Compounds and methods for modulating huntingtin

Abstract

Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of HTT RNA in a cell or subject, and in certain examples, for reducing the amount of HTT protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for preventing, treating, or alleviating at least one symptom or characteristic of repeat expansion diseases. Such repeat expansion diseases include myotonic dystrophy, amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorders, fragile X syndrome, and spinocerebellar ataxia. Such symptoms or characteristics include brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, and depression.

Description

[Technical field]

[0001] Sequence Listing This application has been filed in electronic format with a sequence listing, which is provided under the filename BIOL0413WOSEQ_ST25.txt, created on January 24, 2022, and is 1.204 MB in size. The information in the electronic format of this sequence listing is incorporated herein by reference in its entirety.

[0002] Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount of HTT RNA in cells or subjects, and in certain examples, for reducing the amount of HTT protein in cells or subjects.In certain embodiments, the compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of repeat expansion disease, such as Huntington's disease.Such symptoms or characteristics of Huntington's disease include, but are not limited to, brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movement, seizures, tremors, anxiety, and depression. [Background technology]

[0003] Repeat expansion diseases are a group of diseases characterized by a pathological number of consecutive repeat units in a region of a gene, where each repeat unit consists of several linked nucleosides with the same nucleic acid base sequence as the other repeat units. In general, repeat expansion diseases are hereditary. In some cases, individuals are born with a pathological number of repeat units and show symptoms from early childhood. In other cases, individuals are born with a normal or near-normal number of repeats. However, due to genetic mutations and genetic instability, the number of repeats increases with cell division, time, and age. The expanded region of a gene eventually has a pathological effect, which is most often observed as a neurological symptom. Many repeat expansion diseases are classified as spinocerebellar ataxias, neurodegenerative diseases, or neuromuscular diseases. Non-limiting examples of repeat expansion diseases are myotonic dystrophies (DM1 and DM2), Huntington's disease (HD), and many autosomal dominant spinocerebellar ataxias, some forms of amyotrophic lateral sclerosis and / or frontotemporal dementia, various polyglutamine disorders (including spinal and bulbar muscular atrophy), fragile X syndrome, and Friedrich's ataxia.

[0004] HD is caused by an expansion of a cytosine-adenine-guanine (CAG) trinucleotide repeat region in IT15, the gene that codes for the huntingtin protein (HTT protein). The resulting expanded CAG repeat region encodes an abnormally long polyglutamine (PolyQ) tract of the HTT protein, leading to the expression of mutant HTT (mHTT) protein. As a result of the excess polyglutamine length, the mHTT protein forms aggregates in the cytoplasm and nucleus of CNS neurons (Davies et al., Cell 1997, 90:537-548). Due to its genomic instability, the expanded CAG repeat region can further expand and include additional CAG repeats with age and during meiosis. Individuals with 27-35 CAG repeats typically do not develop HD, but their children are at risk of developing HD. Individuals with 35-60 CAG repeats typically experience adult-onset HD. Individuals with more than 60 CAG repeats typically develop early-onset HD, experiencing symptoms of HD by age 20. Individuals with a normal number of CAG repeats (fewer than 27) are not considered at risk for developing HD. Summary of the Invention

[0005] Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount of HTT RNA, and in certain embodiments, for reducing the amount or activity of HTT protein in a cell or subject. In certain embodiments, the HTT RNA is mHTT RNA. In certain embodiments, the HTT protein is mHTT protein. In certain embodiments, the subject has or is at risk of having a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is a repeat expansion disease. In certain embodiments, the repeat expansion disease is myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, various polyglutamine disorders, fragile X syndrome, or spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, or Friedrich's ataxia). In certain embodiments, the compounds useful for reducing the amount of HTT RNA and / or HTT protein are oligomeric compounds. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide.

[0006] Also provided herein is a method useful for alleviating symptoms or characteristics of neurodegenerative disease.In certain embodiments, the neurodegenerative disease is a repeat expansion disease.In certain embodiments, the repeat expansion disease is myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, various polyglutamine disorders, fragile X syndrome, or spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, or Friedrich's ataxia). In certain embodiments, the symptom or feature is brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, disturbed muscle movements, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, attention disorder, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired learning ability, impaired concentration, impaired speech, depression, irritability, anger, impaired movement, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" and other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.

[0008] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and papers, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0009] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, organic synthetic chemistry, and medicinal and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0010] Unless otherwise stated, the following terms have the following meanings. As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0011] As used herein, "2'-MOE" or "2'-MOE sugar moiety" or "2'-O-methoxyethyl ribose modified sugar" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "MOE" means methoxyethyl. Unless otherwise indicated, 2'-MOE has the β-D stereochemical configuration.

[0012] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0013] As used herein, "2'-OMe" or "2'-O-methyl sugar moiety" means a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, 2'-OMe has a β-D stereochemical configuration.

[0014] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0015] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0016] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0017] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not linked to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0018] As used herein, "administration" or "administering" means providing a pharmaceutical agent or composition to a subject.

[0019] As used herein, "alleviate" in relation to treatment means that at least one symptom or feature is improved, compared to the same symptom or feature in the absence of treatment.In certain embodiments, alleviation is a decrease in the severity or frequency of a symptom or feature, or a delay in the onset of a symptom or feature, or a delay in the progression of the severity or frequency of a symptom or feature.In certain embodiments, the symptom or feature is brain atrophy, decreased brain activity, decreased brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, glucose intolerance, weight loss, osteoporosis, testicular atrophy, general function disorder, motor function disorder, cognitive function disorder, daily function disorder, attention disorder, visual-perceptual processing disorder, working memory disorder, psychomotor speed disorder, speech motor output disorder, independence disorder, apathy disorder, learning ability disorder, mental concentration disorder, speech disorder, depression, irritability, anger, movement disorder, self-care disorder, pain, discomfort, anxiety, suicidal ideation, or suicidal behavior. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those of skill in the art.

[0020] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.

[0021] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0022] As used herein, "antisense compound" refers to an oligomeric compound that can achieve at least one antisense activity. In certain embodiments, the antisense compound further comprises one or more additional features, such as a conjugate group.

[0023] As used herein, a "sense compound" refers to a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group. As used herein, a "bicyclic nucleoside" or "BNA" refers to a nucleoside that includes a bicyclic sugar moiety.

[0024] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that contains two rings, the second ring being formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl sugar moiety.

[0025] As used herein, "CAG repeat" means one of a plurality of consecutive trinucleotide units, each trinucleotide unit consisting of three consecutive nucleosides having a 5' to 3' nucleobase sequence of cytosine (C), adenine (A), and guanine (G).

[0026] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid. aCSF is a buffered solution that closely matches the electrolyte concentrations of CSF.

[0027] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, e.g., within a cell, a subject, or a human.

[0028] As used herein, a "cell targeting moiety" refers to a conjugated moiety that interacts with a cell or a portion thereof. In certain embodiments, the cell targeting moiety binds to a receptor on the surface of a cell.

[0029] As used herein, "chiral enriched population" refers to a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chiral enriched population of molecules with multiple chiral centers in each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide.

[0030] As used herein, "chirally controlled" with respect to an internucleoside linkage means that the chirality of that linkage is enriched in a particular stereochemical configuration.

[0031] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the target nucleic acid or one or more portions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite directions. As used herein, "complementary nucleobases" refers to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or target nucleic acids need not have complementary nucleobases at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to another oligonucleotide or a target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0032] As used herein, "conjugate group" refers to an atomic group that is directly attached to an oligonucleotide. The conjugate group includes a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate moiety includes a cell targeting moiety.

[0033] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that links a conjugate moiety to an oligonucleotide.

[0034] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0035] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety, where the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0036] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0037] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0038] As used herein, a "deoxy region" refers to a region of 5-12 contiguous nucleotides, at least 70% of the nucleosides being 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0039] As used herein, "diluent" refers to an ingredient in a composition that has no pharmacological activity, but is pharmacologic necessary or desirable. For example, the diluent in an injected composition may be a liquid, such as aCSF, PBS, or saline solution.

[0040] As used herein, a "gapmer" refers to an oligonucleotide having a central region comprising multiple nucleosides that support RNaseH1 cleavage located between a 5' region and a 3' region. As used herein, the nucleosides of the 5' region and the 3' region each comprise a 2'-modified furanosyl sugar moiety, and the 3'-most nucleoside and the 5'-most nucleoside of the central region each comprise a sugar moiety independently selected from a 2'-deoxyfuranosyl sugar moiety or a sugar surrogate. The position of the central region refers to the order of the nucleosides in the central region, counting from the 5' end of the central region. Thus, the 5'-most nucleoside of the central region is at position 1 of the central region. The "central region" may be referred to as a "gap," and the "5' region" and the "3' region" may be referred to as "wings" or "wing segments." In certain embodiments, the central region is a deoxy region. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0041] As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising 2'-β-D-deoxynucleosides and wings comprising 2'-MOE nucleosides.

[0042] As used herein, the term "mixed winged gapmer" refers to a gapmer having wings that comprise modified nucleosides that contain at least two different sugar modifications.

[0043] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric agent- or oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0044] As used herein, "HTT RNA" is the RNA expression product of the human gene IT15. "mHTT RNA" is the RNA expression product of the human gene IT15 that contains 27 or more consecutive CAG repeats.

[0045] As used herein, an "HTT protein" is the protein expression product of HTT RNA. An "mHTT protein" is the protein expression product of mHTT.

[0046] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0047] As used herein, "IT15 gene" refers to the genomic sequence that encodes HTT RNA. Generally, humans have two IT15 genes that can have the same or different nucleobase sequences.

[0048] As used herein, "identifying a subject at risk of developing a repeat expansion disease" means identifying a subject who has been diagnosed with a repeat expansion disease or who has risk factors for developing a repeat expansion disease.

[0049] As used herein, the term "internucleoside bond" refers to the covalent bond between consecutive nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" or "PS internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0050] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0051] As used herein, "inverted sugar moiety" means an inverted nucleoside sugar moiety or an abasic sugar moiety having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0052] As used herein, "linked nucleosides" are nucleosides that are connected in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0053] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0054] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence when the first and second nucleic acid sequences are aligned in opposite orientations.

[0055] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0056] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0057] As used herein, "nucleobase" refers to unmodified or modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five types of unmodified nucleobases.

[0058] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0059] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0060] As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0061] As used herein, "oligomeric agent" refers to an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.

[0062] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0063] The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0064] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, each of which may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification. An oligonucleotide may be paired or unpaired with a second oligonucleotide that is complementary to the oligonucleotide. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0065] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to a subject. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a pill, tablet, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by an animal. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, a sterile buffer solution, or sterile artificial cerebrospinal fluid. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is phosphate buffered saline. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is artificial cerebrospinal fluid.

[0066] As used herein, "pharmaceutical acceptable salt" refers to a physiologically and pharmaceutical acceptable salt of a compound. A pharmaceutical acceptable salt retains the desired biological activity of the parent compound and does not impart undesired toxicological effects to the parent compound. As used herein, "potassium salt" refers to a salt of a modified oligonucleotide, the cation of the salt is potassium. As used herein, "sodium salt" refers to a salt of a modified oligonucleotide, the cation of the salt is sodium.

[0067] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0068] As used herein, "prevent" or "preventing" refers to delaying or forestalling the onset or development of a neurodegenerative disease, or a symptom or characteristic thereof, for a period of time or indefinitely.

[0069] As used herein, "prodrug" refers to a therapeutic agent that is in a first form outside the body that is converted to a second form within the subject or cells thereof. Generally, the conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0070] As used herein, "reducing the amount or activity" or "inhibiting the amount or activity," in reference to gene transcripts (RNA), refers to a reduction or blocking of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0071] As used herein, "reducing the amount or activity" or "inhibiting the amount or activity," in reference to a protein, refers to a reduction or blocking of the expression or activity of the protein relative to the expression or activity of the protein in an untreated or control sample, and does not necessarily indicate a total elimination of the expression or activity of the protein.

[0072] As used herein, "repeat expansion disease" refers to a disease associated with an increase in the number of consecutive repeat units in a region of a gene in a subject, where each repeat unit consists of 3 to 10 linked nucleosides having the same nucleobase sequence as the other repeat units, compared to a control subject without the disease. In certain embodiments, the subject experiences a symptom or characteristic of a repeat expansion disease.

[0073] As used herein, "repeat region" means a region of a gene that contains three or more consecutive repeat units, each of which consists of 3 to 10 linked nucleosides having the same nucleobase sequence as the other repeat units. Non-limiting examples of repeat units are CTG, CUG, CAG, CUG, GGGGCC, CAG, GAA, CAA, and ATTCT.

[0074] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0075] As used herein, "RNAi agent" refers to an antisense compound that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNaseH.

[0076] As used herein, "RNaseH agent" refers to an antisense agent that acts via RNaseH to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNaseH agent is single stranded. In certain embodiments, the RNaseH agent is double stranded. The RNaseH agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNaseH agent modulates the amount and / or activity of a target nucleic acid. The term RNaseH agent excludes antisense agents that act primarily via RISC / Ago2.

[0077] As used herein, "single-stranded" refers to nucleic acids (including, but not limited to, oligonucleotides) that are unpaired and not part of a double strand. Single-stranded compounds can hybridize with complementary nucleic acids to form double strands, at which point they are no longer single-stranded.

[0078] As used herein, a "stabilized phosphate group" refers to a 5' phosphate analog that is more metabolically stable than the 5' phosphate naturally occurring on DNA or RNA.

[0079] As used herein, "standard in vitro assay" means the assays described in Examples 1, 2, and 3, as well as reasonable variations thereof.

[0080] As used herein, "standard in vivo assay" refers to the assay described in Example 9 and reasonable variations thereof.

[0081] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules that have the stereorandom chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereorandom chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered to be random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0082] As used herein, "subject" refers to a human or non-human animal. In certain embodiments, the subject is a human subject. A "subject in need thereof" is a subject that will benefit from administration of the modified oligonucleotide disclosed herein. In certain embodiments, the subject in need thereof has HD.

[0083] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0084] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be conjugated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0085] As used herein, "symptom or characteristic" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing the subject. In certain embodiments, the characteristic is evident by invasive diagnostic testing, including but not limited to post-mortem examination.

[0086] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid to which an antisense compound is designed to act. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0087] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0088] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0089] As used herein, "treating" refers to improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms for the same condition in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, or delays the onset of a symptom, or delays the progression of a symptom, or delays the severity or frequency of a symptom.

[0090] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic effect to a subject. For example, a therapeutically effective amount ameliorates a symptom or characteristic of a disease.

[0091] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0092] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of HTT RNA, and said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0093] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of SEQ ID NOs: 26-3707.

[0094] Embodiment 3.1 comprises 2 to 30 linked nucleosides, a) at least 12, at least 13, at least 14, at least 15, at least 16, or 17 consecutive nucleic acid bases of any of SEQ ID NOs: 26 to 857 or 3552 to 3590; b) at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases of any of SEQ ID NOs: 858 to 3551 or 3591 to 3682; or c) at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleic acid bases of any of SEQ ID NOs: 3683 to 3707; 2. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising:

[0095] Embodiment 4.1 comprises 2 to 30 linked nucleosides, An isometric portion of nucleobases 56443 to 56500 of SEQ ID NO: 2; An isometric portion of nucleobases 62833 to 62860 of SEQ ID NO: 2; An isometric portion of nucleobases 69788 to 69824 of SEQ ID NO: 2; An isometric portion of nucleobases 9984 to 10008 of SEQ ID NO: 2; An isometric portion of nucleobases 106863 to 106924 of SEQ ID NO: 2; An isometric portion of nucleobases 115297 to 115337 of SEQ ID NO: 2; An isometric portion of nucleobases 117868 to 117902 of SEQ ID NO: 2; An isometric portion of nucleobases 119644 to 119670 of SEQ ID NO: 2; an isometric portion of nucleobases 126780 to 126829 of SEQ ID NO: 2; or An isometric portion of nucleobases 130388 to 130418 of SEQ ID NO: 2; 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases complementary to SEQ ID NO: 6, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0096] Embodiment 5.1 comprises 2 to 30 linked nucleosides, SEQ ID NOs: 1184, 1274, 1331, 1455, 1481, 1562, and 1684; SEQ ID NOs: 3029, 3104, 3557, 3562, 3569, 3586, 3610, 3620, 3622, 3623, 3627, 3634, 3664, 3687, 3692, and 3697, SEQ ID NOs: 2750, 2814, 2887, 2991, and 3090; SEQ ID NOs: 2581, 2640, 2736, 2857, and 2917; SEQ ID NOs: 1105, 1232, 1249, 3330, 3342, 3344, 3362, 3382, 3411, 3419, 3439, 3456, 3475, 3488, 3491, 3511, 3531, 3550, and 3551, SEQ ID NOs: 2208, 2310, 2335, 2471, 3553, 3559, 3563, 3565, 3570, 3580, 3581, 3583, 3585, 3589, 3593, 3594, 3597, 3600, 3601, 3604, 3614, 3616, 3630, 3631, 3637, 3648, 3650, 3652, 3653, 3660, 3661, 3662, 3684, and 3689, SEQ ID NOs: 2644, 2770, 2786, 2916, 3574, 3576, 3578, 3587, 3665, 3666, 3667, 3668, 3669, 3670, 3671, 3672, 3673, 3674, 3675, 3676, 3686, 3694, and 3698, SEQ ID NOs: 919, 940, 3677, 3678, 3679, 3680, 3681, 3682, 3705, 3706, and 3707, SEQ ID NOs: 1576, 1652, 1771, 1813, 1933, 1987, 2078, 3552, 3555, 3558, 3560, 3572, 3573, 3575, 3579, 3584, 3598, 3608, 3611, 3613, 3619, 3628, 3635, 3644, 3646, 3649, 3663, 3683, 3688, 3690, 3700, 3701, 3702, 3703, and 3704, and SEQ ID NOs: 1343, 1406, 1539, 3335, 3401, 3472, 3477, 3519, and 3591; 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of a sequence selected from the group consisting of:

[0097] Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-5 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0098] Embodiment 7. The oligomeric compound according to any one of embodiments 1 to 6, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 12 to 20, 12 to 25, 12 to 30, 13 to 20, 13 to 25, 13 to 30, 14 to 20, 14 to 25, 14 to 30, 15 to 20, 15 to 25, 15 to 30, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 17 to 20, 17 to 25, 17 to 30, 18 to 20, 18 to 25, 18 to 30, 19 to 20, 19 to 25, 19 to 30, 20 to 25, 20 to 30, 21 to 25, 21 to 30, 22 to 25, 22 to 30, 23 to 25, or 23 to 30 linked nucleosides.

[0099] Embodiment 8. The oligomeric compound according to any one of embodiments 1 to 7, wherein said modified oligonucleotide comprises at least one modified nucleoside.

[0100] Embodiment 9. The oligomeric compound of embodiment 8, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0101] Embodiment 10. The oligomeric compound of embodiment 9, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0102] Embodiment 11. The oligomeric compound of embodiment 10, wherein the bicyclic sugar moiety has a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0103] Embodiment 12. The oligomeric compound according to any one of embodiments 8 to 11, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a non-bicyclic modified sugar moiety.

[0104] Embodiment 13. The oligomeric compound of embodiment 12, wherein said non-bicyclic modified sugar moiety is a 2'-MOE modified sugar moiety or a 2'-cEt modified sugar moiety.

[0105] Embodiment 14. The oligomeric compound of any one of embodiments 8 to 13, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0106] Embodiment 15. The oligomeric compound of embodiment 14, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0107] Embodiment 16. The oligomeric compound according to any one of embodiments 1 to 15, wherein the modified oligonucleotide is a gapmer.

[0108] Embodiment 17. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0109] EMBODIMENT 18. the 5' region consists of five linked 5' region nucleosides; said central region consists of 10 linked central region nucleosides; the 3' region consists of five linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0110] EMBODIMENT 19. the 5' region consists of 6 linked 5' region nucleosides; said central region consists of 10 linked central region nucleosides; the 3' region consists of four linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0111] EMBODIMENT 20. the 5' region consists of five linked 5' region nucleosides; said central region consists of eight linked central region nucleosides; the 3' region consists of five linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0112] EMBODIMENT 21. the 5' region consists of four linked 5' region nucleosides; said central region consists of eight linked central region nucleosides; the 3' region consists of five linked 3' region nucleosides; 18. The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0113] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 21, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0114] Embodiment 23 The oligomeric compound according to embodiment 22, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0115] Embodiment 24 The oligomeric compound according to embodiment 22 or embodiment 23, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0116] Embodiment 25 The oligomeric compound according to embodiment 22, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0117] Embodiment 26 The oligomeric compound of any of embodiments 22, 23, or 25, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0118] Embodiment 27. The oligomeric compound according to any of embodiments 22, 23, or 25-26, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

[0119] Embodiment 28. The internucleoside linkage motif of the modified oligonucleotide is 5'-soossssssssssooss-3', 5'-sooossssssssssssss-3', 5'-sooossssssssssssssoos-3', 5'-sosssssssssssssssss-3', 5'-ssoosssssssssssssss-3', 5' 28. The oligomeric compound of any of embodiments 1-23, or 25-27, wherein the amino acid sequence is selected from -sooosssssssssooss-3', 5'-sossssssssssssss-3', and 5'-sooooossssssssssss-3', wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0120] Embodiment 29. The oligomeric compound according to any one of embodiments 1 to 28, wherein the modified oligonucleotide comprises a modified nucleobase.

[0121] Embodiment 30 The oligomeric compound of embodiment 29, wherein said modified nucleobase is 5-methylcytosine.

[0122] Embodiment 31 The oligomeric compound of any one of embodiments 1 to 30, wherein the modified oligonucleotide comprises a deoxy region.

[0123] Embodiment 32 The oligomeric compound of embodiment 31, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.

[0124] Embodiment 33. The oligomeric compound according to embodiment 31 or embodiment 32, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

[0125] Embodiment 34 The oligomeric compound of any of embodiments 31-33, wherein each nucleoside immediately adjacent to said deoxy region comprises a modified sugar moiety.

[0126] Embodiment 35. The oligomeric compound of any of embodiments 31 to 34, wherein the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and on the 3' side to a 3' region consisting of 1 to 6 linked 3' region nucleosides, at least one nucleoside of the 5' region contains a modified sugar moiety, and at least one nucleoside of the 3' region contains a modified sugar moiety.

[0127] Embodiment 36 The oligomeric compound of embodiment 35, wherein each nucleoside of the 5' region comprises a modified sugar moiety.

[0128] Embodiment 37 The oligomeric compound of embodiment 35 or embodiment 36, wherein each nucleoside of the 3' region comprises a modified sugar moiety.

[0129] Embodiment 38. The oligomeric compound according to any one of embodiments 1 to 37, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.

[0130] Embodiment 39. The oligomeric compound according to any one of embodiments 1 to 38, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0131] Embodiment 40. The oligomeric compound according to any one of embodiments 1 to 38, wherein said modified oligonucleotide consists of 18 linked nucleosides.

[0132] Embodiment 41. The oligomeric compound according to any one of embodiments 1 to 38, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0133] Embodiment 42. The oligomeric compound of any one of embodiments 1 to 41, wherein the modified oligonucleotide is a pharma- ceutically acceptable salt.

[0134] Embodiment 43. The oligomeric compound according to embodiment 42, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0135] Embodiment 44. An oligomeric compound according to any one of embodiments 1 to 43, which comprises the modified oligonucleotide.

[0136] Embodiment 45. The oligomeric compound of any one of embodiments 1 to 44, wherein the oligomeric compound comprises a conjugate group.

[0137] Embodiment 46 The oligomeric compound according to embodiment 45, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0138] Embodiment 47. The oligomeric compound according to embodiment 46, wherein the conjugate linker consists of a single bond.

[0139] Embodiment 48 The oligomeric compound according to embodiment 46, wherein the conjugate linker is cleavable.

[0140] Embodiment 49. The oligomeric compound of embodiment 46, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0141] Embodiment 50. The oligomeric compound of embodiment 46, wherein said oligomeric compound does not contain a linker nucleoside.

[0142] Embodiment 51. The oligomeric compound according to any of embodiments 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0143] Embodiment 52. The oligomeric compound according to any of embodiments 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0144] Embodiment 53. The oligomeric compound of any one of embodiments 1 to 52, comprising a terminal group.

[0145] Embodiment 54 The oligomeric compound of embodiment 53, wherein the terminal group is an abasic sugar moiety.

[0146] Embodiment 55. The oligomeric compound according to any one of embodiments 1 to 54, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

[0147] Embodiment 56. The oligomeric compound according to any one of embodiments 1 to 55, wherein the oligomeric compound is an RNase H agent comprising the oligomeric compound.

[0148] Embodiment 57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es A eo m C eo A eo G eo m C eo T ds T ds T ds T ds A ds T ds T ds T ds m C ds m C ds A eo T es A es m C e (SEQ ID NO: 3619), wherein A is adenine, m C is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar; d is a 2'-deoxyribose sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0149] Embodiment 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es m C eo T eo T eo T es G ds A ds T ds T ds T ds T ds T ds A ds m C ds m C ds A eo G eo T es T es A e (SEQ ID NO: 1502), wherein A is adenine, m C is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar; d is a 2'-deoxyribose sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0150] Embodiment 59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: A es m C eo A eo G eo m C eo T eo T ds T ds T ds A ds T ds T ds T ds m C ds m C ds A ds T eo A es m C es A e (SEQ ID NO: 3646), wherein A is adenine, m C is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar; d is a 2'-deoxyribose sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0151] Embodiment 60. The oligomeric compound of any one of embodiments 57 to 59, wherein the modified oligonucleotide is a pharma- ceutically acceptable salt.

[0152] Embodiment 61. The oligomeric compound according to embodiment 60, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0153] Embodiment 62. The oligomeric compound of any one of embodiments 57 to 61, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0154] Embodiment 63. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 3619), or a pharma- ceutically acceptable salt thereof.

[0155] Embodiment 64. The modified oligonucleotide of embodiment 63, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0156] Embodiment 65. A modified oligonucleotide according to the following chemical structure: [ka] (Sequence number 3619).

[0157] Embodiment 66. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1502), or a pharma- ceutically acceptable salt thereof.

[0158] Embodiment 67. The modified oligonucleotide of embodiment 66, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0159] Embodiment 68. A modified oligonucleotide according to the following chemical structure: [ka] (Sequence number 1502).

[0160] Embodiment 69. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 3646), or a pharma- ceutically acceptable salt thereof.

[0161] Embodiment 70. The modified oligonucleotide of embodiment 69, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0162] Embodiment 71. A modified oligonucleotide according to the following chemical structure: [ka] (Sequence number 3646).

[0163] Embodiment 72. A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 62 or modified oligonucleotides according to any one of embodiments 63 to 71, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0164] Embodiment 73. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0165] Embodiment 74. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0166] Embodiment 75. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0167] Embodiment 76. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage.

[0168] Embodiment 77. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0169] Embodiment 78. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0170] Embodiment 79. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp configuration, the Sp configuration, and the Rp configuration.

[0171] Embodiment 80. A population of oligomeric compounds according to any one of embodiments 1 to 62 or modified oligonucleotides according to any one of embodiments 63 to 71, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0172] Embodiment 81. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of any of embodiments 1 to 62.

[0173] Embodiment 82. The oligomeric duplex of embodiment 81, wherein the second modified oligonucleotide consists of 12 to 30 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0174] Embodiment 83 The oligomeric duplex of embodiment 81 or embodiment 82, wherein said modified oligonucleotide of said first oligomeric compound comprises a 5'-stabilizing phosphate group.

[0175] Embodiment 84 The oligomeric duplex of embodiment 83, wherein the stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate.

[0176] Embodiment 85 The oligomeric duplex of any of embodiments 81 to 84, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0177] Embodiment 86 The oligomeric duplex of embodiment 85, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0178] Embodiment 87. The oligomeric duplex of embodiment 86, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0179] Embodiment 88 The oligomeric duplex of embodiment 85, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0180] Embodiment 89. The oligomeric duplex of embodiment 88, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-cEt sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0181] Embodiment 90. The oligomeric duplex of any of embodiments 81-89, wherein at least one internucleoside linkage of said second modified oligonucleotide is a modified internucleoside linkage.

[0182] Embodiment 91 The oligomeric duplex of embodiment 90, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0183] Embodiment 92. The oligomeric duplex of any of embodiments 81 to 91, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

[0184] Embodiment 93. The oligomeric duplex of any of embodiments 81-92, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0185] Embodiment 94. The oligomeric duplex of any of embodiments 81 to 93, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0186] Embodiment 95 The oligomeric duplex of embodiment 94, wherein said at least one modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

[0187] Embodiment 96 The oligomeric duplex of any of embodiments 81-95, wherein the second modified oligonucleotide comprises a conjugate group.

[0188] Embodiment 97. The oligomeric duplex of embodiment 96, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0189] Embodiment 98. The oligomeric duplex of embodiment 96 or embodiment 97, wherein the conjugate group is attached to the 5' end of the second modified oligonucleotide.

[0190] Embodiment 99. The oligomeric duplex of embodiment 96 or embodiment 97, wherein the conjugate group is attached to the 3' end of the second modified oligonucleotide.

[0191] Embodiment 100. The oligomeric duplex of any of embodiments 96-99, wherein the conjugate group comprises a lipid.

[0192] Embodiment 101. The oligomeric duplex of any of embodiments 81-100, wherein the second modified oligonucleotide comprises a terminal group.

[0193] Embodiment 102 The oligomeric duplex of embodiment 101, wherein the terminal group is an abasic sugar moiety.

[0194] Embodiment 103. The oligomeric compound according to any of embodiments 81-102, wherein the second modified oligonucleotide consists of 12-20, 12-25, 12-30, 13-20, 13-25, 13-30, 14-20, 14-25, 14-30, 15-20, 15-25, 15-30, 16-18, 16-20, 16-25, 16-30, 17-20, 17-25, 17-30, 18-20, 18-22, 18-25, 18-30, 19-20, 19-25, 19-30, 20-25, 20-30, 21-25, 21-30, 22-25, 22-30, 23-25, or 23-30 linked nucleosides.

[0195] Embodiment 104. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of embodiments 1 to 62.

[0196] Embodiment 105. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric duplex as described in any one of embodiments 81 to 103.

[0197] Embodiment 106. The antisense agent is: a) an RNaseH agent capable of reducing the amount of HTT nucleic acid by activating RNaseH, or b) An antisense agent according to embodiment 104 or embodiment 105, which is an RNAi agent capable of reducing the amount of HTT nucleic acid by activating RISC / Ago2.

[0198] Embodiment 107. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 62, a modified oligonucleotide according to any one of embodiments 63 to 71, a population according to any one of embodiments 72 to 79, an oligomeric duplex according to any one of embodiments 81 to 103, or an antisense agent according to any one of embodiments 104 to 106, and a pharma- ceutically acceptable carrier or diluent.

[0199] Embodiment 108. The pharmaceutical composition of embodiment 107, wherein the pharma- ceutically acceptable diluent comprises phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

[0200] Embodiment 109. The pharmaceutical composition of embodiment 108, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any of embodiments 1-62, a modified oligonucleotide of any of embodiments 63-71, a population of any of embodiments 72-79, an oligomeric duplex of any of embodiments 81-103, or an antisense agent of any of embodiments 104-106, and PBS.

[0201] Embodiment 110. The pharmaceutical composition of embodiment 108, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any of embodiments 1-62, a modified oligonucleotide of any of embodiments 63-71, a population of any of embodiments 72-79, an oligomeric duplex of any of embodiments 81-103, or an antisense agent of any of embodiments 104-106, and aCSF.

[0202] Embodiment 111. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 62, a modified oligonucleotide according to any one of embodiments 63 to 71, a population according to any one of embodiments 72 to 79, an oligomeric duplex according to any one of embodiments 81 to 103, an antisense agent according to any one of embodiments 104 to 106, or a pharmaceutical composition according to any one of embodiments 107 to 110.

[0203] Embodiment 112. A method for alleviating or preventing a repeat expansion disease, comprising administering to a subject in need thereof a therapeutically effective amount of an oligomeric compound according to any of embodiments 1-62, a modified oligonucleotide according to any of embodiments 63-71, a population according to any of embodiments 72-79, an oligomeric duplex according to any of embodiments 81-103, an antisense agent according to any of embodiments 104-106, or a pharmaceutical composition according to any of embodiments 107-110.

[0204] Embodiment 113. The method of embodiment 112, wherein the repeat expansion disease is selected from myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorders, fragile X syndrome, and spinocerebellar ataxia.

[0205] Embodiment 114. The method of embodiment 112, wherein the repeat expansion disease is Huntington's disease.

[0206] Embodiment 115. The method of embodiment 112, wherein the repeat expansion disease is spinocerebellar ataxia.

[0207] Embodiment 116. The method of any one of embodiments 112-115, wherein at least one symptom or characteristic of the repeat expansion disease is alleviated.

[0208] Embodiment 117. The method of embodiment 116, wherein the symptom or characteristic is selected from brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, attention disorder, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired learning ability, impaired concentration, impaired speech, depression, irritability, anger, impaired movement, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, and combinations thereof.

[0209] Embodiment 118. Administering an oligomeric compound according to any one of embodiments 1 to 62, a modified oligonucleotide according to any one of embodiments 63 to 71, a population according to any one of embodiments 72 to 79, an oligomeric duplex according to any one of embodiments 81 to 103, an antisense agent according to any one of embodiments 104 to 106, or a pharmaceutical composition according to any one of embodiments 107 to 110, is believed to be effective in preventing or reducing brain atrophy, decreased brain activity, decreased brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, The method according to any one of embodiments 116 to 117, which reduces or delays the onset and progression of tremor, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general functional impairment, motor functional impairment, cognitive functional impairment, daily functional impairment, attention disorder, visual-perceptual processing disorder, working memory disorder, psychomotor speed disorder, speech motor output disorder, impaired independence, amotivation disorder, learning ability disorder, mental concentration disorder, speech disorder, depression, irritability, anger, movement disorder, self-care disorder, pain, discomfort, anxiety neurosis, suicidal ideation, or suicidal behavior.

[0210] Embodiment 119. The method of any of embodiments 111 to 118, comprising identifying the subject having or at risk of having the repeat expansion disease.

[0211] Embodiment 120. The method of any of embodiments 111 to 119, wherein the oligomeric compound of any of embodiments 1 to 62, the modified oligonucleotide of any of embodiments 63 to 71, the population of any of embodiments 72 to 79, the oligomeric duplex of any of embodiments 81 to 103, the antisense agent of any of embodiments 104 to 106, or the pharmaceutical composition of any of embodiments 107 to 110 is administered to the central nervous system or systemically.

[0212] Embodiment 121. The method of any of embodiments 111 to 119, wherein the oligomeric compound of any of embodiments 1 to 62, the modified oligonucleotide of any of embodiments 63 to 71, the population of any of embodiments 72 to 79, the oligomeric duplex of any of embodiments 81 to 103, the antisense agent of any of embodiments 104 to 106, or the pharmaceutical composition of any of embodiments 107 to 110 is administered intrathecally.

[0213] Embodiment 122. The method of any one of embodiments 111 to 121, wherein the subject is a human.

[0214] Embodiment 123. A method for reducing expression of HTT in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 62, a modified oligonucleotide according to any one of embodiments 63 to 71, a population according to any one of embodiments 72 to 79, an oligomeric duplex according to any one of embodiments 81 to 103, an antisense agent according to any one of embodiments 104 to 106, or a pharmaceutical composition according to any one of embodiments 107 to 110.

[0215] Embodiment 124. The method of embodiment 123, wherein the cells are derived from brain tissue, optionally from the cortex, substantia nigra, striatum, midbrain, brainstem, or spinal cord.

[0216] Embodiment 125 The method of embodiment 123 or embodiment 124, wherein the cell is a human cell.

[0217] Embodiment 126. Use of an oligomeric compound according to any of embodiments 1 to 62, a modified oligonucleotide according to any of embodiments 63 to 71, a population according to any of embodiments 72 to 79, an oligomeric duplex according to any of embodiments 81 to 103, an antisense agent according to any of embodiments 104 to 106, or a pharmaceutical composition according to any of embodiments 107 to 110 for alleviating or preventing a repeat expansion disease.

[0218] Embodiment 127. Use of an oligomeric compound according to any of embodiments 1 to 62, a modified oligonucleotide according to any of embodiments 63 to 71, a population according to any of embodiments 72 to 79, an oligomeric duplex according to any of embodiments 81 to 103, an antisense agent according to any of embodiments 104 to 106, or a pharmaceutical composition according to any of embodiments 107 to 110 in the manufacture of a medicament for alleviating or preventing a repeat expansion disease.

[0219] Embodiment 128. The use of embodiment 126 or embodiment 127, wherein the repeat expansion disease is Huntington's disease.

[0220] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides that are composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides include at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides include at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0221] A. Certain modified nucleosides Modified nucleosides include modified sugar moieties or modified nucleobases, or both modified sugar moieties and modified nucleobases. In certain embodiments, modified nucleosides including the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified oligonucleotides:

[0222] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to other types of modified sugar moieties.

[0223] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents, including but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more of the acyclic substituents of the non-bicyclic modified sugar moiety is branched.

[0224] In certain embodiments, a non-bicyclic modified sugar moiety comprises a substituent at the 2' position. Examples of suitable substituents at the 2' position of a modified sugar moiety include, but are not limited to, -F, -OCH3 ("OMe" or "O-methyl"), and -O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected from each R m and R nare independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), where the 2'-substituents are described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0225] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.

[0226] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0227] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0228] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position compared to 2'-deoxyfuranosyl sugar moieties; thus, such sugar moieties have a total of 16 possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0229] In certain embodiments, a non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of a modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128.

[0230] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0231] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 5'. Examples of suitable substituents at the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

[0232] In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0233] In naturally occurring nucleic acids, sugars are linked to each other from 3' to 5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, for example, from 2' position or conversely, from 5' to 3'. For example, when linkage is at 2' position, 2'-substituent may be at 3' position instead.

[0234] Certain modified sugar moieties include a substituent bridging two atoms of the furanosyl ring to form a second ring resulting in a bicyclic sugar moiety, hi certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 7,741,457). al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R b are independently H, a protecting group, or C1-C 12alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0235] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0236] It is also possible to generate a large amount of nucleic acids from the solvent system, as described in Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al al.,J.Am.Chem.Soc.,2007,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al al.,US6,794,499, Wengel et al.,US6,670,461, Wengel et al.,US7,034,133,Wengel et al.,US8,080,644,Wengel et al.,US8,034,909,Wengel et al.,US8,153,365 al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al al.,US7,547,684 Seth et al.,US7,666,854 Seth et al.,US8,088,746 Seth et al.,US7,750,131 Seth et al.,US8,030,467 Seth et al al.,US8,546,556;Seth et al.,USSee US Pat. No. 8,530,640, Migawa et al., US Pat. No. 9,012,421, Seth et al., US Pat. No. 8,501,805, and U.S. Patent Publication Nos. US2008 / 0039618 (Allerson et al.) and US2015 / 0191727 (Migawa et al.).

[0237] In certain embodiments, bicyclic sugar moieties and nucleosides that include such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g. LNA or cEt) is identified in the exemplary embodiment herein, they are in β-D configuration unless otherwise specified.

[0238] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0239] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom as well as substitutions at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or substitutions at the 5' position.

[0240] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and additional modified THP compounds having the formula: [ka] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0241] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0242] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to the following structure: [ka] The term "sugar surrogate" refers to a sugar surrogate having the formula: In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0243] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0244] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked, non-cyclic nucleic acid in which any of the sugar bonds are removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0245] In certain embodiments, the sugar surrogate is glycerol, such as found in GNA (glycol nucleic acid) nucleosides, as shown below: [ka] In the formula, Bx represents any nucleic acid base.

[0246] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.

[0247] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not contain nucleobases, which are referred to as abasic nucleosides.In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides that contain hypoxanthine nucleobases).

[0248] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8- Selected from substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0249] Publications teaching certain preparations of the above modified nucleobases, as well as other modified nucleobases, include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0250] 3. Certain modified internucleoside linkages The naturally occurring internucleoside bond of RNA and DNA is a 3'-5' phosphodiester bond. In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside bond. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bond include, but are not limited to, phosphates, including phosphodiester bonds ("P=O") (also referred to as unmodified or native bonds), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to natural phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0251] In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage has the formula: [ka] and for each internucleoside linkage group of the modified oligonucleotide, independently: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0252] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula: [ka] In certain embodiments, mesyl phosphoramidate internucleoside linkages may contain chiral centers. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each include one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0253] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, methods described in Oka et al., JACS125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0254] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 constituent moieties.

[0255] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, as shown below: [ka] In the formula, each Bx independently represents any nucleobase.

[0256] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one internucleoside bond as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0257] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., attached to the last nucleoside at one end of the oligonucleotide), and thus only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of the oligonucleotide.

[0258] In certain embodiments, the nucleic acids can be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below. [ka] In the formula, each Bx represents any nucleobase.

[0259] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0260] 1. Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif, hi certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0261] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0262] In certain embodiments, a gapmer wing comprises 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least five nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0263] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0264] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-β-D-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe or 2'-cEt sugar moiety.

[0265] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified one comprises the same 2'-modification.

[0266] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides contain unmodified deoxynucleoside sugars. Thus, a 5-10-5 MOE gapmer consists of five linked MOE modified nucleosides in the 5'-wing, ten linked deoxynucleosides in the gap, and five linked MOE nucleosides in the 3'-wing.

[0267] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer.

[0268] A mixed wing gapmer has at least two different modified sugars in the 5' and / or 3' wings. In certain embodiments, the modified oligonucleotide is a 4-8-5 mixed wing gapmer, having at least two different sugar moieties in the 5' and / or 3' wings. In certain embodiments, the at least two different sugar moieties are selected from 2'-MOE and 2'-cEt sugar moieties.

[0269] In certain embodiments, modified oligonucleotides have a sugar motif selected from the following: 5'-eekkddddddddkkeee-3', 5'-ekekddddddddkekee-3', 5'-eeeeeddddddddddeeeee-3', 5'-eeeeddddddddkkeee-3', 5'-eeeeeddddddddddeeeee-3', and 5'-eeeeeeddddddddddeeee-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety.

[0270] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its regions in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0271] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0272] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0273] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0274] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all of the internucleoside linkages in the gap are modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0275] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif selected from 5'-soosssssssssooss-3', 5'-sooosssssssssssss-3', 5'-sooossssssssssssss-3', 5'-sossssssssssssssss-3', 5'-ssoosssssssssssss-3', 5'-sooosssssssssssss-3', 5'-sossssssssssssss-3', 5'-sossssssssssssss-3', and 5'-sooooosssssssssssss-3'. In certain embodiments, each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0276] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif that comprises one or more mesyl phosphoramidate nucleoside linkage groups.In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motif herein are replaced with mesyl phosphoramidate linkage groups.

[0277] C. A certain total length It is possible to increase or decrease the length of the oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0278] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is equal to or less than Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13~19, 13~20, 13~21, 13~22, 13~23, 13~24, 13~25, 13~26, 13~27, 13~28, 13~29, 13~30, 14~15, 14~16, 14~17, 14~18, 14~19, 14~20, 14~21, 14~22, 14~23, 14~24, 14~25, 14~26, 14~27, 14~28, 14~29, 14~3 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 2 2-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0279] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0280] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0281] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0282] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence.In certain embodiments, oligonucleotides have nucleobase sequences that are complementary to identified reference nucleic acids, such as second oligonucleotides or target nucleic acids.In certain such embodiments, a region of an oligonucleotide has nucleobase sequences that are complementary to identified reference nucleic acids, such as second oligonucleotides or target nucleic acids.In certain embodiments, a region or the entire length of an oligonucleotide has nucleobase sequences that are at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to nucleic acids, such as second oligonucleotides or target nucleic acids.

[0283] II. Certain Oligomeric Compounds In certain embodiments, oligomeric compounds are provided herein that consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group can be attached to either or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0284] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.

[0285] A. Certain Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties and clearance properties.

[0286] In certain embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to the modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. The ribonucleotide subunit in which the ribose sugar of the subunit is so replaced is referred to herein as the modified sugar moiety ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon ring system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0287] In certain embodiments, the conjugate group confers new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids, 1997, 10, 1021-1025), and the like. Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0288] In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0289] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0290] In certain embodiments, the conjugate group has the following structure: [ka] It is a lipid having the following structure.

[0291] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0292] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0293] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In certain oligomeric compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In certain embodiments, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.

[0294] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0295] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0296] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0297] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0298] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0299] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group is present. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.

[0300] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable that the conjugate group is cleaved to release the non-conjugate or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0301] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide.In certain embodiments, the cleavable bond is one or both esters of phosphodiester.In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester.In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or the conjugate group.

[0302] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and is covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0303] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or more, j is 1 or 0, and k is 1 or 0.

[0304] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0305] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0306] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0307] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or more, j is 1 or 0, and k is 1 or 0.

[0308] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0309] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0310] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO2011 / 131693, WO2014 / 064257.

[0311] In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including but not limited to those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US7,208,174, US9,034,329, and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, or scFv.

[0312] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US10,138,483.

[0313] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including but not limited to those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0314] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, a 5'-phosphanate, including, but not limited to, a 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0315] III. Oligomeric duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence that is complementary to the sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region that is complementary to the target nucleic acid, and a second oligomeric compound having a region that is complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0316] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that it results in significant undesired antisense activity.

[0317] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNaseH-mediated cleavage of the target nucleic acid. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein as being "DNA-like" enough to induce RNaseH activity. In certain embodiments, one or more non-DNA-like nucleosides within the gap of a gapmer are tolerated.

[0318] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound incorporated into RISC is an RNAi agent.RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0319] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the change of splicing of the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with a protein or other nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the change of translation of the target nucleic acid.

[0320] Antisense activity can be observed directly or indirectly, in certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.

[0321] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0322] A. Complementarity / mismatch with target nucleic acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0323] It is possible to introduce mismatch bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest degree than either the 28 or 42 nucleobase oligonucleotides.

[0324] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0325] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against the non-target is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain embodiments, the mismatch is at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain embodiments, the mismatch is at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain embodiments, the mismatch is at 4, 3, 2, or 1 positions from the 3' end of the wing region.

[0326] B.HTT In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to an HTT nucleic acid. In certain embodiments, the HTT nucleic acid has a sequence shown as GENBANK Accession No. NM_002111.6 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT_006081.17 truncated at nucleotides 462000-634000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_010414.1 (incorporated herein as SEQ ID NO: 3), the complement of GENBANK Accession No. NW_001109716.1 truncated at nucleotides 698000-866000 (incorporated herein as SEQ ID NO: 4), and GENBANK Accession No. NM_024357.2 (incorporated herein as SEQ ID NO: 5).

[0327] In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can reduce HTT RNA in a cell. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can reduce HTT protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can alleviate one or more symptoms or characteristics of a neurodegenerative disease when introduced into a cell in a subject. In certain embodiments, the neurodegenerative disease is a repeat expansion disease. In certain embodiments, the repeat expansion disease is selected from myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, various polyglutamine disorders, fragile X syndrome, and spinocerebellar ataxias (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, or Friedrich's ataxia). In certain embodiments, the symptom or feature is brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, attention disorder, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired learning ability, impaired concentration, impaired speech, depression, irritability, anger, impaired movement, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof.

[0328] In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can reduce the detectable amount of HTT RNA in the CSF of a subject after the oligomeric compound is administered to the subject. The detectable amount of HTT RNA can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can reduce the detectable amount of HTT protein in the CSF of a subject when the oligomeric compound is administered to the subject. The detectable amount of HTT protein can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-5 can reduce the detectable amount of mHTT protein in the CSF of a subject when the oligomeric compound is administered to the subject. The detectable amount of mHTT protein can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, the oligomeric compound is administered to the CSF of the subject.

[0329] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region that is complementary to the target nucleic acid, and the target nucleic acid is expressed in pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is the cell and tissue that comprises the central nervous system (CNS).Such tissues include brain tissues such as cortex, substantia nigra, striatum, midbrain and brainstem, as well as spinal cord.

[0330] VI. Certain Methods and Uses Certain embodiments provided herein relate to a method for reducing or inhibiting HTT expression or activity, which may be useful for treating, preventing or alleviating repeat expansion disease.In certain embodiments, the repeat expansion disease is myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorder, fragile X syndrome, or spinocerebellar ataxia.In certain embodiments, the repeat expansion disease is Huntington's disease.In certain embodiments, the repeat expansion disease is spinocerebellar ataxia.

[0331] In certain embodiments, the method comprises administering to the subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to HTT nucleic acid.In certain embodiments, the subject has or is at risk of developing repeat expansion disease.In certain embodiments, the subject has or is at risk of developing myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorder, fragile X syndrome, or spinocerebellar ataxia.In certain embodiments, the subject has or is at risk of developing Huntington's disease.In certain embodiments, the subject has or is at risk of developing spinocerebellar ataxia.

[0332] In certain embodiments, the method of alleviating, treating, or preventing repeat expansion disease comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an HTT nucleic acid. In certain embodiments, the method of alleviating or preventing repeat expansion disease comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an HTT nucleic acid. In certain embodiments, the subject has or is at risk of developing a repeat expansion disease. In certain embodiments, the subject has myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorder, fragile X syndrome, or spinocerebellar ataxia. In certain embodiments, the subject has Huntington's disease. In certain embodiments, the subject has spinocerebellar ataxia. In certain embodiments, at least one symptom or characteristic of a repeat expansion disease is alleviated. In certain embodiments, the symptom or characteristic is selected from brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, attention disorder, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired learning ability, impaired concentration, impaired speech, depression, irritability, anger, impaired movement, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, and combinations thereof.In certain embodiments, administration of the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent reduces or delays the onset or progression of brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, attention disorder, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired learning ability, impaired concentration, impaired speech, depression, irritability, anger, impaired movement, impaired self-care, pain, discomfort, anxiety, suicidal thoughts, or suicidal behavior.

[0333] In certain embodiments, the method of alleviating, treating or preventing Huntington's disease comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to HTT nucleic acid.In certain embodiments, the method of alleviating or preventing Huntington's disease comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to HTT nucleic acid.In certain embodiments, at least one symptom or characteristic of Huntington's disease is alleviated. In certain embodiments, the symptom or feature is brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, impaired glucose tolerance, impaired general function, impaired motor function, impaired cognitive function, impaired daily function, impaired attention, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired concentration, impaired speech, depression, irritability, impaired movement, impaired self-care, anxiety, suicidal ideation, or suicidal behavior. In certain embodiments, administration of the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent reduces or delays the onset or progression of brain atrophy, reduced brain activity, reduced brain connectivity, muscle atrophy, muscle weakness, muscle spasms, difficulty swallowing, seizures, tremors, neurodegeneration, impaired glucose tolerance, impaired general function, impaired motor function, impaired cognitive function, impaired daily function, impaired attention, impaired visuo-perceptual processing, impaired working memory, impaired psychomotor speed, impaired speech motor output, impaired independence, impaired apathy, impaired concentration, impaired speech, depression, irritability, impaired movement, impaired self-care, anxiety, suicidal ideation, or suicidal behavior.

[0334] In certain embodiments, the method of reducing the expression of HTT nucleic acid, e.g. RNA, or reducing the expression of HTT protein in a cell comprises contacting the cell with an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to HTT nucleic acid.In certain embodiments, the cell is from a subject.In certain embodiments, the subject has or is at risk of developing repeat expansion disease.In certain embodiments, the subject has or is at risk of developing Huntington's disease.In certain embodiments, the cell is from brain tissue, optionally from the cortex, substantia nigra, striatum, midbrain, brainstem, or spinal cord.In certain embodiments, the cell is a human cell.

[0335] Certain embodiments are presented for oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to HTT nucleic acid for use in alleviating, treating, or preventing repeat expansion disease, or for use in the manufacture of a medicament for alleviating, treating, or preventing repeat expansion disease. In certain embodiments, oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to HTT nucleic acid for use in alleviating or preventing repeat expansion disease, or for use in the manufacture of a medicament for alleviating or preventing repeat expansion disease. In certain embodiments, the repeat expansion disease is selected from myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, polyglutamine disorder, fragile X syndrome, and spinocerebellar ataxia. In certain embodiments, the repeat expansion disease is Huntington's disease. In certain embodiments, the repeat expansion disease is spinocerebellar ataxia.

[0336] Certain embodiments are shown for oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to HTT nucleic acid for use in alleviating, treating, or preventing Huntington's disease, or for use in the manufacture of a medicament for alleviating, treating, or preventing Huntington's disease.In certain embodiments, oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to HTT nucleic acid for use in alleviating or preventing Huntington's disease, or for use in the manufacture of a medicament for alleviating or preventing Huntington's disease.

[0337] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent may be any of those described herein.

[0338] VII. Certain Compositions Compound number 1394371 In certain embodiments, compound number 1394371 is characterized as a 6-10-4 MOE gapmer and has the sequence (5' to 3') of CACAGCTTTTATTTCCATAC (incorporated herein as SEQ ID NO: 3619), wherein each of nucleosides 1-6 and 17-20 is a 2'-O-methoxyethyl nucleoside, each of nucleosides 7-16 is a β-D-deoxyribonucleoside, and nucleosides The internucleoside linkages between 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0339] In certain embodiments, compound number 1394371 is represented by the following chemical notation:m C es A eo m C eo A eo G eo m C eo T ds T ds T ds T ds A ds T ds T ds T ds m C ds m C ds A eo T es A es m C e (SEQ ID NO: 3619), wherein A is adenine; m C is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar, d is a 2'-deoxyribose sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage.

[0340] In certain embodiments, compound number 1394371 is described by the following chemical structure, or a pharma- ceutically acceptable salt thereof: [ka] (SEQ ID NO: 3619) (Structure 1). In certain embodiments, the pharma- ceutically acceptable salt of compound number 1394371 described by Structure 1 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0341] In one particular embodiment, the sodium salt of compound number 1394371 is described by the following chemical structure: [ka] (SEQ ID NO: 3619) (Structure 2).

[0342] Compound number 1315578 In certain embodiments, compound number 1315578 is characterized as a 5-10-5 MOE gapmer having a sequence (5' to 3') of GCTTTGATTTTTACCAGTTA (incorporated herein as SEQ ID NO: 1502), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl nucleoside, each of nucleosides 6-15 is a β-D-deoxyribonucleoside, and The internucleoside bonds between nucleosides 2-3, 3-4, 4-5, 16-17, and 17-18 are phosphodiester bonds, the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is a 5-methylcytosine.

[0343] In certain embodiments, compound number 1315578 is represented by the following chemical notation: es m C eo T eo T eo T es G ds A ds T ds T ds T ds T ds T ds A ds m C ds m C ds A eo G eo T es T es A e (SEQ ID NO: 1502), wherein A is adenine; mC is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar, d is a 2'-deoxyribose sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage.

[0344] In certain embodiments, compound number 1315578 is represented by the following chemical structure, or a pharma- ceutically acceptable salt thereof: [ka] (SEQ ID NO: 1502) (Structure 3). In certain embodiments, the pharma- ceutically acceptable salt of compound number 1315578 described by Structure 3 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0345] In one particular embodiment, the sodium salt of compound number 1315578 is described by the following chemical structure: [ka] (SEQ ID NO: 1502) (Structure 4).

[0346] Compound number 1394378 In certain embodiments, compound number 1394378 is characterized as a 6-10-4 MOE gapmer and has the sequence (5' to 3') of ACAGCTTTTATTTCCATACA (incorporated herein as SEQ ID NO: 3646), wherein each of nucleosides 1-6 and 17-20 is a 2'-O-methoxyethyl nucleoside and each of nucleosides 7-16 is a β-D-deoxyribonucleoside. , the internucleoside bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester bonds, the internucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate bonds, and each cytosine is a 5-methylcytosine.

[0347] In certain embodiments, compound number 1394378 is represented by the following chemical notation: es m C eo A eo G eo m C eo T eo T ds T ds T ds A ds T ds T ds T ds m C ds m C ds A ds T eo A es m C es A e (SEQ ID NO: 3646), wherein A is adenine; m C is 5-methylcytosine, G is guanine, T is thymine, e is a 2'-O-methoxyethyl ribose modified sugar, d is a 2'-deoxyribose sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage.

[0348] In certain embodiments, compound number 1394378 is described by the following chemical structure, or a pharma- ceutically acceptable salt thereof: [ka] (SEQ ID NO: 3646) (Structure 5). In certain embodiments, the pharma- ceutically acceptable salt of compound number 1394378 described by Structure 5 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0349] In one particular embodiment, the sodium salt of compound number 1394378 is described by the following chemical structure: [ka] (SEQ ID NO: 3646) (Structure 6).

[0350] VIII. Certain Comparative Compositions In certain embodiments, a 5-10-5 MOE gapmer having the sequence (5' to 3') of CTCAGTAACATTGACACCAC (incorporated herein as SEQ ID NO: 858), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein (5' to 3') nucleosides 1-5 and 16-20 each comprise a 2'-MOE modified sugar, previously described in WO2011 / 032045 (incorporated herein by reference), compound number 388241, is a comparative compound. Compound number 388241 was selected as a comparative compound because it was one of the most potent compounds described in WO2011 / 032045. Compound No. 388241 and compound No. 443139, also one of the most potent compounds described in WO2011 / 032045, were tested in comparative studies and achieved similar results as described in WO2011 / 032045.

[0351] In certain embodiments, the compounds described herein, including compound numbers 1394371, 1315578, and 1394378, are superior to compound number 388241 because they exhibit one or more improved properties, such as activity and tolerability. Compound numbers 1394371, 1315578, and 1394378 may be administered in smaller amounts than compound number 388241 to achieve comparable therapeutic effects. Compound numbers 1394371, 1315578, and 1394378 may be administered less frequently than compound number 388241 to achieve comparable therapeutic effects.

[0352] For example, as provided in Example 8 (below), Compound Nos. 1394371, 1315578, and 1394378 showed improved tolerability in rats compared to that of Compound No. 388241. Compound Nos. 1394371, 1315578, and 1394378 showed 3-hour FOB scores of 0.00, 0.50, and 0.00, respectively. In contrast, Compound No. 388241 showed a 3-hour FOB score of 2.75. See Tables 77 and 78. Thus, Compound Nos. 1394371, 1315578, and 1394378 are clearly better tolerated in rats than Compound No. 388241.

[0353] For example, as provided in Example 9 (below), compound numbers 1394371, 1315578, and 1394378 showed improved activity in human HTT transgenic mice compared to the activity of compound number 388241. Compound numbers 1394371, 1315578, and 1394378 reduced HTT RNA levels in the spinal cord of mice to 26%, 46%, and 28%, respectively, of the HTT RNA levels in untreated control mice, whereas compound number 388241 reduced HTT RNA levels in the spinal cord of mice to only 73% of the HTT RNA levels in untreated control mice. Compounds Nos. 1394371, 1315578, and 1394378 each reduced HTT RNA levels in mouse cortex to 10% of the HTT RNA levels in untreated control mice, whereas compound No. 388241 reduced HTT RNA levels in mouse cortex to only 56% of the HTT RNA levels in untreated control mice.

[0354] IX. Certain hotspot areas In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins at a nucleobase of SEQ ID NO:2 identified in the "Start Site SEQ ID NO:2" column and ends at a nucleobase of SEQ ID NO:2 identified in the "End Site SEQ ID NO:2" column. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide that is complementary within any of hotspot regions 1-10 as defined in the table below. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length.

[0355] In certain embodiments, an oligomeric compound comprises a modified oligonucleotide that is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a gapmer and the wings have a cEt / MOE sugar motif. In certain embodiments, the modified oligonucleotide has a sugar motif selected from eekkddddddddkkeee, ekekddddddddkekee, eeeeeddddddddddeeeee, eeeeddddddddkkeee, and eeeeeeddddddddeeee, wherein each "e" is a nucleoside that includes a 2'-MOE sugar moiety, each "k" is a nucleoside that includes a cEt sugar moiety, and each "d" is a nucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety.

[0356] In certain embodiments, the oligomeric compound comprises a modified oligonucleotide comprising a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif selected from soossssssssssooss, soooosssssssssssss, sssssssssssssssssss, soooosssssssssssss, soossssssssssssss, soooosssssssssss, soooooosssssssssss, and sosssssssssssssss, where each "s" is a phosphorothioate linkage and each "o" is a phosphodiester linkage.

[0357] The nucleobase sequences of the oligomeric compounds in the table below are complementary to SEQ ID NO:2 within the designated hotspot regions. In certain embodiments, compounds comprising modified oligonucleotides complementary to nucleobases within the hotspot regions achieve at least a "Min.% Red." (minimum % reduction relative to untreated control cells) in HTT RNA in a standard in vitro assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve an "Avg.% Red." (average % reduction relative to untreated control cells) in HTT RNA in a standard in vitro assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve a maximum "Max.% Red." (maximum % reduction relative to untreated control cells) in HTT RNA in a standard in vitro assay, as shown in the table below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0358] X. Certain Pharmaceutical Compositions In certain embodiments, provided herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0359] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0360] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dianhydrous dihydrate, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or to about 7.2, using a suitable pH adjusting agent, e.g., an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0361] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0362] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0363] In certain embodiments, the pharmaceutical composition comprising the oligomeric compound includes any pharma- ceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprising one or more oligonucleotides can provide (directly or indirectly) a biologically active metabolite or residue thereof when administered to a subject, including a human. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of the oligomeric compound, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, the pharma- ceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0364] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt.In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent.In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS.In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0365] Lipid moieties are used in nucleic acid therapy in various ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0366] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0367] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0368] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0369] In certain embodiments, the pharmaceutical composition is prepared for administration by intrathecal injection. In certain embodiments, the pharmaceutical composition is prepared for administration by intraventricular injection. In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspensions, and the like. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0370] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and associated with cations (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphodiester bonds of an oligonucleotide in aqueous solution exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Moreover, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of forms, all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are intended to include the corresponding forms as well. As used herein, the structure of the free acid of a compound followed by the term "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with a cation or combination of cations. In certain embodiments, one or more certain cations are specified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, the structure of the free acid of a compound followed by the term "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0371] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising phosphate buffered saline (PBS). In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0372] In this specification, a certain dosage is described.The dosage can be in the form of a dosage unit.For clarity, the dosage (or dosage unit) of modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of modified oligonucleotide or oligomeric compound.As mentioned above, in aqueous solution, free acid is in equilibrium with anion form and salt form.However, for the purpose of calculating dosage, it is assumed that modified oligonucleotide or oligomeric compound exists as solvent-free, sodium acetate-free, anhydrous, free acid.

[0373] In certain embodiments, when modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ion. However, the mass of protons is still counted in the weight of the dose, and the mass of sodium ion is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 10 mg of compound No. 1127954 is equal to the number of fully protonated molecules that have a weight of 10 mg. This corresponds to 10.47 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound No. 1127954.

[0374] In certain embodiments, when the modified oligonucleotide or oligomeric compound is in a solution such as aCSF that contains sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.

[0375] In certain embodiments, when an oligomeric compound contains a conjugate group, the mass of the conjugate group may be included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for purposes of calculating the dosage.

[0376] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0377] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each of the references, GenBank accession numbers, etc. listed in this application are incorporated herein by reference in their entirety.

[0378] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with a nucleic acid sequence such as, but not limited to, those having the sequence "AUCGAUCG", as well as those compounds containing RNA bases such as those having some DNA bases, such as "AUCGATCG", and some RNA bases, such as "AT m and oligomeric compounds having other modified nucleobases such as "AACGAUCG", m C denotes a cytosine base containing a methyl group at the 5-position.

[0379] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms), unless otherwise specified. Similarly, tautomeric forms of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0380] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution can provide oligomeric compounds with new properties that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0381] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for additional oligonucleotides having the same or similar motifs.Furthermore, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0382] Example 1: Effects of mixed MOE and cEt, mixed backbone modified oligonucleotides on human HTT RNA in vitro at a single dose Modified oligonucleotides complementary to human HTT nucleic acid were designed and tested for their single dose effect on HTT RNA in vitro. The modified oligonucleotides were tested in a series of experiments under the culture conditions shown in the table below.

[0383] The modified oligonucleotides in the following table are 17 nucleosides in length and the gapmer sugar motif is (5' to 3') eekkddddddddkkeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. The gapmer internucleoside linkage motif is (5' to 3') soossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0384] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NM_002111.6), SEQ ID NO:2 (GENBANK Accession No. NT_006081.17 truncated at 462000-634000), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0385] Cultured HepG2 or Hep3B cells were treated with modified oligonucleotides by electroporation at a concentration of 2000 nM at a density of 20,000 cells per well. After a treatment period of about 24 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. HTT RNA levels were measured by human primer probe set RTS2617 (forward sequence CTCCGTCCGGTAGACATGCT, designated herein as SEQ ID NO: 11; reverse sequence GGAAATCAGAACCCTCAAAATGG, designated herein as SEQ ID NO: 12; probe sequence TGAGCACTGTTCAACTGTGGATATCGGGA, designated herein as SEQ ID NO: 13). HTT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. The reduction of HTT RNA is presented in the following table as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells. Each table represents the results from an individual assay plate. [Table 2-1] [Table 2-2] [Table 2-3] [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3]

[0386] Example 2: Effects of mixed MOE and cEt, mixed backbone modified oligonucleotides on human HTT RNA in vitro at a single dose Modified oligonucleotides complementary to human HTT nucleic acid were designed and tested for their single dose effect on HTT RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0387] The modified oligonucleotides in the following table are 17 nucleosides in length and the gapmer sugar motif is (5' to 3') ekekddddddddkekee, where each "d" represents a 2'-β-D-deoxyribosyl sugar, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. The gapmer internucleoside linkage motif is (5' to 3') soossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0388] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (described hereinabove), SEQ ID NO:2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0389] Cultured A431 cells were treated with modified oligonucleotides at a concentration of 2000 nM at a density of 10,000 cells per well by free uptake. After a treatment period of about 48 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. HTT RNA levels were measured by human primer probe set RTS36485 (forward sequence GAGGAAGTAGATCCAAACACACA, designated herein as SEQ ID NO: 14; reverse sequence GCCGCTATTCCTTTTATGACC, designated herein as SEQ ID NO: 15; probe sequence TCCACCATTTCTGCCACCATCTCA, designated herein as SEQ ID NO: 16). HTT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. The reduction of HTT RNA is presented in the following table as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells. Each table represents the results from an individual assay plate.

[0390] In the tables below, compound 646253 (described hereinabove) was used as an inter-experimental control. [Table 5-1] [Table 5-2] [Table 5-3]

Table 6-1

Table 6-2

Table 6-3

Table 7-1

Table 7-2

Table 7-3

Table 8-1

Table 8-2

Table 8-3

Table 9-1

Table 9-2

Table 9-3

Table 10-1

Table 10-2

Table 10-3

Table 11-1

Table 11-2

[0391] Example 3: Effects of 5-10-5 MOE mixed backbone modified oligonucleotides on human HTT RNA in vitro, single dose Modified oligonucleotides complementary to human HTT nucleic acid were designed and tested for their single dose effect on HTT RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0392] The modified oligonucleotides in the following table are 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages. The gapmers are 20 nucleosides long and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of the gapmer is (5' to 3') sooosssssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0393] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (described hereinabove), SEQ ID NO:2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0394] Cultured A431 cells were treated with modified oligonucleotides at a concentration of 2000 nM at a density of 10,000 cells per well by free uptake. After a treatment period of about 48 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. HTT RNA levels were measured by human primer probe set RTS36478 (forward sequence ACCTTGCAGAGATTGACTT, designated herein as SEQ ID NO: 17; reverse sequence AGCACTCGTTCTTGCAGTT, designated herein as SEQ ID NO: 18; probe sequence TTTGCTCCAAAAAGCTCACCAGC, designated herein as SEQ ID NO: 19). HTT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. The reduction of HTT RNA is presented in the following table as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells. Each table represents the results from an individual assay plate. Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0395] In the following table, compound 388241 was used as a comparative compound. Compound 388241 is 20 nucleosides long and the sugar motif is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of compound 388241 is (5' to 3') sssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 13-1] [Table 13-2] [Table 13-3] [Table 14-1] [Table 14-2] [Table 14-3] [Table 15-1] [Table 15-2] [Table 15-3] [Table 16-1] [Table 16-2] [Table 16-3] [Table 17-1]

Table 17-2

Table 17-3

Table 18-1

Table 18-2

Table 18-3

Table 19-1

Table 19-2

Table 19-3

Table 20-1

Table 20-2

Table 20-3

Table 21-1

Table 21-2

Table 21-3

Table 22-1

Table 22-2

Table 22-3

Table 23-1

Table 23-2

Table 23-3

Table 24-1

Table 24-2

Table 24-3

Table 25-1

Table 25-2

Table 25-3

Table 26-1

Table 26-2

Table 26-3

Table 27-1

Table 27-2

Table 27-3

Table 28-1

Table 28-2

Table 28-3

Table 29-1

Table 29-2

Table 29-3

Table 30-1

Table 30-2

Table 30-3

Table 30-4

Table 31-1

Table 31-2

Table 31-3

Table 32-1

Table 32-2

Table 32-3

Table 33-1

Table 33-2

Table 33-3

Table 34-1

Table 34-2

Table 34-3

Table 35-1

Table 35-2

Table 35-3

Table 36-1

Table 36-2

Table 36-3

Table 37-1

Table 37-2

Table 37-3

Table 38-1

Table 38-2

Table 38-3

Table 39-1

Table 39-2

Table 39-3

Table 40-1

Table 40-2

Table 40-3

Table 41-1

Table 41-2

Table 41-3

Table 42-1

Table 42-2

Table 42-3

Table 43-1

Table 43-2

Table 43-3

Table 44-1

Table 44-2

Table 44-3

Table 45-1

[0396] Example 4: Dose-dependent inhibition of human HTT in HepG2 cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in HepG2 cells. Cultured HepG2 cells were treated by electroporation with various concentrations of modified oligonucleotides as specified in the table below at a density of 20,000 cells per well. After a treatment period of about 24 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured as described above using human HTT primer probe set RTS2617 (described hereinabove). HTT RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of HTT RNA is expressed in the table below as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells.

[0397] Linear regression of the log / linear plot of the data in Excel was used to calculate the half maximal inhibitory concentration (IC) for each modified oligonucleotide. 50 ) was calculated and is also shown in the table below. [Table 48] [Table 49]

[0398] Example 5: Dose-dependent inhibition of human HTT in A431 cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in A431 cells. Cultured A431 cells were treated with various concentrations of modified oligonucleotides as specified in the table below by free uptake at a density of 10,000 cells per well. After a treatment period of about 48 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. Human HTT primer probe set RTS36485 (described hereinabove) was used to measure RNA levels as described above. HTT RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of HTT RNA is expressed in the table below as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells.

[0399] Linear regression of the log / linear plot of the data in Excel was used to calculate the half maximal inhibitory concentration (IC) for each modified oligonucleotide. 50 ) was calculated and is also shown in the table below. [Table 50] [Table 51] [Table 52] [Table 53]

[0400] Modified oligonucleotides selected from the above examples were tested at various doses in A431 cells. Cultured A431 cells were treated with various concentrations of modified oligonucleotides as specified in the table below by free uptake at a density of 10,000 cells per well. After a treatment period of about 48 hours, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RTPCR. Human HTT primer probe set RTS36478 (described hereinabove) was used to measure RNA levels as described above. HTT RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of HTT RNA is expressed in the table below as a percentage (UTC%) of HTT RNA relative to the amount of HTT RNA in untreated control cells.

[0401] Linear regression of the log / linear plot of the data in Excel was used to calculate the half maximal inhibitory concentration (IC) for each modified oligonucleotide. 50 ) was calculated and is also shown in the table below. In the table below, ND means that the value is not defined. [Table 54] [Table 55] [Table 56] [Table 57] [Table 58] [Table 59] [Table 60] [Table 61] [Table 62] [Table 63] [Table 64] [Table 65] [Table 66]

[0402] Example 6: Design of modified oligonucleotides complementary to human HTT nucleic acids Modified oligonucleotides complementary to human HTT nucleic acids were designed as set forth in the table below. "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (described hereinabove), SEQ ID NO:2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0403] The modified oligonucleotides in the following table are 17 nucleosides in length and have a gapmer sugar motif of (5' to 3') eeeeddddddddkkeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. The modified oligonucleotides have an internucleoside linkage motif of (5' to 3') soossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 67-1] [Table 67-2]

[0404] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (5' to 3') sooosssssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 68]

[0405] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar and each "e" represents a 2'-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (5' to 3') sooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 69-1] [Table 69-2] [Table 69-3]

[0406] The modified oligonucleotide in the table below is a 5-10-5 MOE gapmer. The gapmer is 20 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has an internucleoside linkage motif of (5' to 3') sossssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 70]

[0407] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length and the sugar motif of the gapmers is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (5' to 3') ssoossssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 71]

[0408] The modified oligonucleotide in the table below is a 5-8-5 MOE gapmer. The gapmer is 18 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has an internucleoside linkage motif of (5' to 3') sooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 72]

[0409] The modified oligonucleotide in the table below is a 5-8-5 MOE gapmer. The gapmer is 18 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has an internucleoside linkage motif of (5' to 3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 73]

[0410] The modified oligonucleotide in the table below is a 6-10-4 MOE gapmer. The gapmer is 20 nucleosides in length and the sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has an internucleoside linkage motif of (5' to 3') soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 74-1] [Table 74-2]

[0411] Example 7: Tolerance of modified oligonucleotides complementary to human HTT in wild-type mice, 3-hour study The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to assess the tolerability of the oligonucleotides. Wild-type female C57 / Bl6 mice each received a single ICV dose of 700 μg of the modified oligonucleotides. Each treatment group consisted of four mice. Groups of four mice received PBS as a negative control for each experiment. Each experiment is identified in a separate table below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were: (1) the mice were cheerful, alert, and responsive; (2) the mice stood or hunched without stimulation; (3) the mice showed any movement without stimulation; (4) the mice showed forward movement after being lifted; (5) the mice showed any movement after being lifted; (6) the mice responded to tail pinching; and (7) normal breathing. For each of the seven criteria, mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not (Functional Observational Overall Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the table below. [Table 75] [Table 76] [Table 77]

[0412] Example 8: Tolerance of modified oligonucleotides complementary to human HTT in rats, 3 hour study The modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of the modified oligonucleotides listed in the table below. Each treatment group consisted of 3-4 rats. Groups of 3-4 rats received PBS as a negative control. Each experiment is identified in a separate table below. At 3 hours post-injection, movement of seven different body parts was assessed for each rat. The seven body parts were: (1) rat tail, (2) rat rear posture, (3) rat hind limbs, (4) rat hind paws, (5) rat front paws, (6) rat forward posture, and (7) rat head. For each of the seven different body parts, each rat was given a subscore of 0 if the body part was moving or 1 if the body part was not moving (Functional Observational Overall Score or FOB). After each of the seven body parts was evaluated, the subscores for each rat were summed and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after an IT dose of 3 mg, it was given a total score of 0. If another rat did not move its tail 3 hours after an IT dose of 3 mg, but the other evaluated body parts were moving, it was given a score of 1. Results are presented as the average score for each treatment group. [Table 78] [Table 79] [Table 80] [Table 81] [Table 82] [Table 83] [Table 84]

[0413] Example 9: Activity of modified oligonucleotides complementary to human HTT in transgenic mice To test the activity of the modified oligonucleotides described above, transgenic mice expressing human HTT (The Jackson Laboratory, Stock No. 008197) were used.

[0414] treatment The transgenic mice were divided into groups of 3-4 mice each. Each mouse received a single ICV bolus of 200-300 μg of modified oligonucleotide as shown in the table below. Groups of 3-4 mice received PBS as a negative control.

[0415] RNA analysis After 2 weeks of treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure the amount of HTT RNA using human primer probe set RTS2617 (described herein above). Results are presented as percent human HTT compared to PBS control, normalized to mouse cyclophilin A. Mouse cyclophilin A RNA was amplified using mouse prime probe set m_cyclo24 (forward sequence TCGCCCTTGCTGCA, designated herein as SEQ ID NO: 20; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 21; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 22).

[0416] Each experiment is identified in a separate table below. In the tables below, ND refers to values ​​not defined. [Table 85] [Table 86] [Table 87-1]

Table 87-2

Table 88

Table 89

Table 90

Table 91

Table 92

Table 93

Table 94

Table 95

Table 96

Table 97

Table 98

Table 99

Table 100

Table 101

Table 102

Table 103

[0417] Example 10: Efficacy of modified oligonucleotides complementary to human HTT RNA in transgenic mice The modified oligonucleotides described above were tested in human HTT transgenic mice (described herein above).

[0418] treatment Human HTT transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses shown in the table below. Groups of 3-4 mice received PBS as a negative control.

[0419] RNA analysis After 2 weeks of treatment, mice were sacrificed and RNA was extracted from spinal cord and cerebral cortex for quantitative real-time RTPCR analysis of HTT RNA expression using primer probe set RTS2617 (described hereinabove). Results are presented as a percentage of human HTT RNA relative to PBS control, adjusted for mouse cyclophilin A (described hereinabove).

[0420] Dose-response and tissue concentration-response data were analyzed using Microsoft Excel (v14.4) and GraphPad Prism software (v8.2.0, San Diego, CA). 50Values ​​were calculated from the log transformed dose and HTT RNA levels of individual animals using the built-in GraphPad formula "log(agonist) vs. response--Find ECanything" with the following constraints: for ED50, bottom value>0, top value=100, and F=50.

[0421] Each experiment is identified in a separate table below. As shown in the table below, treatment with modified oligonucleotides resulted in a dose-responsive reduction in HTT RNA compared to PBS control. In the table below, ND refers to value not defined. [Table 108] [Table 109] [Table 110] [Table 111] [Table 112] [Table 113-1] [Table 113-2] [Table 114] [Table 115] [Table 116] [Table 117]

[0422] Example 11: Activity of modified oligonucleotides complementary to human HTT RNA in transgenic mice upon multiple administration The modified oligonucleotides described above were tested in human HTT transgenic mice (described herein above).

[0423] Human HTT transgenic mice were divided into groups of 4 mice each. Each mouse was administered a single ICV bolus of modified oligonucleotide at various doses as shown in the table below. Groups of 4 mice were administered PBS as a negative control.

[0424] After 2 weeks of treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RT-PCR analysis, and the amount of HTT RNA was measured using human primer probe set RTS2617 (described hereinabove) which detects total HTT RNA levels. HTT RNA levels were normalized to mouse cyclophilin A. Mouse cyclophilin A was amplified using primer probe set m_cyclo24 (described hereinabove). Results are presented as a percentage of human HTT RNA relative to the amount of HTT RNA in animals treated with PBS (% control). ED50 was calculated in Prism using a nonlinear fit with variable slope (4 parameters), with the top constrained to 100% (or 1) and the bottom constrained to 0. Y=Bottom+(Top-Bottom) / (1+(IC50 / X)^HillSlope). [Table 118]

Claims

1. The chemical structure: 【Chemistry 1】 (SEQ ID NO: 3619), or a pharma- ceutically acceptable salt thereof.

2. 2. The modified oligonucleotide of claim 1, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

3. The chemical structure: 【Chemistry 2】 (SEQ ID NO: 3619) A modified oligonucleotide according to

4. 1. An oligomeric compound comprising a modified oligonucleotide of the following chemical notation: ｍ C ｅｓ A ｅｏ ｍ C ｅｏ A ｅｏ G ｅｏ ｍ C ｅｏ T ｄｓ T ｄｓ T ｄｓ T ｄｓ A ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ ｍ C ｄｓ A ｅｏ T ｅｓ A ｅｓ ｍ C ｅ (Arrangement number 3619), in the formula, A is an adenine nucleobase, ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-O-methoxyethyl ribose modified sugar; d is a 2'-deoxyribose sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound.

5. A population of modified oligonucleotides according to any one of claims 1 to 3, or a population of oligomeric compounds according to claim 4, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

6. A pharmaceutical composition comprising a modified oligonucleotide according to any one of claims 1 to 3, an oligomeric compound according to claim 4, a population of modified oligonucleotides according to claim 5, or a population of oligomeric compounds according to claim 5, and a pharma- ceutically acceptable carrier or diluent.

7. 8. The pharmaceutical composition of claim 7, wherein the pharma- ceutically acceptable diluent comprises artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

8. 8. The pharmaceutical composition of claim 7, wherein said pharmaceutical composition consists or consists essentially of said modified oligonucleotide or said oligomeric compound and aCSF.

9. 8. The pharmaceutical composition of claim 7, wherein said pharmaceutical composition consists or consists essentially of said modified oligonucleotide or said oligomeric compound and PBS.

10. 8. The pharmaceutical composition of claim 7, wherein said pharmaceutical composition consists or consists essentially of said population of modified oligonucleotides or said population of oligomeric compounds and aCSF.

11. 8. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition consists or consists essentially of the population of modified oligonucleotides or the population of oligomeric compounds and PBS.

Images