Compositions and methods for delivery of RNA

Abstract

The present disclosure relates to compositions and methods for the treatment of fibrotic diseases and disorders, and / or liver diseases and disorders with one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 131,528, entitled “COMPOSITIONS AND METHODS FOR DELIVERY OF RNA ENCODING TERT USING LIPIDS,” filed December 29, 2020, the disclosure of which is hereby incorporated by reference in its entirety.

[0002] Incorporating sequence tables The contents of the text file named "REJU-002_03WO_SeqList_ST25.txt", created on December 28, 2021, and 205KB in size, are hereby incorporated by reference in their entirety.

[0003] Technical Field The present disclosure relates generally to telomerase reverse transcriptase (TERT) messenger ribonucleic acid (mRNA) therapy for the treatment of fibrotic and liver diseases. [Background technology]

[0004] 2. Background of the Invention Drug treatment of fibrotic and liver diseases remains elusive, as indicated by the high mortality rate of these diseases. Currently, halting injury activity or disease is the primary method for treating fibrosis (e.g., of the liver) and liver diseases. Thus, there is a need for drug therapies to treat fibrotic and liver diseases. Summary of the Invention

[0005] Summary of the Invention The present disclosure relates to telomerase reverse transcriptase (TERT) messenger ribonucleic acid (mRNA) therapy for the treatment of, for example, hepatic, fibrotic diseases and conditions, and liver diseases and conditions. Treatment with a composition comprising TERT mRNA can prevent, reverse, or treat fibrosis and other pathological features of fibrotic disease and / or liver disease, leading to improved overall organ function and subject health. Thus, in some embodiments, compositions are provided herein that comprise one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

[0006] In some embodiments, a composition comprises (i) a ribonucleic acid (RNA) encoding telomerase reverse transcriptase (TERT); and (ii) a delivery vehicle, wherein the RNA of (i) comprises one or more modified nucleotides, and the delivery vehicle of (ii) is operably linked to the RNA of (i).

[0007] In some embodiments of the compositions of the present disclosure, the delivery vehicle comprises one or more of a nanoparticle, a liposome, a cationic lipid, an exosome, an extracellular vesicle, a lipid nanoparticle, a natural lipoprotein particle, and an artificial lipoprotein particle.

[0008] In some embodiments of the compositions of the present disclosure, the delivery vehicle comprises a lipid nanoparticle (LNP). In some embodiments, the delivery vehicle comprises an ionizable lipid and / or a cationic lipid.

[0009] In some embodiments, the delivery vehicle comprises a targeting moiety. In some embodiments, the targeting moiety causes the delivery vehicle to specifically or selectively interact with hepatocytes. In some embodiments, the targeting moiety comprises cholesterol. In some embodiments, the targeting moiety is a lipid, a peptide, and / or an antibody. In some embodiments, the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid. In some embodiments, the LNP comprises a molar ratio of about 30-70 moles of ionizable lipid to about 0.1-20 moles of phospholipid, about 20-60 moles of cholesterol, and about 0.1-5.5 moles of PEGylated lipid. In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the delivery vehicle comprises a compound of formula I, [ka] In the formula, R 1a and R 1b each independently represents an alkylene group having 1 to 6 carbon atoms; a and X b are each independently an acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, or an acyclic alkyl tertiary amino group having 2 to 5 carbon atoms, and a cyclic alkylene tertiary amino group having 1 to 2 tertiary amino groups; R 2a and R 2b each independently represents an alkylene or oxydialkylene group having 8 or fewer carbon atoms; Y a and Y b each independently represents an ester bond, an amide bond, a carbamate bond, an ether bond, or a urea bond; Z a and Z b are each independently a divalent group derived from an aromatic compound having 3 to 16 carbon atoms, at least one aromatic ring, and optionally a heteroatom; R 3a and R 3beach independently represents a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group and succinic anhydride or glutaric anhydride, or a residue derived from a reaction product of a sterol derivative having a hydroxyl group and succinic anhydride, or glutaric anhydride or an aliphatic hydrocarbon group having 12 to 22 carbon atoms.

[0010] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0011] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0012] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0013] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0014] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0015] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the compound of formula I is: [ka]

[0016] In some embodiments, the RNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1-5, 30-31, or 37-40.

[0017] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the RNA comprises a 5' cap. In some embodiments, the 5' cap comprises an anti-reverse cap analog (ARCA). In some embodiments, the ARCA comprises a 3'-O-Me-m7G(5')ppp(5')G structure. In some embodiments, the 5' cap comprises m7G(5')ppp(5')(2'OMeA)pG. In some embodiments, the 5' cap comprises m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0018] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the RNA further comprises at least one untranslated region (UTR). The UTR may comprise a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36. In some embodiments, the at least one UTR is located 5' to the RNA encoding (i) TERT. In some embodiments, the at least one UTR is located 3' to the RNA of (i). In some embodiments, the UTR comprises a human sequence. In some embodiments, the UTR comprises a non-human sequence or a synthetic sequence. In some embodiments, the UTR comprises a chimeric sequence. In some embodiments, the UTR increases the stability, increases the half-life, increases the rate of transcription, or decreases the time to initiation of transcription of the RNA of (i). In some embodiments, the UTR comprises a sequence having at least 70% identity to a UTR sequence isolated or derived from one or more of α-globin, β-globin, c-fos, and tobacco etch virus.

[0019] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the one or more modified nucleotides of the RNA of (i) include one or more of a modified adenine or analog thereof, a modified cytidine or analog thereof, a modified guanosine or analog thereof, and a modified uridine or analog thereof. In some embodiments, the one or more modified nucleotides of the RNA of (i) include one or more of 1-methylpseudouridine (also known as N1-methylpseudouridine), pseudouridine (N1m), 2-thiouridine, and 5-methylcytidine. In some embodiments, the one or more modified nucleotides of the RNA of (i) include 5-methoxyuridine (5-moU). In some embodiments, the one or more modified nucleotides of the RNA of (i) are m1A 1-methyladenosine, m6A N6-methyladenosine, Am 2'-O-methyladenosine, i6A N6-isopentenyladenosine, io6A N6-(cis-hydroxyisopentenyl)adenosine, ms2io6A 2-methylthio-N6(cis-hydroxyisopentenyl)adenosine, g6A N6-glycinylcarbamoyladenosine, t6A N6-threonylcarbamoyladenosine, ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine, Ar(p)2'-O-ribosyladenosine (phosphate), m6 2A N6,N6-dimethyladenosine, m6Am N6,2'-O-dimethyladenosine, m6 2Am N6,N6,2′-O-trimethyladenosine, m1Am 1,2′-O-dimethyladenosine, m3C 3-methylcytidine, m5C 5-methylcytidine, Cm 2′-O-methylcytidine, ac4C N4-acetylcytidine, f5C 5-formylcytidine, m4C N4-methylcytidine, hm5C 5-hydroxymethylcytidine, f5Cm 5-formyl-2′-O-methylcytidine, m1G 1-methylguanosine, m2G N2-methylguanosine, m7G 7-methylguanosine, Gm 2′-O-methylguanosine, m2 2G N2,N2-dimethylguanosine, Gr(p) 2′-O-ribosylguanosine (phosphate), yW wibutosine, o2yW peroxywibutosine, OHyW Hydroxywvutocine,OHyW* undermodified hydroxywybutosine, imG wyosine, m2,7G N2,7-dimethylguanosine, m2,2,7G N2,N2,7-trimethylguanosine, I inosine, m1I 1-methylinosine, Im 2'-O-methylinosine, Q queosine, galQ galactosyl-queosine, manQ mannosyl-queosine, Ψ pseudouridine, D dihydrouridine, m5U 5-methyluridine, Um 2'-O-methyluridine, m5Um 5,2'-O-dimethyluridine, m1Ψ 1-methylpseudouridine, Ψm 2'-O-methylpseudouridine, s2U 2-thiouridine, ho5U 5-hydroxyuridine, chm5U 5-(carboxyhydroxymethyl)uridine, mchm5U 5-(Carboxyhydroxymethyl)uridine, methyl ester mcm5U 5-methoxycarbonylmethyluridine, mcm5Um 5-methoxycarbonylmethyl-2'-O-methyluridine, mcm5s2U 5-methoxycarbonylmethyl-2-thiouridine, ncm5U 5-carbamoylmethyluridine, ncm5Um 5-carbamoylmethyl-2'-O-methyluridine, cmnm5U 5-carboxymethylaminomethyluridine, m3U 3-methyluridine, m1acp3Ψ 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, cm5U 5-carboxymethyluridine, m3Um 3,2′-O-dimethyluridine, m5D 5-methyldihydrouridine, τm5U 5-taurinomethyluridine, τm5s2U 5-taurinomethyl-2-thiouridine, 2-aminoadenosine, 2-amino-6-chloropurine riboside, 8-azaadenosine, 6-chloropurine riboside, 5-iodocytidine, 5-iodouridine, inosine, 2'-O-methylinosine, xanthosine, 4-thiouridine, O6-methylguanosine, 5,6-dihydrouridine, 2-thiocytidine, 6-azacytidine, 6-azauridine, 2'-O-methyl-2-aminoadenosine, 2'-O-methylpseudouridine, N1-methyladenosine, 2'-O-methyl-5-methyluridine, 7-deazaguanosine, 8-azidoadenosine, 5-bromocytidine, 5-bromouridine, 7-deazaadenosine, 5-aminoallyluridine,5-Aminoallylcytidine, 8-oxoguanosine, 2-aminopurine-riboside, pseudoisocytidine, N1-methylpseudouridine, 5,6-dihydro-5-methyluridine, N6-methyl-2-aminoadenosine, 5-carboxycytidine, 5-hydroxymethyluridine, thienoguanosine, 5-hydroxycytidine, 5-formyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-methoxycytidine, thienouridine, 5-carboxymethylesteruridine, thienocytidine, 8-oxoadenosine (Oxoaden oosine), isoguanosine, N1-ethylpseudouridine, N1-methyl-2'-O-methylpseudouridine, N1-methoxymethylpseudouridine, N1-propylpseudouridine, 2'-O-methyl-N6-methyladenosine, 2-amino-6-Cl-purine-2'-deoxyriboside, 2-amino-2'-deoxyadenosine, 2-aminopurine-2'-deoxyriboside, 5-bromo-2'-deoxycytidine, 5-bromo-2'-deoxyuridine, 6-chloropurine-2'-deoxyriboside, 7-deaza-2'-deoxy Cyadenosine, 7-deaza-2'-deoxyguanosine, 2'-deoxyinosine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxyuridine, 5-fluoro-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, N6-methyl-2'-deoxyadenosine, 5-methyl-2'-deoxycytidine, O6-methyl-2'-deoxyguanosine, N2-methyl-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine, 8-oxo-2'-deoxyguanosine , 2-thiothymidine, 2'-deoxy-P-nucleoside, 5-hydroxy-2'-deoxycytidine, 4-thiothymidine, 2-thio-2'-deoxycytidine, 6-aza-2'-deoxyuridine, 6-thio-2'-deoxyguanosine, 8-chloro-2'-deoxyadenosine, 5-aminoallyl-2'-deoxycytidine, 5-aminoallyl-2'-deoxyuridine, N4-methyl-2'-deoxycytidine, 2'-deoxyzebularine, 5-hydroxymethyl-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycytidine,5-propargylamino-2'-deoxycytidine, 5-propargylamino-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-formyl-2'-deoxycytidine, 5-[(3-indolyl)propionamido-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxyuridine, 5-formyl-2'-deoxyuridine, 7-deaza-7-propargylamino-2'-deoxyadenosine, 7-deaza-7-propargylamino-2'-deoxyguanosine, biotin-16-aminoallyl-2'-dUT P, biotin-16-aminoallyl-2'-dCTP, biotin-16-aminoallylcytidine, N4-biotin-OBEA-2'-deoxycytidine, biotin-16-aminoallyluridine, dabsyl-5-3-aminoallyl-2'-dUTP, desthiobiotin-6-aminoallyl-2'-deoxycytidine, desthiobiotin-16-aminoallyl-uridine, biotin-16-7-deaza-7-propargylamino-2'-deoxyguanosine, cyanine 3-5-propargylamino-2'-deoxycytidine, cyanine 3-6-propargyl Amino-2'-deoxyuridine, Cyanine 5-6-propargylamino-2'-deoxycytidine, Cyanine 5-6-propargylamino-2'-deoxyuridine, Cyanine 3-aminoallylcytidine, Cyanine 3-aminoallyluridine, Cyanine 5-aminoallylcytidine, Cyanine 5-aminoallyluridine, Cyanine 7-aminoallyluridine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro-2'-deoxyuridine, 2'-O-methyl-2'-deoxyuridine, 2'-fluoro-2' ...methyl-2'-deoxyuridine, 2'-fluoro-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl-2'-methyl thyradenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methyluridine, puromycin, 2'-amino-2'-deoxycytidine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxycytidine, 2'-azido-2'-deoxyuridine, aracytidine, aurauridine, 2'-azido-2'-deoxyadenosine, 2'-amino-2'-deoxyadenosine, araadenosine, 2'-fluoro-thymidine, 3'-O-methyladenosine, 3'-O-methylcytidine, 3'-O-methylguanosine,3'-O-methyluridine, 2'-azido-2'-deoxyguanosine, araguanosine, 2'-deoxyuridine, 3'-O-(2-nitrobenzyl)-2'-deoxyadenosine, 3'-O-(2-nitrobenzyl)-2'-deoxyinosine, 3'-deoxyadenosine, 3'-deoxyguanosine, 3'-deoxycytidine, 3'-deoxy-5-methyluridine, 3'-deoxyuridine, 2',3'-dideoxyadenosine, 2',3'-dideoxyguanosine, 2',3'-dideoxyuridine, 2',3'-dideoxythymidine, 2', 3'-dideoxycytidine, 3'-azido-2',3'-dideoxyadenosine, 3'-azido-2',3'-dideoxythymidine, 3'-amino-2',3'-dideoxyadenosine, 3'-amino-2',3'-dideoxycytidine, 3'-amino-2',3'-dideoxyguanosine, 3'-amino-2',3'-dideoxythymidine, 3'-azido-2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyuridine, 5-bromo-2',3'-dideoxyuridine, 2',3'-dideoxyinosine, 2'-deoxyadenosine -5'-O-(1-thiophosphate), 2'-deoxycytidine-5'-O-(1-thiophosphate), 2'-deoxyguanosine-5'-O-(1-thiotriphosphate), 2'-deoxythymidine-5'-O-(1-thiophosphate), adenosine-5'-O-(1-thiophosphate), cytidine-5'-O-(1-thiophosphate), guanosine-5'-O-(1-thiophosphate), uridine-5'-O-(1-thiophosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiophosphate), 2',3'-dideoxycytidine-5'-O-(1-thiophosphate), 2',3' -dideoxyguanosine-5'-O-(1-thiophosphate), 3'-deoxythymidine-5'-O-(1-thiophosphate), 3'-azido-2',3'-dideoxythymidine-5'-O-(1-thiophosphate), 2',3'-dideoxyuridine-5'-O-(1-thiophosphate), 2'-deoxyadenosine-5'-O-(1-boranophosphate), 2'-deoxycytidine-5'-O-(1-boranophosphate), 2'-deoxyguanosine-5'-O-(1-boranophosphate), and 2'-deoxythymidine-5'-O-(1-boranophosphate).

[0020] In some embodiments of the compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the delivery vehicle comprises an RNA encoding TERT. In some embodiments, one or more of a surface, layer, or volume of the delivery vehicle comprises an RNA encoding TERT. In some embodiments, the surface comprises an outer surface or an inner surface. In some embodiments, the layer comprises a lipid monolayer or a lipid bilayer. In some embodiments, the volume comprises an internal volume.

[0021] In some embodiments, the disclosure provides a composition comprising (i) a ribonucleic acid (RNA) encoding telomerase reverse transcriptase (TERT); and (ii) a delivery vehicle, wherein the RNA of (i) comprises one or more modified nucleotides, and the delivery vehicle of (ii) is operably linked to the RNA of (i).

[0022] In some embodiments of compositions of the present disclosure, including those in which the delivery vehicle is a lipid nanoparticle (LNP), the composition further comprises a ribonucleic acid (RNA) encoding a telomerase RNA component (TERC). In some embodiments, the delivery vehicle is operably linked to a ribonucleic acid (RNA) encoding a telomerase RNA component (TERC). In some embodiments, the delivery vehicle comprises an RNA encoding TERC. In some embodiments, one or more of a surface, layer, or volume of the delivery vehicle comprises an RNA encoding TERC. In some embodiments, the surface comprises an exterior surface or an interior surface. In some embodiments, the layer comprises a lipid monolayer or lipid bilayer. In some embodiments, the volume comprises an interior volume.

[0023] In some embodiments, the RNA encoding TERT comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-5, 7, 9, 14-17, 19, 21, 23, 25, 27, 29-31, 37-40. In some embodiments, the RNA encoding TERT comprises a UTR sequence, optionally having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 32-34, 35, and 36.

[0024] In some embodiments, the RNA comprises self-replicating RNA. In some embodiments, the RNA comprises circular RNA.

[0025] The present disclosure provides methods of increasing telomerase activity in a cell, the methods comprising contacting the cell with a composition of the present disclosure. In some embodiments, the cell is in vivo, ex vivo, or in vitro.

[0026] The present disclosure provides methods of extending telomeres in a cell, the methods comprising contacting the cell with a composition of the present disclosure. In some embodiments, the cell is in vivo, ex vivo, or in vitro.

[0027] The present disclosure provides a cell comprising a composition of the present disclosure.

[0028] The present disclosure provides a formulation comprising the cells of the present disclosure comprising the composition of the present disclosure. In some embodiments of the formulation, the plurality of cells comprises the cells of the present disclosure comprising the composition of the present disclosure. In some embodiments of the formulation, each cell of the plurality is a cell of the present disclosure comprising the composition of the present disclosure.

[0029] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject an effective amount of a composition of the present disclosure.

[0030] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject an effective amount of a cell of the present disclosure, including a composition of the present disclosure.

[0031] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject an effective amount of a formulation of the present disclosure.

[0032] The present disclosure provides a method of delaying the onset of a disease comprising administering to a subject an effective amount of a composition of the present disclosure.

[0033] The present disclosure provides a method of delaying the onset of a disease comprising administering to a subject an effective amount of a cell of the present disclosure, including a composition of the present disclosure.

[0034] The present disclosure provides a method of delaying the onset of a disease comprising administering to a subject an effective amount of a formulation of the present disclosure.

[0035] In some embodiments, the disclosure provides a method of treating a fibrotic disease in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

[0036] In some embodiments of the method, the composition comprises a delivery vehicle, and optionally the delivery vehicle is a nanoparticle, optionally a lipid nanoparticle (LNP). In some embodiments, the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

[0037] In some embodiments, the LNPs comprise a molar ratio of about 50 to about 60 moles of ionizable lipid to about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1.0 to about 2.0 moles of PEGylated lipid.

[0038] In some embodiments, the LNPs comprise a molar ratio of about 30 to 40 moles of ionizable lipid to about 14 to about 18 moles of phospholipid, about 40 to about 50 moles of cholesterol, and about 2.0 to about 3.0 moles of PEGylated lipid.

[0039] In some embodiments, the LNPs comprise a molar ratio of about 55 moles of ionizable lipid to about 5 moles of phospholipid, about 40 moles of cholesterol, and about 1.5 moles of PEGylated lipid.

[0040] In some embodiments, the LNPs comprise a molar ratio of about 52.5 moles of ionizable lipid to about 7.5 moles of phospholipid, about 40 moles of cholesterol, and about 1.5 moles of PEGylated lipid.

[0041] In some embodiments, the TERT synthetic mRNA comprises at least one modified nucleoside from the list in Table 1B. In some embodiments, the modified nucleoside is pseudouridine or a pseudouridine analog, and optionally, the pseudouridine analog is N-1-methylpseudouridine. In some embodiments, the modified nucleoside is 5-methoxyuridine.

[0042] In some embodiments, the TERT synthetic mRNA comprises an untranslated region (UTR). In some embodiments, the UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

[0043] In some embodiments, the TERT synthetic mRNA comprises a 5' cap structure, the 5' cap structure being IRES, Cap0, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, CleanCap™, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, CAP-225.

[0044] In some embodiments, the TERT synthetic mRNA comprises a poly-adenosine (poly-A) nucleotide sequence 3' to the coding region.

[0045] In some embodiments, the TERT synthetic mRNA comprises a chain terminating nucleotide, wherein the nucleotide is 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, a 2',3'-dideoxynucleoside, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an -O-methylnucleoside.

[0046] In some embodiments, the TERT synthetic mRNA is codon-optimized. In some embodiments, the TERT synthetic mRNA comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identity to any one of SEQ ID NOs: 1, 2, 7, 9, 30, 39, or 40.

[0047] In some embodiments, the delivery vehicle is a liposome, an ionizable lipid, an extracellular vesicle, or an exosome. In some embodiments, the delivery vehicle is an exosome extracellular vesicle, and optionally the extracellular vesicle or exosome comprises one or more targeting moieties, such as a lipid, a peptide, or an antibody.

[0048] In some embodiments, the method reduces fibrosis.

[0049] In some embodiments, the subject is a human.

[0050] In some embodiments, the present disclosure describes a composition for use. In some embodiments, the composition for use is a pharmaceutical composition that includes one or more pharma- ceutically acceptable solvents or excipients.

[0051] In some embodiments, the present disclosure provides a kit for treating a fibrotic disease in a subject, the kit comprising a composition and instructions therefor.

[0052] In some embodiments, the disclosure provides a method of treating liver disease in a subject in need thereof, the method comprising administering to the subject a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

[0053] In some embodiments, the method reduces liver fibrosis. In some embodiments, the liver disease is non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD). In some embodiments, the liver disease is alcoholic hepatitis, cirrhosis, liver fibrosis, compensated cirrhosis, decompensated cirrhosis, acute exacerbation of chronic hepatitis, fibrotic stage F4 nonalcoholic steatohepatitis (NASH), biliary atresia, primary biliary cirrhosis, primary sclerosing cholangitis, and / or chronic liver disease, hemochromatosis, Wilson's disease, or ischemic hepatitis. Incorporation by Reference

[0054] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0055] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings, in which: [Brief description of the drawings]

[0056] [Figure 1] FIG. 1 is a schematic diagram showing the long-term therapeutic benefit from transient rapid telomere elongation via telomerase reverse transcriptase (TERT) mRNA. In particular, the rate of telomere elongation enabled by TERT mRNA therapy allows telomere maintenance with very low frequency of TERT mRNA administration. Telomerase activity resulting from TERT mRNA delivery rapidly elongates telomeres for a short period of time, after which the mRNA is turned over, thus allowing the protective anti-cancer mechanism of telomere shortening to function for most of the time. Between treatments, there is normal telomerase activity and telomere shortening, and therefore the risk of short telomere-related diseases remains low, while the anti-cancer safety mechanism of telomere shortening to prevent uncontrolled proliferation remains intact. In contrast, the best existing small molecule treatments for telomere elongation require chronic delivery and therefore present a risk of chronic cancer, and even then, have small and inconsistent effects on telomere length, with about half of the patients having no detectable effect on telomere length at all. [Diagram 2]Figure 2 is a series of graphs showing that TERT mRNA LNPs exhibit low toxicity by liver panel. Mice were intravenously administered reporter mRNA encapsulated in lipid nanoparticles with either LNP1 or LNP2 (N=1-4 per condition) as shown in Table 5. Mice were sacrificed and blood was collected at the indicated time points (12, 24, and 72 hours). Mice given saline (N=4) and carbon tetrachloride (CCl4, N=4) served as negative and positive controls, respectively. Error bars represent standard error of the mean. [Diagram 3] Figure 3 is a series of photographs showing that TERT mRNA LNPs induce normal tissue types. Cre mRNA was packaged in LNP1 (Table 5) and delivered intravenously (iv) to tdTomato fl / fl mice. Organs were harvested 72 hours later, fixed, paraffin embedded, and sectioned. Organs from untreated tdTomato fl / fl mice are shown for reference. [Figure 4] Figure 4 is a series of photographs showing that TERT mRNA LNPs transfect hepatocytes with high efficiency. Cre mRNA was packaged in LNP1 (Table 5) and delivered intravenously (iv) to tdTomato fl / fl mice. Organs were harvested 72 hours later, fixed, paraffin embedded, and sectioned. Photographs show immunohistochemistry (IHC) with anti-tdTomato. Organs from untreated tdTomato fl / fl mice are shown for reference. [Diagram 5] Figure 5 is a series of photographs showing that TERT mRNA LNPs also target some cells in the spleen. Cre mRNA was packaged in LNP1 (Table 5) and delivered intravenously (iv) to tdTomato fl / fl mice. Organs were harvested 72 hours later, fixed, paraffin embedded, and sectioned. Photographs show immunohistochemistry (IHC) with anti-tdTomato. Organs from untreated tdTomato fl / fl mice are shown for reference. [Figure 6]Figure 6 is a pair of graphs showing that TERT mRNA LNPs induce high telomerase activity in liver. Tert mRNA was formulated with LNP1 or LNP2 (Table 5) and delivered intravenously to TERT KO mice. After 20 hours, livers were harvested for telomerase repeat amplification protocol (TRAP). Wild-type C57Bl6 / J and untreated TERT KO mouse livers were used as positive and negative controls, respectively. [Figure 7] Figure 7 is a photograph showing the results of an assay demonstrating that luciferase mRNA LNPs induce high bioluminescence signals in the liver. The various LNPs were designated as lipid nanoparticle 1 (LNP1), lipid nanoparticle 2 (LNP2), or lipid nanoparticle 3 (LNP3) (Table 5). Empty LNPs are shown as negative controls (ctrl). Luciferase mRNA was formulated in LNP1, 2, and 3 and delivered via IV injection to C57Bl6 / J mice. After 20 hours, the mice were shaved and imaged after injection with luciferin using the IVIS BLI system. [Figure 8]Figure 8 is a graph and a series of photographs from the first study showing that TERT LNPs reduce fibrosis in a thioacetamide (TAA) drinking water model. Adding thioacetamide (TAA) to drinking water represents an art-recognized model for inducing experimental liver fibrosis in rodents (Wallace MC, Hamesch K, Lunova M, et al. Standard operating procedures in experimental liver research: thioacetamide model in mice and rats. Lab Anim 2015;49:21-9). In this experiment, TERT KO mice were administered 0.3 g / L of TAA in drinking water for 9.5 weeks. Mice were treated once a week with LNPs carrying either Tert mRNA or luciferase (LUC) mRNA. Liver sections were stained with picrosirius red (PSR) and quantification showed a mean reduction of 24% of PSR stained tissue in mice treated with TERT LNPs compared to mice treated with LUC LNPs. Scale bar on photographs equals 500 μm. [Figure 9A]Figures 9A and 9B are graphs and photographs of a study demonstrating that TERT LNP reduces fibrosis in a thioacetamide (TAA) drinking water model. TERT KO mice received 0.3 g / L TAA in drinking water for 9.4 weeks and were treated with TERT or LUC mRNA- LNP once a week. By picrosirius red (PSR) staining, a mean reduction in fibrosis in female mice was 18%, and a mean reduction of 37% was observed in males treated with TERT mRNA-LNP, representing a significant (p=0.041) reduction in fibrosis. The scale bar on the photographs is 500 μm. Furthermore, using a 0-4 grading system developed by the Pathology Committee of the NASH Clinical Research Network (Kleiner et al Hepatology 2005), animals treated with TERT mRNA LNPs showed a significant reduction in fibrosis (p=0.032) compared to control animals treated with LUC (luciferase) mRNA LNPs, as seen in Figure 9B. For all evaluations, liver fibrosis was assessed independently, in a blinded fashion, for each of the three lobes (right, middle, and left) per mouse. Scores were combined and averaged to obtain a score per mouse, which was then plotted on a graph (Figure 8, Figure 9A, and Figure 9B). [Figure 9B]Figures 9A and 9B are graphs and photographs of a study demonstrating that TERT LNP reduces fibrosis in a thioacetamide (TAA) drinking water model. TERT KO mice received 0.3 g / L TAA in drinking water for 9.4 weeks and were treated with TERT or LUC mRNA- LNP once a week. By picrosirius red (PSR) staining, a mean reduction in fibrosis in female mice was 18%, and a mean reduction of 37% was observed in males treated with TERT mRNA-LNP, representing a significant (p=0.041) reduction in fibrosis. The scale bar on the photographs is 500 μm. Furthermore, using a 0-4 grading system developed by the Pathology Committee of the NASH Clinical Research Network (Kleiner et al Hepatology 2005), animals treated with TERT mRNA LNPs showed a significant reduction in fibrosis (p=0.032) compared to control animals treated with LUC (luciferase) mRNA LNPs, as seen in Figure 9B. For all evaluations, liver fibrosis was assessed independently, in a blinded fashion, for each of the three lobes (right, middle, and left) per mouse. Scores were combined and averaged to obtain a score per mouse, which was then plotted on a graph (Figure 8, Figure 9A, and Figure 9B). [Figure 10A] Figures 10A and 10B are graphs showing that TERT mRNA improves survival. Survival was plotted as the percentage of surviving mice as a function of days after the first dose of either TERT or luciferase (Luc) negative control. The same experimental procedure was followed as described in Figure 9, except that the mice were fourth generation (G4) TERT KOs aged to over 30 weeks at the start of the study. These mice were administered TERT or LUC once a week, and survival rates after the first dose were recorded. Mice treated with TERT showed a 42% increase in median survival and a 58% increase in maximum survival. Figure 10B shows the survival rate of a group of aged mice that did not receive thioacetamide (TAA) in their drinking water (no TAA). [Figure 10B]Figures 10A and 10B are graphs showing that TERT mRNA improves survival. Survival was plotted as the percentage of surviving mice as a function of days after the first dose of either TERT or luciferase (Luc) negative control. The same experimental procedure was followed as described in Figure 9, except that the mice were fourth generation (G4) TERT KOs aged to over 30 weeks at the start of the study. These mice were administered TERT or LUC once a week, and survival rates after the first dose were recorded. Mice treated with TERT showed a 42% increase in median survival and a 58% increase in maximum survival. Figure 10B shows the survival rate of a group of aged mice that did not receive thioacetamide (TAA) in their drinking water (no TAA). [Figure 11A] Figures 11A and 11B show the effect of TERT mRNA on pathological liver fibrosis in mice. Figure 11A shows the assessment of pathological fibrosis in liver sections from TERT knockout mice with TAA-induced liver fibrosis, as described in Figure 9, by a certified pathologist based on the non-alcoholic fatty liver disease (NAFLD) activity score (NAS). TERT knockout mice without TAA-induced liver fibrosis (saline IV) showed a mild inflammation score of 1 (less than 2 foci per 200× field). Untreated control mice (C57Bl / 6 strain) showed no detectable inflammation. Figure 11B shows that inflammation was significantly reduced in TERT knockout mice treated with TERT mRNA compared to controls (LUC), i.e., TERT mRNA treatment resulted in a 60% reduction in the number of animals with a score greater than 1. [Figure 11B]Figures 11A and 11B show the effect of TERT mRNA on pathological liver fibrosis in mice. Figure 11A shows the assessment of pathological fibrosis in liver sections from TERT knockout mice with TAA-induced liver fibrosis, as described in Figure 9, by a certified pathologist based on the non-alcoholic fatty liver disease (NAFLD) activity score (NAS). TERT knockout mice without TAA-induced liver fibrosis (saline IV) showed a mild inflammation score of 1 (less than 2 foci per 200× field). Untreated control mice (C57Bl / 6 strain) showed no detectable inflammation. Figure 11B shows that inflammation was significantly reduced in TERT knockout mice treated with TERT mRNA compared to controls (LUC), i.e., TERT mRNA treatment resulted in a 60% reduction in the number of animals with a score greater than 1. [Figure 12A] Figure 12A and Figure 12B show the transfection efficiency of mRNA in the liver. Figure 12A shows the quantification of the percentage (%) of positive hepatocytes after different doses of Cre mRNA encapsulated in lipid nanoparticles using ionizable lipid 1 (LNP1) delivered intravenously to tdTomato fl / fl (HTT flox / flox) mice. Hepatocytes were identified in liver tissue sections using nuclear size and circularity by QuPath software. The experimental design was the same as in Figures 3-5. Figure 12B is a representative image of immunohistochemistry (IHC) using anti-tdTomato antibody in liver sections. [Figure 12B] Figure 12A and Figure 12B show the transfection efficiency of mRNA in the liver. Figure 12A shows the quantification of the percentage (%) of positive hepatocytes after different doses of Cre mRNA encapsulated in lipid nanoparticles using ionizable lipid 1 (LNP1) delivered intravenously to tdTomato fl / fl (HTT flox / flox) mice. Hepatocytes were identified in liver tissue sections using nuclear size and circularity by QuPath software. The experimental design was the same as in Figures 3-5. Figure 12B is a representative image of immunohistochemistry (IHC) using anti-tdTomato antibody in liver sections. [Figure 13] Figure 13 shows the levels of liver injury makers after TERT mRNA delivery. TERT mRNA was formulated with LNP1 or D-Lin-MC3-DMA (MC3) and delivered intravenously to C57Bl6 mice at 0.6 mg / kg. After 24 hours, plasma was collected for the measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST). TERT-LNP1 had similar or lower levels of ALT and AST compared to MC3. These liver enzymes serve as markers of acute toxicity. [Figure 14A] Figure 14 and Figure 14B show transfection efficiency in fibrotic liver. Figure 14A shows quantification of the percentage (%) of positive hepatocytes after delivery of Cre mRNA encapsulated in lipid nanoparticles using LNP1 to tdTomato fl / fl mice after 16 weeks of treatment with thioacetamide (TAA) in drinking water at 0.3 g / L. Hepatocytes were identified using nuclear size and circularity by QuPath software. The experimental design was the same as in Figures 3-5. Figure 12B is a representative immunohistochemical (IHC) image using anti-tdTomato antibody in liver sections. [Figure 14B] Figure 14 and Figure 14B show transfection efficiency in fibrotic liver. Figure 14A shows quantification of the percentage (%) of positive hepatocytes after delivery of Cre mRNA encapsulated in lipid nanoparticles using LNP1 to tdTomato fl / fl mice after 16 weeks of treatment with thioacetamide (TAA) in drinking water at 0.3 g / L. Hepatocytes were identified using nuclear size and circularity by QuPath software. The experimental design was the same as in Figures 3-5. Figure 12B is a representative immunohistochemical (IHC) image using anti-tdTomato antibody in liver sections. [Figure 15A]Figure 15A and Figure 15B show telomere elongation in liver. The experimental design was as follows: three doses of either TERT mRNA (SEQ ID NO: 37) or luciferase (LUC) mRNA formulated with LNP1 were delivered intravenously to TERT KO mice once a week at 0.5 mg / kg. Two days before mRNA-LNP administration, an intraperitoneal (ip) administration of 50 mg / kg thioacetamide preceded the administration. Mice were harvested one week after the final administration of mRNA-LNP. Telomere length was quantified in hepatocytes using Q-FISH. Liver tissue was fixed, sectioned, and stained with TelC fluorescent probe, which labels telomeres. Individual telomere fluorescence was quantified per cell and averaged for each mouse. Median fluorescence is shown in Figure 15A, and 10th percentile fluorescence is shown in Figure 15B. Each point represents a single mouse. Hepatocytes from mice treated with TERT mRNA had significantly longer telomeres than LUC mRNA-treated control animals. At least 300 cells were analyzed per mouse per treatment group. [Figure 15B] Figure 15A and Figure 15B show telomere elongation in liver. The experimental design was as follows: three doses of either TERT mRNA (SEQ ID NO: 37) or luciferase (LUC) mRNA formulated with LNP1 were delivered intravenously to TERT KO mice once a week at 0.5 mg / kg. Two days before mRNA-LNP administration, an intraperitoneal (ip) administration of 50 mg / kg thioacetamide preceded the administration. Mice were harvested one week after the final administration of mRNA-LNP. Telomere length was quantified in hepatocytes using Q-FISH. Liver tissue was fixed, sectioned, and stained with TelC fluorescent probe, which labels telomeres. Individual telomere fluorescence was quantified per cell and averaged for each mouse. Median fluorescence is shown in Figure 15A, and 10th percentile fluorescence is shown in Figure 15B. Each point represents a single mouse. Hepatocytes from mice treated with TERT mRNA had significantly longer telomeres than LUC mRNA-treated control animals. At least 300 cells were analyzed per mouse per treatment group. [Figure 16A]Figures 16A and 16B show telomerase activity in human hepatocytes. Cultured human hepatocytes from a 51-year-old donor were transfected with green fluorescent protein (GFP) mRNA or TERT mRNA at 1 μg / ml using Messenger Max from Thermo Scientific. At each time point shown in Figure 16A, cells were harvested for TRAP assays and telomerase activity was measured. Telomerase activity produces a ladder pattern detected using an Agilent Bioanalyzer. By day 14, telomerase activity returned to baseline. [Figure 16B] Figures 16A and 16B show telomerase activity in human hepatocytes. Cultured human hepatocytes from a 51-year-old donor were transfected with green fluorescent protein (GFP) mRNA or TERT mRNA at 1 μg / ml using Messenger Max from Thermo Scientific. At each time point shown in Figure 16A, cells were harvested for TRAP assays and telomerase activity was measured. Telomerase activity produces a ladder pattern detected using an Agilent Bioanalyzer. By day 14, telomerase activity returned to baseline. [Figure 17A] Figures 17A and 17B show that telomere length was quantified from human hepatocytes from a 51-year-old donor. In the experimental design, human hepatocytes were cultured on glass coverslips. Cells were transfected once with TERT mRNA at 1 μg / ml using Messenger Max from Thermo Scientific or left untreated (UT). Cells were fixed and stained with TelC fluorescent probe using Q-FISH protocol. Individual telomere fluorescence was quantified at the cell level. Mean fluorescence is shown in Figure 17A and 10th percentile fluorescence is shown in Figure 17B. At least 150 cells were analyzed per treatment group. [Figure 17B]Figures 17A and 17B show that telomere length was quantified from human hepatocytes from a 51-year-old donor. In the experimental design, human hepatocytes were cultured on glass coverslips. Cells were transfected once with TERT mRNA at 1 μg / ml using Messenger Max from Thermo Scientific or left untreated (UT). Cells were fixed and stained with TelC fluorescent probe using Q-FISH protocol. Individual telomere fluorescence was quantified at the cell level. Mean fluorescence is shown in Figure 17A and 10th percentile fluorescence is shown in Figure 17B. At least 150 cells were analyzed per treatment group. [Figure 18A] Figures 18A and 18B show TERT mRNA (SEQ ID NO: 40) formulated in LNP1 and imaged at high resolution using a Thermo Scientific Talos Glacios Cryo transmission electron microscope (TEM) at 34,000x magnification and 200kv voltage. A representative image is shown in Figure 18A, with the TEM copper grid being the dark area on the right. Particle size was characterized using dynamic light scattering (DLS) using a Brookhaven 90Plus Particle Analyzer, as shown in Figure 18B. [Figure 18B] Figures 18A and 18B show TERT mRNA (SEQ ID NO: 40) formulated in LNP1 and imaged at high resolution using a Thermo Scientific Talos Glacios Cryo transmission electron microscope (TEM) at 34,000x magnification and 200kv voltage. A representative image is shown in Figure 18A, with the TEM copper grid being the dark area on the right. Particle size was characterized using dynamic light scattering (DLS) using a Brookhaven 90Plus Particle Analyzer, as shown in Figure 18B. [Figure 19]Figure 19 shows the results of the telomerase activity assay "Telomerase Repeat Amplification Protocol" (TRAP) in human fibroblasts treated for 24 hours with, from left to right, untreated cells, 1 μg / ml TERT mRNA of SEQ ID NO: 39, 40, 1, 2, 31, 3, 5, and 4, respectively, and a GFP mRNA control. Telomerase activity is shown by a characteristic ladder pattern as shown by transfection with various degrees of TERT mRNA of SEQ ID NO: 39, 40, 1, 2, 31, 3, 5, and 4. Samples transfected with human TERT mRNA showed higher levels of telomerase activity than samples transfected with mouse TERT mRNA. Untreated and GFP mRNA samples showed telomerase activity. [Figure 20] FIG. 20 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, showing in vivo delivery of mRNA. Luciferase mRNA was formulated with SS-OP using lipid ratios of LNP1 as shown in Table 5. The lipid:mRNA ratio (wt / wt) was varied. Formulated mRNA LNPs were delivered via IV injection at 0.6 mg / kg to C57Bl6 / J mice. As a negative control, mice were injected with saline. After 24 hours, the mice were shaved and imaged after injection with luciferin using a Lago instrument from Spectral Instruments Imaging. Depicted are BLI images from mice administered lipid:mRNA ratios of 175, 42, and 25. Signal was highest in mice administered LNPs with lipid:mRNA ratios of 175 and 42 (wt / wt). Other data presented here using LNP1 uses a wt / wt ratio of 42. [Figure 21]FIG. 21 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, showing in vivo delivery of mRNA. LNPs designated as lipid nanoparticle 4 (LNP4) or lipid nanoparticle 5 (LNP5) were formulated with luciferase mRNA using the recipe in Table 5. These LNPs were delivered by IV injection to C57Bl6 / J mice at 0.6 mg / kg. As a negative control, mice were injected with saline. After 20 hours, the mice were shaved and imaged after injection with luciferin using a Lago instrument from Spectral Instruments Imaging. LNP4 consisted of the formulation for LNP2, but with SS-OP instead of cKK-E12. LNP5 consisted of the formulation for LNP1, but with cKK-E12 instead of SS-OP. Bioluminescence imaging shows that both of these LNPs were successfully delivered to the liver. [Figure 22] FIG. 22 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, showing the in vivo delivery of mRNA. Luciferase mRNA was formulated with lipids according to the recipe for LNP1 in Table 5. The component that was varied was the molar ratio of DMG-PEG2000. As shown in FIG. 22, DMG-PEG2000 was added as either 1, 1.5, 2, or 3 parts to the molar sum of all lipids, while the molar ratios of the other three lipids were kept constant. This corresponds to a molecular percentage of DMG-PEG2000 of approximately 1.0%, 1.5%, 2.0%, and 2.9%. Twenty hours after intravenous delivery at 0.6 mg / kg, C57BL / 6J mice were shaved and imaged after injection of luciferin using a Lago instrument from Spectral Instruments Imaging. The signal was strong from all mice that received active luciferase mRNA LNPs, with the best signal seen when DMG-PEG2000 was added at a molar ratio of 1.5:101.5 (approximately 1.5% total). Other data presented here use LNP1 with this molar ratio of DMG-PEG2000. [Figure 23] Figure 23 is a capillary electrophoresis gel image showing that TERT mRNA LNP induces high telomerase activity in liver. Tert mRNA (mTert SEQ ID NO: 37) was formulated with LNP3, a lipid nanoparticle containing DLin-MC3-DMA (Table 5), and delivered intravenously to TERT KO mice at 0.6 mg / kg. After 16 hours or 8 days (as shown in the image), livers were harvested for telomerase repeat amplification protocol (TRAP). The negative control was TRAP performed on livers from saline-injected TERT KO mice. Livers from mice treated with TERT mRNA LNP3 showed elevated telomerase activity, which returned to baseline levels, indicating that the increase in telomerase activity was transient. Modes for carrying out the invention DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0057] Provided herein are compositions and methods that can be used to prevent or treat fibrotic disease and liver disease or disorders. The present disclosure describes the surprising result that a composition comprising mRNA encoding telomerase reverse transcriptase (TERT) reduces liver fibrosis. The TERT mRNA therapy described herein may be delivered by lipid nanoparticles (LNPs), or other delivery vehicles. Diseases that can be treated include, but are not limited to, fibrotic disease (e.g., liver), and other liver diseases.

[0058] Telomerase reverse transcriptase (TERT) is an enzyme known to maintain and extend chromosome ends (telomeres). The TERT enzyme is the catalytic subunit of the ribonucleoprotein telomerase. TERT adds simple sequence repeats to telomeres by copying the template sequence 5'-GGTTAG-3' within the RNA component of telomerase. This addition of repetitive deoxyribonucleic acid (DNA) sequences helps slow telomere shortening, which occurs over time due to, for example, incomplete DNA replication during mitosis.

[0059] TERT translocates between the cell nucleus and cytoplasm and has been shown to be an important factor in many other biological processes, including cell proliferation and cancer metastasis, and thus the level of TERT in the cell nucleus may be a key step in regulating the health of cells and organisms.

[0060] Telomerase reverse transcriptase (TERT) is also known in the art as TRT, cutaneous malignant melanoma 9 (CMM9), dyskeratosis congenita autosomal dominant 2 (DKCA2), autosomal recessive dyskeratosis congenita-4 (DKCB4), human ever shorter telomeres 2 (HEST2), pulmonary fibrosis / bone marrow failure telomere associated 1 (PFBMFT1), telomerase catalytic subunit (TCS1), and telomerase-associated protein 2 (TP2).

[0061] In some embodiments, the treatments described herein may halt, slow, or reverse the progression of a fibrotic disease, eg, liver disease, or other liver disease.

[0062] TERT mRNA is transient and only requires a few hours to elongate the telomere of human cells before being degraded.Therefore, TERT mRNA leaves the protective anti-cancer telomere shortening mechanism intact.The present disclosure provides compositions and methods for the delivery of TERT mRNA and the treatment of fibrotic disease and liver disease.

[0063] During normal aging, telomeres shorten by approximately 30-100 base pairs per year due to oxidation and incomplete DNA replication during the S phase of the cell cycle (Kurenova EV, et al. Telomere functions. A review. Biochemistry (Mosc) 1997; 62:1242-53). Telomerase, consisting of the TERT protein and a polynucleotide template (TERC), extends telomeres, but in humans it is inactive in most somatic cell types and active at low levels insufficient to prevent net telomere shortening in many progenitor cell types. The exception is the spermatogenic lineage, where telomerase is active enough to maintain telomere length over the human lifespan (Takubo K, Aida J, Izumiyama-Shimomura N, et al. Changes of telomere length with aging. Geriatric Gerontology Int 2010; 10 Suppl 1:S197-206). TERC components are present at high levels in all cell types, typically with copy numbers of >10,000 per cell, making TERT the limiting component. Short telomeres limit the cells' ability to proliferate and reproduce, and are therefore associated with aging, premature death, and a vast number of diseases and conditions.

[0064] Telomeres contain repeated DNA sequences at the ends of linear chromosomes that, when of sufficient length, can allow each chromosome end to form a loop that protects the end from acting as a double- or single-stranded DNA break. Telomeres can shorten over time, in part due to oxidative damage and incomplete DNA replication, ultimately resulting in extremely short telomeres that cannot form protective loops, exposed chromosome ends, chromosome-chromosome fusions, DNA damage responses, and cellular senescence, apoptosis, or malignancy.

[0065] Maintenance of telomere length can play a role in preventing cellular senescence and apoptosis and the resulting dysfunction of cells and organs. In many diseases, the need for cell replication to replace cells damaged or killed by the underlying disease mechanism causes telomeres to shorten more rapidly than normal, exhausting the replicative capacity of cells and resulting in tissue dysfunction, worsened or additional symptoms, disability, or death. Furthermore, genetic mutations in the telomerase enzyme (TERT) can be linked to fatal inherited disorders of insufficient telomere maintenance.

[0066] The possibility of preventing, delaying, or treating dysfunctions, conditions, and diseases by telomere elongation motivates the need for safe and effective therapies for elongating telomeres in animal cells in vivo and / or in vitro, as well as safe and effective compositions and methods for delivering therapies to animal cells for elongating telomeres. Furthermore, there is a need for safe and rapid extension of telomeres in cells for use in cell therapy, cell and tissue engineering, and regenerative medicine. At the same time, however, there may be dangers in constant, as opposed to transient, activation of telomerase activity. Indeed, for cell therapy applications, there is a need to avoid immortalizing cells. To this end, transient, rather than constant, telomerase activity may be advantageous for safety, for example, when the increase in telomerase activity is not only short-term, but also elongates telomeres rapidly enough that treatment does not need to be repeated continuously.

[0067] Thus, there is a need for therapies that safely lengthen telomeres to potentially prevent, delay, ameliorate, or treat these and other conditions and diseases, to do the same for the gradual decline in physical form and function and mental function that accompanies aging over time, and to enable cell therapy and regenerative medicine. Additionally, there is a need for improved methods of delivering these therapies, e.g., nucleic acid molecules encoding telomerase, to cells.

[0068] Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings commonly understood by those skilled in the art. Generally, the nomenclature used in connection with, and techniques of, chemistry, molecular biology, cell and cancer biology, immunology, microbiology, pharmacology, and protein and nucleic acid chemistry described herein are those well known and commonly used in the art.

[0069] It must be noted that, as used herein and in the appended claims, the singular forms "a," "and," and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "drug candidates" refers to one or a mixture of such candidates, reference to a "method" includes reference to equivalent steps and methods known to those skilled in the art, and so forth.

[0070] As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest refers to a value that is similar in magnitude and / or within a similar range to a stated reference value. In certain embodiments, the term "approximately" or "about" can refer to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less on either side of (greater than or less than) the stated reference value (except where such value exceeds 100% of possible values), unless otherwise stated or otherwise clear from the context.

[0071] Where a range of values ​​is provided, it is understood that each intervening value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, and any other stated or intervening values ​​in that stated range, are encompassed in the disclosure, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0072] "G", "C", "A", "T", and "U" generally represent the bases guanine, cytosine, adenine, thymidine, and uracil, respectively. Nucleobases can form nucleosides by the addition of a five-carbon sugar. When the sugar is ribose, the nucleoside is a ribonucleoside. Additionally, nucleosides can form nucleotides by the addition of one or more linker groups, such as phosphate groups. Additionally, nucleotides can form polymers (polynucleotides), including short polymers (oligonucleotides). However, it should be understood that the terms "base", "nucleobase", "nucleoside", "ribonucleoside", "nucleotide", and "ribonucleotide" can also refer to modified bases, nucleobases, nucleosides, ribonucleosides, nucleotides, or ribonucleotides, or surrogate replacement moieties (see, e.g., Table 1B and elsewhere herein), as further detailed below. Those skilled in the art are well aware that guanine, cytosine, adenine, thymidine, uracil can be replaced by other moieties without substantially impairing one or more of the specific properties (such as base pairing properties, translatability, or protein binding properties) of an oligonucleotide or polynucleotide containing a nucleotide with such a replacement moiety. Sequences containing such a replacement moiety are suitable for the compositions and methods described in this disclosure. Similarly, those skilled in the art are well aware that ribose can be replaced by other moieties without impairing the specific properties (such as base pairing properties, translatability, or protein binding properties) of an oligonucleotide or polynucleotide containing a nucleotide with such a replacement moiety. Sequences containing such a replacement moiety are suitable for the compositions and methods described in this disclosure. Similarly, those skilled in the art are well aware that phosphate can be replaced by other moieties without impairing the specific properties (such as base pairing properties, translatability, or protein binding properties) of an oligonucleotide or polynucleotide containing a nucleotide with such a replacement moiety. Sequences containing such a replacement moiety are suitable for the compositions and methods described in this disclosure.

[0073] As used herein, the terms "polypeptide," "peptide," and "protein" refer to polymers of amino acids of any length. The terms also encompass modified amino acid polymers, including, for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component.

[0074] As used herein, the terms "identity" and "identical" refer to the percentage of perfectly matching residues in an alignment of a polypeptide or polynucleotide subject sequence to a reference sequence, such as an alignment generated by the BLAST algorithm. Identity is calculated over the entire length of the reference sequence unless otherwise specified. Thus, when the reference sequence is aligned (as a query sequence) to the subject sequence (as the subject sequence), a subject sequence is said to "share at least x% identity with" a reference sequence if at least x% (truncated) of the residues in the subject sequence are aligned to perfectly match the corresponding residues in the query sequence, with the denominator being the entire length of the reference sequence plus the length of any gaps inserted in the reference sequence by the alignment of the reference sequence to the subject sequence. If the subject sequence has variable positions (e.g., residues marked with X), alignment to any residue in the query sequence is counted as a match. Sequence alignment may be performed using the NCBI Blast service (BLAST+ version 2.12.0) or another program that gives the same results.

[0075] As used herein, the term "natural" or "wild type" refers to a nucleotide sequence, e.g., a gene, or a gene product, e.g., an RNA or a polypeptide, present in a wild-type cell, tissue, organ, or organism. As used herein, the term "variant" refers to a variant having less than 100% sequence identity with a reference polynucleotide or polypeptide sequence, e.g., a naturally occurring polynucleotide or polypeptide sequence. In other words, a variant comprises at least one nucleotide difference (e.g., a nucleotide substitution, a nucleotide insertion, a nucleotide deletion) or one amino acid difference (e.g., an amino acid substitution, an amino acid insertion, an amino acid deletion) with respect to a reference polynucleotide sequence, e.g., a naturally occurring polynucleotide or polypeptide sequence. For example, a variant may be a polynucleotide having 50% or more, 60% or more, or 70% or more sequence identity with a full-length naturally occurring polynucleotide sequence, e.g., 75% or 80% or more identity with a full-length naturally occurring polynucleotide sequence, e.g., 85%, 90%, or 95% or more, e.g., 98% or 99% identity. As another example, a variant may be a polypeptide having 70% or more sequence identity to a full-length naturally occurring polypeptide sequence, e.g., 75% or 80% or more identity to a full-length naturally occurring polypeptide sequence, such as 85%, 90%, or 95% or more, e.g., 98% or 99% identity. A variant may also include a variant fragment of a reference sequence (e.g., a naturally occurring sequence) that shares 70% or more sequence identity with a fragment of the reference sequence (e.g., a naturally occurring sequence), e.g., 75% or 80% or more (such as 85%, 90%, or 95% or more) identity, e.g., 98% or 99% identity with the naturally occurring sequence.

[0076] As used herein, the term "codon optimized" refers to any process used to improve gene expression, increase the translation efficiency of a gene of interest by accommodating the codon bias of the host organism, and / or reduce the immunogenicity of a polynucleotide.

[0077] The term "treat" or "treatment" is used herein to generally mean to obtain a desired pharmacological and / or physiological effect with a therapeutic agent. The effect may be prophylactic in that it completely or partially prevents a disease or its symptoms, e.g., reduces the likelihood that a disease or its symptoms will occur in a subject, and / or it may be therapeutic in that it completely or partially reduces the symptoms or partially or completely cures the disease and / or the adverse effects caused by the disease. As used herein, "treatment" encompasses any treatment of a disease in a mammal, including (a) preventing a disease from occurring in a subject who may be susceptible to the disease but has not yet been diagnosed as having it, (b) inhibiting or delaying the onset or development of the disease, or (c) relieving the disease, e.g., causing regression of the disease or symptoms associated with the disease. The therapeutic agent may be administered before, during, or after the onset of the disease. Treatment of ongoing disease, where the treatment stabilizes or reduces undesirable clinical symptoms in the patient, may be of particular interest. In some embodiments, the treatment is performed before complete loss of function in the affected tissue. In some embodiments, the subject therapy is administered before, and in some embodiments during, the symptomatic stage of the disease, and in some embodiments after the symptomatic stage of the disease.

[0078] In some embodiments, the therapy described herein treats fibrotic or hepatic disease, including but not limited to fibrotic liver disease.Fibrotic or hepatic disease may be associated with TERT mutation, mutation of other genes, or non-genetic causes.Diseases that can be treated using the compositions and methods of the present disclosure include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) such as stage F4 NASH, alcoholic hepatitis, alcoholic liver disease, cirrhosis such as compensated and decompensated cirrhosis, hepatic fibrosis, hemochromatosis, biliary atresia, primary biliary cirrhosis, primary sclerosing cholangitis, chronic liver disease, acute exacerbation of chronic hepatitis (ACLF), Wilson's disease, or ischemic hepatitis.

[0079] The terms "individual," "subject," and "patient" are used interchangeably herein and refer to any subject for whom treatment or therapy is desired. The subject may be a mammalian subject. Mammalian subjects include, for example, humans, non-human primates, rodents (e.g., rats, mice), lagomorphs (e.g., rabbits), and ungulates (e.g., cows, sheep, pigs, horses, goats, etc.). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate, such as a cynomolgus monkey. In some embodiments, the subject is a companion animal or a service animal (e.g., a cat or dog).

[0080] As used herein, a subject "in need thereof" refers to any subject identified as suffering from or at risk of developing a fibrotic or liver disease.

[0081] Of course, this disclosure is not limited to the particular methodology, products, devices, and agents described, because such methods, devices, and formulations may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the disclosure, which is limited only by the appended claims.

[0082] I. Synthetic mRNA As used herein, synthetic mRNA may refer to any sequence that contains mutations (points or deletions) or additional nucleotides not found in the wild-type sequence. For example, synthetic TERT mRNA may refer to a wild-type sequence that encodes a human TERT sequence flanked by the addition of 1, 2, 3, 10, 100 or more nucleotides. Similarly, the nucleotides themselves may code for amino acids different from the wild-type or may be modified to reduce immunogenicity in cells or tissues. In some embodiments, the mRNA sequence may contain any of the following modifications, including but not limited to untranslated regions (UTRs), 5' caps, and polyadenosine tails. In some embodiments, the RNA may be circular and / or self-replicating. Exemplary methods for making circular mRNA are provided in Chen et al. Science. 1995 Apr 21;268(5209):415-7;Perriman R. (2002) Circular mRNA Encoding for Monomeric and Polymeric Green Fluorescent Protein. In: Hicks BW (eds) Green Fluorescent Protein. Methods in Molecular Biology, vol 183. Humana Press;Wang et al. RNA. 2015 Feb;21(2):172-9. doi: 10.1261 / rna.048272.114. Epub 2014 Dec 1;Wesselhoeft et al. Nat Commun. 2018 Jul 6;9(1):2629; and Wesselhoeft et al. Mol Cell. 2019 May 2;74(3):508-520.e4.Exemplary methods for generating self-replicating mRNA are provided in Tews BA, Meyers G. (2017) Self-Replicating RNA. In: Kramps T., Elbers K. (eds) RNA Vaccines. Methods in Molecular Biology, vol 1499. Humana Press; Leyman et al. Mol Pharm. 2018 Feb 5;15(2):377-384; and Huysmans et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:388-395.

[0083] TERT mRNA In some embodiments, the compositions may include a reverse transcriptase telomerase (TERT) mRNA sequence for treating one or more phenotypes or symptoms associated with fibrotic or liver disease. In some embodiments, TERT mRNA refers to an mRNA encoding any full-length, functional fragment or portion of the TERT protein, including the wild-type sequence or variants thereof.

[0084] In some embodiments, the TERT mRNA may comprise a codon-optimized sequence. In some embodiments, the TERT mRNA may comprise a uridine-depleted human TERT sequence. In some embodiments, the codon-optimized sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:1 below.

[0085]

[0086] In some embodiments, the TERT mRNA may comprise a mutant human TERT sequence. In some embodiments, the mutant human TERT mRNA may code for a Y707F mutation in the resulting peptide sequence. In some embodiments, the mutation in the TERT mRNA sequence codes for a mutation in a nuclear export signal, which may result in nuclear anchoring of the TERT peptide. In some embodiments, the mutant TERT mRNA sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:2 below.

[0087]

[0088] In some embodiments, the mouse TERT mRNA may comprise a codon-optimized sequence. In some embodiments, the TERT mRNA may comprise a uridine-depleted mouse TERT sequence. In some embodiments, the codon-optimized sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:3 below.

[0089]

[0090] In some embodiments, the mouse TERT mRNA may comprise a mutant mouse TERT sequence. In some embodiments, the mutant mouse TERT mRNA may code for a Y707F mutation in the resulting peptide sequence. In some embodiments, the mutation in the TERT mRNA sequence codes for a mutation in a nuclear export signal, which may result in nuclear anchoring of the TERT peptide. In some embodiments, the mutant mouse TERT mRNA sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 4 below.

[0091]

[0092] In some embodiments, the mouse TERT mRNA may comprise a mutant mouse TERT sequence. In some embodiments, the mutant mouse TERT mRNA may code for a Y697F mutation in the resulting peptide sequence. In some embodiments, the mutation in the TERT mRNA sequence codes for a mutation in a nuclear export signal, which may result in nuclear anchoring of the TERT peptide. In some embodiments, the mutant mouse TERT mRNA sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:5 below.

[0093]

[0094] The composition includes a ribonucleic acid, for example, a synthetic ribonucleic acid encoding telomerase reverse transcriptase (TERT), where the telomeres are extended in cells treated with the compound. The ribonucleic acid used in the transient expression of TERT can include a ribonucleic acid encoding a TERT protein. The ribonucleic acid can further include one or more sequences that affect the expression and / or stability of the ribonucleic acid in the cell. For example, the ribonucleic acid can include a 5' cap and an untranslated region (UTR) 5' and / or 3' of the coding sequence. The ribonucleic acid can further include a 3' tail, such as a poly-A tail. The poly-A tail can, for example, increase the stability of the ribonucleic acid. In some embodiments, the poly-A tail includes at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 225 nucleotides, at least 250 nucleotides. In some embodiments, the poly-A tail comprises between 1 and 25 nucleotides, between 25 and 50 nucleotides, between 50 and 75 nucleotides, between 75 and 100 nucleotides, between 100 and 125 nucleotides, between 125 and 150 nucleotides, between 150 and 175 nucleotides, between 175 and 200 nucleotides, between 200 and 225 nucleotides, or between 225 and 250 nucleotides, each range including the endpoints, hi some embodiments, the poly-A tail comprises between 100 and 200 nucleotides (including the endpoints).

[0095] In some embodiments, the 5' cap of the ribonucleic acid is a non-immunogenic cap. In some embodiments, the 5' cap may increase translation of the ribonucleic acid. In some embodiments, the 5' cap may be treated with a phosphatase to modulate the innate immunogenicity of the ribonucleic acid. In some embodiments, the 5' cap is an anti-reverse cap analog ("ARCA"), such as a 3'-O-Me-m7G(5')ppp(5')G RNA cap structure analog. In some embodiments, the 5' cap is m7G(5')ppp(5')(2'OmeA)pG (also known as CleanCap© AG). In some embodiments, the 5' cap is m7(3'OmeG)(5')ppp(5')(2'OmeA)pG (also known as CleanCap® AG(3'Ome)).

[0096] The above features, or other features, may increase the translation of the TERT protein encoded by the ribonucleic acid, or may increase or decrease the stability of the ribonucleic acid itself in a cell type specific or cell type independent manner, or both. In some embodiments, the 5'UTR and / or 3'UTR are from genes with highly stable and / or rapidly translated mRNAs, such as alpha-globin or beta-globin, c-fos, or tobacco etch virus. In some embodiments, the 5'UTR and 3'UTR are from different genes or from different species than the species to which the composition is delivered. The UTRs may also be a collection of portions of UTRs from mRNAs of different genes, where the portions are selected to achieve a particular combination of translation stability and efficiency. The UTRs may also include designed sequences that confer properties to the RNA, such as cell type specific or cell type independent stability.

[0097] The ribonucleic acid of the present disclosure may contain one or more modified nucleosides and / or a primary sequence of nucleosides that modulate the translation, stability, or immunogenicity of the RNA ("mRNA"). Most mature RNA molecules in eukaryotic cells contain nucleosides that are modified versions of the canonically unmodified RNA nucleosides, adenine, cytidine, guanosine, and uridine. For example, the 5' cap of mature RNA contains modified nucleosides, and other modified nucleosides often occur elsewhere in the RNA. These modifications may prevent the RNA from being recognized as a foreign RNA. Synthetic RNA molecules made using certain nucleosides are much less immunogenic than unmodified RNA. Immunogenicity can be even further reduced by purifying the synthetic mRNA using, for example, high performance liquid chromatography (HPLC). The modified nucleosides may be selected from, for example, the nucleosides listed below. In some embodiments, the nucleoside is pseudouridine, 1-methylpseudouridine, 2-thiouridine, 5-methoxyuridine, or 5-methylcytidine. The primary sequence may be modified in a manner that increases or decreases immunogenicity. In some situations, it may be desirable for the modified RNA to retain some immunogenicity.

[0098] Thus, in some embodiments, the ribonucleic acid of the composition comprises 1-methylpseudouridine, pseudouridine, 5-methoxyuridine (5-moU), 2-thiouridine, 5-methylcytidine, or another modified nucleoside. Modified nucleosides found in eukaryotic cells include m1A 1-methyladenosine, m6A N6-methyladenosine, Am 2'-O-methyladenosine, i6A N6-isopentenyladenosine, io6A N6-(cis-hydroxyisopentenyl)adenosine, ms2io6A 2-methylthio-N6(cis-hydroxyisopentenyl)adenosine, g6A N6-glycinylcarbamoyladenosine, t6A N6-threonylcarbamoyladenosine, ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine, Ar(p)2'-O-ribosyladenosine (phosphate), m6 2A N6,N6-dimethyladenosine, m6Am N6,2'-O-dimethyladenosine, m6 2Am N6,N6,2′-O-trimethyladenosine, m1Am 1,2′-O-dimethyladenosine, m3C 3-methylcytidine, m5C 5-methylcytidine, Cm 2′-O-methylcytidine, ac4C N4-acetylcytidine, f5C 5-formylcytidine, m4C N4-methylcytidine, hm5C 5-hydroxymethylcytidine, f5Cm 5-formyl-2′-O-methylcytidine, m1G 1-methylguanosine, m2G N2-methylguanosine, m7G 7-methylguanosine, Gm 2′-O-methylguanosine, m2 2G N2,N2-dimethylguanosine, Gr(p) 2′-O-ribosylguanosine (phosphate), yW wibutosine, o2yW peroxywibutosine, OhyW Hydroxywybutosine, OhyW* undermodified hydroxywybutosine, imG wybutosine, m2,7G N2,7-dimethylguanosine, m2,2,7G N2,N2,7-trimethylguanosine, I inosine, m1I 1-methylinosine, Im 2'-O-methylinosine, Q queosine, galQ galactosyl-queosine, manQ mannosyl-queosine, Ψ pseudouridine, D dihydrouridine, m5U 5-methyluridine, Um 2'-O-methyluridine, m5Um 5,2'-O-dimethyluridine,m1Ψ 1-methylpseudouridine, Ψm 2'-O-methylpseudouridine, s2U 2-thiouridine, ho5U 5-hydroxyuridine, chm5U 5-(carboxyhydroxymethyl)uridine, mchm5U 5-(carboxyhydroxymethyl)uridine, methyl ester mcm5U 5-methoxycarbonylmethyluridine, mcm5Um 5-methoxycarbonylmethyl-2'-O-methyluridine, mcm5s2U 5-methoxycarbonylmethyl-2-thiouridine, ncm5U 5-carbamoylmethyluridine, ncm5Um 5-carbamoylmethyl-2'-O-methyluridine, cmnm5U 5-carboxymethylaminomethyluridine, m3U 3-methyluridine, m1acp3Ψ 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, cm5U 5-carboxymethyluridine, m3Um 3,2′-O-dimethyluridine, m5D 5-methyldihydrouridine, τm5U 5-taurinomethyluridine, τm5s2U 5-taurinomethyl-2-thiouridine, 2-aminoadenosine, 2-amino-6-chloropurine riboside, 8-azaadenosine, 6-chloropurine riboside, 5-iodocytidine, 5-iodouridine, inosine, 2′-O-methylinosine, xanthosine, 4-thiouridine, O6-methylguanosine, 5,6-dihydrouridine, 2-thiocytidine, 6-azacytidine, 6-azauridine, 2′-O-methyl-2-aminoadenosine, 2′-O-methylpseudouridine, N1-methyladenosine, 2′-O-methyl-5-methyluridine, 7-deazaguanosine, 8-azidoadenosine, 5- Bromocytidine, 5-bromouridine, 7-deazaadenosine, 5-aminoallyluridine, 5-aminoallylcytidine, 8-oxoguanosine, 2-aminopurine-riboside, pseudoisocytidine, N1-methylpseudouridine, 5,6-dihydro-5-methyluridine, N6-methyl-2-aminoadenosine, 5-carboxycytidine, 5-hydroxymethyluridine, thienoguanosine, 5-hydroxycytidine, 5-formyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-methoxycytidine, thienouridine, 5-carboxymethylesteruridine, thienocytidine,8-Oxoadenosine, Isoguanosine, N1-Ethylpseudouridine, N1-Methyl-2'-O-Methylpseudouridine, N1-Methoxymethylpseudouridine, N1-Propylpseudouridine, 2'-O-Methyl-N6-Methyladenosine, 2-Amino-6-Cl-purine-2'-deoxyriboside, 2-Amino-2'-deoxyadenosine, 2-Aminopurine-2'-deoxyriboside, 5-Bromo-2'-deoxycytidine, 5-Bromo-2'-deoxyuridine, 6-Chloropurine-2'-deoxy Siriboside, 7-deaza-2'-deoxyadenosine, 7-deaza-2'-deoxyguanosine, 2'-deoxyinosine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxyuridine, 5-fluoro-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, N6-methyl-2'-deoxyadenosine, 5-methyl-2'-deoxycytidine, O6-methyl-2'-deoxyguanosine, N2-methyl-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine , 8-oxo-2'-deoxyguanosine, 2-thiothymidine, 2'-deoxy-P-nucleoside, 5-hydroxy-2'-deoxycytidine, 4-thiothymidine, 2-thio-2'-deoxycytidine, 6-aza-2'-deoxyuridine, 6-thio-2'-deoxyguanosine, 8-chloro-2'-deoxyadenosine, 5-aminoallyl-2'-deoxycytidine, 5-aminoallyl-2'-deoxyuridine, N4-methyl-2'-deoxycytidine, 2'-deoxyzebularine, 5-hydroxymethyl-2'-deoxyuridine ... hydroxymethyl-2'-deoxycytidine, 5-propargylamino-2'-deoxycytidine, 5-propargylamino-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-formyl-2'-deoxycytidine, 5-[(3-indolyl)propionamido-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxyuridine, 5-formyl-2'-deoxyuridine, 7-deaza-7-propargylamino-2'-deoxyadenosine, 7-deaza-7-propargylamino-2'-deoxyguanosine,Biotin-16-aminoallyl-2'-dUTP, biotin-16-aminoallyl-2'-dCTP, biotin-16-aminoallylcytidine, N4-biotin-OBEA-2'-deoxycytidine, biotin-16-aminoallyluridine, dabsyl-5-3-aminoallyl-2'-dUTP, desthiobiotin-6-aminoallyl-2'-deoxycytidine, desthiobiotin-16-aminoallyl-uridine, biotin-16-7-deaza-7-propargylamino-2'-deoxyguanosine, cyanine 3-5-propargylamino-2'-deo 2'-fluoro-2'-deoxycytidine, cyanine 3-6-propargylamino-2'-deoxyuridine, cyanine 5-6-propargylamino-2'-deoxycytidine, cyanine 5-6-propargylamino-2'-deoxyuridine, cyanine 3-aminoallylcytidine, cyanine 3-aminoallyluridine, cyanine 5-aminoallylcytidine, cyanine 5-aminoallyluridine, cyanine 7-aminoallyluridine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro 2'-O-deoxyuridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methyluridine, puromycin, 2'-amino-2'-deoxycytidine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxycytidine, 2'-azido-2'-deoxyuridine, aracytidine, aurauridine, 2'-azido-2'-deoxyadenosine, 2'-amino-2'-deoxyadenosine, araadenosine, 2'-fluoro-thymidine, 3'-O-methyladenosine, 3'-O-methy lucitidine, 3'-O-methylguanosine, 3'-O-methyluridine, 2'-azido-2'-deoxyguanosine, araguanosine, 2'-deoxyuridine, 3'-O-(2-nitrobenzyl)-2'-deoxyadenosine, 3'-O-(2-nitrobenzyl)-2'-deoxyinosine, 3'-deoxyadenosine, 3'-deoxyguanosine, 3'-deoxycytidine, 3'-deoxy-5-methyluridine, 3'-deoxyuridine, 2',3'-dideoxyadenosine, 2',3'-dideoxyguanosine, 2',3'-dideoxyuridine,2',3'-dideoxythymidine, 2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyadenosine, 3'-azido-2',3'-dideoxythymidine, 3'-amino-2',3'-dideoxyadenosine, 3'-amino-2',3'-dideoxycytidine, 3'-amino-2',3'-dideoxyguanosine, 3'-amino-2',3'-dideoxythymidine, 3'-azido-2',3'-dideoxy Cytidine, 3'-azido-2',3'-dideoxyuridine, 5-bromo-2',3'-dideoxyuridine, 2',3'-dideoxyinosine, 2'-deoxyadenosine-5'-O-(1-thiophosphate), 2'-deoxycytidine-5'-O-(1-thiophosphate), 2'-deoxyguanosine-5'-O-(1-thiophosphate), 2'-deoxythymidine-5'-O-(1-thiophosphate), adenosine-5'-O-(1 -thiophosphate), cytidine-5'-O-(1-thiophosphate), guanosine-5'-O-(1-thiophosphate), uridine-5'-O-(1-thiophosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiophosphate), 2',3'-dideoxycytidine-5'-O-(1-thiophosphate), 2',3'-dideoxyguanosine-5'-O-(1-thiophosphate), 3'-deoxythymidine-5'-O-(1-thiophosphate) , 3'-azido-2',3'-dideoxythymidine-5'-O-(1-thiophosphate), 2',3'-dideoxyuridine-5'-O-(1-thiophosphate), 2'-deoxyadenosine-5'-O-(1-boranophosphate), 2'-deoxycytidine-5'-O-(1-boranophosphate), 2'-deoxyguanosine-5'-O-(1-boranophosphate), and 2'-deoxythymidine-5'-O-(1-boranophosphate).

[0099] Without intending to be bound by theory, the presence of modified nucleosides and / or sequences of nucleosides that modify the secondary structure of RNA and / or modify the binding of RNA to RNA-binding proteins or microRNAs may allow mRNA to avoid activation of immune responses mediated by various receptors, including Toll-like receptors and RIG-1. Non-immunogenic mRNAs have been used as therapeutic agents in mice via local delivery. Kormann et al. (2011) Nature Biotechnology 29:154-157. In some embodiments, the ribonucleic acid comprises two or more of the above nucleosides, or a combination of the above nucleosides. In some embodiments, the ribonucleic acid comprises 1-methylpseudouridine, 5-methoxyuridine, or pseudouridine and 5-methylcytidine.

[0100] In some embodiments, an immune response to the mRNA may be desired, and the RNA may be modified to induce optimal levels of natural immunity. In other embodiments, an immune response to the mRNA may not be desired, and the RNA may be modified to minimize such a response. The RNA can be modified for either situation.

[0101] The ribonucleic acid molecule can be a synthetic ribonucleic acid. As used herein, the term "synthetic" may mean that the ribonucleic acid is prepared, in some embodiments, under human direction using molecular biology tools, for example, as described below. Synthetic ribonucleic acids may be prepared by in vitro synthesis, for example, using cell extracts or purified enzymes and nucleic acid templates. Synthetic ribonucleic acids may be prepared, in some embodiments, partially or completely, by chemical synthesis. Alternatively, or in addition, synthetic ribonucleic acids may be prepared, in some embodiments, by engineered expression in cells, followed by disruption of the cells and at least partial purification of the ribonucleic acid.

[0102] The ribonucleic acids of the present disclosure may be prepared using a variety of techniques, as will be understood by those skilled in the art. In some embodiments, the ribonucleic acids may be prepared by in vitro synthesis. In some embodiments, the ribonucleic acids may be prepared by chemical synthesis. In some embodiments, the ribonucleic acids may be prepared by a combination of in vitro synthesis and chemical synthesis. As stated above, the term "synthetic" should be understood to include ribonucleic acids prepared by any of the following combinations: chemical synthesis, in vitro synthesis, in vivo expression and at least partial purification, or such methods, or other methods, chemical or molecular biological methods.

[0103] The ribonucleic acid may be purified in some embodiments. As mentioned above, purification may reduce the immunogenicity of the ribonucleic acid, which may be advantageous in some circumstances. In some embodiments, the ribonucleic acid is purified by one or more of HPLC, DNAse treatment, protease treatment, or by affinity capture and elution.

[0104] The protein structure of TERT may include at least three distinct domains: a long amino-terminal extension (N-terminal extension, NTE) containing a conserved domain and an unstructured linker region, a catalytic reverse transcriptase domain in the center of the primary sequence containing seven conserved reverse transcriptase (RT) motifs, and a short carboxyl-terminal extension. In some embodiments, the ribonucleic acid encodes full-length TERT. In some embodiments, the ribonucleic acid encodes the catalytic reverse transcriptase domain of TERT. In some embodiments, the ribonucleic acid encodes a polypeptide having TERT activity. TERT activity may be measured using known methods, including the telomerase repeat amplification protocol (TRAP).

[0105] The TERT encoded by the ribonucleic acid of the present disclosure may be a mammalian, avian, reptilian, or fish TERT. In some embodiments, the TERT is a mammalian TERT, such as human TERT. Meyerson et al. (1997) Cell 90:785-795; Nakamura et al. (1997) Science 277:955-959; Wick et al. (1999) Gene 232:97-106.

[0106] The amino acid sequences of the two human TERT isoforms are available as NCBI reference sequences NP_937983.2 and NP_001180305.1.

[0107] The amino acid sequence of human TERT isoform 1 may comprise or consist of the sequence of SEQ ID NO:6 below (also set forth in GenBank Accession No. NP_937983.2). [ka] [ka]

[0108] The nucleic acid sequence of human TERT isoform 1 may comprise or consist of the sequence of SEQ ID NO: 7 below (also set forth in GenBank Accession No. NM_198253.3). [ka] [ka]

[0109] The amino acid sequence of human TERT isoform 2 may comprise or consist of the sequence of SEQ ID NO:8 below (also listed in GenBank Accession No. NP_001180305.1). [ka]

[0110] The amino acid sequence of human TERT isoform 2 may comprise or consist of the sequence of SEQ ID NO: 9 below (also set forth in GenBank accession number NM_001193376.3). [ka] [ka] [ka]

[0111] In some embodiments, the human TERT mRNA may comprise a wild-type TERT sequence, which may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:30 below.

[0112]

[0113] In some embodiments, the mouse TERT mRNA may comprise a wild-type TERT sequence. In some embodiments, the wild-type TERT sequence may comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:31 below.

[0114]

[0115] In some embodiments, TERT mRNA can comprise a nucleic acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1-5, 7, 9 or 30.

[0116] In some embodiments, the TERT mRNA may encode a modified TERT protein that contains one or more amino acid substitutions, deletions, and / or insertions compared to SEQ ID NO:6 or 8, while retaining substantial TERT activity. In some embodiments, the TERT mRNA may encode an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:6 or SEQ ID NO:8.

[0117] In other embodiments, the TERT mRNA may encode an amino acid sequence having the following mutations relative to the amino acid sequence of SEQ ID NO:6: L55Q, P65A, V70M, A202T, A279T, V299M, H412Y, or deletions of residues 441, R522K, K570N, R631Q, G682D, V694M, Y697F, P704S, Y707F, A716T, P721R, T726M, Y772C, P785L, V791I, R811C, L841F, R865H, V867M, R901W, K902N, P923L, S948R, R979W, V1025F, A1062T, V1090M, T1110M and / or F1127L. In some embodiments, the TERT mRNA may encode a TERT isoform in which the translated protein lacks amino acid residues 711-722, 764-807, 808-1132, or 885-947 relative to the amino acid sequence of SEQ ID NO: 6. In some embodiments, about 1, about 5, about 10, about 20, or about 100 amino acids before or after the domain are also deleted from the amino acid sequence of SEQ ID NO: 6.

[0118] In some embodiments, the TERT The mRNA may encode an amino acid sequence in which one or more of the protein regions are deleted from or repeated with respect to the amino acid sequence of SEQ ID NO:6, i.e., residues 1-230 corresponding to RNA interaction domain 1, residues 58-197 corresponding to the "GQ" residue motif, residues 137-141 associated with telomeric DNA and primer extension specificity, residues 210-320 corresponding to the disordered region, residues 231-324 associated with the linker sequence, residues 301-538 associated with oligomerization, residues 325-550 or 460-594 corresponding to the RNA interaction domain, residues 376-521 corresponding to the "QFP" residue motif, residues 397-417 corresponding to the "CP" residue motif, residues 825-884 corresponding to a DNA repeat template, residues 618-729 corresponding to a reverse transcriptase-like element, residues 914-928 associated with oligomerization, residues 930-934 associated with the primer grip sequence, and / or residues 936-1132 corresponding to the C-terminus. In some embodiments, about 1, about 5, about 10, about 20, or about 100 amino acids before or after the domain are also deleted or repeated.

[0119] In some embodiments, TERT mRNA can comprise or consist of a nucleotide sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to any of the nucleic acid sequences of the present disclosure, or to any subsequence of the disclosed nucleic acid sequences, e.g., to any 100 base pairs (bp), 200 bp, 300 bp, 400 bp, 500 bp, or more of the disclosed nucleic acid sequences. In some embodiments, the TERT mRNA can encode an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to any one of the polypeptide sequences of the present disclosure, or to any subsequence of a disclosed polypeptide sequence, e.g., any 50 amino acids (aa), 100 aa, 200 aa, 300 aa, 400 aa, 500 aa, or more of a disclosed polypeptide sequence.

[0120] Non-limiting TERT sequences of the present disclosure include the TERT nucleic acid and amino acid sequences listed in Table 1A. [Table 1A]

[0121] In some embodiments of the compositions and methods of the present disclosure, the amino acid sequence of TERT may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 6-8 or 10-13. In some embodiments of the compositions and methods of the present disclosure, the amino acid sequence of a portion of TERT, whether functional or non-functional, may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 6-8 or 10-13.

[0122] In some embodiments of the compositions and methods of the present disclosure, the nucleic acid sequence of TERT may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 1-5, 7, 9, 14-17, 30, or 31. In some embodiments of the compositions and methods of the present disclosure, the nucleic acid sequence of a portion of a non-human TERT, whether functional or non-functional, may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 1-5, 7, 9, 14-17, 30, or 31.

[0123] The amino acid sequence of non-human primate TERT isoform 1 may comprise or consist of the sequence of SEQ ID NO: 18 below (also set forth in GenBank Accession No. XP_016808391.2). [ka]

[0124] The nucleic acid sequence of non-human primate TERT isoform 1 may comprise or consist of the sequence of SEQ ID NO: 19 below (also set forth in GenBank Accession No. XM_016952902.2). [ka] [ka]

[0125] The amino acid sequence of non-human primate TERT isoform 2 may comprise or consist of the sequence of SEQ ID NO: 20 below, GenBank Accession No. PNI27662.1. [ka] [ka]

[0126] The nucleic acid sequence of non-human primate TERT isoform 2 may comprise or consist of the sequence of SEQ ID NO: 21 below (reverse machine translation of GenBank accession number PNI27662.1). [ka] [ka]

[0127] The amino acid sequence of non-human primate TERT isoform 3 may comprise or consist of the sequence of SEQ ID NO: 22 below (also set forth in GenBank Accession No. PNI27663.1). [ka]

[0128] The nucleic acid sequence of non-human primate TERT isoform 3 may comprise or consist of the sequence of SEQ ID NO: 23 below (reverse machine translation of GenBank accession number PNI27663.1). [ka] [ka]

[0129] The amino acid sequence of non-human primate TERT isoform 4 may comprise or consist of the sequence of SEQ ID NO: 24 below (also set forth in GenBank Accession No. PNI27664.1). [ka]

[0130] The nucleic acid sequence of non-human primate TERT isoform 4 may comprise or consist of the sequence of SEQ ID NO: 25 below (reverse machine translation of GenBank accession number PNI27664.1). [ka] [ka]

[0131] The amino acid sequence of non-human primate TERT isoform 5 may comprise or consist of the sequence of SEQ ID NO: 26 below (also set forth in GenBank Accession No. PNI27665.1). [ka] [ka]

[0132] The nucleic acid sequence of non-human primate TERT isoform 5 may comprise or consist of the sequence of SEQ ID NO: 27 below (reverse machine translation of GenBank accession number PNI27665.1). [ka]

[0133] The amino acid sequence of non-human primate TERT isoform 6 may comprise or consist of the sequence of SEQ ID NO: 28 below (also set forth in GenBank Accession No. PNI27666.1). [ka]

[0134] The nucleic acid sequence of non-human primate TERT isoform 6 may comprise or consist of the sequence of SEQ ID NO: 29 below (reverse machine translation of GenBank accession number PNI27666.1). [ka] [ka]

[0135] In some embodiments of the compositions and methods of the present disclosure, the amino acid sequence of TERT may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 6, 8, 10-13, 18, 20, 22, 24, 26, or 28. In some embodiments of the compositions and methods of the present disclosure, the amino acid sequence of a portion of TERT, whether functional or non-functional, may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 6, 8, 10-13, 18, 20, 22, 24, 26, or 28.

[0136] In some embodiments of the compositions and methods of the present disclosure, the nucleic acid sequence of TERT may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 1-5, 7, 9, 14-17, 19, 21, 23, 25, 27, 29, 30, or 31. In some embodiments of the compositions and methods of the present disclosure, the nucleic acid sequence of a portion of a non-human primate TERT, whether functional or non-functional, may comprise or consist of a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or any percentage therebetween, identity to one or more of SEQ ID NOs: 1-5, 7, 9, 14-17, 19, 21, 23, 25, 27, 29, 30, or 31. In some embodiments, the ribonucleic acid may correspond to a native gene sequence encoding a TERT protein as listed above, or may correspond to a variant that is possible due to redundancy in the genetic code, as will be understood by those skilled in the art. In some embodiments, codon selection may be optimized to optimize protein expression and / or reduce or increase immunogenicity, using algorithms and methods known to those skilled in the art.

[0137] In some embodiments, the mRNA sequence may be synthesized as unmodified or modified mRNA. The mRNA may be modified to enhance stability and / or avoid immune detection and degradation. The modified mRNA may include, for example, one or more of nucleotide modifications, nucleoside modifications, backbone modifications, sugar modifications, and / or base modifications. In some embodiments, the modified nucleoside is pseudouridine or a pseudouridine analog. In some embodiments, the pseudouridine analog is N-1-methylpseudouridine. In some embodiments, the modified nucleoside is 5-methoxyuridine. In some embodiments, as used herein, a modified nucleotide may include any of the moieties listed in Table 1B. [Table 1B-1] [Table 1B-2] [Table 1B-3] [Table 1B-4] [Table 1B-5] [Table 1B-6] [Table 1B-7] [Table 1B-8] [Table 1B-9] [Table 1B-10]

[0138] In some embodiments, the mRNA may be modified with purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and analogs and derivatives thereof, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-acetyl-cytosine, 6-acetyl-cytosine, 7-acetyl-cytosine, 8-acetyl-cytosine, 9-acetyl-cytosine, 10-acetyl-cytosine, 11-acetyl-cytosine, 12-acetyl-cytosine, 13-acetyl-cytosine, 14-acetyl-cytosine, 15-acetyl-cytosine, 16-acetyl-cytosine, 17-acetyl-cytosine, 18-acetyl-cytosine, 19-acetyl-cytosine, 20-acetyl-cytosine, 21-acetyl-cytosine, 22-acetyl-cytosine, 23-acetyl-cytosine, 24-acetyl-cytosine, 25-acetyl-cytosine, 26-acetyl-cytosine, 27-acetyl-cytosine, 28-acetyl-cytosine, 29-acetyl-cytosine, 30-acetyl-cytosine, 31-acetyl-cytosine, 32-acetyl-cytosine, 33-acetyl-cytosine, 34-acetyl-cytosine, 35-acetyl-cytosine, 36-acetyl-cytosine, 37-acetyl-cytosine, Tosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), pseudouridine, N-1-methyl-pseudouridine, dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(calcium phosphate) The bases may be synthesized from natural bases and / or base analogs (modified bases), including, but not limited to, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, beta-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.

[0139] In some embodiments, the mRNA is selected from the group consisting of nucleosides including adenosine (A), guanosine (G), or pyrimidines including thymine (T), cytidine (C), uridine (U), and analogs and derivatives thereof, such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxythymine, 2',3'-dideoxyuridine ... Oxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides, -O-methylnucleosides, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7- Methyl-guanine, inosine, 1-methyl-inosine, pseudouridine, N-1-methyl-pseudouridine, dihydro-uracil, 2-thio-uracil, 4-thio-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-(carboxyhydroxymethyl)-uridine, 5-fluoro-uridine, 5-bromo-uridine, 5-carboxymethylaminomethyl-uridine, 5-methyl-2-thio-uridine, 5-methyl-uridine, N-uridine-5-oxyacetic acid methyl ester, 5-methylaminomethy The nucleosides may be synthesized from natural nucleosides and / or nucleoside analogs (modified nucleosides), including, but not limited to, uridine, 5-methoxyaminomethyl-2-thio-uridine, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 1-methyl-pseudouridine, queosine, beta-D-mannosyl-queosine, wybutoxosine, 7-deazaguanosine, 5-methylcytosine, and inosine.

[0140] The preparation of such base, nucleoside, nucleotide, and backbone analogs, modifications, and derivatives is known to those skilled in the art from, e.g., U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, all of which are incorporated by reference in their entireties.

[0141] In some embodiments, uracil nucleosides in the mRNA are about 80%, about 90%, 95%, 99%, or 100% depleted and replaced with uracil nucleoside analogs, such as pseudouridine, 5-methoxyuridine, or N-1-methyl-pseudouridine.

[0142] In some embodiments, mRNA may contain RNA backbone modification.Typically, backbone modification is a modification in which the backbone phosphate of the nucleotide contained in RNA is chemically modified.Exemplary backbone modifications may include, but are not limited to, the modification in which phosphodiester bond is replaced with a member from the group consisting of peptide, methylphosphonate, methylphosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-0-(l-thiophosphate)), boranophosphate, and / or positively charged guanidine group, or other means of replacing phosphodiester bond.

[0143] In some embodiments, the mRNA may contain sugar modifications, including 2'O-methyl sugar modifications, 2'fluoro sugar modifications (e.g., 2'-fluororibose), 3'amino sugar modifications, 2'thio sugar modifications, 2'-O-alkyl sugar modifications, 5-methylthioribose, and 2'-deoxy-2'-fluoro-ribonucleotides (2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyuridine), 2'-deoxy-2'-deamine-ribonucleotides (2'-amino-2'-deoxycytidine, 2, ... Sugar modifications may include, but are not limited to, 2'-amino-2'-deoxyuridine), 2'-O-alkyl ribonucleotides, 2'-deoxy-2'-C-alkyl ribonucleotides (2'-O-methylcytidine, 2'-methyluridine), 2'-C-alkyl ribonucleotides and their isomers (2'-aracytidine, 2'-arauridine), or azidophosphates (2'-azido-2'-deoxycytidine, 2'-azido-2'-deoxyuridine).

[0144] In some embodiments, the mRNA can be any of the nucleosides and nucleotides disclosed herein or the following nucleoside triphosphates: 2'-deoxyadenosine-5'-O-(1-thiotriphosphate), 2'-deoxycytidine-5'-O-(1-thiotriphosphate), 2'-deoxyguanosine-5'-O-(1-thiotriphosphate), 2'-deoxythymidine-5'-O-(1-thiotriphosphate), adenosine-5'-O-(1-thiotriphosphate), cytidine-5'-O-(1-thiotriphosphate), guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1-thiotriphosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiotriphosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiotriphosphate), 2',3'-dideoxycytidine-5'-O-(1-thiotriphosphate), 2'-deoxyguanosine-5'-O-(1-thiotriphosphate), 2'-deoxythymidine-5'-O-(1-thiotriphosphate), adenosine-5'-O-(1-thiotriphosphate), cytidine-5'-O-(1-thiotriphosphate), guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1-thiotriphosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiotriphosphate), 2',3'-dideoxycytidine ... The nucleic acid may be synthesized from one or more of the nucleotide triphosphates including any of 2'-cytidine-5'-O-(1-thiotriphosphate), 2',3'-dideoxyguanosine-5'-O-(1-thiotriphosphate), 3'-deoxythymidine-5'-O-(1-thiotriphosphate), 3'-azido-2',3'-dideoxythymidine-5'-O-(1-thiotriphosphate), 2',3'-dideoxyuridine-5'-O-(1-thiotriphosphate), 2'-deoxyadenosine-5'-O-(1-boranotriphosphate), 2'-deoxycytidine-5'-O-(1-boranotriphosphate), 2'-deoxyguanosine-5'-O-(1-boranotriphosphate), and 2'-deoxythymidine-5'-O-(1-boranotriphosphate).

[0145] In some embodiments, the mRNA may include the addition of a "cap" at the N-terminal (5') end, and a "tail" at the C-terminal (3') end. The presence of a cap may provide resistance to nucleases found in eukaryotic cells. The presence of a "tail" may protect the mRNA from exonuclease degradation. Cap Construction

[0146] In some embodiments, the mRNA may include a 5' cap structure. The 5' cap may, for example, include a triphosphate linkage and a guanine nucleotide in which the 7 nitrogen is methylated. Examples of cap structures include, but are not limited to, m7G(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G. The native cap structure includes a 7-methylguanosine linked to the 5' end of the first transcribed nucleotide via a triphosphate bridge, resulting in a dinucleotide cap of m7G(5')ppp(5')N, where N is any nucleoside. In vivo, the cap is added in the nucleus by the enzyme guanylyltransferase shortly after transcription initiation.

[0147] In some embodiments, the 5' cap may comprise m7(3'OmeG)(5')ppp(5')(2'OmeA)pG or (CleanCap™ 3' Ome) structure. In some embodiments, the 5' cap may comprise m7G(5')ppp(5')G. In some embodiments, an anti-reverse cap analog ("ARCA") or modified ARCA is a 5' cap in which the 2' or 3' OH group is replaced with -OCH3. In some embodiments, an ARCA comprises a 3'-O-Me-m7G(5')ppp(5')G structure. In some embodiments, the 5' cap comprises m7G(5')ppp(5')(2'OmeA)pG. Additional mRNA caps can include, but are not limited to, chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC, unmethylated caps (e.g., GpppG); 71e methylated caps (e.g., m2'7GpppG), trimethylated cap analogs, or anti-reverse cap analogs (e.g., ARCA; m7,2'0meGpppG, m72'dGpppG, m7'3'0meGpppG, m7,3 dGpppG and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al, 'Wove anti-reverse cap analogs with superior translational properties”, RNA, 9: 1108-1122 (2003)).

[0148] In some embodiments, a suitable cap is methyl 7-guanylate ("m7G") linked to the 5' end of the first transcribed nucleotide via a triphosphate bridge, resulting in m7G(5')ppp(5')N, where N is any nucleoside. An embodiment of the m7G cap utilized in embodiments of the present disclosure is m7G(5')ppp(5')G. In some embodiments, the cap is a Cap0 structure. The Cap0 structure lacks 2'-0-methyl residues of the ribose attached to bases 1 and 2. In some embodiments, the cap is a Capl structure. The Capl structure has a 2'-0-methyl residue at base 2. In some embodiments, the cap is a Cap2 structure. The Cap2 structure has 2'-0-methyl residues added to both bases 2 and 3.

[0149] A variety of m7G cap analogs are known in the art, many of which are commercially available, including the m7 GpppG described above, as well as the ARCA 3'-OCH3 and 2'-OCH3 cap analogs (Jemielity, J. et al., RNA, 9: 1108-1122 (2003)). Additional cap analogs for use in embodiments of the present disclosure include N7-benzylated dinucleoside tetraphosphate analogs (described in Grudzien, E. et al, RNA, 10: 1479-1487 (2004)), phosphorothioate cap analogs (described in Grudzien-Nogalska, E., et al, RNA, 13: 1745-1755 (2007)), and cap analogs described in U.S. Patent Nos. 8,093,367 and 8,304,529 (incorporated herein by reference), including biotinylated cap analogs.

[0150] In some embodiments, the 5' cap is inosine, Nl-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, m7(3'OmeG)(5')ppp(5')(2'OmeA)pG, CleanCap™, m7(3'OmeG)(5')ppp(5')(2'OmeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, or CAP-225.

[0151] In some embodiments, the 5' cap comprises or consists of an internal ribosome entry site (IRES). In some embodiments, the IRES is in the 5'UTR. In some embodiments, the 5' cap comprises or consists of one or more of 2A self-cleaving peptides, e.g., P2A, T2A, E2A, and F2A.

[0152] Tail Structure The presence of the "tail" may serve to protect the mRNA from exonuclease degradation. Poly-A tails are believed to stabilize natural messenger and synthetic sense RNA. Thus, in certain embodiments, long poly-A tails can be added to mRNA molecules, thereby making the RNA more stable. Poly-A tails can be added using a variety of art-recognized techniques. For example, long poly-A tails can be added to synthetic or in vitro transcribed RNA using poly-A polymerase (Yokoe, et al. Nature Biotechnology. 1996; 14: 1252-1256). Transcription vectors can also encode long poly-A tails. Additionally, poly-A tails can be added by direct transcription from PCR products. Poly-A may also be ligated to the 3' end of sense RNA using RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2 ndEd., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition).

[0153] In some embodiments, the mRNA may include a 3' poly(A) tail structure. The length of the polyA tail may be at least about 10, 50, 100, 200, 300, 400, or at least about 500 nucleotides. In some embodiments, the polyA tail on the 3' end of the mRNA may include about 10-300 adenosine nucleotides (e.g., about 10-200 adenosine nucleotides, about 10-150 adenosine nucleotides, about 10-100 adenosine nucleotides, about 20-70 adenosine nucleotides, or about 20-60 adenosine nucleotides). In some embodiments, the polyA tail is 120 adenosine nucleotides. In some embodiments, the mRNA may include a 3' poly I tail structure. The poly C tail at the 3' end of the mRNA may include about 10-200 cytosine nucleotides (e.g., about 10-150 cytosine nucleotides, about 10-100 cytosine nucleotides, about 20-70 cytosine nucleotides, about 20-60 cytosine nucleotides, or about 10-40 cytosine nucleotides). The poly-C tail may be in addition to or may replace the poly-A tail. In some embodiments, the length of the poly-A tail or poly-C tail is associated with the stability of the modified sense mRNA and therefore the transcription of the protein. For example, since the length of the poly-A tail may affect the half-life of the sense mRNA molecule, the length of the poly-A tail may be adjusted to modify the level of resistance of the mRNA to nucleases, thereby providing more control over the time course of polynucleotide expression and / or polypeptide production.

[0154] 5' and 3' untranslated regions (UTRs) In some embodiments, the mRNA may include a 5' untranslated region (UTR) and / or a 3' UTR. In some embodiments, the 5' UTR may include one or more elements that affect mRNA stability or translation. In some embodiments, for example, the 5' UTR may include an iron response element. In some embodiments, the 5' UTR may be about 50 to about 100, or about 50 to about 500 nucleotides in length. In some embodiments, the 3' UTR includes one or more of a polyA signal, a binding site for a protein that may affect mRNA stability or localization, or one or more binding sites for an miRNA. In some embodiments, the 3' UTR may be about 0 to about 50 nucleotides, or about 50 to about 100 nucleotides in length.

[0155] Example 3' an' 5' UTR sequence may be derived from an mRNA with a relatively long half-life (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzyme) to increase the stability of the sense mRNA molecule. For example, the 5'UTR sequence may include a partial sequence of the immediate early 1 (IE1) gene of cytomegalovirus (CMV), or a fragment thereof, to improve nuclease resistance and / or improve the half-life of the polynucleotide. Generally, these modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, and to improve, for example, the resistance of such polynucleotides to nuclease digestion in vivo.

[0156] In some embodiments, the UTRs may improve tissue-specific expression (eg, in the liver).

[0157] In some embodiments, the 3'UTR is a mouse alpha-globin 3'UTR. In some embodiments, the 3'UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:32 below. TTAAGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAGTCTAG

[0158] In some embodiments, the 3' UTR is a wild-type human beta-globin 3' UTR. In some embodiments, the 3' UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:33 below. CAATTGGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCGAATTC

[0159] In some embodiments, the 3' UTR is a variant human beta-globin 3' UTR. In some embodiments, the 3' UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:34 below. CAATTGGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTTGTTCCCTAAGTCCAACTACTAAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTCTTTTCATTGCGAATTC

[0160] In some embodiments, the 5' UTR is a synthetic 5' UTR. In some embodiments, the 5' UTR comprises a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:35 below. AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC

[0161] In some embodiments, the 5' UTR is a human beta-globin 5' UTR. In some embodiments, the 5' UTR comprises a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:36 below. GGACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAACTAGTACACC

[0162] In some embodiments, the UTRs may be any of those described in any of WO2017053297 and U.S. Pat. No. 10,519,189 (both of which are incorporated herein in their entireties) or functional variants thereof.

[0163] Exemplary Therapeutic TERT mRNA Sequences In some embodiments, TERT mRNA may refer to the full length mRNA sequence, i.e., coding and non-coding, and is delivered to tissues such as the liver. Exemplary sequences include sequences comprising mouse TERT in SEQ ID NO: 37 and 38, and sequences comprising human TERT in SEQ ID NO: 39 and 40.

[0164] In some embodiments, the mouse TERT mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:37 below.

[0165]

[0166] In some embodiments, the mouse TERT mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:38 below.

[0167] In some embodiments, the human TERT mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:39 below.

[0168] In some embodiments, the human TERT mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:40 below.

[0169] In some embodiments, TERT mRNA can comprise a nucleic acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 38-40.

[0170] The present disclosure provides a composition for telomere elongation in cells, the composition comprising a compound of the present disclosure described above, and an additional component. In some embodiments, the additional component comprises a telomerase RNA component (TERC). In some embodiments, the composition further comprises a telomerase RNA component (TERC). In some embodiments, the composition further comprises one or more additional components that can facilitate delivery of RNA to cells in vitro and / or in vivo. In some embodiments, the one or more additional components comprise a nanoparticle. In some embodiments, the nanoparticle comprises a lipid. In some embodiments, the nanoparticle or lipid comprises a coatosome-like lipid, or a compound of the present disclosure. In some embodiments, the nanoparticle or lipid comprises a compound of the present disclosure according to formula I.

[0171] II. Delivery Vehicles In some embodiments, one or more mRNAs may be delivered to cells or tissues via a delivery vehicle. In some embodiments, the delivery vehicle may be a nanoparticle. In some embodiments, the delivery vehicle is a lipid nanoparticle (LNP), including but not limited to nanoparticles, including lipids and / or polymers, liposomes, liposomal nanoparticles, cationic lipids, or exosomes. As used herein, a liposomal nanoparticle may be characterized as a microscopic vesicle having an internal aqueous space separated from the outside medium by one or more bilayer membranes.

[0172] In some embodiments, the nanoparticles are polymeric nanoparticles. In some embodiments, the nanoparticles are metal nanoparticles. In other embodiments, the delivery vehicle comprises or consists of a recombinant virus or virus-like particle, such as an adenovirus, an adeno-associated virus (AAV), a herpes virus, or a retrovirus, such as a lentivirus. In some embodiments, the delivery vehicle comprises or consists of a modified viral vector, such as an adenovirus dodecahedron or a recombinant adenovirus assembly. In other embodiments, the delivery vehicle may comprise or consist of calcium phosphate nucleotides, aptamers, cell-penetrating peptides, or other vector tags.

[0173] A. Liposomal Delivery Vehicles In some embodiments, a suitable delivery vehicle is a lipid nanoparticle (LNP), and exemplary LNPs may include one or more different lipids and / or polymers. In some embodiments, the LNPs include one or more of an ionizable lipid, a neutral lipid, cholesterol, and / or a stabilizing lipid (e.g., a PEGylated lipid).

[0174] Ionizable lipids In some embodiments, the LNP may comprise an ionizable lipid. An ionizable lipid may refer to any of several lipid species that have a net positive charge at a selected pH, such as physiological pH. An ionizable lipid may also refer to, for example, a lipid in an ionized state, such as a cationic lipid. In some embodiments, the LNP may comprise an ionizable lipid disclosed in either WO 2010 / 053572 or WO 2012 / 170930 (both of which are incorporated herein by reference in their entirety), or a variant thereof.

[0175] In some embodiments, LNPs for hepatic delivery of TERT mRNA may comprise one or more of MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), 1,2-dilineoyl-3-dimethylammonium-propane (DLinDAP), DLin-MC3-DMA 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)-9,12-octadecadien-1-yl-10,13-nonadecadien-1-yl ester, and / or cKK-E12 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione. In some embodiments, LNPs comprise 2,2-dilinoleyl-4-dimethylaminoethyl-[1 ,3]-dioxolane (Dlin-KC2-DMA, 1) and / or (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate. In some embodiments, the ionizable lipid may have a pKa range of 6.1 to 6.7, optionally a pKa range of 6.2 to 6.5.

[0176] In some embodiments, the LNPs comprise 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N,N-distearyl-N,N-dimethylaluminum bromide (DABB), or 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (EPC). In some embodiments, the LNPs comprise an ionizable lipid, which is one or more of N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 5-carboxyspermylglycine dioctadecylamide (DOGS), 2,3-dioleoyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium (DOSPA), l,2-dioleoyl-3-dimethylammonium-propane (DODAP), and / or l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), or variations thereof. LNPs may also include one or more of 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DODMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or (DLenDMA), 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)-9,12-octadecadien-1-yl-10,13-nonadecadien-1-yl ester (DLin-MC3-DMA), N-dioleyl-N,N-dimethylammonium chloride (DODAC), or variations thereof.In other embodiments, the LNP is selected from the group consisting of XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-Nl,N16-diundecyl-4,7,10,11-tris( ... 13-tetraazahexadecane-1,16-diamide), or a variation thereof.

[0177] In some embodiments, the LNPs may comprise one or more ionizable lipids, such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-l-yl)tetracosa-15,18-dien-1-amine, (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-l-amine, and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002).

[0178] In some embodiments, the LNPs may comprise cleavable, ionizable lipids that contain disulfide bonds, e.g., COATSOME™ SS-OP, i.e., SS-OP™, COATSOME™ SS-M, COATSOME™ SS-E, COATSOME™ SS-EC, COATSOME™ SS-LC, COATSOME™ SS-OC and variations thereof. In some embodiments, the LNPs may comprise about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% ionizable lipids compared to other lipids. Other "Helper" Phospholipids

[0179] In some embodiments, the LNPs are selected from the group consisting of distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-trans The LNPs may include an additional lipid selected from another of PE, l-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), or variants thereof. In some embodiments, the LNPs may include one or more phosphatidyl lipids, such as, for example, phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, and phosphatidylethanolamine). In some embodiments, the LNPs may include sphingolipids, such as, but not limited to, sphingosine, ceramide, sphingomyelin, cerebrosides, and gangliosides. In some embodiments, the aforementioned "helper" lipids contribute to the stability and / or specificity of the LNP composition.

[0180] Cholesterol-based lipids In some embodiments, the LNPs may include one or more cholesterol-based lipids, which may include, but are not limited to, PEGylated cholesterol, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine. In some embodiments, the LNPs may contain from about 2% to about 30%, or from about 5% to about 20%, cholesterol relative to the total lipids present. PEGylated lipids

[0181] Without intending to be bound by theory, it is contemplated that the addition of lipids modified with insulating molecules such as proteins or other polymers such as polyethylene-glycol (PEG), also known as PEGylated lipids, may prevent aggregation of the complex and extend circulation lifetime to facilitate delivery of liposome-encapsulated mRNA to target cells. In some embodiments, the addition of PEGylated lipids protects the LNPs from immune targeting. In some embodiments, the PEGylated lipids form a hydrophilic barrier around the hydrophobic LNPs, preventing opsonization of plasma proteins and bypassing macrophage uptake. In some embodiments, lipids modified with other hydrophilic molecules may be substituted for the PEGylated lipids in the LNP delivery vehicle.

[0182] In some embodiments of the present disclosure, the LNPs may include one or more PEGylated lipids. For example, the use of polyethylene glycol (PEG)-modified phospholipids, including N-octanoyl-sphingosine-l-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), and derivatized lipids such as derivatized ceramides (PEG-CER) are contemplated by the present disclosure in combination with one or more of the ionizable lipids and / or other lipids. In some embodiments, the PEGylated lipid includes a PEG-ceramide with a shorter acyl chain (e.g., C14 or C18). In some embodiments, the PEGylated lipid DSPE-PEG-maleimide-lectin may be used. Other contemplated PEG-modified lipids include, but are not limited to, polyethylene glycol chains of up to 5 kDa in length covalently attached to the lipid with alkyl chains of C6-C2o length. Without intending to be bound by any particular theory, it is contemplated that the addition of PEGylated lipids may prevent aggregation of the complexes, increase circulation lifetime, and facilitate delivery of liposome-encapsulated mRNA to target cells.

[0183] In some embodiments, the PEGylated lipid may comprise, by molar ratio, about 0% to about 20%, about 0% to about 15%, about 0% to about 10%, about 1% to about 10%, about 1% to about 8%, 1% to about 6%, 1% to about 5%, about 2% to about 10%, about 4% to about 10% of the total lipid present in the liposome. In some embodiments, the proportion of the PEGylated lipid may be, by molar ratio, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or less than about 1% of the total lipid present in the liposome. In some embodiments, the proportion of PEGylated lipid, by molar ratio, may be greater than about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, or about 20% of the total lipid present in the liposome.

[0184] In some embodiments, the lipid nanoparticle formulations are those described in U.S. Pat. Nos. 11,185,595, 9,868,693, 10,195,156, 9,877,919, 9,738,593, 10,399,937, 10,106,490, 9,738,593, 10,821,186, or 8,058,069, each of which is incorporated by reference in its entirety. or may comprise, consist essentially of, or consist of any of those described in U.S. Patent Application Publication Nos. 20180085474, 20210259980, 20200206362, 20210267895, 20200283372, or 20200163878 (each of which is incorporated by reference in its entirety herein).

[0185] Lipid Nanoparticle (LNP) Composition The following examples of LNP formulations are not intended to be limiting. In some embodiments, the LNPs may comprise a molar ratio of about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, or about 75 molar ionizable lipids. In some embodiments, the LNPs may comprise a molar ratio of about 0.1, about 1.0, about 2.0, about 3.0, about 4.0, about 5.0, about 6.0, about 7.0, about 8.0, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 40, or about 50 molar cholesterol. In some embodiments, the LNPs may comprise a molar ratio of about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, or about 70 molar cholesterol. In some embodiments, the LNPs may comprise a molar ratio of about 0.1, about 0.25, about 0.5, about 0.75, about 1.0, about 1.25, about 1.5, about 1.75, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, or about 5.0 molar PEGylated lipids.

[0186] In some embodiments, the LNP comprises a molar ratio of about 40-70 moles of ionizable lipid to about 0.1 to about 20 moles of another phospholipid, about 20 to about 60 moles of cholesterol, and about 0.1 to about 5 moles of PEGylated lipid. In some embodiments, the LNP delivery vehicle comprises a molar ratio of about 50-60 moles of ionizable lipid to about 4-18 moles of another phospholipid, about 35-50 moles of cholesterol, and about 1-3 moles of PEGylated lipid.

[0187] In some embodiments, the LNP may comprise a molar ratio of about 50 to about 60 moles of ionizable lipid, about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

[0188] In some embodiments, the LNPs may comprise a molar ratio of about 30 to about 40 moles of ionizable lipid, about 14 to about 18 moles of phospholipid, about 40 to about 50 moles of cholesterol, and about 2.0 to about 3.0 moles of PEGylated lipid.

[0189] In some embodiments, the LNPs may include the ionizable lipid SS-OP™, the phospholipid DOPC, a cholesterol lipid, and the PEGylated lipid DMG-PEG2000. In some embodiments, the LNPs may include a molar ratio of 55 moles of SS-OP™ to 5 moles of DOPC, 40 moles of cholesterol lipid, and 1.5 moles of the PEGylated lipid DMG-PEG2000. In some embodiments, the LNPs may include a molar ratio of 52.5 moles of SS-OP™ to 7.5 moles of DOPC, 40 moles of cholesterol lipid, and 1.5 moles of the PEGylated lipid DMG-PEG2000.

[0190] In some embodiments, the LNPs may comprise an ionizable lipid cKK-E12, a phospholipid DOPE, a cholesterol lipid, and a PEGylated lipid 14:0 PEG2000 PE. In some embodiments, the LNPs may comprise a molar ratio of about 35 moles of cKK-E12 to about 16 moles of DOPE, about 46.5 moles of cholesterol lipid, and about 2.5 moles of the PEGylated lipid 14:0 PEG2000 PE.

[0191] In some embodiments, the LNPs may comprise an ionizable lipid DLin-MC3-DMA, a phospholipid DSPC, a cholesterol lipid, and a PEGylated lipid DMG-PEG 2000. In some embodiments, the LNPs may comprise a molar ratio of about 50 moles DLin-MC3-DMA, about 10 moles phospholipid DSPC, about 40 moles cholesterol lipid, and about 1.5 moles PEGylated lipid DMG-PEG 2000.

[0192] In some embodiments, the LNPs may comprise the ionizable lipid SS-OP™, the phospholipid DOPE, a cholesterol lipid, and the PEGylated lipid 14:0 PEG2000 PE. In some embodiments, the LNPs may comprise a molar ratio of about 35 moles of SS-OP™ to about 16 moles of DOPE, about 46.5 moles of cholesterol lipid, and about 2.5 moles of the PEGylated lipid 14:0 PEG2000 PE.

[0193] In some embodiments, the LNPs may comprise an ionizable lipid cKK-E12, a phospholipid DOPC, a cholesterol lipid, and a PEGylated lipid DMG-PEG 2000. In some embodiments, the LNPs may comprise a molar ratio of about 55 moles of cKK-E12 to about 5 moles of DOPC, about 40 moles of cholesterol lipid, and about 1.5 moles of the PEGylated lipid DMG-PEG 2000.

[0194] B. Polymer Nanoparticles In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, either alone or in combination with other carriers, including various lipids as described herein. Thus, in some embodiments, liposomal delivery vehicles, as used herein, also encompass polymer-containing nanoparticles. Suitable polymers may include, for example, polyacrylate, polyalkoxyanoacrylate, polylactic acid, polylactic acid-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, protamine, polyethylene glycol (PEG)-modified (PEGylated) protamine, poly-D-lysine (PLL), PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be linear or branched PEI with a molecular weight ranging from 10 to 40 kDA, e.g., 25 kDa branched PEI (Sigma#408727). In some embodiments, the PEGylated lipid is 14:0 PEG2000 PE and / or DMG-PEG2000.

[0195] C. Liver-Targeted Delivery Vehicles In some embodiments, the delivery vehicles disclosed herein preferentially target a particular organ, such as the liver. In various embodiments, the delivery vehicles preferentially target a particular organ, such as the liver, by 10-fold, 10-fold, or 10-fold relative to a reference cell type (e.g., lung cells). 2 Double, 10 3 Double, 10 4 Double, 10 5 Double, 10 6 Double, 10 7 Double, 10 8 Double, 10 9 Double, or 10 10mRNA may be delivered to liver cells twice as effectively. However, it is understood that some level of delivery to non-target cells / organs can be tolerated without reducing efficacy in target organs / cells. In some embodiments, the lipid composition of the delivery vehicle enhances delivery to the liver compared to other lipid compositions known in the art. In other embodiments, the lipid composition of the delivery vehicle enhances delivery to the liver compared to other lipid compositions. In some embodiments, the presence or level of cholesterol enhances the delivery of the delivery vehicle, for example, LNP or extracellular vesicle, to the liver.

[0196] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise a molar ratio of about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, or about 75 molar ionizable lipids. In some embodiments, the LNP may comprise a molar ratio of about 0.1, about 1.0, about 2.0, about 3.0, about 4.0, about 5.0, about 6.0, about 7.0, about 8.0, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 40, or about 50 molar cholesterol. In some embodiments, the LNP may comprise a molar ratio of about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, or about 70 molar cholesterol. In some embodiments, the LNPs may comprise a molar ratio of about 0.1, about 0.25, about 0.5, about 0.75, about 1.0, about 1.25, about 1.5, about 1.75, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, or about 5.0 molar PEGylated lipids.

[0197] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) comprises a molar ratio of about 40-70 moles of ionizable lipid to about 0.1 to about 20 moles of another phospholipid, about 20 to about 60 moles of cholesterol, and about 0.1 to about 5 moles of PEGylated lipid. In some embodiments, an LNP delivery vehicle comprises a molar ratio of about 50-60 moles of ionizable lipid to about 4-18 moles of another phospholipid, about 35-50 moles of cholesterol, and about 1-3 moles of PEGylated lipid.

[0198] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise a molar ratio of about 50 to about 60 moles of ionizable lipid, about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

[0199] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise a molar ratio of about 30 to about 40 moles of ionizable lipid, about 14 to about 18 moles of phospholipid, about 40 to about 50 moles of cholesterol, and about 2.0 to about 3.0 moles of PEGylated lipid.

[0200] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may include the ionizable lipid SS-OP™, the phospholipid DOPC, a cholesterol lipid, and the PEGylated lipid DMG-PEG 2000. In some embodiments, the LNP may include a molar ratio of 55 moles of SS-OP™ to 5 moles of DOPC, 40 moles of cholesterol lipid, and 1.5 moles of the PEGylated lipid DMG-PEG 2000.

[0201] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise an ionizable lipid cKK-E12, a phospholipid DOPE, a cholesterol lipid, and a PEGylated lipid 14:0 PEG2000 PE. In some embodiments, the LNP may comprise a molar ratio of about 35 moles of cKK-E12 to about 16 moles of DOPE, about 46.5 moles of cholesterol lipid, and about 2.5 moles of the PEGylated lipid 14:0 PEG2000 PE.

[0202] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may include an ionizable lipid DLin-MC3-DMA, a phospholipid DSPC, a cholesterol lipid, and a PEGylated lipid DMG-PEG2000. In some embodiments, the LNP may include a molar ratio of about 50 moles DLin-MC3-DMA, about 10 moles phospholipid DSPC, about 40 moles cholesterol lipid, and about 1.5 moles PEGylated lipid DMG-PEG2000.

[0203] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise an ionizable lipid SS-OP™, a phospholipid DOPE, a cholesterol lipid, and a PEGylated lipid 14:0 PEG2000 PE. In some embodiments, the LNP may comprise a molar ratio of about 35 moles of SS-OP™ to about 16 moles of DOPE, about 46.5 moles of cholesterol lipid, and about 2.5 moles of the PEGylated lipid 14:0 PEG2000 PE.

[0204] In some embodiments, a liver-targeted delivery vehicle (e.g., LNP) may comprise an ionizable lipid cKK-E12, a phospholipid DOPC, a cholesterol lipid, and a PEGylated lipid DMG-PEG 2000. In some embodiments, the LNP may comprise a molar ratio of about 55 moles of cKK-E12 to about 5 moles of DOPC, about 40 moles of cholesterol lipid, and about 1.5 moles of the PEGylated lipid DMG-PEG 2000.

[0205] In some embodiments, the delivery vehicle comprises an organ-specific targeting ligand to enhance delivery to a particular organ, for example, the liver. The ligand may include, but is not limited to, a protein (e.g., human serum albumin HSA), low density lipoprotein (LDL), or globulin), a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or hyaluronic acid), or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, for example, a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic acid polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of polyamine, or alpha helical peptide. The ligand may also comprise a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody that binds to a particular cell type, e.g., a kidney cell.The targeting group can be thyroid stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, gelatin, and the like. nyloxyhexyl group, hexadecylglycerol, vomeol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., anthrenopeptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0206] In some embodiments, the organ targeting ligand is a protein, e.g., a glycoprotein, or a peptide, e.g., a molecule with specific affinity for a co-ligand, or an antibody, e.g., an antibody that binds to a specific cell type, e.g., a liver cell. In some embodiments, the ligand may be a hormone or a hormone receptor. The ligand may also be a non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetylglucosamine multivalent mannose, or multivalent fructose.

[0207] In some embodiments, the liver-targeted delivery vehicle (e.g., LNP) may include an apoE ligand and / or a ligand containing a multivalent N-acetylgalactosamine (GalNAc) cluster, which binds with high affinity to the asialoglycoprotein receptor (ASGPR) expressed on hepatocytes. In some embodiments, the LNP may include a retinol-binding protein (RBP) for targeting hepatocytes, which express the RBP receptor.

[0208] In some embodiments, the delivery vehicle may comprise an extracellular vesicle, such as an exosome, that is targeted to the liver. In some embodiments, the extracellular vesicle comprises one or more tissue-targeting moieties, including, but not limited to, lipids, peptides, or antibodies.

[0209] The composition of the present disclosure may comprise one or more components that can facilitate the delivery of RNA to cells. The components of the composition may collectively or in part comprise a delivery vehicle. In some embodiments, the delivery vehicle facilitates the targeting and uptake of the ribonucleic acid of the composition of the present disclosure into target cells. Exemplary delivery vehicles include, but are not limited to, nanoparticles, lipid nanoparticles (LNPs), liposomes, micelles, exosomes, cationic lipids, and natural or artificial lipoprotein particles.

[0210] In some embodiments, the delivery vehicle comprises ionizable lipid.Ionizable lipid may refer to any of several lipid species that have a net positive charge at a selected pH, such as physiological pH.Ionizable lipid may also refer to, for example, lipid in ionized state, such as cationic lipid.

[0211] In some embodiments, the cationic lipid formulation comprises a cationic lipid and a structural or matrix lipid. The cationic lipid may be composed of a cationic amine moiety and a lipid moiety, and the cationic amine moiety may interact with a polyanionic nucleic acid to form a positively charged liposome or lipid membrane structure. In some embodiments, the references to the "moiety" and "lipid" of the lipid may be equivalent. Thus, the uptake into cells may be promoted and the nucleic acid may be delivered into cells.

[0212] In some embodiments, the ionizable lipid can be a compound of formula (1). [ka]

[0213] In formula (1), R 1a and R 1b R each independently represents an alkylene group having 1 to 6 carbon atoms, and may be linear or branched. The alkylene group may have 1 to 4 carbon atoms, or may have 1 to 2 carbon atoms. Specific examples of alkylene groups having 1 to 6 carbon atoms include a methylene group, an ethylene group, a trimethylene group, an isopropylene group, a tetramethylene group, an isobutylene group, a pentamethylene group, and a neopentylene group. 1a and R 1b may each independently be a methylene group, an ethylene group, a trimethylene group, an isopropylene group, or a tetramethylene group, or may be an ethylene group.

[0214] R 1a is R 1bmay be different from or the same as.

[0215] X a and X b are each independently an acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, or an acyclic alkyl tertiary amino group having 2 to 5 carbon atoms, and a cyclic alkylene tertiary amino group having 1 to 2 tertiary amino groups, and / or each independently a cyclic alkylene having 2 to 5 carbon atoms and 1 to 2 tertiary amino groups and an alkylene tertiary amino group.

[0216] In the non-cyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, the alkyl group having 1 to 6 carbon atoms is branched even if it is linear. The alkyl group may be cyclic. The alkyl group may have 1 to 3 carbon atoms. Specific examples of the alkyl group having 1 to 6 carbon atoms include a methyl group, an ethyl group, a propyl group, an isopropyl group, a n-butyl group, a sec-butyl group, an isobutyl group, a tert-butyl group, a pentyl group, and an isopentyl group. Examples of the alkyl group having 1 to 6 carbon atoms include a neopentyl group, a t-pentyl group, a 1,2-dimethylpropyl group, a 2-methylbutyl group, a 2-methylpentyl group, a 3-methylpentyl group, a 2,2-dimethylbutyl group, a 2,3-dimethylbutyl group, and a cyclohexyl group.

[0217] The specific structure of the acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group is X 1 It is represented by:

[0218] [ka]

[0219] X 1 R 5represents an alkyl group having 1 to 6 carbon atoms, and may be linear, branched, or cyclic. The alkyl group may have 1 to 3 carbon atoms. Specific examples of the alkyl group having 1 to 6 carbon atoms include a methyl group, an ethyl group, a propyl group, an isopropyl group, a n-butyl group, a sec-butyl group, an isobutyl group, a tert-butyl group, a pentyl group, and an isopentyl group. Examples of the alkyl group having 1 to 6 carbon atoms include a neopentyl group, a t-pentyl group, a 1,2-dimethylpropyl group, a 2-methylbutyl group, a 2-methylpentyl group, a 3-methylpentyl group, a 2,2-dimethylbutyl group, a 2,3-dimethylbutyl group, and a cyclohexyl group.

[0220] The number of carbon atoms in the cyclic alkylene tertiary amino group having 2 to 5 carbon atoms and 1 to 2 tertiary amino groups may be 4 to 5. Specific examples of the cyclic alkylene tertiary amino group having 2 to 5 carbon atoms and 1 to 2 tertiary amino groups include an aziridylene group, an azetidylene group, a pyrrolizylene group, a piperidylene group, an imidazolidylene group, a piperaziylene group, and optionally a pyrrolizylene group, a piperidylene group, or a piperaziylene group.

[0221] The specific structure of the alkylene tertiary amino group containing 2 to 5 carbon atoms and one cyclic tertiary amino group is X 2 It is expressed as: [ka]

[0222] X 2 In the formula, p is 1 or 2. When p is 1, X 2 is a pyrrolidine group, and when p is 2, X 2 is a piperidylene group.

[0223] The specific structure of a cyclic alkylene tertiary amino group having 2 to 5 carbon atoms and two tertiary amino groups is X 3 It is represented by: [ka]

[0224] X 3 In the formula, W is 1 or 2. When w is 1, X 3 is an imidazolidylene group, and when w is 2, X 3 is a piperazylene group.

[0225] X a X b It may be different from or the same as.

[0226] R 2a and R 2b each independently represent an alkylene group or an oxydialkylene group having up to 8 carbon atoms, and optionally each independently represent an alkylene group having up to 8 carbon atoms.

[0227] Alkylene groups having 8 or less carbon atoms may be linear or branched, but are optionally linear. The number of carbon atoms contained in the alkylene group is optionally 6 or less, and optionally 4 or less. Specific examples of alkylene groups having 8 or less carbon atoms include methylene, ethylene, propylene, isopropylene, tetramethylene, isobutylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, and the like. Some embodiments include methylene, ethylene, propylene, and tetramethylene groups.

[0228] An oxydialkylene group having 8 or less carbon atoms refers to an alkylene group (alkylene-O-alkylene) through an ether bond, and the total number of carbon atoms of the two alkylene groups is 8 or less. Here, the two alkylenes may be the same or different, but are optionally the same. Specific examples of an oxydialkylene group having 8 or less carbon atoms include an oxydimethylene group, an oxydiethylene group, an oxydipropylene group, and an oxydibutylene group.

[0229] R 2amay be the same or different, R 2b may be also possible.

[0230] Y a and Y b are each independently an ester bond, an amide bond, a carbamate bond, an ether bond, or a urea bond, and optionally each independently an ester bond, an amide bond, or a carbamate bond. Y a and Y b The Y bond orientation is not limited, but a and Y b is an ester bond, optionally -Z a -CO---R 2a - and -Z b -CO-OR 2b -Structure.

[0231] Y a is Y b It may be different from or the same as.

[0232] Z a and Z b are each independently a divalent group derived from an aromatic compound having 3 to 16 carbon atoms, at least one aromatic ring, and optionally a heteroatom. The number of carbon atoms contained in the aromatic compound is optionally 6 to 12 or 6 to 7. Furthermore, the number of aromatic rings contained in the aromatic compound is optionally 1.

[0233] The types of aromatic rings contained in the aromatic compounds having 3 to 16 carbon atoms include aromatic hydrocarbon rings such as benzene ring, naphthalene ring, and anthracene ring, and aromatic heterocycles such as imidazole ring, pyrazole ring, oxazole ring, isoxazole ring, thiazole ring, isothiazole ring, triazine ring, pyrrole ring, furanthiophene ring, pyrimidine ring, pyridazine ring, pyrazine ring, pyridine ring, purine ring, pteridine ring, benzimidazole ring, indole ring, benzofuran ring, quinazoline ring, phthalazine ring, quinoline ring, isoquinoline ring, coumarin ring, chromone ring, benzodiazepine ring, phenoxazine ring, phenothiazine ring, and acridine ring, and are optionally benzene ring, naphthalene ring, and anthracene ring. The aromatic ring may have a substituent. Examples of the substituent include an acyl group having 2 to 4 carbon atoms, an alkoxycarbonyl group having 2 to 4 carbon atoms, a carbamoyl group having 2 to 4 carbon atoms, an acyloxy group having 2 to 4 carbon atoms, an acylamino group having 2 to 4 carbon atoms, an alkoxycarbonylamino group having 2 to 4 carbon atoms, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, an alkylsulfanyl group having 1 to 4 carbon atoms, an alkylsulfonyl group having 1 to 4 carbon atoms, an arylsulfonyl group having 6 to 10 carbon atoms, a nitro group, a trifluoromethyl group, a cyano group, an alkyl group having 1 to 4 carbon atoms, a ureido group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, an aryl group having 6 to 10 carbon atoms, and an aryloxy group having 6 to 10 carbon atoms. Some examples include acetyl, methoxycarbonyl, methylcarbonate and the like, moyl, acetoxy, acetamido, methoxycarbonylamino, fluorine, chlorine, bromine, iodine, methylsulfanyl, phenylsulfonyl, nitro, trifluoromethyl, cyano, methyl, ethyl, propyl, isopropyl, t-butyl, ureido, methoxy, ethoxy, propoxy, isopropoxy, t-butoxy, phenyl, and phenoxy groups.

[0234] Z a and Z b The specific structure of Z 1 Includes. [ka]

[0235] In the formula, s represents an integer of 0 to 3, t represents an integer of 0 to 3, u represents an integer of 0 to 4, and the u numbers in R4 each independently represent a substituent.

[0236] Z 1 wherein S is optionally an integer between 0 and 1.

[0237] Z 1 wherein T is optionally an integer from 0 to 2.

[0238] Z 1 wherein U is optionally an integer from 0 to 2.

[0239] Z 1R4 in the formula (I) is a substituent of an aromatic ring (benzene ring) contained in an aromatic compound having 3 to 16 carbon atoms that does not inhibit the reaction in the process of synthesizing an ionizable lipid. Examples of the substituent include an acyl group having 2 to 4 carbon atoms, an alkoxycarbonyl group having 2 to 4 carbon atoms, a carbamoyl group having 2 to 4 carbon atoms, an acyloxy group having 2 to 4 carbon atoms, an acylamino group having 2 to 4 carbon atoms, an alkoxycarbonylamino group having 2 to 4 carbon atoms, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, an alkylsulfanyl group having 1 to 4 carbon atoms, an alkylsulfonyl group having 1 to 4 carbon atoms, an arylsulfonyl group having 6 to 10 carbon atoms, a nitro group, a trifluoromethyl group, a cyano group, an alkyl group having 1 to 4 carbon atoms, an alkyl group having 1 to 4 carbon atoms, an aryl ... Examples of the aryl group include ureido, alkoxy, aryl, and aryloxy groups having 6 to 10 carbon atoms, and examples thereof include acetyl, methoxycarbonyl, methylcarbamoyl, acetoxy, amido, methoxycarbonylamino, fluorine, chlorine, bromine, iodine, methylsulfanyl, phenylsulfonyl, nitro, trifluoromethyl, cyano, methyl, ethyl, propyl, isopropyl, t-butyl, ureido, methoxy, ethoxy, propoxy, isopropoxy, t-butoxy, phenyl, and phenoxy groups. 4 If present, then each R 4 may be the same or different.

[0240] Z a is Z b may be the same as or different from.

[0241] R 3a and R 3bare each independently a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group and succinic anhydride or glutaric anhydride, or a sterol derivative having a hydroxyl group and succinic anhydride or glutaric anhydride, an anhydride, or a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group and succinic anhydride or glutaric anhydride with an aliphatic hydrocarbon group having 12 to 22 carbon atoms, optionally each independently a C12-22 aliphatic hydrocarbon group, and optionally each independently an aliphatic hydrocarbon group having 12 to 22 carbon atoms.

[0242] Examples of fat-soluble vitamins having a hydroxyl group include retinol, ergosterol, 7-dehydrocholesterol, calciferol, corcalciferol, dihydroergocalciferol, dihydrotaxolol, tocopherol, and tocotrienol. The fat-soluble vitamin having a hydroxyl group is optionally a tocopherol.

[0243] Examples of sterol derivatives having a hydroxyl group include cholesterol, cholestanol, stigmasterol, β-sitosterol, lanosterol, ergosterol, and the like, optionally including cholesterol or cholestanol.

[0244] The aliphatic hydrocarbon group having 12 to 22 carbon atoms may be linear or branched. The aliphatic hydrocarbon group may be saturated or unsaturated. In the case of an unsaturated aliphatic hydrocarbon group, the number of unsaturated bonds contained in the aliphatic hydrocarbon group is usually 1 to 6, optionally 1 to 3, or 1 to 2. The unsaturated bonds include carbon-carbon double bonds and carbon-carbon triple bonds. The number of carbon atoms contained in the aliphatic hydrocarbon group is optionally 13 to 19, or 13 to 17. The aliphatic hydrocarbon group includes an alkyl group, an alkenyl group, an alkynyl group, and the like, and optionally includes an alkyl group or an alkenyl group. Specific examples of the aliphatic hydrocarbon group having 12 to 22 carbon atoms include dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, Octadecyl, nonadecyl, icosyl, heicosyl, docosyl, dodecenyl, tridecenyl, tetradecenyl, pentadecenyl, hexadecenyl, heptadecenyl, octadecenyl, nonadecenyl, icosenyl, henicosenyl, docosenyl, dodecadienyl, tridecadienyl, tetradecadienyl, pentadecadienyl, hexadecadienyl, heptadecadienyl Possible groups include, but are not limited to, octadecadienyl, nonadecadienyl, icosadenyi, henicosadienyl, docosadienyl, octadecatrienyl, icosatrienyl, cosatetraenyl, icosapentaenyl, docosahexaenyl, isostearyl, 1-hexylheptyl, 1-hexylnonyl, 1-octylnonyl, 1-octylundecyl, 1-decylundecyl, and the like. The aliphatic hydrocarbon group having 12 to 22 carbon atoms is optionally a tridecyl group, a pentadecyl group, a heptadecyl group, a nonadecyl group, a heptadecenyl group, a heptadecadienyl group, or a 1-hexylnonyl group, or a tridecyl group, a heptadecyl group, a heptadecenyl group, and a heptadecadienyl group.

[0245] In one embodiment of the present disclosure, R 3a and R 3bThe aliphatic hydrocarbon group having 12 to 22 carbon atoms represented by the formula (1) is derived from a fatty acid. In this case, the carbonyl carbon derived from the fatty acid is included in -CO-O- in formula (1). Specific examples of the aliphatic hydrocarbon group include a heptadecenyl group when linoleic acid is used as the fatty acid, and a heptadecenyl group when oleic acid is used as the fatty acid.

[0246] R 3a is R 3b It may be different from or the same as.

[0247] In one embodiment of the present disclosure, R 1a is R 1b is the same as X a isX b is the same as R 2a is R 2b is the same as Y a is Y b is the same as Z a is Z b is the same as R 3a is R 3b is equivalent to.

[0248] Preferred examples of the ionizable lipid represented by formula (1) include the following ionizable lipids: Ionizable lipid (1-1); R1a and R1b are each independently an alkylene group having 1 to 6 carbon atoms (e.g., a methylene group, an ethylene group); Xa and Xb are each independently an acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group (e.g., -N(CH3)-) or a cyclic alkylene tertiary amino group containing 2 to 5 carbon atoms and 1 to 2 tertiary amino groups (e.g., a piperidylene group); R 2a and R 2b are each independently an alkylene group having 8 or fewer carbon atoms (e.g., a methylene group, an ethylene group, a propylene group); a and Y b are each independently an ester bond or an amide bond; Z a and Z bare each independently a divalent group derived from an aromatic compound having 3 to 16 carbon atoms, at least one aromatic ring, and optionally a heteroatom (e.g., -CH-CH-, -CH-CH-CH-); R 3a and R 3b are each independently a residue derived from the reaction product of a fat-soluble vitamin having a hydroxyl group (e.g., tocopherol) and succinic or glutaric anhydride, or an aliphatic group having a hydrocarbon group of 12 to 22 carbon atoms (e.g., heptadecenyl, heptadecadienyl, 1-hexylnonyl).

[0249] Ionizable lipid (1-2); R 1a and R 1b are each independently an alkylene group having 1 to 4 carbon atoms (e.g., a methylene group, an ethylene group), Xa and Xb are each independently an acyclic alkyl tertiary amino group having 1 to 3 carbon atoms and one tertiary amino group (e.g., -N(CH3)-) or a cyclic alkylene tertiary amino group having 2 to 5 carbon atoms and one tertiary amino group (e.g., a piperidylene group); R 2a and R 2b are each independently an alkylene group having 6 or fewer carbon atoms (e.g., a methylene group, an ethylene group, a propylene group); Y a and Y b are each independently an ester bond or an amide bond; Za and Zb are each independently a divalent group derived from an aromatic compound having 6 to 12 carbon atoms, one aromatic ring, and optionally a heteroatom (e.g., -CH-CH-, -CH-CH-); R 3a and R 3b are each independently a residue derived from the reaction product of a fat-soluble vitamin having a hydroxyl group (e.g., tocopherol) and succinic anhydride, or an aliphatic hydrocarbon group having 13 to 19 carbon atoms (e.g., heptadecenyl, heptadecadienyl, 1-hexylnonyl). Ionizable lipids (1-3); R 1aand R 1b are each independently an alkylene group having 1 to 2 carbon atoms (e.g., a methylene group, an ethylene group); a and X b are each independently 1 : [ka] where R5 is an alkyl group having 1 to 3 carbon atoms (e.g., a methyl group), or X 2 : [ka] where p is 1 or 2; R 2a and R 2b are each independently an alkylene group having 4 or fewer carbon atoms (e.g., a methylene group, an ethylene group, a propylene group); Y a and Y b are each independently an ester bond or an amide bond; Z a and Z b are each independently 1 : [ka] where s is an integer from 0 to 1, t is an integer from 0 to 2, and u is an integer from 0 to 2 (optionally 0), and (R 4 Each u independently represents a substituent. 3a and R 3b are each independently a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group (e.g., tocopherol) and succinic anhydride, or an aliphatic hydrocarbon group having 13 to 17 carbon atoms (e.g., heptadecenyl, heptadecadienyl, 1-hexylnonyl);

[0250] Ionizable lipids (1). Specific examples of ionizable lipids (1) of the present disclosure include the following O-Ph-P3C1, O-Ph-P4C1, O-Ph-P4C2, O-Bn-P4C2, E-Ph-P4C2, L-Ph-P4C2, HD-Ph-P4C2, O-Ph-amide-P4C2, and O-Ph-C3M, as shown in Tables 2, 3, and 4. Table 2: Ionizable lipids [ka] [ka] Table 3: Ionizable lipids [ka]

[0251] In some embodiments, the delivery vehicle is an LNP capable of transfecting at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the hepatocyte population, where the ionizable lipid is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the molecular percentage of the LNP.

[0252] In some embodiments, the LNP comprises an ionizable lipid, hi some embodiments, the ionizable lipid is 20% or less, 30% or less, 40% or less, 50% or less, 60% or less, 70% or less, or 90% or less of the molecular percentage of the LNP. Exemplary ionizable lipids include, but are not limited to, imidazole cholesterol ester (ICE), (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002).

[0253] Lipids having the structure of Formula I are shown in Table 4 below. For example, SS-OP is also referred to as 0-Ph-P4C2. As used herein, the term "SS-OP analog" refers to a compound of Formula I. Table 4: Lipid nomenclature [ka] Provided herein are compositions comprising i) a ribonucleic acid (RNA) encoding telomerase reverse transcriptase (TERT); and ii) a compound of formula (I): [ka]

[0254] In formula (I): R 1a and R 1bcan each independently represent an alkylene group having 1 to 6 carbon atoms, which may be linear or branched, but is optionally linear. The alkylene group optionally has 1 to 4 carbon atoms, or 1 to 2. Specific examples of alkylene groups having 1 to 6 carbon atoms include methylene, ethylene, trimethylene, isopropylene, tetramethylene, isobutylene, pentamethylene, and neopentylene. R 1a and R 1b is optionally independently a methylene group, an ethylene group, a trimethylene group, an isopropylene group, or a tetramethylene group, or an ethylene group.

[0255] R 1a is R 1b may be different from or the same as.

[0256] X a and X b can each independently be a cyclic alkylene tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, or a non-cyclic alkyl tertiary amino group having 2 to 5 carbon atoms, and a cyclic alkylene tertiary amino group having 1 to 2 tertiary amino groups, and optionally each independently be a cyclic alkylene having 2 to 5 carbon atoms and 1 to 2 tertiary amino groups and an alkylene tertiary amino group.

[0257] In some embodiments, the compound of formula II is [ka] It is.

[0258] The RNA can be synthetic RNA. The RNA can include at least one modified nucleoside. Also provided herein is a method of delivering the composition to a cell. The compound of formula I can be used to assist in the delivery of RNA to a cell in vitro or in vivo. Once delivered to a cell, the synthetic RNA can transiently express exogenous telomerase in the cell and extend telomeres in the cell treated with the synthetic RNA. Thus, the composition can be used to extend telomeres in a cell.

[0259] III. Formulation of mRNA and Nanoparticle Delivery Vehicle Compositions Methods for the synthesis of mRNA and lipid nanoparticles (LNPs) are well established. For example, synthetic mRNAs containing 5' cap, 5' and 3' UTR coding sequences, and poly A tails can be synthesized from modified and unmodified nucleotides by in vitro transcription of DNA templates using RNA polymerases such as T7 RNA polymerase. DNA templates can be generated, for example, by PCR or plasmid amplification and restriction digestion, followed by purification.

[0260] Lipid nanoparticles (LNPs), liposomes, or polymeric nanoparticle delivery vehicles carrying mRNA may be produced, for example, by mixing lipids or polymers in an organic solvent (e.g., ethanol) with one or more mRNAs in an aqueous buffer, followed by buffer exchange and concentration. In some embodiments, LNPs, liposomes, or polymeric nanoparticle delivery vehicles may be produced using a microfluidic device to rapidly mix reagents and form monodisperse particles of controlled size. For example, the microfluidic mixer may be a staggered herringbone mixer (SHM). For example, the microfluidic mixer may be produced by a NanoAsssemblr made by Precision Nanosystems (PNI). In other embodiments, LNPs, liposomes, or polymeric nanoparticle delivery vehicles may be produced by a T-mixer. In some embodiments, the LNPs, liposomes, or polymeric nanoparticles may encapsulate mRNA and / or associate with one or more mRNAs via electrostatic interactions. Buffer exchange and concentration of the LNPs, liposomes, or polymeric nanoparticles may be performed by tangential flow filtration. In other embodiments, buffer exchange and concentration of LNPs, liposomes, or polymeric nanoparticles may be performed by centrifugal ultrafiltration using membranes with a nominal molecular weight cut-off of 500,000 Da or less (e.g., 100,000 Da).

[0261] In some embodiments, the lipid nanoparticle (LNP) formulations provided herein are capable of transfecting at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of a hepatocyte population.

[0262] The form of the lipid membrane structure of the present disclosure is not particularly limited, for example, as a form in which the ionizable lipid of the present disclosure is dispersed in an aqueous solvent, a liposome (e.g., a unilamellar liposome, a multilamellar liposome, etc.), a spherical micelle, a string micelle, a lipid nanoparticle (LNP), or an unspecified layer structure.

[0263] The lipid membrane structure of the present disclosure may further contain other components in addition to the ionizable lipid of the present disclosure. Examples of other components include lipids (phospholipids (phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylcholine), glycolipids, peptide lipids, cholesterol, ionizable lipids other than cationic lipids, PEG lipids, etc.), surfactants (e.g., 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate, cholic acid sodium salt, octyl glycoside, ND-gluco-N-methylalkanamide), polyethylene glycol, proteins, etc. The content of other components in the lipid membrane structure of the present disclosure is usually 5 to 95 mol%, optionally 10 to 90 mol%, or 30 to 80 mol%.

[0264] The content of the ionizable lipid of the present disclosure contained in the lipid membrane structure of the present disclosure is not particularly limited.

[0265] The lipid membrane structures of the present disclosure are prepared by dispersing the ionizable lipids of the present disclosure and other components (such as lipids) in a suitable solvent or dispersion medium, such as an aqueous or alcoholic solvent, and optionally a tissue, which can be prepared by performing an action that induces crystallization.

[0266] Examples of "actions for inducing organization" include ethanol dilution using microchannels or vortexing, simple hydration, sonication, heating, vortexing, ether injection, French press, and cholic acid. Examples include, but are not limited to, methods known per se, such as Ca2+ fusion, freeze-thawing, and reverse phase evaporation.

[0267] Nucleic acid can be introduced into cells in vivo and / or in vitro by encapsulating the nucleic acid in a lipid membrane structure containing the ionizable lipid of the present disclosure and contacting it with cells. Thus, the present disclosure provides a nucleic acid transfer agent comprising the ionizable lipid or lipid membrane structure of the present disclosure.

[0268] The nucleic acid transfer agent of the present disclosure can transfer any nucleic acid into cells. Examples of nucleic acids include, but are not limited to, DNA, RNA, RNA chimeric nucleic acid, DNA / RNA hybrids, etc. The nucleic acid may be any one of 1 to 3 strands, but is optionally single-stranded or double-stranded. The nucleic acid may be other types of nucleotides that are N-glycosides of purine or pyrimidine bases, or other oligomers with non-nucleotide backbones (e.g., commercially available peptide nucleic acids (PNAs), etc.), or other oligomers with special linkages. The oligomers may contain nucleotides with configurations that allow base pairing or base bonding found in DNA or RNA. Additionally, the nucleic acids may be substituted with, for example, known modified nucleic acids, labeled nucleic acids, capped nucleic acids, methylated nucleic acids, or with one or more natural nucleotides known in the art, intramolecular nucleotide modified nucleic acids, nucleic acids with uncharged linkages (e.g., methyl sulfonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged or sulfur-containing linkages (e.g., phosphorothioates), side groups such as proteins (e.g., nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.) and sugars (e.g., monosaccharides), nucleic acids and nucleic acids with intermediate compounds (e.g., acridine, psoralen, etc.), nucleic acid-containing chelating compounds (e.g., metals, radioactive metals, boron, metal oxides, etc.), nucleic acid-containing alkylating agents, and nucleic acids with modified linkages (e.g., alpha anomeric nucleic acids, etc.).

[0269] The type of DNA that can be used in the present disclosure is not particularly limited and can be appropriately selected according to the purpose of use.Examples include plasmid DNA, cDNA, antisense DNA, chromosomal DNA, PAC, BAC, and CpG oligo, optionally plasmid DNA, cDNA, and antisense DNA, or plasmid DNA.Circular DNA such as plasmid DNA can be appropriately digested with restriction enzymes and the like and used as linear DNA.

[0270] The type of RNA that can be used in the present disclosure is not particularly limited, and can be appropriately selected according to the purpose of use. For example, siRNA, miRNA, shRNA, antisense RNA, messenger RNA (mRNA), single-stranded RNA genome, double-stranded RNA genome, RNA replicon, transfer RNA, ribosomal RNA, etc., and optionally siRNA, miRNA, shRNA, mRNA, antisense RNA, RNA replicon.

[0271] The nucleic acids used in this disclosure are optionally purified by methods commonly used by those of skill in the art.

[0272] The nucleic acid transfer agent of the present disclosure that encapsulates nucleic acid can be administered in vivo, for example, for the purpose of preventing and / or treating disease.Therefore, the nucleic acid used in the present disclosure is optionally a nucleic acid that has preventive and / or therapeutic activity against a given disease (prophylactic / therapeutic nucleic acid).An example of such a nucleic acid includes the nucleic acid used in so-called gene therapy.

[0273] In order to introduce nucleic acid into cells using the nucleic acid transfer agent of the present disclosure, the nucleic acid is encapsulated by making the target nucleic acid coexist when forming the lipid membrane structure of the present disclosure. The lipid membrane structure of the present disclosure is formed. For example, when the liposome is formed by the ethanol dilution method, the aqueous solution of the nucleic acid and the ethanol solution of the components of the lipid membrane structure of the present disclosure (such as lipids) are vigorously mixed by vortex or microchannel. Dilute with a suitable buffer. When the liposome is formed by the simple hydration method, the components of the lipid membrane structure of the present disclosure (such as lipids) are dissolved in a suitable organic solvent, the solution is placed in a glass container, and the solvent is retained by drying under reduced pressure and left to obtain a lipid membrane. Here, an aqueous solution of nucleic acid is added, hydrated, and then sonicated with an ultrasonic device. The present disclosure also provides the above lipid membrane structure in which such nucleic acid is encapsulated.

[0274] An example of a lipid membrane structure with encapsulated nucleic acid is LNP encapsulated with nucleic acid by forming an electrostatic complex between the nucleic acid and ionizable lipid. This LNP can be used as a drug delivery system to selectively deliver nucleic acid or similar into specific cells. For example, DNA vaccines by introducing antigen genes into dendritic cells, gene therapy drugs for tumors, RNA. It is useful for nucleic acid drugs that suppress the expression of target genes using interference.

[0275] The particle diameter of the lipid membrane structure of the present disclosure that encapsulates nucleic acid is not particularly limited, but is optionally 10 nm to 500 nm, or 30 nm to 300 nm. The particle diameter can be measured using a particle size distribution measuring device such as Zetasizer Nano (Malvern). The particle diameter of the lipid membrane structure can be appropriately adjusted according to the method of preparing the lipid membrane structure.

[0276] The surface potential (zeta potential) of the lipid membrane structure of the present disclosure that encapsulates the nucleic acid is not particularly limited, but may be -60 to +60 mV, -45 to 45 mV, -30 to +30 mV, -15 to +15 mV, or -10 to +10 mV. In conventional gene transfer, particles with a positive surface potential have been mainly used. This is useful as a method to promote electrostatic interaction with the negatively charged cell surface heparin sulfate and promote cellular uptake, but the positive surface charge is delivered into the cell. There is a possibility that the release of nucleic acid from the carrier due to the interaction with the nucleic acid is inhibited, and that protein synthesis due to the interaction between the mRNA and the delivered nucleic acid is inhibited. This problem can be solved by adjusting the surface charge within the above range. The surface charge can be measured using a zeta potential measuring device such as Zetasizer Nano. The surface charge of the lipid membrane structure can be adjusted by the composition of the components of the lipid membrane structure containing the ionizable lipid of the present disclosure.

[0277] The lipid membrane surface pKa of the lipid membrane structure of the present disclosure (hereinafter referred to as liposome pKa) is not particularly limited, but may have a pKa of 5.5 to 7.2 pKa, or 6.0 to 6.8 pKa. The liposome pKa is used as an indicator of the susceptibility of the lipid membrane structure taken up by endocytosis to protonation in the weakly acidic environment in the endosome. The liposome pKa can be adjusted by the composition of the lipid membrane structure components containing the ionizable lipid of any of the above embodiments.

[0278] The hemolytic activity (membrane fusion ability) of the lipid membrane structure of the present disclosure is not particularly limited, but may be non-hemolytic (less than 5%) at physiological pH (pH 7.4) or may be endosomal. The higher the hemolytic activity, the more efficiently the nucleic acid can be delivered into the cytoplasm. However, if hemolytic activity exists at physiological pH, the nucleic acid will be delivered to unintended cells while remaining in the blood, resulting in reduced targeting and toxicity. Therefore, it is preferable to have hemolytic activity only in the endosomal environment as described above. The hemolytic activity can be regulated by the composition of the components of the lipid membrane structure containing the ionizable lipid of the present disclosure.

[0279] The nucleic acid encapsulated can be introduced into cells by providing the lipid membrane structure of the present disclosure, in which the nucleic acid is encapsulated so as to contact with cells.The cell can be a cancer cell, a cell isolated from an individual or tissue, or a cultured cell line containing tissue or cell fragments of cells.Furthermore, the cell can be an adherent cell or a non-adherent cell.

[0280] The step of contacting the lipid membrane structure of the present disclosure encapsulating nucleic acid with cells in vitro is specifically described below.

[0281] The cells are suspended in a suitable medium and cultured under suitable conditions several days before contacting the lipid membrane structure, where the cells may or may not be in a growth phase.

[0282] The medium at the time of contact may be a serum-added medium or a serum-free medium, but the serum concentration in the medium may be 30% by weight or less, or even 20% by weight or less. If the medium contains excess proteins such as serum, the contact between the lipid membrane structure and the cells may be inhibited.

[0283] The cell density at the time of contact is not particularly limited and can be appropriately set in consideration of the cell type, but is usually 1 × 10 4 ~1×10 7 cells / mL range.

[0284] For example, a suspension of the lipid membrane structure of the present disclosure in which the above-mentioned nucleic acid is encapsulated is added to the cells thus prepared. The amount of the suspension added is not particularly limited, and can be appropriately set in consideration of the number of cells, etc. The concentration of the lipid membrane structure when contacted with the cells is not particularly limited as long as the introduction of the target nucleic acid into the cells can be achieved, but the lipid concentration is usually 1 to 100 nmol / mL, and may be 0.1 to 10 μg / mL.

[0285] After the above suspension is added to the cells, the cells are cultured. The culture temperature, humidity, CO2 concentration, etc. are appropriately set in consideration of the cell type. When the cells are mammalian cells, the temperature is usually about 37°C, the humidity is about 95%, and the CO2 concentration is about 5%. Furthermore, the culture time can be appropriately set in consideration of conditions such as the type of cells used, and may be in the range of 0.1 to 76 hours, or in the range of 0.2 to 24 hours, or may be 0.5 to 12 hours. If the culture time is too short, the nucleic acid will not be sufficiently introduced into the cells, and if the culture time is too long, the cells may be weakened.

[0286] The nucleic acid is introduced into the cells by the above-mentioned culture. The medium may be replaced with fresh medium, or fresh medium may be added to the medium, and the culture is continued. If the cells are mammalian cells, the fresh medium may contain serum or nutrient factors.

[0287] The lipid membrane structure of the present disclosure may further contain other components in addition to the ionizable lipid of the present disclosure. Examples of other components include lipids (phospholipids (phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylcholine), glycolipids, peptide lipids, cholesterol, ionizable lipids other than cationic lipids, PEG lipids, etc.), surfactants (e.g., 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate, cholic acid sodium salt, octyl glycoside, ND-gluco-N-methylalkanamide), polyethylene glycol, proteins, etc.

[0288] The lipid membrane structures of the present disclosure are prepared by dispersing the ionizable lipids of the present disclosure and other components (such as lipids) in a suitable solvent or dispersion medium, such as an aqueous or alcoholic solvent, and optionally a tissue, which can be prepared by performing an action that induces crystallization.

[0289] Examples of "actions for inducing organization" include ethanol dilution using microchannels or vortexing, simple hydration, sonication, heating, vortexing, ether injection, French press, and cholic acid. Examples include, but are not limited to, methods known per se, such as Ca2+ fusion, freeze-thawing, and reverse phase evaporation.

[0290] Nucleic acid can be introduced into cells in vivo and / or in vitro by encapsulating the nucleic acid in a lipid membrane structure containing the ionizable lipid of the present disclosure and contacting it with cells. Thus, the present disclosure provides a nucleic acid transfer agent comprising the ionizable lipid or lipid membrane structure of the present disclosure.

[0291] The nucleic acid transfer agent of the present disclosure can transfer any nucleic acid into cells. Examples of nucleic acids include, but are not limited to, DNA, RNA, RNA chimeric nucleic acid, DNA / RNA hybrid, etc. The nucleic acid may be any one of 1 to 3 strands, but may be single-stranded or double-stranded. The nucleic acid may be other types of nucleotides that are N-glycosides of purine or pyrimidine bases, or other oligomers with non-nucleotide backbones (e.g., commercially available peptide nucleic acids (PNAs), etc.), or other oligomers with special linkages. The oligomers may contain nucleotides with configurations that allow base pairing or base bonding found in DNA or RNA.

[0292] The type of RNA that can be used in the present disclosure is not particularly limited, and can be appropriately selected according to the purpose of use.For example, siRNA, miRNA, shRNA, antisense RNA, messenger RNA (mRNA), single-stranded RNA genome, double-stranded RNA genome, RNA replicon, transfer RNA, ribosomal RNA, etc., or siRNA, miRNA, shRNA, mRNA, antisense RNA, or RNA replicon.

[0293] The nucleic acids used in this disclosure may be purified by methods commonly used by those of skill in the art.

[0294] The nucleic acid transfer agent of the present disclosure that encapsulates nucleic acid can be administered in vivo, for example, for the purpose of preventing and / or treating disease.Therefore, the nucleic acid used in the present disclosure may be a nucleic acid that has preventive and / or therapeutic activity against a given disease (prophylactic / therapeutic nucleic acid).An example of such a nucleic acid includes the nucleic acid used in so-called gene therapy.

[0295] IV. Treatment method The therapeutic method described herein refers to treating fibrotic disease and / or liver disease in a subject in need thereof by administering a composition comprising one or more TERT mRNA sequences. The compositions and methods of the present disclosure may be used to treat fibrotic conditions, including fibrosis. In some embodiments, the compositions and / or methods of use of the compositions of the present disclosure for treating fibrotic conditions, including fibrosis, induce TERT expression or increase TERT activity in liver cells. In some embodiments, the compositions and / or methods of use of the compositions of the present disclosure for treating fibrotic conditions, including fibrosis, do not induce cytotoxicity, tissue toxicity, or systemic toxicity. In some embodiments, the compositions and / or methods of use of the compositions of the present disclosure for treating fibrotic conditions, including fibrosis, induce TERT expression or increase TERT activity in spleen cells. The compositions may be administered systemically, for example, intravenously.

[0296] A. Dosage and timing of telomerase reverse transcriptase (TERT) mRNA In the compositions and methods described herein, in some embodiments, TERT mRNA is administered to a subject in need thereof at a dose of about 0.001 mg / kg of subject body weight to about 2.0 mg / kg of subject body weight. In some embodiments, TERT mRNA is administered to a subject in need thereof at a dose of about 0.01 mg / kg, in some embodiments at a dose of about 0.025 mg / kg, in some embodiments at a dose of about 0.05 mg / kg, in some embodiments at a dose of about 0.075 mg / kg, in some embodiments at a dose of about 0.1 mg / kg, in some embodiments at a dose of about 0.125 mg / kg, in some embodiments at a dose of about 0.150 mg / kg, in some embodiments at a dose of about 0.175 mg / kg, in some embodiments at a dose of about 0.2 mg / kg, in some embodiments at a dose of about 0.5 mg / kg, in some embodiments at a dose of about 0.75 mg / kg, in some embodiments at a dose of about 1.0 mg / kg, in some embodiments at a dose of about 1.25 mg / kg, in some embodiments at a dose of about 1.5 mg / kg, or in some embodiments at a dose of about 2.0 mg / kg. In some embodiments, the TERT mRNA is administered to a subject in need thereof at a dose of 0.1 mg / kg. In some embodiments, the TERT mRNA is administered to a subject in need thereof at a dose of 0.125 mg / kg.

[0297] In some embodiments, TERT mRNA is administered to a subject in need thereof in a single dose. In some embodiments, TERT mRNA is administered to a subject in need thereof two, three, four, or five times or more. In some embodiments, TERT mRNA is administered twice a week, every week, every two weeks, every four weeks, every six weeks, every twelve weeks, or every fifteen weeks. In some embodiments, TERT mRNA is administered monthly, every two months, every six months, once a year, continuously, or as determined by the subject's physician.

[0298] B.TERT mRNA co-therapy In some embodiments, co-administration of TERT mRNA may be combined with other anti-fibrotic drugs used to treat fibrotic disease and / or liver disease.The drugs that may be used include, but are not limited to, nintedanib, pirfenidone, prednisone, azathioprine, cyclophosphamide, mycophenolate mofetil, pamrevlumab, and N-acetylcysteine.

[0299] C. Route of Administration In some embodiments, TERT mRNA may be delivered orally, subcutaneously, intravenously, intranasally, intradermally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, intravaginally, intrarectally, or intraocularly. In exemplary embodiments, TERT mRNA may be administered intravenously or via inhalation.

[0300] D. Subjects and Treatment The therapeutic method described herein is useful for treating fibrotic disease, condition and disorder, and liver disease, condition and disorder in subjects who need it.The fibrotic disease and condition of the present disclosure include, but are not limited to, non-alcoholic hepatitis, hepatitis A, hepatitis B, hepatitis C, alcoholic hepatitis, cirrhosis, hemochromatosis, Wilson's disease, non-alcoholic steatohepatitis (NASH), NASH with fibrosis stage F4 according to METAVIR evaluation system, compensated cirrhosis, decompensated cirrhosis, acute chronic cirrhosis, biliary atresia, primary biliary cirrhosis, primary sclerosing cholangitis, autoimmune hepatitis, cryptogenic cirrhosis and ischemic hepatitis.

[0301] In some embodiments, the subject in need of the treatment described herein is a subject with a genetic disorder or mutation in telomerase reverse transcriptase (TERT). In some embodiments, the subject does not have symptoms of fibrosis or liver disease. In other embodiments, the subject has symptoms and the treatment completely or partially ameliorates the symptoms. In other embodiments, the treatment slows the progression of the symptoms.

[0302] In some embodiments, the subject is a human.

[0303] In some embodiments, administration of TERT mRNA reduces fibrotic tissue compared to subjects without treatment. In some embodiments, fibrotic tissue level is measured by METAVIR scoring system. In some embodiments, TERT mRNA reduces the fibrotic stage of tissue by METAVIR scoring system (e.g., F4 to F3, F3 to F2, F2 to F1, or F1 to F0, or variations thereof). In some embodiments, administration of TERT mRNA reduces collagen level.

[0304] In some embodiments, administration of TERT mRNA reduces fibrotic tissue in a subject by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% during and / or after a treatment period.

[0305] In some embodiments, administration of TERT mRNA stops or slows the increase in fibrous tissue over time compared to a subject without treatment. In some embodiments, administration of TERT mRNA slows the increase in the amount of fibrous tissue in a subject by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% during and / or after a treatment period.

[0306] In some embodiments, administration of TERT mRNA increases liver function compared to a subject without treatment. In some embodiments, administration of TERT mRNA increases liver function in a subject by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% during and / or after the treatment period.

[0307] In some embodiments, administration of TERT mRNA extends survival compared to subjects without treatment. In some embodiments, administration of TERT mRNA extends liver transplant-free survival compared to subjects without treatment. In some embodiments, administration of TERT mRNA extends survival of subjects by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 1000% during and / or after the treatment period. In some embodiments, administration of TERT mRNA reduces hospitalization time and / or number of hospital visits for treating fibrotic or liver disease. In some embodiments, administration of TERT mRNA delays time to liver transplant.

[0308] Liver function may be measured by methods including, but not limited to, quantitative liver function tests (HepQuant SHUNT), Child-Pugh score, Model for End-Stage Liver Disease (MELD) score, Lillie model, Acute Exacerbation of Chronic Hepatitis (CLIF-C ACLF) score, Glasgow Alcoholic Hepatitis Score (GAHS), International Normalized Ratio (INR) score, "prothrombin time", and other measurements of clotting enzymes, presence or occurrence of ascites, presence or occurrence of encephalopathy, platelet count, white blood cell count, mean arterial pressure, blood urea nitrogen (BUN) level, total bilirubin level, indirect bilirubin level, albumin level, alanine aminotransferase (ALT) level, aspartate aminotransferase (AST) level, alkaline phosphatase (ALP) level, and / or sodium creatinine level.

[0309] V. Pharmaceutical Combinations In some embodiments, the composition comprising TERT mRNA comprises an excipient or carrier, e.g., an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline. The composition may contain pharma- ceutically acceptable auxiliary substances as necessary to approximate physiological conditions, such as pH and buffering agents, toxicity counteracting agents, e.g., sodium acetate, sodium chloride, sodium citrate, potassium chloride, calcium chloride, and sodium lactate. In some embodiments, the pharmaceutical composition comprises 10 mM sodium citrate buffered to pH 6.4. The composition may contain a cryoprotectant, e.g., glycerol, ethylene glycol, propylene glycol, or dimethyl sulfoxide (DMSO). The concentration of active agents in these formulations can vary and is selected based on fluid volume, viscosity, and body weight, according to the particular mode of administration selected and the patient's needs (e.g., Remington's Pharmaceutical Science (15th ed., 1980) and Goodman & Gillman, The Pharmacological Basis of Therapeutics (Hardman et al., eds., 1996)).

[0310] VI. Methods of Telomere Extension In another aspect, the disclosure provides a method of lengthening telomeres comprising administering any of the above-mentioned compounds or compositions to a cell having shortened telomeres, wherein the telomeres are lengthened within the cell. The disclosure also provides a method of treatment comprising administering any of the above-mentioned compounds or compositions to an animal subject in need of or that may benefit from telomere lengthening.

[0311] In some embodiments, the compound or composition is administered to a cell, which is an isolated cell or is part of a cell culture, an isolated tissue culture, an isolated organ, or the like (i.e., administration is in vitro).

[0312] In other embodiments, the compound or composition is administered without isolating the cell or cells, tissues, or organs from the subject (i.e., administration is in vivo). In some of these embodiments, the compound or composition is delivered to all or nearly all of the cells in the subject's body. In some embodiments, the compound or composition is delivered to a specific cell, cell type, tissue, or organ in the subject's body.

[0313] Administration of the disclosed compound or composition may result in the transient expression of telomerase activity in cells. The increased activity may be measured by various assays, such as, for example, the telomerase repeat amplification protocol (TRAP) assay. Commercial versions of the TRAP assay are available, such as, for example, the Trapeze® Telomerase Detection Kit (Millipore), which provide sensitive detection and quantification of telomerase activity, although other measurement techniques are possible.

[0314] As mentioned above, one advantage of the present technique is that the expression of telomerase activity is transient in the treated cells, in particular, such transient expression is in contrast to prior techniques in which the telomerase reverse transcriptase gene persists in episomal DNA segments or is inserted into the genomic sequence of the cells, or otherwise permanently alters the genetic makeup of the target cells, resulting in constitutive activity of the nucleic acid sequence.

[0315] Figure 1 diagrammatically illustrates some of the advantages of the compounds, compositions, and methods disclosed herein. In particular, the rate of telomere elongation enabled by these compounds, compositions, and methods allows telomere maintenance with very low frequency delivery of TERT mRNA. The expressed telomerase activity rapidly elongates telomeres for a short period of time and then turns over, thus allowing the protective anti-cancer mechanism of telomere shortening to function for most of the time. Between treatments, there is normal telomerase activity and telomere shortening, and therefore the anti-cancer safety mechanism of telomere shortening to prevent uncontrolled proliferation remains intact, while the risk of short telomere-related diseases remains low. In contrast, small molecule treatments for telomere elongation may require chronic delivery, thus resulting in chronic cancer risk and minimal therapeutic benefit.

[0316] In some embodiments of the method, the transient expression is cell cycle independent.

[0317] As described above, the transient expression of telomerase reverse transcriptase leads to the elongation of shortened telomeres in treated cells. Telomere length can be measured using techniques such as terminal restriction fragment (TRF) length analysis, qPCR, MMqPCR, TeSLA, flow FISH, and Q-FISH, as understood by those skilled in the art. In some embodiments, the method increases the average telomere length of treated cells by at least 0.1 kb, at least 0.2 kb, at least 0.3 kb, at least 0.4 kb, at least 0.5 kb, at least 1 kb, at least 2 kb, at least 3 kb, at least 4 kb, at least 5 kb, or even more. In some embodiments, the method reduces the proportion of telomeres that are less than a certain length, such as, for example, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, or more.

[0318] One advantage of the present compounds, compositions, and methods is the rapidity of telomere lengthening achieved by these techniques, which allows treatments to be brief and therefore the intervals between treatments can be long, and therefore the treatments can be safe because the normal protective telomere shortening mechanisms remain intact for the majority of the time, i.e., between treatments.

[0319] Transient expression of telomerase reverse transcriptase also results in an increase in replicative capacity in treated cells. The increase in replicative capacity is easily monitored in cells approaching replicative senescence by measuring additional population doublings in such cells. Senescent cells do not divide in response to many conditions that cause normal cells to divide, such as passage in culture or treatment with serum. Senescent cells are often further characterized by expression of pH-dependent β-galactosidase activity, expression of cell cycle inhibitors p53 and p19, and other changes in gene expression patterns, as well as an increase in cell size. In the absence of treatment with TERT mRNA, certain types of cells (e.g., human lung fibroblasts) typically undergo 50-60 postnatal doublings before senescence, but with TERT mRNA treatment, it is known in the art that these cells achieve an additional 16-28 population doublings. If treated again several weeks later, additional proliferative capacity is again conferred. This process of intermittent treatment to periodically re-lengthen telomeres can be applied additional times, with the interval between treatments depending on factors such as the rate of telomere shortening, the rate of cell division, and the amount of telomere lengthening provided by the treatment. Similarly, human microvascular dermal endothelial cells from elderly individuals not treated with the composition may achieve only 1-2 population doublings, while treated cells may achieve 3, 4, or even more population doublings.

[0320] Thus, in some embodiments, the subject therapeutic methods increase the number of population doublings of the treated cells.

[0321] VII. Medical Kit Therapeutic kits containing pharmaceutical compositions of TERT mRNA, or sequences thereof (including complementary sequences), and instructions are also contemplated herein. In some embodiments, the therapeutic kits include devices for administration, including, but not limited to, syringes, inhalers, nebulizers, and vials or containers.

[0322] In another aspect, the present disclosure provides a ready-to-use kit for use in telomere elongation in mammalian cells. The kit includes any of the compounds or compositions described above, together with instructions for their use. In some embodiments, the kit further includes packaging materials. In some embodiments, the packaging materials are airtight. In these embodiments, the packaging materials may be optionally filled with an inert gas, such as, for example, nitrogen, argon, etc. In some embodiments, the packaging materials include, for example, metal foil containers, such as sealed aluminum pouches or similar. Such packaging materials are well known to those skilled in the art. The kit may also include a delivery vehicle, such as a lipid, as described herein. In some embodiments, one or more components of the formulation are provided frozen or lyophilized with a cryoprotectant.

[0323] In some embodiments, the kit may further include a desiccant, a culture medium, an RNase inhibitor, or other such components. In some embodiments, the kit may further include a combination of two or more of these additional components. In some kit embodiments, the compositions of the kit are sterile.

[0324] Enumeration of embodiments The present disclosure may be defined by reference to the following enumeration of exemplary embodiments.

[0325] Embodiment 1. A composition comprising (i) a ribonucleic acid (RNA) encoding telomerase reverse transcriptase (TERT) and (ii) a delivery vehicle, wherein the RNA of (i) comprises one or more modified nucleotides, and the delivery vehicle of (ii) is operably linked to the RNA of (i).

[0326] Embodiment 2. The composition of embodiment 1, wherein the delivery vehicle comprises one or more of a nanoparticle, a liposome, a cationic lipid, an exosome, an extracellular vesicle, a lipid nanoparticle (LNP), a natural lipoprotein particle, and an artificial lipoprotein particle.

[0327] Embodiment 3. The composition of embodiment 1, wherein the delivery vehicle comprises a lipid nanoparticle (LNP).

[0328] Embodiment 4. The composition of embodiment 1, wherein the delivery vehicle comprises an ionizable lipid nanoparticle.

[0329] Embodiment 5. A composition according to any one of embodiments 1 to 4, wherein the delivery vehicle comprises a targeting moiety.

[0330] Embodiment 6. The composition of embodiment 5, wherein the delivery vehicle specifically or selectively interacts with hepatocytes.

[0331] Embodiment 7. The composition of embodiment 5, wherein the targeting moiety is a lipid, a peptide, and / or an antibody.

[0332] Embodiment 8. The composition of embodiment 3, wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

[0333] Embodiment 9. The composition of embodiment 8, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid, about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

[0334] Embodiment 10. A delivery vehicle comprising a compound of formula (I), [ka]

[0335] In the formula, R 1a and R 1b each independently represents an alkylene group having 1 to 6 carbon atoms; a and X b are each independently an acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, or an acyclic alkyl tertiary amino group having 2 to 5 carbon atoms, and a cyclic alkylene tertiary amino group having 1 to 2 tertiary amino groups; R 2aand R 2b each independently represents an alkylene or oxydialkylene group having 8 or fewer carbon atoms; Y a and Y b each independently represents an ester bond, an amide bond, a carbamate bond, an ether bond, or a urea bond; Z a and Z b are each independently a divalent group derived from an aromatic compound having 3 to 16 carbon atoms, at least one aromatic ring, and optionally a heteroatom; R 3a and R 3b each independently represents a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group and succinic anhydride or glutaric anhydride, or a residue derived from a reaction product of a sterol derivative having a hydroxyl group and succinic anhydride, or glutaric anhydride or an aliphatic hydrocarbon group having 12 to 22 carbon atoms.

[0336] Embodiment 11. The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0337] Embodiment 12. The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0338] Embodiment 13. The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0339] Embodiment 14. The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0340] Embodiment 15. The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0341] Embodiment 16 The composition of embodiment 10, wherein the compound of formula (I) is: [ka]

[0342] Embodiment 17. A composition described in any one of embodiments 1 to 16, wherein the RNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1 to 5, 30 to 31, or 37 to 40.

[0343] Embodiment 18. The composition of embodiment 17, wherein the RNA comprises a 5' cap.

[0344] Embodiment 19. The composition of embodiment 18, wherein the 5' cap comprises an anti-reverse cap analog (ARCA).

[0345] Embodiment 20. The composition of embodiment 19, wherein the ARCA comprises the 3'-O-Me-m7G(5')ppp(5')G structure.

[0346] Embodiment 21. The composition of embodiment 18, wherein the 5' cap comprises m7(3'O'eG)(5''ppp'5')(2'OMeA)pG.

[0347] Embodiment 22. The composition of any one of embodiments 1 to 21, wherein the RNA further comprises at least one untranslated region (UTR).

[0348] Embodiment 23 The composition of embodiment 22, wherein at least one UTR is positioned 5' to the RNA of (i).

[0349] Embodiment 24 The composition of embodiment 22, wherein at least one UTR is positioned 3' to the RNA of (i).

[0350] Embodiment 25. A composition according to any one of embodiments 22 to 24, wherein the UTR comprises a human sequence.

[0351] Embodiment 26 The composition of any one of embodiments 22 to 24, wherein the UTR comprises a non-human sequence.

[0352] Embodiment 27. A composition described in any one of embodiments 22 to 26, wherein the UTR comprises a chimeric sequence.

[0353] Embodiment 28 The composition of embodiment 27, wherein the chimeric sequence increases the stability, increases the transcription rate, or decreases the time to initiation of transcription of the RNA of (i).

[0354] Embodiment 29. The composition of any one of embodiments 22 to 28, wherein the UTR comprises a sequence having at least 70% identity to a UTR sequence isolated or derived from one or more of alpha-globin, beta-globin, c-fos, and tobacco etch virus.

[0355] Embodiment 30. The composition of any one of embodiments 1 to 29, wherein the one or more modified nucleotides of the RNA of (i) include one or more of a modified adenine or analogue thereof, a modified cytidine or analogue thereof, a modified guanosine or analogue thereof, and a modified uridine or analogue thereof.

[0356] Embodiment 31. The composition of any one of embodiments 1 to 30, wherein the one or more modified nucleotides of the RNA of (i) include one or more of 1-methylpseudouridine, pseudouridine, 2-thiouridine, and 5-methylcytidine.

[0357] Embodiment 32. The composition of any one of embodiments 1 to 31, wherein one or more modified nucleotides of the RNA of (i) include 5-methoxyuridine (5-moU).

[0358] The one or more modified nucleotides of the RNA of embodiment 33 (i) are selected from the group consisting of m1A 1-methyladenosine, m6A N6-methyladenosine, Am 2'-O-methyladenosine, i6A N6-isopentenyladenosine, io6A N6-(cis-hydroxyisopentenyl)adenosine, ms2io6A 2-methylthio-N6(cis-hydroxyisopentenyl)adenosine, g6A N6-glycinylcarbamoyladenosine, t6A N6-threonylcarbamoyladenosine, ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine, Ar(p)2'-O-ribosyladenosine (phosphate), m6 2A N6,N6-dimethyladenosine, m6Am N6,2'-O-dimethyladenosine, m6 2Am N6,N6,2′-O-trimethyladenosine, m1Am 1,2′-O-dimethyladenosine, m3C 3-methylcytidine, m5C 5-methylcytidine, Cm 2′-O-methylcytidine, ac4C N4-acetylcytidine, f5C 5-formylcytidine, m4C N4-methylcytidine, hm5C 5-hydroxymethylcytidine, f5Cm 5-formyl-2′-O-methylcytidine, m1G 1-methylguanosine, m2G N2-methylguanosine, m7G 7-methylguanosine, Gm 2′-O-methylguanosine, m2 2G N2,N2-dimethylguanosine, Gr(p) 2′-O-ribosylguanosine (phosphate), yW wibutosine, o2yW peroxywibutosine, OHyW Hydroxywybutosine, OHYW* undermodified hydroxywybutosine, imG wybutosine, m2,7G N2,7-dimethylguanosine, m2,2,7G N2,N2,7-trimethylguanosine, I inosine, m1I 1-methylinosine, Im 2'-O-methylinosine, Q queosine, galQ galactosyl-queosine, manQ mannosyl-queosine, Ψ pseudouridine, D dihydrouridine, m5U 5-methyluridine, Um 2'-O-methyluridine, m5Um 5,2'-O-dimethyluridine, m1Ψ 1-methylpseudouridine, Ψm 2'-O-methylpseudouridine, s2U 2-thiouridine, ho5U 5-hydroxyuridine, chm5U 5-(carboxyhydroxymethyl)uridine,mchm5U 5-(carboxyhydroxymethyl)uridine, methyl ester mcm5U 5-methoxycarbonylmethyluridine, mcm5Um 5-methoxycarbonylmethyl-2'-O-methyluridine, mcm5s2U 5-methoxycarbonylmethyl-2-thiouridine, ncm5U 5-carbamoylmethyluridine, ncm5Um 5-carbamoylmethyl-2'-O-methyluridine, cmnm5U 5-carboxymethylaminomethyluridine, m3U 3-methyluridine, m1acp3Ψ 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, cm5U 5-carboxymethyluridine, m3Um 3,2′-O-dimethyluridine, m5D 5-methyldihydrouridine, τm5U 5-taurinomethyluridine, τm5s2U 5-Taurinomethyl-2-thiouridine, 2-Aminoadenosine, 2-Amino-6-chloropurine riboside, 8-Azaadenosine, 6-Chloropurine riboside, 5-Iodocytidine, 5-Iodouridine, Inosine, 2'-O-Methylinosine, Xanthosine, 4-Thiouridine, O6-Methylguanosine, 5,6-Dihydrouridine, 2-Thiocytidine, 6-Azacytidine, 6-Azauridine, 2'-O-Methyl-2-aminoadenosine, 2'-O-Methylpseudouridine, N1-Methyladenosine, 2'-O-Methyl-5-methyluridine, 7-Deazaguanosine, 8-Azidoadenosine, 5-Bromocytidine, 5-Bromouridine, 7-Deazaadenosine, 5-Aminoallyluridine, 5-Amino Noarylcytidine, 8-oxoguanosine, 2-aminopurine riboside, pseudoisocytidine, N1-methylpseudouridine, 5,6-dihydro-5-methyluridine, N6-methyl-2-aminoadenosine, 5-carboxycytidine, 5-hydroxymethyluridine, thienoguanosine, 5-hydroxycytidine, 5-formyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-methoxycytidine, thienouridine, 5-carboxymethylesteruridine, thienocytidine, 8-oxoadenosine, isoguanosine, N1-ethylpseudouridine, N1-methyl-2'-O-methylpseudouridine, N1-methoxymethylpseudouridine,N1-propyl pseudouridine, 2'-O-methyl-N6-methyl adenosine, 2-amino-6-Cl-purine-2'-deoxyriboside, 2-amino-2'-deoxyadenosine, 2-aminopurine-2'-deoxyriboside, 5-bromo-2'-deoxycytidine, 5-bromo-2'-deoxyuridine, 6-chloropurine-2'-deoxyriboside, 7-deaza-2'-deoxyadenosine, 7-deaza-2'-deoxyguanosine, 2'-deoxyinosine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxy Uridine, 5-fluoro-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, N6-methyl-2'-deoxyadenosine, 5-methyl-2'-deoxycytidine, O6-methyl-2'-deoxyguanosine, N2-methyl-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine, 8-oxo-2'-deoxyguanosine, 2-thiothymidine, 2'-deoxy-P-nucleoside, 5-hydroxy-2'-deoxycytidine, 4-thiothymidine, 2-thio-2'-deoxycytidine , 6-aza-2'-deoxyuridine, 6-thio-2'-deoxyguanosine, 8-chloro-2'-deoxyadenosine, 5-aminoallyl-2'-deoxycytidine, 5-aminoallyl-2'-deoxyuridine, N4-methyl-2'-deoxycytidine, 2'-deoxyzebularine, 5-hydroxymethyl-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycytidine, 5-propargylamino-2'-deoxycytidine, 5-propargylamino-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-phosphatidyl-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycyt ... lumyl-2'-deoxycytidine, 5-[(3-indolyl)propionamido-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxyuridine, 5-formyl-2'-deoxyuridine, 7-deaza-7-propargylamino-2'-deoxyadenosine, 7-deaza-7-propargylamino-2'-deoxyguanosine, biotin-16-aminoallyl-2'-dUTP, biotin-16-aminoallyl-2'-dCTP, biotin-16-aminoallylcytidine, N4-biotin-OBEA-2'-deoxycytidine,Biotin-16-aminoallyl uridine, Dabsyl-5-3-aminoallyl-2'-dUTP, Desthiobiotin-6-aminoallyl-2'-deoxycytidine, Desthiobiotin-16-aminoallyl-uridine, Biotin-16-7-deaza-7-propargylamino-2'-deoxyguanosine, Cyanine 3-5-propargylamino-2'-deoxycytidine, Cyanine 3-6-propargylamino-2'-deoxyuridine, Cyanine 5-6-propargylamino-2'-deoxycytidine, Cyanine 5-6-propargylamino-2' -deoxyuridine, cyanine 3-aminoallylcytidine, cyanine 3-aminoallyluridine, cyanine 5-aminoallylcytidine, cyanine 5-aminoallyluridine, cyanine 7-aminoallyluridine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro-2'-deoxyuridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methyluridine, puromycin, 2'-amino- 2'-deoxycytidine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxycytidine, 2'-azido-2'-deoxyuridine, aracytidine, arauridine, 2'-azido-2'-deoxyadenosine, 2'-amino-2'-deoxyadenosine, araadenosine, 2'-fluoro-thymidine, 3'-O-methyladenosine, 3'-O-methylcytidine, 3'-O-methylguanosine, 3'-O-methyluridine, 2'-azido-2'-deoxyguanosine, araguanosine, 2'-deoxyuridine, 3'-O-(2-nitro) 3'-O-(2-nitrobenzyl)-2'-deoxyadenosine, 3'-O-(2-nitrobenzyl)-2'-deoxyinosine, 3'-deoxyadenosine, 3'-deoxyguanosine, 3'-deoxycytidine, 3'-deoxy-5-methyluridine, 3'-deoxyuridine, 2',3'-dideoxyadenosine, 2',3'-dideoxyguanosine, 2',3'-dideoxyuridine, 2',3'-dideoxythymidine, 2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyadenosine, 3'-azido-2',3'-dideoxythymidine,3'-amino-2',3'-dideoxyadenosine, 3'-amino-2',3'-dideoxycytidine, 3'-amino-2',3'-dideoxyguanosine, 3'-amino-2',3'-dideoxythymidine, 3'-azido-2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyuridine, 5-bromo-2',3'-dideoxyuridine, 2',3'-dideoxyinosine, 2'-deoxyadenosine-5'-O-(1-thiophosphate), 2'-deoxycytidine-5'-O-(1-thiophosphate), 2'-deoxyguanosine-5'-O-(1-thiotriphosphate), 2'-deoxythymidine-5'-O-(1-thiophosphate), adenosine-5'-O-(1-thiophosphate), cytidine-5'-O-(1-thiophosphate), guanosine-5'-O-(1-thiophosphate), uridine- 5'-O-(1-thiophosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiophosphate), 2',3'-dideoxycytidine-5'-O-(1-thiophosphate), 2',3'-dideoxyguanosine-5'-O-(1-thiophosphate), 3'-deoxythymidine-5'-O-(1-thiophosphate), 3'-azido-2',3'-dideoxythymidine-5'-O-(1-thiophosphate), 2', The composition of any one of the preceding embodiments, comprising one or more of 3'-dideoxyuridine-5'-O-(1-thiophosphate), 2'-deoxyadenosine-5'-O-(1-boranophosphate), 2'-deoxycytidine-5'-O-(1-boranophosphate), 2'-deoxyguanosine-5'-O-(1-boranophosphate), and 2'-deoxythymidine-5'-O-(1-boranophosphate).

[0359] Embodiment 34. The composition of any one of embodiments 1 to 33, wherein the composition further comprises a ribonucleic acid (RNA) encoding a telomerase RNA component (TERC).

[0360] Embodiment 35. A composition described in any one of embodiments 1 to 34, wherein the delivery vehicle comprises RNA encoding TERT.

[0361] Embodiment 36. The composition described in embodiment 35, wherein the RNA encoding TERT comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-5, 7, 9, 14-17, 19, 21, 23, 25, 27, 29-31, 37-40.

[0362] Embodiment 37. The composition of embodiment 35, wherein the RNA encoding TERT comprises the full length or a portion of a UTR of one of SEQ ID NOs: 32-34, 35, and 36.

[0363] Embodiment 38. A composition described in any one of embodiments 1 to 36, wherein the RNA comprises a self-replicating RNA.

[0364] Embodiment 39. A composition described in any one of embodiments 1 to 38, wherein the RNA comprises circular RNA.

[0365] Embodiment 40. The composition of embodiment 8, wherein the layer comprises a lipid monolayer or a lipid bilayer.

[0366] Embodiment 41 The composition of embodiment 41, wherein the delivery vehicle comprises an internal volume.

[0367] 40. The composition of any one of embodiments 1-39, wherein the delivery vehicle is operably linked to a ribonucleic acid (RNA) encoding a telomerase RNA component (TERC).

[0368] Embodiment 41 The composition of embodiment 40, wherein the delivery vehicle comprises RNA encoding TERC.

[0369] Embodiment 42 The composition of embodiment 35, wherein one or more of the surfaces, layers, or volumes of the delivery vehicle comprises RNA encoding TERC.

[0370] Embodiment 43. The composition of embodiment 42, wherein the surface comprises an exterior surface or an interior surface.

[0371] Embodiment 44. The composition of embodiment 42, wherein the layer comprises a lipid monolayer or a lipid bilayer.

[0372] Embodiment 45. The composition of embodiment 42, wherein the volume comprises the internal volume.

[0373] Embodiment 46. A method for increasing telomerase activity in a cell, the method comprising contacting a cell with a composition described in any one of embodiments 1 to 45.

[0374] Embodiment 47. A method for extending telomeres in a cell, the method comprising contacting the cell with a composition described in any one of embodiments 1 to 45.

[0375] Embodiment 48. The method of embodiment 46 or 47, wherein the cell is in vivo, ex vivo, or in vitro.

[0376] Embodiment 49. A cell comprising a composition according to any one of embodiments 1 to 45.

[0377] Embodiment 50. A formulation comprising the cells of embodiment 49.

[0378] Embodiment 51. The formulation of embodiment 50, wherein the plurality of cells comprises the cells of embodiment 29.

[0379] Embodiment 52 The formulation of embodiment 51, wherein each cell of the plurality is a cell of embodiment 49.

[0380] Embodiment 53. A method for treating a disease or disorder, comprising administering to a subject an effective amount of a composition described in any one of embodiments 1 to 45.

[0381] Embodiment 54. A method for treating a disease or disorder comprising administering to a subject an effective amount of a cell according to embodiment 49.

[0382] Embodiment 55. A method for treating a disease or disorder, comprising administering to a subject an effective amount of a formulation described in any one of embodiments 50 to 52.

[0383] Embodiment 56. A method for delaying the onset of a disease, comprising administering to a subject an effective amount of a composition described in any one of embodiments 1 to 45.

[0384] Embodiment 57. A method for delaying the onset of a disease, comprising administering to a subject an effective amount of a cell according to embodiment 49.

[0385] Embodiment 58. A method for delaying the onset of a disease, comprising administering to a subject an effective amount of a formulation described in any one of embodiments 50 to 52.

[0386] Embodiment 59. A method of treating a fibrotic disease in a subject in need thereof, comprising: A method comprising administering to a subject an effective amount of a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

[0387] Embodiment 60 The method of embodiment 59, wherein the composition comprises a delivery vehicle.

[0388] Embodiment 61 The method of embodiment 60, wherein the delivery vehicle is a nanoparticle.

[0389] Embodiment 62. The method of embodiment 61, wherein the nanoparticle is a lipid nanoparticle (LNP).

[0390] Embodiment 63 The method of embodiment 62, wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

[0391] Embodiment 64. The method of embodiment 63, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid to about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1.0 to about 2.0 moles of PEGylated lipid.

[0392] Embodiment 65. The method of embodiment 63, wherein the LNP comprises a molar ratio of about 30 to 40 moles of ionizable lipid to about 14 to about 18 moles of phospholipid, about 40 to about 50 moles of cholesterol, and about 2.0 to about 3.0 moles of PEGylated lipid.

[0393] Embodiment 66 The method of any one of embodiments 59 to 65, wherein the TERT synthetic mRNA comprises at least one modified nucleoside from the list in Table 1B.

[0394] Embodiment 67. The method of embodiment 66, wherein the modified nucleoside is pseudouridine or a pseudouridine analog.

[0395] Embodiment 68 The method of embodiment 67, wherein the pseudouridine analog is N-1-methylpseudouridine.

[0396] Embodiment 69. The method of embodiment 66, wherein the modified nucleoside is 5-methoxyuridine.

[0397] Embodiment 70. The method of any one of embodiments 59 to 69, wherein the TERT synthetic mRNA comprises an untranslated region (UTR).

[0398] Embodiment 71. The method of embodiment 70, wherein the UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

[0399] Embodiment 72. The method of any one of embodiments 59 to 71, wherein the TERT synthetic mRNA comprises a 5' cap structure, and the 5' cap structure is IRES, Cap0, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, CleanCap™, m7(3'O'eG)(5''ppp'5')(2'OMeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, or CAP-225.

[0400] Embodiment 73. The method of any one of embodiments 59 to 72, wherein the TERT synthetic mRNA comprises a poly-adenosine (poly-A) nucleotide sequence 3' to the coding region.

[0401] Embodiment 74. The method of any one of embodiments 59 to 73, wherein the TERT synthetic mRNA comprises a chain terminating nucleotide, and the nucleotide is 3'-deoxyadenosine (cordycepin), 3'-deoxyuridone, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridone, 2',3'-dideoxycytosine, 2',3'-deoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an -O-methylnucleoside.

[0402] Embodiment 75. The method of any one of embodiments 59 to 74, wherein the TERT synthetic mRNA is codon-optimized.

[0403] Embodiment 76. The method of any one of embodiments 59 to 73, wherein the TERT synthetic mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1, 2, 7, 9, 30, 39, or 40.

[0404] Embodiment 77. The method of embodiment 60, wherein the delivery vehicle is a liposome, an ionizable lipid, or an exosome.

[0405] Embodiment 78. The method of embodiment 77, wherein the delivery vehicle is an exosome, and the exosome comprises one or more targeting moieties, which are lipids, peptides, or antibodies.

[0406] Embodiment 79. The method according to any one of embodiments 59 to 78, wherein the method reduces fibrosis.

[0407] Embodiment 80. The method of any one of embodiments 59 to 79, wherein the subject is a human.

[0408] Embodiment 81. The composition of any one of embodiments 1 to 58 for use in the method of any one of embodiments 59 to 80.

[0409] Embodiment 82. A composition for use according to embodiment 81, wherein the composition is a pharmaceutical composition comprising one or more pharma- ceutically acceptable solvents or excipients.

[0410] Embodiment 83. A kit for treating a fibrotic disease in a subject, the kit comprising a composition described in any one of embodiments 1 to 58, and instructions therefor.

[0411] Embodiment 84. A method for treating liver disease in a subject in need thereof, comprising administering to the subject a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

[0412] Embodiment 85. The method of embodiment 84, wherein the composition comprises a delivery vehicle.

[0413] Embodiment 86 The method of embodiment 85, wherein the delivery vehicle is a nanoparticle.

[0414] Embodiment 87. The method of embodiment 86, wherein the nanoparticle is a lipid nanoparticle (LNP).

[0415] Embodiment 88. The method of embodiment 87, wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

[0416] Embodiment 89. The method of embodiment 88, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid to about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

[0417] Embodiment 90. The method of embodiment 88, wherein the LNP comprises a molar ratio of about 55 moles of ionizable lipid to about 5 moles of phospholipid, about 40 moles of cholesterol, and about 1.5 moles of PEGylated lipid.

[0418] Embodiment 91. The method of any one of embodiments 84 to 90, wherein the TERT synthetic mRNA comprises at least one modified nucleoside from the list in Table 1B.

[0419] Embodiment 92. The method of embodiment 91, wherein the modified nucleoside is pseudouridine or a pseudouridine analog.

[0420] Embodiment 93 The method of embodiment 92, wherein the pseudouridine analog is N-1-methylpseudouridine.

[0421] Embodiment 94. The method of embodiment 91, wherein the modified nucleoside is 5-methoxyuridine.

[0422] Embodiment 95. The method of any one of embodiments 84 to 94, wherein the TERT synthetic mRNA comprises an untranslated region (UTR).

[0423] Embodiment 96. The method of embodiment 95, wherein the UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

[0424] Embodiment 97. The method of any one of embodiments 84 to 96, wherein the TERT synthetic mRNA comprises a 5' cap structure, and the 5' cap structure is IRES, Cap0, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, CleanCap™, m7(3'O'eG)(5''ppp'5')(2'OMeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, or CAP-225.

[0425] Embodiment 98. The method of any one of embodiments 84 to 97, wherein the TERT synthetic mRNA comprises a poly-adenosine (poly-A) nucleotide sequence 3' to the coding region.

[0426] Embodiment 99. The method of any one of embodiments 84 to 98, wherein the TERT synthetic mRNA comprises a chain terminating nucleotide, and the nucleotide is 3'-deoxyadenosine (cordycepin), 3'-deoxyuridone, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridone, 2',3'-dideoxycytosine, 2',3'-deoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an -O-methylnucleoside.

[0427] Embodiment 100. The method of any one of embodiments 84 to 99, wherein the TERT synthetic mRNA is codon-optimized.

[0428] Embodiment 101. The method of any one of embodiments 84 to 99, wherein the TERT synthetic mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1, 2, 7, 9, 30, 39, or 40.

[0429] Embodiment 102. The method of embodiment 85, wherein the delivery vehicle is a liposome, a cationic lipid, or an exosome.

[0430] Embodiment 103. The method according to any one of embodiments 84 to 102, wherein the method reduces liver fibrosis.

[0431] Embodiment 104. The method of any one of embodiments 84 to 103, wherein the liver disease is nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver disease (NAFLD).

[0432] Embodiment 105. The method of any one of embodiments 84 to 103, wherein the liver disease is alcoholic hepatitis.

[0433] Embodiment 106. The method of any one of embodiments 84 to 103, wherein the liver disease is cirrhosis or liver fibrosis.

[0434] Embodiment 107. The method of any one of embodiments 84 to 103, wherein the liver disease is compensated cirrhosis, decompensated cirrhosis, or acute exacerbation of chronic hepatitis.

[0435] Embodiment 108. The method of any one of embodiments 84 to 103, wherein the liver disease is fibrotic stage F4 nonalcoholic steatohepatitis (NASH).

[0436] Embodiment 109. The method of any one of embodiments 84 to 103, wherein the liver disease is biliary atresia, primary biliary cirrhosis, primary sclerosing cholangitis, and / or chronic liver disease.

[0437] Embodiment 110. The method of any one of embodiments 84 to 103, wherein the liver disease is hemochromatosis, Wilson's disease, or ischemic hepatitis.

[0438] Embodiment 111. The method of any one of embodiments 84 to 110, wherein the subject is a human.

[0439] Embodiment 112. The composition of any one of embodiments 1 to 58 for use in the method of any one of embodiments 84 to 111.

[0440] Embodiment 113. A composition for use according to embodiment 112, wherein the composition is a pharmaceutical composition comprising one or more pharma- ceutically acceptable solvents or excipients.

[0441] Embodiment 114. A kit for treating liver disease in a subject, the kit comprising a composition described in any one of embodiments 1 to 58, and instructions therefor. Working Example

[0442] The following examples are included for illustrative purposes and are not intended to limit the scope of the disclosure.

[0443] Example 1: LNP formulation for mRNA expression in the liver This example shows that three different lipid nanoparticle (LNP) formulations may be used to deliver mRNA encoding a heterologous protein to the liver of a subject animal. The LNP formulation containing SS-OP lipids resulted in the highest level of expression and / or activity of the heterologous protein. Intravenous administration was used in this example. Furthermore, the SS-OP-based formulation (LNP1) caused less tissue toxicity than the cKK-E12-based formulation (LNP2). These experiments show expression of the report luciferase or therapeutic gene TERT in the liver of a subject animal. In particular, the SS-OP-based formulation is shown herein to cause high TERT expression and / or activity with low toxicity.

[0444] Table 5 shows exemplary lipid nanoparticle (LNP) formulations targeted to the liver with total lipid / mRNA ratios by weight / weight (wt / wt). [Table 5]

[0445] The compositions and methods of the present disclosure can be used to treat liver cirrhosis.In some embodiments, the compositions and / or methods of the present disclosure for treating liver cirrhosis induce TERT expression or increase TERT activity in liver cells.In some embodiments, the compositions and / or methods of the present disclosure for treating liver cirrhosis do not induce cytotoxicity, tissue toxicity, or systemic toxicity.The compositions can be administered systemically, for example, intravenously.

[0446] Figure 2 is a series of graphs showing that mRNA LNPs exhibit low toxicity by liver panel. Mice were administered intravenously with GRP or CRE mRNA encapsulated in lipid nanoparticles using either LNP1 (with SS-OP™) or LNP2 (with cKK-E12) (N=1-4 per condition). Mice were sacrificed and blood was collected at the indicated time points (12, 24, and 72 hours). Mice given saline (N=4) and carbon tetrachloride (CCl4, N=4) served as negative and positive controls, respectively. Error bars represent standard error of the mean.

[0447] Figure 3 is a series of photographs showing that intravenous delivery of TERT mRNA LNPs does not result in unusual tissue types. 11 μg of Cre mRNA was encapsulated in LNP1 and delivered intravenously to tdTomato fl / fl mice. Organs were harvested 72 hours later, fixed, paraffin embedded, and sectioned. Organs from untreated tdTomato fl / fl mice are shown for reference.

[0448] Figure 4 is a series of photographs showing that TERT mRNA LNPs transfect hepatocytes with high efficiency. 11 μg of Cre mRNA was encapsulated in LNP1 and delivered intravenously (iv) to tdTomato fl / fl mice. Organs were harvested 72 hours later, fixed, paraffin embedded, and sectioned. Photographs show immunohistochemistry (IHC) with anti-tdTomato. Organs from untreated tdTomato fl / fl mice are shown for reference.

[0449] Figure 5 is a series of photographs showing that TERT mRNA LNPs also target some cells in the spleen, specifically in the red pulp region. 11 μg of Cre mRNA was encapsulated in LNP1 and delivered intravenously (iv) to tdTomato fl / fl mice. 72 hours later, organs were harvested, fixed, paraffin embedded, and sectioned. Photographs show immunohistochemistry (IHC) with anti-tdTomato. Organs from untreated tdTomato fl / fl mice are shown for reference.

[0450] Figure 6 is a pair of graphs showing that TERT mRNA LNP induces high telomerase activity in liver. Tert mRNA (SEQ ID NO: 37) was formulated with LNP1 or LNP2 and delivered intravenously to TERT KO mice at a concentration of 0.6 mg / kg. After 20 hours, livers were harvested for TRAP. Wild-type C57Bl6 / J and untreated TERT KO mouse livers were used as positive and negative controls, respectively.

[0451] The TRAP assay detects telomerase using lysates from cells or tissues incubated with artificial telomeres (DNA oligonucleotides). If active telomerase is present, it extends the artificial telomere six base pairs (bp) at a time, producing a ladder pattern. This extension reaction is amplified by PCR and run on a gel (in this case, an Agilent bioanalyzer, microfluidic agarose gel). The presence of a ladder at 6 bp increments indicates telomerase activity.

[0452] Figure 7 is a photograph showing that exemplary LNP formulations deliver luciferase (LUC) mRNA to the liver, as shown by high bioluminescence signals. LNP1 (containing SS-OP™), LNP2 (containing cKK), and LNP3 (containing DLin-MC3-DMA) are shown. Empty LNP formulations are also shown as negative controls (ctrl). Luciferase mRNA was formulated with LNP1, 2, and 3 as described above and delivered intravenously to C57Bl6 / J mice. After 20 hours, the mice were shaved and imaged after luciferin injection using an IVIS™ bioluminescence imaging system.

[0453] FIG. 20 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, demonstrating in vivo delivery of mRNA. Luciferase mRNA was formulated with SS-OP using the lipid ratio of LNP1 as shown in Table 5. The lipid:mRNA ratio (wt / wt) was varied. Formulated mRNA LNPs were delivered to C57Bl6 / J mice by IV injection at 0.6 mg total mRNA / kg body weight. As a negative control, mice were injected with saline. After 24 hours, the mice were shaved and imaged after injection with luciferin using a Lago instrument from Spectral Instruments Imaging. Depicted are BLI images from mice administered lipid:mRNA ratios of 175, 42, and 25. Signal was highest in mice administered LNPs with lipid:mRNA ratios of 175 and 42 (wt / wt). Other data presented here using LNP1 uses a wt / wt ratio of 42.

[0454] FIG. 21 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, showing in vivo delivery of mRNA. LNPs designated as lipid nanoparticle 4 (LNP4) or lipid nanoparticle 5 (LNP5) were formulated with luciferase mRNA using the recipe in Table 5. These LNPs were delivered by IV injection to C57Bl6 / J mice at 0.6 mg / kg. As a negative control, mice were injected with saline. After 20 hours, the mice were shaved and imaged after injection with luciferin using a Lago instrument from Spectral Instruments Imaging. LNP4 consisted of the formulation for LNP2, but with SS-OP instead of cKK-E12. LNP5 consisted of the formulation for LNP1, but with cKK-E12 instead of SS-OP. Bioluminescence imaging shows that both of these LNPs were successfully delivered to the liver.

[0455] FIG. 22 is a photograph depicting the results showing that luciferase mRNA LNPs induce high bioluminescence signals in the liver, demonstrating the in vivo delivery of mRNA. Luciferase mRNA was formulated with lipids according to the recipe for LNP1 in Table 5. The component that was varied was the molar ratio of DMG-PEG2000. As shown in FIG. 22, DMG-PEG2000 was added as either 1, 1.5, 2, or 3 parts to the molar sum of all lipids, while the molar ratios of the other three lipids were kept constant. This corresponds to a molecular percentage of DMG-PEG2000 of approximately 1.0%, 1.5%, 2.0%, and 2.9%. Twenty hours after intravenous delivery at 0.6 mg / kg, C57Bl6 / J mice were shaved and imaged after injection of luciferin (75 mg / kg) using a Lago instrument from Spectral Instruments Imaging. The signal was strong from all mice that received active luciferase mRNA LNPs, with the best signal seen when DMG-PEG2000 was added at a molar ratio of 1.5:101.5 total (approximately 1.5%). Other data presented here use LNP1 with this molar ratio of DMG-PEG2000.

[0456] Figure 23 is a capillary electrophoresis gel image showing that TERT mRNA LNP induces high telomerase activity in liver. Tert mRNA (mTert SEQ ID NO: 37) was formulated with LNP3, a lipid nanoparticle containing DLin-MC3-DMA (Table 5), and delivered intravenously to TERT KO mice at 0.6 mg / kg. After 16 hours or 8 days (as shown in the image), livers were harvested for telomerase repeat amplification protocol (TRAP). The negative control was TRAP performed on livers from saline-injected TERT KO mice. Livers from mice treated with TERT mRNA LNP3 showed elevated telomerase activity, which returned to baseline levels, indicating that the increase in telomerase activity was transient. Example 2: Treatment of fibrosis in a TAA mouse model with TERT mRNA

[0457] This example shows that an LNP formulation with SS-OP (LNP1 in Table 5) administered intravenously effectively delivered mRNA encoding TERT to the liver in an amount effective to treat liver fibrosis. Treatment was demonstrated by reduced liver scarring in both female and male animals (left graph in FIG. 9A and FIG. 9B).

[0458] Figure 8 is a graph and a series of photographs from a first study showing that TERT LNP reduces fibrosis in a thioacetamide (TAA) drinking water model. Adding thioacetamide (TAA) to drinking water represents a recognized model in the art for inducing experimental liver fibrosis in rodents (Wallace et al. Standard operating procedures in experimental liver research: thioacetamide model in mice and rats. Lab Anim. 49:21-9 (2015)). In this experiment, TERT KO mice were administered 0.3 g / L of TAA in drinking water for 9.5 weeks. Mice were treated once a week with 0.6 mg / kg of LNP1 carrying TERT mRNA (SEQ ID NO: 37) or luciferase (LUC) mRNA. Liver sections were stained with picrosirius red (PSR) and quantification showed a mean reduction of 24% of PSR stained tissue in mice treated with TERT LNPs compared to mice treated with LUC LNPs. Scale bar on photographs equals 500 μm.

[0459] Figures 9A and 9B are graphs and photographs of a second study demonstrating that TERT LNP reduces fibrosis in a thioacetamide (TAA) drinking water model. TERT KO mice were administered 0.3 g / L TAA in drinking water for 9.4 weeks and treated with TERT or LUC LNP once a week. By picrosirius red (PSR) staining, a mean reduction in fibrosis in female mice was 18%, and a mean reduction of 37% was observed in males treated with TERT LNP, representing a significant (p=0.041) reduction in fibrosis. The scale bar on the photographs equals 500 μm. Furthermore, using a 0-4 scoring system developed by the Pathology Committee of the NASH Clinical Research Network (Kleiner et al. Hepatology 2005), animals treated with TERT mRNA LNPs showed a significant reduction in fibrosis (p=0.032) compared to control animals treated with LUC (luciferase) mRNA LNPs, as seen in Figure 9B. For all assessments, liver fibrosis was assessed independently, in a blinded fashion, for each of the three lobes (right, middle, and left) per mouse. Scores were combined and averaged to obtain a score per mouse, which was then plotted on a graph (Figure 8, Figure 9A, and Figure 9B).

[0460] Example 3: Improved survival in a TAA mouse model following treatment with TERT mRNA This example shows that an LNP formulation with SS-OP (LNP1 in Table 5) administered intravenously effectively delivered mRNA encoding TERT to the liver in an amount effective for treating liver fibrosis. Treatment was evidenced by increased survival in the treated group (TERT) compared to the control group (LUC) in FIG. 10. Mice treated with TERT mRNA showed a 42% increase in median survival time and a 58% increase in maximum survival time. Furthermore, the maximum life span of TERT mRNA-treated mice against TAA hepatotoxin was 12.5% ​​longer than control mice that did not receive TAA (117 vs. 104 days).

[0461] Figure 10A and Figure 10B are graphs showing that TERT mRNA improves survival rate. Survival rate is plotted as the percentage of mice surviving as a function of days after the first administration of either TERT (SEQ ID NO: 37) or luciferase (LUC) negative control. The same experimental procedure as described in Figure 9 was followed, except that the mice were fourth generation (G4) TERT KO aged to more than 30 weeks at the start of the study. These mice were administered 0.6 mg / kg TERT or LUC mRNA once a week for 8 weeks, and survival rate after the first administration was recorded.

[0462] Example 4: Decreased inflammation and increased telomere length following TERT mRNA treatment This example demonstrates that TERT mRNA treatment reduced inflammation and increased telomere length in the livers of treated animals with hepatic fibrosis. Furthermore, we confirm that mRNA was delivered and translated at all dose levels tested (0.05 mg / kg to 0.6 mg / kg) in nearly all hepatocytes with SS-OP-based LNP (LNP1). Finally, we show that both SS-OP-based LNP and MC3-based LNP were well tolerated, with SS-OP-based LNP being less toxic (lower AST) than MC3-based LNP. Furthermore, the number of mice with pathological inflammation was significantly reduced in mice treated with TERT mRNA.

[0463] Transfection efficiency with reporter mRNA in healthy and fibrotic subjects High in vivo transfection efficiency of reporter mRNA in liver with LNP1 is shown in Figure 12A. Different doses of Cre mRNA encapsulated in lipid nanoparticles with ionizable LNP1 delivered intravenously to tdTomato fl / fl mice were quantified. tdTomato flox / flox (fl / fl) mice refer to knock-in of the tdTomato gene, where a portion of the gene is flanked by two Cre recombinase recognition sites. Figure 12B shows representative images of immunohistochemistry (IHC) using anti-tdTomato antibody in liver sections from knock-in mice. Hepatocytes were identified from mouse liver tissue sections using nuclear size and circularity by QuPath software.

[0464] Upon successful TERT mRNA delivery, low levels of liver injury markers were observed. TERT mRNA was formulated in LNP1 or D-Lin-MC3-DMA(MC3)(LNP3) and delivered intravenously to C57Bl6 mice at 0.6 mg / kg. After 24 hours, liver toxicity markers alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured. LNP1 delivery of TERT mRNA resulted in similar or lower levels of ALT and AST compared to MC3 delivery of TERT mRNA (Figure 13).

[0465] The transfection efficiency of reporter mRNA in vivo was also high in fibrotic liver. Hepatocytes were identified using nuclear size and circularity by QuPath software as described above. Figure 14B shows a representative IHC image using anti-tdTomato antibody in liver sections.

[0466] Decreased telomere elongation and inflammation in the liver of subjects treated with fibrosis-inducing hepatotoxins Figure 11 shows two graphs showing that TERT LNP reduces lobular inflammation in the liver of mice in the thioacetamide (TAA) drinking water model. Addition of thioacetamide (TAA) to drinking water represents an art-recognized model for inducing experimental liver fibrosis in rodents. In this experiment, TERT KO mice were administered 0.3 g / L of TAA in drinking water for 9.5 weeks. Mice were treated once a week with 0.6 mg / kg of LNP1 carrying TERT mRNA (SEQ ID NO: 37) or luciferase (LUC) mRNA. In vivo delivery of TERT mRNA (SEQ ID NO: 37) using LNP1 formulation reduced the number of animals with a score greater than 1 by 60% (Figure 11B). Lobular inflammation was performed by a certified pathologist based on the nonalcoholic fatty liver disease NAFLD activity score (NAS) (Kleiner et al Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology Jun 41(6);1313-21; 2005). Measurements were performed on hematoxylin and eosin (H&E) stained liver sections from the thioacetamide (TAA) water experiment described in Example 2. Saline treated animals had a mild inflammation score of 1 (less than 2 foci per 200× field).

[0467] Three doses of either TERT mRNA (SEQ ID NO: 37) or LUC mRNA formulated with LNP1 were delivered intravenously to TERT knockout (KO) mice at 0.5 mg / kg once a week. Two days before mRNA-LNP1 administration, an intraperitoneal (ip) administration of 50 mg / kg thioacetamide (TAA) preceded the administration. Mice were harvested one week after the final administration of mRNA-LNP1. Telomere length was quantified in hepatocytes using Q-FISH. Liver tissue was fixed, sectioned, and stained with TelC fluorescent probe, which labels telomeres. Individual telomere fluorescence was quantified per cell (median values ​​are shown in FIG. 15A and 10th percentiles in FIG. 15B) and averaged for each mouse. Each point represents a single mouse. Hepatocytes from mice treated with TERT mRNA had significantly longer telomeres than luciferase mRNA-treated control animals. At least 300 cells were analyzed per mouse per treatment group.

[0468] Telomere elongation in human hepatocytes To measure telomerase activity in ex vivo human samples, the Telomerase Repeat Amplification Protocol (TRAP) assay was used on lysates from human hepatocytes incubated with artificial telomeres (DNA oligonucleotides). As described above in Example 1, if active telomerase is present, it will extend the artificial telomere 6 base pairs bp at a time, generating a ladder pattern. This extension reaction is amplified by PCR and run on a gel (in this case, an Agilent bioanalyzer, microfluidic agarose gel). The presence of a ladder at 6 bp increments indicates telomerase activity.

[0469] Human hepatocytes from a 51-year-old donor were cultured and transfected with GFP mRNA or TERT mRNA (SEQ ID NO: 39) at 1 μg / ml using Messenger Max™ from Thermo Scientific. At each time point shown in FIG. 16A, cells were harvested for TRAP assay and telomerase activity was measured. An Agilent Bioanalyzer was used to detect the ladder pattern, which is characteristic telomerase activity, as shown in FIG. 16A. Telomerase activity was strongly detected on days 1 and 2 post-transfection and weakly detected on day 7 post-transfection. It was not detected on day 14 post-transfection or in hepatocytes treated with GFP mRNA.

[0470] Telomere length was quantified using a fluorescent probe to label telomeres. Individual telomere fluorescence was quantified at the cell level, with averages in Figure 17A and 10th percentiles in Figure 17B. At least 150 cells were analyzed per treatment group. Telomerase activity was observed to return to baseline by day 14.

[0471] Figure 19 shows the results of a telomerase activity assay "telomerase repeat amplification protocol" (TRAP) in human fibroblasts treated for 24 hours with, from left to right, untreated cells, 1 μg / ml TERT mRNA of SEQ ID NO: 39, 40, 1, 2, 31, 3, 5, and 4, respectively, and a GFP mRNA control. Telomerase activity is shown by a characteristic ladder pattern as shown by transfection with various degrees of TERT mRNA of SEQ ID NO: 39, 40, 1, 2, 31, 3, 5, and 4. Untreated and GFP mRNA samples did not show telomerase activity.

[0472] Imaging of LNP1-TERT mRNA formulations The LNP1-TERT mRNA (SEQ ID NO: 40) formulation was imaged at high resolution using a Thermo Scientific Talos Glacios Cryo transmission electron microscope (TEM) at 34,000x magnification and 200kv voltage. A representative image is shown in Figure 18A, with the TEM copper grid being the dark area on the right. Particle size was characterized using dynamic light scattering (DLS) using a Brookhaven 90Plus Particle Analyzer (Figure 18B).

[0473] LNP1 nanoparticles containing TERT mRNA were observed to have the following exemplary characteristics shown in Table 6. [Table 6]

[0474] Although embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. Of course, various alternatives to the embodiments of the present disclosure described herein may be used in implementing the present disclosure. It is intended that the following claims define the scope of the present disclosure, and that methods and structures within the scope of these claims, and their equivalents, are covered thereby.

Claims

1. A composition comprising: (i) a ribonucleic acid (RNA) encoding telomerase reverse transcriptase (TERT); and (ii) a delivery vehicle, wherein the RNA of (i) comprises one or more modified nucleotides, and the delivery vehicle of (ii) is operably linked to the RNA of (i).

2. 2. The composition of claim 1, wherein the delivery vehicle comprises one or more of a nanoparticle, a liposome, a cationic lipid, an exosome, an extracellular vesicle, a lipid nanoparticle (LNP), a natural lipoprotein particle, and an artificial lipoprotein particle.

3. The composition of claim 1 , wherein the delivery vehicle comprises a lipid nanoparticle (LNP).

4. The composition of claim 1 , wherein the delivery vehicle comprises an ionizable lipid nanoparticle.

5. The composition of any one of claims 1 to 4, wherein the delivery vehicle comprises a targeting moiety.

6. The composition of claim 5 , wherein the delivery vehicle specifically or selectively interacts with hepatocytes.

7. The composition of claim 5 , wherein the targeting moiety is a lipid, a peptide, and / or an antibody.

8. The composition of claim 3 , wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

9. 9. The composition of claim 8, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid, about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

10. The delivery vehicle comprises a compound of formula (I), [Formula 1] In the formula, R 1aand R 1b each independently represents an alkylene group having 1 to 6 carbon atoms; X a and X b are each independently an acyclic alkyl tertiary amino group having 1 to 6 carbon atoms and one tertiary amino group, or an acyclic alkyl tertiary amino group having 2 to 5 carbon atoms, and a cyclic alkylene tertiary amino group having 1 to 2 tertiary amino groups; R 2a and R 2b each independently represents an alkylene group or an oxydialkylene group having 8 or fewer carbon atoms; Y a and Y b each independently represents an ester bond, an amide bond, a carbamate bond, an ether bond, or a urea bond; Z a and Z b are each independently a divalent radical derived from an aromatic compound having 3 to 16 carbon atoms, at least one aromatic ring, and optionally a heteroatom; R 3a and R 3b 10. The composition of claim 1, wherein each independently represents a residue derived from a reaction product of a fat-soluble vitamin having a hydroxyl group and succinic anhydride or glutaric anhydride, or a residue derived from a reaction product of a sterol derivative having a hydroxyl group and succinic anhydride, or glutaric anhydride or an aliphatic hydrocarbon group having 12 to 22 carbon atoms.

11. 11. The composition of claim 10, wherein the compound of formula I is: [Case 2]

12. 11. The composition of claim 10, wherein the compound of formula I is: [C3]

13. 11. The composition of claim 10, wherein the compound of formula I is: [C4]

14. 11. The composition of claim 10, wherein the compound of formula I is: [C5]

15. 11. The composition of claim 10, wherein the compound of formula I is: [C6]

16. 11. The composition of claim 10, wherein the compound of formula I is: [C7]

17. 17. The composition of any one of claims 1 to 16, wherein the RNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1-5, 30-31, or 37-40.

18. The composition of claim 17, wherein the RNA comprises a 5' cap.

19. The composition of claim 18, wherein the 5' cap comprises an anti-reverse cap analog (ARCA).

20. The composition of claim 19, wherein the ARCA comprises a 3'-O-Me-m7G(5')ppp(5')G structure.

21. 20. The composition of claim 18, wherein the 5' cap comprises m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

22. 22. The composition of any one of claims 1-21, wherein the RNA comprises at least one untranslated region (UTR), optionally a UTR sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

23. The composition of claim 22, wherein the at least one UTR is positioned 5' to the RNA of (i).

24. The composition of claim 22, wherein the at least one UTR is positioned 3' to the RNA of (i).

25. The composition of any one of claims 22 to 24, wherein the UTR comprises a human sequence.

26. The composition of any one of claims 22 to 24, wherein the UTR comprises a non-human sequence.

27. The composition of any one of claims 22 to 26, wherein the UTR comprises a chimeric sequence.

28. 28. The composition of claim 27, wherein the chimeric sequence increases the stability, increases the rate of transcription, or decreases the time to initiation of transcription of the RNA of (i).

29. 29. The composition of any one of claims 22-28, wherein the UTR comprises a sequence having at least 70% identity to a UTR sequence isolated or derived from one or more of alpha-globin, beta-globin, c-fos, and tobacco etch virus.

30. 30. The composition of any one of claims 1 to 29, wherein the one or more modified nucleotides of the RNA of (i) comprise one or more of a modified adenine or analogue, a modified cytidine or analogue, a modified guanosine or analogue, and a modified uridine or analogue.

31. 31. The composition of any one of claims 1 to 30, wherein the one or more modified nucleotides of the RNA of (i) comprise one or more of 1-methylpseudouridine, pseudouridine, 2-thiouridine, and 5-methylcytidine.

32. 32. The composition of any one of claims 1 to 31, wherein the one or more modified nucleotides of the RNA of (i) comprises 5-methoxyuridine (5-moU).

33. (i) the one or more modified nucleotides of the RNA are selected from the group consisting of m1A 1-methyladenosine, m6A N6-methyladenosine, Am 2'-O-methyladenosine, i6A N6-isopentenyladenosine, io6A N6-(cis-hydroxyisopentenyl)adenosine, ms2io6A 2-methylthio-N6(cis-hydroxyisopentenyl)adenosine, g6A N6-glycinylcarbamoyladenosine, t6A N6-threonylcarbamoyladenosine, ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine, Ar(p)2'-O-ribosyladenosine (phosphate), m6 2A N6,N6-dimethyladenosine, m6Am N6,2'-O-dimethyladenosine, m6 2Am N6,N6,2′-O-trimethyladenosine, m1Am 1,2′-O-dimethyladenosine, m3C 3-methylcytidine, m5C 5-methylcytidine, Cm 2′-O-methylcytidine, ac4C N4-acetylcytidine, f5C 5-formylcytidine, m4C N4-methylcytidine, hm5C 5-hydroxymethylcytidine, f5Cm 5-formyl-2′-O-methylcytidine, m1G 1-methylguanosine, m2G N2-methylguanosine, m7G 7-methylguanosine, Gm 2′-O-methylguanosine, m2 2G N2,N2-dimethylguanosine, Gr(p) 2′-O-ribosylguanosine (phosphate), yW wibutosine, o2yW peroxywibutosine, OHyW Hydroxywybutosine, OHYW* undermodified hydroxywybutosine, imG wybutosine, m2,7G N2,7-dimethylguanosine, m2,2,7G N2,N2,7-trimethylguanosine, I inosine, m1I 1-methylinosine, Im 2'-O-methylinosine, Q queosine, galQ galactosyl-queosine, manQ mannosyl-queosine, Ψ pseudouridine, D dihydrouridine, m5U 5-methyluridine, Um 2'-O-methyluridine, m5Um 5,2'-O-dimethyluridine, m1Ψ 1-methylpseudouridine, Ψm 2'-O-methylpseudouridine, s2U 2-thiouridine, ho5U 5-hydroxyuridine, chm5U 5-(carboxyhydroxymethyl)uridine,mchm5U 5-(carboxyhydroxymethyl)uridine, methyl ester mcm5U 5-methoxycarbonylmethyluridine, mcm5Um 5-methoxycarbonylmethyl-2'-O-methyluridine, mcm5s2U 5-methoxycarbonylmethyl-2-thiouridine, ncm5U 5-carbamoylmethyluridine, ncm5Um 5-carbamoylmethyl-2'-O-methyluridine, cmnm5U 5-carboxymethylaminomethyluridine, m3U 3-methyluridine, m1acp3Ψ 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, cm5U 5-carboxymethyluridine, m3Um 3,2′-O-dimethyluridine, m5D 5-methyldihydrouridine, τm5U 5-taurinomethyluridine, τm5s2U 5-Taurinomethyl-2-thiouridine, 2-Aminoadenosine, 2-Amino-6-chloropurine riboside, 8-Azaadenosine, 6-Chloropurine riboside, 5-Iodocytidine, 5-Iodouridine, Inosine, 2'-O-Methylinosine, Xanthosine, 4-Thiouridine, O6-Methylguanosine, 5,6-Dihydrouridine, 2-Thiocytidine, 6-Azacytidine, 6-Azauridine, 2'-O-Methyl-2-aminoadenosine, 2'-O-Methylpseudouridine, N1-Methyladenosine, 2'-O-Methyl-5-methyluridine, 7-Deazaguanosine, 8-Azidoadenosine, 5-Bromocytidine, 5-Bromouridine, 7-Deazaadenosine, 5-Aminoallyluridine, 5-Amino Noarylcytidine, 8-oxoguanosine, 2-aminopurine riboside, pseudoisocytidine, N1-methylpseudouridine, 5,6-dihydro-5-methyluridine, N6-methyl-2-aminoadenosine, 5-carboxycytidine, 5-hydroxymethyluridine, thienoguanosine, 5-hydroxycytidine, 5-formyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-methoxycytidine, thienouridine, 5-carboxymethylesteruridine, thienocytidine, 8-oxoadenosine, isoguanosine, N1-ethylpseudouridine, N1-methyl-2'-O-methylpseudouridine, N1-methoxymethylpseudouridine,N1-propyl pseudouridine, 2'-O-methyl-N6-methyl adenosine, 2-amino-6-Cl-purine-2'-deoxyriboside, 2-amino-2'-deoxyadenosine, 2-aminopurine-2'-deoxyriboside, 5-bromo-2'-deoxycytidine, 5-bromo-2'-deoxyuridine, 6-chloropurine-2'-deoxyriboside, 7-deaza-2'-deoxyadenosine, 7-deaza-2'-deoxyguanosine, 2'-deoxyinosine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxy Uridine, 5-fluoro-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, N6-methyl-2'-deoxyadenosine, 5-methyl-2'-deoxycytidine, O6-methyl-2'-deoxyguanosine, N2-methyl-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine, 8-oxo-2'-deoxyguanosine, 2-thiothymidine, 2'-deoxy-P-nucleoside, 5-hydroxy-2'-deoxycytidine, 4-thiothymidine, 2-thio-2'-deoxycytidine , 6-aza-2'-deoxyuridine, 6-thio-2'-deoxyguanosine, 8-chloro-2'-deoxyadenosine, 5-aminoallyl-2'-deoxycytidine, 5-aminoallyl-2'-deoxyuridine, N4-methyl-2'-deoxycytidine, 2'-deoxyzebularine, 5-hydroxymethyl-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycytidine, 5-propargylamino-2'-deoxycytidine, 5-propargylamino-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-phosphatidyl-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycyt ... lumyl-2'-deoxycytidine, 5-[(3-indolyl)propionamido-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxyuridine, 5-formyl-2'-deoxyuridine, 7-deaza-7-propargylamino-2'-deoxyadenosine, 7-deaza-7-propargylamino-2'-deoxyguanosine, biotin-16-aminoallyl-2'-dUTP, biotin-16-aminoallyl-2'-dCTP, biotin-16-aminoallylcytidine, N4-biotin-OBEA-2'-deoxycytidine,Biotin-16-aminoallyl uridine, Dabsyl-5-3-aminoallyl-2'-dUTP, Desthiobiotin-6-aminoallyl-2'-deoxycytidine, Desthiobiotin-16-aminoallyl-uridine, Biotin-16-7-deaza-7-propargylamino-2'-deoxyguanosine, Cyanine 3-5-propargylamino-2'-deoxycytidine, Cyanine 3-6-propargylamino-2'-deoxyuridine, Cyanine 5-6-propargylamino-2'-deoxycytidine, Cyanine 5-6-propargylamino-2' -deoxyuridine, cyanine 3-aminoallylcytidine, cyanine 3-aminoallyluridine, cyanine 5-aminoallylcytidine, cyanine 5-aminoallyluridine, cyanine 7-aminoallyluridine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro-2'-deoxyuridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methyluridine, puromycin, 2'-amino- 2'-deoxycytidine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxycytidine, 2'-azido-2'-deoxyuridine, aracytidine, arauridine, 2'-azido-2'-deoxyadenosine, 2'-amino-2'-deoxyadenosine, araadenosine, 2'-fluoro-thymidine, 3'-O-methyladenosine, 3'-O-methylcytidine, 3'-O-methylguanosine, 3'-O-methyluridine, 2'-azido-2'-deoxyguanosine, araguanosine, 2'-deoxyuridine, 3'-O-(2-nitro) 3'-O-(2-nitrobenzyl)-2'-deoxyadenosine, 3'-O-(2-nitrobenzyl)-2'-deoxyinosine, 3'-deoxyadenosine, 3'-deoxyguanosine, 3'-deoxycytidine, 3'-deoxy-5-methyluridine, 3'-deoxyuridine, 2',3'-dideoxyadenosine, 2',3'-dideoxyguanosine, 2',3'-dideoxyuridine, 2',3'-dideoxythymidine, 2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyadenosine, 3'-azido-2',3'-dideoxythymidine,3'-amino-2',3'-dideoxyadenosine, 3'-amino-2',3'-dideoxycytidine, 3'-amino-2',3'-dideoxyguanosine, 3'-amino-2',3'-dideoxythymidine, 3'-azido-2',3'-dideoxycytidine, 3'-azido-2',3'-dideoxyuridine, 5-bromo-2',3'-dideoxyuridine, 2',3'-dideoxyinosine , 2'-deoxyadenosine-5'-O-(1-thiophosphate), 2'-deoxycytidine-5'-O-(1-thiophosphate), 2'-deoxyguanosine-5'-O-(1-thiotriphosphate), 2'-deoxythymidine-5'-O-(1-thiophosphate), adenosine-5'-O-(1-thiophosphate), cytidine-5'-O-(1-thiophosphate), guanosine-5'-O-(1-thiophosphate), uridine -5'-O-(1-thiophosphate), 2',3'-dideoxyadenosine-5'-O-(1-thiophosphate), 2',3'-dideoxycytidine-5'-O-(1-thiophosphate), 2',3'-dideoxyguanosine-5'-O-(1-thiophosphate), 3'-deoxythymidine-5'-O-(1-thiophosphate), 3'-azido-2',3'-dideoxythymidine-5'-O-(1-thiophosphate), 2' 33. The composition of any one of claims 1 to 32, comprising one or more of 3'-dideoxyuridine-5'-O-(1-thiophosphate), 2'-deoxyadenosine-5'-O-(1-boranophosphate), 2'-deoxycytidine-5'-O-(1-boranophosphate), 2'-deoxyguanosine-5'-O-(1-boranophosphate), and 2'-deoxythymidine-5'-O-(1-boranophosphate).

34. The composition of any one of claims 1 to 33, wherein the composition further comprises ribonucleic acid (RNA) encoding a telomerase RNA component (TERC).

35. The composition of any one of claims 1 to 34, wherein the delivery vehicle comprises the RNA encoding TERT.

36. The composition of claim 35, wherein the RNA encoding TERT comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1-5, 7, 9, 14-17, 19, 21, 23, 25, 27, 29-31, 37-40.

37. The composition of claim 35, wherein the RNA encoding TERT comprises a UTR, optionally with a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-34, 35, and 36.

38. The composition of any one of claims 1 to 37, wherein the RNA comprises self-replicating RNA.

39. The composition of any one of claims 1 to 38, wherein the RNA comprises circular RNA.

40. The composition of claim 8 , wherein the layer comprises a lipid monolayer or a lipid bilayer.

41. 36. The composition of claim 35, wherein the delivery vehicle comprises an internal volume.

42. 40. The composition of any one of claims 1 to 39, wherein the delivery vehicle is operably linked to a ribonucleic acid (RNA) encoding a telomerase RNA component (TERC).

43. The composition of claim 40 , wherein the delivery vehicle comprises the RNA encoding TERC.

44. The composition of claim 35 , wherein one or more of a surface, layer, or volume of the delivery vehicle comprises the RNA encoding TERC.

45. 43. The composition of claim 42, wherein the surface comprises an exterior surface or an interior surface.

46. 46. ​​A method of increasing telomerase activity in a cell, said method comprising contacting said cell with a composition of any one of claims 1 to 45.

47. 46. ​​A method of extending telomeres in a cell, said method comprising contacting said cell with a composition of any one of claims 1 to 45.

48. 48. The method of claim 46 or 47, wherein the cell is in vivo, ex vivo, or in vitro.

49. A cell comprising the composition of any one of claims 1 to 45.

50. 50. A formulation comprising the cells of claim 49.

51. 51. The formulation of claim 50, wherein the plurality of cells comprises the cell of claim 49.

52. 52. The formulation of claim 51 , wherein each cell of the plurality is a cell of claim 49 .

53. 46. ​​A method of treating a disease or disorder comprising administering to a subject an effective amount of a composition according to any one of claims 1 to 45.

54. 50. A method of treating a disease or disorder comprising administering to a subject an effective amount of a cell of claim 49.

55. 53. A method of treating a disease or disorder comprising administering to a subject an effective amount of a formulation according to any one of claims 50 to 52.

56. A method of delaying the onset of a disease comprising administering to a subject an effective amount of a composition according to any one of claims 1 to 45.

57. 50. A method of delaying the onset of a disease comprising administering to a subject an effective amount of a cell of claim 49.

58. 53. A method of delaying the onset of a disease comprising administering to a subject an effective amount of a formulation according to any one of claims 50 to 52.

59. 1. A method of treating a fibrotic disease in a subject in need thereof, comprising: Administering to the subject an effective amount of a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

60. 60. The method of claim 59, wherein the composition comprises a delivery vehicle.

61. 61. The method of claim 60, wherein the delivery vehicle is a nanoparticle.

62. 62. The method of claim 61 , wherein the nanoparticle is a lipid nanoparticle (LNP).

63. 63. The method of claim 62, wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

64. 64. The method of claim 63, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid to about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1.0 to about 2.0 moles of PEGylated lipid.

65. 64. The method of claim 63, wherein the LNP comprises a molar ratio of about 30 to 40 moles of ionizable lipid to about 14 to about 18 moles of phospholipid, about 40 to about 50 moles of cholesterol, and about 2.0 to about 3.0 moles of PEGylated lipid.

66. The method of any one of claims 59 to 65, wherein the TERT synthetic mRNA comprises at least one modified nucleoside from the list in Table 1B.

67. 67. The method of claim 66, wherein the modified nucleoside is pseudouridine or a pseudouridine analog.

68. 68. The method of claim 67, wherein the pseudouridine analog is N-1-methylpseudouridine.

69. 67. The method of claim 66, wherein the modified nucleoside is 5-methoxyuridine.

70. The method of any one of claims 59 to 69, wherein the TERT synthetic mRNA comprises an untranslated region (UTR).

71. 71. The method of claim 70, wherein the UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

72. 72. The method of any one of claims 59 to 71, wherein the TERT synthetic mRNA comprises a 5' cap structure, wherein the 5' cap structure is IRES, Cap0, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, CleanCap™, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, or CAP-225.

73. The method of any one of claims 59 to 72, wherein the TERT synthetic mRNA comprises a poly-adenosine (poly-A) nucleotide sequence 3' to the coding region.

74. 74. The method of any one of claims 59 to 73, wherein the TERT synthetic mRNA comprises a chain terminating nucleotide, the nucleotide being 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, a 2',3'-dideoxynucleoside, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an -O-methylnucleoside.

75. The method of any one of claims 59 to 74, wherein the TERT synthetic mRNA is codon optimized.

76. 74. The method of any one of claims 59 to 73, wherein the TERT synthetic mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1, 2, 7, 9, 30, 39, or 40.

77. 61. The method of claim 60, wherein the delivery vehicle is a liposome, an ionizable lipid, or an exosome.

78. 78. The method of claim 77, wherein the delivery vehicle is an exosome or extracellular vesicle, and the exosome or extracellular vesicle comprises one or more targeting moieties, which are lipids, peptides, or antibodies.

79. 79. The method of any one of claims 59 to 78, wherein the method reduces fibrosis.

80. The method of any one of claims 59 to 79, wherein the subject is a human.

81. A composition according to any one of claims 1 to 58 for use in a method according to any one of claims 59 to 80.

82. 82. The composition for use according to claim 81, wherein the composition is a pharmaceutical composition comprising one or more pharma- ceutically acceptable solvents or excipients.

83. 60. A kit for treating a fibrotic disease in a subject, said kit comprising the composition of any one of claims 1 to 58, and instructions therefor.

84. 1. A method of treating liver disease in a subject in need thereof, comprising: The method includes administering to the subject a composition comprising one or more synthetic messenger ribonucleic acid (mRNA) encoding telomerase reverse transcriptase (TERT).

85. 85. The method of claim 84, wherein the composition comprises a delivery vehicle.

86. 86. The method of claim 85, wherein the delivery vehicle is a nanoparticle.

87. 87. The method of claim 86, wherein the nanoparticle is a lipid nanoparticle (LNP).

88. 88. The method of claim 87, wherein the LNP comprises an ionizable lipid, a phospholipid, cholesterol, and / or a PEGylated lipid.

89. 90. The method of claim 88, wherein the LNP comprises a molar ratio of about 50 to about 60 moles of ionizable lipid to about 4 to about 6 moles of phospholipid, about 35 to about 45 moles of cholesterol, and about 1 to about 2 moles of PEGylated lipid.

90. 89. The method of claim 88, wherein the LNP comprises a molar ratio of about 55 moles of ionizable lipid to about 5 moles of phospholipid, about 40 moles of cholesterol, and about 1.5 moles of PEGylated lipid.

91. 91. The method of any one of claims 84 to 90, wherein the TERT synthetic mRNA comprises at least one modified nucleoside from the list of Table 1B.

92. 92. The method of claim 91, wherein the modified nucleoside is pseudouridine or a pseudouridine analog.

93. 93. The method of claim 92, wherein the pseudouridine analog is N-1-methylpseudouridine.

94. 92. The method of claim 91, wherein the modified nucleoside is 5-methoxyuridine.

95. The method of any one of claims 84 to 94, wherein the TERT synthetic mRNA comprises an untranslated region (UTR).

96. 96. The method of claim 95, wherein the UTR comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 32-36.

97. 97. The method of any one of claims 84 to 96, wherein the TERT synthetic mRNA comprises a 5' cap structure, wherein the 5' cap structure is IRES, Cap0, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, CleanCap™, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, Cap2, Cap4, CAP-003, or CAP-225.

98. The method of any one of claims 84 to 97, wherein the TERT synthetic mRNA comprises a poly-adenosine (poly-A) nucleotide sequence 3' to the coding region.

99. 99. The method of any one of claims 84 to 98, wherein the TERT synthetic mRNA comprises a chain terminating nucleotide, wherein the nucleotide is 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, a 2',3'-dideoxynucleoside, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an -O-methylnucleoside.

100. The method of any one of claims 84 to 99, wherein the TERT synthetic mRNA is codon optimized.

101. 100. The method of any one of claims 84 to 99, wherein the TERT synthetic mRNA comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1, 2, 7, 9, 30, 39, or 40.

102. 86. The method of claim 85, wherein the delivery vehicle is a liposome, a cationic lipid, an extracellular vesicle, or an exosome.

103. The method of any one of claims 84 to 102, wherein the method reduces liver fibrosis.

104. The method of any one of claims 84 to 103, wherein the liver disease is nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver disease (NAFLD).

105. The method according to any one of claims 84 to 103, wherein the liver disease is alcoholic hepatitis.

106. The method according to any one of claims 84 to 103, wherein the liver disease is cirrhosis or liver fibrosis.

107. The method according to any one of claims 84 to 103, wherein the liver disease is compensated cirrhosis, decompensated cirrhosis, or acute exacerbation of chronic hepatitis.

108. The method of any one of claims 84 to 103, wherein the liver disease is fibrotic stage F4 non-alcoholic steatohepatitis (NASH).

109. The method according to any one of claims 84 to 103, wherein the liver disease is biliary atresia, primary biliary cirrhosis, primary sclerosing cholangitis, and / or chronic liver disease.

110. 104. The method of any one of claims 84 to 103, wherein the liver disease is hemochromatosis, Wilson's disease, or ischemic hepatitis.

111. The method of any one of claims 84 to 110, wherein the subject is a human.

112. A composition according to any one of claims 1 to 58 for use in a method according to any one of claims 84 to 111.

113. The composition for use according to claim 112, wherein the composition is a pharmaceutical composition comprising one or more pharma- ceutically acceptable solvents or excipients.

114. 60. A kit for treating liver disease in a subject, said kit comprising a composition according to any one of claims 1 to 58, and instructions therefor.

Images