Encapsulation of messenger RNA

Abstract

To provide encapsulation of messenger RNA.SOLUTION: The present invention provides an improved process for lipid nanoparticle formulation and mRNA encapsulation. In some embodiments, the present invention provides a process of encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising a step of mixing an mRNA solution and a lipid solution, where the mRNA solution and / or the lipid solution are at a predetermined temperature greater than ambient temperature. The present invention provides, among other things, an improved process for lipid nanoparticle formulation and mRNA encapsulation. In particular, the present invention is based on the surprising discovery that pre-heating an mRNA solution and / or a lipid solution prior to the mixing results in significantly improved encapsulation efficiency and mRNA recovery rate, and more homogeneous and smaller particle sizes (e.g., less than 100 nm).SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 020,163, filed July 2, 2014, the disclosure of which is incorporated herein by reference in its entirety. [Background technology]

[0002] Messenger RNA therapy (MRT) has become an increasingly important approach for the treatment of various diseases. MRT involves the administration of messenger RNA (mRNA) to a patient in need of the therapy for the production of the protein encoded by the mRNA in the patient's body. Lipid nanoparticles are often used to encapsulate mRNA for efficient in vivo delivery of mRNA. However, current methods for producing mRNA-loaded lipid nanoparticles suffer from poor encapsulation efficiency, low mRNA recovery and / or heterogeneous particle size. Summary of the Invention [Means for solving the problem]

[0003] The present invention provides, inter alia, improved processes for lipid nanoparticle formulation and mRNA encapsulation. In particular, the present invention is based on the surprising discovery that pre-heating the mRNA solution and / or lipid solution before mixing results in significantly improved encapsulation efficiency, mRNA recovery, and more homogeneous and smaller particle size (e.g., less than 100 nm).

[0004] Thus, in some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature. In some embodiments, the predetermined temperature suitable for the present invention is about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, the predetermined temperature suitable for the present invention is in the range of about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In a particular embodiment, the predetermined temperature suitable for the present invention is about 65°C.

[0005] In some embodiments, the mRNA solution and the lipid solution are heated separately to a predetermined temperature before mixing. In some embodiments, the mRNA solution is heated to a predetermined temperature and the lipid solution is at ambient temperature before mixing. In some embodiments, the mRNA solution is heated to a predetermined temperature by adding the ambient temperature mRNA stock solution to a heated buffer solution to the predetermined temperature. In some embodiments, the buffer solution has a pH of about 4.5 or less (e.g., about 4.4, 4.2, 4.0, or 3.8 or less).

[0006] In some embodiments, the mRNA solution and the lipid solution are mixed by a low pulse flow pump. In some embodiments, a suitable pump is a gear pump. In some embodiments, a suitable pump is a peristaltic pump. In some embodiments, a suitable pump is a centrifugal pump.

[0007] In some embodiments, the mRNA solution is at about 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, 2000-30 In some embodiments, the mRNA solution is mixed at a flow rate of about 200 ml / min, about 500 ml / min, about 1000 ml / min, about 2000 ml / min, about 3000 ml / min, about 4000 ml / min, or about 5000 ml / min.

[0008] In some embodiments, the lipid solution is mixed at a flow rate ranging from about 25-75 ml / min, about 75-200 ml / min, about 200-350 ml / min, about 350-500 ml / min, about 500-650 ml / min, about 650-850 ml / min, or about 850-1000 ml / min. In some embodiments, the lipid solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

[0009] In some embodiments, the process of the present invention includes first generating an mRNA solution by mixing a citrate buffer with an mRNA stock solution. In certain embodiments, a suitable citrate buffer contains about 10 mM citrate, about 150 mM NaCl, and a pH of about 4.5. In some embodiments, a suitable mRNA stock solution contains mRNA at a concentration of about 0.10 mg / ml, 1 mg / ml, about 10 mg / ml, about 50 mg / ml, or about 100 mg / ml or more.

[0010] In some embodiments, the citrate buffer is mixed at a flow rate ranging between about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, or 4800-6000 ml / min. In some embodiments, the citrate buffer is mixed at a flow rate of about 220 ml / min, about 600 ml / min, about 1200 ml / min, about 2400 ml / min, about 3600 ml / min, about 4800 ml / min, or about 6000 ml / min.

[0011] In some embodiments, the mRNA stock solution is mixed at a flow rate ranging between about 10-30 ml / min, about 30-60 ml / min, about 60-120 ml / min, about 120-240 ml / min, about 240-360 ml / min, about 360-480 ml / min, or about 480-600 ml / min. In some embodiments, the mRNA stock solution is mixed at a flow rate of about 20 ml / min, about 40 ml / min, about 60 ml / min, about 80 ml / min, about 100 ml / min, about 200 ml / min, about 300 ml / min, about 400 ml / min, about 500 ml / min, or about 600 ml / min.

[0012] In some embodiments, the lipid solution contains one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids and PEG lipids in ethanol. In some embodiments, the mRNA solution and lipid solution are mixed into 20% ethanol, resulting in a suspension of lipid nanoparticles. In some embodiments, the lipid nanoparticles are further purified by tangential flow filtration.

[0013] In some embodiments, about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% of the purified nanoparticles have a size of less than about 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, substantially all of the purified nanoparticles have a size of less than 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). Has a size.

[0014] In some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles have a size in the range of about 40-90 nm (e.g., about 40-85 nm, about 40-80 nm, about 40-75 nm, about 40-70 nm, about 40-65 nm, or about 40-60 nm). In some embodiments, substantially all of the purified nanoparticles have a size in the range of about 40-90 nm (e.g., about 40-85 nm, about 40-80 nm, about 40-75 nm, about 40-70 nm, about 40-65 nm, or about 40-60 nm).

[0015] In some embodiments, the purified nanoparticles have an encapsulation efficiency of greater than about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the processes of the present invention result in a recovery of mRNA of greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0016] In some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, the process comprising: (a) separately heating an mRNA solution and / or a lipid solution to a predetermined temperature above ambient temperature; (b) mixing the heated mRNA solution and / or the heated lipid solution to produce a suspension of lipid nanoparticles; and (c) purifying the lipid nanoparticles.

[0017] In another aspect, the present invention provides a composition of lipid nanoparticles produced by the process described herein.In some embodiments, the present invention provides a composition comprising purified lipid nanoparticles, wherein more than about 90% of the purified lipid nanoparticles have an individual particle size of less than about 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm), and more than about 70% of the purified lipid nanoparticles encapsulate mRNA within each individual particle.In some embodiments, more than about 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles have an individual particle size of less than about 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, substantially all of the purified lipid nanoparticles have an individual particle size of less than about 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. In some embodiments, substantially all of the purified lipid nanoparticles encapsulate mRNA within each individual particle. In some embodiments, the compositions of the present invention contain at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA.

[0018] In some embodiments, each individual lipid nanoparticle comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and a PEG-lipid. In some embodiments, the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XT C2-DMA, HGT4003, and combinations thereof.

[0019] In some embodiments, the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

[0020] In some embodiments, the one or more cholesterol-based lipids are cholesterol or PEGylated cholesterol. In some embodiments, the one or more PEG-modified lipids are C6-C 20 They contain poly(ethylene) glycol chains of up to 5 kDa in length covalently attached to a lipid having alkyl chain(s) of length.

[0021] In some embodiments, the invention is used to encapsulate mRNA that contains one or more modified nucleotides, hi some embodiments, the invention is used to encapsulate mRNA that is unmodified. The present invention provides, for example, the following items. (Item 1) A process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising a step of mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature. (Item 2) 2. The process of claim 1, wherein the predetermined temperature is at or above about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. (Item 3) 3. The process according to item 1 or 2, wherein the predetermined temperature is in the range of about 25 to 70°C, about 30 to 70°C, about 35 to 70°C, about 40 to 70°C, about 45 to 70°C, about 50 to 70°C, or about 60 to 70°C. (Item 4) Item 2. The process of any one of the preceding items, wherein the predetermined temperature is about 65° C. (Item 5) 2. The process of any one of the preceding claims, wherein the mRNA solution and the lipid solution are heated separately to the predetermined temperature prior to said mixing. (Item 6) 5. The process according to any one of items 1 to 4, wherein prior to said mixing, the mRNA solution is heated to the predetermined temperature and the lipid solution is at ambient temperature. (Item 7) 2. The process of any one of the preceding claims, wherein the mRNA solution is heated to the predetermined temperature by adding an ambient temperature mRNA stock solution to a heated buffer to bring the solution to the predetermined temperature. (Item 8) 8. The process of claim 7, wherein the buffer has a pH of about 4.5 or less. (Item 9) 2. The process of any one of the preceding claims, wherein the mRNA solution and the lipid solution are mixed by a low pulse flow pump. (Item 10) 10. The process of claim 9, wherein the pump is a gear pump. (Item 11) 10. The process of claim 9, wherein the pump is a centrifugal pump. (Item 12) 2. The process of any one of the preceding items, wherein the mRNA solution is mixed at a flow rate in the range of about 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, 2000-3000 ml / min, 3000-4000 ml / min, or 4000-5000 ml / min. (Item 13) The process of any one of the preceding items, wherein the mRNA solution is mixed at a flow rate of about 200 ml / min, about 500 ml / min, about 1000 ml / min, about 2000 ml / min, about 3000 ml / min, about 4000 ml / min, or about 5000 ml / min. (Item 14) 2. The process of any one of the preceding items, wherein the lipid solution is mixed at a flow rate in the range of about 25-75 ml / min, about 75-200 ml / min, about 200-350 ml / min, about 350-500 ml / min, about 500-650 ml / min, about 650-850 ml / min, or about 850-1000 ml / min. (Item 15) 2. The process of any one of the preceding items, wherein the lipid solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min. (Item 16) 2. The process of any one of the preceding claims, wherein the process comprises first generating the mRNA solution by mixing a citrate buffer with a stock mRNA solution. (Item 17) 17. The process of claim 16, wherein the citrate buffer comprises about 10 mM citrate, about 150 mM NaCl, a pH of about 4.5. (Item 18) 18. The process according to item 16 or 17, wherein the stock mRNA solution contains the mRNA at a concentration of about 1 mg / ml, about 10 mg / ml, about 50 mg / ml, about 100 mg / ml or more. (Item 19) 19. The process according to any one of items 16 to 18, wherein the citrate buffer is mixed at a flow rate ranging between about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, or 4800-6000 ml / min. (Item 20) 20. The process according to any one of items 16 to 19, wherein the citrate buffer is mixed at a flow rate of about 220 ml / min, about 600 ml / min, about 1200 ml / min, about 2400 ml / min, about 3600 ml / min, about 4800 ml / min, or about 6000 ml / min. (Item 21) 21. The process according to any one of items 16 to 20, wherein the mRNA stock solution is mixed at a flow rate ranging between about 10-30 ml / min, about 30-60 ml / min, about 60-120 ml / min, about 120-240 ml / min, about 240-360 ml / min, about 360-480 ml / min, or about 480-600 ml / min. (Item 22) The said mRNA stock solution is about 20 ml / min, about 40 ml / min, about 60 ml / min, about 80 ml / min, about 100 ml / min, about 200 ml / min, about 300 ml / min, about 400 ml / min, about 22. The process according to any one of items 16 to 21, wherein the mixing is carried out at a flow rate of 500 ml / min, or about 600 ml / min. (Item 23) Item 2. The process of any one of the preceding items, wherein the lipid solution comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids and PEG lipids in ethanol. (Item 24) 2. The process of any one of the preceding claims, wherein the mRNA solution and the lipid solution are mixed in 20% ethanol, resulting in a suspension of lipid nanoparticles. (Item 25) 25. The process of claim 24, wherein the lipid nanoparticles are further purified by tangential flow filtration. (Item 26) 26. The process of claim 25, wherein greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles have a size less than 100 nm. (Item 27) 27. The process of claim 26, wherein substantially all of the purified nanoparticles have a size of less than 100 nm. (Item 28) 28. The process according to any one of items 25 to 27, wherein more than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles have a size in the range of 50 to 80 nm. (Item 29) 29. The process according to any one of items 25 to 28, wherein substantially all of the purified nanoparticles have a size in the range of 50 to 80 nm. (Item 30) 30. The process of any one of items 25 to 29, wherein the purified nanoparticles have an encapsulation rate of greater than about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. (Item 31) The process of any one of the preceding items, wherein the process results in a recovery of greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% mRNA. (Item 32) A process for encapsulating messenger RNA (mRNA) within lipid nanoparticles comprising: a. separately heating an mRNA solution and / or a lipid solution to a predetermined temperature above ambient temperature; b. mixing the heated mRNA solution and / or the heated lipid solution to produce a suspension of lipid nanoparticles; and c. The process comprising purifying the lipid nanoparticles. (Item 34) A composition of lipid nanoparticles produced by the process of any one of the preceding items. (Item 35) A composition comprising purified lipid nanoparticles, wherein greater than about 90% of the purified lipid nanoparticles have individual particles less than about 100 nm in size, and greater than about 70% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. (Item 36) 36. The composition of claim 35, wherein greater than about 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles have an individual particle size of less than about 100 nm. (Item 37) 37. The composition of any one of claims 35 or 36, wherein substantially all of the purified lipid nanoparticles have an individual particle size of less than about 100 nm. (Item 38) 38. The composition of any one of items 35-37, wherein greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. (Item 39) 39. The composition of any one of items 35 to 38, wherein substantially all of the purified lipid nanoparticles encapsulate mRNA within each individual particle. (Item 40) 40. The composition of any one of items 35 to 39, wherein the composition comprises at least 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. (Item 41) 41. The composition according to any one of items 35 to 40, wherein each individual lipid nanoparticle comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids and PEG-lipids. (Item 42) 42. The process of claim 24 or the composition of claim 41, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof. (Item 43) The one or more non-cationic lipids may be DSPC (1,2-distearoyl-sn-glycol). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC (1,2-dipalmitoyl-sn-glycero-3- phosphocholine), DOPE (1,2-(dioleyl-sn-glycero-3-phosphoethanoic acid diolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphoryl Phosphorus)DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) 42. The process of claim 24 or the composition of claim 41, wherein the glyceryl phosphate group is selected from the group consisting of glyceryl phosphate (PEG), ... (Item 44) 42. The process of claim 24 or the composition of claim 41, wherein the one or more cholesterol-based lipids is cholesterol or PEGylated cholesterol. (Item 45) One or more PEG-modified lipids are 20 42. The process of claim 24 or the composition of claim 41, comprising a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to a lipid having an alkyl chain(s) of length. (Item 46) The process or composition of any one of the preceding items, wherein the mRNA comprises one or more modified nucleotides. (Item 47) The process or composition of any one of the preceding items, wherein the mRNA is unmodified.

[0022] Other features, objects, and advantages of the present invention will be apparent in the following detailed description, drawings, and claims. It should be understood, however, that the detailed description, drawings, and claims, while indicating embodiments of the present invention, are given by way of illustration only, and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art.

[0023] The drawings are for purposes of illustration only, not limitation. [Brief description of the drawings]

[0024] [Figure 1] FIG. 1 shows a schematic diagram of an exemplary scaled-up lipid nanoparticle encapsulated mRNA formulation process using a homogenous flow pump. [Diagram 2] 1 shows an exemplary purification and buffer exchange system for lipid nanoparticles. [Diagram 3] FIG. 1 shows a schematic diagram of an exemplary scaled-up lipid nanoparticle encapsulated mRNA formulation process using a peristaltic pump. [Figure 4] 1 shows an alternative exemplary tangential flow filtration system for purification and buffer exchange. [Diagram 5] FIG. 1 shows an alternative schematic of an exemplary scaled-up lipid nanoparticle encapsulated mRNA formulation process using a peristaltic pump.

[0025] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions for these terms, as well as other terms, are set forth throughout the specification.

[0026] Approximately or about: As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest refers to a value similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value (except where such number exceeds 100% of possible values), unless otherwise stated or unless otherwise clear from the context.

[0027] Encapsulation: As used herein, the term "encapsulation" or grammatical equivalents refers to the process of confining individual mRNA molecules within a nanoparticle.

[0028] Improve, increase, or reduce: As used herein, the terms "improve," "increase," or "reduce," or grammatical equivalents, refer to a value relative to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject of about the same age as the subject being treated, and suffering from the same form of the disease as the subject being treated.

[0029] Impurity: As used herein, the term "impurity" refers to a limited amount of liquid, gaseous, or solid internal substance that differs from the chemical composition of a target material or compound. Impurities are also referred to as contaminants.

[0030] In vitro: As used herein, the term "in vitro" refers to events that take place in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than in a multicellular organism.

[0031] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0032] Isolated: As used herein, the term "isolated" refers to a substance and / or entity that (1) has been separated from at least some of the components with which it was associated when originally produced (either in nature and / or in an experimental setting) and / or (2) has been produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% of other components with which they were originally associated. In some embodiments, an isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of percent purity of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).

[0033] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions.

[0034] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain that includes individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA as well as single and / or double stranded DNA and / or cDNA. Furthermore, the terms "nucleic acid", "DNA", "RNA" and / or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, so-called "peptide nucleic acids" are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone and are considered within the scope of the present invention. The term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and / or that encode the same amino acid sequence. Nucleotide sequences encoding proteins and / or RNA may include introns. Nucleic acids can be purified from natural sources, can be produced using recombinant expression systems, and can be optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, the nucleic acids can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. Nucleic acid sequences are presented in a 5' to 3' direction unless otherwise specified. In some embodiments, nucleic acids include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, The nucleic acid may be or include C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages). In some embodiments, the present invention specifically relates to "unmodified nucleic acids," meaning nucleic acids (e.g., polynucleotides and residues, including nucleotides and / or nucleosides) that have not been chemically modified to facilitate or achieve delivery.

[0035] Salt: As used herein, the term "salt" refers to an ionic compound that results or can result from the neutralization reaction between an acid and a base.

[0036] Substantially: As used herein, the term "substantially" refers to the qualitative state of exhibiting all or nearly all of the degree or extent of a feature or characteristic of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or completion or achieve or avoid absolute results. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0037] Yield: As used herein, the term "yield" refers to the percentage of mRNA recovered after encapsulation compared to the total mRNA as starting material. In some embodiments, the term "recovery" is used interchangeably with the term "yield." DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] The present invention provides improved processes for formulating lipid nanoparticles and encapsulating mRNA. In some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature.

[0039] Various aspects of the invention are described in detail in the following sections. The use of the sections is not intended to limit the invention. Each section may be applicable to any aspect of the invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0040] mRNA The present invention may be used to encapsulate any mRNA. mRNA is typically considered to be a type of RNA that carries information from DNA to ribosomes. The existence of an mRNA is typically very short and involves processing and translation, followed by degradation. Typically, in eukaryotes, mRNA processing involves the addition of a "cap" to the N-terminal (5') end and a "tail" to the C-terminal (3') end. A typical cap is the 7-methylguanosine cap, which is a guanosine that is attached to the first transcribed nucleotide through a 5'-5'-triphosphate bond. The presence of a cap is important in providing resistance to nucleases found in most eukaryotic cells. The tail is typically a polyadenylation event, whereby a polyadenylated portion is added to the 3' end of the mRNA molecule. The presence of this "tail" serves to protect the mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a series of amino acids that make up proteins.

[0041] mRNA may be synthesized according to any of a variety of known methods. For example, the mRNA of the present invention may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically carried out with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), deoxyribonuclease I, pyrophosphatase, and / or ribonuclease inhibitors. Stringent conditions will vary according to the specific application.

[0042] In some embodiments, in vitro synthesized mRNA may be purified prior to formulation and encapsulation to remove undesirable impurities, including various enzymes and other reagents used during mRNA synthesis.

[0043] The present invention may be used to formulate and encapsulate mRNAs of various lengths. In some embodiments, the present invention may be used to formulate and encapsulate in vitro synthesized mRNAs of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention may be used to formulate and encapsulate in vitro synthesized mRNAs of lengths ranging from about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb.

[0044] The present invention may be used to formulate and encapsulate mRNA that is unmodified or that contains one or more modifications that typically enhance stability, in some embodiments the modifications are selected from modified nucleotides, modified sugar phosphate backbones, 5' and / or 3' untranslated regions.

[0045] In some embodiments, the modification of the mRNA may include modification of the nucleotides of the RNA. The modified mRNA of the present invention may include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA may include purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine (C), uracil (U ... , 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-2-thio-uracil, The nucleotides may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queuosine, beta-D-mannosyl-queuosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogs is described, for example, in US Pat. No. 6,399,413, the disclosure of which is incorporated herein by reference in its entirety. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, all of which are incorporated herein by reference.

[0046] Typically, mRNA synthesis involves the addition of a "cap" to the N-terminal (5') end and a "tail" to the C-terminal (3') end. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation.

[0047] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase, creating a 5'5'5 triphosphate bond; then, the 7-nitrogen of guanine is methylated by methyltransferase. 2'-O-methylation can also occur at the first and / or second base after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (m refers to the 2'-O methyl residue).

[0048] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0049] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the location of the mRNA in the cell, or one or more binding sites for an miRNA, hi some embodiments, the 3' untranslated region can be 50-500 nucleotides in length or longer.

[0050] While mRNA provided from an in vitro transcription reaction may be desirable in some embodiments, other sources of mRNA are contemplated to be within the scope of the present invention, including mRNA produced from bacteria, fungi, plants, and / or animals.

[0051] The present invention may be used to formulate and encapsulate mRNAs that code for various proteins.Non-limiting examples of mRNAs suitable for the present invention include mRNAs that code for spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinic acid synthase (ASS1), firefly luciferase, factor IX (FIX), phenylalanine hydroxylase (PAH), and cystic fibrosis transmembrane conductance receptor (CFTR).Exemplary mRNA sequences are detailed in the Examples section.

[0052] mRNA solution The mRNA may be provided in a solution that is mixed with the lipid solution so that the mRNA can be encapsulated in the lipid nanoparticles. A suitable mRNA solution may be any aqueous solution that contains the mRNA to be encapsulated at various concentrations. For example, a suitable mRNA solution may contain the mRNA at about 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 ... In some embodiments, a suitable mRNA solution may contain mRNA at a concentration of about 0.01-1.0 mg / ml, 0.01-0.9 mg / ml, 0.01-0.8 mg / ml, 0.01-0.7 mg / ml, 0.01-0.6 mg / ml, 0.01-0.5 mg / ml, 0.01-0.4 mg / ml, 0.01-0.3 mg / ml, 0.01-0.2 mg / ml, 0.01-0.1 mg / ml, 0.05-1.0 mg / ml, 0.05-0.9 mg / ml, or 1.0 mg / ml or more. ml, 0.05-0.8 mg / ml, 0.05-0.7 mg / ml, 0.05-0.6 mg / ml, 0.05-0.5 mg / ml, 0.05-0.4 mg / ml, 0.05-0.3 mg / ml, 0.05-0.2 mg / ml, 0.05-0.1 mg / ml, 0.1-1.0 mg / ml, 0.2-0.9 mg / ml, 0.3-0.8 mg / ml, 0.4-0.7 mg / ml, or 0.5-0.6 mg / ml. In some embodiments, a suitable mRNA solution may contain mRNA at a concentration of up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, .09 mg / ml, 0.08 mg / ml, 0.07 mg / ml, 0.06 mg / ml, or 0.05 mg / ml.

[0053] Typically, a suitable mRNA solution may also contain a buffer and / or salt. Typically, the buffer may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. In some embodiments, a suitable concentration of the buffer may be in the range of about 0.1 mM to 100 mM, 0.5 mM to 90 mM, 1.0 mM to 80 mM, 2 mM to 70 mM, 3 mM to 60 mM, 4 mM to 50 mM, 5 mM to 40 mM, 6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 to 12 mM. In some embodiments, a suitable concentration of buffering agent is about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or more.

[0054] Exemplary salts can include sodium chloride, magnesium chloride, and potassium chloride. In some embodiments, suitable concentrations of salt in the mRNA solution can range from about 1 mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM. Suitable salt concentrations in the mRNA solution are about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or more.

[0055] In some embodiments, a suitable mRNA solution may have a pH in the range of about 3.5-6.5, 3.5-6.0, 3.5-5.5, 3.5-5.0, 3.5-4.5, 4.0-5.5, 4.0-5.0, 4.0-4.9, 4.0-4.8, 4.0-4.7, 4.0-4.6, or 4.0-4.5. In some embodiments, a suitable mRNA solution may have a pH of about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and less than 6.5.

[0056] A variety of methods may be used to prepare an mRNA solution suitable for the present invention. In some embodiments, the mRNA may be dissolved directly in a buffer solution as described herein. In some embodiments, an mRNA solution may be produced by mixing the mRNA stock solution with a buffer solution prior to mixing with a lipid solution for encapsulation. In some embodiments, an mRNA solution may be produced by mixing the mRNA stock solution with a buffer solution immediately prior to mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may be approximately 0.2 mg The mRNA may be contained in water at a concentration of 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml or more.

[0057] In some embodiments, the mRNA stock solution is mixed with the buffer using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps.

[0058] Typically, the buffer is mixed at a ratio greater than that of the mRNA stock solution. For example, the buffer may be mixed at a ratio at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x greater than that of the mRNA stock solution. In some embodiments, the buffer may be mixed at a flow rate in the range of about 100-6000 ml / min (e.g., about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, 4800-6000 ml / min, or 60-420 ml / min). In some embodiments, the buffer is mixed at a flow rate of about 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or greater.

[0059] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of about 10 to 600 ml / min (e.g., about 5 to 50 ml / min, about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of about 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or greater.

[0060] Lipid solution In accordance with the present invention, the lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulating mRNA. In some embodiments, the suitable lipid solution is ethanol-based. For example, the suitable lipid solution may contain a mixture of desired lipids dissolved in pure ethanol (i.e., 100% ethanol). In another embodiment, the suitable lipid solution is isopropyl alcohol-based. In another embodiment, the suitable lipid solution is dimethyl sulfoxide-based. In another embodiment, the suitable lipid solution is a mixture of suitable solvents including, but not limited to, ethanol, isopropyl alcohol, and dimethyl sulfoxide.

[0061] A suitable lipid solution may contain a mixture of desired lipids at various concentrations. For example, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of about 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml or more. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of about 0.1-100 mg / ml, 0.5-90 mg / ml, 1.0-80 mg / ml, 1.0-70 mg / ml, 1.0-60 mg / ml, 1.0-50 mg / ml, or more. The lipid solution may contain a mixture of desired lipids at a total concentration ranging from 1.0-40 mg / ml, 1.0-30 mg / ml, 1.0-20 mg / ml, 1.0-15 mg / ml, 1.0-10 mg / ml, 1.0-9 mg / ml, 1.0-8 mg / ml, 1.0-7 mg / ml, 1.0-6 mg / ml, or 1.0-5 mg / ml. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration up to about 100 mg / ml, 90 mg / ml, 80 mg / ml, 70 mg / ml, 60 mg / ml, 50 mg / ml, 40 mg / ml, 30 mg / ml, 20 mg / ml, or 10 mg / ml.

[0062] Any desired lipids may be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids including cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and / or PEGylated lipids. In some embodiments, a suitable lipid solution contains a mixture of desired lipids including one or more cationic lipids, one or more helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and one or more PEGylated lipids.

[0063] Cationic lipids As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH.Some cationic lipids have been described in the literature, and many of them are commercially available.Cationic lipids that are particularly suitable for use in the compositions and methods of the present invention include those described in International Patent Publication WO2010 / 053572 (and in particular C12-200 described in paragraph

[0225] ) and WO2012 / 170930, both of which are incorporated herein by reference. In certain embodiments, cationic lipids suitable for the compositions and methods of the present invention include ionizable cationic lipids described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012, which is incorporated herein by reference, such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ( HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002).

[0064] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include those cationic lipids described in WO2013063468 and in U.S. Provisional Patent Application entitled "Lipid Formulations for Delivery of Messenger RNA," both of which are incorporated herein by reference. In some embodiments, the cationic lipid has the formula I-c1-a: [ka] In the formula, each R 2 are independently hydrogen or C 1-3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is alkyl; Each R L is independently 8-12 is alkyl, or a pharma- ceutically acceptable salt thereof.

[0065] In some embodiments, each R 2 is independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0066] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0067] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0068] In some embodiments, each R L is independently 8-12 In some embodiments, each R L are independent of each other, 8-12 In some embodiments, each R L is independently 9-11 In some embodiments, each R L are independent of each other, 9-11 In some embodiments, each R L is independently 10 In some embodiments, each R L are independent of each other, 10 It is an alkyl.

[0069] In some embodiments, each R 2 is independently hydrogen or methyl; each q is independently 3 to 5; each R' is independently hydrogen or methyl; each R L is independently 8-12 It is an alkyl.

[0070] In some embodiments, each R 2 is hydrogen; each q is independently 3 to 5; each R' is hydrogen; L is independently 8-12 It is an alkyl.

[0071] In some embodiments, each R 2 is hydrogen; each q is 4; each R' is hydrogen; L is independently 8-12 It is an alkyl.

[0072] In some embodiments, the cationic lipid has formula Ig: [ka] In the formula, each R L is independently 8-12 In some embodiments, each R is an alkyl group, or a pharma- ceutical acceptable salt thereof. L are independent of each other, 8-12 In some embodiments, each R L is independently 9-11 In some embodiments, each R L are independent of each other, 9-11 In some embodiments, each R L is independently 10 In some embodiments, each R L nC 10 It is an alkyl.

[0073] In certain embodiments, a suitable cationic lipid is cKK-E12, or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below: [ka]

[0074] In some embodiments, one or more cationic lipids suitable for the present invention may be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA" (Feigner et al., (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355). Other Suitable cationic lipids include, for example, 5-carboxyspermylglycine dioctadecylamide or "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium or "DOSPA" (Behr et al., Proc. Nat.'l Acad. Sci. 86, 6982 (1989); U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane or "DODAP", 1,2-dioleoyl-3-trimethylammonium-propane or "DOTAP".

[0075] Further exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-distearyl-N,N -Dimethylammonium (arnrnonium) bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-Dimethylamino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane or "CLinDMA", 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleoylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", aminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin--DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA)) (WO2010 / 042877; Semple et al., Nature Biotech.28:172-176 (2010)), or a mixture thereof (Heyes, J. et al., J. Controlled Release 107:276-287 (2005); Morrissey, DV. et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO 2005 / 121348 A1). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole, dialkylamino, or guanidinium moiety.

[0076] In some embodiments, the one or more cationic lipids are selected from the group consisting of XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl), ALNY-200 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((3aR,5s,6aS)-octadeca-9,12-dienyl), ALNY-200 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((3aR,5s,6aS)-octadeca-9,12-dienyl), ALNY-100 ((3aR,5s,6aS)-octadeca-9,12-dienyl), ALNY-2 ... (undecyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO 2012 / 170889, the teachings of which are incorporated herein by reference in their entirety). No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), aminoalcohol lipidoids such as those disclosed in WO 2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acid and DLin-KC2-DMA (Semple, SC et al., "Rational Design of Cationic Lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), and C12-200 (Love, KT et al., "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869).

[0077] In some embodiments, the cationic lipid comprises at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid in a suitable lipid solution by weight or molar. In some embodiments, the cationic lipid(s) comprises about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid mixture by weight or molar.

[0078] Non-cationic / helper lipids As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (D ... Examples of suitable phosphatidylethanolamines include, but are not limited to, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), ...

[0079] In some embodiments, the non-cationic lipids may comprise at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipids in a suitable lipid solution, by weight or molar. In some embodiments, the non-cationic lipid(s) comprise about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution, by weight or molar.

[0080] Cholesterol-based lipids In some embodiments, a suitable lipid solution comprises one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23,139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid(s) constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipid in a suitable lipid solution, by weight or molar. In some embodiments, the cholesterol-based lipid(s) constitute about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid in a suitable lipid solution, by weight or molar.

[0081] PEGylated lipids In some embodiments, a suitable lipid solution comprises one or more PEGylated lipids. The use of polyethylene glycol (PEG) modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8PEG-2000 ceramide), is also contemplated by the present invention. Contemplated PEG-modified lipids include C6-C 20 These include, but are not limited to, polyethylene glycol chains of up to 5 kDa in length covalently attached to the lipid with an alkyl chain(s) of length. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, particularly useful exchangeable lipids have shorter acyl chains (e.g., C 14 or C 18 ) is a PEG-ceramide.

[0082] The PEG-modified phospholipids and derivatized lipids may comprise at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable lipid solution, by weight or molar. In some embodiments, the PEGylated lipid(s) comprise about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution, by weight or molar.

[0083] The exemplary combination of cationic lipid, non-cationic lipid, cholesterol-based lipid and PEG-modified lipid is described in the examples section.For example, suitable lipid solution may contain cKK-E12, DOPE, chol and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT5000, DOPE, chol and DMG-PEG2K; HGT5001, DOPE, chol and DMG-PEG2K; cKK-E12, DPPC, chol and DMG-PEG2K; C12-200, DPPC, cholesterol and DMG-PEG2K; HGT5000, DPPC, chol and DMG-PEG2K; or HGT5001, DPPC, chol and DMG-PEG2K. The selection of cationic lipid, non-cationic lipid, and / or PEG-modified lipid that comprise lipid mixture, and the relative molar ratio of such lipids to each other are based on the characteristics of selected lipid(s) and the characteristics and properties of the mRNA to be encapsulated. Further considerations include, for example, the saturation of alkyl chain, and the size, charge, pH, pKa, membrane fusogenicity, and toxicity of selected lipid(s). Thus, the molar ratio can be adjusted accordingly.

[0084] Mixing Process The present invention is based on the discovery of an unexpected effect of temperature on mRNA encapsulation efficiency and recovery. Thus, in some embodiments, the present invention provides an mRNA solution as described herein. The present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles by mixing a lipid solution with a glycerol, wherein the mRNA solution and / or the lipid solution are heated to a predetermined temperature above ambient temperature. As used herein, the term "ambient temperature" refers to room temperature or the temperature surrounding the object of interest (e.g., the mRNA solution or the lipid solution) without heating or cooling. In some embodiments, ambient temperature refers to a temperature in the range of about 20-25°C.

[0085] Thus, the predetermined temperature above ambient temperature is typically greater than about 25° C. In some embodiments, the predetermined temperature suitable for the present invention is greater than about 30° C., 37° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., or 70° C. In some embodiments, the predetermined temperature suitable for the present invention is in the range of about 25-70° C., about 30-70° C., about 35-70° C., about 40-70° C., about 45-70° C., about 50-70° C., or about 60-70° C. In certain embodiments, the predetermined temperature suitable for the present invention is about 65° C.

[0086] The mRNA solution, or the lipid solution, or both, may be heated to a predetermined temperature above ambient temperature before mixing. In some embodiments, the mRNA solution and the lipid solution are heated to a predetermined temperature separately before mixing. In some embodiments, the mRNA solution and the lipid solution are mixed at ambient temperature, but then heated to a predetermined temperature after mixing. In some embodiments, the lipid solution is heated to a predetermined temperature and mixed with the mRNA solution at ambient temperature. In some embodiments, the mRNA solution is heated to a predetermined temperature and mixed with the lipid solution at ambient temperature.

[0087] In some embodiments, the mRNA solution is heated to a predetermined temperature by adding an ambient temperature mRNA stock solution to a heated buffer to achieve the desired predetermined temperature.

[0088] The mRNA solution and the lipid solution may be mixed using a pump. The encapsulation procedure can occur at a wide range of scales, so different types of pumps may be used to accommodate the desired scale. In general, however, it is desirable to use a low-pulse flow pump. As used herein, a low-pulse flow pump refers to any pump that can establish a continuous flow at a stable flow rate. Suitable pump types include, but are not limited to, gear pumps and centrifugal pumps. Exemplary gear pumps include, but are not limited to, Cole-Parmer or Diener gear pumps. Exemplary centrifugal pumps include, but are not limited to, those manufactured by Grainger or Cole-Parmer.

[0089] The mRNA solution and lipid solution can be mixed at various flow rates.Typically, the mRNA solution can be mixed at a ratio that exceeds that of the lipid solution.For example, the mRNA solution can be mixed at a ratio that is at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x greater than that of the lipid solution.

[0090] A suitable flow rate for mixing may be determined based on scale. In some embodiments, the mRNA solution is mixed at a flow rate of about 40-400 ml / min, 60-500 ml / min, 70-600 ml / min, 80-700 ml / min, 90-800 ml / min, 100-900 ml / min, 110-1000 ml / min, 120-1100 ml / min, 130-1200 ml / min, 140-1300 ml / min, 150-1400 ml / min, 160-1700 ml / min, 170-1800 ml / min, 180-1900 ml / min, 190-2100 ml / min, 210-2200 ml / min, 220-2300 ml / min, 230-2400 ml / min, 240-2500 ml / min, 250-2600 ml / min, 260-2700 ml / min, 270-2800 ml / min, 280-2900 ml / min, 290-3000 ml / min, 300-3100 ml / min, 320-3300 ml / min, 340-3500 ml / min, 350-3600 ml / min, 360-3700 ml / min, 370-3800 ml / min, 380-3900 ml / min, 390-4000 ml / min, 400-4100 ml / min, 420-4300 ml / min, 440-4500 ml / min, 450-4600 ml / min, 460-4700 ml / min, 470-4800 ml / min, In some embodiments, the mRNA solution is mixed at a flow rate ranging from about 200 ml / min, about 500 ml / min, about 1000 ml / min, about 2000 ml / min, about 3000 ml / min, about 4000 ml / min, or about 500 ml / min. The mixture is mixed at a flow rate of 1000 ml / min, or approximately 5000 ml / min.

[0091] In some embodiments, the lipid solution is mixed at a flow rate in the range of about 25-75 ml / min, 20-50 ml / min, 25-75 ml / min, 30-90 ml / min, 40-100 ml / min, 50-110 ml / min, 75-200 ml / min, 200-350 ml / min, 350-500 ml / min, 500-650 ml / min, 650-850 ml / min, or 850-1000 ml / min. In some embodiments, the lipid solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

[0092] Typically, the mRNA solution and the lipid solution are mixed in a solution so that the lipid can form nanoparticles that encapsulate the mRNA. Such a solution is also referred to as a formulation or encapsulation solution. A suitable formulation or encapsulation solution may be based on a solvent such as ethanol. For example, a suitable formulation or encapsulation solution may be based on about 10% ethanol, about 15% ethanol, about 20% ethanol, about 25% ethanol, about 30% ethanol, about 35% ethanol, or about 40% ethanol.

[0093] A suitable formulation or encapsulation solution may be based on a solvent such as isopropyl alcohol. For example, a suitable formulation or encapsulation solution may be based on about 10% isopropyl alcohol, about 15% isopropyl alcohol, about 20% isopropyl alcohol, about 25% isopropyl alcohol, about 30% isopropyl alcohol, about 35% isopropyl alcohol, or about 40% isopropyl alcohol.

[0094] A suitable formulation or encapsulation solution may be based on a solvent such as dimethylsulfoxide. For example, a suitable formulation or encapsulation solution may be based on about 10% dimethylsulfoxide, about 15% dimethylsulfoxide, about 20% dimethylsulfoxide, about 25% dimethylsulfoxide, about 30% dimethylsulfoxide, about 35% dimethylsulfoxide, or about 40% dimethylsulfoxide.

[0095] Suitable formulations or encapsulation solutions may also contain buffers or salts. Exemplary buffers may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride.

[0096] purification Typically, after formulation and encapsulation, lipid nanoparticles are purified and / or concentrated. A variety of purification techniques may be used. In some embodiments, lipid nanoparticles are purified using tangential flow filtration. Tangential flow filtration (TFF), also referred to as cross-flow filtration, is a type of filtration in which the material to be filtered passes tangentially through the filter rather than through it. In TFF, the undesired permeate passes through the filter, while the desired retentate passes along the filter and is collected downstream. It is important to note that in TFF, the desired material is typically contained in the retentate, as opposed to what is usually encountered in traditional dead-end filtration.

[0097] Depending on the material being filtered, TFF is used for either microfiltration or ultrafiltration. Microfiltration is typically defined as the case where the filter has a pore size between 0.05 μm and 1.0 μm, inclusive, while ultrafiltration is typically This necessarily includes filters with pore sizes less than 0.05 μm. The pore size also determines the nominal molecular weight cut-off (NMWL), also referred to as the molecular weight cut-off (MWCO) for a particular filter; typically, microfiltration membranes have an NMWL greater than 1,000 kilodaltons (kDa), and ultrafiltration filters have an NMWL between 1 kDa and 1,000 kDa.

[0098] The primary advantage of tangential flow filtration is that non-permeable particles (sometimes referred to as "filter cake") that may agglomerate and block the filter during traditional "dead-end" filtration are instead carried along the surface of the filter. This advantage allows tangential flow filtration to be widely used in industrial processes that require continuous operation because it generally eliminates the need to remove and clean filters, thus significantly reducing downtime.

[0099] Tangential flow filtration can be used for several purposes, including concentration and diafiltration, among others. Concentration is a process by which a solvent is removed from a solution while solute molecules are retained. To efficiently concentrate a sample, a membrane is used that has a NMWL or MWCO that is substantially lower than the molecular weight of the solute molecules to be retained. Typically, one skilled in the art may select a filter that has a NMWL or MWCO that is 3-6 times lower than the molecular weight of the target molecule(s).

[0100] Diafiltration is a fractionation process whereby small undesirable particles pass through the filter while large desired nanoparticles are retained in the retentate without changing the concentration of the nanoparticles in the solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration can be continuous or discontinuous. In continuous diafiltration, the diafiltration solution is added to the sample at the same rate that the filtrate is produced. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting concentration. Discontinuous diafiltration can be repeated until the desired concentration of nanoparticles is reached.

[0101] The purified and / or concentrated lipid nanoparticles may be formulated in a desired buffer, such as, for example, PBS.

[0102] Provision of nanoparticles encapsulating mRNA The process of the present invention results in more uniform and smaller particle size (eg, less than 100 nm) as well as significantly improved encapsulation efficiency and / or mRNA recovery compared to prior art processes.

[0103] Thus, the present invention provides a composition comprising the purified nanoparticles described herein. In some embodiments, the majority of the purified nanoparticles in the composition, i.e., more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have a size of less than about 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, substantially all of the purified nanoparticles have a size of less than 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm).

[0104] In addition, more homogeneous nanoparticles having a narrow nanoparticle size range are achieved by the process of the present invention, for example, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles in the compositions provided by the present invention. have a size in the range of about 40 to 90 nm (e.g., about 40 to 85 nm, about 40 to 80 nm, about 40 to 75 nm, about 40 to 70 nm, about 40 to 65 nm, or about 40 to 60 nm). In some embodiments, substantially all of the purified nanoparticles have a size in the range of about 40 to 90 nm (e.g., about 40 to 85 nm, about 40 to 80 nm, about 40 to 75 nm, about 40 to 70 nm, about 40 to 65 nm, or about 40 to 60 nm).

[0105] In some embodiments, the dispersibility, or molecular size uniformity measure (PDI), of the nanoparticles in the compositions provided herein is less than about 0.16 (e.g., less than about 0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.09, or 0.08).

[0106] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles in the compositions provided herein encapsulate mRNA within each individual particle, in some embodiments, substantially all of the purified lipid nanoparticles in the composition encapsulate mRNA within each individual particle.

[0107] In some embodiments, compositions of the present invention contain at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. In some embodiments, processes of the present invention result in greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% recovery of mRNA. EXAMPLES

[0108] While certain compounds, compositions and methods of the invention have been described with specificity in accordance with certain embodiments, the following examples serve merely to illustrate the compounds of the invention and are not intended to be limiting thereof.

[0109] Example 1. Effect of temperature on the nanoparticle encapsulation process This example demonstrates that increasing the temperature during the nanoparticle encapsulation process results in increased yield and / or encapsulation efficiency.

[0110] lipid material The formulations described in the Examples below contain, unless otherwise specified, various ratios of multi-component lipid mixtures employing one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and PEGylated lipids designed to encapsulate various nucleic acid materials. The cationic lipids for this process are DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic Lipids," vol. 11, no. 1, pp. 111-115, 2003). lipid saturation influences intracellular delivery of encapsulated nucleic acids” J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al., “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al., “Lipid-like materials for low-dose in vivo gene silencing” PNAS 2010, 107, 1864-1869), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl) These may include, but are not limited to, dialkylamino, imidazole, guanidinium, and the like. Helper lipids can include, but are not limited to, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), cholesterol, and the like. PEGylated lipids can include, but are not limited to, poly(ethylene) glycol chains of up to 5 kDa in length covalently attached to the lipid by alkyl chain(s) of C6-C20 length.

[0111] Messenger RNA Materials Codon-optimized human spinal motor neuron 1 (SMN) messenger RNA, argininosuccinate synthetase (ASS1) messenger RNA, modified cystic fibrosis transmembrane conductance regulator (SNIM® CFTR, 25% pseudouridine, 25% 5-methyl-cytidine) messenger RNA, firefly luciferase (FFL) messenger RNA, factor IX (FIX) messenger RNA, phelyalanine hydroxylase (PAH) messenger RNA and alpha-galactosidase (GLA) messenger RNA were synthesized by in vitro transcription from plasmid DNA templates encoding the genes and subsequently modified with a 5′ cap structure (cap1) (Fechter, P.; Brownlee, GG “Recognition of mRNA cap structures by viral and cellular proteins” J. Gen. Virology 2005, 86, 1239-1249) and a 3' polyA tail of approximately 250 nucleotides in length as determined by gel electrophoresis. The 5' and 3' untranslated regions present in each mRNA product are designated as X and Y, respectively, and are defined as described (below). Codon-optimized human spinal motor neuron 1 (SMN) mRNA: XAUGGCCAUGAGCAGCGGAGGCAGCGGCGGAGGAGUGCCCGAGCAGGAGGACAGCGUGCUGUUCAGGAGAGGCACCGGCCAGAGCGAUGAGCGAUAUCUGGGACGAUACCGCUCUGAUCAAGGCCUACGACAAGGCCGUGGCCAGCUUCAAGCACGCCCUGAAAAACGGCGACAUCUGCGAGACCAGCGGCAAGCCCA AGACAACCCCCAAGAGAAAGCCCGCCAAGAGAAUAAGAGCCAGAAAAAAACACCGCCGCCAGCCUGCAGCAGUGGAAGGUGGGCGACAAGUCAGCGCCAUCUGGAGCGAGGACGGCUGCAUCUACCCGCCCACCAUCGCCAGCAUCGAUCAAGAGAGAGACCUGCGUGGUCGUGUACACGGCUACGGCAACACA GAGGAGCAGAACCUGAGCGACCUGUGCCCCAUUUGUGAGGUGGCCAAUAAACAUCGAACAGACGCCCAGGAGAACGAGAAUGAAAGCCAGGUGAGCACCGACGAGAGCAGAACAGCAUGUCCUCCCUUGGAACAGCUUCCUCCUCCUCCACCAUGCCCGGACCAGACUGGGACCCGGAAACCUGGCCUGAGUUCAACGGACCACCCCCUCCCUCCCACCUCUCUCUCUCUCUCUCUCUCUCUCCCACGGACCCCCUAUAUCCCACCACCCCCUCCAUCUGCCCCUCCAUCUCCCCGACUCCCCGACUCCCCGACUCGCCCUGACGCCGAGCAGCCGAGCAGCCGAGCAGCCGAGCAGCCGAGCAUGCCUGAUCAUCCU GGUACAUGAGCGGCUACCACACAGGAUACUACAUGGGCUUCAGACAGAACCAGAAGGGAGGCAGAUGCUCCCACUCCCUGAACUGAY ヒトカルファ-ガラクトシダーズ(GLA)mRNA: Codon-optimized human argininosuccinate synthetase (ASS1) mRNA: XAUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCU GAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGGCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCCCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGGGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGAGUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAGGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCCUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGCCCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACCACCGCCUGCAGAGCAAGGUGACCGCCAAGUGAY Codon-optimized firefly luciferase mRNA: GCGGCGAGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGUUAACAACCCCGAGGCUACAAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCUUCAUCGUGGACCGGCUGAAGAGCCUGAUCAAAUACAAGGGCUACCAGGUAGCCCCAGCCGAACUGGAGAGCAUCCUGCUGCAACACCCCAACAUCUUCGACGCCGGGGUCGCCGGCCUGCCCGACGACGAUGCCGGCGAGCUGCCCGCCGCAGUCGUCGUGCUGGAACACGGUAAAACCAUGACCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCCAGGUUACAACCGCCAAGAAGCUGCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAAAGGACUGACCGGCAAGUUGGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAGAAGGGCGGCAAGAUCGCCGUGUAAY Human Factor IX (FIX) mRNA: Codon-optimized human phenylalanine hydroxylase (PAH) mRNA: Codon-optimized cystic fibrosis transmembrane conductance regulator (CFTR) mRNA: AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCAUGGACUCGGCCUAUCCUUAGAAAGGGGUAUCGGCAGAGGCUUGAGUUGUCUGACAUCUACCAGAUCCCCUCGGUAGAUUCGGCGGAUAACCUCUCGGAGAAGCUCGAACGGGAAUGGGACCGCGAACUCGCGUCUAAGAAAAACCCGAAGCUCAUCAACGCACUGAGAAGGUGCUUCUUCUGGCGGUUCAUGUUCUACGGUAUCUUCUUGUAUCUCGGGGAGGUCACAAAAGCAGUCCAACCCCUGUUGUUGGGUCGCAUUAUCGCCUCGUACGACCCCGAUAACAAAGAAGAACGGAGCAUCGCGAUCUACCUCGGGAUCGGACUGUGUUUGCUUUUCAUCGUCAGAACACUUUUGUUGCAUCCAGCAAUCUUCGGCCUCCAUCACAUCGGUAUGCAGAUGCGAAUCGCUAUGUUUAGCUUGAUCUACAAAAAGACACUGAAACUCUCGUCGCGGGUGUUGGAUAAGAUUUCCAUCGGUCAGUUGGUGUCCCUGCUUAGUAAUAA 5' and 3' UTR sequences X= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG Y=CGGGUGGCAUCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU

[0112] Lipid nanoparticle formulations Ethanol solutions of the mixture of lipids (cationic lipids, helper lipids, zwitterionic lipids, PEG lipids, etc.) were prepared to the reported volumes and heated to the selected temperature. Separately, a buffered aqueous solution of mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution and heated to the selected temperature for 5-10 min.

[0113] For small-scale preparations, the lipid solution was rapidly injected (3.71 mL / sec) into the aqueous mRNA solution using a syringe pump, and the resulting suspension was shaken to obtain 20% ethanol containing lipid nanoparticles. The resulting nanoparticle suspension was diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C.

[0114] Representative Example at 25°C Aliquots of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FFL mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated and stored at 2-8 °C. Final concentration = 0.20 mg / mL FFL mRNA (encapsulated). Z ave =91nm PDI(0.16).

[0115] Preparation at 37°C Aliquots of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FIX mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated and stored at 2-8 °C. Final concentration = 0.20 mg / mL FIX mRNA (encapsulated). Z ave = 64 nm; PDI (0.12).

[0116] Formulation at 65°C Aliquots of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FIX mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated and stored at 2-8 °C. Final concentration = 0.20 mg / mL FIX mRNA (encapsulated). Zave = 73 nm; PDI (0.13).

[0117] Effect of temperature on the nanoparticle encapsulation process Both the ethanolic lipid solution and the buffered aqueous solution of mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) were heated at different selected temperatures prior to the formulation process to determine the effect of temperature on the final yield and encapsulation efficiency of the formulation.

[0118] The effect of temperature on the nanoparticle formulation process was evaluated for size, size dispersity, encapsulation efficiency and yield (or recovery). Exemplary data is shown in Table 1. As can be seen, an increase in temperature (e.g., above ambient temperature) results in an increase in encapsulation efficiency and / or yield / recovery, and a decrease in particle size and / or size dispersity. [Table 1]

[0119] Example 2. Scaled-up formulation process This example illustrates an exemplary scaled-up formulation process for encapsulating mRNA at increased temperatures.

[0120] An exemplary scaled-up formulation process is shown in Figure 1. An Ismatec programmable digitally driven pump (Cole Parmer model number CP78008-10) was used. A Micropump A-mount suction shoe pump head 316 SS body / graphite gear / PTFE seal, 0.084mL / rev, no internal bypass (Cole Parmer part number 07002-27) and Pharma Pure tubing size #14, 0.06" ID, 1 / 16" (Spectrum labs part number ACTU-P14 -25N) was used.

[0121] Nanoparticle formulations and encapsulation of mRNA are prepared by mixing ethanol lipid solution and mRNA in citrate buffer (10 mM citrate buffer, 150 mM NaCl, pH 4.5) using a "T" junction (or "Y" junction). Exemplary flow rates of citrate buffer containing mRNA and ethanol solution containing lipid are 200 ml / min and 50 ml / min, respectively. During this process, both pumps are started simultaneously. Fractions at the beginning and end of the formulation were discarded and only the intermediate formulation was collected. Accurate flow rate and low pulse flow are two important parameters of this process.

[0122] Purification and buffer exchange Purification and buffer exchange of the formulation obtained from the above steps is performed on a KrosFlo® Research IIi tangential flow filtration system from Spectrum labs using modified polyethersulfone hollow fiber filter modules. Buffer exchange is performed in continuous diafiltration mode with 6 volumes of sterile PBS (pH 7.4). See Figure 2. The formulation is analyzed for size (PDI) and encapsulation (yield). Exemplary data is presented in Table 2. [Table 2-1] [Table 2-2]

[0123] Using this process, very narrow particle size ranges and high encapsulation efficiencies (eg, averages greater than 90%) are achieved.

[0124] To test the importance of low pulse homogeneous flow, a peristaltic pump with some pulsatile flow was used for the formulation process. See Figure 3. The citrate buffer containing mRNA and the pure ethanol containing lipid were mixed at flow rates of 200ml / min and 50ml / min, respectively. Exemplary results are shown in Table 3. As can be seen, the use of a peristaltic pump in this process results in the formulation of nanoparticles with larger sizes. This is likely due to the non-homogenous mixing caused by the pulsatile flow. [Table 3]

[0125] Equivalence and Scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited by the above description, but is set forth in the following claims.

Claims

1. 1. A process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, the process comprising: mixing an mRNA solution and a lipid solution; Here, the mRNA solution is mixed at a flow rate ranging from 150 to 5000 ml / min; The lipid solution is mixed at a flow rate ranging from 25 to 1000 ml / min; The process wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature, and the mRNA solution and the lipid solution are mixed by a low pulse flow pump.

2. 2. The process of claim 1, wherein the predetermined temperature is at or above about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C.

3. The predetermined temperature is about 25 to 70° C., about 30 to 70° C., about 35 to 70° C., about 40 to 70° C.

3. The process of claim 1 or 2, wherein the reaction temperature is in the range of about 45-70°C, about 50-70°C, or about 60-70°C.

4. The process of any one of claims 1 to 3, wherein the predetermined temperature is about 65°C.

5. 5. The process of claim 1, wherein the mRNA solution and the lipid solution are heated separately to the predetermined temperature before said mixing.

6. 5. The process of any one of claims 1 to 4, wherein prior to said mixing, the mRNA solution is heated to said predetermined temperature and the lipid solution is at ambient temperature.

7. 7. The process of any one of claims 1 to 6, wherein the mRNA solution is heated to said predetermined temperature by adding an ambient temperature stock mRNA solution to a heated buffer to bring it to said predetermined temperature.

8. 8. The process of claim 7, wherein the buffer has a pH of about 4.5 or less.

9. The process according to any one of claims 1 to 8, wherein the pump is a gear pump.

10. The process according to any one of claims 1 to 8, wherein the pump is a centrifugal pump.

11. 11. The process of any one of claims 1 to 10, wherein the mRNA solution is mixed at a flow rate in the range of about 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, 2000-3000 ml / min, 3000-4000 ml / min, or 4000-5000 ml / min, or at a flow rate of about 200 ml / min, about 500 ml / min, about 1000 ml / min, about 2000 ml / min, about 3000 ml / min, about 4000 ml / min, or about 5000 ml / min.

12. The lipid solution is mixed at a flow rate ranging from about 25-75 ml / min, about 75-200 ml / min, about 200-350 ml / min, about 350-500 ml / min, about 500-650 ml / min, about 650-850 ml / min, or about 850-1000 ml / min; or 12. The process of any one of claims 1 to 11, wherein the mixing is performed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

13. The process of any one of claims 1 to 12, wherein the process comprises first generating an mRNA solution by mixing a buffer with a stock mRNA solution.

14. 14. The process of claim 13, wherein the buffer is a citrate buffer.

15. 15. The process of claim 14, wherein the citrate buffer comprises about 10 mM citrate, about 150 mM NaCl, a pH of about 4.

5.

16. 16. The process of claim 13, wherein the stock mRNA solution contains the mRNA at a concentration of about 1 mg / ml, about 10 mg / ml, about 50 mg / ml, about 100 mg / ml or more.

17. 17. The process of any one of claims 13 to 16, wherein the lipid solution comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids and PEG lipids in ethanol.

18. 18. The process of any one of claims 13 to 17, wherein the mRNA solution and the lipid solution are mixed in 20% ethanol, resulting in a suspension of lipid nanoparticles.

19. 20. The process of claim 18, wherein the lipid nanoparticles are further purified by tangential flow filtration.

20. 20. The process of claim 19, wherein greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or substantially all of the purified nanoparticles have a size less than 100 nm.

21. More than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or substantially all of the purified nanoparticles are 5% or more. The process according to any one of claims 18 to 20, having a size in the range of 0 to 80 nm.

22. 22. The process of any one of claims 18 to 21, wherein the purified nanoparticles have an encapsulation rate of greater than about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

23. 23. The process of any one of claims 1-22, wherein the process results in a recovery of greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of mRNA.

24. 18. The process of claim 17, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

25. 18. The process of claim 17, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

26. 18. The process of claim 17, wherein the one or more cholesterol-based lipids is cholesterol or PEGylated cholesterol.

27. The one or more PEG-modified lipids are 6 -C 20 20. The process of claim 17, comprising a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to a lipid having an alkyl chain(s) of length.

28. The process according to any one of claims 1 to 27, wherein the mRNA comprises one or more modified nucleotides.

29. The process according to any one of claims 1 to 28, wherein the mRNA is unmodified.

Images