AAV-based regulation of gene expression

Abstract

Aspects of the present disclosure relate to compositions and methods for positively or negatively regulating the expression of a gene therapy (e.g., a therapeutic protein expressed from an AAV vector). The present disclosure is based, in part, on specific nucleic acids, e.g., antisense oligonucleotides (ASOs), configured to bind to specific regions of an expression cassette (or mRNA transcribed from such an expression cassette).

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 USC § 119(e) of U.S. Provisional Application No. 63 / 141,110, filed January 25, 2021, entitled "MODULATION OF AAV-BASED GENE EXPRESSION," the entire contents of which are incorporated herein by reference. [Background technology]

[0002] background The ability to regulate the expression of therapeutic transgenes introduced into patients via AAV transduction would transform the field of gene therapy. The biology underpinning current viral approaches to gene therapy ensures long-term expression of therapeutic transgenes. This continuous expression of therapeutic genes is suitable for many indications, especially those caused by loss-of-function genetic mutations in the patient's genome. However, there are several scenarios in which the ability to increase / decrease, turn on / off the expression of therapeutic genes is highly desirable from the perspective of therapeutic drug administration or safety; the present invention describes multiple methods to achieve such control of gene expression through the use of specific ASOs. DISCLOSURE OF THEINVENTION

[0003] overview Aspects of the present disclosure relate to compositions and methods for positively or negatively regulating expression of gene therapeutics (e.g., therapeutic proteins expressed from AAV vectors) through the use of specific nucleic acids, such as antisense oligonucleotides (ASOs). In some embodiments, the methods described by the present disclosure allow for regulation of gene expression from expression cassettes consisting of common and widely used cis-acting DNA or RNA regulatory elements or expression cassettes having cis-acting DNA or RNA elements through interaction of the nucleic acid (e.g., ASO) with elements within the expression cassette or within the mRNA transcribed from such expression cassette. Thus, in some aspects, the disclosure provides a method of modulating expression of a transgene in a cell, the method comprising contacting a cell containing an rAAV vector including a transgene flanked by AAV inverted terminal repeats (ITRs) with one or more antisense oligonucleotides (ASOs) that specifically bind to at least one of the AAV ITRs, wherein binding of the one or more ASOs to the AAV ITRs results in altered expression of the transgene compared to a cell not containing the one or more ASOs.

[0004] In some embodiments, each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides. In some embodiments, each of the ASOs comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications are selected from a nucleobase modification or a backbone modification. In some embodiments, all of the nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modification comprises a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification comprises a phosphorothioate linkage. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the AAV2 ITR comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO: 1. In some embodiments, the AAV2 ITR consists of the nucleic acid sequence set forth in SEQ ID NO: 1 or its complement. In some embodiments, the ASO binds to at least 3 consecutive nucleotides of the AAV ITR.

[0005] In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 2-8, or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 2-8, or a complement thereof, and each of the at least one ASO comprises one or more chemical modifications selected from a nucleobase modification or a backbone modification. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modification comprises a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification comprises a phosphorothioate linkage. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the change in expression is an increase in expression of the transgene (e.g., increased expression compared to cells that do not contain one or more ASOs), In some embodiments, the change in expression is a decrease in expression of the transgene (e.g., decreased expression compared to cells that do not contain one or more ASOs).

[0006] In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is within a subject. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, the GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequence set forth in SEQ ID NO: 1, 9, 25, 40, 51, and 80. In some aspects, the disclosure provides a method of regulating expression of a transgene in a cell, the method comprising contacting a cell containing an rAAV vector comprising the transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to a transcriptional control region sequence of the transgene, wherein binding of the one or more ASOs to the transcriptional control region sequence results in altered expression of the transgene compared to a cell not containing the one or more ASOs.

[0007] In some embodiments, each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides. In some embodiments, each of the ASOs comprises one or more chemical modifications. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the one or more chemical modifications are selected from nucleobase modifications or backbone modifications. In some embodiments, the nucleobase modifications comprise 2'-O-methyl (2'OMe) modifications. In some embodiments, the backbone modifications comprise phosphorothioate linkages. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the transcriptional control region sequence comprises an enhancer sequence and / or a promoter sequence. In some embodiments, the enhancer sequence is a cytomegalovirus (CMV) enhancer sequence, and / or the promoter sequence is a chicken beta actin (CBA) promoter sequence. In some embodiments, the CMV enhancer sequence comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO:9, or a complement thereof. In some embodiments, the chicken beta actin (CBA) promoter sequence comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO:25, or a complement thereof.

[0008] In some embodiments, the ASO binds to at least three consecutive nucleotides of the transcriptional regulatory region sequence. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 10-24 and 26-39, or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 10-24 and 26-39, or a complement thereof, and each of the at least one ASO comprises one or more chemical modifications selected from a nucleobase modification or a backbone modification. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modification comprises a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification comprises a phosphorothioate linkage. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs).

[0009] In some embodiments, the change in expression is an increase in expression of the transgene (e.g., increased expression compared to cells that do not contain one or more ASOs), In some embodiments, the change in expression is a decrease in expression of the transgene (e.g., decreased expression compared to cells that do not contain one or more ASOs). In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, the GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequence set forth in SEQ ID NO: 1, 9, 25, 40, 51, and 80.

[0010] In some aspects, the disclosure provides a method of regulating expression of a transgene in a cell, the method comprising contacting a cell containing an rAAV vector comprising the transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to a protein coding region of an mRNA transcribed from the transgene, wherein binding of the one or more ASOs to the protein coding region results in altered expression of the transgene compared to a cell not containing the one or more ASOs. In some embodiments, each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides. In some embodiments, each of the ASOs comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications are selected from nucleobase modifications or backbone modifications. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modifications comprise 2'-O-methyl (2'OMe) modifications. In some embodiments, the backbone modifications comprise phosphorothioate linkages. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the ASO comprises a gapmer structure. In some embodiments, the ASO binds to at least three consecutive nucleotides of a protein coding region.

[0011] In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 41-50, any one of SEQ ID NOs: 91-95, or any one of SEQ ID NOs: 106-110, or a complement thereof. In some embodiments, the protein coding region encodes a β-glucocerebrosidase (GBA) protein. In some embodiments, the protein coding region comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO: 40, or a complement thereof. In some embodiments, the change in expression is an increase in expression of the transgene (e.g., increased expression compared to cells that do not contain one or more ASOs). In some embodiments, the change in expression is a decrease in expression of the transgene (e.g., decreased expression compared to cells that do not contain one or more ASOs). In some embodiments, the decrease in expression of the transgene results from RNaseH-mediated degradation of mRNA transcripts bound by one or more ASOs.

[0012] In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the rAAV vector comprises the nucleic acid sequence set forth in SEQ ID NOs: 1, 9, 25, 40, 51, and 80. In some aspects, the disclosure provides a method of regulating expression of a transgene in a cell, the method comprising contacting a cell containing an rAAV vector comprising the transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to a woodchuck post-translational regulatory element (WPRE) of an mRNA transcribed from the transgene, wherein binding of the one or more ASOs to the WPRE results in altered expression of the transgene compared to a cell not containing the one or more ASOs.

[0013] In some embodiments, each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides. In some embodiments, each of the ASOs comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications are selected from nucleobase modifications or backbone modifications. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modifications comprise 2'-O-methyl (2'OMe) modifications. In some embodiments, the backbone modifications comprise phosphorothioate linkages. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the WPRE comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO: 51, or its complement. In some embodiments, the ASO binds to at least three consecutive nucleotides of the WPRE sequence.

[0014] In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 52-79, any one of SEQ ID NOs: 96-100, or any one of SEQ ID NOs: 111-115, or a complement thereof. In some embodiments, the change in expression is an increase in expression of the transgene (e.g., increased expression compared to cells that do not contain one or more ASOs), In some embodiments, the change in expression is a decrease in expression of the transgene (e.g., decreased expression compared to cells that do not contain one or more ASOs). In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, the GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequence set forth in SEQ ID NO: 1, 9, 25, 40, 51, and 80.

[0015] In some aspects, the disclosure provides a method of regulating expression of a transgene in a cell, the method comprising contacting a cell containing an rAAV vector comprising the transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to a polyadenylation element of an mRNA transcribed from the transgene, wherein binding of the one or more ASOs to the polyadenylation element results in altered expression of the transgene compared to a cell not containing the one or more ASOs. In some embodiments, each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides. In some embodiments, each of the ASOs comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications are selected from nucleobase modifications or backbone modifications. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modifications comprise 2'-O-methyl (2'OMe) modifications. In some embodiments, the backbone modifications comprise phosphorothioate linkages. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the ASO comprises a gapmer structure. In some embodiments, the ASO binds to at least three consecutive nucleotides of a polyadenylation element.

[0016] In some embodiments, the polyadenylation element comprises a nucleic acid sequence set forth in SEQ ID NO: 80, or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 81-90, any one of SEQ ID NOs: 101-104, or any one of SEQ ID NOs: 116-120, or a complement thereof. In some embodiments, the change in expression is an increase in expression of the transgene (e.g., increased expression compared to cells that do not contain one or more ASOs). In some embodiments, the change in expression is a decrease in expression of the transgene (e.g., decreased expression compared to cells that do not contain one or more ASOs). In some embodiments, the decrease in expression of the transgene results from RNaseH-mediated degradation of mRNA transcripts bound by one or more ASOs.

[0017] In some embodiments, the expression of transgene changes (i.e., increases or decreases) independently of the nature of the expressed transgene.In some embodiments, one or more ASOs are delivered to cells at the same time as transgene transfection.In some embodiments, one or more ASOs are delivered to cells several hours, for example 3 hours, after transfecting cells with a plasmid containing a rAAV vector encoding a transgene.In some embodiments, one or more ASOs are delivered to cells several weeks after transfecting cells with a plasmid containing a rAAV vector encoding a transgene. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, the GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequence set forth in SEQ ID NO: 1, 9, 25, 40, 51, and 80.

[0018] In some aspects, the present disclosure provides an isolated nucleic acid comprising any one of the sequences set forth in SEQ ID NOs: 2-8, 10-24, 26-39, 41-50, 52-79, 81-120, or a complement thereof. In some embodiments, the isolated nucleic acid comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications comprise 2'-O-methyl (2'OMe) modifications, phosphorothioate linkages, locked nucleic acids (LNA), or any combination of the foregoing. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO). In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the isolated nucleic acid has a gapmer structure. [Brief description of the drawings]

[0019] [Figure 1] Figure 1 shows the effect of GBA-directed ASOs on GBA expression in HEK293T cells transfected with a GBA-encoding plasmid and the indicated ASOs. Cells were harvested after 72 hours and GBA expression was quantified using qRT-PCR. [Diagram 2] Figure 2 shows the effect of WPRE-directed ASOs on GBA expression in HEK293T cells transfected with a GBA-encoding plasmid and the indicated ASOs. Cells were harvested 72 hours later and GBA expression was quantified using qRT-PCR. [Diagram 3] Figure 3 shows the effect of BGH polyA-directed ASOs on GBA expression in HEK293T cells transfected with a GBA-encoding plasmid and the indicated ASOs. Cells were harvested after 72 hours and GBA expression was quantified using qRT-PCR.

[0020] [Figure 4] Figure 4 shows the effect of the ASO polyA ASO-2 on Trem2 expression in HEK293T cells transfected with a Trem2-encoding plasmid and the indicated ASOs. Cells were harvested 72 hours later and GBA expression was quantified using qRT-PCR. [Diagram 5] Figure 5 shows the effect of ASO on GBA expression in sequential transfection. HEK293T cells were transfected with a plasmid encoding GBA expression. After 3 hours, the plasmid transfection mixture was removed and the cells were transfected with the indicated ASO. Cells were harvested after 72 hours and GBA expression was quantified using qRT-PCR. [Figure 6] FIG. 6 shows the ASO target sequence of the PR001 construct. [Figure 7]Figure 7 shows GBA mRNA levels in the liver of mice injected with AAV-GBA followed by treatment with GBA ASO 1, WPRE ASO 2, or polyA ASO2.

[0021] Detailed Description In some aspects, the present disclosure relates to compositions and methods for modulating (e.g., positively or negatively modulating) expression of a gene therapeutic (e.g., a therapeutic protein expressed from an AAV vector) through the use of specific nucleic acids, such as antisense oligonucleotides (ASOs). In some embodiments, the nucleic acids (e.g., ASOs) described herein modulate gene expression from expression cassettes consisting of common and widely used cis-acting DNA or RNA regulatory elements, from expression cassettes with cis-acting DNA or RNA elements, or of mRNA transcribed from such expression cassettes.

[0022] Isolated Nucleic Acids An isolated nucleic acid may be DNA or RNA. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" means artificially produced. As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro, for example by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, for example by cleavage and gel separation; or (iv) synthesized, for example by chemical synthesis. An isolated nucleic acid is one that can be readily manipulated by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector for which the 5' and 3' restriction sites are known or the polymerase chain reaction (PCR) primer sequence is disclosed is considered to be isolated, but a nucleic acid sequence that exists naturally in a natural host is not isolated. An isolated nucleic acid may be, but need not be, substantially purified. For example, a nucleic acid isolated in a cloning vector or expression vector is not pure, since it may contain only a small portion of the material in the cell in which it resides. However, such nucleic acids are readily manipulable by standard techniques known to those of skill in the art and, as such, are isolated as such used herein. As used herein with respect to a protein or peptide, the term "isolated" refers to a protein or peptide that has been isolated from its natural environment or that has been artificially produced (e.g., by chemical synthesis, by recombinant DNA techniques, etc.).

[0023] Those skilled in the art will also understand that conservative amino acid substitutions can be made to provide functionally equivalent variants or homologues of capsid proteins. In some aspects, the present disclosure encompasses sequence changes that result in conservative amino acid substitutions. As used herein, conservative amino acid substitutions refer to amino acid substitutions that do not change the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, such as those found in references that summarize such methods; for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, FM Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include those made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Thus, conservative amino acid substitutions can be made to the amino acid sequences of the proteins and polypeptides disclosed herein. The disclosure relates, in part, to an isolated nucleic acid (e.g., an artificial or synthetic isolated nucleic acid) that includes a region complementary to a target nucleotide sequence, such as a sequence from a rAAV vector or expression construct, or a sequence of an mRNA transcribed from an expression construct. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).

[0024] Antisense oligonucleotides As used herein, the term "antisense nucleic acid" or "ASO" refers to a nucleic acid that has sequence complementarity to a target sequence and can specifically hybridize to a nucleic acid having a target sequence, for example, under stringent conditions.An antisense nucleic acid can specifically hybridize when the binding of the antisense nucleic acid to the target nucleic acid is sufficient to generate a pairing based on complementarity between the antisense nucleic acid and the target nucleic acid, and the degree of complementarity is sufficient to avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under the conditions where specific binding is desired, such as physiological conditions for in vivo assays or therapeutic treatments, and conditions where the assay is performed for in vitro assays.ASO can include one or more DNA nucleic acid bases, one or more RNA nucleic acid bases, or a combination of DNA nucleic acid bases and RNA nucleic acid bases.

[0025] Complementary refers to the ability of exact pairing between two nucleotides. For example, if a nucleotide at a particular position of an antisense nucleic acid can hydrogen bond with a nucleotide at a corresponding position of a target nucleic acid (e.g., a target nucleic acid sequence), the antisense nucleic acid and the target nucleic acid are considered to be complementary to each other at that position. An antisense nucleic acid and a target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other via their bases. Thus, "complementary" is a term used to indicate a sufficient degree of complementarity or exact pairing such that stable and specific binding occurs between an antisense nucleic acid and a target nucleic acid. However, it should be understood that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide such as an ASO) can be at least 80% complementary (e.g., at least 85%, 90%, 91%, 92%, 93%, 940%, 95%, 96%, 97%, 98%, 99% or 100% complementary) to consecutive nucleotides of a target nucleic acid sequence.

[0026] In some embodiments, antisense nucleic acids (ASOs) are used that have a region of complementarity that is fully complementary (e.g., 100% complementary) to a portion of a target nucleic acid (e.g., a target sequence of an rAAV vector, a target sequence of an expression construct, an mRNA sequence transcribed from an expression construct, etc.). In some embodiments, the antisense nucleic acid oligonucleotide comprises a region of complementarity that is complementary to a sequence set forth in any one of SEQ ID NOs: 1, 9, 25, 40, 51, and 80. The region of complementarity of the antisense nucleic acid may be complementary to at least 3, at least 4, at least 5, at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides of the target nucleic acid sequence. Additionally, to minimize potential off-target effects, ASOs may be designed to ensure that they do not have sequences complementary to off-target nucleic acids (e.g., 5 or more consecutive nucleotides).

[0027] However, it should be understood that in some embodiments, antisense nucleic acids with less than 100% sequence complementarity with target nucleic acid may be used. Thus, it is understood in the art that a complementary nucleotide sequence does not need to be 100% complementary to its target nucleotide sequence to be specifically hybridizable. For example, in some embodiments, an isolated nucleic acid contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches with its target sequence. In some embodiments, a complementary nucleic acid sequence for the purposes of the present disclosure is specifically hybridizable if the binding of the sequence to the target nucleic acid causes the desired change in gene expression (e.g., increased expression or increased translation of a gene product, or decreased expression or decreased translation of a gene product) and has a sufficient degree of complementarity to avoid non-specific binding to non-target nucleic acid under conditions where it is desired to avoid non-specific binding, such as under physiological conditions for in vivo assays or therapeutic treatments, and under conditions where the assay is performed under appropriate stringency conditions for in vitro assays.

[0028] Sequence identity, including the determination of sequence complementarity of nucleic acid sequences, can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or the second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. In some embodiments, the percent identity between two sequences is a function of the number of identical positions shared by the sequences (e.g., homology %=number of identical positions / total number of positions×100), and optionally penalizes the score for the number of gaps introduced and / or the length of the gaps introduced.

[0029] In some embodiments, oligonucleotides (e.g., ASOs) of the disclosure range from 5-40 nucleotides, 5-30 nucleotides, 10-30 nucleotides, 10-25 nucleotides, or 15-25 nucleotides in length. In some embodiments of the disclosure, the oligonucleotides are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length. In some embodiments, the oligonucleotides comprise a region of complementarity that is complementary to a region within 5, 10, 15, 25, or more nucleotides of a rAAV vector sequence, expression cassette sequence, or sequence of an mRNA transcribed from an expression cassette or rAAV vector described herein. In some embodiments, the antisense nucleic acids (e.g., oligonucleotides) are provided in homogenous preparations, e.g., where at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides are identical. In some embodiments, the compositions described herein are heterogeneous with respect to the ASO (e.g., the composition can include 2, 3, 4, 5, 6, 7, or more different sequences of the ASO).

[0030] The antisense nucleic acids of the present disclosure may be modified to achieve one or more desired properties, such as improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. Antisense nucleic acids may be modified at the base moiety, sugar moiety, and / or phosphate backbone. Thus, antisense nucleic acids may have one or more modified nucleotides (e.g., nucleotide analogs) and / or one or more backbone modifications (e.g., modified internucleotide linkages). Antisense nucleic acids may have a combination of modified and unmodified nucleotides. Antisense nucleic acids may also have a combination of modified and unmodified internucleotide linkages. Antisense nucleic acids may also be composed exclusively of modified nucleotides and / or modified internucleotide linkages.

[0031] Antisense nucleic acid can include ribonucleotide, deoxyribonucleotide, and combinations thereof.Examples of modified nucleotides that can be used in antisense nucleic acid include, for example, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine. uracil-5-oxyacetic acid(v), 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0032] In some embodiments, the modified nucleotide is a 2'-modified nucleotide. For example, the 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'-amino and 2'-aminoalkoxy modified nucleotide. In some embodiments, the 2'-modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of the 2'-modified nucleotide, the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. In such embodiments, the bond is a methylene (-CH2-) linking the 2' oxygen atom and the 3' or 4' carbon atom. n group, where n is 1 or 2. Antisense nucleic acids may contain a combination of LNA nucleotides and unmodified nucleotides.Antisense nucleic acids may contain a combination of LNA nucleotides and RNA nucleotides.Antisense nucleic acids may contain a combination of LNA nucleotides and DNA nucleotides.Further preferred oligonucleotide modifications include locked nucleic acids (LNA), in which a 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.

[0033] Antisense nucleic acid can also include nucleobase modified nucleotides, such as nucleotides that contain non-naturally occurring nucleobases instead of naturally occurring nucleobases.For example, bases can be modified to block the activity of adenosine deaminase.Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at 8-position, such as 8-bromoguanosine; deaza nucleotides, such as 7-deaza-adenosine; O- and N-alkylated nucleotides, such as N6-methyladenosine.It should be noted that the above modifications can also be combined. In the antisense nucleic acid (e.g., oligonucleotide) of the present disclosure, at least one nucleotide and up to all nucleotides can be modified.For example, an oligonucleotide (e.g., an oligonucleotide of 20 nucleotides in length) can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 modified nucleotides.In some embodiments, modified oligonucleotide will contain the minimum modified nucleotides required to achieve a desired level of in vivo stability and / or bioaccessibility or other desired properties.

[0034] Certain antisense nucleic acids can include nonionic DNA analogs, such as alkyl and aryl phosphates (where the charged phosphonate oxygen is replaced with an alkyl or aryl group), phosphodiesters and alkyl phosphotriesters where the charged oxygen moiety is alkylated, etc. Nucleic acids that contain diols, such as tetraethylene glycol or hexaethylene glycol, at one or both ends have also been shown to be substantially resistant to nuclease degradation and can be used herein.In some embodiments, antisense nucleic acids can include at least one lipophilic substituted nucleotide analog and / or pyrimidine-purine dinucleotide. In some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may have one or two accessible 5' ends. For example, it is possible to create a modified oligonucleotide with two such 5' ends by attaching two oligonucleotides via a 3'-3' linkage to generate an oligonucleotide with one or two accessible 5' ends. The 3'-3' linkage may be a phosphodiester, phosphorothioate, or other modified internucleoside bridge. In addition, 3'3' linked oligonucleotides in which the 3' terminal internucleoside linkage is not a phosphodiester, phosphorothioate, or other modified bridge can be prepared using an additional spacer, such as a tri- or tetraethylene glycol phosphate moiety.

[0035] The phosphodiester internucleotide bonds of the antisense nucleic acid can be replaced by modified bonds. The modified bonds can be selected, for example, from phosphorothioates, phosphorodithioates, NR1R2-phosphoramidates, boranophosphates, α-hydroxybenzylphosphonates, phosphate-(C1-C21)-O-alkyl esters, phosphate-[(C6-C12)aryl-(C1-C21)-O-alkyl] esters, (C1-C8) alkylphosphonates and / or (C6-C12) arylphosphonate bridges, and (C7-C12)-α-hydroxymethyl-aryl. The phosphate backbone of antisense nucleic acid can be modified to generate peptide nucleic acid molecules.As used herein, the term "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic, such as a DNA mimic, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleic acid bases are retained.The neutral backbone of PNA has been shown to allow specific hybridization to DNA and RNA under conditions of low ionic strength.The synthesis of PNA oligomers can be carried out, for example, using standard solid-phase peptide synthesis protocols.

[0036] The antisense nucleic acid can also be formulated as a morpholino oligonucleotide. In such an embodiment, the riboside moiety of each subunit of the oligonucleotide of the oligonucleotide reagent is converted to a morpholino moiety. The morpholino can also be modified, for example, as a peptide-linked morpholino. In other embodiments, the antisense nucleic acid (e.g., an oligonucleotide) can be linked to a functional group such as a peptide (e.g., for targeting a host cell receptor in vivo) or an agent that facilitates transport across a cell membrane or the blood-brain barrier. The oligonucleotide reagents of the present disclosure may also be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the oligonucleotide reagent.

[0037] Aspects of the present disclosure relate to ASOs having a "gapmer" structure. As used herein, a "gapmer" is a chimeric nucleic acid sequence that includes DNA bases and RNA bases, such as the following: (modified RNA nucleobases) N -(unmodified DNA nucleobase) A -(modified RNA nucleobase) N where each "N" is an integer between 1 and 20 and "A" is an integer between 2 and 10. Examples of ASOs with "gapmer" structures include: ASOs with a "5-10-5" structure, which contain five ribonucleotides (starting at the 5' end) with 2'-O-methoxyethyl modifications, followed by ten deoxynucleotides, followed by five ribonucleotides with 2'-O-methoxyethyl modifications, all with phosphorothioate internucleotide linkages. In some embodiments, the cytidine nucleotides of the gapmer may be methylated. In some embodiments, the uridine nucleotides of the gapmer may be methylated. In some embodiments, the gapmer structure contains 15 nucleotides of alternating LNA and deoxy nucleotides, all with phosphorothioate internucleotide linkages. In some embodiments, the central two nucleotides of the gapmer are deoxynucleotides. In some embodiments, the isolated nucleic acid having a sequence set forth in any one of SEQ ID NOs: 2-8, 10-24, 26-39, 41-50, 52-79, and 81-90 comprises a "gapmer" structure (one of skill in the art will recognize that in any of the nucleic acid sequences described herein, one or more "T" DNA nucleobases can be replaced by a "U" RNA nucleobase, or vice versa, to generate an ASO having a gapmer structure).

[0038] Nucleic acids targeting AAV ITRs Aspects of the disclosure relate to methods for modulating transgene expression (e.g., transgene expression mediated by a rAAV vector or expression cassette) by contacting a cell configured to express the transgene with one or more (e.g., 1, 2, 3, 4, 5, or more) isolated nucleic acids (e.g., nucleic acid sequences encoding AAV ITRs) that bind to AAV inverted terminal repeats (ITRs). In some embodiments, binding of the isolated nucleic acids described herein to AAV ITR sequences increases expression of an ITR-containing rAAV vector or increases the transduction efficiency of an ITR-containing rAAV vector. The isolated nucleic acid may specifically bind to the 5'ITR, 3'ITR, or both the 5'ITR and 3'ITR of the rAAV vector. In some embodiments, the isolated nucleic acid binds to (e.g., hybridizes to) the AAV2 ITR. In some embodiments, the AAV2 ITR comprises or consists of the sequence set forth in SEQ ID NO:1. In some embodiments, the isolated nucleic acid specifically binds to (e.g., hybridizes to) at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the AAV2 ITR (e.g., having the sequence set forth in SEQ ID NO:1). In some embodiments, the isolated nucleic acid comprises or consists of the nucleic acid sequence set forth in any one of SEQ ID NOs:2-8.

[0039] The modulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASOs) to the AAV ITRs can vary. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to the AAV ITRs results in an increase in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to the AAV ITRs results in an increase in transduction efficiency of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASOs) to the AAV ITRs results in about a 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% reduction in transgene expression compared to transgene expression of a rAAV vector that is not contacted with the one or more isolated nucleic acids.

[0040] Nucleic acids targeting transcriptional regulator regions Aspects of the disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by a rAAV vector or expression cassette) by contacting a cell configured to express the transgene with one or more (e.g., 1, 2, 3, 4, 5, or more) isolated nucleic acids that bind to a transcription control region sequence (e.g., a nucleic acid sequence encoding one or more transcription regulators). Examples of transcription control region sequences include promoter sequences, enhancer sequences, repressor sequences, Kozak sequences, and the like. In some embodiments, the transcription control region sequence comprises a promoter sequence. In some embodiments, the transcription control region sequence comprises an enhancer sequence. In some embodiments, binding of the isolated nucleic acid described herein to a transcription regulator sequence increases expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector.

[0041] The isolated nucleic acid may specifically bind to a promoter sequence of a rAAV vector. The promoter sequence may be a constitutive promoter sequence, an inducible promoter sequence, a tissue-specific promoter sequence, a native promoter sequence, and the like. In some embodiments, the isolated nucleic acid binds to (e.g., hybridizes to) a chicken beta actin (CBA) promoter sequence. In some embodiments, the CBA promoter sequence comprises or consists of a sequence set forth in SEQ ID NO:9. In some embodiments, the isolated nucleic acid specifically binds to (e.g., hybridizes to) at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of a CBA promoter sequence (e.g., having a sequence set forth in SEQ ID NO:9). In some embodiments, the isolated nucleic acid comprises or consists of a nucleic acid sequence set forth in any one of SEQ ID NOs:10-24.

[0042] The isolated nucleic acid may specifically bind to an enhancer sequence of a rAAV vector. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to a cytomegalovirus (CMV) enhancer sequence. In some embodiments, the CMV enhancer sequence comprises or consists of a sequence set forth in SEQ ID NO:25. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of a CMV promoter sequence (e.g., having a sequence set forth in SEQ ID NO:25). In some embodiments, the isolated nucleic acid comprises or consists of a nucleic acid sequence set forth in any one of SEQ ID NOs:26-39. The modulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASO) to the transcriptional control region sequence can vary. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to the transcriptional control region sequence results in an increase of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more in transgene expression compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to the transcriptional control region sequence results in a decrease of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% in transgene expression compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids.

[0043] Nucleic acid targeting coding sequence Aspects of the disclosure relate to methods for modulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette) by contacting a cell configured to express the transgene with one or more (e.g., 1, 2, 3, 4, 5, or more) isolated nucleic acids that bind to a protein coding region (e.g., DNA or mRNA sequence) encoding one or more therapeutic genes (e.g., PD-associated genes), such as, for example, Gcase (e.g., gene product of the GBA1 gene) or a portion thereof, Progranulin (e.g., gene product of the PGRN gene) or a portion thereof, Prosaposin (e.g., gene product of the PSAP gene) or a portion thereof, Triggering Receptor Expressed on Myeloid Cells 2 (e.g., gene product of the TREM2 gene) or a portion thereof, Apolipoprotein (e.g., gene product of the APOE gene), C9Orf72 protein (e.g., gene product of the C9Orf72 gene) or a portion thereof. In some embodiments, the gene product is encoded by a coding portion (e.g., cDNA) of a naturally occurring gene. In some embodiments, the coding region encodes a protein fragment of a naturally occurring gene. The protein fragment may comprise about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the naturally occurring protein. In some embodiments, the protein fragment comprises 50%-99.9% (e.g., any value between 50% and 99.9%) of the naturally occurring protein. In some embodiments, binding of the isolated nucleic acid described herein to a transcriptional regulator sequence reduces expression of the protein from the rAAV vector.

[0044] The isolated nucleic acid may specifically bind to a protein coding region of an rAAV vector (e.g., an mRNA transcribed from an rAAV vector). In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to a protein coding region (e.g., a DNA or mRNA sequence) encoding any one of the aforementioned transgenes, or a gene product thereof, or a codon-optimized region of the transgene, or a codon-optimized region of the gene product. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to a protein coding region encoding any one of the aforementioned transgenes, or a gene product thereof, or a codon-optimized region of the transgene, or a codon-optimized region of the gene product. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to a protein coding region encoding β-glucocerebrosidase or GBA. Gcase, also called β-glucocerebrosidase or GBA, refers to a lysosomal protein that cleaves the β-glucosidic bond of the chemical glucocerebroside, an intermediate in glycolipid metabolism. In humans, Gcase is encoded by the GBA1 gene located on chromosome 1. In some embodiments, GBA1 encodes a peptide represented by the NCBI reference sequence NCBI reference sequence NP_000148.2.

[0045] In some embodiments, the isolated nucleic acid specifically binds to a codon-optimized (e.g., codon-optimized for expression in a mammalian cell, e.g., a human cell) nucleic acid sequence encoding a GBA protein, such as the sequence set forth in SEQ ID NO: 40. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of a GBA protein coding sequence (e.g., having a sequence set forth in SEQ ID NO: 40). In some embodiments, the isolated nucleic acid comprises or consists of a nucleic acid sequence set forth in any one of SEQ ID NOs: 41-50 or any one of SEQ ID NOs: 91-95. In some embodiments, the isolated nucleic acid that specifically binds to a protein coding region (e.g., a nucleic acid sequence encoding a GBA protein, such as an mRNA sequence encoding a GBA protein) comprises a gapmer structure. In some embodiments, the isolated nucleic acid having a gapmer structure comprises at least three consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 41-50, any one of SEQ ID NOs: 91-95, or any one of SEQ ID NOs: 106-110.

[0046] The modulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASO) to a protein coding sequence can vary. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to a transcriptional control region sequence results in an increase in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to a protein coding sequence results in a decrease in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids.

[0047] Nucleic Acids Targeting Post-Transcriptional Regulatory Elements Aspects of the disclosure relate to methods for modulating transgene expression (e.g., transgene expression mediated by a rAAV vector or expression cassette) by contacting a cell configured to express the transgene with one or more (e.g., 1, 2, 3, 4, 5, or more) isolated nucleic acids that bind to a post-transcriptional regulatory element sequence (e.g., a nucleic acid sequence, such as an mRNA, that includes a post-transcriptional regulatory element sequence). Examples of polyadenylation element sequences include Hepatitis B virus (HPRE) and Woodchuck Hepatitis virus (WPRE). In some embodiments, the post-transcriptional regulatory element sequence is a Woodchuck post-transcriptional regulatory element sequence (WPRE). In some embodiments, binding of the isolated nucleic acid described herein to the post-transcriptional regulatory element sequence increases expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector.

[0048] The isolated nucleic acid may specifically bind to the WPRE of a rAAV vector. In some embodiments, the WPRE element sequence comprises or consists of the sequence set forth in SEQ ID NO:51. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the WPRE sequence (e.g., having the sequence set forth in SEQ ID NO:51). In some embodiments, the isolated nucleic acid comprises or consists of a nucleic acid sequence set forth in any one of SEQ ID NOs:52-79, any one of SEQ ID NOs:96-100, or any one of SEQ ID NOs:111-115. The modulation (e.g., increase or decrease) of transgene expression caused by binding of one or more isolated nucleic acids (e.g., ASO) to a post-transcriptional regulatory element sequence (e.g., WPRE) can vary. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASO) to a post-transcriptional regulatory element sequence results in an increase in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more compared to transgene expression of a rAAV vector not contacted with one or more isolated nucleic acids. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASO) to a post-transcriptional regulatory element sequence results in a decrease in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% compared to transgene expression of a rAAV vector not contacted with one or more isolated nucleic acids.

[0049] Polyadenylation element targeting nucleic acid Aspects of the disclosure relate to methods for modulating transgene expression (e.g., transgene expression mediated by a rAAV vector or expression cassette) by contacting a cell configured to express the transgene with one or more (e.g., 1, 2, 3, 4, 5, or more) isolated nucleic acids that bind to a polyadenylation element sequence (e.g., a nucleic acid sequence such as DNA encoding a polyA tail or an mRNA containing a polyU tail). Examples of polyadenylation element sequences include the SV40 polyadenylation element, the bovine growth hormone (BGH) polyadenylation element, and the like. In some embodiments, the polyadenylation element is a BGH polyA element. In some embodiments, binding of the isolated nucleic acid described herein to a transcriptional regulator sequence increases expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector. The isolated nucleic acid may specifically bind to the BGH polyA element of the rAAV vector. In some embodiments, the BGH polyadenylation element sequence comprises or consists of the sequence set forth in SEQ ID NO:80. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the BGH polyadenylation element sequence (e.g., having the sequence set forth in SEQ ID NO:80). In some embodiments, the isolated nucleic acid comprises or consists of the nucleic acid sequence set forth in any one of SEQ ID NOs:81-90 or any one of SEQ ID NOs:101-104.

[0050] In some embodiments, the isolated nucleic acid that specifically binds to a polyadenylation element sequence (e.g., a nucleic acid sequence encoding a BGH polyadenylation element, such as an mRNA sequence encoding a BGH polyadenylation element) comprises a gapmer structure. In some embodiments, the isolated nucleic acid having a gapmer structure comprises at least three consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 81-90, any one of SEQ ID NOs: 101-104, or any one of SEQ ID NOs: 116-120. The modulation (e.g., increase or decrease) of transgene expression caused by binding of one or more isolated nucleic acids (e.g., ASO) to the BGH polyadenylation element sequence can vary. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASO) to the BGH polyadenylation element sequence results in an increase in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000% or more compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASO) to the BGH polyadenylation element sequence results in a decrease in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% compared to the transgene expression of a rAAV vector that is not contacted with one or more isolated nucleic acids.

[0051] Pharmaceutical Compositions In some aspects, the present disclosure provides a pharmaceutical composition comprising the isolated nucleic acid or rAAV described herein and a pharma- ceutically acceptable carrier.As used herein, the term "pharma-ceutically acceptable" refers to a material, such as a carrier or diluent, that does not destroy the biological activity or properties of a compound and is relatively non-toxic, e.g., the material may be administered to an individual without causing undesirable biological effects or interacting in a harmful manner with any of the components of the composition in which it is contained. As used herein, the term "pharmaceutical acceptable carrier" refers to a pharmaceutical acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersant, suspending agent, diluent, excipient, thickener, solvent or encapsulating material, which is associated with carrying or transporting a compound useful within the present invention into or to a patient so that it can perform its intended function. Additional components that can be included in the pharmaceutical composition used in the practice of the present invention are known in the art and described, for example, in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA); which is incorporated herein by reference.

[0052] The compositions (e.g., pharmaceutical compositions) provided herein can be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (by powder, ointment, cream, and / or drops), mucosal, nasal, buccal, sublingual; intratracheal instillation, bronchial instillation, and / or inhalation; and / or as oral spray, nasal spray, and / or aerosol. Specifically contemplated routes are oral administration, intravenous administration (e.g., systemic intravenous injection), local administration via the blood and / or lymphatic supply, and / or direct administration to the affected site. In general, the most appropriate administration route will depend on various factors, such as the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract) and / or the condition of the subject (e.g., whether the subject can tolerate oral administration). In certain embodiments, the compounds or pharmaceutical compositions described herein are suitable for topical administration to the eye of a subject.

[0053] rAAV Vectors and rAAVs The isolated nucleic acid described herein may exist by itself or as part of a vector. Generally, the vector is a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome (BAC), or a viral vector (e.g., an adenovirus vector, an adeno-associated virus (AAV) vector, a retrovirus vector, a baculovirus vector, etc.). In some embodiments, the vector is a plasmid (e.g., a plasmid containing an isolated nucleic acid described herein). In some embodiments, the rAAV vector is single-stranded (e.g., single-stranded DNA). In some embodiments, the vector is a recombinant AAV (rAAV) vector. In some embodiments, the vector is a baculovirus vector (e.g., an Autographa californica nuclear polyhedrosis (AcNPV) vector). Typically, a rAAV vector (e.g., a rAAV genome) comprises a transgene (e.g., an expression construct comprising one or more of each of the following: promoter, intron, enhancer sequence, protein coding sequence, inhibitory RNA coding sequence, polyA tail sequence, etc.) flanked by two AAV inverted terminal repeat (ITR) sequences. In some embodiments, the transgene of the rAAV vector comprises an isolated nucleic acid described in this disclosure. In some embodiments, each of the two ITR sequences of the rAAV vector is a full-length ITR (e.g., about 145 bp in length and containing a functional Rep binding site (RBS) and terminal resolution site (trs)). In some embodiments, one of the ITRs of the rAAV vector is truncated (e.g., shortened or not full-length). In some embodiments, the truncated ITR lacks a functional terminal resolution site (trs) and is used for the generation of self-complementary AAV vectors (scAAV vectors). In some embodiments, the truncated ITR is, for example, a ΔITR as described in McCarty et al. (2003) Gene Ther. 10(26):2112-8.

[0054] In some aspects, the present disclosure relates to recombinant AAV (rAAV) comprising a transgene encoding a nucleic acid described herein (e.g., an rAAV vector described herein). The term "rAAV" generally refers to a viral particle comprising a rAAV vector encapsidated by one or more AAV capsid proteins. The rAAV described in this disclosure may comprise a capsid protein having a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10. In some embodiments, the rAAV comprises a capsid protein from a non-human host, e.g., a rhesus AAV capsid protein such as AAVrh.10, AAVrh.39. In some embodiments, the rAAV described herein comprises a capsid protein that is a variant of a wild-type capsid protein, e.g., a capsid protein variant that comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 (e.g., 15, 20, 25, 50, 100, etc.) amino acid substitutions (e.g., mutations) relative to the wild-type AAV capsid protein from which it is derived. In some embodiments, the AAV capsid protein variant is an AAV1RX capsid protein, e.g., as described in Albright et al. Mol Ther. 2018 Feb 7;26(2):510-523. In some embodiments, the capsid protein variant is an AAV TM6 capsid protein, e.g., as described in Rosario et al. Mol Ther Methods Clin Dev. 2016;3:16026.

[0055] In some embodiments, the rAAV described in this disclosure spreads easily through the CNS, especially when introduced into the CSF space or directly into the brain parenchyma.Thus, in some embodiments, the rAAV described in this disclosure comprises a capsid protein that can cross the blood-brain barrier (BBB).For example, in some embodiments, the rAAV comprises a capsid protein with AAV9 or AAVrh.10 serotype.The generation of rAAV is described, for example, in Samulski et al.(1989) J Virol. 63(9):3822-8 and Wright(2009) Hum Gene Ther. 20(7):698-706.In some embodiments, the rAAV comprises a capsid protein that specifically or preferentially targets myeloid cells, such as microglial cells. In some embodiments, the rAAV described in this disclosure (e.g., comprising a recombinant rAAV genome that is encapsidated by AAV capsid proteins to form rAAV capsid particles) is produced in a baculovirus vector expression system (BEVS). The production of rAAV using BEVS is described, for example, in Urabe et al. (2002) Hum Gene Ther 13(16):1935-43, Smith et al. (2009) Mol Ther 17(11):1888-1896, U.S. Patent No. 8,945,918, U.S. Patent No. 9,879,282, and International PCT Publication WO 2017 / 184879. However, rAAV can be produced using any suitable method (e.g., using recombinant rep and cap genes).

[0056] Regulation of gene expression Aspects of the present disclosure relate to compositions and methods for positively or negatively regulating expression of a gene therapy (e.g., a therapeutic protein expressed from an AAV vector) through the use of specific nucleic acids, such as antisense oligonucleotides (ASOs) that specifically bind (e.g., hybridize) to one or more of the following: viral vector regions (e.g., AAV ITRs), DNA or RNA regulatory elements (e.g., promoter sequences, enhancer sequences, post-transcriptional regulatory element sequences, etc.), and protein coding sequences of mRNA transcribed from an rAAV vector. The isolated nucleic acid may be administered to a cell or subject at the same time as the expression cassette or rAAV vector to which it specifically binds, or at different times (e.g., before or after administration of the expression cassette or rAAV vector). In some embodiments, the subject is administered rAAV, followed by one or more doses of the isolated nucleic acid (or multiple isolated nucleic acids) described herein. In some embodiments, the subject is administered one or more isolated nucleic acids based on detection of transgene expression levels in the cell or subject prior to administration of the isolated nucleic acid.

[0057] In some embodiments, the rAAV vector is in a cell, such as a host cell. The host cell can be a prokaryotic cell or a eukaryotic cell. For example, the host cell can be a mammalian cell, a bacterial cell, a yeast cell, an insect cell, etc. In some embodiments, the host cell is a mammalian cell, such as a HEK293T cell. In some embodiments, the host cell is a bacterial cell, such as an E. coli cell. In some embodiments, the cell is in vitro. In some embodiments, the cell is in a subject, such as a mammalian subject, such as a human, a mouse, a dog, a cat, etc. In some embodiments, one isolated nucleic acid that specifically binds to the rAAV vector or expression cassette is provided to a cell or subject. In some embodiments, more than one (e.g., 2, 3, 4, 5, or more) isolated nucleic acid is provided to a cell or subject. More than one different isolated nucleic acid (e.g., ASO) may bind to the same region or sequence (e.g., two ASOs that each bind to the AAV ITRs), or each may bind to a different region or sequence (e.g., a first ASO that specifically binds to the AAV ITRs and a second ASO that binds to a post-transcriptional regulatory element sequence).

[0058] Delivery of one or more isolated nucleic acids described by this disclosure to a cell or subject, in some embodiments, results in modulation (e.g., increase or decrease) of transgene expression caused by binding of the one or more isolated nucleic acids (e.g., ASOs) to sequences of a rAAV vector or expression construct contained in the cell or subject. In some embodiments, binding of the one or more isolated nucleic acids (e.g., ASOs) to a rAAV vector or expression construct results in an increase in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 100%, or more compared to transgene expression of a rAAV vector or expression construct not contacted with the one or more isolated nucleic acids. In some embodiments, the conjugation of one or more isolated nucleic acids (e.g., ASOs) to a rAAV vector or expression construct results in an increase in transduction efficiency of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, 100%, or more, compared to transgene expression of a rAAV vector or expression construct not contacted with one or more isolated nucleic acids. In some embodiments, the conjugation of one or more isolated nucleic acids (e.g., ASOs) to a rAAV vector or expression construct results in a decrease in transgene expression of about 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 100%, compared to transgene expression of a rAAV vector or expression construct not contacted with one or more isolated nucleic acids. In some embodiments, the one or more isolated nucleic acids are delivered to a cell at the same time as transfecting the cell with a plasmid comprising a rAAV vector encoding a transgene. In some embodiments, the one or more isolated nucleic acids are delivered to the cell after the plasmid containing the rAAV vector encoding the transgene is transfected into the cell.In some embodiments, the one or more isolated nucleic acids are delivered to the cell 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22 or 24 hours after the plasmid containing the rAAV vector encoding the transgene is transfected into the cell.In some embodiments, the one or more isolated nucleic acids are delivered to the cell 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the cell is transfected with a plasmid containing a rAAV vector encoding a transgene. In some embodiments, the one or more isolated nucleic acids are delivered to the cell 1, 2, 3, 4, 10, 15, 20, 26 or 52 weeks after the cell is transfected with a plasmid containing a rAAV vector encoding a transgene. In some embodiments, the one or more isolated nucleic acids are delivered to the cell 1, 2, 3 or 5 years after the cell is transfected with a plasmid containing a rAAV vector encoding a transgene.

[0059] Aspects of the present disclosure relate to compositions for regulating the expression of one or more CNS disease-related gene products in a subject to treat a CNS-related disease. One or more CNS disease-related gene products can be encoded by one or more isolated nucleic acids or rAAV vectors. In some embodiments, a subject is administered a single vector (e.g., isolated nucleic acid, rAAV, etc.) that encodes one or more (1, 2, 3, 4, 5, or more) gene products. In some embodiments, a subject is administered multiple (e.g., 2, 3, 4, 5, or more) vectors (e.g., isolated nucleic acid, rAAV, etc.), each vector encoding a different CNS disease-related gene product. The CNS-related disease may be a neurodegenerative disease, a synucleinopathy, a tauopathy, or a lysosomal storage disease. Examples of neurodegenerative diseases and their associated genes are shown in Table 1.

[0060] "Synucleinopathy" refers to a disease or disorder characterized by decreased expression or activity of alpha-synuclein (the gene product of SCNA) in a subject (e.g., compared to a healthy subject, e.g., a subject without a synucleinopathy). Examples of synucleinopathies and their associated genes are shown in Table 2. "Tauopathy" refers to a disease or disorder characterized by decreased expression or activity of tau protein in a subject (e.g., a healthy subject without a tauopathy). Examples of tauopathies and their associated genes are shown in Table 3. "Lysosomal storage disease" refers to a disease characterized by the abnormal accumulation of toxic cellular products in the lysosomes of a subject. Examples of lysosomal storage diseases and their associated genes are shown in Table 4.

[0061] [Table 1-1] [Table 1-2] [Table 2]

[0062] [Table 3]

[0063] [Table 4-1] [Table 4-2]

[0064] As used herein, "treat" or "treating" refers to (a) preventing or delaying the onset of a CNS disease; (b) reducing the severity of a CNS disease; (c) reducing or preventing the onset of symptoms characteristic of a CNS disease; and / or (d) preventing the deterioration of symptoms characteristic of a CNS disease in a subject. Symptoms of a CNS disease can include, for example, motor dysfunction (e.g., tremor, rigidity, slowness of movement, difficulty walking, paralysis), cognitive dysfunction (e.g., dementia, depression, anxiety, psychosis), memory impairment, emotional and behavioral dysfunction. The subject is typically a mammal, preferably a human. In some embodiments, the subject is 1 month to 10 years old (e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, 3 years old, 4 years old, 5 years old, 6 years old, 7 years old, 8 years old, 9 years old, 10 years old, or any age in between). In some embodiments, the subject is between 2 years old and 20 years old. In some embodiments, the subject is between 30 years old and 100 years old. In some embodiments, the subject is older than 55 years old.

[0065] In some embodiments, the composition is administered directly to the CNS of a subject, for example, by direct injection into the brain and / or spinal cord of the subject.Examples of CNS direct administration methods include, but are not limited to, intracerebral injection, intraventricular injection, intracisternal injection, intraparenchymal injection, intrathecal injection, and any combination of the above.In some embodiments, direct injection into the CNS of a subject results in transgene expression (e.g., expression of the first gene product, the second gene product, and if applicable, the third gene product) in the midbrain, striatum, and / or cerebral cortex of the subject.In some embodiments, direct injection into the CNS results in transgene expression (e.g., expression of the first gene product, the second gene product, and if applicable, the third gene product) in the spinal cord and / or CSF of the subject. In some embodiments, direct injection into the CNS of the subject comprises convection-enhanced delivery (CED).Convection-enhanced delivery is a therapeutic strategy that comprises surgical exposure of the brain and placing a small-diameter catheter directly into the target area of ​​the brain, followed by injecting a therapeutic agent (for example, the composition described herein or rAAV) directly into the brain of the subject.CED is described, for example, in Debinski et al.(2009) Expert Rev Neurother.9(10):1519-27.

[0066] In some embodiments, the composition is administered to the subject's periphery, for example by peripheral injection.Examples of peripheral injection include subcutaneous injection, intravenous injection, intraarterial injection, intraperitoneal injection, or any combination thereof.In some embodiments, the peripheral injection is intraarterial injection, for example injection into the carotid artery of the subject. In some embodiments, a composition described in this disclosure (e.g., an isolated nucleic acid or vector or rAAV, and / or a composition comprising an isolated nucleic acid described herein) is administered both peripherally and directly to the CNS of a subject. For example, in some embodiments, a subject is administered the composition by intra-arterial injection (e.g., injection into the carotid artery) and intraparenchymal injection (e.g., intraparenchymal injection by CED). In some embodiments, the direct injection into the CNS and the peripheral injection are simultaneous (e.g., occur simultaneously). In some embodiments, the direct injection is administered prior to (e.g., between 1 minute and 1 week, or more prior to) the peripheral injection. In some embodiments, the direct injection is administered subsequent to (e.g., between 1 minute and 1 week, or more after) the peripheral injection.

[0067] In some embodiments, the subject is administered an immunosuppressant prior to (e.g., from 1 month to 1 minute prior to) or concurrently with the compositions described herein. In some embodiments, the immunosuppressant is a corticosteroid (e.g., prednisone, budesonide, etc.), an mTOR inhibitor (e.g., sirolimus, everolimus, etc.), an antibody (e.g., adalimumab, etanercept, natalizumab, etc.), or methotrexate. The amount of a composition described herein (e.g., a composition comprising an isolated nucleic acid or vector or rAAV) administered to a subject will vary depending on the method of administration. A composition described herein (e.g., a composition comprising an isolated nucleic acid or vector or rAAV) can be administered to a subject one or more times (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or more). In some embodiments, the composition is administered to a subject continuously (e.g., chronically), e.g., via an infusion pump. EXAMPLES

[0068] Examples 1-5: Cell-based assays of viral transduction into GBA-deficient cells GBA1-deficient cells are obtained, for example, as fibroblasts, monocytes, or hES cells from GD patients, or patient-derived induced pluripotent stem cells (iPSCs), or HEK293T cells. These cells accumulate substrates such as glucosylceramide and glucosylsphingosine (GlcCer and GlcSph). Treatment of wild-type or mutant cultured cell lines with Gcase inhibitors such as CBE is also used to obtain GBA-deficient cells. The cells are administered rAAV containing AAV9 capsid proteins encapsulating a rAAV vector containing the nucleic acid sequence set forth in SEQ ID NOs: 1, 9, 25, 40, 51, and 80 (e.g., PR001). Transduction efficiency and GBA expression levels are monitored in the cells. One or more isolated nucleic acids (e.g., ASOs) targeting the PR001 vector are administered to the cells. Therapeutic endpoints (e.g., reduction of PD-associated pathology in in vivo assays) are measured in the context of AAV vector transduction expression to confirm and quantify increases or decreases in PR001 activity and function. GBA expression is quantified using qRT-PCT or through Gcase level measurements using protein ELISA measurements or by standard Gcase activity assays.

[0069] Example 1: Effect of ASOs directed at the GBA HEK293T cells were transfected with a plasmid containing a rAAV vector (e.g., PR001) encoding the GBA protein, and administered ASO directed to the GBA coding portion of the rAAV vector (PR001). The levels and types of ASO administered in the eight experimental groups were as follows: 20nM GBA ASO 1 modified (SEQ ID NO: 91), 100nM GBA ASO 1 modified (SEQ ID NO: 91), 20nM GBA ASO 2 modified (SEQ ID NO: 92), 100nM GBA ASO 2 modified (SEQ ID NO: 92), 20nM GBA ASO 3 modified (SEQ ID NO: 93), 100nM GBA ASO 3 modified (SEQ ID NO: 93), 20nM GBA ASO 4 modified (SEQ ID NO: 94), and 100nM GBA ASO 4 modified (SEQ ID NO: 94). Negative and positive control groups were also included in the experimental design. In the negative control, cells were not transfected with a plasmid encoding GBA and were not administered any ASO. In the positive control, cells were transfected with a plasmid encoding GBA expression and administered 100 nM ASO directed to GFP (green fluorescent protein), comprising the nucleic acid sequence set forth in SEQ ID NO: 105. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. All experimental groups showed a significant decrease in GBA expression compared to the positive control (Figure 1).

[0070] Example 2: Effect of ASO directed at WPRE HEK293T cells were transfected with a plasmid containing an rAAV vector (e.g., PR001) encoding the GBA protein and administered an ASO directed to the WPRE-encoding portion of the rAAV vector (PR001). The levels and types of ASO administered in the 10 experimental groups were as follows: 20 nM WPRE ASO 1 modified (SEQ ID NO: 96), 100 nM WPRE ASO 1 modified (SEQ ID NO: 96), 20 nM WPRE ASO 2 modified (SEQ ID NO: 97), 100 nM WPRE ASO 2 modified (SEQ ID NO: 97), 20 nM WPRE ASO 3 modified (SEQ ID NO: 98), 100 nM WPRE ASO 3 modified (SEQ ID NO: 98), 20 nM WPRE ASO 4 modified (SEQ ID NO: 99), 100 nM WPRE ASO 4 modified (SEQ ID NO: 99), 20 nM WPRE ASO 5 modified (SEQ ID NO: 100), 100 nM WPRE ASO 5 modified (SEQ ID NO: 100). Four control groups were also included in the experimental design: in the negative control group, cells were not transfected with a plasmid encoding GBA and were not administered any ASO; in the positive control group, cells were transfected with a plasmid encoding GBA expression and were administered 100 nM ASO (SEQ ID NO: 105) directed to GFP; in two groups, cells were transfected with a plasmid encoding GBA and were administered 20 nM GBA ASO 1 modified (SEQ ID NO: 91) and 100 nM GBA ASO 1 modified (SEQ ID NO: 91), respectively. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. Surprisingly, an increase in GBA expression compared to the positive control was observed in some experimental groups, especially in the groups administered 100 nM WPRE ASO 1 modified (SEQ ID NO: 96), WPRE ASO 4 modified (SEQ ID NO: 99), or WPRE ASO 5 modified (SEQ ID NO: 100) (Figure 2).

[0071] Example 3: Effect of ASOs directed against the bovine growth hormone polyadenylation element (BGH polyA) HEK293T cells were transfected with a plasmid containing an rAAV vector (e.g., PR001) encoding the GBA protein and administered an ASO directed to the BGH polyadenylation element (polyA)-encoding portion of the rAAV vector (PR001). The levels and types of ASO administered in the eight experimental groups were as follows: 20 nM polyA ASO 1 modified (SEQ ID NO: 101), 100 nM polyA ASO 1 modified (SEQ ID NO: 101), 20 nM polyA ASO 2 modified (SEQ ID NO: 102), 100 nM polyA ASO 2 modified (SEQ ID NO: 102), 20 nM polyA ASO 3 modified (SEQ ID NO: 103), 100 nM polyA ASO 3 modified (SEQ ID NO: 103), 20 nM polyA ASO 5 modified (SEQ ID NO: 104), 100 nM polyA ASO 5 modified (SEQ ID NO: 104). Four control groups were also included in the experimental design: in the negative control group, cells were not transfected with a plasmid encoding GBA and were not administered any ASO; in the positive control group, cells were transfected with a plasmid encoding GBA expression and were administered 100 nM ASO (SEQ ID NO: 105) directed to GFP; in two groups, cells were transfected with a plasmid encoding GBA and were administered 20 nM GBA ASO 1 modified (SEQ ID NO: 91) or 100 nM GBA ASO 1 modified (SEQ ID NO: 91), respectively. Cells were harvested after 72 hours and GBA expression was quantified using qRT-PCR. Surprisingly, all experimental groups showed comparable or significantly increased GBA expression compared to the positive control. Remarkably, a 20-fold increase in GBA expression was observed in cells administered 100 nM polyA ASO 2 modified (SEQ ID NO: 102) relative to the positive control (Figure 3).

[0072] Example 4: Effect of polyA ASO 2 modification (SEQ ID NO: 102) on Trem2 expression HEK293T cells were transfected with a plasmid containing a rAAV vector encoding Trem2 protein and treated with 20 nM or 100 nM of polyA ASO 2 modified (sequence no. 102), respectively. Two control groups were also included in the experimental design: in the negative control group, cells were not transfected with a plasmid encoding Trem2 and did not receive any ASO; in the positive control group, cells were transfected with a plasmid encoding Trem2 expression and treated with 100 nM of ASO directed against GFP (sequence no. 105). Cells were harvested after 72 hours and Trem2 expression was quantified using qRT-PCR. Both experimental groups showed a significant increase in Trem2 expression compared to the positive control. Of note, cells treated with 100 nM of polyA ASO 2 modified (sequence no. 102) showed a 13-fold increase in Trem2 expression compared to the positive control (Figure 4).

[0073] Example 5: Effect of ASO administration in sequential transfection HEK293T cells were transfected with a plasmid containing a rAAV vector encoding GBA protein. After 3 hours, the plasmid transfection mixture was removed, and the cells of four experimental groups were transfected with 20nM of GBA ASO 1 modified (SEQ ID NO: 91), 100nM of GBA ASO 1 modified (SEQ ID NO: 91), 20nM of polyA ASO 2 modified (SEQ ID NO: 102) or 100nM of modified polyA ASO 2 (SEQ ID NO: 102). Two control groups were also included in the experimental design: in the negative control group, cells were not transfected with a plasmid encoding GBA and were not administered any ASO; in the positive control group, cells were transfected with a plasmid encoding GBA expression and were administered 100nM of ASO (SEQ ID NO: 105) directed to GFP. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. Both experimental groups administered GBA ASO 1 modification (SEQ ID NO: 91) showed a significant decrease in GBA expression compared to the positive control. The group administered 20 nM polyA ASO 2 modification (SEQ ID NO: 102) showed a similar level of GBA expression as the positive group. Cells administered 100 nM polyA ASO 2 modification (SEQ ID NO: 102) showed the most significant change, with a 7-8 fold increase in GBA expression compared to the positive control (Figure 5).

[0074] Example 6: In vivo assay Male C57 / BL6J mice were inoculated with 1 × 10 12 Mice were then IV-injected with saline or ASO at 100 mg / kg vg / kg or vehicle control. Mice in the vehicle group then received a saline control, while mice given AAV-GBA received an IV injection of saline or ASO on days 7, 14, and 21 after AAV-GBA injection, as detailed in Table 5. Plasma was collected by submandibular blood sampling prior to AAV-GBA injection and on days 7 and 21 after AAV-GBA injection. Mice were euthanized 30 days after AAV injection and tissues were collected for analysis. [Table 5]

[0075] The results show that GBA ASO 1 and WPRE ASO 2 significantly reduced GBA mRNA levels in the liver, and polyA ASO 2 showed a trend toward reducing GBA mRNA in the liver (Figure 7). In vivo assays of AAV vectors are performed using mutant mice. Vehicle control and AAV vector (e.g., PR001 at 2×10 11 Intrathecal or intraventricular delivery of 1000 mg / vg / mouse (at a dose of 1000 mg / vg / mouse) is performed using concentrated AAV stocks, e.g., in injection volumes of 5-10 μL. Intraparenchymal delivery by convection-enhanced delivery is performed. One or more isolated nucleic acids (e.g., ASOs) targeting the PR001 vector are administered to the cells. Therapeutic endpoints (e.g., reduction in PD-associated pathology) are measured in the context of expression of AAV vector transduction, confirming and quantifying increases or decreases in PR001 activity and function. Endpoints measured are accumulation of substrates in the CNS and CSF, accumulation of Gcase enzymes and enzyme activity by ELISA, motor and cognitive endpoints, lysosomal dysfunction, and accumulation of α-synuclein monomers, protofibrils or fibrils.

[0076] array In some embodiments, the isolated nucleic acids (e.g., ASOs) described herein specifically bind (e.g., hybridize) to the sequences shown below, or their complements, or their reverse complements. In some embodiments, the isolated nucleic acids (e.g., ASOs) described herein comprise or consist of one of the sequences shown below, or their complements, or their reverse complements, or their gapmers, or modified versions thereof that contain one or more chemical modifications, where the one or more chemical modifications are selected from nucleobase modifications or backbone modifications. In some embodiments, all nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleobase modifications include 2'-O-methyl (2'OMe) modifications and the backbone modifications include phosphorothioate linkages. In some embodiments, the ASOs include one or more locked nucleic acids (LNAs). In the sequences shown below, the letter "m" in front of the nucleobase letter indicates a 2'-O-methyl (2'OMe) modification and the "*" between the two nucleobases indicates a phosphorothioate linkage.

[0077] >AAV2 ITR nucleic acid sequence (SEQ ID NO:1) cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccggggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct >ITR ASO 1 (SEQ ID NO:2) gcgcgcagctgcctgcagg >ITR ASO 2 (SEQ ID NO:3) cggcctcagtgagcgagcga >ITR ASO 3 (SEQ ID NO: 4) acgcccgggctttgcccggg >ITR ASO 4 (SEQ ID NO:5) cgggcgaccaaaggtcgcccg

[0078] >ITR ASO 5 (SEQ ID NO:6) gctcgctcgctcactgaggc >ITR ASO 6 (SEQ ID NO:7) tggccactccctctctgcgc >ITR ASO 7 (SEQ ID NO:8) aggaacccctagtgatggagt >CMV enhancer nucleic acid sequence (SEQ ID NO:9) Cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatg

[0079] >CMV ASO 1 (SEQ ID NO: 10) tttaccgtaagttatgtaacg >CMV ASO 2 (SEQ ID NO: 11) ggcggtcagccaggcgggcca >CMV ASO 3 (SEQ ID NO: 12) gtcaatgggcgggggtcgttg >CMV ASO 4 (SEQ ID NO: 13) ggaacatacgtcattattgac >CMV ASO 5 (SEQ ID NO: 14) gtccctattggcgttactatg

[0080] >CMV ASO 6 (SEQ ID NO: 15) acccattgacgtcaatggaaa >CMV ASO 7 (SEQ ID NO: 16) gcagtttaccgtaaatactcc >CMV ASO 8 (SEQ ID NO: 17) acttgatgtactgccaagtgg >CMV ASO 9 (SEQ ID NO: 18) ggcgtacttggcatatgatac >CMV ASO 10 (SEQ ID NO: 19) ccgtcattgacgtcaataggg

[0081] >CMV ASO 11 (SEQ ID NO: 20) taatgccaggcgggccattta >CMV ASO 12 (SEQ ID NO:21) cataaggtcatgtactgggca >CMV ASO 13 (SEQ ID NO:22) tactgccaagtaggaaagtcc >CMV ASO 14 (SEQ ID NO:23) gcgatgactaatacgtagatg >CMV ASO 15 (SEQ ID NO:24) ccatggtaatagcgatgac

[0082] >CBA promoter nucleic acid sequence (SEQ ID NO:25) tcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccaccccaattttgtatttatttatttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggc ggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg >CB ASO 1 (SEQ ID NO:26) agaacgtggggctcacctcga >CB ASO 2 (SEQ ID NO:27) gggagatggggagagtgaagc >CB ASO 3 (SEQ ID NO:28) aaattgggggtggggaggggg

[0083] >CB ASO 4 (SEQ ID NO:29) attaaaaaataaataaataca >CB ASO 5 (SEQ ID NO:30) cccccatcgctgcacaaaata >CB ASO 6 (SEQ ID NO:31) cgcgccccccccccccccccccg >CB ASO 7 (SEQ ID NO:32) cccgccccgccccgcctggcg >CB ASO 8 (SEQ ID NO:33) tcgccccgccccgcccctcgc

[0084] >CB ASO 9 (SEQ ID NO:34) ctgccgccgcacctctccgcc >CB ASO 10 (SEQ ID NO:35) ggagcgcgccgctctgattgg >CB ASO 11 (SEQ ID NO:36) tcgccataaaaggaaactttc >CB ASO 12 (SEQ ID NO:37) agggccgccgccgccgccgcc >CB ASO 13 (SEQ ID NO:38) gccgcgcgcttcgctttttat >CB ASO 14 (SEQ ID NO:39) agcgcgcagcgactcccgccc

[0085] >GBA codon-optimized nucleic acid sequence (SEQ ID NO:40)

[0086] >GBA ASO 1 (SEQ ID NO:41) gcugcugaauuccaugguggc >GBA ASO 2 (SEQ ID NO:42) ggggcauuccucucugcuggg >GBA ASO 3 (SEQ ID NO:43) ugacacccggcucagaggcuu >GBA ASO 4 (SEQ ID NO:44) ugucagagauccggccaugau >GBA ASO 5 (SEQ ID NO:45) ggccugaagcagcagcagucc

[0087] >GBA ASO 6 (SEQ ID NO:46) agcgccagaagcccaagacac >GBA ASO 7 (SEQ ID NO:47) gcucuuggggaugcaaggucu >GBA ASO 8 (SEQ ID NO:48) cacgacgcugcuguagccgaa >GBA ASO 9 (SEQ ID NO:49) guagguggcauugcacacgca >GBA ASO 10 (SEQ ID NO:50) aggagggucgaagcugucgca

[0088] >WPRE nucleic acid sequence (SEQ ID NO:51) Aaucaaccucuggauuacaaaauuugugaaagauugacugguauucuuaacuauguugcuccuuuuacgcuauguggauacgcugcuuuaaugccuuuguaucaugcuauugcuucccguauggcuuucauuuucuccuccuuguauaaauccugguugcugucucuuuaugaggaguuguggcccguugucaggcaacguggcguggugugcacuguguuugcugacgcaacccccacugguuggggcauugccaccaccugucagcuccuuuccgggacuuucgcuuucccccucccuauugccacggcggaacucaucgccgccugccuugcccgcugcuggacaggggcucggcuguugggcacugacaauuccgugguguugucggggaaaucaucguccuuuccuuggcugcucgccuguguugccaccuggauucugcgcgggacguccuucugcuacgucccuucggcccucaauccagcggaccuuccuucccgcggccugcugccggcucugcggccucuuccgcgucuucgccuucgcccucagacgagucggaucucccuuugggccgccuccccgc

[0089] >WPRE ASO 1 (SEQ ID NO: 52) uuuguaauccagagguugauu >WPRE ASO 2 (SEQ ID NO: 53) accagucaaucuuucacaaau >WPRE ASO 3 (SEQ ID NO: 54) aggagcaacauaguuaagaau >WPRE ASO 4 (SEQ ID NO: 55) agcguauccacauagcguaaa >WPRE ASO 5 (SEQ ID NO: 56) augauacaaaggcauuaaagc

[0090] >WPRE ASO 6 (SEQ ID NO:57) agccauacgggaagcaauagc >WPRE ASO 7 (SEQ ID NO:58) auacaaggaggagaaaaugaa >WPRE ASO 8 (SEQ ID NO:59) aagagacagcaaccaggauuu >WPRE ASO 9 (SEQ ID NO:60) aacgggccacaacuccucaua >WPRE ASO 10 (SEQ ID NO:61) caccacgccacguugccugac

[0091] >WPRE ASO 11 (SEQ ID NO:62) ugcgucagcaaacacagugca >WPRE ASO 12 (SEQ ID NO:63) aaugccccaaccagugggggu >WPRE ASO 13 (SEQ ID NO:64) aaggagcugacaggugguggc >WPRE ASO 14 (SEQ ID NO:65) ggggaaagcgaaagucccgga >WPRE ASO 15 (SEQ ID NO:66) uuccgccguggcaauagggag

[0092] >WPRE ASO 16 (SEQ ID NO:67) ggcaaggcaggcggcgaugag >WPRE ASO 17 (SEQ ID NO:68) ccgagccccuguccagcagcg >WPRE ASO 18 (SEQ ID NO:69) ggaauugucagugcccaacag >WPRE ASO 19 (SEQ ID NO: 70) ugauuuccccgacaacaccac >WPRE ASO 20 (SEQ ID NO:71) gagcagccaaggaaaggacga

[0093] >WPRE ASO 21 (SEQ ID NO:72) aauccagguggcaacacaggc >WPRE ASO 22 (SEQ ID NO:73) gcagaaggacgucccgcgcag >WPRE ASO 23 (SEQ ID NO:74) auugagggccgaagggacgua >WPRE ASO 24 (SEQ ID NO:75) gcgggaaggaagguccgcugg >WPRE ASO 25 (SEQ ID NO:76) ccgcagagccggcagcaggcc

[0094] >WPRE ASO 26 (SEQ ID NO:77) aaggcgaagacgcggaagagg >WPRE ASO 27 (SEQ ID NO:78) gauccgacucgucugagggcg >WPRE ASO 28 (SEQ ID NO:79) cggggaggcggcccaaaggga >Bovine growth hormone polyadenylation addition element (SEQ ID NO:80) cugugccuucuaguugccagccaucuguuguuugccccucccgugccuuccuugacccuggaaggugccacucccacuguccuuuccuaauaaaaugaggaaauugcaucgcauugucugaguaggugucauucuauucuggggggugggguggggcaggacagcaagggggaggauugggaagacaauagcaggcaugcugggga

[0095] >PolyA ASO 1 (SEQ ID NO:81) gcuggcaacuagaaggcacag >PolyA ASO 2 (SEQ ID NO: 82) gggaggggcaaacaacagaug >PolyA ASO 3 (SEQ ID NO: 83) ccagggucaaggaaggcacgg >PolyA ASO 4 (SEQ ID NO: 84) ggacagugggaguggcaccuu >PolyA ASO 5 (SEQ ID NO: 85) uuuccucauuuuauuaggaaa

[0096] >PolyA ASO 6 (SEQ ID NO:86) uacucagacaaugcgaugcaa >PolyA ASO 7 (SEQ ID NO:87) cccccagaauagaaugacacc >PolyA ASO 8 (SEQ ID NO:88) ugcuguccugccccaccccac >PolyA ASO 9 (SEQ ID NO:89) ugucuucccaauccucccccu >PolyA ASO 10 (SEQ ID NO: 90) ucuccccagcaugccugcuau

[0097] >GBA ASO 1 modified (SEQ ID NO:91) mG*mG*mG*mG*mC*A*T*T*C*C*T*C*T*C*T*mG*mC*mU*mG*mG >GBA ASO 2 modified (SEQ ID NO:92) mU*mG*mC*mA*mG*T*G*T*C*A*G*C*A*G*C*mA*mG*mG*mC*mC >GBA ASO 3 modified (SEQ ID NO:93) mG*mG*mU*mG*mG*A*G*A*C*A*G*A*G*C*C*mA*mG*mG*mA*mU >GBA ASO 4 modified (SEQ ID NO:94) mG*mC*mC*mU*mU*C*C*T*C*G*C*T*G*A*A*mG*mU*mA*mG*mC >GBA ASO 5 modified (SEQ ID NO:95) mC*mG*mC*mA*mG*C*T*G*G*C*C*A*T*G*G*mG*mC*mA*mC*mU

[0098] >WPRE ASO 1 modified (SEQ ID NO:96) mC*mU*mU*mU*mC*A*C*A*A*A*T*T*T*T*G*T*mA*mA*mU*mC*mC >WPRE ASO 2 modified (SEQ ID NO:97) mG*mG*mC*mA*mU*T*A*A*A*G*C*A*G*C*G*mU*mA*mU*mC*mC >WPRE ASO 3 modified (SEQ ID NO:98) mC*mC*mC*mC*mG*A*C*A*A*C*A*C*C*A*C*G*G*mA*mA*mU*mU*mG >WPRE ASO 4 modified (SEQ ID NO: 99) mG*mG*mG*mC*mC*G*A*A*G*G*G*A*C*G*T*mA*mG*mC*mA*mG >WPRE ASO 5 modified (SEQ ID NO: 100) mG*mC*mG*mG*mG*G*A*G*G*C*G*G*C*C*C*A*mA*mA*mG*mG*mG

[0099] >PolyA ASO 1 modified (SEQ ID NO: 101) mG*mG*mC*mU*mG*G*C*A*A*C*T*A*G*A*A*mG*mG*mC*mA*mC >PolyA ASO 2 modified (SEQ ID NO: 102) mG*mG*mU*mC*mA*A*G*G*A*A*G*G*C*A*C*mG*mG*mG*mG*mG >PolyA ASO 3 modified (SEQ ID NO: 103) mC*mC*mC*mC*mC*C*A*G*A*A*T*A*G*A*A*T*G*mA*mC*mA*mC*mC >PolyA ASO 5 modified (SEQ ID NO: 104) mG*mG*mA*mC*mA*mG*mU*mG*mG*mG*mA*mG*mU*mG*mG*mC*mA*mC*mC

[0100] >GFP ASO 1 modified (SEQ ID NO: 105) mU*mG*mU*mG*mG*C*C*G*T*T*T*A*C*G*T*mC*mG*mC*mC*mG >GBA ASO 1 unmodified (SEQ ID NO: 106) Ggggcauuccucucugcugg >GBA ASO 2 unmodified (SEQ ID NO: 107) ugcagugucagcagcaggcc >GBA ASO 3 unmodified (SEQ ID NO: 108) gguggagacagagccaggau >GBA ASO 4 unmodified (SEQ ID NO: 109) gccuuccucgcugaaguagc

[0101] >GBA ASO 5 unmodified (SEQ ID NO: 110) cgcagcuggccaugggcacu >WPRE ASO 1 unmodified (SEQ ID NO: 111) Cuuucacaaauuuuguaaucc >WPRE ASO 2 unmodified (SEQ ID NO: 112) Ggcauuaaagcagcguaucc >WPRE ASO 3 unmodified (SEQ ID NO: 113) Ccccgacaacaccacggaauug >WPRE ASO 4 unmodified (SEQ ID NO: 114) Gggccgaagggacguagcag

[0102] >WPRE ASO 5 unmodified (SEQ ID NO: 115) Gcggggaggcggcccaaaggg >PolyA ASO 1 unmodified (SEQ ID NO: 116) ggcuggcaacuagaaggcac >PolyA ASO 2 unmodified (SEQ ID NO: 117) ggucaaggaaggcacggggg >PolyA ASO 3 unmodified (SEQ ID NO: 118) ccccccagaauagaaugacacc >PolyA ASO 4 unmodified (SEQ ID NO: 119) ccauagagcccaccgcaucccc >PolyA ASO 5 unmodified (SEQ ID NO: 120) ggacagugggaguggcacc

Claims

1. A pharmaceutical composition for use in a method for modulating expression of a transgene in an isolated cell, the method comprising contacting an isolated cell containing a recombinant adeno-associated virus (rAAV) vector comprising a transgene flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs), with one or more antisense oligonucleotides (ASOs) that specifically bind to at least one of the AAV ITRs, wherein binding of the one or more ASOs to at least one of the AAV ITRs results in altered expression of the transgene compared to an isolated cell not containing the one or more ASOs.

2. The pharmaceutical composition of claim 1, wherein each of the one or more ASOs ranges in length from about 10 nucleotides to about 30 nucleotides.

3. The pharmaceutical composition of claim 1 or 2, wherein each ASO contains one or more chemical modifications.

4. The pharmaceutical composition of claim 3 , wherein each of the one or more chemical modifications is selected from a nucleobase modification or a backbone modification.

5. The pharmaceutical composition of claim 4, wherein all nucleobases and / or the entire backbone of each ASO are modified.

6. The pharmaceutical composition of claim 4 or 5, wherein the nucleobase modification comprises a 2'-O-methyl (2'OMe) modification.

7. 6. The pharmaceutical composition of claim 4 or 5, wherein the backbone modification comprises a phosphorothioate bond.

8. A pharmaceutical composition described in claim 4 or 5, wherein at least one of the one or more ASOs contains one or more locked nucleic acids (LNAs).

9. A pharmaceutical composition described in any one of claims 1 to 8, wherein at least one AAV ITR is an AAV2 ITR.

10. The pharmaceutical composition of claim 9, wherein the AAV2 ITR comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO:1, or its complement.

11. The pharmaceutical composition of claim 10, wherein the AAV2 ITR consists of the nucleic acid sequence set forth in SEQ ID NO: 1 or its complement.

12. The pharmaceutical composition of any one of claims 1 to 11, wherein the ASO binds to at least three consecutive nucleotides of at least one AAV ITR.

13. A pharmaceutical composition described in any one of claims 1 to 12, wherein at least one ASO comprises a nucleic acid sequence that is at least 90% identical to a sequence set forth in any one of SEQ ID NOs: 2 to 8, or a complement thereof.

14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the altered expression is an increase in expression of the introduced gene.

15. The pharmaceutical composition according to any one of claims 1 to 13, wherein the altered expression is a decrease in expression of the transgene.

16. The pharmaceutical composition according to any one of claims 1 to 15, wherein the cell is a mammalian cell.

17. A pharmaceutical composition described in any one of claims 1 to 16, wherein the cell is a human cell.

18. The pharmaceutical composition of any one of claims 1 to 17, wherein the cell is in a subject.

19. The pharmaceutical composition according to any one of claims 1 to 18, wherein the transgene is a therapeutic protein.

20. 20. The pharmaceutical composition of claim 19, wherein the therapeutic protein is β-glucocerebrosidase (GBA).

21. 21. The pharmaceutical composition of claim 20, wherein GBA is encoded by a codon-optimized nucleic acid sequence.

22. 22. The pharmaceutical composition of claim 20 or 21, wherein the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement.

23. The pharmaceutical composition of any one of claims 1 to 22, wherein the rAAV vector comprises a nucleic acid sequence as set forth in SEQ ID NOs: 1, 9, 25, 40, 51, and 80.

24. An isolated nucleic acid comprising a sequence set forth in any one of SEQ ID NOs: 2-8, 10-24, 26-39, 41-50, 52-79, 81-120, or a complement thereof.

25. 25. The isolated nucleic acid of claim 24, wherein the isolated nucleic acid comprises one or more chemical modifications.

26. 26. The isolated nucleic acid of claim 24 or 25, wherein the one or more chemical modifications comprise a 2'-O-methyl (2'OMe) modification, a phosphorothioate linkage, a locked nucleic acid (LNA), or any combination of the foregoing.

27. The isolated nucleic acid according to any one of claims 24 to 26, wherein the isolated nucleic acid is an antisense oligonucleotide (ASO).

28. 28. The isolated nucleic acid of claim 27, wherein all nucleobases and / or the entire backbone of the ASO are modified.

29. The isolated nucleic acid according to any one of claims 24 to 28, wherein the isolated nucleic acid has a gapmer structure.

Images