adapted functions were measured at 2° intervals across the central visual field (central 60° along horizontal and vertical meridians) and at 12° intervals across the visual field. Photoreceptor mediation under dark-adapted conditions was determined by the difference in sensitivity between 500 and 650 nm stimuli. Dark-adapted kinetics was assessed similarly to previously described techniques (92–94) using a LED-based dark adaptometer (Roland Consult) and a brief (30 s) medium exposure from a clinical short-wavelength autofluorescence imaging device (25% laser power; Spectralis HRA; Heidelberg Engineering). Optical coherence tomography (OCT) was used to analyze the laminar structure of the whole retina. Retinal cross sections were recorded with a spectral-domain (SD) OCT system (RTVue-100; Optovue). Post-acquisition data analysis was performed with a custom program (MATLAB 7.5; MathWorks). Recording and analysis techniques have been previously described (30, 31, 94). Longitudinal reflectance profiles (LRP) were used to identify retinal features. En face images were recorded using a confocal scanning laser ophthalmoscope (Spectralis HRA; Heidelberg Engineering) as previously described (95), and RPE health was estimated by short wavelength low intensity autofluorescence imaging (SW-RAFI). All images were acquired in fast mode (30° × 30° square field or 50° circular field).

[0114] Canine BEST1 model and in vivo retinal imaging. Overlapping en face images of reflectance with near infrared illumination (820 nm) were acquired (Spectralis HRA + OCT) using 30° and 55° diameter lenses to delineate fundus features such as the optic nerve, retinal vessels, injection bleb borders, retinotomy sites, and other localized changes. Individual photographs were digitally stitched into a whole-retinal panorama using a custom program (MATLAB 7.5; MathWorks). Short-wavelength autofluorescence and reflectance imaging were used to delineate the tapetum and pigmented RPE borders. Spectral domain optical coherence tomography (SD-OCT) was performed using overlapping (30° × 25°) raster scans over a large area of ​​the retina. Postacquisition processing of the OCT data was performed using a custom program (MATLAB 7.5). For topographical analysis of the whole retina, the integrated backscatter intensity of each raster scan was used to locate the exact location and orientation of retinal features displayed in the whole-retina mosaic formed by the near-infrared reflectance (NIR) images. Individual LRPs forming all registered raster scans were assigned to regularly spaced bins (1° × 1°) in a Cartesian coordinate system centered on the optic nerve; the LRPs in each bin were aligned and averaged. Peaks and boundaries within the retina corresponding to the OPL, ELM, IS / OS, and RPE / T were segmented using both intensity and gradient information of the backscattered signal along each LRP. Topographical maps of ONL thickness were generated from the distance from the OPL to the ELM, and maps of IS / OS to RPE / T thickness were generated from the distance between these peaks. For all topographical results, the locations of blood vessels, optic disc, bleb, tapetum border, and foveal-like regions (24) were superimposed for reference. First, the maps from WT dogs were registered to the center of the optic disc and rotated to match the foveal-like region, and a map of the average WT topography was derived. The foveal-like region of cBest mutant dogs was determined by overlaying the WT template on the mutant eyes by alignment of the optic disc, major superior vessels, and the border of the tapetum. The cBEST1 mutation map was then registered to the WT map by the center of the optic nerve and the estimated foveal-like region, and a difference map was derived. The difference map was sampled inside and outside the treatment bleb of each eye.The relationship between light exposure and changes in outer retinal structure was assessed by two approaches. In a subset of eyes, cross-sectional OCT imaging was performed early in each experimental session, first with bright short-wavelength light autofluorescence imaging, followed by further OCT imaging. OCT recordings obtained early in such sessions were likely from retinas exposed to less light compared with recordings obtained later, although precise exposure could not be quantified. In another subset of eight eyes, OCT recordings were performed after overnight dark adaptation, followed by short intervals of short-wavelength exposures from cSLO, followed consecutively in a dark room. In three eyes, five increasingly larger exposures were used: L1: laser, 20%; duration, 60 s; L2: laser, 25%; duration, 30 s; L3: laser, 50%; duration, 30 s; L4: laser, 100%; duration, 30 s; L5: laser, 100%; duration, 300 s. In three eyes, only L4 and L5 were used. In two additional eyes, light-mediated microdetachment recovery was followed over 24 h using only L5. Standard (100%) laser settings are estimated to correspond to a human retinal irradiance of 330 μW·cm-2 at a wavelength of 488 nm (98). In both approaches, the areas selected for analysis were based on near-infrared imaging of the fundus with cSLO before the start of the study and excluded areas where clinically evident macrodetachments were located.

[0115] Subretinal injections and postoperative procedures. Subretinal injections of recombinant AAV2 / 2 delivering either cBEST1 or hBEST1 transgenes under the control of the human VMD2 promoter (46) were performed under general anesthesia according to previously published procedures (46, 82, 97). Vector production and validation have been described in detail previously (46). Injection volumes ranging from 50 to 180 μL of viral vector solution (titer range 0.1–5 × 10 11100 mg / mL) (Table 1) was delivered subretinally using a custom modified RetinaJect subretinal syringe (SurModics) (97) under direct visualization with a surgical microscope via a transvitreal approach without vitrectomy. Anterior chamber paracentesis was performed immediately after injection to prevent elevation of intraocular pressure. Immediately after injection, the formation of a subretinal bleb was documented by fundus photography (RetCam Shuttle; Clarity Medical Systems). In all cases, the surgical bleb flattened and the retina reattached within 24–48 h p.i. Ophthalmic examinations, including biomicroscopy, indirect ophthalmoscopy, and fundus photography, were performed periodically throughout the injection–endpoint assessment time interval (at 24 h, 48 h, and 5 days p.i., then weekly for the first 2 months, followed by monthly ophthalmic examinations thereafter). Postoperative management was performed as previously described (46).

[0116] Histological and immunohistochemical evaluation. Ocular tissues for ex vivo analysis were collected as previously described (24, 99). All efforts were made to improve animal welfare and minimize discomfort. For all ex vivo evaluations, cBest and control (WT) eyes were fixed in 4% paraformaldehyde, embedded in optimal cutting temperature medium, and processed as previously reported (99). Histological evaluations were performed using standard hematoxylin / eosin (H&E) staining, and all immunohistochemical experiments were performed on 10-μm-thick cryosections according to established protocols (46, 99). Briefly, retinal cryosections were permeabilized in 1× PBS / 0.25% Triton X-100, blocked for 1 h at room temperature, and incubated overnight with primary antibodies (Table 2). For multicolor labeling, primary antibodies were combined with Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647 (L32460; Molecular Probes), followed by incubation with the corresponding secondary antibody (Alexa Fluor) for 1 h. Slides were examined under epifluorescence or transmitted light microscope (Axioplan; Carl Zeiss Meditec), and digital images were collected with a Spot 4.0 camera (Diagnostic Instruments). [Table 2]

[0117] Confocal microscopy and image analysis. Confocal images were acquired with a TCS-SP5 confocal microscope system (Leica Microsystems) or an A1R laser scanning confocal microscope (Nikon Instruments). To obtain counts of cone-associated MVs (cone-MVs), two adjacent fields, each region of interest (ROI) 155 μm long, were scanned in 6-week-old cBest (R25 *Both eyes from 16-month-old mice (P463fs) and age-matched WT controls were imaged 4 mm from the optic disc in 10 retinal sections (n=80 ROIs / eye) per retinal quadrant (temporal, superior, inferior, and nasal). Image stacks were acquired with a Z-step of 0.25 μm and deconvolved with Huygens deconvolution software version 17.04 (Scientific Volume Imaging). All deconvolved images were rendered with a Leica LAS X 3D rendering module and cone-MVs were counted manually. The lengths of both cone-MVs and rod-MVs were assessed within the Leica LAS X software from maximum projection images. Data were analyzed in Microsoft Excel and quantified using Prism software version 7 (GraphPad).

[0118] References [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

[0119] Other Aspects All features disclosed herein can be combined in any combination. Each feature disclosed herein can be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, those skilled in the art can easily ascertain the essential features of the present disclosure, and can make various changes and modifications of the disclosure to adapt it to various uses and conditions without departing from its spirit and scope. Accordingly, other embodiments are also within the claims.

[0120] Equivalent While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily recognize various other means and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is deemed to be within the scope of the inventive embodiments described herein. More generally, those of ordinary skill in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application(s) in which the teachings of the invention are used. Those of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. Thus, it should be understood that the above embodiments are presented by way of example only, and that within the scope of the appended claims and equivalents thereto, the inventive embodiments may be practiced other than as specifically described and claimed. The inventive embodiments of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and / or methods is included within the inventive scope of the present disclosure, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0121] All definitions, as defined and used herein, should be understood to supersede any dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meaning of the defined term. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter cited, and in some cases may include the entirety of the document. The indefinite articles "a" and "an," as used in the specification and claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

[0122] The phrase "and / or," as used in the specification and claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner (i.e., "one or more" of the elements so conjoined). Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising," may refer in one embodiment to A only (optionally including elements other than B); in another embodiment to B only (optionally including elements other than A); in another embodiment to both A and B (optionally including other elements); and so forth.

[0123] As used herein and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., including at least one, but also including more than one, of a number or list of elements, and optionally including additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or "consisting of," when used in the claims, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or," as used herein, shall be interpreted to indicate exclusive alternatives (i.e., "one or the other" but not both) only when preceded by a term of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0124] As used in this specification and claims, the phrase "at least one," with reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but need not include at least one of each and every element specifically listed in the list of elements, and does not exclude any combinations of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related to the specifically identified element or not. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer to, in one embodiment, at least one A (optionally including more than one A), and no B (and optionally including elements other than B); in another embodiment, at least one B (optionally including more than one B), and no A (and optionally including elements other than A); in another embodiment, at least one A (optionally including more than one A), and at least one B (optionally including more than one B) (and optionally including other elements); and so forth.

[0125] It should also be understood that, unless expressly indicated to the contrary, in any method claimed in this specification that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are described. In the claims and in the above specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, should be understood to be open-ended, i.e., meaning including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" are intended to be closed or semi-closed transitional phrases, respectively, as expressed in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be understood that embodiments described in this document that use open-ended transitional phrases (e.g., "comprising") are also contemplated in alternative embodiments as "consisting of" and "consisting essentially of" the features described by the open-ended transitional phrase. For example, if the disclosure describes "a composition comprising A and B," the disclosure also contemplates the alternative embodiments "a composition consisting of A and B" and "a composition consisting essentially of A and B."

Claims

1. (a) the sense strand; (b) the antisense strand; and (c) Loop A small hairpin RNA (shRNA) comprising:

2. The shRNA of claim 1 , wherein the loop is located between the sense strand and the antisense strand.

3. The shRNA of claim 1 or 2, wherein the loop comprises the nucleotide sequence SEQ ID NO:7 or SEQ ID NO:

8.

4. where a) the sense strand comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:6; and b) the shRNA according to any one of claims 1 to 3, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 5;

5. The shRNA of any one of claims 1 to 4, comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:

4.

6. An shRNA described in any one of claims 1 to 5, comprising the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:

4.

7. A vector encoding the shRNA according to any one of claims 1 to 6.

8. The vector of claim 7, further comprising a recombinant bestrophin 1 (BEST1) coding sequence that does not contain a sequence targeted by an shRNA.

9. 9. The vector of claim 7 or 8, wherein the recombinant BEST1 coding sequence is codon-optimized for expression in human cells.

10. The vector according to any one of claims 7 to 9, wherein the recombinant BEST1 coding sequence comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:10, or SEQ ID NO:

11.

11. The vector according to any one of claims 7 to 10, which is a plasmid or a viral vector.

12. The vector of claim 11, which is a viral vector, and wherein the viral vector is a recombinant adeno-associated viral (rAAV) vector.

13. A recombinant adeno-associated virus (rAAV) particle comprising the rAAV vector of claim 11 or 12.

14. The rAAV particle of claim 13, which is an AAV serotype 2 (AAV2) viral particle.

15. A composition comprising an shRNA according to any one of claims 1 to 6, a vector according to any one of claims 7 to 12, or an rAAV particle according to claim 13 or 15, and a pharma- ceutically acceptable carrier.

16. A method for regulating BEST1 expression in a subject, the method comprising administering to the subject an shRNA described in any one of claims 1 to 6, a vector described in any one of claims 7 to 12, an rAAV particle described in any one of claims 13 to 14, or a composition described in claim 15.

17. 16. The composition of claim 15 for use in treating Best's disease in a subject.

18. 16. The composition of claim 15 for use in treating autosomal recessive bestrophinopathy (ARB) in a subject.

19. 16. The composition of claim 15 for use in the manufacture of a medicament for treating Best's disease.

20. 16. The composition of claim 15 for use in the manufacture of a medicament for treating an ARB.

Images