Treating HSV-1 with meganucleases

Abstract

Embodiments of the present disclosure are directed to methods and compositions for reducing or eliminating latent HSV-1 reactivation in cells. In some embodiments, the methods include delivering one or more self-complementary adeno-associated viruses (scAAV) that include one or more sequences encoding one or more HSV-1 specific meganucleases to an HSV-1 infected cell. In some embodiments, the compositions include one or more self-complementary adeno-associated viruses (scAAV) that include one or more sequences encoding one or more HSV-1 specific meganucleases.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 141,344, filed January 25, 2021, and U.S. Provisional Patent Application No. 63 / 176,813, filed April 19, 2021, the disclosures of which are incorporated herein in their entireties.

[0002] Description of sequence listing The sequence listing associated with this application is provided in text format in lieu of hard copy and is incorporated herein by reference. The name of the text file containing the sequence listing is 1896-P58WO_Seq_List_FINAL_20220119_ST25.txt. This text file is 20 KB, was created on January 19, 2022, and will be submitted via EFS-Web with the filing of this specification.

[0003] GOVERNMENT LICENSE RIGHTS STATEMENT This invention was made with Government support under grants AI132599 and GM105691 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0004] Herpes simplex virus type 1 (HSV-1) is a widespread and important human pathogen that causes oral and genital ulcers, neonatal herpes, and increases the risk of HIV infection. After primary infection on the skin or mucosa, HSV-1 establishes lifelong latency in both sensory (e.g., trigeminal and dorsal root ganglia) and autonomic (e.g., superior cervical and large pelvic ganglia) neurons of the peripheral nervous system. HSV-1 can subsequently reactivate from latency, causing lesions and / or viral shedding at mucosal surfaces. Current antiviral therapies reduce the severity of acute infections and decrease the frequency of viral reactivation, but do not reduce or eliminate latent virus that causes recurrent disease. Gene editing using CRISPR / Cas9, meganucleases, or similar enzymes offers the possibility of directly targeting the latent genome for destruction or elimination while sparing neurons, thus eliminating the possibility of viral reactivation and pathogenicity.

[0005] In vivo gene editing of latent HSV genomes in mouse TG sensory neurons has been previously demonstrated using HSV-specific meganucleases delivered via adeno-associated virus (AAV) vectors, but the level of gene editing was modest (<4%). Given the limitations of the art, there remains a need for antiviral therapies that reduce or eliminate latent virus causing recurrent disease. The present disclosure addresses these and related needs. Summary of the Invention

[0006] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features of the patented subject matter, nor is it intended to be used as an aid in determining the scope of the patented subject matter.

[0007] Disclosed herein are embodiments of methods and compositions for reducing or eliminating latent herpes simplex virus type 1 (HSV-1) reactivation in cells.

[0008] In one aspect, a method for reducing or eliminating latent HSV-1 reactivation in a cell can include delivering to an HSV-1 infected cell one or more viral vectors that include one or more sequences encoding one or more HSV-1 specific meganucleases.

[0009] In another embodiment, a composition for reducing or eliminating latent HSV-1 reactivation in a cell can comprise one or more viral vectors that include one or more sequences encoding one or more HSV-1 specific meganucleases.

[0010] In some embodiments, one or more viral vectors are self-complementary adeno-associated viruses (scAAV) and / or single-stranded adeno-associated viruses (ssAAV). In yet other embodiments, one or more viral vectors are scAAV. In some embodiments, one or more scAAV can include AAV-Rh10, AAV8, AAV1 serotype adeno-associated viruses, or combinations thereof. In yet other embodiments, one or more scAAV is AAV-Rh10 or AAV8 serotype adeno-associated virus.

[0011] In some embodiments, the one or more HSV-1 specific meganucleases can be configured to induce one or more DNA double strand breaks (DSBs). In some embodiments, the one or more HSV-1 specific meganucleases are meganucleases that can be configured to target UL19, which encodes the major capsid protein VP5. In some embodiments, the one or more HSV-1 specific meganucleases are meganucleases that can be configured to target UL30, which encodes the catalytic subunit of HSV-1 DNA polymerase. In some embodiments, the one or more HSV-1 specific meganucleases are meganucleases that can be configured to target the overlapping gene ICP0. In some embodiments, the one or more HSV-1 specific meganucleases are meganucleases that can be configured to target UL54, which encodes the immediate early regulatory protein ICP27. In some embodiments, the one or more HSV-1 specific meganucleases are meganucleases that can be configured to target any combination of UL19, UL30, ICP0, and / or UL54. In some embodiments, the one or more meganucleases can comprise a sequence set forth in SEQ ID NOs: 1-3. In some embodiments, the one or more meganucleases are meganucleases that can be configured to target one or more of the sequences set forth in SEQ ID NOs: 4-6.

[0012] In some embodiments, the method can include delivering one scAAV that includes two or more sequences encoding one or more HSV-1 specific meganucleases. In some embodiments, the method can include delivering two scAAVs, each including one or more sequences encoding one or more HSV-1 specific meganucleases. In yet other embodiments, the method can include delivering two different scAAVs, each including a sequence encoding an HSV-1 specific meganuclease, the sequences being the same or different. In yet other embodiments, one or more scAAVs can be delivered to a subject by subcutaneous injection.

[0013] In some embodiments, the cell may be in a mammalian subject. In some embodiments, the mammalian subject may be a human. In yet other embodiments, the cell may be a superior cervical ganglion (SCG) cell. In yet other embodiments, the cell may be a trigeminal ganglion (TG) cell. In yet other embodiments, the cell may be a combination of SCG cells and / or TG cells.

[0014] In some embodiments, the method further comprises administering a bromodomain and extraterminal (BET) protein inhibitor to the HSV-1 infected cell. In some embodiments, the method comprises administering a BET protein inhibitor to the HSV-1 infected cell prior to delivery of one or more scAAVs comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell. In some embodiments, the method comprises administering a BET protein inhibitor to the HSV-1 infected cell after delivery of one or more scAAVs comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell. In yet other embodiments, the method comprises administering a BET protein inhibitor to the HSV-1 infected cell in conjunction with delivery of one or more scAAVs comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell.

[0015] In some embodiments, the BET protein inhibitor can be administered at a dose sufficient to provide a concentration of 3 μM or less in HSV-1 infected cells. In some embodiments, the BET protein inhibitor can be selected from the group of JQ1, bilabresib, molybresib, apabetalone, ZEN-3694, BMS-986158, and INC-B057643.

[0016] In some embodiments, the method can reduce HSV-1 load in SCG cells by at least 97% at least 96 hours after administration of the BET protein inhibitor. In some embodiments, the method can reduce HSV-1 load in SCG cells by at least 83% at least 48 hours after administration of the BET protein inhibitor. In yet other embodiments, the method can reduce HSV-1 load in TG cells by at least 97% at 96 hours after administration of the BET protein inhibitor.

[0017] In some embodiments, the composition can include one or more pharma- ceutically acceptable carriers configured for subcutaneous injection. In some embodiments, the composition can further include a bromodomain and extraterminal (BET) protein inhibitor. In some embodiments, the composition can reduce HSV-1 load in SCG cells by at least 97% 96 hours after administration of the BET protein inhibitor. In some embodiments, the composition can reduce HSV-1 load in SCG cells by at least 83% 48 hours after administration of the BET protein inhibitor. In yet other embodiments, the composition can reduce HSV-1 load in TG cells by at least 97% 96 hours after administration of the BET protein inhibitor. [Brief description of the drawings]

[0018] The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, in which:

[0019] [Figure 1A] Figures 1A-1D. Reduction of HSV load in dual meganuclease treated mice. Figure 1A. Mice latently infected with 105 PFU HSV17+ for 44 days were left untreated (control, circles n=8) or administered by whisker pad injection either 5x1011 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5x1011 vg scAAV8-CBh-m8 (triangles, n=8) or 5x1011 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9). Analysis was performed 31 days later. Figure 1B. ddPCR quantification of HSV genome in superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice (p=0.018 in control vs. m5+m8 SCG, p=0.001 in control vs. m5+m8 TG). Figure 1C-1D. NGS analysis of m5 and m8 sites in HSV genome from SCG and right (ipsilateral) TG from infected mice treated with either m5 (squares, n=9), m8 (triangles, n=8), or m5+m8 (diamonds, n=9). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. [Figure 1B]Figures 1A-1D. Reduction of HSV load in dual meganuclease treated mice. Figure 1A. Mice latently infected with 105 PFU HSV17+ for 44 days were left untreated (control, circles n=8) or administered by whisker pad injection either 5x1011 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5x1011 vg scAAV8-CBh-m8 (triangles, n=8) or 5x1011 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9). Analysis was performed 31 days later. Figure 1B. ddPCR quantification of HSV genome in superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice (p=0.018 in control vs. m5+m8 SCG, p=0.001 in control vs. m5+m8 TG). Figure 1C-1D. NGS analysis of m5 and m8 sites in HSV genome from SCG and right (ipsilateral) TG from infected mice treated with either m5 (squares, n=9), m8 (triangles, n=8), or m5+m8 (diamonds, n=9). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. [Figure 1C]Figures 1A-1D. Reduction of HSV load in dual meganuclease treated mice. Figure 1A. Mice latently infected with 105 PFU HSV17+ for 44 days were left untreated (control, circles n=8) or administered by whisker pad injection either 5x1011 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5x1011 vg scAAV8-CBh-m8 (triangles, n=8) or 5x1011 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9). Analysis was performed 31 days later. Figure 1B. ddPCR quantification of HSV genome in superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice (p=0.018 in control vs. m5+m8 SCG, p=0.001 in control vs. m5+m8 TG). Figure 1C-1D. NGS analysis of m5 and m8 sites in HSV genome from SCG and right (ipsilateral) TG from infected mice treated with either m5 (squares, n=9), m8 (triangles, n=8), or m5+m8 (diamonds, n=9). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. [Figure 1D]Figures 1A-1D. Reduction of HSV load in dual meganuclease treated mice. Figure 1A. Mice latently infected with 105 PFU HSV17+ for 44 days were left untreated (control, circles n=8) or administered by whisker pad injection either 5x1011 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5x1011 vg scAAV8-CBh-m8 (triangles, n=8) or 5x1011 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9). Analysis was performed 31 days later. Figure 1B. ddPCR quantification of HSV genome in superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice (p=0.018 in control vs. m5+m8 SCG, p=0.001 in control vs. m5+m8 TG). Figure 1C-1D. NGS analysis of m5 and m8 sites in HSV genome from SCG and right (ipsilateral) TG from infected mice treated with either m5 (squares, n=9), m8 (triangles, n=8), or m5+m8 (diamonds, n=9). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. [Figure 2A]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 2B]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 2C]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 2D]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 2E]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 2F]Figure 2A-2F. Efficient gene editing after optimized delivery of dual meganuclease therapy. Figure 2A. Mice latently infected with 105 PFU HSV17+ for 30 days were administered 0.5-1x1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection. Analysis was performed 41 days later. Figure 2B. ddPCR quantification of HSV genomes in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) of control (CTRL, circles n=3) or m5 (squares n=6) treated mice. p=0.017 for SCG. Figure 2C. Next generation sequencing (NGS) analysis in SCG and TG from m5 treated mice (n=6) to detect HSV gene editing at m5 target sites in SCG (circles) or TG (squares). Figure 2D. Mice latently infected with 105 PFU HSV17+ in the right eye for 28 days were administered 5x1011 vector genomes (vg) scAAV-Rh10-CBh-m5 + 5x1011 vg scAAV-Rh10-CBh-m8 by RO injection. SCG and ipsilateral TG were harvested 33-35 days later. Figure 2E. ddPCR quantification of HSV genomes in TG and SCG from latently infected mice that were either left untreated (control, CTRL, circles, n=12) or administered m5 + m8 (squares, n=12). p=0.006 and p=0.01 for SCG and TG, respectively. Figure 2F. NGS analysis of SCG and TG from treated mice to detect mutations at either the m5 (filled circles) or m8 (open circles) target sites. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data are provided as source data files. [Figure 3A]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 3B]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 3C]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 3D]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 3E]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 3F]Figures 3A-3F. Reduction of ganglionic HSV genomes after dual meganuclease therapy. Figure 3A. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=12) or administered 1x1012 vector genome (vg) scAAV-Rh10-CBh-m4 (m4, n=12) by retro-orbital (RO) injection. These mice were infected and treated simultaneously with the mice described in Figures 2D-F (control mice are the same for these two data sets). 33-35 days after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Figure 3B, HSV genomes quantified by ddPCR. p=0.03 and p=0.02 for SCG and TG, respectively. Figure 2C. Next generation sequencing (NGS) analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at the m4 target site in SCG or TG. Figure 3D. Mice latently infected with 105 PFU HSV17+ for 28 days were left untreated (control, CTRL, n=10) or administered 5x1011vg scAAV-Rh10-CBh-m5+5x1011vg scAAV-Rh10-CBh-m4 (m5+m4, n=10) by RO injection. At 40-41 days after meganuclease therapy, SCG and right (ipsilateral) TG were harvested from infected mice either untreated (filled circles) or treated with m5+m4 (open circles), Figure 3E, HSV genomes quantified by ddPCR, p=0.00001 for SCG. Figure 3F. NGS analysis of SCG and TG from dual meganuclease treated mice to detect HSV gene editing at m5 (open circle) and m4 (closed circle) target sites in SCG or TG. ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons. Source data is provided as source data file. [Figure 4A]Figures 4A-4E. Reactivation after dual meganuclease therapy. Figure 1A. Concurrently with those described in Figures 2D-F, ganglia from a second set of mice latently infected and treated with dual meganuclease therapy were subjected to ganglion (SCG / TG) explant reactivation prior to DNA extraction (see Methods). Figure 4B. ddPCR quantification of HSV genomes in reactivated superior cervical ganglia (SCG) and trigeminal ganglia (TG) from latently infected untreated control mice (CTRL, open circles, n=12) or dual meganuclease-treated mice (open squares, n=12). p=0.002 and p=0.01 for SCG and TG, respectively. Figure 4C. Next-generation sequencing (NGS) analysis in reactivated SCG and TG from dual meganuclease-treated mice to detect HSV gene editing at either m5 (m5, closed circles) or m8 (m8, open circles) target sites. Figures 4D-4E. Comparison of HSV loads in SCG and TG from latently infected (closed circles) and reactivated (open circles) control mice (CTRL), p=0.02 for SCG from latently infected (closed squares) or reactivated (open squares) dual meganuclease treated mice (m5+m8), p=0.0012 and p=0.012 for Figure 4D SCG and Figure 4E TG, respectively. *p<0.05, **p<0.01, ns: not significantly different. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons (4C) and one-tailed, unpaired t-tests (4D, 4E). Source data are provided as source data files. [Figure 4B]Figures 4A-4E. Reactivation after dual meganuclease therapy. Figure 1A. Concurrently with those described in Figures 2D-F, ganglia from a second set of mice latently infected and treated with dual meganuclease therapy were subjected to ganglion (SCG / TG) explant reactivation prior to DNA extraction (see Methods). Figure 4B. ddPCR quantification of HSV genomes in reactivated superior cervical ganglia (SCG) and trigeminal ganglia (TG) from latently infected untreated control mice (CTRL, open circles, n=12) or dual meganuclease-treated mice (open squares, n=12). p=0.002 and p=0.01 for SCG and TG, respectively. Figure 4C. Next-generation sequencing (NGS) analysis in reactivated SCG and TG from dual meganuclease-treated mice to detect HSV gene editing at either m5 (m5, closed circles) or m8 (m8, open circles) target sites. Figures 4D-4E. Comparison of HSV loads in SCG and TG from latently infected (closed circles) and reactivated (open circles) control mice (CTRL), p=0.02 for SCG from latently infected (closed squares) or reactivated (open squares) dual meganuclease treated mice (m5+m8), p=0.0012 and p=0.012 for Figure 4D SCG and Figure 4E TG, respectively. *p<0.05, **p<0.01, ns: not significantly different. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons (4C) and one-tailed, unpaired t-tests (4D, 4E). Source data are provided as source data files. [Figure 4C]Figures 4A-4E. Reactivation after dual meganuclease therapy. Figure 1A. Concurrently with those described in Figures 2D-F, ganglia from a second set of mice latently infected and treated with dual meganuclease therapy were subjected to ganglion (SCG / TG) explant reactivation prior to DNA extraction (see Methods). Figure 4B. ddPCR quantification of HSV genomes in reactivated superior cervical ganglia (SCG) and trigeminal ganglia (TG) from latently infected untreated control mice (CTRL, open circles, n=12) or dual meganuclease-treated mice (open squares, n=12). p=0.002 and p=0.01 for SCG and TG, respectively. Figure 4C. Next-generation sequencing (NGS) analysis in reactivated SCG and TG from dual meganuclease-treated mice to detect HSV gene editing at either m5 (m5, closed circles) or m8 (m8, open circles) target sites. Figures 4D-4E. Comparison of HSV loads in SCG and TG from latently infected (closed circles) and reactivated (open circles) control mice (CTRL), p=0.02 for SCG from latently infected (closed squares) or reactivated (open squares) dual meganuclease treated mice (m5+m8), p=0.0012 and p=0.012 for Figure 4D SCG and Figure 4E TG, respectively. *p<0.05, **p<0.01, ns: not significantly different. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons (4C) and one-tailed, unpaired t-tests (4D, 4E). Source data are provided as source data files. [Figure 4D]Figures 4A-4E. Reactivation after dual meganuclease therapy. Figure 1A. Concurrently with those described in Figures 2D-F, ganglia from a second set of mice latently infected and treated with dual meganuclease therapy were subjected to ganglion (SCG / TG) explant reactivation prior to DNA extraction (see Methods). Figure 4B. ddPCR quantification of HSV genomes in reactivated superior cervical ganglia (SCG) and trigeminal ganglia (TG) from latently infected untreated control mice (CTRL, open circles, n=12) or dual meganuclease-treated mice (open squares, n=12). p=0.002 and p=0.01 for SCG and TG, respectively. Figure 4C. Next-generation sequencing (NGS) analysis in reactivated SCG and TG from dual meganuclease-treated mice to detect HSV gene editing at either m5 (m5, closed circles) or m8 (m8, open circles) target sites. Figures 4D-4E. Comparison of HSV loads in SCG and TG from latently infected (closed circles) and reactivated (open circles) control mice (CTRL), p=0.02 for SCG from latently infected (closed squares) or reactivated (open squares) dual meganuclease treated mice (m5+m8), p=0.0012 and p=0.012 for Figure 4D SCG and Figure 4E TG, respectively. *p<0.05, **p<0.01, ns: not significantly different. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons (4C) and one-tailed, unpaired t-tests (4D, 4E). Source data are provided as source data files. [Figure 4E]Figures 4A-4E. Reactivation after dual meganuclease therapy. Figure 1A. Concurrently with those described in Figures 2D-F, ganglia from a second set of mice latently infected and treated with dual meganuclease therapy were subjected to ganglion (SCG / TG) explant reactivation prior to DNA extraction (see Methods). Figure 4B. ddPCR quantification of HSV genomes in reactivated superior cervical ganglia (SCG) and trigeminal ganglia (TG) from latently infected untreated control mice (CTRL, open circles, n=12) or dual meganuclease-treated mice (open squares, n=12). p=0.002 and p=0.01 for SCG and TG, respectively. Figure 4C. Next-generation sequencing (NGS) analysis in reactivated SCG and TG from dual meganuclease-treated mice to detect HSV gene editing at either m5 (m5, closed circles) or m8 (m8, open circles) target sites. Figures 4D-4E. Comparison of HSV loads in SCG and TG from latently infected (closed circles) and reactivated (open circles) control mice (CTRL), p=0.02 for SCG from latently infected (closed squares) or reactivated (open squares) dual meganuclease treated mice (m5+m8), p=0.0012 and p=0.012 for Figure 4D SCG and Figure 4E TG, respectively. *p<0.05, **p<0.01, ns: not significantly different. All data are presented as mean + / - SD. Statistical analysis was performed using unpaired multiple t-tests without correction for multiple comparisons (4C) and one-tailed, unpaired t-tests (4D, 4E). Source data are provided as source data files. [Figure 5A]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 5B]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 5C]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 5D]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 5E]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 5F]Figure 5A-5F. SaCas9 gene editing of HSV in infected neuronal cultures. Figure 5A. Schematic of neuronal culture generation and exposure to AAV / CRISPR-Cas9 treatment. Mice were infected with 2 × 105 PFU of HSV-1(F) and the right trigeminal ganglion (TG) was harvested 7 days later. Neuronal cultures were established and cells were cultured for 5 days in medium supplemented with 100 μM ACV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cells were then transduced with either ssAAV1-sCMV-SaCas9-sgRNAUL54 or ssAAV1-sCMV-SaCas9-sgRNAUL30 at an MOI of 106 AAV vector genomes (vg) per neuron for the times indicated. Analysis was performed 10 days after AAV exposure. Mutagenic event detection by T7E1 assay in DNA from cultured TG neurons treated with either Figure 5B, 106vg ssAAV1-sCMV-SaCas9-sgRNAUL54 or Figure 5C, ssAAV1-sCMV-SaCas9-sgRNAUL30. HSV regions containing the target site for each sgRNA were PCR amplified from total genomic DNA obtained from the right ipsilateral TG. Products were subjected to T7E1 digestion and resolved on a 3% agarose gel. Gel legend: mw: molecular weight size ladder, V: no sgRNA, 13: sgRNAUL54-13, 17: sgRNAUL54-17, 26: sgRNAUL54-26, 1: sgRNAUL30-1, 2: sgRNAUL30-2, 3: sgRNAUL30-3, 6: sgRNAUL30-6, 9: sgRNAUL30-9, 10: sgRNAUL30-10. Schematic diagrams of PCR amplicons with full size and T7E1 cleavage product sizes showing HSV-specific Cas9 cleavage and mutagenesis are provided below each gel. The location of the sgRNA site in the PCR product is indicated by a black (efficient) or grey (inefficient) arrow, and the resulting T7 digestion product is shown for an efficient sgRNA.Figure 5D. Mice were latently infected with 2x105 PFU HSV-1(F) and 28 days later injected with 1012vg ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure. Figure 5E. Genome levels were quantified by ddPCR in the right (ipsilateral) TG from infected mice. Figure 5F. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis (see Figures 11A-11C). sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Gel images were cropped. All data are presented as mean + / - SD. bp: base pairs. Source data are provided as source data files. [Figure 6A]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6B]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6C]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6D]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6E]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6F]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6G]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6H]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6I]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6J]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 6K]Figure 6A-6K. Dual sgRNA therapy did not increase SaCas9 gene editing efficiency of latent HSV. Figure 6A. Mice were latently infected with 105 PFU HSV-1(F) and 28 days later were either left untreated (CTRL, n=10 circles) or administered, via retro-orbital (RO) injection, either a dual sgRNA therapy consisting of 1012 vector genomes (vg) ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 1012vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9, n=10 squares) or a meganuclease therapy of 1012vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2, n=10 triangles). At day 29 post-AAV exposure, Figures 6B-6C, levels of HSV genome were quantified by ddPCR in the superior cervical ganglion (SCG) and right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 6D-6E. NGS analysis was performed to detect mutations at sites targeted by either sgRNAUL54-26, sgRNAUL30-10, or m5 in latent HSV from the SCG and TG of treated mice. Figures 6F-6G. Detection of Cas9 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. Figures 6H-6I. Detection of sgRNA by RT-ddPCR in the SCG (6H) and TG (6I) of infected mice. Figures 6J-6K. Detection of m5 mRNA by RT-qPCR in the SCG (6J) and TG (6K) of infected mice. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 7A]Figure 7A-7D. Single-cell RNA-seq analysis of purified neurons. Figure 7A. tSNE plots of neurons divided into transcriptionally defined clusters. Clusters of neurons purified from the superior cervical ganglion (SCG) (n=2,041, average reads per cell 94,797, average genes 5,635) shown as grey / dark grey dots in the top grouping (SCG-1-5) and neurons purified from the trigeminal ganglion (TG) (n=2,319, average reads per cell 99,817, average genes 5,908) shown as grey / dark grey dots in the bottom grouping (TG-1-10). Lymphocytes are shown as grey dots at the bottom of the figure. Figure 7B-7C. Fractional distribution across SCGs and TGs of each neuronal cluster within all neurons or neurons expressing HSV RNA or transgenes carried by the indicated AAV serotypes. FIG. 7D. Calculated percentage of HSV+ cells in SCG and TG that also express a given transgene mScarlet (AAV1+), mEGFP (AAV8+), DsRed.Express2 (PHP.S+), TagBFP2 (Rh10+). [Figure 7B]Figure 7A-7D. Single-cell RNA-seq analysis of purified neurons. Figure 7A. tSNE plots of neurons divided into transcriptionally defined clusters. Clusters of neurons purified from the superior cervical ganglion (SCG) (n=2,041, average reads per cell 94,797, average genes 5,635) shown as grey / dark grey dots in the top grouping (SCG-1-5) and neurons purified from the trigeminal ganglion (TG) (n=2,319, average reads per cell 99,817, average genes 5,908) shown as grey / dark grey dots in the bottom grouping (TG-1-10). Lymphocytes are shown as grey dots at the bottom of the figure. Figure 7B-7C. Fractional distribution across SCGs and TGs of each neuronal cluster within all neurons or neurons expressing HSV RNA or transgenes carried by the indicated AAV serotypes. FIG. 7D. Calculated percentage of HSV+ cells in SCG and TG that also express a given transgene mScarlet (AAV1+), mEGFP (AAV8+), DsRed.Express2 (PHP.S+), TagBFP2 (Rh10+). [Figure 7C]Figure 7A-7D. Single-cell RNA-seq analysis of purified neurons. Figure 7A. tSNE plots of neurons divided into transcriptionally defined clusters. Clusters of neurons purified from the superior cervical ganglion (SCG) (n=2,041, average reads per cell 94,797, average genes 5,635) shown as grey / dark grey dots in the top grouping (SCG-1-5) and neurons purified from the trigeminal ganglion (TG) (n=2,319, average reads per cell 99,817, average genes 5,908) shown as grey / dark grey dots in the bottom grouping (TG-1-10). Lymphocytes are shown as grey dots at the bottom of the figure. Figure 7B-7C. Fractional distribution across SCGs and TGs of each neuronal cluster within all neurons or neurons expressing HSV RNA or transgenes carried by the indicated AAV serotypes. FIG. 7D. Calculated percentage of HSV+ cells in SCG and TG that also express a given transgene mScarlet (AAV1+), mEGFP (AAV8+), DsRed.Express2 (PHP.S+), TagBFP2 (Rh10+). [Figure 7D]Figure 7A-7D. Single-cell RNA-seq analysis of purified neurons. Figure 7A. tSNE plots of neurons divided into transcriptionally defined clusters. Clusters of neurons purified from the superior cervical ganglion (SCG) (n=2,041, average reads per cell 94,797, average genes 5,635) shown as grey / dark grey dots in the top grouping (SCG-1-5) and neurons purified from the trigeminal ganglion (TG) (n=2,319, average reads per cell 99,817, average genes 5,908) shown as grey / dark grey dots in the bottom grouping (TG-1-10). Lymphocytes are shown as grey dots at the bottom of the figure. Figure 7B-7C. Fractional distribution across SCGs and TGs of each neuronal cluster within all neurons or neurons expressing HSV RNA or transgenes carried by the indicated AAV serotypes. FIG. 7D. Calculated percentage of HSV+ cells in SCG and TG that also express a given transgene mScarlet (AAV1+), mEGFP (AAV8+), DsRed.Express2 (PHP.S+), TagBFP2 (Rh10+). [Figure 8A]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8B]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8C]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8D]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8E]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8F]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8G]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8H]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 8I]Figures 8A-8I. AAV serotype combinations for delivery of dual meganuclease therapy. Figure 8A. Mice latently infected with 105 PFU HSV17+ for 57 days were left untreated (control, CTRL, n=10) or administered a total of 2x1012 vector genomes (vg) of scAAV-CBH-meganuclease combinations by retro-orbital (RO) injection to deliver meganuclease dual therapy (m5+m8, n=10 / AAV combination). Mice were administered either single (Rh10, 1, or 8), dual (1-8, 1-Rh10, or 8-Rh10), or triple (1-8-Rh10) AAV serotype combinations (Table 6). On days 33-36 after meganuclease therapy, superior cervical ganglia (SCG) and right (ipsilateral) trigeminal ganglia (TG) were harvested and Fig. 8B-8C, AAV genomes and Fig. 8D-8E HSV genomes from SCG (BD) and TG (CE) from infected mice were quantified by ddPCR. Percentage of HSV genome reduction in ganglia from dual meganuclease treated mice is shown for each AAV combination (DE) compared to untreated control (CTRL) mice. n / a: not applicable. Fig. 8F-8I. Gene editing at m5 target site (FG) and m8 target site (HI) was quantified by T7E1 assay in SCG (FH) or TG (GI). ns: not significantly different from control, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Statistical analysis was performed using one-tailed unpaired t-tests. Exact p-values ​​are shown in Table 6. Source data are provided as source data files. [Figure 9A]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9B]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9C]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9D]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9E]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9F]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9G]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 9H]Figure 9A-9H. Screening of AAV serotypes and administration routes for nuclease delivery to ganglionic neurons. Figure 9A. Mice were infected with 1-2 x 105 PFU HSV17+ in the right eye after corneal scar formation and administered 5 x 1011 vector genomes (vg) scAAVCBh-HSV1m5 packaged with AAV serotypes 8, PHP.S, or Rh10 by either tail vein (TV, circles, n=3), retroorbital (RO, squares, n=3), or whisker pad (WP, triangles, n=3) injection 30-46 days after HSV latency establishment. Analysis was performed 38-41 days later. Figure 9B. AAV from the right ipsilateral superior cervical ganglion (SCG) (upper panel) or trigeminal ganglion (TG) (lower panel), and Figure 9C HSV genomes were quantified by ddPCR. Figure 9D. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG (upper panel) or TG (lower panel) were quantified by NGS analysis. Figure 9E. Mice infected with 105 PFU HSV17+ in the right eye were administered 5x1011vg scAAV1-CBh-HSV1m5 by either TV (circles, n=3), RO (squares, n=3), or WP (triangles, n=3) injection 30 days after corneal scar formation. At 41 days after AAV administration, ipsilateral SCG and TG were harvested for analysis. Figure 9F AAV from SCG and TG, and Figure 9G HSV genome were quantified by ddPCR. Figure 9H. Mutagenic events at the HSV1m5 target site of the HSV genome in SCG and TG were quantified by NGS analysis. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 10A]Figures 10A-10B. HSV load after tissue explant reactivation. Figure 10A. Mice were infected with 2x105 PFU HSV17+ in the right eye after corneal scar formation, and 36 days later the right ipsilateral trigeminal ganglion (TG) was harvested and total DNA was extracted either immediately or after undergoing TG explant reactivation by placing in culture medium for 22 hours. Figure 10B. ddPCR quantification of HSV genomes from latently infected TG (open circles, n=11) or reactivated TG (closed circles, n=11). One-tailed, unpaired t-test shows a significant 3-fold increase in viral load from reactivated TG compared to latent TG, p=0.0002. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 10B] Figures 10A-10B. HSV load after tissue explant reactivation. Figure 10A. Mice were infected with 2x105 PFU HSV17+ in the right eye after corneal scar formation, and 36 days later the right ipsilateral trigeminal ganglion (TG) was harvested and total DNA was extracted either immediately or after undergoing TG explant reactivation by placing in culture medium for 22 hours. Figure 10B. ddPCR quantification of HSV genomes from latently infected TG (open circles, n=11) or reactivated TG (closed circles, n=11). One-tailed, unpaired t-test shows a significant 3-fold increase in viral load from reactivated TG compared to latent TG, p=0.0002. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different from control. All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 11A]Figures 11A-11C. T7E1 analysis of CRISPR / Cas9 gene editing of latent HSV in vivo. Figure 11A. Mice latently infected with 2x105 PFU HSV-1(F) for 28 days were injected with 1012 vector genomes (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either on day 28 (n=3 mice per sgRNAUL54) or on day 56 (n=2 mice per sgRNAUL54) after AAV injection. Figures 11B-11C. Detection of mutations by T7E1 assay in HSV genome from trigeminal ganglion (TG) DNA taken either on day 2811B or on day 5611C after AAV administration of treated mice from the experiment described in Figures 5D-5F. Source data is provided as source data file. [Figure 11B] Figures 11A-11C. T7E1 analysis of CRISPR / Cas9 gene editing of latent HSV in vivo. Figure 11A. Mice latently infected with 2x105 PFU HSV-1(F) for 28 days were injected with 1012 vector genomes (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either on day 28 (n=3 mice per sgRNAUL54) or on day 56 (n=2 mice per sgRNAUL54) after AAV injection. Figures 11B-11C. Detection of mutations by T7E1 assay in HSV genome from trigeminal ganglion (TG) DNA taken either on day 2811B or on day 5611C after AAV administration of treated mice from the experiment described in Figures 5D-5F. Source data is provided as source data file. [Figure 11C]Figures 11A-11C. T7E1 analysis of CRISPR / Cas9 gene editing of latent HSV in vivo. Figure 11A. Mice latently infected with 2x105 PFU HSV-1(F) for 28 days were injected with 1012 vector genomes (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54) in the right whisker pad. Analysis was performed either on day 28 (n=3 mice per sgRNAUL54) or on day 56 (n=2 mice per sgRNAUL54) after AAV injection. Figures 11B-11C. Detection of mutations by T7E1 assay in HSV genome from trigeminal ganglion (TG) DNA taken either on day 2811B or on day 5611C after AAV administration of treated mice from the experiment described in Figures 5D-5F. Source data is provided as source data file. [Figure 12A]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12B]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12C]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12D]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12E]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12F]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12G]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12H]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 12I]Figures 12A-12I. ddPCR quantification of AAV genomes in ganglia. Figure 12A. Levels of AAV transduction in trigeminal ganglia (TG) from infected mice injected into the right whisker pad with 1012 vector genome (vg) ssAAV1-sCMV-SaCas9-sgRNAUL54 (n=5 per sgRNAUL54), sgRNAUL54-13 (circles), sgRNAUL54-17 (squares), and sgRNAUL54-26 (triangles). Analyses were performed either 28 days (n=3 mice per sgRNAUL54) or 56 days (n=2 mice per sgRNAUL54) after AAV exposure (see Figures 5D-5F). (Left) Levels of AAV transduction in the superior cervical ganglion (SCG) and ipsilateral trigeminal ganglion (TG) of latently infected mice that were either untreated (control, circles, n=8) or received either 5×10 vector genomes (vg) scAAV8-CBh-m5 (squares, n=9), 5×10 vg scAAV8-CBh-m8 (triangles, n=8), or 5×10 vg each of scAAV8-CBh-m5 and scAAV8-CBh-m8 (diamonds, n=9) via whisker pad injection. Analysis was performed 31 days later (see FIG. 1). FIG. 12C. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=3) or administered 0.5-1×1012 scAAV-Rh10-CBh-m5 by retro-orbital (RO) injection (m5, squares n=6). Analysis was performed 41 days later (see FIG. 2A-2C). FIG. 12D. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles n=12) or administered 5×1011 vg scAAV-Rh10-CBh-m5 + 5×1011 vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12). Analysis was performed 33-35 days later (see FIG. 2D-2F). FIG 12E. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles n=12) or administered 1x1012vg scAAV-Rh10-CBh-m4 by RO injection (m4, n=12). Analysis was performed 33-35 days later (see FIG 3A-3C).FIG 12F. (Left) Levels of AAV transduction in the SCG and ipsilateral TG of latently infected mice either untreated (CTRL, circles, n=10) or administered 5x10vg scAAV-Rh10-CBh-m5+5x10vg scAAV-Rh10-CBh-m4 by RO injection (m5+m4, squares, n=10). Analyses were performed 33-35 days later (see FIG 3D-3F). FIG. 12G. (Left) Levels of AAV transduction in the reactivated SCG and ipsilateral TG of latently infected mice that were either untreated (CTRL, circles, n=12) or received 5×1011vg scAAV-Rh10-CBh-m5+5×1011vg scAAV-Rh10-CBh-m8 by RO injection (m5+m8, squares, n=12) (see FIG. 4). Figures 12H-12I. Levels of AAV transduction in the SCG (12H) and ipsilateral TG (12I) of latently infected mice either left untreated (CTRL, circles n=10) or administered a dual sgRNA therapy consisting of 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL54-26 and 10vg ssAAVRh10-sCMV-SaCas9-sgRNAUL30-10 (Cas9 squares, n=10) or a meganuclease therapy of 10vg ssAAVRh10-smCBA-m5-Trex2-mCherry (m5+Trex2 triangles, n=10) by RO injection. Analysis was performed after 28 / 29 days (see Figure 6). All data are presented as mean + / - SD. Source data are provided as source data files. [Figure 13A]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13B]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13C]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13D]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13E]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13F]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13G]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13H]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13I]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 13J]13A-13J. Insufficient efficiency of HSV gene editing by SaCas9 in infected mice. FIG. 13A. Mice were latently infected with 2×105 PFU HSV-1(F) for 28 days and then injected in the right whisker pad (n=3) with 1012vg SaCas9 expressing ssAAV1 or ssAAV8 under the indicated promoters and sgRNA targeting either the UL54 (UL54-26: sgRNAUL54-26) or UL30 (UL30-1: sgRNAUL30-1 and UL30-10: sgRNAUL30-10) genes (n=3 per group). Analysis was performed 28 days after AAV exposure. FIG. 13B-13C, levels of HSV, and FIG. 13D-13E, levels of AAV genome were quantified by ddPCR in the right (ipsilateral) trigeminal ganglion (TG) from infected mice. Figures 13F-13H. Detection of mutations by T7E1 assay in HSV genome from TG DNA 28 days after injection with 13F, ssAAV1(1) or ssAAV8(8) carrying SaCas9 and sgRNAUL54-26 under the indicated promoters, 13G, ssAAV8 carrying SaCas9 under the sCMV promoter with the indicated sgRNAUL30, 13H, ssAAV1(1) carrying SaCas9 under the CBh promoter with sgRNAUL54-26. T7-: T7E1 negative control, T7+: T7E1 positive control, mw: molecular weight marker, bp: base pairs. Gel images were cropped. Figures 13I-13J. Mutagenic event detection by NGS analysis of PCR products used for T7E1 analysis. Dotted lines indicate the level of background mutations detected at the sites targeted by the respective sgRNAs in PBS-treated animals. All data are presented as mean + / - SD. The source data is provided as a source data file. [Figure 14A]Figures 14A-14E. Gene expression patterns defining cluster identity. Figure 14A. Heatmap of the top 10 most upregulated genes in each cluster. Figure 14B-14E. The top 100 most upregulated genes from each cluster in our study are shown in Figure 14B, our study, 14C, (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), 14D, (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci18, 145-153, doi:10.1038 / nn.3881(2015)), 14E, (Li, CL et al. Somatosensory neuron types identified by high-coverage Heatmap generated by comparing the top 100 most upregulated genes from either cluster of the 100 most upregulated genes from the 100 most upregulated genes from either cluster of ... [Figure 14B]Figures 14A-14E. Gene expression patterns defining cluster identity. Figure 14A. Heatmap of the top 10 most upregulated genes in each cluster. Figure 14B-14E. The top 100 most upregulated genes from each cluster in our study are shown in Figure 14B, our study, 14C, (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), 14D, (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci18, 145-153, doi:10.1038 / nn.3881(2015)), 14E, (Li, CL et al. Somatosensory neuron types identified by high-coverage Heatmap generated by comparing the top 100 most upregulated genes from either cluster of the 100 most upregulated genes from the 100 most upregulated genes from either cluster of ... [Figure 14C]Figures 14A-14E. Gene expression patterns defining cluster identity. Figure 14A. Heatmap of the top 10 most upregulated genes in each cluster. Figure 14B-14E. The top 100 most upregulated genes from each cluster in our study are shown in Figure 14B, our study, 14C, (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), 14D, (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci18, 145-153, doi:10.1038 / nn.3881(2015)), 14E, (Li, CL et al. Somatosensory neuron types identified by high-coverage Heatmap generated by comparing the top 100 most upregulated genes from either cluster of the 100 most upregulated genes from the 100 most upregulated genes from either cluster of ... [Figure 14D]Figures 14A-14E. Gene expression patterns defining cluster identity. Figure 14A. Heatmap of the top 10 most upregulated genes in each cluster. Figure 14B-14E. The top 100 most upregulated genes from each cluster in our study are shown in Figure 14B, our study, 14C, (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), 14D, (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci18, 145-153, doi:10.1038 / nn.3881(2015)), 14E, (Li, CL et al. Somatosensory neuron types identified by high-coverage Heatmap generated by comparing the top 100 most upregulated genes from either cluster of the 100 most upregulated genes from the 100 most upregulated genes from either cluster of ... [Figure 14E]Figures 14A-14E. Gene expression patterns defining cluster identity. Figure 14A. Heatmap of the top 10 most upregulated genes in each cluster. Figure 14B-14E. The top 100 most upregulated genes from each cluster in our study are shown in Figure 14B, our study, 14C, (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), 14D, (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci18, 145-153, doi:10.1038 / nn.3881(2015)), 14E, (Li, CL et al. Somatosensory neuron types identified by high-coverage Heatmap generated by comparing the top 100 most upregulated genes from either cluster of the 100 most upregulated genes from the 100 most upregulated genes from either cluster of ... [Figure 15A]Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 15B] Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 15C]Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 15D] Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 15E]Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 15F] Figures 15A-15F. Distribution of HSV and AAV positive cells across clusters. Neurons expressing HSV genes (light grey dots) (Figure 15B) or transgenes (grey dots) delivered via the indicated AAV (Figure 15C AAV1, Figure 15D AAV8, Figure 15E PHP.S, Figure 15F Rh10) were overlaid on the tSNE plot (Figure 15A). Note that the actual saturation of neuronal subsets is greater than this representation indicates, since only a quarter of the animals analyzed received each AAV serotype. All animals were administered HSV. The total percentage of transgene positive neurons from the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown at the top left and bottom right, respectively. *Note that a quarter of the mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce, at a theoretical maximum, ¼ of the neurons. All mice were infected with HSV. [Figure 16A]Figures 16A-16E. Percentage of neurons in each neuronal cluster positive for HSV or the indicated AAV transgene: 16A HSV, 16B AAV1, 16C AAV8, 16D PHP.S, 16E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (grey bars). For AAV expression, percentages were normalized to input as described in Methods. [Figure 16B] Figures 16A-16E. Percentage of neurons in each neuronal cluster positive for HSV or the indicated AAV transgene: 16A HSV, 16B AAV1, 16C AAV8, 16D PHP.S, 16E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (grey bars). For AAV expression, percentages were normalized to input as described in Methods. [Figure 16C] Figures 16A-16E. Percentage of neurons in each neuronal cluster positive for HSV or the indicated AAV transgene: 16A HSV, 16B AAV1, 16C AAV8, 16D PHP.S, 16E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (grey bars). For AAV expression, percentages were normalized to input as described in Methods. [Figure 16D] Figures 16A-16E. Percentage of neurons in each neuronal cluster positive for HSV or the indicated AAV transgene: 16A HSV, 16B AAV1, 16C AAV8, 16D PHP.S, 16E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (grey bars). For AAV expression, percentages were normalized to input as described in Methods. [Figure 16E]Figures 16A-16E. Percentage of neurons in each neuronal cluster positive for HSV or the indicated AAV transgene: 16A HSV, 16B AAV1, 16C AAV8, 16D PHP.S, 16E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (grey bars). For AAV expression, percentages were normalized to input as described in Methods. [Figure 17A] Figures 17A-17E. Percent difference in fractional distribution of HSV+ or AAV+ cells within a cluster compared to random distribution. 17A HSV, 17B AAV1, 17C AAV8, 17D PHP.S, 17E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (gray bars). Percent difference from random was calculated using the following formula: For HSV+ cells: Percent difference from random = [(number of HSV+ cells detected in cluster - number of HSV+ cells expected in cluster 1) / total number of cells in cluster] x 100. For AAV+ cells: Percent difference from random = [(number of AAV+ cells detected in cluster - number of AAV+ cells expected in cluster 1) / total number of cells in normalized cluster 2] x 100. Expected number of positive cells in cluster 1 = number of positive cells in tissue (TG or SCG) x [total number of cells in cluster / total number of cells in tissue]. Normalized total number of cells in cluster 2 = total number of cells in cluster x percentage of cells contributed by mice injected with a given AAV serotype. [Figure 17B]Figures 17A-17E. Percent difference in fractional distribution of HSV+ or AAV+ cells within a cluster compared to random distribution. 17A HSV, 17B AAV1, 17C AAV8, 17D PHP.S, 17E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (gray bars). Percent difference from random was calculated using the following formula: For HSV+ cells: Percent difference from random = [(number of HSV+ cells detected in cluster - number of HSV+ cells expected in cluster 1) / total number of cells in cluster] x 100. For AAV+ cells: Percent difference from random = [(number of AAV+ cells detected in cluster - number of AAV+ cells expected in cluster 1) / total number of cells in normalized cluster 2] x 100. Expected number of positive cells in cluster 1 = number of positive cells in tissue (TG or SCG) x [total number of cells in cluster / total number of cells in tissue]. Normalized total number of cells in cluster 2 = total number of cells in cluster x percentage of cells contributed by mice injected with a given AAV serotype. [Figure 17C]Figures 17A-17E. Percent difference in fractional distribution of HSV+ or AAV+ cells within a cluster compared to random distribution. 17A HSV, 17B AAV1, 17C AAV8, 17D PHP.S, 17E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (gray bars). Percent difference from random was calculated using the following formula: For HSV+ cells: Percent difference from random = [(number of HSV+ cells detected in cluster - number of HSV+ cells expected in cluster 1) / total number of cells in cluster] x 100. For AAV+ cells: Percent difference from random = [(number of AAV+ cells detected in cluster - number of AAV+ cells expected in cluster 1) / total number of cells in normalized cluster 2] x 100. Expected number of positive cells in cluster 1 = number of positive cells in tissue (TG or SCG) x [total number of cells in cluster / total number of cells in tissue]. Normalized total number of cells in cluster 2 = total number of cells in cluster x percentage of cells contributed by mice injected with a given AAV serotype. [Figure 17D]Figures 17A-17E. Percent difference in fractional distribution of HSV+ or AAV+ cells within a cluster compared to random distribution. 17A HSV, 17B AAV1, 17C AAV8, 17D PHP.S, 17E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (gray bars). Percent difference from random was calculated using the following formula: For HSV+ cells: Percent difference from random = [(number of HSV+ cells detected in cluster - number of HSV+ cells expected in cluster 1) / total number of cells in cluster] x 100. For AAV+ cells: Percent difference from random = [(number of AAV+ cells detected in cluster - number of AAV+ cells expected in cluster 1) / total number of cells in normalized cluster 2] x 100. Expected number of positive cells in cluster 1 = number of positive cells in tissue (TG or SCG) x [total number of cells in cluster / total number of cells in tissue]. Normalized total number of cells in cluster 2 = total number of cells in cluster x percentage of cells contributed by mice injected with a given AAV serotype. [Figure 17E]Figures 17A-17E. Percent difference in fractional distribution of HSV+ or AAV+ cells within a cluster compared to random distribution. 17A HSV, 17B AAV1, 17C AAV8, 17D PHP.S, 17E Rh10. Trigeminal ganglion-1 (TG-1) to TG-10 cluster (black bars) and superior cervical ganglion-1 (SCG-1) to SCG-5 cluster (gray bars). Percent difference from random was calculated using the following formula: For HSV+ cells: Percent difference from random = [(number of HSV+ cells detected in cluster - number of HSV+ cells expected in cluster 1) / total number of cells in cluster] x 100. For AAV+ cells: Percent difference from random = [(number of AAV+ cells detected in cluster - number of AAV+ cells expected in cluster 1) / total number of cells in normalized cluster 2] x 100. Expected number of positive cells in cluster 1 = number of positive cells in tissue (TG or SCG) x [total number of cells in cluster / total number of cells in tissue]. Normalized total number of cells in cluster 2 = total number of cells in cluster x percentage of cells contributed by mice injected with a given AAV serotype. [Figure 18A]Figures 18A-18E. Distribution of HSV and AAV double positive cells across clusters. Cells expressing HSV genes and transgenes delivered via the indicated AAV (Figure 18B HSV / AAV1+, Figure 18C HSV / AAV8+, Figure 18D HSV / PHP.S+, Figure 18E HSV / Rh10+) were overlaid on the tSNE plot (Figure 18A). Neurons positive for HSV transcripts HSV+ (light grey dots), transgene transcripts of the indicated AAV serotypes (grey dots), or both HSV+ / AAV+ (diamonds). The actual saturation of neuronal subsets is greater than indicated by this representation, since only a quarter of the analyzed animals received each AAV serotype. All animals received HSV. The percentage of HSV positive neurons also positive for the AAV transgene in the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown in the top left and bottom right, respectively. *Note that one quarter of mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce a theoretical maximum of one quarter of neurons. All mice were infected with HSV. [Figure 18B]Figures 18A-18E. Distribution of HSV and AAV double positive cells across clusters. Cells expressing HSV genes and transgenes delivered via the indicated AAV (Figure 18B HSV / AAV1+, Figure 18C HSV / AAV8+, Figure 18D HSV / PHP.S+, Figure 18E HSV / Rh10+) were overlaid on the tSNE plot (Figure 18A). Neurons positive for HSV transcripts HSV+ (light grey dots), transgene transcripts of the indicated AAV serotypes (grey dots), or both HSV+ / AAV+ (diamonds). The actual saturation of neuronal subsets is greater than indicated by this representation, since only a quarter of the analyzed animals received each AAV serotype. All animals received HSV. The percentage of HSV positive neurons also positive for the AAV transgene in the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown in the top left and bottom right, respectively. *Note that one quarter of mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce a theoretical maximum of one quarter of neurons. All mice were infected with HSV. [Figure 18C]Figures 18A-18E. Distribution of HSV and AAV double positive cells across clusters. Cells expressing HSV genes and transgenes delivered via the indicated AAV (Figure 18B HSV / AAV1+, Figure 18C HSV / AAV8+, Figure 18D HSV / PHP.S+, Figure 18E HSV / Rh10+) were overlaid on the tSNE plot (Figure 18A). Neurons positive for HSV transcripts HSV+ (light grey dots), transgene transcripts of the indicated AAV serotypes (grey dots), or both HSV+ / AAV+ (diamonds). The actual saturation of neuronal subsets is greater than indicated by this representation, since only a quarter of the analyzed animals received each AAV serotype. All animals received HSV. The percentage of HSV positive neurons also positive for the AAV transgene in the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown in the top left and bottom right, respectively. *Note that one quarter of mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce a theoretical maximum of one quarter of neurons. All mice were infected with HSV. [Figure 18D]Figures 18A-18E. Distribution of HSV and AAV double positive cells across clusters. Cells expressing HSV genes and transgenes delivered via the indicated AAV (Figure 18B HSV / AAV1+, Figure 18C HSV / AAV8+, Figure 18D HSV / PHP.S+, Figure 18E HSV / Rh10+) were overlaid on the tSNE plot (Figure 18A). Neurons positive for HSV transcripts HSV+ (light grey dots), transgene transcripts of the indicated AAV serotypes (grey dots), or both HSV+ / AAV+ (diamonds). The actual saturation of neuronal subsets is greater than indicated by this representation, since only a quarter of the analyzed animals received each AAV serotype. All animals received HSV. The percentage of HSV positive neurons also positive for the AAV transgene in the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown in the top left and bottom right, respectively. *Note that one quarter of mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce a theoretical maximum of one quarter of neurons. All mice were infected with HSV. [Figure 18E]Figures 18A-18E. Distribution of HSV and AAV double positive cells across clusters. Cells expressing HSV genes and transgenes delivered via the indicated AAV (Figure 18B HSV / AAV1+, Figure 18C HSV / AAV8+, Figure 18D HSV / PHP.S+, Figure 18E HSV / Rh10+) were overlaid on the tSNE plot (Figure 18A). Neurons positive for HSV transcripts HSV+ (light grey dots), transgene transcripts of the indicated AAV serotypes (grey dots), or both HSV+ / AAV+ (diamonds). The actual saturation of neuronal subsets is greater than indicated by this representation, since only a quarter of the analyzed animals received each AAV serotype. All animals received HSV. The percentage of HSV positive neurons also positive for the AAV transgene in the superior cervical ganglion (SCG) and trigeminal ganglion (TG) are shown in the top left and bottom right, respectively. *Note that one quarter of mice received each of the four AAV serotypes and samples were pooled for library construction and sequencing. Thus, each serotype can transduce a theoretical maximum of one quarter of neurons. All mice were infected with HSV. [Figure 19] Schematic of JQ1 reactivation experiment. Latently infected mice were divided into three experimental groups to determine the effect of JQ1 on HSV reactivation. As shown in the figure, Groups 1 and 2 were JQ1 groups that received an intraperitoneal injection of 50 mg / kg of JQ1. Group 3 was the control group, i.e., no JQ1 injection. Mice in Group 1 received two injections, one JQ1 injection at 0 hours and a second JQ1 injection at 12 hours. Mice in Group 2 received one injection at 0 hours. Mice in Group 3 received one control injection at 0 hours. To determine shedding from mucosal surfaces, as an indicator of HSV reactivation, mice were swabbed at 0 hours (control) and this swab was compared to swabs taken at 24 hours, 48 ​​hours, and 72 hours. [Figure 20A]Figures 20A-20C. JQ1 treatment results in shedding of HSV. Following the protocol described in Figure 19, Figure 20A detects no shedding in control mice (group 3). Figure 20B. Shedding was detected in mice that received a single dose of JQ1 (group 2) and peaked 2 days after JQ1 injection. Figure 20C. Shedding was also detected in mice that received two doses of JQ1 (group 1). [Figure 20B] Figures 20A-20C. JQ1 treatment results in shedding of HSV. Following the protocol described in Figure 19, Figure 20A detects no shedding in control mice (group 3). Figure 20B. Shedding was detected in mice that received a single dose of JQ1 (group 2) and peaked 2 days after JQ1 injection. Figure 20C. Shedding was also detected in mice that received two doses of JQ1 (group 1). [Figure 20C] Figures 20A-20C. JQ1 treatment results in shedding of HSV. Following the protocol described in Figure 19, Figure 20A detects no shedding in control mice (group 3). Figure 20B. Shedding was detected in mice that received a single dose of JQ1 (group 2) and peaked 2 days after JQ1 injection. Figure 20C. Shedding was also detected in mice that received two doses of JQ1 (group 1). [Figure 21A] Figures 21A-21C. Dual meganucleases in combination with JQ1 reduced HSV-1 load. Figure 21A. In mice treated with dual meganucleases and JQ1, HSV viral load was reduced by at least 83% in superior cervical ganglion cells 48 hours after JQ1 treatment, and this reduction in HSV load increased to at least 97% at 96 hours after JQ1 treatment. Figure 21B. In mice treated with dual meganucleases and JQ1, HSV load was reduced by at least 97% in trigeminal ganglion cells 96 hours after JQ1 treatment. Unlike superior cervical ganglion cells, no reduction in HSV load was observed in trigeminal ganglion cells 48 hours after JQ1 treatment. [Figure 21B]Figures 21A-21C. Dual meganucleases in combination with JQ1 reduced HSV-1 load. Figure 21A. In mice treated with dual meganucleases and JQ1, HSV viral load was reduced by at least 83% in superior cervical ganglion cells 48 hours after JQ1 treatment, and this reduction in HSV load increased to at least 97% at 96 hours after JQ1 treatment. Figure 21B. In mice treated with dual meganucleases and JQ1, HSV load was reduced by at least 97% in trigeminal ganglion cells 96 hours after JQ1 treatment. Unlike superior cervical ganglion cells, no reduction in HSV load was observed in trigeminal ganglion cells 48 hours after JQ1 treatment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The inventors evaluated gene editing of HSV-1 in a well-established mouse model using adeno-associated virus (AAV)-delivered meganuclease as a potential curative approach to treat latent HSV-1 infection. The present disclosure describes that AAV-delivered meganuclease, but not CRISPR / Cas9, mediates highly efficient gene editing of HSV-1, clearing more than 90% of latent virus from the superior cervical ganglion. Single-cell RNA sequencing demonstrated that both HSV-1 and individual AAV serotypes were non-randomly distributed among neuronal subsets in the ganglion, suggesting that improved delivery to all neuronal subsets may lead to more complete elimination of HSV-1. As described in more detail below in Example 1, delivery of meganuclease using a triple AAV serotype combination resulted in the greatest reduction in ganglionic HSV-1 load. The levels of HSV-1 clearance observed in these studies are likely to significantly reduce HSV-1 reactivation, shedding, and pathology when applied to humans. Further optimization of meganuclease delivery and activity is possible, potentially providing a route to treatment of HSV-1 infection.

[0021] Herpes simplex virus Herpes simplex virus (HSV) includes at least HSV type 1. As used herein, HSV-1 and HSV are used interchangeably to refer to HSV type 1 (HSV-1). HSV-1 belongs to the Herpesviridae family of DNA viruses that cause infection in humans. Once acquired, HSV-1 remains in the host for life, typically remaining latent in the form of a stable dsDNA episome in the nucleus of sensory neurons. HSV-1 is a highly adapted human pathogen with a rapid lytic replication cycle and also exhibits the ability to invade sensory neurons without exhibiting cytopathology. Latent infections are subject to reactivation, whereby infectious virus can be retrieved in peripheral tissues attenuated by latently infected neurons following certain physiological stresses. The main drivers of these switches from lytic to latent infections and vice versa include changes in transcription patterns, primarily as a result of interactions between the viral promoter, the viral genome, and the cellular transcription machinery.

[0022] The primary site of infection of HSV-1 is at mucosal surfaces. In some embodiments, HSV-1 can access sensory nerve terminals and migrate from the site of infection to the trigeminal ganglion (TG) and superior cervical ganglion (SCG) via retrograde transport. There, HSV-1 can infect the TG and SCG, which remain sites of latency until HSV-1 is reactivated, particularly by stress, and HSV-1 migrates from the TG or SCG to the primary site of infection via retrograde transport.

[0023] The HSV-1 genome is a linear double-stranded DNA 152,261 base pairs (bp) in length with a base composition of 68% G+C that circularizes during infection. The HSV-1 genome is divided into six important regions: the "a" sequences, which are the termini of the linear molecule, and are important for both circularization of the viral DNA and packaging of the DNA in virions; the 9,000 bp long repeats (RL), which code for both the important immediate-early regulatory protein (aO) and the promoters of most of the latency-associated transcript (LAT) "genes"; and the 108,000 bp long unique region (UL ) encodes at least 56 different proteins, including genes for DNA replication enzymes and capsid proteins. The fourth, the 6,600 bp short repeat (Rs), encodes the crucial "a" immediate-early protein, which is a very strong transcriptional activator that acts together with aO ICPO and a27 (ICP27 / UL54) (in the UL) to prime the infected cell for all viral gene expression leading to viral DNA replication. The fifth, the origin of replication, OHL, is located in the U L In the middle of the region, the oris is located in the te Rs and is therefore present in two copies. The full set of oris operates during infection to give a highly complex replication complex very similar to that seen in phage T4 replication. The sixth, a short 13,000 bp unique region (Us), encodes 12 ORFs, some of which are glycoproteins important in viral host range and in the response to host defense.

[0024] The virus encodes approximately 100 transcripts and more than 70 open translational reading frames (ORFs). Most ORFs are expressed by a single transcript. L 19. U L 30, and U L Approximately 40 genes, including 54, are thought to be essential for viral replication in culture. L 19 is expressed late in the infectious cycle and encodes the major capsid protein, VPR. L 30 is expressed early in the infection cycle and encodes the catalytic subunit of the viral DNA polymerase. L 54 is expressed during intermediate stages of the infectious cycle and encodes the immediate early regulatory protein ICP27. ICPO is expressed and functions early in the productive infectious cycle and is important for initiating early transcription and replication.

[0025] Meganuclease Meganucleases are essentially represented by homing endonucleases. Homing endonucleases (HEs) are a widespread family of natural meganucleases that include hundreds of protein families (Chevalier, BS and BL Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). These proteins are encoded by mobile genetic elements that propagate by a process called "homing", where the endonucleases cleave the cognate allele in the absence of the mobile element, thereby stimulating homologous recombination events that copy the mobile DNA into the recipient locus.

[0026] As used herein, a "meganuclease" is a double-stranded endonuclease with a large polynucleotide recognition site of at least 12 bp, preferably 12by to 60 bp. Meganucleases are also referred to as rare-cutting or highly rare-cutting endonucleases. In some embodiments, meganucleases can be either monomeric or dimeric. In some embodiments, meganucleases can be any naturally occurring meganuclease, such as a homing endonuclease. In some embodiments, meganucleases can be any artificial or man-made meganuclease with such high specificity, derived either from homing endonucleases of group I introns and inteins, or from other proteins, such as zinc finger proteins or group II intron proteins, or from compounds, such as nucleic acids condensed with chemical compounds.

[0027] Detailed three-dimensional structures of several homing endonucleases have been described, namely I-Dmo I, PI-Sce I, PI-Pfu I, I-Cre I, I-Ppo I, and the hybrid homing endonuclease I-Dmo I / I-Cre I, called E-Dre I (Chevalier et al., 2001, Nat Struct Biol, 8, 312-316; Dunn et al., 1997, Cell, 89, 555-564; Heath et al., 1997, Nat Struct Biol, 4, 468-476; Hu et al., 2000, J Biol Chem, 275, 2705-2712; Ichiyanagi et al., 2000, J Mol Biol, 300, 889-901; Jurica et al., 1998, Mol Cell, 2, 469-476; Poland et al., 2000, J Biol Chem, 275, 16408-16413; Silva et al., 1999, J Mol Biol, 286, 1123-1136; Chevalier et al., 2002, Molecular Cell, 10, 895-905) are known.

[0028] The LAGLIDADG family is the largest family of proteins clustered by the most common conserved sequence motif, a didodecapeptide, also called the LAGLIDADG motif, with one or two copies of a 12-residue sequence. Homing endonucleases with one dodecapeptide (D) have a molecular weight of approximately 20 kDa and act as homodimers. Those with two copies (DD) range from 25 kDa (230 AA) to 50 kDa (HO, 545 AA) with 70 to 150 residues between each motif and function as monomers. The cleavage is internal to the recognition site, leaving a 4 nt staggered cleavage with a 3'OH overhang. I-Ceu I, and I-Cre I represent homodimeric homing endonucleases with one dodecapeptide motif (monododecapeptide). The initial LAGLIDADG homing endonuclease can be selected from the group consisting of I-Dmo I, I-Cre I, PI-Sce I, and PI-Pfu I.

[0029] Bromodomain and extraterminal (BET) proteins Bromodomain and extraterminal (BET) proteins are a group of epigenetic readers that play a key role in epigenetic processes and may actually control the expression of genes involved in cell proliferation and carcinogenesis. Post-translational acetylation of nucleosomal histone N-terminal tails represents a fundamental epigenetic mark for open structural chromatin and active gene transcription. Members of the BET protein family are characterized by highly homologous tandem bromodomains (BD-1 and BD-2) that recognize and bind these acetylated lysine histone tails. BET proteins then act as scaffolds to recruit transcription factors and chromatin organizers that are required for transcription. For example, through a series of hydrogen-bonding interactions between highly conserved asparagine and tyrosine residues and acetylated lysines, BET bromodomains link chromatin to the CDK9-containing complex P-TEFb, which phosphorylates the large subunit of RNA polymerase II, facilitating pause release and transcription elongation.

[0030] As used herein, the term "bromodomain and extra-terminal domain" or "BET" includes any natural and / or artificial BET from any source, unless otherwise specified. The term "BET" refers to members of the BET family, including BRD2, BRD3, BRD4, and BRDT. Disrupting BET protein interactions through bromodomain inhibition results in modulation of transcriptional programs that are often associated with diseases characterized by dysregulation of cell cycle control, inflammatory cytokine expression, viral transcription, hematopoietic differentiation, insulin transcription, and adipogenesis.

[0031] As noted above, in one aspect, the disclosure provides methods and compositions for reducing or eliminating latent herpes complex virus type 1 (HSV-1) reactivation in cells.

[0032] In one aspect, a method for reducing or eliminating latent HSV-1 reactivation in a cell can include delivering to an HSV-1 infected cell one or more viral vectors that include one or more sequences encoding one or more HSV-1 specific meganucleases.

[0033] In another embodiment, a composition for reducing or eliminating latent HSV-1 reactivation in a cell can comprise one or more viral vectors that include one or more sequences encoding one or more HSV-1 specific meganucleases.

[0034] As used herein, "viral vector" refers to the use of an adeno-associated viral vector (AAV) or any viral vector engineered from an AAV to deliver one or more HSV-1 specific meganucleases to a desired target. In some embodiments, the engineered AAV can comprise a self-complementary adeno-associated virus (scAAV). In some embodiments, the engineered AAV can comprise a single-stranded adeno-associated virus (ssAAV). Viral vectors, e.g., AAV, scAAV, ssAAV, etc., containing one or more sequences encoding one or more HSV-1 specific meganucleases, were generated according to the method of Choi et al. (Choi, VW, Asokan, A., Haberman, RA & Samulski, RJ Production of recombinant adeno-associated viral vectors for in vitro and in vivo use. Curr Protoc Mol Biol Chapter 16, Unit 16 25, doi:10.1002 / 0471142727.mb1625s78 (2007)), the contents of which are incorporated herein by reference.

[0035] In some embodiments, one or more viral vectors are AAV. In some embodiments, AAV can include any serotype known to those skilled in the art. In some embodiments, one or more AAV can include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-Rh8, AAV-rh10 serotype adeno-associated virus, or a combination thereof. In some embodiments, one or more AAV can include AAV-Rh10, AAV8, AAV1 serotype adeno-associated virus, or a combination thereof. In yet other embodiments, one or more AAV is AAV-Rh10 and / or AAV8 serotype adeno-associated virus.

[0036] In some embodiments, one or more viral vectors are scAAV. In some embodiments, scAAV can include any serotype known to those skilled in the art. In some embodiments, one or more scAAV can include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-Rh8, AAV-rh10 serotype adeno-associated virus, or a combination thereof. In some embodiments, one or more scAAV can include AAV-Rh10, AAV8, AAV1 serotype adeno-associated virus, or a combination thereof. In yet other embodiments, one or more scAAV is AAV-Rh10 and / or AAV8 serotype adeno-associated virus.

[0037] In some embodiments, one or more viral vectors are ssAAV. In some embodiments, the ssAAV can include any serotype known to those skilled in the art. In some embodiments, the one or more ssAAV can include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-Rh8, AAV-rh10 serotype adeno-associated virus, or a combination thereof. In some embodiments, the one or more ssAAV can include AAV-Rh10, AAV8, AAV1 serotype adeno-associated virus, or a combination thereof. In yet other embodiments, the one or more ssAAV is AAV-Rh10 and / or AAV8 serotype adeno-associated virus.

[0038] In some embodiments, one or more HSV-1 specific meganucleases can be configured to induce one or more DNA double strand breaks (DSBs). DNA DSBs are created in the HSV-1 genome upon expression of a homing endonuclease that targets a specific sequence in an essential HSV-1 gene. The DSBs are repaired by error-prone non-homologous end joining, such that continued cleavage of the HSV-1 target site results in the disruption / mutation of the HSV-1 gene. As used herein, the phrase "configured to induce one or more DNA DSBs" refers to the use of a meganuclease that targets a specific HSV-1 target site to cause a DSB. As used herein, "target sequence" or "target site" refers to a nucleic acid sequence in the viral genome that includes a sequence targeted by a specific meganuclease that results in gene editing of the HSV-1 target site.

[0039] In some embodiments, the one or more HSV-1 specific meganucleases are derived from the I-CreI enzyme. In some embodiments, the HSV-1 specific meganucleases can be configured to induce one or more DNA DSBs in any HSV-1 gene known to those of skill in the art. For example, in some embodiments, the one or more HSV-1 specific meganucleases can be configured to induce one or more DNA DSBs in any HSV-1 gene known to those of skill in the art. L 19. U L 30, U L 19. U L 54, ICP0, etc. In some embodiments, the one or more HSV-1 specific meganucleases are L 19. U L 30, ICP0, UL54, and / or any combination of HSV-1 genes known to one of skill in the art.

[0040] In yet another embodiment, the HSV-1 specific meganuclease comprises L19. In some embodiments, the HSV-1 specific meganuclease is L 30。 In some embodiments, the HSV-1 specific meganuclease is HSV1m4, which targets the overlapping gene ICPO. In still other embodiments, the HSV-1 specific meganuclease is any combination of HSV1m5, HSV1m8, and / or HSV1m4.

[0041] In some embodiments, the one or more meganucleases can comprise a sequence set forth in SEQ ID NOs: 1-3. In some embodiments, the one or more meganucleases are meganucleases that can be configured to target one or more of the sequences set forth in SEQ ID NOs: 4-6.

[0042] In some embodiments, the method can include delivering one viral vector (e.g., AAV, scAAV, ssAAV, etc.) that includes two or more sequences encoding one or more HSV-1 specific meganucleases. In some embodiments, the method can include delivering two viral vectors (e.g., AAV, scAAV, ssAAV, etc.), each including one or more sequences encoding one or more HSV-1 specific meganucleases. In yet other embodiments, the method can include delivering two different viral vectors (e.g., AAV, scAAV, ssAAV, etc.), each including a sequence encoding an HSV-1 specific meganuclease, the sequences being the same or different. In some embodiments, the two different viral vectors can include, for example, delivering a first scAAV and a second scAAV, i.e., the same type of viral vector. In some embodiments, the different viral vectors can be selected from any combination, e.g., AAV, scAAV, ssAAV, etc., i.e., two different types of viral vectors. As used herein, "delivering" refers to administering to a subject one or more viral vectors containing one or more sequences encoding one or more HSV-1 specific meganucleases by a method or route that results in at least partial inoculation of the subject at a desired site.

[0043] In some embodiments, one or more viral vectors can be delivered to cells according to methods generally known to those skilled in the art that are suitable for the particular viral vector and cell type. In some embodiments, the viral vector is delivered to the subject via intravenous injection, subcutaneous injection, intramuscular injection, autologous cell transplantation, or allogeneic cell transplantation. In yet other embodiments, the viral vector is combined with one or more pharmaceutically acceptable carriers for administration. Pharmaceutically acceptable carriers can include those well known to those skilled in the art and suitable for the particular viral vector and cell type.

[0044] In yet other embodiments, an "effective amount" of the viral vector is delivered to edit the HSV-1 genome. As used herein, the term "effective" refers to any amount that induces a desired response, e.g., edits a particular HSV-1 genome, without inducing significant toxicity in a subject.

[0045] In some embodiments, the cell may be in a mammalian subject. In some embodiments, the mammalian subject may be a human. In yet other embodiments, the cell may be a superior cervical ganglion (SCG) cell. In yet other embodiments, the cell may be a trigeminal ganglion (TG) cell. In yet other embodiments, the cell may be a combination of SCG cells and / or TG cells.

[0046] In some embodiments, the method further comprises administering to the HSV-1 infected cells a bromodomain and extraterminal (BET) protein inhibitor. As used herein, "BET inhibitor" refers to a compound that binds to BET and inhibits and / or reduces the biological activity of BET. In some embodiments, the BET inhibitor substantially or completely inhibits the biological activity of BET. In some embodiments, the biological activity is that BET binds to chromatin (e.g., histones associated with DNA) and / or another acetylated protein. In some embodiments, the BET inhibitor can inhibit one or more of BRD2, BRD3, BRD4, and BRDT. In some embodiments, the BET protein inhibitor can be selected from any of these BET protein inhibitors known to those of skill in the art. In still other embodiments, the BET protein inhibitor can be selected from the group consisting of JQ1, bilabresib, molybresib, apabetalone, ZEN-3694, BMS-986158, INC-B057643, and the like.

[0047] As used herein, the BET protein inhibitor JQ1, also known as (+)-JQ1, has the following chemical name: (tert-butyl (S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate).

[0048] As used herein, virabresib, also known as OTX015 and MK-8628, has the following chemical name: ((S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-N-(4-hydroxyphenyl)acetamide).

[0049] As used herein, molybresib, also known as GSK525762, GSK525762A, and I-BET762, has the following chemical name: ((S)-2-(6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-N-ethylacetamide).

[0050] As used herein, apabetalone, also known as RVX-208 and RVX000222, has the following chemical name: (2-(4-(2-hydroxyethoxy)-3,5-dimethylphenyl)-5,7-dimethoxyquinazolin-4(3H)-one).

[0051] As used herein, BMS-986158 has the following chemical name: ((S)-2-(3-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-5-(phenyl(tetrahydro-2H-pyran-4-yl)methyl)-5H-pyrido[3,2-b]indol-7-yl)propan-2-ol).

[0052] As used herein, INC-B057643 has the following chemical name: (2,2,4-trimethyl-8-(6-methyl-7-oxo-6,7-dihydro-1H-pyrrolo[2,3-c]pyridin-4-yl)-6-(methylsulfonyl)-2H-benzo[b][1,4]oxazin-3(4H)-one).

[0053] In some embodiments, the method can include administering a BET protein inhibitor to an HSV-1 infected cell prior to delivery of one or more viral vectors (e.g., AAV, scAAV, ssAAV, etc.) comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell. In some embodiments, the method can include administering a BET protein inhibitor to an HSV-1 infected cell after delivery of one or more viral vectors (e.g., AAV, scAAV, ssAAV, etc.) comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell. In yet other embodiments, the method can include administering a BET protein inhibitor to an HSV-1 infected cell in conjunction with delivery of one or more viral vectors (e.g., AAV, scAAV, ssAAV, etc.) comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell.

[0054] In some embodiments, the BET protein inhibitor can be administered in a dose sufficient to provide an "effective concentration" of the BET protein inhibitor in HSV-1 infected cells. As used herein, "effective" refers to an amount of the BET protein inhibitor that reduces the biological activity of BET and thus achieves a desired response without inducing significant toxicity in the subject. In some embodiments, the desired response is induction of viral shedding. In some embodiments, the dose of the BET protein inhibitor is administered in mg / kg. In other embodiments, the dose of the BET protein inhibitor is administered in an amount to achieve a particular concentration in HSV-1 infected cells. Determining the effective amount of the dose and the type of dose (e.g., a dose based on body weight or a dose to achieve a particular concentration in HSV-1 infected cells) is well within the capabilities of one of ordinary skill in the art. In some embodiments, the dose can be at least 100 mg / kg. In some embodiments, the dose can be at least 25 mg / kg. In some embodiments, the dose can be at least 50 mg / kg. In some embodiments, the dose can be at least 75 mg / kg. In another embodiment, the dose is administered to achieve a concentration of at least 10 μM in HSV-1 infected cells. In another embodiment, the dose is administered to achieve a concentration of at least 1 μM in HSV-1 infected cells. In another embodiment, the dose is administered to achieve a concentration of at least 2 μM in HSV-1 infected cells. In another embodiment, the dose is administered to achieve a concentration of at least 4 μM in HSV-1 infected cells. In another embodiment, the dose is administered to achieve a concentration of at least 6 μM in HSV-1 infected cells. In another embodiment, the dose is administered to achieve a concentration of at least 8 μM in HSV-1 infected cells.

[0055] In some embodiments, the method is capable of reducing HSV-1 load in SCG cells by at least 97% at least 96 hours after administration of the BET protein inhibitor. In some embodiments, the method is capable of reducing HSV-1 load in SCG cells by at least 83% at least 48 hours after administration of the BET protein inhibitor. In yet other embodiments, the method is capable of reducing HSV-1 load in TG cells by at least 97% at 96 hours after administration of the BET protein inhibitor.

[0056] In some embodiments, the composition is capable of reducing HSV-1 load in SCG cells by at least 97% 96 hours after administration of the BET protein inhibitor. In some embodiments, the composition is capable of reducing HSV-1 load in SCG cells by at least 83% 48 hours after administration of the BET protein inhibitor. In yet other embodiments, the composition is capable of reducing HSV-1 load in TG cells by at least 97% 96 hours after administration of the BET protein inhibitor.

[0057] Additional definitions Unless specifically defined herein, all terms used herein have the same meaning as they would have to one of ordinary skill in the art of the present invention.

[0058] Although the present disclosure supports a definition that refers only to alternatives and "and / or," use of the term "or" in the claims is used to mean "and / or" unless expressly indicated to refer only to alternatives or unless the alternatives are mutually exclusive.

[0059] In accordance with long-standing patent law, the words "a" and "an," when used in conjunction with the word "comprising" in a claim or the specification, indicate one or more, unless otherwise noted.

[0060] Unless the context clearly requires otherwise, throughout this specification and claims, terms such as "comprise", "comprising" and the like are to be interpreted in an inclusive sense, as opposed to an exclusive or exhaustive sense, which is indicated in the sense of "including, but not limited to". Words using singular or plural numbers also include the plural and singular numbers, respectively. Additionally, the words "herein", "above" and "below" and words of similar meaning, when used in this application, refer to this application as a whole and not to any particular portion of this application. The word "about" refers to a number within a range of minor variations above or below a stated reference number. For example, "about" can refer to a number within a range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% below or above the indicated reference number.

[0061] The term "subject" herein refers to a mammal being evaluated to reduce or eliminate latent HSV-1 reactivation. In certain embodiments, the mammal is a human. The term "subject" includes, but is not limited to, an individual having HSV-1. In some embodiments, the subject is one who has been diagnosed and is currently undergoing treatment or is seeking treatment, monitoring, adjustment or modification of an existing therapy, or is at risk of developing an HSV-1 infection. In one embodiment, the HSV-1 infection is an HSV-1-1 infection.

[0062] The term "HSV-1 infection" refers to the presence of unwanted proliferation or invasion of HSV-1 in a host organism. In some embodiments, the infection may be caused by actively replicating lytic HSV-1 and may be referred to as a lytic infection. Such infections are usually symptomatic. In some embodiments, the infection may be caused by quiescent or latent HSV-1 and may be referred to as a latent HSV-1 infection. Such infections are usually asymptomatic. Latent viral infections can reactivate to become lytic viral infections or recurrent HSV-1 infections, resulting in the recurrence of active symptomatic HSV-1-associated disease.

[0063] As used herein, the term "protein" refers to a series of amino acid residues linked together by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The term "protein" can also refer to polymers of amino acids, including modified amino acids (e.g., phosphorylation, glycosylation, glycosylation, etc.) and amino acid analogs, regardless of their size or function. The term "protein" can also be used to refer to gene products and fragments thereof.

[0064] As used herein, the term "pharmacologically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0065] As used herein, the term "pharmaceutically acceptable carrier" means a pharma- ceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid, or solvent encapsulating material, necessary or used in formulating an active ingredient or drug for delivery to a subject. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient.

[0066] As used herein, the terms "reduce", "reduce", "lower", "eliminate", or "inhibit" are all commonly used to mean a statistically significant amount of reduction. For example, "reduce", "reduce", "reduce", or "inhibit" means a reduction of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or a reduction of 100% or less (e.g., an absent or undetectable level compared to a reference level), or any reduction between 10 and 100% compared to a reference level. "Eliminate" means complete removal, i.e., no detection is possible.

[0067] While illustrative embodiments have been illustrated and described, it will be understood that various changes can be made therein without departing from the spirit and scope of the invention. Publications cited herein and the subject matter for which they are cited are specifically incorporated herein by reference in their entireties. EXAMPLES

[0068] The following examples are put forward to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are the following experiments meant to represent all or the only experiments performed.

[0069] Example 1: This example describes that AAV-delivered meganucleases, but not CRISPR / Cas9, mediate highly efficient gene editing of HSV and eliminate more than 90% of latent virus from the superior cervical ganglion. Single-cell RNA sequencing demonstrated that both HSV and individual AAV serotypes were non-randomly distributed among neuronal subsets in the ganglion, suggesting that improved delivery to all neuronal subsets may lead to more complete elimination of HSV.

[0070] To improve endonuclease-directed gene editing of the latent HSV genome to the level required for therapeutic efficacy, we evaluated the use of improved self-complementary (sc) AAV vectors, simultaneous targeting of multiple sites within the HSV genome, replacement of CRISPR / Cas9 with meganucleases, and the relative distribution of HSV versus AAV vectors at the single cell level. The results described in this example provide important insights for the optimization of in vivo gene therapy against HSV and suggest that meganuclease-mediated gene editing represents a plausible route towards HSV treatment.

[0071] result Gene editing reduces ganglionic HSV To evaluate the impact of efficient meganuclease-mediated gene editing on latent HSV infection in vivo, we used a mouse model of HSV ocular infection, as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)) (Figure 1A). The HSV-specific meganuclease HSV1m5 (m5) was used to transfect the U gene encoding the major capsid protein VP5. L 19 and used HSV1m8 (m8) to express the U L30 and HSV1m4 (m4) was used to target the overlapping gene ICP0 (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight1, doi:10.1172 / jci.insight.88468(2016)), Grosse, S. et al. Meganuclease-mediated Inhibition of HSV1 Infection in Cultured Cells. Mol Ther19, 694-702, doi:10.1038 / mt.2010.302(2011)), Aubert, M. et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids3, e146, doi:10.1038 / mtna.2013.75(2014)). Initially, latently infected mice were treated with the indicated doses using scAAV8 delivery vectors as either single meganuclease (m5 or m8) or dual meganuclease (m5+m8) therapy (Figure 1A). After one month, mice were sacrificed and superior cervical ganglia (SCG) and trigeminal ganglia (TG) were harvested for analysis. Consistent with our previous results (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)), animals that received a single meganuclease (either m5 or m8) showed modest levels of gene editing of the HSV target site (mean of 4.7% for m5 and 0.97% for m8 in SCG, and 0.92% for m5 and 0.17% for m8 in TG), and neither SCG nor TG showed a detectable reduction in ganglionic HSV burden compared to control mice (Figure 1B).However, when infected mice were treated with dual meganuclease (m5+m8) therapy, a significant reduction in HSV load was detected in both SCG and TG, with an HSV genome / 10 in the SCG. 6 The average ganglion cell level was 3.5 × 10 in control animals. 4 in dual meganuclease-treated mice compared with 7.3 × 10 3 (79% reduction, p = 0.018) and in TG, 4.2 × 10 4 in dual meganuclease-treated mice compared with 9.6 × 10 3 (77% reduction, p = 0.001) (Figure 1B). Interestingly, the HSV genomes remaining after dual meganuclease therapy had average gene editing levels similar to those of single nuclease-treated mice (3.6% in m5 and 0.63% in m8 in SCG and 1.0% in m5 and 0.21% in m8 in TG, Figures 1C-1D). In both single and dual meganuclease treated mice, the pattern of mutations seen (mostly small deletions of 1-16 bp) was consistent with that previously observed with gene editing of HSV (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468 (2016); Aubert, M. et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids 3, e146, doi:10.1038 / mtna.2013.75 (2014)).

[0072] To evaluate the role of AAV serotype in gene editing efficacy, latently infected mice were treated with a single nuclease therapy delivered by a vector derived from the AAV-Rh10 serotype (Figure 2A). This serotype has demonstrated efficient ganglionic transgene delivery in optimization studies, and we showed that the AAV-Rh10 serotype administered via retro-orbital injection resulted in the highest levels of HSV gene editing in ganglia (Figure 9). Although the reduction in viral load in the TG did not reach statistical significance as previously seen with dual meganuclease therapy (Figure 1B), a ∼65% reduction in the mean HSV load in the SCG was detected (average of 3.7 × 10 in control animals). 4 HSV genome / 10 6 Compared with ganglion cells, an average of 6 × 10 3 HSV genome / 10 6 ganglion cells, p=0.017) (Figure 2B). Interestingly, the HSV genomes remaining after single meganuclease therapy delivered by scAAV-Rh10 (Figure 2C) showed up to 30% mutagenesis by NGS, a level substantially higher than that observed after dual meganuclease therapy.

[0073] Next, 5×10 11 Vector genome (vg) scAAV-Rh10-CBh-m5, and 5 × 10 11 Dual meganuclease therapy delivered by AAV serotype Rh10 consisting of scAAV-Rh10-CBh-m8 in the vg (Figure 2D) was evaluated. Dual meganuclease therapy delivered by scAAV-Rh10 (m5+m8) significantly reduced the number of SCG (average 2 × 10) in treated mice compared to untreated controls. 4 vs. 2.6×10 3 , 86% decrease, p = 0.0006) and TG (mean 3.9 × 10 4 vs. 2.1×10 4 Both treatments resulted in a significant reduction in latent HSV genomes in both groups (45% reduction, p = 0.01) (Figure 2E). Among the viruses remaining after therapy, the mean levels of target site mutations were 4.2% for m5 and 0.4% for m8 in SCG and 3.8% for m5 and 0.4% for m8 in TG (Figure 2F).

[0074] Taken together, these results suggest that a single DNA double-strand break (DSB) in HSV is typically repaired and often results in mutations, but the generation of two DNA DSBs more commonly leads to degradation and loss of the HSV genome. To further evaluate the significance of dual meganuclease therapy compared to single meganuclease therapy, we performed 10 12 We injected scAAV-Rh10 expressing the vg HSV1m4 (m4), a meganuclease that targets the sequence of the overlapping gene encoding ICP0, thus inducing two DNA DSBs in HSV (Figure 3A) (Grosse, S. et al. Meganuclease-mediated Inhibition of HSV1 Infection in Cultured Cells. Mol Ther 19, 694-702, doi:10.1038 / mt.2010.302 (2011)). A significant reduction in HSV genomes was detected in both the SCG (59% reduction, p=0.03) and TG (45% reduction, p=0.02) of m4-treated mice compared to untreated control animals (Figure 3B). Consistent with the results from dual m5+m8 meganuclease-treated animals, NGS analysis showed that only 1.6% (SCG) and 0.8% (TG) of target sites in the remaining viral DNA were mutated in m4-treated mice ( Fig. 3C ), again supporting the interpretation that the creation of two DNA DSBs preferentially leads to degradation of HSV DNA.

[0075] To assess whether the introduction of more than two DNA DSBs would further improve elimination of the HSV genome by gene editing ( Fig. 3D ), latently infected mice were injected with 5 × 10 11 The vector genome scAAV-Rh10-CBh-m5 (targeting a single site in HSV), and 5 × 10 11AAV-Rh10 / dual meganuclease therapy consisting of scAAV-Rh10-CBh-m4 (targeting two additional sites) in vg was administered. A reduction in HSV viral load was observed in treated animals, along with mutations in the remaining genome at sites m5 (average 5.7% in SCG, average 2.7% in TG) (Figure 3F) compared to controls (82.5% in SCG, p=0.00001; 22.5% in TG, p=0.47) (Figure 3E), but these did not appear to be superior to dual m5+m8 or m4 therapy. The observed target site mutation frequency was higher for m5 than for m4 or m8, consistent with previous reports that this enzyme has higher activity (Grosse, S. et al. Meganuclease-mediated Inhibition of HSV1 Infection in Cultured Cells. Mol Ther 19, 694-702, doi:10.1038 / mt.2010.302(2011)).

[0076] To determine the effect of dual meganuclease treatment on the ability of HSV to reactivate from ganglia of treated mice, TG and SCG were harvested from dual AAVRh10 / meganuclease-(m5+m8) treated and control mice and tissues were subjected to 24 hours of explant reactivation as previously described (Figure 4A) (Sawtell, NM & Thompson, RL Comparison of herpes simplex virus reactivation in ganglia in vivo and in explants demonstrates quantitative and qualitative differences. J Virol 78, 7784-7794, doi:10.1128 / JVI.78.14.7784-7794.2004(2004)). We showed that ganglion explant reactivation resulted in an approximately 2-3 fold increase in total HSV levels on fresh ganglia, which could be measured by ddPCR (Figures 10A-10B). Consistent with the results in Figure 2, there was a significant reduction in HSV genomes in reactivated ganglia, especially in SCGs (90% reduction, mean 4.9 × 10 4 vs 4.2×10 3 , p = 0.002) and TG (51% decrease, mean 8.9 × 10 4 vs 4.4×10 4 , p=0.01) was detected in dual meganuclease-treated mice compared to untreated animals (Figure 4B). By NGS, gene editing was detected in 6.0% of residual virus for HSV1m5, 1.4% of residual virus for HSV1m8 in SCG, and 3.9% of residual virus for HSV1m5, and 0.3% of residual virus for HSV1m8 in TG (Figure 4C). Strikingly, these reductions in total HSV in reactivated ganglia resulted in a 95% (SCG) and 55% (TG) reduction in de novo-produced HSV genomes from dual-treated ganglia compared to untreated controls (Figures 4D-4E and Table 1). [Table 1]

[0077] AAV-Cas9 mediates only weak gene editing of HSV in vivo To investigate whether the CRISPR / Cas9 system would allow more efficient gene editing of HSV than meganucleases, we targeted two essential HSV genes: U, which encodes the immediate-early regulatory protein ICP27; L 54(sgRNA UL54 13, 17, and 26), and U, which encodes the catalytic subunit of the viral DNA polymerase. L 30 (also the target of meganuclease HSV1m8) (sgRNA UL30 Several Staphylococcus aureus (Sa)Cas9 sgRNAs targeting HSV (1 and 10) were identified. Because the SaCas9 coding sequence is large (3.1 kb), ssAAV was used as the delivery system. The larger payload capacity of ssAAV allowed both SaCas9 and sgRNA expression cassettes to be on the same AAV construct, ensuring simultaneous delivery of SaCas9 and sgRNA to transduced cells. Several sgRNAs were able to promote high levels of Cas9 gene editing of the HSV genome in latently infected cultured neurons transduced with SaCas9 / sgRNA-expressing AAV vectors, as detected by T7 endonuclease 1 (T7E1) assay (Figures 5A-5C). More sensitive next-generation sequencing (NGS) analysis confirmed that SaCas9 was highly targeted to sgRNAs. UL54-26 The highest level of mutations detected when combined with was 49% (Table 2). [Table 2]

[0078] To evaluate the ability of Cas9 to gene edit HSV in vivo, latent HSV infection was established in mice by ocular infection as described above (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Thirty days after HSV infection, mice were infected with 10 12 ssAAV1-sCMV-SaCas9-sgRNA in vg UL54 was administered by whisker pad injection, and TGs were harvested and analyzed at days 28 and 56 post-injection (Figure 5D). Consistent with the results using single meganuclease therapy, quantification by ddPCR showed similar levels of HSV in the TGs of treated and control animals (Figure 5E). However, in contrast to the readily detectable gene editing of HSV after single meganuclease therapy, gene editing of HSV could not be detected in any of the treated mice by T7E1 assay (Figures 11A-11C), despite AAV loads comparable or higher than those observed in previous experiments (Figure 12A). Only very low levels of mutations (0.1-0.3%) in Cas9-treated animals could be detected by more sensitive NGS analysis (Figure 5F).

[0079] Although the sCMV promoter used in the above experiments with Cas9 can mediate strong transgene expression in sensory neurons in vitro (Aubert, M. et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids3, e146, doi:10.1038 / mtna.2013.75(2014)) and in vivo (Dang, CH et al. In vivo dynamics of AAV-mediated gene delivery to sensory neurons of the trigeminal ganglia. Sci Rep7, 927, doi:10.1038 / s41598-017-01004-y(2017)), it is possible that optimization of the promoter may enable more efficient gene editing of latent HSV by Cas9. In response to this, we performed similar in vivo experiments (Figure 13Aa) using ssAAV1 vectors expressing SaCas9 under the control of alternative strong constitutive promoters CMV, nEF, and CBh. L The most effective sgRNA targeting 54 (sgRNA UL54-26 ) along with U L Two additional sgRNAs targeting 30 (sgRNA UL30-1 and sgRNA UL30-10 ) were also tested. Alternative AAV8 serotypes were also evaluated and achieved readily detectable gene editing of HSV when delivering meganuclease (Figures 1A-1D). Quantification by ddPCR showed similar levels of HSV in the TG of all treated animals (Figures 13B-13C). As observed in previous experiments, no gene editing of the latent HSV genome was detected by the T7E1 assay under any condition using Cas9 (Figures 13F-13H). Consistent with this and previous results, NGS analysis demonstrated that the levels of gene editing were very low and observed only in a subset of animals (Figures 13I-13J).

[0080] Similar to the results using meganucleases, CRISPR / Cas9 has shown significantly higher gene disruption efficiency when dual sites are targeted (Wang, G., Zhao, N., Berkhout, B. & Das, ATA Combinatorial CRISPR-Cas9 Attack on HIV-1 DNA Extinguishes All Infectious Provirus in Infected T Cell Cultures. Cell Rep17, 2819-2826, doi:10.1016 / j.celrep.2016.11.057(2016); Lebbink, RJ et al. A combinational CRISPR / Cas9 gene-editing approach can halt HIV replication and prevent viral escape. Sci Rep 7, 41968, doi:10.1038 / srep41968(2017); van Diemen, FR et al. CRISPR / Cas9-Mediated Genome Editing of Herpesviruses Limits Productive and Latent Infections. PLoS Pathog12, e1005701, doi:10.1371 / journal.ppat.1005701 (2016)). Therefore, we tested whether dual sgRNA therapy could result in more extensive gene editing of latent HSV. 12 ssAAVRh10-sCMV-Cas9-sgRNA in vg UL54-26 and 10 12 ssAAVRh10-sCMV-Cas9-sgRNA in vg UL30-10 or 10 12We administered either a single meganuclease regimen with ssAAVRh10-smCBA-HSV1m5-Trex2-mCherry or a single meganuclease regimen with ssAAVRh10-smCBA-HSV1m5-Trex2-mCherry in 1000 ng / mL mice (Figure 6A). The ssAAV construct carrying HSV1m5 also delivers Trex2, a 3'-5' exonuclease previously shown to increase meganuclease gene editing (Aubert, M. et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids 3, e146, doi:10.1038 / mtna.2013.75 (2014)). No loss of HSV genome was observed in the ganglia of either dual sgRNA / cas9 or single meganuclease treated mice compared to control animals (Figure 6B-6C). NGS analysis showed gene editing in some, but not all, treated animals, regardless of the therapy received, and mutation levels observed in ganglia from dual sgRNA-treated mice remained weaker and lower (<0.2%) than in ganglia from single meganuclease-treated mice (up to 9.9% in SCG and 1.1% in TG, Figures 6D-6E). RNA expression of Cas9, sgRNA, and m5 was tested to determine whether low enzyme expression could explain the weak gene editing. Cas9 mRNA was detected in 80% of SCG and TG from dual sgRNA / cas9-treated mice, but only 40% and 20% of mice had detectable levels of sgRNA in SCG and TG, respectively (Figures 6F-6G). For comparison, with single meganuclease therapy, expression of HSV1m5 was detected in only 50% of TG and SCG of treated animals, despite readily detectable gene editing.

[0081] Single neuron analysis of HSV and AAV vectors While optimizing AAV meganuclease therapy, we obtained different levels of HSV gene editing in the ganglia depending on the AAV serotype used for meganuclease delivery. The route of administration of the AAV delivery vector influenced the efficiency of HSV gene editing. It was previously shown that delivery of AAV to the site of HSV latency was less efficient after administration via the cornea (with or without a scar) than intradermal whisker pad (WP) injection (Dang, CH et al. In vivo dynamics of AAV-mediated gene delivery to sensory neurons of the trigeminal ganglia. Sci Rep7,927,doi:10.1038 / s41598-017-01004-y(2017)). Optimization studies presented in Figure 9 showed that AAV delivery to the ganglia was similar after injection via retro-orbital (RO), tail vein (TV), and WP injection, but RO resulted in the highest level of gene editing, especially with the Rh10 serotype. Furthermore, gene editing and loss of viral genome was consistently greater in SCGs than in TGs (Figures 1-4 and 9). These differences were hypothesized to result from differential distribution of AAV vector serotypes and HSV between TGs and SCGs, and among different types of neurons within ganglia. To assess this issue, AAV-mediated gene delivery to HSV-infected neurons was evaluated in mice using single-cell RNA sequencing (scRNA-seq). Mice were latently infected with HSV-1, and then each latently infected mouse was infected with 10 mAbs of one of four AAV vector serotypes reported to have neuronal tropism in mice. 12(Dang, CHet al. In vivo dynamics of AAV-mediated gene delivery to sensory neurons of the trigeminal ganglia. Sci Rep7,927,doi:10.1038 / s41598-017-01004-y (2017), Bradbury, AMet al. AAVrh10 Gene Therapy Ameliorates Central and Peripheral Nervous System Disease in Canine Globoid Cell Leukodystrophy(Krabbe Disease).Hum Gene Ther29,785-801,doi:10.1089 / hum.2017.151(2018), Chan,KYet al.Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems.Nat Neurosci 20, 1172-1179, doi:10.1038 / nn.4593(2017)). Each AAV serotype carried a unique marker transgene: AAV1-mScarlet, AAV8-mEGFP, AAV-PHP.S-DsRed-Express2, and AAV-Rh10-mTagBFP-2. Three weeks after AAV injection, TG and SCG were harvested and TG or SCG were pooled from all animals for neuronal purification, library construction, and sequencing. High-quality single-cell expression data were obtained from 2,319 purified TG neurons and 2,041 SCG neurons (average number of reads per cell of 99,817 and average number of genes of 5,908 for TG and average number of reads per cell of 94,797 and average number of genes of 5,635 for SCG).

[0082] To determine whether specific subtypes of neurons were infected by HSV and targeted by each AAV serotype, neurons were first classified into groups based on their gene expression profiles. Principal component analysis (PCA) of single-cell gene expression data identified transcriptionally distinct clusters of neurons for each tissue, 5 for SCG and 10 for TG. As expected, SCG (autonomous) and TG (sensory) neurons were completely separated from each other (Figures 7A and 14A). The cell clusters in the TG were found to be distinct in the DRG (Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci 18, 145-153, doi:10.1038 / nn.3881(2015), Li, CL et al. Somatosensory neuron types identified by high-coverage single-cell RNA-sequencing and functional heterogeneity. Cell Res 26, 83-102, doi:10.1038 / cr.2015.149(2016)) and in the TG (Nguyen, MQ, Wu, Y., Bonilla, LS, von Buchholtz, LJ & Ryba, NJP Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), which correlated well with previously identified clusters.For example, cluster TG-8 corresponds closely to Nguyen's cluster 6 (Nguyen et al. PLoS One 12, e0185543, doi:10.1371 / journal.pone.0185543(2017)), Usoskin's cluster PEP2 (Usoskin et al. Nat Neurosci 18, 145-153, doi:10.1038 / nn.3881(2015)), and Li's cluster C8-2 (Li et al. Cell Res 26, 83-102, doi:10.1038 / cr.2015.149(2016)) (Figures 14B-14E).

[0083] To determine the relative distribution of HSV and each AAV serotype across neuronal subtypes, we identified neurons expressing HSV transcripts and each of the marker transgenes carried by four different AAV serotypes: mScarlet (AAV1), mEGFP (AAV8), DsRed-Express2 (AAV-PHP.S), and mTagBFP-2 (AAV-Rh10) (Figure 7 and Tables 3-4). [Table 3] [Table 4] The latency-associated transcript (LAT), the only HSV RNA highly expressed during latent infection (reviewed in Fields, B., Knipe, D., Howley, P. & Griffin, D. (Philadelphia: Wolters Kluwer Health / Lippincott Williams & Wilkins, 2007)), accounts for 99% of all HSV transcripts detected. HSV transcripts were detected in 1.4% of cells in SCG and 12.2% of cells in TG, consistent with ddPCR results showing 10-fold fewer HSV genomes in SCG (Figure 9). HSV-expressing cells were significantly more abundant in SCG (χ 2 , p < 0.0001) and TG (χ 2, p<0.0001). For example, in the SCG, HSV-expressing cells were most enriched in SCG-4 and absent in SCG-3, whereas in the TG, HSV-expressing cells were most enriched in TG-8 (Figures 7B-7C, 16, and 17, and Tables 3-4).

[0084] The distribution of transgene expression from AAV varied by serotype and tissue. AAV1 (mScarlet) supported minimal expression in the SCG, with only 2.3% of neurons expressing mScarlet, but the most widespread transgene expression in the TG (18.2% of cells). In contrast, mEGFP (AAV8) was expressed in 60.4% of SCG neurons and 11.9% of TG neurons, DsRed-Express2 (PHP.S) was expressed in 18.9% and 12.3% of SCG and TG neurons, respectively, and mTagBFP-2 (Rh10) was expressed in 23.5% and 9.6% of SCG and TG neurons, respectively (Figure 15). Within the SCG, mScarlet (AAV1)-expressing cells were randomly distributed across the cluster, whereas mEGFP (AAV8), DsRed-Express2 (AAV-PHP.S), and mTagBFP-2 (AAV-Rh10) showed nonrandom distribution (χ 2 : p<0.0981, p<0.0001, p=0.0143, and p<0.0001, Figures 7B, 16, and 17, and Tables 2-3). Within the TG, transgene expression from all serotypes was nonrandomly distributed across neuronal clusters (χ 2 : AAV1 p=0.0023, AAV8 p=0.0002, PHP.S p<0.0001, Rh10 p=0.0006, Figures 7C, 16, and 17, and Tables 3-4). 62% of AAV-Rh10+ neurons vs. 54% of AAV8+ neurons were positive for HSV +They were clustered in TG-3, TG-4, and TG-8, neuronal clusters that contained 70% of neurons, which may partially explain why Rh10 provided slightly higher levels of gene editing in TGs than AAV8 (Figure 9). The analysis did not identify specific cellular transcripts unique to neurons transduced by specific AAV serotypes.

[0085] Finally, we assessed the overlap across neuronal clusters of HSV gene expression compared with each AAV serotype. + 79% of neurons were calculated to also express AAV8 or Rh10 transgenes, whereas HSV in the TG + Only about 10% of the cells detectably expressed these transgenes (FIGS. 7D, 18, and Table 5). [Table 5] Collectively, these scRNA-seq data demonstrate that AAV distribution to HSV-containing neurons is a critical parameter in regulating DNA editing efficiency and suggest that selecting AAV serotypes, promoters, and delivery methods to maximize the overlap between HSV infection and AAV transduction may increase the efficacy of meganuclease gene therapy against HSV.

[0086] Combining AAV serotypes results in more advanced gene editing Results from scRNA-seq analysis showed that individual AAV serotypes differ in tropism for specific neuronal subsets, suggesting that combinations of AAV serotypes may facilitate efficient ganglion meganuclease delivery. Thus, latently infected mice were treated with dual meganuclease therapy using either single (AAV1, AAV8, or AAVRh10), dual (AAV1 and AAV8, AAV1 and AAVRh10, or AAV8 and AAVRh10), or triple (AAV1, AAV8, and AAVRh10) AAV serotype combinations (Figure 8A). Analysis of SCGs and TGs collected one month later showed that all AAV combinations, except AAV1 alone, transduced ganglia at similar levels (Figures 8B-8C). Consistent with the results above, dual meganuclease therapy delivered using AAVRh10, either alone or in combination with one or two of the other AAV serotypes, resulted in the greatest loss of latent viral genomes from SCGs and the greatest reduction in viral load obtained with the triple AAV combination (92%, Figure 8B, Table 6). [Table 6]

[0087] As predicted from the scRNA-seq data, the smallest reduction in HSV genome was observed in animals that received AAV1 unless AAVRh10 was included. Similarly, in TG, the greatest loss of latent HSV genome was detected in mice that received dual meganuclease therapy delivered using a triple AAV serotype combination (54.8%, Figure 8E, Table 6). Consistent with previous results, despite efficient elimination of HSV genome, gene editing in the residual HSV genome was low, generally less than 10% at the HSV1m5 site (Figure 8F-8G) and ranging from undetectable to 8% at the HSVm8 site (Figure 8H-8I).

[0088] Taken together, these data suggest that to maximize HSV gene therapy in both SCGs and TGs, meganuclease delivery may benefit from a combination of different AAV serotypes to optimally target all HSV-infected neurons in both autonomic and sensory ganglia. Furthermore, the results indicated that AAV1 may not be the ideal serotype to be combined with AAVRh10 and AAV8. Additional experiments are required to identify the optimal AAV serotype to include in the therapeutic combination to maximize meganuclease delivery to all HSV-infected ganglionic neurons.

[0089] Consideration This example describes the use of a relatively simple mouse model of HSV infection to perform a series of iterative studies to increase the efficiency of AAV-delivered gene editing enzymes targeting HSV. This example discloses a reduction of the HSV genome by >90% in the SCG and >50% in the TG of treated animals. This represents a dramatic improvement over the inventors' previous report, where up to approximately 4% gene editing without loss of viral genome was observed. Although HSV does not spontaneously reactivate from ganglia in vivo mice, the virus does reactivate from mouse neurons after transplantation, and the results demonstrate a reduction of 95% (SCG) to 55% (TG) of de novo produced viral genomes in ganglion explants after meganuclease treatment of latently infected mice. This is consistent with previous studies demonstrating that ganglionic HSV load is a major determinant of the frequency of viral reactivation (Hoshino, Y., Pesnicak, L., Cohen, JI & Straus, SE Rates of reactivation of latent herpes simplex virus from mouse trigeminal ganglia ex vivo correlate directly with viral load and inversely with number of infiltrating CD8+T cells. J Virol 81, 8157-8164, doi:10.1128 / JVI.00474-07 (2007); Sawtell, NM The probability of in vivo reactivation of herpes simplex virus type1 increases with the number of latently infected neurons in the ganglia. J Virol 72, 6888-6892 (1998); Sawtell, NM, Poon, DK, Tansky, CS & Thompson, RLThe latent herpes simplex virus type1 genome copy number in individual neurons is virus strain specific and correlates with reactivation.J Virol72,5343-5350(1998), Hoshino, Y., Pesnicak, L., Straus, SE&Cohen, JIImpairment in reactivation of a latency associated transcript(LAT)-deficient HSV-2 is not solely dependent on the latent viral load or the number of CD8(+)T cells infiltrating the ganglia.Virology387,193-199,doi:10.1016 / j.virol.2009.02.004(2009)). Translated to humans, such results may be useful in reducing the chances of viral reactivation, shedding, and transmission to others (Schiffer, JT, Mayer, BT, Fong, Y., Swan, DA & Wald, A. Herpes simplex virus-2 transmission probability estimates based on quantity of viral shedding. JR Soc Interface 11, 20140160, doi:10.1098 / rsif.2014.0160(2014)). We have previously hypothesized that linearization of episomal latent HSV genomes by gene editing enzymes may lead to their degradation and loss if DNA repair and recircularization are not successful (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). However, the gene editing frequency achieved in our earlier study after exposure to a single meganuclease was insufficient to generate sufficient HSV genome loss to be detected even by a precise ddPCR assay (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). In contrast, the robust gene editing achieved in the current report after dual meganuclease treatment resulted in loss of HSV genome to a degree that was easily detectable by ddPCR. Of the remaining viral genomes, an average of 4%-6% were mutated, which likely further contributes to the suppression of HSV reactivation. .

[0090] One limitation of this study is that it is not possible to distinguish whether the observed reduction in de novo production of viral genomes is due to a reduction in the number of reactivation events or instead due to a decrease in viral production after a reactivation event has been initiated. While our previous results suggest that newly synthesized HSV genomes are efficiently targeted by nucleases (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight1, doi:10.1172 / jci.insight.88468(2016)), results from various groups have demonstrated that chromatin modifications of latent HSV can reduce the efficacy of gene editing (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight1, doi:10.1172 / jci.insight.88468(2016); Aubert, M. et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids3,e146,doi:10.1038 / mtna.2013.75(2014), van Diemen,FRet al.CRISPR / Cas9-Mediated Genome Editing of Herpesviruses Limits Productive and Latent Infections.PLoS Pathog12,e1005701,doi:10.1371 / journal.ppat.1005701(2016), Oh,HSet al.Herpesviral lytic gene functions render the viral genome susceptible to novel editing by CRISPR / Cas9.Elife8,doi:10.7554 / eLife.51662(2019)).This has important implications for the eventual embodiment of gene editing of HSV, to determine whether sustained long-term expression of nuclease achieved using AAV vectors (Dang, CH et al. In vivo dynamics of AAV-mediated gene delivery to sensory neurons of the trigeminal ganglia. Sci Rep7, 927, doi:10.1038 / s41598-017-01004-y (2017)) is necessary for therapeutic benefit, or whether alternative transient delivery approaches would be sufficient. On the other hand, the substantial improvement in the reduction of latent HSV load reported here (>90% reduction compared to approximately 4% in the inventors' previous report) warrants cautious optimism that with further optimization, ganglionic HSV load may be reduced to a level where sustained nuclease expression is not necessary. Ongoing experiments in mice and other model systems will shed further light on this issue.

[0091] The disclosure in this example convincingly demonstrates the value of single-cell analysis to optimize in vivo gene therapy. For gene editing against persistent viruses to have maximum efficacy, the transgene must be efficiently delivered to the cell containing the virus. These results demonstrate that a significant proportion of HSV-expressing cells also express a detectable reporter transgene, indicative of delivery by AAV, especially in the SCGs with the highest degree of editing. Furthermore, these results clearly demonstrate that different neuronal subsets are preferentially transduced by different AAV serotypes. For example, AAV1 transduced 17.4% of cells in TG-3 and 16.6% of cells in TG-8, but only 2.3% of cells in the entire SCG, both of which were not transduced by HSV. +Although AAVRh10 transduced only 5.1% of cells in TG-3, 20.7% of cells in TG-8, and 23.5% of cells in the entire SCG, including 78.6% of HSV-expressing cells, the majority of the cells in the SCG. Together, these results suggest that a combination of AAV serotypes may be required to efficiently target all neurons containing latent HSV, and this combination was tested in a follow-up experiment in which a rationally selected combination of AAV serotypes was used for the delivery of dual meganuclease therapy. As predicted, the triple AAV serotype combination resulted in the greatest reduction in HSV burden, 92% in SCG and 54.8% in TG. These results suggest that the AAV serotypes combined for the delivery of meganuclease therapy need to be carefully selected and can likely be further improved. For example, the use of AAV1 alone resulted in the lowest reduction in HSV burden in both SCGs and TGs, and the addition of AAV1, either alone or in combination, appeared to add little efficacy to AAVRh10 or AAV8. Future studies should focus on identifying optimal combinations of AAVs to ensure complete coverage of all infected neurons and establishing whether such combinations are also effective in other model systems that would facilitate the human translation of this approach.

[0092] Somewhat unexpectedly, in the disclosed system, meganucleases provided substantially higher gene editing than Cas9 with any of the gRNAs tested. The simplest explanation for this may be due to the relative expression levels; due to its large size, Cas9 requires delivery by single-stranded (ss) AAV vectors, whereas meganucleases are easily adapted to the more transcriptionally competent self-complementary (sc) AAV, which does not require de novo second-strand synthesis or intermolecular annealing for transgene expression. It has previously been demonstrated that the use of scAAV vectors rather than ssAAV significantly improves transduction efficiency (McCarty, D. M. Self-complementary AAV vectors; advances and applications. Mol Ther 16, 1648-1656, doi:10.1038 / mt.2008.171 (2008)). Size restrictions also limited the choice of potential promoters for Cas9 expression. On the other hand, if true, these factors must be more important in vivo than in vitro, since high levels of HSV gene editing were achieved in vitro using these same AAV / promoter / Cas9 constructs. The low expression of sgRNAs detected in SCG and TG (only 40% and 20%, respectively) may partially explain the poor gene editing in vivo. However, it is not the only explanation, since m5 mRNA was detected in only 50% of ganglia, whereas the observed mutations amounted to 9.9% or 1.1% in SCG and TG, respectively. It cannot be excluded that the disclosed in vitro model systems may not fully recapitulate the state of viral latency achieved in vivo, particularly with regard to viral chromatinization (reviewed in Knipe, D. M. Nuclear sensing of viral DNA, epigenetic regulation of herpes simplex virus infection, and innate immunity. Virology 479-480, 153-159, doi:10.1016 / j.virol.2015.02.009 (2015)).However, we have previously shown that there was no detectable difference in the frequency of mutations induced by HSV-specific meganucleases in neuronal cultures established from TGs of mice during acute versus latent infection, which should differ in chromatinization. An intriguing possibility is that meganucleases may target highly compact and heterochromatic viral genomes better than Cas9, which would be consistent with their evolution in eukaryotes compared to that of Cas9 in prokaryotes. Future studies will need to systematically evaluate the expression of various classes of gene editing enzymes and their effectiveness against specific genomic and viral targets to address this issue.

[0093] Taken together, these results provide strong support for the continued development of gene editing as a strategy against latent HSV infection, as well as other chronic infections such as HBV and HIV. Recent studies using a similar approach against HIV show detectable eradication of HIV in some (but not all) humanized mice (Dash, PK et al. Sequential LASER ART and CRISPR Treatments Eliminate HIV-1 in a Subset of Infected Humanized Mice. Nat Commun 10, 2753, doi:10.1038 / s41467-019-10366-y (2019)). Similar studies have been performed in liver-humanized mice infected with HBV, achieving a nearly one-log reduction in intrahepatic HBV cccDNA levels along with a marked improvement in human hepatocyte viability. (Stone, D. et al., CRISPR-Cas9 gene editing of hepatitis B virus in chronically infected humanized mice. Molecular Therapy Methods & Clinical Development. 2020 Nov. 26; 20: 258-275. doi: 10.1016 / j.omtm.2020.11.014. PMID: 33473359; PMCID: PMC7803634). The genetic diversity of these viruses remains a concern, but careful informatics analysis can effectively address this issue (Roychoudhury, P. et al. Viral diversity is an obligate consideration in CRISPR / Cas9 designs for targeting the HIV reservoir. BMC Biol 16, 75, doi: 10.1186 / s12915-018-0544-1 (2018)). Translating this approach into clinical applications will require careful testing of its safety, including ensuring the absence of off-target cuts in the genome.The results also suggest important potential advantages for meganucleases, an underappreciated class of gene editing enzymes, especially their compact nature that allows for the use of highly optimized scAAV vectors and a broader selection of promoters.Sequence-specific meganucleases are more difficult to develop compared to CRISPR / Cas9, but this is only a minor issue for targets such as HSV, which have limited genetic diversity and a slow rate of genome evolution. In principle, a few optimized meganucleases should be sufficient to cover the full diversity of HSV-1 and HSV-2 observed in human infections, in contrast to other non-conserved viruses such as HBV and HIV (Roychoudhury, P. et al. Viral diversity is an obligate consideration in CRISPR / Cas9 designs for targeting the HIV reservoir. BMC Biol 16, 75, doi:10.1186 / s12915-018-0544-1 (2018); Schiffer, JT et al. Targeted DNA mutagenesis for the cure of chronic viral infections. J Virol 86, 8920-8936, doi:10.1128 / JVI.00052-12 (2012)). The levels of efficacy observed to date (>90% HSV reduction in SCG and >50% in TG) are likely to translate to humans, significantly reducing HSV reactivation, shedding, transmission, and pathology. Further optimization of enzyme delivery and the meganuclease itself may be possible, so that a treatment for HSV infection may ultimately be within reach.

[0094] method Cells and Herpes Viruses HEK293 (Graham, FL, Smiley, J., Russell, WC & Nairn, R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36, 59-74, doi:10.1099 / 0022-1317-36-1-59 (1977)) and Vero cell lines (ATCC#CCL-81) were propagated in Dubelcco's modified Eagle's medium supplemented with 10% fetal bovine serum. HSV-1 strain F (kindly provided by Dr J. Blaho) or syn17 + (kindly provided by Dr N. Sawtell) was used in the experiments, grown and titrated on Vero cells.

[0095] AAV production and titration The following AAV vector plasmids were used to generate AAV stocks in this study: pscAAV-CBh-m5, pscAAV-CBh-m8, pscAAV-CBh-m4, pssAAV-smCBA-m5-T2A-Trex2-2A-mCherry, pssAAV-sCMV-SaCas9-U6-sgRNA, pssAAV-CMV-SaCas9-U6-sgRNA, pssAAV-nEF-SaCas9-U6-sgRNA, pscAAV-CBh-NLS-mScarlet, pscAAV-CBh-NLS-mEGFP, pscAAV-CBh-NLS-DsRed-Express2, and pscAAV-CBh-NLS-mTagBFP2. AAV stocks of all serotypes were generated by transiently transfecting 293 cells with PEI at a ratio of 4:1 (μl PEI:μg DNA) according to the method of Choi et al. (Choi, VW, Asokan, A., Haberman, RA & Samulski, RJ Production of recombinant adeno-associated viral vectors for in vitro and in vivo use. Curr Protoc Mol Biol Chapter 16, Unit 16 25, doi:10.1002 / 0471142727.mb1625s78 (2007)). Briefly, 1.6 × 10 7HEK293 cells were transfected with 28 μg of DNA consisting of scAAV or ssAAV vector plasmid DNA, plasmids expressing AAV rep and capsid proteins, and a helper plasmid expressing adenovirus helper proteins (pHelper) in a ratio of 5:1:3, respectively. 24 h post-transfection, the medium was changed to serum-free DMEM, and 72 h later the cells were harvested and resuspended in AAV lysis buffer (50 mM Tris, 150 mM NaCl, pH 8.5) followed by freeze-thawing four times. AAV stocks were purified by iodixanol gradient separation (Choi, VW, Asokan, A., Haberman, RA & Samulski, RJ Production of recombinant adeno-associated viral vectors for in vitro and in vivo use. Curr Protoc Mol Biol Chapter 16, Unit 16 25, doi:10.1002 / 0471142727.mb1625s78 (2007); Zolotukhin, S. et al. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther 6, 973-985, doi:10.1038 / sj.gt.3300938 (1999)), followed by concentration into PBS using Amicon Ultra-15 columns (EMD Millipore) and storage at -80°C.All AAV vector stocks were quantified by qPCR using primers / probes against the AAV ITRs according to the method of Aurnhammer et al. (Aurnhammer, C. et al. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods 23, 18-28, doi:10.1089 / hgtb.2011.034(2012)) with linearized plasmid DNA as a standard. Prior to quantification, AAV stocks were treated with DNase I and proteinase K.

[0096] Establishment of neuronal cultures Neuronal cultures were inoculated at 2 x 10 into the wounded cornea. 5It was established from TGs taken from mice 7 days after infection with PFU HSV-1(F) (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Briefly, neuronal cultures were established after enzymatic digestion with collagenase and dispase (Invitrogen, Carlsbad, CA) (Bertke, ASet al. A5-positive primary sensory neurons are nonpermissive for productive infection with herpes simplex virus1 in vitro. J Virol 85, 6669-6677, doi:10.1128 / JVI.00204-11(2011)) and purification of the resulting cell homogenate using a Percoll gradient (12.5% ​​and 28%) (Malin, SA, Davis, BM & Molliver, DC Production of dissociated sensory neuron cultures and considerations for their use in studying neuronal function and plasticity. Nature protocols 2, 152-160, doi:10.1038 / nprot.2006.461(2007)). Neurons were counted and plated on poly-D-lysine and laminin-coated 12 mm circular slides (BD Biosciences, San Jose CA) at a density of 4,000 neurons per well. Neurons were cultured without removing non-neuronal cells that provide important growth support, and therefore these cultures contained a mixed population of neurons, satellite glial cells, and other cell types. Cultures were maintained in complete neuronal medium consisting of Neurobasal A medium supplemented with 2% B27 supplement, 1% PenStrep, L-glutamine (500 μM), and nerve growth factor (NGF, 50 ng / ml).The medium was replaced with fresh medium every 2–3 days. Acyclovir (100 nM, Sigma) was added to the medium for the first 5 days.

[0097] HSV infection and AAV inoculation of mice Mice were housed in accordance with institutional and NIH guidelines for the care and use of animals in research. Six to eight week old Swiss Webster mice (Charles River) were used for all studies. Ophthalmically HSV infected mice were anesthetized by intraperitoneal injection of ketamine (100 mg per kg) and xylazine (12 mg per kg) and then 2 × 10 sucrose was injected into the right eye after corneal scarring using a 28 gauge needle. 5 PFU of HSV1(F) or syn17+ were infected. For AAV inoculation, ketamine / xylazine-anesthetized mice were administered the indicated AAV vector doses unilaterally, either by intradermal whisker pad (WP), retro-orbital (RO) or tail vein (TV) injection. The right (ipsilateral) TG and both SCGs were harvested at the indicated times. The presence of AAV in the ganglia of treated mice was confirmed by ddPCR (Figure 12).

[0098] Tissue explant reactivation HSV was reactivated by incubating the harvested TG and SCG in 10% FBS-DMEM culture medium for 24 h, followed by total genomic DNA extraction as described below. After tissue reactivation, a statistically significant 2- to 3-fold increase in HSV genomes is detected in the reactivated tissues compared to the unactivated (latent) tissues in untreated (control mice) (Figures 2G-2H and 10F).

[0099] HSV target site PCR amplification Total genomic DNA (gDNA) was extracted using either the DNeasy Tissue & Blood micro kit (Qiagen, Valencia, CA) for neuronal cultures or the DNeasy Tissue & Blood mini kit (Qiagen, Valencia, CA) for total TG. Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) and 5 μl of gDNA were used to amplify the DNA. L HSV1m5 was generated using the UL19 primer: forward 5'-CTGGCCGTGGTCGTACATGA (SEQ ID NO: 37) and reverse 5'-TCACCGACATGGGCAACCTT (SEQ ID NO: 38), HSV1m8 was generated using the UL30 primer: forward 5'-GAGAACGTGGAGCACGCGTACGGC (SEQ ID NO: 39) and reverse 5'-GGCCCGGTTTGAGACGGTACCAGC (SEQ ID NO: 40), HSV1m4 was generated using the ICP0 primer: forward 5'-GACAGCACGGACACGGAACT (SEQ ID NO: 41) and reverse 5'-TCGTCCAGGTCGTCGTCATC (SEQ ID NO: 42), L 54 primer: forward 5'-GACCGCATCAGCGAGAGCTT (SEQ ID NO: 43) and reverse 5'-CTCGCAGACACGACTCGAAC (SEQ ID NO: 44) were used to synthesize SaCas9 / sgRNA UL54 (sgRNA13, sgRNA17, and sgRNA26), or U L 30- Primer: forward 5'-CGGCCATCAAGAAGTACGAG (SEQ ID NO: 45) and reverse 5'-AAGTGGCTCTGGCCTATGTC (SEQ ID NO: 46) were used to synthesize SaCas9 / sgRNA UL30 A region containing either the target site (sgRNA1 or sgRNA10) was PCR amplified under the thermocycler conditions of 94°C for 5 minutes, 40 to 45 cycles (94°C for 30 seconds, 60°C for 30 seconds, 70°C for 30 seconds), and then 70°C for 5 minutes.

[0100] T7 endonuclease 1 (T7E1) assay T7 endonuclease assays and quantification to determine the level of gene disruption were performed as follows: After PCR amplification of the target site from the HSV genome and purification using the Zymo Research clean and concentrator-5 kit (Zymo Research, Irvine CA), 300 ng of DNA amplicon was denatured at 95°C for 10 min and slowly reannealed by cooling to room temperature. DNA was then digested with 5-10 units of T7 endonuclease (New England Biolabs,) at 37°C for 30-60 min and resolved in an agarose gel. Quantification of gene disruption was performed using ImageJ software (NIH; Schneider, CA, Rasband, WS & Eliceiri, KW NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675, doi:10.1038 / nmeth.2089(2012)) and calculated using the formula: 100 × (1-[1-fraction cleaved]1 / 2), where fraction cleaved = density of cleaved products / (density of cleaved products + density of uncleaved products).

[0101] ddPCR quantification Viral genome quantification by ddPCR was performed using the AAV ITR primer / probe set and gB primer / probe set for HSV as previously described (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)). Cell numbers in tissues were quantified by ddPCR using the mouse-specific RPP30 primer / probe set: forward 5'-GGCGTTCGCAGATTTGGA (SEQ ID NO: 47), reverse 5'-TCCCAGGTGAGCAGCAGTCT (SEQ ID NO: 48), probe 5'-ACCTGAAGGCTCTGCGCGGACTC (SEQ ID NO: 49). In some control ganglia, sporadic samples were positive for AAV genomes, but typically at levels >2-3 logs lower than ganglia from treated mice that received AAV. This may be due to low-level contamination of occasional tissue samples.

[0102] Illumina Next Generation Sequencing (NGS) Next-generation sequencing of the meganuclease target sites was performed using PCR products generated with the target site-specific primers described above and a MiSeq sequencer (Illumina) (Aubert, M. et al. In vivo disruption of latent HSV by designer endonuclease therapy. JCI Insight 1, doi:10.1172 / jci.insight.88468(2016)).

[0103] Single-cell RNA analysis Swiss-Webster mice were administered 10 5Mice were latently infected with PFU HSV-1 syn17+ and 60 days later injected with one of four different AAV serotypes: 1, 8, PHP.S, and Rh10, each carrying a unique fluorescent protein transgene under the CBh promoter: mScarlet, mEGFP, DsRed.Express2, and TagBFP2, respectively. For each serotype, three mice were injected with 10 12 AAV genomes were independently injected subcutaneously into the whisker pad (AAV1) or intravenously into the retro-orbital vein (AAV8, PHP.S, and Rh10). After 3 weeks, TG and SCG from animals were collected and each tissue (TG or SCG) was pooled from all animals for neuronal isolation via enzymatic tissue digestion (see above), followed by density gradient centrifugation and enrichment using the Neuron Isolation Kit (Miltenyi BioTech.), which allows untouched neurons to flow through the column while non-neuronal cells remain attached.

[0104] Only two AAV8-mEGFP animals were used for cell preparation or analysis. Tissues and isolated neurons were maintained in ice-cold Neurobasal A medium supplemented with 2% B27 supplement, 1% PenStrep, L-glutamine (500 μM), or PBS throughout the procedure, except during the enzymatic tissue digestion step. Cells were encapsulated and scRNA-seq libraries were prepared at the Genomics Core Facility at FHCRC using the Chromium Single Cell3' Library and Gel Bead Kit v2 from 10X Genomic according to the manufacturer's instructions. 10x Genomics Single Cell3' expression libraries were sequenced on an Illumina HiSeq2500 operating in high-output mode using a paired-end (26bp × 8bp × 98bp) sequencing strategy. SCG and TG libraries were pooled and distributed across eight sequencing lanes. Image analysis and base calling were performed using RTA version 1.18.66.3. Sequencing reads were processed using 10X Genomics' Cell Ranger' v2.1.0 and Seurat v2.3.4 (Butler, A., Hoffman, P., Smibert, P., Papalexi, E. & Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol 36, 411-420, doi:10.1038 / nbt.4096 (2018)). High-quality sequence data were obtained from 2,372 purified TG neurons and 2,172 SCG neurons.

[0105] Statistics and Reproducibility GraphPad Prism7 software was used for statistical analysis. Comparisons of HSV loads were performed using multiple t-tests with alpha = 0.05%. Each tissue was analyzed separately without assuming consistent SD. HSV and AAV distributions in scRNA-seq experiments were calculated using chi-squared. 2Analysis was performed using a mean-average correlation test with alpha = 0.05. Because tissues from animals injected with different AAV serotypes / transgenes were pooled, cell numbers were normalized to input by multiplying the cell count by the number of animals that received that serotype divided by the total number of animals. Mean and error bars representing standard deviations are displayed on each graph. The results of the study were reproduced across experiments using different experimental setups.

[0106] RT-ddPCR quantification of SaCas9, sgRNA, and HSV1m5 expression An AllPrep DNA / RNA kit (Qiagen, Valencia, CA) was used to isolate DNA and RNA from ganglia collected in the experiment presented in Figure 4. 2 μl of RNA and the following primer / probe set: SaCas9-specific primers: SaCas9 forward 5'-CCGCCCGGAAAGAGATTATT (SEQ ID NO: 50), reverse 5'-CGGAGTTCAGATTGGTCAGTT (SEQ ID NO: 51), and probe [FAM]AGCTGCTGGATCAGATTGCCAAGA[MGB] (SEQ ID NO: 52); Tracr-specific primers: TRACR SaCas9, sgRNA, and HSV1m5 expression were quantified with One-step RT-ddPCR kits (BIO-RAD, Hercules, Calif.) using LS forward 5'-TGCCGTGTTTATCTCGTCAACT (SEQ ID NO: 53), reverse 5'-CCCGCCATGCTACTTATCTACTTAA (SEQ ID NO: 54), and probe [FAM]TTGGCGAGATTTTT[MGB] (SEQ ID NO: 55); HSV1m5 specific primers: m5 mega forward 5'-TGGACAGCCTGAGCGAGAA (SEQ ID NO: 56), reverse 5'-GCAGAGACAGAGGAGCAATGTG (SEQ ID NO: 57), and probe [FAM]CGGCCGGTGATTCCTCTGTTTCTAATTC[BHQ] (SEQ ID NO: 58). The cycling steps were as follows: reverse transcription 50°C for 60 min, enzyme activation 95°C for 10 min, 40 cycles (95°C for 30 sec, 60°C for 1 min, 70°C for 30 sec), followed by enzyme inactivation 98°C for 10 min.

[0107] Example 2 This example describes that the use of meganucleases in combination with bromodomain and extraterminal motif (BET) protein inhibitors, as described in Example 1, dramatically reduces viral load.

[0108] It is known that BET inhibitors reactivate HSV-1 in vivo and in vitro. (Ren, K., et al., An Epigenetic Compound Library Screen Identifies BET Inhibitors that Promote HSV-1 and-2 Replication by Bridging P-TEFb to Viral Gene Promoters through BRD4, PLOS Pathogens, October 20, 2016, https: / / doi.org / 10.1371 / journal.ppat.1005950, Alfonso-Dunn, R., et al., Transcriptional Elongation of HSV Immediate Early Genes by the Super Elongation Complex Drives Lytic Infection and Reactivation from Latency, Cell Host & Microbe, vol. 21, issue 4, April 12, 2017, 507-517.e). However, Ren et al. and Alfonso-Dunn et al. did not investigate whether the BET inhibitor, JQ1, caused mice to shed virus from mucosal surfaces - mice do not shed spontaneously. The inventors determined that JQ1 caused mice to shed virus from mucosal surfaces, allowing the mouse model to be used in shedding experiments to examine whether meganucleases reduce BET-mediated shedding and whether the combination of meganucleases and BET inhibitors reduces HSV-1 load.

[0109] JQ1 treatment results in excretion First, a mouse model for BET-induced shedding was validated. In this model, latently infected mice were divided into three experimental groups to determine the effect of the BET inhibitor JQ1 on HSV-1 reactivation. As shown in Figure 19, Groups 1 and 2 were JQ1 groups that received an intraperitoneal injection of 50 mg / kg of JQ1. Group 3 was the control group, i.e., no JQ1 injection. Mice in Group 1 received two injections, one JQ1 injection at 0 hours and a second JQ1 injection at 12 hours. Mice in Group 2 received one injection at 0 hours. Mice in Group 3 received one control injection at 0 hours. To determine shedding from mucosal surfaces, as an indicator of HSV-1 reactivation, mice were swabbed at 0 hours (control) and this swab was compared to swabs taken at 24 hours, 48 ​​hours, and 72 hours. As shown in Figures 20A-20C, no shedding was detected in control mice (Figure 20A, Group 3, Figure 19). However, shedding was detected in mice receiving a single JQ1 dose (group 2, FIG. 19), which peaked on day 2 after JQ1 injection. FIG. 20B. Furthermore, in FIG. 20C, shedding was also detected in mice receiving two doses of JQ1 (group 1, FIG. 19). These data indicate that JQ1 causes mice to shed virus from mucosal surfaces, and the onset and duration of shedding appear to be dependent on JQ1 in a dose-dependent manner. The onset and duration of viral shedding in the double JQ1 dose are compared to the single JQ1 dose.

[0110] Meganuclease and JQ1 treatment reduced viral load A shedding mouse model (Figure 19) was used to determine whether meganuclease treatment reduces JQ1-induced shedding and whether treatment with meganuclease and JQ1 reduces HSV load. Meganuclease therapy reduced JQ1 shedding by >95% (data not shown). To determine whether the combination of meganuclease and JQ1 reduces HSV-1 load, latently infected mice were separated into SCG and TG groups. Figure 21. Within each group, mice were further divided into three treatment groups: (1) latency, (2) 48 hours after JQ1 treatment, and (3) 96 hours after JQ1 treatment. Each treatment group had a control and was treated with dual meganuclease (m5+m8) as described in Example 1. As shown in the latency treatment group, i.e., without JQ1 treatment, meganuclease treatment did not reduce viral load in TG cells compared to the control. Figure 21B. In SCG cells, meganuclease treatment reduced the viral load by 82.4% compared to the control. Figure 21A. In the 48-hour group after JQ1 treatment, meganuclease + JQ1 treatment reduced the viral load by 83.2% in SCG cells compared to the control (Figure 21A), but had no effect in TG cells (Figure 21B). However, in the 48-hour group after JQ1 treatment, meganuclease + JQ1 reduced the viral load by 97.4% in SCG cells (Figure 21A), and surprisingly, reduced the viral load by 97.3% in TG cells (Figure 21B). Thus, these data indicate that the BET inhibitor, JQ1, can be used to increase meganuclease editing, especially in TG cells, where editing has been observed to be weaker. The embodiments of the invention in which an exclusive right or privilege is claimed are defined as follows:

Claims

1. A composition for use in a method for reducing or eliminating latent herpes simplex virus type 1 (HSV-1) reactivation in a cell, said composition comprising one or more viral vectors comprising one or more sequences encoding one or more HSV-1 specific meganucleases, said method comprising delivering said one or more viral vectors to an HSV-1 infected cell.

2. 2. The composition of claim 1, wherein the one or more viral vectors are self-complementary adeno-associated virus (scAAV) and / or single-stranded adeno-associated virus (ssAAV).

3. The composition of claim 2, wherein the one or more viral vectors is a scAAV.

4. 4. The composition of claim 3, wherein the one or more scAAV comprises AAV-Rh10, AAV8, AAV1 serotype adeno-associated virus, or a combination thereof.

5. 5. The composition of claim 3 or claim 4, wherein the one or more scAAV comprises an AAV-Rh10 or AAV8 serotype adeno-associated virus.

6. The composition of any one of claims 1 to 5, wherein the one or more HSV-1 specific meganucleases are configured to induce one or more DNA double strand breaks (DSBs).

7. The composition of any one of claims 1 to 6, wherein the one or more HSV-1 specific meganucleases are meganucleases configured to target one or more HSV-1 genes essential for replication.

8. The composition of any one of claims 1 to 7, wherein the one or more meganucleases comprise the sequences set forth in SEQ ID NOs: 1 to 3.

9. The composition of any one of claims 1 to 8, wherein the one or more meganucleases are meganucleases configured to target one or more sequences set forth in SEQ ID NOs: 4 to 6.

10. The composition of any one of claims 3 to 9, wherein the method comprises delivering an scAAV comprising two or more sequences encoding one or more HSV-1 specific meganucleases.

11. The composition of any one of claims 3 to 9, wherein the method comprises delivering two scAAVs, each comprising one or more sequences encoding one or more HSV-1 specific meganucleases.

12. 10. The composition of any one of claims 3 to 9, wherein the method comprises delivering two different scAAVs, each comprising a sequence encoding an HSV-1 specific meganuclease, said sequences being the same or different.

13. The composition of any one of claims 1 to 12, wherein the cell is in a mammalian subject.

14. The composition of claim 13, wherein the mammalian subject is a human.

15. The composition of any one of claims 1 to 14, wherein the cells are superior cervical ganglion (SCG) cells, trigeminal ganglion (TG) cells, or a combination thereof.

16. The composition of any one of claims 13 to 15, wherein the one or more scAAVs are delivered with one or more pharma- ceutically acceptable carriers adapted for injection.

17. The composition of claim 16, wherein the one or more scAAVs are delivered to the subject by subcutaneous injection.

18. The composition of claim 16, wherein the one or more scAAVs are delivered to the subject by intramuscular injection.

19. The composition of any one of claims 1 to 18, wherein the method further comprises administering a bromodomain and extraterminal (BET) protein inhibitor to the HSV-1 infected cell.

20. 20. The composition of claim 19, wherein the method comprises administering the BET protein inhibitor to the HSV-1 infected cell prior to delivering one or more scAAVs comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell.

21. 20. The composition of claim 19, wherein the method comprises administering the BET protein inhibitor to the HSV-1 infected cell after delivering one or more scAAVs comprising one or more sequences encoding one or more HSV-1 specific meganucleases to the HSV-1 infected cell.

22. 20. The composition of claim 19, wherein the method comprises administering the BET protein inhibitor to the HSV-1 infected cell in conjunction with delivering to the HSV-1 infected cell one or more scAAVs that comprise one or more sequences encoding one or more HSV-1 specific meganucleases.

23. The composition of any one of claims 19 to 22, characterized in that the BET protein inhibitor is administered at a dose sufficient to provide a concentration of 3 μM or less in the HSV-1 infected cells.

24. 24. The composition of any one of claims 19 to 23, wherein the BET protein inhibitor is selected from the group of JQ1, virabresib, molybresib, apabetalone, ZEN-3694, BMS-986158, and INC-B057643.

25. The composition of any one of claims 19 to 24, wherein the method reduces HSV-1 load in the SCG cells by at least 97% at least 96 hours after administration of the BET protein inhibitor.

26. The composition of any one of claims 19 to 24, wherein the method reduces HSV-1 load in the SCG cells by at least 83% at least 48 hours after administration of the BET protein inhibitor.

27. The composition of any one of claims 19 to 24, wherein the method reduces HSV-1 load in the TG cells by at least 97% 96 hours after administration of the BET protein inhibitor.

28. A composition for reducing or eliminating latent HSV-1 reactivation in a cell, the composition comprising one or more viral vectors comprising one or more sequences encoding one or more HSV-1 specific meganucleases.

29. 29. The composition of claim 28, wherein the one or more viral vectors are self-complementary adeno-associated virus (scAAV) and / or single-stranded adeno-associated virus (ssAAV).

30. 30. The composition of claim 29, wherein the one or more viral vectors is a scAAV.

31. 31. The composition of claim 30, wherein the one or more scAAV is AAV-Rh10, AAV8, AAV1 serotype adeno-associated virus, or a combination thereof.

32. The composition of claim 30 or 31, wherein the one or more scAAV is an AAV-Rh10 or AAV8 serotype adeno-associated virus.

33. The composition of any one of claims 28 to 32, wherein the one or more HSV-1 specific meganucleases are configured to induce one or more DNA double strand breaks (DSBs).

34. The composition of any one of claims 28 to 33, wherein the one or more HSV-1 specific meganucleases are meganucleases configured to target one or more HSV-1 genes essential for replication.

35. The composition of any one of claims 28 to 34, wherein the one or more meganucleases are meganucleases comprising a sequence as set forth in SEQ ID NOs: 1 to 3.

36. The composition of any one of claims 28 to 35, wherein the one or more meganucleases are meganucleases configured to target one or more sequences set forth in SEQ ID NOs: 4 to 6.

37. The composition of any one of claims 28 to 36, wherein the composition comprises one or more pharma- ceutically acceptable carriers adapted for subcutaneous injection.

38. The composition of any one of claims 28 to 37, wherein the composition further comprises a bromodomain and extraterminal (BET) protein inhibitor.

39. 39. The composition of claim 38, wherein the BET protein inhibitor is administered at a dose sufficient to provide a concentration of at least 3 μM or less in HSV-1 infected cells.

40. 40. The composition of claim 38 or 39, wherein the BET protein inhibitor is selected from the group consisting of JQ1, virabresib, molybresib, apabetalone, ZEN-3694, BMS-986158, and INC-B057643.

41. 41. The composition of any one of claims 38-40, wherein the composition reduces HSV-1 load in superior cervical ganglion cells (SCG) by at least 97% 96 hours after administration of the BET protein inhibitor.

42. 41. The composition of any one of claims 38 to 40, wherein the composition reduces the HSV-1 load in the SCG cells by at least 83% 48 hours after administration of the BET protein inhibitor.

43. 41. The composition of any one of claims 38-40, wherein the composition reduces HSV-1 load in trigeminal ganglion cells (TG) by at least 97% 96 hours after administration of the BET protein inhibitor.

Images