Substituted pyrrolopyrimidines and pyrazolopyrimidines as Bruton's tyrosine kinase (BTK) degraders

Abstract

The present disclosure relates to novel compounds that degrade Bruton's tyrosine kinase (BTK), pharmaceutical compositions containing such compounds, and their use in the prevention and treatment of conditions modulated by BTK.Similarly, disclosed herein is a method for treating conditions modulated by Bruton's tyrosine kinase (BTK) in a subject in need of such treatment, comprising administering to the subject a compound of formula (I) (e.g., formula (IA), formula (IB)) or a pharmaceutical acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutical acceptable salt thereof.

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 145,126, filed February 3, 2021, which is incorporated by reference in its entirety.

[0002] Field of Disclosure The present invention relates to compounds that modulate Bruton's tyrosine kinase (BTK). In particular, the present invention relates to compounds that have a degradative effect on BTK, pharmaceutical compositions containing the compounds, and methods of use therefor. [Background technology]

[0003] Background to the disclosure Signaling through the B cell receptor (BCR) can result in a wide range of biological production, depending in part on the developmental stage of the B cell. Poor signaling through the BCR can lead to dysregulation of B cell function and / or autoantibody formation, which can result in autoimmune and / or inflammatory diseases. Therapeutic agents that reduce B cells, such as Rituxan, are effective in treating inflammatory diseases such as rheumatoid arthritis. BTK is a Tec family non-receptor protein kinase that is expressed in most hematopoietic cells, such as B cells, mast cells, and macrophages, but not in T cells, natural killer cells, and plasma cells. See Smith, CI et al. J Immunology, 152 (2), 557-65 (1994). BTK is a key component of the BCR and FcR signaling pathways, and targeted inhibition of BTK is a novel approach for treating a variety of human diseases, including B cell malignancies, autoimmune diseases, and inflammatory disorders. See, e.g., Uckun, Fatih M. et al., Anti-Cancer Agents in Med Chem. 7(6):624-632 (2007); Shinohara et al., Cell 132(5):794-806 (2008); Pan, Z., Drug News & Perspectives, 21(7):357-362 (2008); Gilfillan et al., Immuno. Rev. 228(1):149-169 (2009); Davis RE et al., Nature, 463:88-92 (2010). BTK plays a role in B-cell development and activation and is involved in multiple signaling pathways across a wide range of immune-mediated diseases. BTK activity has been implicated in the pathogenesis of several disorders and conditions, such as B-cell-associated hematological cancers (e.g., non-Hodgkin's lymphoma and B-cell chronic lymphocytic leukemia) and autoimmune diseases (e.g., rheumatoid arthritis, Sjögren's syndrome, pemphigus, inflammatory bowel disease, lupus, and asthma). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Smith, CI et al. J Immunology, 152 (2), 557-65 (1994) [Non-patent document 2] Uckun, Fatih M. et al, Anti-Cancer Agents in Med Chem. 7(6):624-632 (2007) [Non-patent document 3] Shinohara et al., Cell 132(5):794-806 (2008) [Non-patent document 4] Pan, Z., Drug News & Perspectives, 21(7):357-362 (2008) [Non-patent document 5] Gilfillan et al, Immuno. Rev. 228(1):149-169 (2009) [Non-patent document 6] Davis RE et al, Nature, 463:88-92 (2010) Summary of the Invention [Means for solving the problem]

[0005] Disclosure Summary In some embodiments, the present disclosure provides a compound of formula (I), or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof: [ka] (In the formula, X is CH or N; Y is CH or N; A is selected from —C(O)—, —SO—, —S(O)—, —O—, —S—, —NH—, —N(C1-C5 alkyl)-, and —C(O)NH(C1-C5 alkyl)-; B is [ka] and However, B [ka] provided that if A is not -O-, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, dialkylamino, amino, -CN, hydroxyl, C1-C4 alkoxy, and halogen; R2 and R3 are each independently selected from H, halogen, —CN, hydroxyl, dialkylamino, C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkyl, deuterated C1-C5 alkoxy and C1-C5 haloalkyl; Q is L-W1 or L-W2, where: L is a linker 2 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally independently replaced by a group selected from C(=O), O, N(R6), S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, C2-alkenyl, C2-alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl, or heteroaryl, each of which is independently substituted by 0, 1, 2, or 3 R7; W1 is [ka] is selected from R4 is selected from H, halogen, —CN, C1-C5 alkyl, C1-C5 alkoxy and C1-C5 haloalkyl; W2 is [ka] or absent, and R5 is selected from H, halogen, —CN, C1-C5 alkyl, deuterated C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkoxy and C1-C5 haloalkyl; each R6 is independently selected from H, C1-C3 alkyl, -C(=O)-(C1-C3 alkyl), -C(=O)-O-(C1-C3 alkyl) and -C(=O)-NH-(C1-C3 alkyl), each of which is substituted by 0, 1, 2 or 3 R7; Each R7 is independently selected from halogen, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl, -N(R6)2, and -CN. The target is.

[0006] In some embodiments, the compound of formula (I) is a compound of formula (IA): [ka] It can be said that:

[0007] In some embodiments, the compound of formula (I) is a compound of formula (IB): [ka] It can be said that:

[0008] In some embodiments, A is —O— or —C(O)—NH—CH 2 —.

[0009] In some embodiments, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, and halogen.

[0010] In some embodiments, R2 and R3 are each independently selected from H, -OCD3, -CD3, halogen, C1-C4 alkyl, and C1-C4 alkoxy.

[0011] In some embodiments, R4 is selected from H, halogen, -CN, and C1-C4 haloalkyl.

[0012] In some embodiments, R5 is selected from H, halogen, deuterated C1-C5 alkoxy, and C1-C5 alkoxy. In some embodiments, L is a linker 2 to 12 carbon atoms in length, where one or more of the carbon atoms are optionally independently selected from C(=O), O, S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, NH, NCH3, NCH2CH3, C2-alkynyl, [ka] [ka] is substituted by a group selected from

[0013] In some embodiments, compounds of formula (I) (e.g., formula (IA), formula (IB)) may include both stereoisomers and mixtures of stereoisomers. In some embodiments, compounds of formula (I) may include both racemic isomers and enantiomers.

[0014] Similarly, disclosed herein is a method of treating a condition modulated by Bruton's tyrosine kinase (BTK) in a subject in need thereof, the method comprising administering to the subject a compound of Formula (I) (e.g., Formula (IA), Formula (IB)) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of Formula (I) or a pharmaceutically acceptable salt thereof. In at least one embodiment, the pharmaceutical composition of the present disclosure may be for use in the treatment of (or the manufacture of a medicament for treating) cancer, immunological diseases, autoimmune diseases, and inflammatory diseases in a subject in need thereof.

[0015] In at least one embodiment, a therapeutically effective amount of a pharmaceutical composition of the present disclosure can be administered to a subject suffering from a condition modulated by BTK. In some embodiments, the condition modulated by BTK is selected from cancer, immunological disorders, autoimmune diseases, and inflammatory disorders. In some embodiments, the condition is selected from B-cell malignancies, B-cell lymphoma, diffuse large B-cell lymphoma, chronic lymphocytic leukemia, non-Hodgkin's lymphoma, mantle cell lymphoma, follicular lymphoma, hairy cell leukemia, B-cell non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma, bone cancer, bone metastasis, arthritis, multiple sclerosis, osteoporosis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease, lupus, Sjögren's syndrome, and disorders associated with kidney transplantation.

[0016] The foregoing summary of the invention, and the following detailed description of the present disclosure, will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the disclosure, the accompanying drawings illustrate some, but not all, alternative embodiments. It should be understood, however, that the disclosure is not limited to the precise arrangements and instrumentalities shown. These drawings, which are incorporated in and constitute a part of this specification, help to explain the principles of the present disclosure. [Brief explanation of the drawings]

[0017] [Figure 1] FIG. 1 illustrates the BTK degradation activity of compounds 13, 25, 34, 42, 48, 49, 51, and 78 in the RAMOS cell line 6 hours after administration.

[0018] [Figure 2] FIG. 2 illustrates the BTK degradation activity of compounds 53, 54, 93, and 96 in the RAMOS cell line 6 hours after administration. DETAILED DESCRIPTION OF THE INVENTION

[0019] Detailed Description of the Disclosure definition A dash ("-") that is not between two letters or symbols is used to indicate a point of attachment for a substituent, for example, -CN is attached through the carbon atom.

[0020] When a range of values ​​is listed, it is intended to encompass each value and subrange within the range. For example, "C 1~ C6 alkyl" is C1, C2, C3, C4, C5, C6, C 1~6 , C 1~5 , C 1~4 , C 1~3 , C 1~2 , C 2~6 , C 2~5 , C 2~4 , C 2~3 , C 3~6 , C 3~5 , C 3~4 , C 4~6 , C 4~5 and C 5~6 Alkyl is intended to be included.

[0021] The term "acyl," as used herein, refers to the group RC(O)-, including, but not limited to, (alkyl)-C(O)-, (alkenyl)-C(O)-, (alkynyl)-C(O)-, (aryl)-C(O)-, (cycloalkyl)-C(O)-, (heteroaryl)-C(O)-, and (heterocyclyl)-C(O)-, which is attached to the parent molecular structure through a carbonyl functionality. In some embodiments, it is 1~10 An acyl radical refers to the total number of chain or ring atoms between, for example, the alkyl, alkenyl, alkynyl, aryl, cycloalkyl, or heteroaryl moiety and the carbonyl carbon of the acyl. For example, a C4-acyl has three other ring or chain atoms and the carbonyl.

[0022] The term "alkenyl," as used herein, refers to a straight-chain or branched unsaturated hydrocarbon having at least one carbon-carbon double bond, such as a straight-chain or branched group of 2 to 8 carbon atoms, referred to herein as (C2-C8) alkenyl. Exemplary alkenyl groups include, but are not limited to, vinyl, allyl, butenyl, pentenyl, hexenyl, butadienyl, pentadienyl, hexadienyl, 2-ethylhexenyl, 2-propyl-2-butenyl, and 4-(2-methyl-3-butene)-pentenyl.

[0023] The term "alkyl" as used herein refers to a group including C 1~8 "Alkyl" refers to a straight-chain or branched saturated hydrocarbon, such as a straight-chain or branched group of 1 to 8 carbon atoms, referred to as alkyl. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-1-propyl, 2-methyl-2-propyl, 2-methyl-1-butyl, 3-methyl-1-butyl, 2-methyl-3-butyl, 2,2-dimethyl-1-propyl, 2-methyl-1-pentyl, 3-methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3-dimethyl-1-butyl, 2-ethyl-1-butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, and octyl. In some embodiments, "alkyl" is a straight-chain hydrocarbon. In some embodiments, "alkyl" is a branched hydrocarbon.

[0024] The term "alkoxy" refers to a straight or branched chain saturated hydrocarbon containing 1 to 12 carbon atoms containing a terminal "O" in the chain, e.g., -O(alkyl). Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pentoxy groups.

[0025] The term "alkylene," as used herein, refers to a divalent alkyl radical. 1~10Representative examples of alkylene include, but are not limited to, methylene, ethylene, n-propylene, iso-propylene, n-butylene, sec-butylene, iso-butylene, tert-butylene, n-pentylene, isopentylene, neopentylene, n-hexylene, 3-methylhexylene, 2,2-dimethylpentylene, 2,3-dimethylpentylene, n-heptylene, n-octylene, n-nonylene, and n-decylene.

[0026] The term "alkynyl," as used herein, refers to a straight-chain or branched unsaturated hydrocarbon having at least one carbon-carbon triple bond, such as a straight-chain or branched group of 2 to 8 carbon atoms, referred to herein as (C2-C8)alkynyl. Exemplary alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, hexynyl, methylpropynyl, 4-methyl-1-butynyl, 4-propyl-2-pentynyl, and 4-butyl-2-hexynyl.

[0027] The term "aryl" as used herein refers to a monocyclic, bicyclic, or other polycyclic carbocyclic aromatic ring system having 5 to 14 ring atoms. The aryl group may be optionally fused to one or more rings selected from aryl, cycloalkyl, heteroaryl, and heterocyclyl. The aryl groups of the present disclosure may be substituted with groups selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amido, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone. Exemplary aryl groups include, but are not limited to, phenyl, tolyl, anthracenyl, fluorenyl, indenyl, azulenyl, and naphthyl, as well as benzo-fused carbocyclic moieties such as 5,6,7,8-tetrahydronaphthyl. Exemplary aryl groups also include, but are not limited to, monocyclic aromatic ring systems, in which the ring contains 6 carbon atoms, referred to herein as "C6-aryl."

[0028] The term "cyano," as used herein, refers to --CN.

[0029] The term "cycloalkyl," as used herein, refers to a saturated or unsaturated cyclic, bicyclic, or bridged bicyclic hydrocarbon group of 3 to 16 carbons or 3 to 8 carbons, derived from cycloalkane, referred to herein as "(C-C)cycloalkyl." Exemplary cycloalkyl groups include, but are not limited to, cyclohexane, cyclohexene, cyclopentane, and cyclopentene. Cycloalkyl groups can be optionally substituted with alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amido, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone. Cycloalkyl groups can be fused to other cycloalkyl (saturated or partially unsaturated), aryl, or heterocyclyl groups to form bicycles, tetracycles, etc. The term "cycloalkyl" also includes bridged and spiro-fused ring structures, which may or may not contain heteroatoms.

[0030] The term "halo" or "halogen," as used herein, refers to -F, -Cl, -Br and / or -I.

[0031] "Haloalkyl" means an alkyl group substituted with one or more halogens. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, trichloromethyl, and the like.

[0032] The term "heteroaryl," as used herein, refers to a monocyclic, bicyclic, or polycyclic aromatic ring system containing one or more heteroatoms, e.g., 1 to 3 heteroatoms, such as nitrogen, oxygen, and sulfur. Heteroaryl can be substituted with one or more substituents, including alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amido, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone. Heteroaryl can also be fused to a non-aromatic ring. Exemplary heteroaryl groups include, but are not limited to, monocyclic aromatic rings containing 2 to 5 carbon atoms and 1 to 3 heteroatoms, referred to herein as "(C2-C5)heteroaryl." Illustrative examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrimidyl, pyrazyl, triazinyl, pyrrolyl, pyrazolyl, imidazolyl, (1,2,3)- and (1,2,4)-triazolyl, pyrazinyl, pyrimidylyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, furyl, phenyl, isoxazolyl, and oxazolyl. Illustrative heteroaryl groups also include, but are not limited to, bicyclic aromatic rings, which are defined herein as "(C5-C 14 ) heteroaryl" contains 5 to 14 carbon atoms and 1 to 3 heteroatoms. Representative examples of heteroaryl include, but are not limited to, indazolyl, indolyl, azaindolyl, indolinyl, benzotriazolyl, benzoxadiazolyl, imidazolyl, cinnolinyl, imidazopyridyl, pyrazolopyridyl, pyrrolopyridyl, quinolinyl, isoquinolinyl, quinazolinyl, quinazolinonyl, indolinonyl, isoindolinonyl, tetrahydronaphthyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like.

[0033] The terms "heterocycle," "heterocyclyl," or "heterocyclic," as used herein, refer to a 3- to 18-membered saturated or unsaturated ring containing 1, 2, 3, or 4 heteroatoms, independently selected from nitrogen, oxygen, phosphorus, and sulfur, respectively. Heterocycles can be aromatic (heteroaryl) or non-aromatic. Heterocycles can be substituted with one or more substituents, including alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amido, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone. Heterocycle also includes bicyclic, tricyclic, and tetracyclic groups, in which any of the above heterocyclic rings is fused to one or two rings independently selected from aryl, cycloalkyl, and heterocycle. Exemplary heterocycles include acridinyl, benzimidazolyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, biotinyl, cinnolinyl, dihydrofuryl, dihydroindolyl, dihydropyranyl, dihydrothienyl, dithiazolyl, furyl, homopiperidinyl, imidazolidinyl, imidazolinyl, imidazolyl, indolyl, isoquinolyl, isothiazolidinyl, isothiazolyl, isoxazolidinyl, isoxazolyl, morpholinyl, oxadiazolyl, oxazolidinyl, o- ... Examples include oxazolyl, piperazinyl, piperidinyl, pyranyl, pyrazolidinyl, pyrazinyl, pyrazolyl, pyrazolinyl, pyridazinyl, pyridyl, pyrimidinyl, pyrimidyl, pyrrolidinyl, pyrrolidin-2-onyl, pyrrolinyl, pyrrolyl, quinolinyl, quinoxaloyl, tetrahydrofuryl, tetrahydroisoquinolyl, tetrahydropyranyl, tetrahydroquinolyl, tetrazolyl, thiadiazolyl, thiazolidinyl, thiazolyl, thienyl, thiomorpholinyl, thiopyranyl and triazolyl.

[0034] The terms "hydroxy" and "hydroxyl" as used herein refer to --OH.

[0035] "Spirocycloalkyl" or "spirocyclyl" refers to a carbon-based bicyclic ring system in which both rings are connected through a single atom. The rings can vary in size and nature or can be identical in size and nature. Examples include spiropentane, spirohexane, spiroheptane, spirooctane, spirononane, or spirodecane. One or both rings in a spirocycle can be fused to another carbocyclic, heterocyclic, aromatic, or heteroaromatic ring. (C 3~12 ) A spirocycloalkyl is a spiro ring containing between 3 and 12 carbon atoms.

[0036] "Spiroheterocycloalkyl" or "spiroheterocyclyl" means a spiro ring in which at least one of the rings is heterocyclic and one or more of the carbon atoms can be replaced by a heteroatom (e.g., one or more of the carbon atoms can be replaced by a heteroatom in at least one of the rings). One or both of the rings in a spiroheterocycle can be fused to another carbocyclic, heterocyclic, aromatic, or heteroaromatic ring.

[0037] "Isomers" means compounds having the same number and kinds of atoms, and therefore the same molecular weight, but differing in the arrangement or configuration of the atoms in space.

[0038] "Stereoisomer" or "optical isomer" refers to a stable isomer with at least one chiral atom or restricted rotation resulting in a perpendicular plane of asymmetry (e.g., certain biphenyl, allene, and spiro compounds), which can rotate plane-polarized light. Because asymmetric centers and other chemical structures exist in the compounds of the present disclosure that can give rise to stereoisomerism, the present disclosure contemplates stereoisomers and mixtures thereof. The compounds of the present disclosure and their salts contain asymmetric carbon atoms and therefore may exist as single stereoisomers, racemates, and mixtures of enantiomers and diastereomers. Typically, such compounds are prepared as racemic mixtures. However, if desired, such compounds can be prepared or isolated as pure stereoisomers, i.e., as individual enantiomers or diastereomers, or as stereoisomer-enriched mixtures. As discussed in more detail below, individual stereoisomers of the compounds are prepared by synthesis from optically active starting materials containing the desired chiral center, or by preparation of a mixture of enantiomeric products followed by separation or resolution (such as conversion to a mixture of diastereomers followed by separation or recrystallization, chromatographic techniques, use of chiral resolving agents, or direct separation of enantiomers on a chiral chromatographic column). Starting compounds of particular stereochemistry are either commercially available or made by the methods described below, and resolved by techniques well known in the art.

[0039] It is well known in the art that the biological and pharmacological activity of a compound is sensitive to the stereochemistry of the compound. Thus, for example, enantiomers often exhibit significantly different biological activities, including differences in pharmacokinetic properties, including metabolism, protein binding, and the like, and pharmacological properties, including the type of activity exhibited, the degree of activity, toxicity, and the like. Therefore, one skilled in the art will recognize that one enantiomer may be more active or may exhibit beneficial effects when enriched relative to or separated from the other enantiomer. Furthermore, from the present disclosure, one skilled in the art will recognize methods for separating, enriching, or selectively preparing the enantiomers of the compounds of the present disclosure, as well as knowledge of the prior art.

[0040] Thus, while racemic drugs may be used, they are often less effective than the pure drug administered as equal amounts of the enantiomer. Indeed, in some cases, one enantiomer may be pharmacologically inactive and merely function as a diluent. For example, ibuprofen has previously been administered as a racemate, but only the S-isomer of ibuprofen has been shown to be effective as an anti-inflammatory agent. (However, in the case of ibuprofen, the R-isomer is inactive but is converted to the S-isomer in vivo, and therefore the rate of action of the racemic drug is slower than that of the pure S-isomer.) Furthermore, the pharmacological activity of enantiomers may have different biological activities. For example, S-penicillamine is a therapeutic agent for chronic arthritis, while R-penicillamine is toxic. Indeed, some purified enantiomers have advantages over the racemate, as purified individual isomers have been reported to have faster transdermal penetration rates compared to the racemic mixture. See U.S. Patent Nos. 5,114,946 and 4,818,541.

[0041] In some embodiments, the compound is a racemic mixture of the (S)- and (R)-isomers. In other embodiments, provided herein are mixtures of compounds, wherein the individual compounds of the mixture are predominantly present in the (S)- or (R)-isomeric configuration. For example, the compound mixture has an (S)-enantiomeric excess of greater than about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or more. In other embodiments, the compound mixture has an (S)-enantiomeric excess of greater than about 55% to about 99.5%, greater than about 60% to about 99.5%, greater than about 65% to about 99.5%, greater than about 70% to about 99.5%, greater than about 75% to about 99.5%, greater than about 80% to about 99.5%, greater than about 85% to about 99.5%, greater than about 90% to about 99.5%, greater than about 95% to about 99.5%, greater than about 96% to about 99.5%, greater than about 97% to about 99.5%, greater than about 98% to about 99.5%, greater than about 99% to about 99.5%, or higher. In other embodiments, the compound mixture has an (R)-enantiomeric purity of greater than about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or more. In some other embodiments, the compound mixture has an (R)-enantiomeric excess of greater than about 55% to about 99.5%, greater than about 60% to about 99.5%, greater than about 65% to about 99.5%, greater than about 70% to about 99.5%, greater than about 75% to about 99.5%, greater than about 80% to about 99.5%, greater than about 85% to about 99.5%, greater than about 90% to about 99.5%, greater than about 95% to about 99.5%, greater than about 96% to about 99.5%, greater than about 97% to about 99.5%, greater than about 98% to about 99.5%, greater than about 99% to about 99.5%, or higher.

[0042] Individual stereoisomers of the compounds of the present disclosure can be prepared by synthesis from commercially available starting materials containing asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those skilled in the art. These methods of resolution are exemplified by (1) coupling the mixture of enantiomers to a chiral auxiliary, recrystallization or chromatographic separation of the resulting mixture of diastereomers, and liberation of the optically pure product from the auxiliary; (2) salt formation using an optically active resolving agent; or (3) direct separation of the mixture of optical enantiomers on a chiral chromatographic column. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods such as chiral-phase gas chromatography, chiral-phase high-performance liquid chromatography, crystallization of the compound as a chiral salt complex, or crystallization of the compound in a chiral solvent. Stereoisomers can also be obtained from stereopure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0043] Thus, if one enantiomer is more pharmacologically active, less toxic, or has a preferred location in the body than the other, it may be more therapeutically beneficial to administer the former enantiomer preferentially. In this way, the patient undergoing treatment may be exposed to a lower total dose of the drug and a lower dose of the potentially toxic enantiomer or inhibitor of the other enantiomer.

[0044] The term "pharmaceutically acceptable carrier" as used herein refers to any and all solvents, dispersion media, coating agents, isotonic and absorption delaying agents, etc., that are compatible with the administration of pharmaceuticals. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide auxiliary, additional, or therapeutically enhancing functions.

[0045] The term "pharmaceutically acceptable composition," as used herein, refers to a composition comprising at least one compound disclosed herein formulated together with one or more pharmaceutically acceptable carriers.

[0046] The term "pharmaceutically acceptable prodrug," as used herein, refers to those prodrugs of compounds of the present disclosure that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, or allergic response, commensurate with a reasonable benefit / risk ratio, and that are effective for their intended use, and where possible, represent zwitterionic forms of compounds of the present disclosure. Discussion is provided in Higuchi et al., "Prodrugs as Novel Delivery Systems," ACS Symposium Series, Vol. 14, and Roche, E.B., ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference.

[0047] The term "pharmaceutically acceptable salt" refers to a salt of an acidic or basic group that may be present in the compound used in the composition of the present invention. The compound included in the composition of the present invention that is basic in nature can form a wide variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds include non-toxic acid addition salts, i.e., but are not limited to, sulfate, citrate, malate, acetate, oxalate, chloride, bromide, iodide, nitrate, sulfate, hydrogen sulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbic acid, and the like. The compounds of the present invention can form salts with pharmaceutically acceptable anions, including phosphate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Compounds included in the compositions of the present invention that contain an amino moiety can form pharmaceutically acceptable salts with various amino acids in addition to the acids mentioned above. Compounds included in the compositions of the present invention that are acidic in nature can form base salts with various pharmaceutically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts, and, in particular, calcium, magnesium, sodium, lithium, zinc, potassium, and iron salts.

[0048] As used herein, names of compounds, including organic compounds, can be given using common names, IUPAC, IUBMB, or CAS nomenclature recommendations. When a name is given, those skilled in the art can easily confirm the structure of the compound either by systematic reduction of the compound's structure using the naming rules, or by using commercially available software such as CHEMDRAW (trademark) (Cambridgesoft Corporation, USA). Chemical names were generated using PerkinElmer ChemDraw Professional, version 17.

[0049] The compounds of the present disclosure may contain one or more chiral centers and / or double bonds and therefore exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. As used herein, the term "stereoisomer" refers to any geometric isomer, enantiomer, or diastereomer. These compounds can be represented by the symbols "R" or "S," depending on the configuration of substituents around the stereogenic carbon atom. The present disclosure encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be represented by "(±)" in the nomenclature, although those skilled in the art will recognize that the structure may implicitly represent chiral centers. In some embodiments, an enantiomer or stereoisomer may be provided substantially free of its corresponding enantiomer.

[0050] As used herein, "cancer" refers to diseases, disorders, and conditions involving abnormal cell growth that have the potential to invade or spread to other parts of the body. Exemplary cancers include, but are not limited to, breast cancer, lung cancer, ovarian cancer, endometrial cancer, prostate cancer, and esophageal cancer.

[0051] As used herein, the term "subject" refers to an animal. Typically, an animal is a mammal. A subject also refers to, for example, a primate (e.g., a human, male or female), cow, sheep, goat, horse, dog, cat, rabbit, rat, mouse, fish, bird, etc. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.

[0052] As used herein, the terms "inhibit," "inhibition," or "inhibiting" refer to the reduction or suppression of a given condition, symptom, or disorder or disease, or a significant decrease in the baseline activity of a biological activity or process.

[0053] As used herein, the terms "treat," "treating," or "treatment" of any disease or disorder refer, in one embodiment, to ameliorating the disease or disorder (i.e., slowing, arresting, or reducing the development of the disease or at least one of its clinical symptoms). In another embodiment, "treat," "treating," or "treatment" refers to alleviating or improving at least one physical parameter, including those that may not be discernible by the patient. In yet another embodiment, "treat," "treating," or "treatment" refers to modulating the disease or disorder either physically (e.g., by stabilization of discernible symptoms), physiologically (e.g., by stabilization of physical parameters), or both. In yet another embodiment, "treat," "treating," or "treatment" refers to preventing or delaying the onset or development or progression of the disease or disorder.

[0054] As used herein, a subject is "in need of" a treatment if such subject would benefit biologically, medically, or in quality of life from such treatment.

[0055] Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, a hydrogen atom may be substituted with a deuterium atom ( 2 H) or tritium ( 3 H) or carbon replaced by 13 C- or 14 Compounds having the present structure except for the replacement of the C-carbon atom are within the scope of this disclosure. Such compounds may be useful in biological assays, for example, as analytical tools, probes, or as therapeutic agents. compound

[0056] In some embodiments, a compound of Formula (I), or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof: [ka] (In the formula, X is CH or N; Y is CH or N; A is selected from —C(O)—, —SO—, —S(O)—, —O—, —S—, —NH—, —N(C1-C5 alkyl)-, and —C(O)NH(C1-C5 alkyl)-; B is [ka] and However, B [ka] provided that if A is not -O-, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, dialkylamino, amino, -CN, hydroxyl, C1-C4 alkoxy, and halogen; R2 and R3 are each independently selected from H, halogen, —CN, hydroxyl, dialkylamino, C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkyl, deuterated C1-C5 alkoxy and C1-C5 haloalkyl; Q is L-W1 or L-W2, where: L is a linker 2 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally independently replaced by a group selected from C(=O), O, N(R6), S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, C2-alkenyl, C2-alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl, or heteroaryl, each of which is independently substituted by 0, 1, 2, or 3 R7; W1 is [ka] is selected from R4 is selected from H, halogen, —CN, C1-C5 alkyl, C1-C5 alkoxy and C1-C5 haloalkyl; W2 is [ka] or absent, and R5 is selected from H, halogen, —CN, C1-C5 alkyl, C1-C5 alkoxy, and C1-C5 haloalkyl; each R6 is independently selected from H, C1-C3 alkyl, -C(=O)-(C1-C3 alkyl), -C(=O)-O-(C1-C3 alkyl) and -C(=O)-NH-(C1-C3 alkyl), each of which is substituted by 0, 1, 2 or 3 R7; Each R7 is independently selected from halogen, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl, -N(R6)2, and -CN. In some embodiments, the compound of formula (I) can be a compound of formula (IA): [ka] It can be said that:

[0057] In some embodiments, the compound of formula (I) is a compound of formula (IB): [ka] It can be said that:

[0058] In some embodiments, A is -O- or -C(O)-NH-CH. In some embodiments, A is -O-. In some embodiments, A is -C(O)-NH-CH.

[0059] In some embodiments, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, and halogen. In some embodiments, R1 is selected from H, F, Cl, Br, I, -CF3, -CH3, and [ka] In some embodiments, R1 is selected from: In some embodiments, R1 is H. In some embodiments, R1 is Br. In some embodiments, R1 is Cl. In some embodiments, R1 is F. In some embodiments, R1 is I.

[0060] In some embodiments, R2 and R3 are each independently selected from H, -OCD3, -CD3, halogen, C1-C4 alkyl, and C1-C4 alkoxy. In some embodiments, R2 and R3 are each H. In some embodiments, R2 is H and R3 is F. In some embodiments, R2 is F and R3 is H. In some embodiments, R2 is -OCH3 and R3 is F. In some embodiments, R2 is F and R3 is -OCH3. In some embodiments, R2 is -OCD3 and R3 is F. In some embodiments, R2 is -F and R3 is -OCD3. In some embodiments, R2 is -CD3 and R3 is F. In some embodiments, R2 is -F and R3 is -CD3.

[0061] In some embodiments, R4 is selected from H, halogen, —CN, and C1-C4 haloalkyl. In some embodiments, R4 is H. In some embodiments, R4 is halogen. In some embodiments, R4 is F. In some embodiments, R4 is Cl. In some embodiments, R4 is Br.

[0062] In some embodiments, R5 is selected from H, halogen, deuterated C1-C5 alkoxy, and C1-C5 alkoxy. In some embodiments, R5 is -OCH3 or -OCD3. In some embodiments, R5 is -OCH3.

[0063] In some embodiments, L is a linker 2 to 12 carbon atoms in length, where one or more of the carbon atoms are optionally independently selected from C(=O), O, S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, NH, NCH3, NCH2CH3, C2-alkynyl, [ka] [ka] is substituted by a group selected from

[0064] In some embodiments, W2 is [ka] In some embodiments, W2 is [ka] In some embodiments, W2 is [ka] In some embodiments, W2 is [ka] In some embodiments, W2 is absent.

[0065] In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, selected from the compounds listed in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 1-16 Table 1-17 Table 1-18 Table 1-19 Table 1-20 Table 1-21 Table 1-22 Table 1-23 Table 1-24 Table 1-25 Table 1-26 [Table 1-27] [Table 1-28] [Table 1-29] [Table 1-30] [Table 1-31] Pharmaceutical Composition

[0066] The pharmaceutical compositions of the present disclosure comprise at least one compound of Formula (I) (e.g., Formula (IA), Formula (IB)), or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof, formulated together with one or more pharmaceutically acceptable carriers. These formulations include those suitable for oral, rectal, topical, buccal, and parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous) administration. The most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and the nature of the particular compound being used.

[0067] Formulations suitable for oral administration may be provided in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of a compound of the present disclosure, as a powder or granules, as a solution or suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil emulsion. As indicated, such formulations may be prepared by any suitable method of pharmacy, including the step of combining at least one compound of the present disclosure as an active agent compound with the carrier or excipient (which may constitute one or more accessory ingredients). The carrier must be acceptable, in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient. The carrier may be solid or liquid, or both, and may be formulated with at least one compound described herein as an active compound in a unit-dose formulation, e.g., a tablet, which may contain from about 0.05% to about 95% by weight of at least one active compound. Other pharmacologically active substances, including other compounds, may also be present. The formulations of the present disclosure may be prepared by any of the well known techniques of pharmacy which consist essentially of mixing the ingredients.

[0068] For solid compositions, conventional non-toxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like. Liquid pharmaceutically administrable compositions can be prepared, for example, by dissolving or dispersing at least one active compound of the present disclosure described herein and optional pharmaceutical adjuvants in an excipient such as water, saline, aqueous dextrose, glycerol, ethanol, etc., to form a solution or suspension. In general, suitable formulations can be prepared by uniformly and intimately mixing at least one active compound of the present disclosure with a liquid carrier or a finely divided solid carrier, or both, and then, if necessary, shaping the product. For example, tablets can be prepared by compressing or molding a powder or granules of at least one compound of the present disclosure, optionally combined with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine at least one compound of the present disclosure in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent and / or surfactant / dispersant. Molded tablets may be made by molding in a suitable machine, in which the powder form of at least one compound of the present disclosure is moistened with an inert liquid diluent.

[0069] Formulations suitable for buccal (sublingual) administration include lozenges comprising at least one compound of the present disclosure in a flavored base, usually sucrose and acacia or tragacanth, and pastilles comprising at least one compound in an inert base such as gelatin and glycerin or sucrose and acacia.

[0070] Formulations of the present disclosure suitable for parenteral administration comprise a sterile aqueous preparation of at least one compound of Formula (I) (e.g., Formula (IA), Formula (IB)), or a tautomer, stereoisomer, or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof, which is approximately isotonic with the blood of the intended recipient. These preparations are administered intravenously, although administration may also be by subcutaneous, intramuscular, or intradermal injection. Such preparations may conveniently be prepared by combining at least one compound described herein with water and rendering the resulting solution sterile and isotonic with blood. Injectable compositions according to the present disclosure may contain from about 0.1 to about 5% w / w of the active compound.

[0071] Formulations suitable for rectal administration are supplied as unit-dose suppositories, which may be prepared by admixing at least one compound described herein with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.

[0072] Formulations suitable for topical application to the skin may take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers and excipients that can be used include petrolatum, lanolin, polyethylene glycol, alcohol, and combinations of two or more thereof. The active compound (i.e., at least one compound of formula (I) (e.g., formula (IA), formula (IB)), or a tautomer, stereoisomer, or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative) is generally present in a concentration of about 0.1% to about 15% w / w of the composition, for example, about 0.5 to about 2%.

[0073] The amount of active compound administered will depend on the subject being treated, the subject's weight, the method of administration, and the judgment of the prescribing physician. For example, a dosing schedule can include daily or semi-daily administration of the encapsulated compound at a recognized dosage of about 1 μg to about 1000 mg. In another embodiment, intermittent administration of a dose of the encapsulated compound, such as on a monthly or yearly basis, may be used. Encapsulation facilitates access to the site of action and allows the active ingredients to be administered simultaneously, theoretically creating a synergistic effect. A physician can easily determine optimal dosages and modify the administration to achieve such dosages by following standard dosing regimens.

[0074] The therapeutically effective amount of the compound or composition disclosed herein can be measured by the therapeutic effectiveness of the compound.However, dosage can vary according to the patient's requirements, the severity of the condition to be treated and the compound used.In one embodiment, the therapeutically effective amount of the disclosed compound is sufficient to establish the maximum plasma concentration.For example, the preliminary dose is determined according to animal test and the dosage scale adjustment for human administration according to the accepted practice in the art.

[0075] Toxicity and therapeutic efficacy can be measured, for example, by LD 50 (the dose that is lethal to 50% of the population) and ED 50 The dose that is therapeutically effective in 50% of the population can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, and the LD 50 / ED 50 Compositions that exhibit large therapeutic indices are preferred.

[0076] Data obtained from cell culture assays or animal studies can be used in formulating a range of dosages for use in humans. Therapeutically effective dosages achieved in one animal model can be converted for use in other animals, including humans, using conversion factors known in the art (see, e.g., Freireich et al., Cancer Chemother. Reports 50(4):219-244 (1966) and the following table for Equivalent Surface Area Dosage Factors). [Table 2]

[0077] Doses of such compounds can be administered with little or no toxicity, and can be used to treat ED 50 The circulating concentration range preferably falls within the range including the range of 100 to 1500 mg / kg. The dosage may vary within this range depending on the dosage form used and the route of administration used. Generally, the therapeutically effective amount may vary depending on the age, condition, and sex of the subject, as well as the severity of the medical condition in the subject. The dosage may be determined by a physician and, if necessary, may be adjusted to suit the observed effects of treatment. Treatment method

[0078] In some embodiments, a compound of Formula (I) (e.g., Formula (IA), Formula (IB)), or a tautomer, stereoisomer, or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative thereof, is administered to a subject in need of treatment for a condition modulated by BTK to treat the condition modulated by BTK. In some embodiments, the condition modulated by BTK is selected from cancer, an immunological disease, an autoimmune disease, and an inflammatory disease.

[0079] In some embodiments, the disease is an inflammatory disease such as arthritis, a kidney disease, or a cancer such as leukemia and lymphoma, e.g., chronic lymphocytic leukemia (CLL), multiple myeloma and small lymphocytic lymphoma (SLL) and B-cell non-Hodgkin's lymphoma.

[0080] In some embodiments, the disease is an autoimmune disease. In some embodiments, the disease is rheumatoid arthritis. In some embodiments, the autoimmune disease is lupus.

[0081] In one embodiment, the subject in need is suffering from a xenoimmune condition or disease, such as graft-versus-host disease, transplantation, blood transfusion, anaphylaxis, allergy, hypersensitivity type I, allergic conjunctivitis, allergic rhinitis, or atopic dermatitis.

[0082] In some embodiments, the subject in need thereof is suffering from an inflammatory disease, such as asthma, appendicitis, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, colitis, or conjunctivitis.

[0083] In some embodiments, the subject in need thereof is suffering from cancer. In one embodiment, the cancer is a B-cell proliferative disorder, e.g., diffuse large B-cell lymphoma, follicular lymphoma, lymphoma, chronic lymphocytic leukemia, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Wandenstrom's macroglobulinemia, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mantle cell lymphoma, longitudinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, Burkitt's lymphoma / leukemia, or lymphomatoid granuloma. In some embodiments, the condition is selected from B-cell malignancies, B-cell lymphoma, diffuse large B-cell lymphoma, chronic lymphocytic leukemia, non-Hodgkin's lymphoma, mantle cell lymphoma, follicular lymphoma, hairy cell leukemia, B-cell non-Hodgkin's lymphoma, marginal zone lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma, bone cancer, bone metastasis, arthritis, multiple sclerosis, osteoporosis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease, lupus, Sjogren's syndrome, and kidney transplant-related disorders. In some embodiments, the condition is mantle cell lymphoma. In some embodiments, the condition is chronic lymphocytic leukemia and small lymphocytic lymphoma. In some embodiments, the condition is Waldenstrom's macroglobulinemia. In some embodiments, the condition is marginal zone lymphoma.

[0084] In some embodiments, the subject in need thereof suffers from a heterologous immune condition or disease, such as graft-versus-host disease (GVHD). In some embodiments, the GVHD is acute GVHD. In some embodiments, the GVHD is chronic GVHD.

[0085] In some embodiments, a compound of Formula (I) (e.g., Formula (IA), Formula (IB)), or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof, is administered as a pharmaceutical composition.

[0086] In some embodiments, the present invention provides a method of degrading BTK in a cell, comprising contacting the cell with an effective amount of a compound of Formula (I) (e.g., Formula (IA), Formula (IB)), a pharmaceutically acceptable salt thereof, or a pharmaceutical composition containing the compound or a pharmaceutically acceptable salt thereof. In one embodiment, the contacting is in vitro. In one embodiment, the contacting is in vivo.

[0087] As used herein, the term "contacting" refers to bringing the indicated moieties together in an in vitro or in vivo system. For example, "contacting" BTK with a compound provided herein includes administering a compound provided herein to an individual or patient, such as a human, having a condition modulated by BTK, and also includes introducing a compound provided herein into, for example, a cell-containing sample or a purified preparation containing BTK.

[0088] The concentration and route of administration to the patient will vary depending on the condition being treated.

[0089] In one embodiment, a compound of Formula (I) (e.g., Formula (IA), Formula (IB)), or a tautomer, stereoisomer, or mixture of stereoisomers thereof, or a pharmaceutically acceptable salt, or hydrate, or deuterated derivative thereof, is administered in combination with other therapeutic agents. In one embodiment, these therapeutic agents include chemotherapeutic agents, steroids, immunotherapeutic agents, targeted therapeutic agents, antibody drug conjugates, B cell receptor pathway inhibitors, antibodies, B cell receptor signaling inhibitors, PI3K inhibitors, IAP inhibitors, mTOR inhibitors, radioimmunotherapeutic agents, DNA damaging agents, proteosome inhibitors, histone deacetylase inhibitors, protein kinase inhibitors, hedgehog inhibitors, Hsp90 inhibitors, telomerase inhibitors, Jak1 / 2 inhibitors, protease inhibitors, BCL2 inhibitors, PKC inhibitors, and PARP inhibitors. In some embodiments, the therapeutic agents are chlorambucil, ifosfamide, doxorubicin, mesalazine, thalidomide, lenalidomide, temsirolimus, everolimus, fludarabine, fostamatinib, paclitaxel, docetaxel, ofatumumab, rituximab, dexamethasone, prednisone, CAL-101, ibritumomab, tositumomab, bortezomib, pentostatin, endostatin, bendamustine, cyclophosphamide, vincristine, venetoclax, and lenalidomide.

[0090] Those skilled in the art will recognize that both in vivo and in vitro tests using suitable, known, and generally accepted cellular and / or animal models are predictive of the ability of a test compound to treat or prevent a given disorder.

[0091] Those skilled in the art will further recognize that human clinical trials, including first-in-human, dose-ranging, and efficacy studies, in healthy patients and / or patients suffering from a given disorder can be completed in accordance with methods well known in the clinical and medical arts. [Example]

[0092] The examples and preparations presented below further illustrate and exemplify the compounds disclosed herein and methods for preparing such compounds. It should be understood that the scope of the present disclosure is in no way limited by the scope of the following examples and preparations.

[0093] The chemical entities described herein can be synthesized in accordance with one or more exemplary schemes herein and / or techniques well known in the art. Unless specifically specified to the contrary, reactions described herein are generally carried out at atmospheric pressure and within a temperature range of about -10°C to about 200°C. Furthermore, unless otherwise specified, reaction times and conditions are intended to be approximations, e.g., carried out at about atmospheric pressure and within a temperature range of about -10°C to about 200°C for a time period that can be, e.g., about 1 to about 24 hours. Reactions carried out overnight can, in some embodiments, average a time period of about 16 hours.

[0094] Isolation and purification of the chemical entities and intermediates described herein, if desired, can be carried out by any suitable separation or purification procedure, such as, for example, filtration, extraction, crystallization, column chromatography, thin layer chromatography or thick layer chromatography, or a combination of these procedures. See, for example, Carey et al., Advanced Organic Chemistry, 3 rd Ed., 1990 New York: Plenum Press; Mundy et al., Name Reaction and Reagents in Organic Synthesis, 2 nd Ed., 2005 Hoboken, NJ: J. Wiley & Sons. Specific examples of suitable separation and isolation procedures are shown by reference to the examples herein below. However, other equivalent separation or isolation procedures may also be used.

[0095] In all of the methods, it is well understood that protecting groups for sensitive or reactive groups may be used where necessary, in accordance with general principles of chemistry. Protecting groups are those described in organic synthesis (TW Greene and PGM Wuts (1999) Protective Groups in Organic Synthesis, 3 rd These groups may be removed at a routine stage of the compound synthesis using methods that are readily apparent to those skilled in the art.

[0096] If desired, the (R)- and (S)-isomers of the non-limiting exemplary compounds can be resolved by methods known to those skilled in the art, such as, for example, by the formation of diastereomeric salts or complexes which can be separated by, for example, crystallization; by the formation of diastereomeric derivatives which can be separated by, for example, crystallization, gas-liquid or liquid chromatography; by the selective reaction of one enantiomer with an enantiomer-specific reagent (e.g., enzymatic oxidation or reduction) followed by separation of the modified and unmodified enantiomers; or by gas-liquid or liquid chromatography in a chiral environment, for example, on a chiral support such as silica containing bound chiral ligands, or in the presence of a chiral solvent. Alternatively, specific enantiomers can be synthesized by asymmetric synthesis using optically active reagents, substrates, catalysts, or solvents, or by converting one enantiomer into the other by asymmetric transformation.

[0097] The compounds described herein can be contacted, if desired, with a pharmaceutically acceptable acid to form the corresponding acid addition salt. Similarly, the compounds described herein can be contacted, if desired, with a pharmaceutically acceptable base to form the corresponding base addition salt.

[0098] In some embodiments, the disclosed compounds can generally be synthesized by appropriate combination of generally known synthetic methods.The techniques useful for synthesizing these chemical entities are easily apparent and available to those skilled in the art based on this disclosure.Many of the starting compounds and other reactants that are optionally substituted are commercially available, for example, from Millipore Sigma, or can be easily prepared by those skilled in the art using commonly used synthetic methodology.

[0099] The following discussion is presented to illustrate certain diverse methods available for use in making the disclosed compounds and is not intended to limit the scope of reactions or reaction sequences that can be used in preparing the compounds presented herein. Those skilled in the art will understand that standard atomic valencies apply to all compounds disclosed herein by genus or named compound unless otherwise specified. The following abbreviations have the definitions set forth below: [Table 5] General synthetic scheme

[0100] The claimed compounds can be prepared according to the following schemes: The following schemes represent the general methods used in preparing these compounds. However, these compounds can also be prepared by a variety of other methods by those skilled in the art of synthetic chemistry, and therefore their synthesis is not limited to these representative methods. Scheme 1: Methods for the preparation of compounds 1, 3, 4, 5 and 6 [ka] [ka] Scheme 2: Methods for the preparation of compound 2 [ka] Scheme 3: Methods for the preparation of compounds 7, 8, 11 and 19 [ka] Scheme 4: Methods for the preparation of compounds 14, 16, 17 and 20 [ka] Scheme 5: Methods for the preparation of compounds 9 and 10 [ka] Scheme 6: Methods for the preparation of compounds 12 and 18 [ka]

[0101] The following compounds were prepared according to Scheme 3: Compounds 22, 23, 28 and 31.

[0102] The following compounds were prepared according to Scheme 4: Compounds 13, 21, 24 and 25.

[0103] The following compounds were prepared according to Scheme 6: Compounds 15, 26, 27, 29, 30 and 34. Scheme 7: Methods for the preparation of compound 32 [ka] Compound 33 can be prepared using similar methods as described in the synthesis of compound 32. Scheme 8: Methods for the preparation of compounds 35, 36 and 38 [ka] Compounds 39, 40 and 41 can be prepared using the methods described in Scheme 8. Scheme 9: Methods for the preparation of compounds 37 and 48 [ka] Compounds 42 and 43 can be synthesized using similar methods described in Scheme 9. Scheme 10: Methods for the preparation of compound 44 [ka] Compounds 45, 46 and 47 can be synthesized using similar methods as described in the preparation of compound 44. Scheme 11: Methods for the preparation of compounds 49, 50, 51, 59 and 70 [ka] Compounds 65, 66, 67, 68, 69, 81, 82 and 85 can be synthesized using similar methods described in Scheme 11. Scheme 12: Methods for the preparation of compounds 52, 53, 54, 56, 57, 58, 60 and 61 [ka] Scheme 13: Methods for the preparation of compounds 71, 72, 78 and 80 [ka] Compound 79 can be synthesized using a similar method as described in Scheme 13. Scheme 14: Methods for the preparation of compounds 73 and 74 [ka] Compounds 75, 76 and 77 can be prepared using similar methods described in Scheme 14. Scheme 15: Methods for the preparation of compounds 83 and 84 [ka] Scheme 16: Methods for the preparation of compounds 86 and 87 [ka] Scheme 17: Methods for the preparation of compounds 88-91 and 100-101 [ka] Compounds 93, 94, 95, 96, 97, 98, 99, 102, 103 and 104 can be prepared using similar methods described in Scheme 11. Scheme 18: Methods for the preparation of compounds 105-108 [ka] Compound 109 can be synthesized using a similar method described in Scheme 18. Preparation of intermediates Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (Intermediate A) [ka] Step 1: Preparation of methyl 2-chloro-4-phenoxybenzoate

[0104] A mixture of methyl 2-chloro-4-fluorobenzoate (20 g, 106.1 mmol), phenol (13 g, 137.9 mmol), and cesium carbonate (51.83 g, 156.1 mmol) in N,N-dimethylformamide (200 mL) was stirred at 90 °C for 16 h. The mixture was extracted with EtOAc (200 mL × 3). The organic layer was washed with saturated NaCl solution and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 50:1 → 5:1) to give methyl 2-chloro-4-phenoxybenzoate (18 g, 64.5%). Step 2: Preparation of (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone

[0105] 5-Bromo-4-chloro-7h-pyrrole[2,3-d]pyrimidine (1 g, 4.3 mmol) was dissolved in tetrahydrofuran (25 mL) and n-BuLi (2.5 M in hexane, 2 equivalents) was slowly added dropwise under Ar at −78° C. The mixture was stirred at −78° C. for 1 hour, and then a solution of methyl 2-chloro-4-phenoxybenzoate (1.1 equivalents) was added dropwise. The mixture was stirred at −78° C. for 2 hours. The reaction was quenched with 1N HCl and extracted with EtOAc. The organic layer was washed with brine and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=9:1 to 1:1) to give (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (650 mg). LCMS: (ES+): m / z 383.02 [M] + . Step 3: Preparation of tert-butyl (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate

[0106] A 20 mL microwave tube was charged with (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (1 g, 2.6 mmol), DIEA (3 equivalents), (R)-tert-butyl 3-aminopiperidine-1-carboxylate (1.2 equivalents), and isopropanol (12 mL). The mixture was heated at 160° C. for 1.5 hours under microwave irradiation. After cooling to room temperature, the reaction mixture was extracted with EtOAc (40 mL×4), and the organic layer was washed with brine and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was recrystallized with 25% EtOAc in petroleum ether to give tert-butyl (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate (1.1 g). LCMS: (ES+): m / z 547.2 [M] + . Step 4: Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone

[0107] To a solution of tert-butyl (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate (11 g, 20.07 mmol) in dioxane (250 mL) was added 4N HCl in dioxane (50 mL). The reaction mixture was stirred at room temperature for 2.0 hours. The mixture was concentrated to dryness under vacuum. The residue was triturated with DCM to give the crude product (9 g). The solid was further purified by reverse phase chromatography to give 7.8 g of the TFA salt. 1H NMR (400 MHz, DMSO-d6) δ 12.91 (br, 1H), 8.91-8.81 (m, 3H), 8.31 (s, 1H), 7.70 (s, 1H), 7.58 (d, J = 8.4 Hz, 1H), 7.49 (t, J = 7.6 Hz, 2H), 7.27 (t, J = 7.6 Hz, 1H), 7.20 - 7.05 (m, 3H), 7.05 (d, J = 6.7 Hz, 1H), 4.44 (s, 1H), 3.56 (br, 1H), 3.25 (br, 1H), 3.02 - 2.97 (m, 2H), 2.15 (br, 1H), 1.98 (br, 1H), 1.82 - 1.77 (m, 2H).LCMS:(ES+):m / z 448.2[M] + . Preparation of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone hydrochloride (Intermediate B) [ka] Step 1: Preparation of tert-butyl 4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate

[0108] A 20 mL microwave tube was charged with (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (4.4 g, 11.45 mmol), DIEA (3 equivalents), 4-aminoperidine-1-tert-butylcarboxylate (1.2 equivalents), and isopropanol (12 mL). The mixture was heated at 160° C. for 1.5 hours under microwave irradiation. After cooling to room temperature, the reaction was extracted with EtOAc (40 mL×4), and the organic layer was washed with brine and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was recrystallized with 25% EtOAc in petroleum ether to give tert-butyl 4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate (5 g). LCMS: (ES+): m / z 547.2 [M] + . Step 2: Preparation of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone hydrochloride

[0109] To a solution of tert-butyl-4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylate (10 g, 18.3 mmol) in dioxane (250 mL) was added 4N HCl in dioxane (50 mL). The reaction mixture was stirred at room temperature for 2.0 hours. The mixture was concentrated to dryness under vacuum. The residue was triturated with DCM to give (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone hydrochloride (8 g). 1H NMR (400 MHz, MeOD) δ 8.47 (s, 1H), 7.85 (s, 1H), 7.57 (d, J = 7.9 Hz, 1H), 7.47 (t, J = 7.8 Hz, 2H), 7.27 (t, J = 7.4 Hz, 1H), 7.18 - 7.10 (m, 3H), 7.04 (d, J = 6.7 Hz, 1H), 4.44 (s, 1H), 3.57 (br, 2H), 3.34 (br, 2H), 2.47 (br, 2H), 2.06 (br, 2H).LCMS:(ES+):m / z 448.2[M] + . Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (Intermediate C) [ka]

[0110] Intermediate 2-1 was prepared according to the above scheme as the hydrochloride salt using a similar method described in the literature. LC / MS 343.1 [M+H] + ; 1 H-NMR (400 MHz, CD3OD) δ ppm 7.76 (d, J = 8.36 Hz, 1 H), 7.47 (s, 1 H), 7.35 (dd, J = 8.36, 1.54 Hz, 1 H), 5.09 (br dd, J = 12.8, 5.40 Hz, 1 H), 3.67 - 3.74 (m, 4 H), 3.37 - 3.42 (m, 4 H), 2.63 - 2.94 (m, 3 H), 2.07 - 2.17 (m, 1 H). Synthesis of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione benzenesulfonic acid (intermediate D) [ka]

[0111] To a solution of (S)-tert-butyl 4-(2-(1-amino-5-tert-butoxy-1,5-dioxopentan-2-yl)-1-oxoisoindolin-5-yl)piperazine-1-carboxylate (5.8 g, 12 mol) in acetonitrile (90 mL) was added benzenesulfonic acid (3.64 g, 23 mol). The mixture was stirred at 85° C. for 12 hours. LC / MS showed the reaction was complete. The mixture was concentrated in vacuo. The residue was triturated with ethyl acetate to give (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione benzenesulfonate (5.2 g, 93%) as an off-white solid. LC / MS 329.1 [M+1] + ; 1 H NMR (400 MHz, DMSO-d6) δ 1.95-1.99 (m, 1H), 2.36-2.41 (m, 1H), 2.58-2.62 (d, 1H), 2.88-2.91 (m, 1H), 3.26 (s, 4H), 3.49-3.52 (m, 4H), 4.21-4.38 (dd, 2H), 5.05-5.10 (dd, 1H), 7.12-7.16 (m, 2H), 7.30-7.358 (m, 3H), 7.58-7.62 (m, 3H), 8.72 (s, 2H). Synthesis of N-(4-(4-amino-1-(4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Intermediate E) [ka] Step 1: Preparation of N-(4-bromobenzyl)-5-fluoro-2-methoxybenzamide

[0112] A solution of 5-fluoro-2-methoxybenzoic acid (30 g, 176 mmol, 1.0 equiv.), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (80.5 g, 212 mmol, 1.2 equiv.), and N,N-diisopropylethylamine (45.6 g, 353 mmol, 2 equiv.) in N,N-dimethylformamide (300 mL) was stirred at 25° C. for 30 minutes. Next, (4-bromophenyl)methanamine (32.8 g, 176 mmol, 1.0 equiv.) was added to the solution, and the mixture was stirred at 25° C. for 12 hours. The solution was poured into water (500 mL) and extracted with ethyl acetate (500 mL x 3). The combined organic phase was washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by silica gel chromatography using 20% ​​to 30% ethyl acetate in petroleum ether as eluent to give the desired compound (56 g, 94% yield) as a white solid. 1 HNMR (400 MHz, CDCl3): δ 8.26 (br s, 1H), 7.94 (q, J = 2.0 Hz, 1H), 7.45 (d, J = 7.6 Hz, 2H), 7.22 (d, J = 8.0 Hz, 2H), 7.16 - 7.12 (m, 1H), 6.94 - 6.91 (m, 1H), 4.61 (d, J = 6.0 Hz, 2H), 3.91 (s, 3H). Step 2: Preparation of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]methyl]benzamide

[0113] To a solution of N-[(4-bromophenyl)methyl]-5-fluoro-2-methoxy-benzamide (46 g, 136 mmol, 1.0 equiv.) and 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (51.8 g, 204 mmol, 1.5 equiv.) in dioxane (500 mL) was added potassium acetate (26.7 g, 272 mmol, 2.0 equiv.) and 1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (9.95 g, 13.6 mmol, 0.1 equiv.). The suspension was degassed under vacuum and purged with nitrogen three times. The mixture was stirred under nitrogen at 90 °C for 12 h. The solution was poured into water (2 L) and extracted with ethyl acetate (1 L x 3). The combined organic phases were washed with brine (2 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The combined crude product was purified by silica gel chromatography using 20% ​​to 30% ethyl acetate in petroleum ether as the eluent. The crude product was triturated with petroleum ether (200 mL), filtered, and the filter cake was dried under vacuum to give the desired compound (50 g, 79% yield) as a white solid. LC / MS: 386.2 [M+H] + . Step 3: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide A mixture of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]methyl]benzamide (10.0 g, 26.0 mmol, 1.0 equiv), 3-iodo-1H-pyrazolo[3,4-d]pyrimidin-4-amine (6.78 g, 26.0 mmol, 1.0 equiv), 1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (3.80 g, 5.19 mmol, 0.2 equiv), potassium phosphate (16.5 g, 77.9 mmol, 3.0 equiv) in dioxane (200 mL) and water (40 mL) was degassed and purged with nitrogen three times, and then the mixture was stirred at 110° C. under a nitrogen atmosphere for 60 hours. The reaction mixture was partitioned between ethyl acetate (1 L) and water (1 L). The organic phase was separated, washed with brine (1 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was triturated with acetonitrile (50 mL) and then ethyl acetate (50 mL), and the solid was collected and dried under vacuum to give the desired compound (6.0 g, 59% yield) as a pale yellow solid. LC / MS: 393.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6): δ 13.59 (s, 1H), 8.86 (t, J = 6.0 Hz, 1H), 8.22 (s, 1H), 7.64 (d, J = 8.0 Hz, 2H), 7.57 - 7.47 (m, 3H), 7.37 - 7.31 (m, 1H), 7.19 (dd, J = 4.4, 9.2 Hz, 1H), 4.59 (d, J = 6.0 Hz, 2H), 3.90 (s, 3H). Step 4: Preparation of N-[[4-[4-amino-1-[4-[4-(dimethoxymethyl)-1-piperidyl]-3-fluoro-phenyl]pyrazolo[3,4-d]pyrimidin-3-yl]phenyl]methyl]-5-fluoro-2-methoxy-benzamide

[0114] To a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl]-5-fluoro-2-methoxy-benzamide (12.0 g, 30.6 mmol, 1.0 equiv.) and 4-(dimethoxymethyl)-1-(2-fluoro-4-iodo-phenyl)piperidine (11.6 g, 30.6 mmol, 1.0 equiv.) in dimethyl sulfoxide (150 mL) was added copper iodide (3.24 g, 17.0 mmol, 0.55 equiv.), 2-(dimethylamino)acetic acid (3.50 g, 33.98 mmol, 1.1 equiv.), and sodium carbonate (7.20 g, 68.0 mmol, 2.2 equiv.). The suspension was degassed under vacuum and purged with nitrogen three times. The mixture was stirred under nitrogen at 110 °C for 12 h. The solution was partitioned between ethyl acetate (800 mL) and water (2.0 L). The separated aqueous layer was extracted with ethyl acetate (700 mL x 3). The combined organic layers were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product (15 g). The crude product was dissolved in ethyl acetate (420 mL) at reflux. The solution was then cooled to ambient temperature without significant precipitate formation, and the mixture was kept in a refrigerator (approximately 5°C) for 48 hours. The solution was filtered, and the filter cake was washed with cold ethyl acetate (20 mL) to give the pure product (5.28 g). The mother liquor was concentrated, and the residue was recrystallized from ethyl acetate (100 mL) to give another crop (1.7 g) of pure product (total 6.98 g, 36% yield) as a gray solid. LC / MS: 644.2 [M+H] + . 1HNMR (400 MHz, CDCl3): δ 8.47 (s, 1H), 8.38 (t, J = 5.2 Hz, 1H), 7.99 (dd, J = 3.2, 9.2 Hz, 1H), 7.97 - 7.93 (m, 1H), 7.92 (s, 1H), 7.75 (d, J = 8.0 Hz, 2H), 7.56 (d, J = 8.0 Hz, 2H), 7.22 - 7.14 (m, 1H), 7.08 (t, J = 8.8 Hz, 1H), 6.97 (dd, J = 4.4, 8.8 Hz, 1H), 5.60 (br s, 2H), 4.78 (d, J = 6.0 Hz, 2H), 4.12 (d, J = 7.2 Hz, 1H), 3.97 (s, 3H), 3.53 (d, J = 12.0 Hz, 2H), 3.39 (s, 6H), 2.69 (t, J = 11.6 Hz, 2H), 1.88 (d, J = 12.0 Hz, 2H), 1.82 - 1.73 (m, 1H), 1.64 - 1.48 (m, 2H). Preparation of (S)-3-(6-fluoro-1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione benzenesulfonic acid (intermediate F) [ka] Step 1: Preparation of methyl 2-bromo-4,5-difluorobenzoate

[0115] To a mixture of 2-bromo-4,5-difluorobenzoic acid (20 g, 0.084 mol) in MeOH (60 mL) was slowly added thionyl chloride (13 g, 0.11 mol) at 10 °C, followed by stirring at 80 °C for 3 h. TLC showed the reaction was complete. The mixture was cooled to room temperature, concentrated, and then partitioned between ethyl acetate and water. The organic layer was washed twice with saturated Na2CO3 and brine, dried over Na2SO4, and concentrated to give the desired crude product (21 g, yield: 100%), which was used in the next step without further purification. Step 2: Preparation of tert-butyl 4-(5-bromo-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate

[0116] A mixture of methyl 2-bromo-4,5-difluorobenzoate (21 g, 0.084 mol), tert-butyl piperazine-1-carboxylate (23.4 g, 0.125 mol), and K2CO3 (17.3 g, 0.125 mol) in N,N-dimethylacetamide (60 mL) was stirred at 80 °C for 16 h. TLC showed the reaction was complete. The mixture was added to water (200 mL) and stirred for 10 min. EtOAc (200 mL) was added. The mixture was partitioned between ethyl acetate and water. The organic layer was washed with water, brine, dried over Na2SO4, and concentrated to give the desired title product (31.6 g, 90% yield). Step 3: Preparation of tert-butyl 4-(5-cyano-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate

[0117] A mixture of tert-butyl 4-(5-bromo-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate (30.6 g, 0.073 mol) and CuCN (9.8 g, 0.11 mol) in DMF (120 mL) was stirred at 100° C. for 16 hours. TLC showed the reaction was complete. The mixture was cooled to room temperature. Ethyl acetate (200 mL) and ammonium hydroxide (200 mL) were added and stirred for 30 minutes. The mixture was filtered. The organic layer was washed with water, dried over NaSO, and concentrated to give the crude product (25.4 g). The crude material was taken up in refluxing petroleum ether (100 mL). The mixture was filtered and dried in an oven at 50° C. to give the title compound (21.5 g, 81% yield). Step 4: Preparation of tert-butyl 4-(2-fluoro-5-formyl-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate

[0118] To a solution of pyridine (39.1 g, 495 mmol), water (20 mL), and acetic acid (26.4 g, 440 mmol) was added tert-butyl 4-(5-cyano-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate (20 g, 55 mmol) and Raney-Nickel (85% in water, 10 g) at room temperature. The resulting mixture was heated to 60° C. Sodium hypophosphite (29.2 g in 50 mL of water) was added dropwise to the mixture. The mixture was stirred at 60° C. for 16 hours. TLC showed that the reaction was not complete. The mixture was further stirred for 10 hours. The mixture was cooled to room temperature. Ethyl acetate and water were added. The mixture was filtered. The organic layer was washed with water, 1N HCl, and brine, dried over Na2SO4, and concentrated under reduced pressure to give the crude product (20.8 g, crude). The resulting residue was purified by silica gel pad to give the desired product (8.7 g, yield: 43%). Step 5: Preparation of tert-butyl (S)-4-(2-(1-amino-5-(tert-butoxy)-1,5-dioxopentan-2-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazine-1-carboxylate

[0119] To a solution of tert-butyl 4-(2-fluoro-5-formyl-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate (8.15 g, 22 mmol) in methanol (50 mL) was added tert-butyl (S)-4,5-diamino-5-oxopentanoate (5.4 g, 27 mmol) at room temperature. Acetic acid (1.98 g, 33 mmol) was added at 0 °C. Sodium cyanoborohydride (2.76 g, 44 mmol) was added slowly. The mixture was stirred at room temperature for 16 hours. TLC showed the reaction was complete. The mixture was concentrated and partitioned between ethyl acetate and water. The organic layer was washed with saturated citric acid, brine, dried over Na2SO4, and concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel pad to give the desired product (8 g, yield: 69%). Step 6: Preparation of (S)-3-(6-fluoro-1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione benzenesulfonic acid

[0120] To a solution of tert-butyl (S)-4-(2-(1-amino-5-(tert-butoxy)-1,5-dioxopentan-2-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazine-1-carboxylate (6.7 g, 13 mmol) in acetonitrile (67 mL) was added benzenesulfonic acid (4.3 g, 26 mmol). The mixture was stirred at 80° C. for 16 hours. LC / MS showed the reaction was complete. The mixture was cooled to room temperature. The mixture was filtered and dried to give the desired product (5.6 g, 86%) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) δ 10.99 (s, 1H), 8.73 (br s, 2H), 7.60 (m, 2H), 7.49 (d, 1H), 7.32 (m, 4H), 5.08 (dd, J = 13.2 and 5.2 Hz, 1H), LC / MS 347.3 [M+H] + Example Example 1 Preparation of 5-((7-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)heptyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 1) [ka] Step 1: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-hydroxyisoindoline-1,3-dione

[0121] To a solution of 3-aminopiperidine-2,6-dione HCl salt (4.1 g, 24.7 mmol) in acetic acid (45 mL) was added sodium acetate (4.1 g, 49.4 mmol), and the mixture was stirred at 25 °C for 1 h. 4-Hydroxyphthalic acid (3.0 g, 16.5 mmol) was added to the mixture, which was then heated to 120 °C for 11 h. The mixture was concentrated and then poured into water (20 mL). The suspension was filtered. The crude product was purified by column chromatography (dichloromethane:methanol = 50:1 to 10:1) to give 2-(2,6-dioxo-3-piperidyl)-5-hydroxy-isoindoline-1,3-dione (3.9 g, 14.3 mmol, 86% yield) as a colorless solid. Step 2: Preparation of tert-butyl 6-(piperazin-1-yl)nicotinate

[0122] To a solution of tert-butyl 6-chloronicotinate (8.52 g, 40 mmol) in tert-butanol (100 mL) was added piperazine (17.2 g, 200 mmol), and the mixture was heated to 60° C. for 6 hours. The mixture was concentrated in vacuo, and the crude product was purified by column chromatography to give the title compound (10 g, 95%) as a colorless solid. LCMS: m / z=264.2 [M] + . Step 3: Preparation of tert-butyl 6-(4-(7-hydroxyheptyl)piperazin-1-yl)nicotinate

[0123] To a solution of tert-butyl 6-(piperazin-1-yl)nicotinate (526 mg, 2 mmol) and 7-bromoheptan-1-ol (468 mg, 2.4 mmol) in CHCN (5 mL) was added KCO at room temperature, and the reaction mixture was stirred at 85 °C for 4 hours. The mixture was diluted with EtOAc and filtered through a Celite pad. The filtrate was concentrated to give tert-butyl 6-(4-(7-hydroxyheptyl)piperazin-1-yl)nicotinate (630 mg, 83%) as a pale yellow solid. LCMS: m / z = 378.3 [M] + . Step 4: Preparation of tert-butyl 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)heptyl)piperazin-1-yl)nicotinate

[0124] To a solution of tert-butyl 6-(4-(7-hydroxyheptyl)piperazin-1-yl)nicotinate (377 mg, 1 mmol) in dry THF (3 mL) was added 2-(2,6-dioxopiperidin-3-yl)-5-hydroxyisoindoline-1,3-dione (383.6 mg, 1.4 mmol) and PPh3 (524 mg, 2.0 mmol) under nitrogen at 25 °C. To this mixture was added DIAD (404 mg, 2.0 mmol) at room temperature. The resulting mixture was stirred at 45 °C for 2 hours. After cooling to room temperature, the reaction was quenched with HO (10 mL) and extracted with EtOAc (10 mL × 2). The combined organic layer was washed with brine (20 mL × 5), dried over anhydrous sodium sulfate, and concentrated. The residue was purified by preparative TLC to give the desired product (80 mg, 12.6%) as a white solid. LCMS: m / z=634.3 [M+1] + . Step 5: Preparation of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)heptyl)piperazin-1-yl)nicotinic acid

[0125] A solution of tert-butyl 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)heptyl)piperazin-1-yl)nicotinate (80 mg, 0.13 mmol) in TFA / DCM (6.0 mL, 1:5) was stirred at room temperature for 3 hours. The reaction mixture was concentrated by rotary evaporation to give the title product (70 mg), which was used in the next step without further purification. LCMS: m / z=578.3 [M+1] + . Step 6: Preparation of 5-((7-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)heptyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0126] To a solution of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)heptyl)piperazin-1-yl)nicotinic acid (58 mg, 0.1 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (54 mg, 0.12 mmol) and DIEA (51.6 mg, 0.4 mmol) in DMF (3 mL) was added HATU (57 mg, 0.15 mmol) at room temperature. The reaction was stirred at room temperature until LCMS showed the reaction was complete. The mixture was quenched with ice water and extracted with DCM (10 mL x 3). The organic layer was washed with water and brine, dried over Na2SO4, filtered, and the solvent was removed by rotary evaporation. The residue was purified by preparative TLC to give the title product (21 mg, 20.8%) as a white solid. LCMS: m / z=1007.4 [M+H] + . 1HNMR (400 MHz, CDCl3-d): δ9.05 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.65 (m, 2H), 7.41-7.31 (m, 5H), 7.23-7.16 (m, 2H), 7.10-7.07 (m, 3H), 6.95-6.93 (m, 1H), 6.50-6.48 (m, 1H), 4.96-4.95 (m, 1H), 4.38 (s, 1H), 4.08 (s, 3H), 3.90 (s, 1H), 3.58-3.44 (m, 6H), 2.91-2.74 (m, 3H), 2.52 (m, 4H), 2.36 (s, 2H), 2.19-2.01 (m, 4H), 1.18-1.75 (m, 5H), 1.51-1.36 (m, 8H). Example 2 Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 2) [ka] Step 1: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-fluoroisoindoline-1,3-dione

[0127] To a solution of 5-fluoroisobenzofuran-1,3-dione (2 g, 12.05 mmol) in acetic acid (30 mL) was added sodium acetate (1.98 g, 24.08 mmol) and 3-aminopiperidine-2,6-dione hydrochloride (1.98 g, 12.05 mmol). The mixture was stirred at 120° C. for 18 hours. The reaction mixture was concentrated under reduced pressure. The residue was poured into water (60 mL) and stirred for 10 minutes. The solid was collected by filtration, washed with water (2×20 mL), and dried under vacuum to give the title compound (2.8 g, 94%) as a white solid. Step 2: Preparation of tert-butyl 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)nicotinate

[0128] In a 20 mL microwave tube, 2-(2,6-dioxopiperidin-3-yl)-5-fluoroisoindoline-1,3-dione (200 mg, 0.724 mmol), tert-butyl 6-(piperazin-1-yl)nicotinate (158 mg, 0.603 mmol), and K2CO3 (167 mg, 1.207 mmol) were suspended in DMF. The mixture was irradiated in a microwave oven at 120 °C for 1 hour. The mixture was extracted with EtOAc (30 mL × 3) and washed with brine (20 mL × 2). The combined organic phase was dried over Na2SO4 and concentrated in vacuo. The residue was purified by preparative TLC to give tert-butyl 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)nicotinate (200 mg). Step 3: Preparation of 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)nicotinic acid

[0129] tert-Butyl 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)nicotinate (180 mg, 0.346 mol) was dissolved in 4N HCl / dioxane, and the mixture was stirred at room temperature for 1 hour. After concentration in vacuo, the title compound (130 mg) was obtained as a yellow solid and used directly in the next step. Step 4: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0130] To a solution of 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)nicotinic acid (130 mg, 0.281 mmol) in DMF (5 mL) was added (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (163 mg, 0.337 mmol), HATU (128 mg, 0.337 mmol), and DIEA (145 mg, 1.12 mmol). The mixture was stirred at room temperature for 3 hours and then extracted with ethyl acetate. The combined organic phases were washed with aqueous sodium chloride solution. After concentration in vacuo, the residue was purified by preparative HPLC to give the title compound (16.8 mg) as a yellow solid. LCMS: (ES + ): m / z 893.3[M+1] + . 1 HNMR (400 MHz, CDCl3): δ: 12.71 (s, 1H), 11.06(s, 1H), 8.87 (s, 1H), 8.17(m, 2H), 7.82 (d, J=13.6Hz, 1H),7.77-7.10(m, 12H)7.05 (br, 1H), 6,68(br,1H, 5.08-5.06(m, 1H), 4,25 (br, 1H), 3,79-3.51 (m, 14H), 2.93-2.89 (m, 1H),2.13-21.85 (m, 5H) Example 3 Preparation of 5-((6-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)hexyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 3) [ka] Compound 3 was prepared using the same procedure described for compound 1 by replacing 7-bromoheptan-1-ol with 6-bromohexan-1-ol in step 3. LCMS: m / z=993.4[M] + . 1 HNMR (400 MHz, CDCl3-d): δ9.04 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.65 (m, 2H), 7.41-7.32 (m, 5H), 7.22-7.18 (m, 2H), 7.10-7.07 (m, 3H), 6.95-6.93 (m, 1H), 6.54-6.50 (m, 1H), 4.96-4.95 (m, 1H), 4.37 (s, 1H), 4.10-4.06 (m, 4H), 3.57-3.42 (m, 6H), 2.90-2.78 (m, 3H), 2.49 (s, 4H), 2.35 (s, 2H), 2.18-2.15 (m, 2H), 2.00 (s, 3H), 1.83-1.51 (m, 10H). Example 4 Preparation of 5-(3-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)propoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 4) [ka] Compound 4 was prepared by the same procedure described for compound 1 in step 3, replacing 7-bromoheptan-1-ol with 3-bromopropan-1-ol. LCMS: m / z=951.3[M] + . 1HNMR (400 MHz, CDCl3-d): δ8.98-8.89 (m, 1H), 8.46-8.32 (m, 2H), 7.81-7.68 (m, 2H), 7.41-7.39 (m, 3H), 7.29-7.20 (m, 3H), 7.09-7.07 (m, 3H), 6.95-6.93 (m, 1H), 6.54-6.47 (m, 1H), 4.96-4.93 (m, 1H), 4.35-4.13 (m, 4H), 3.74-3.73 (m, 1H), 3.57 (s, 3H), 3.35-3.32 (m, 1H), 2.91-2.73 (m, 4H), 2.47 (s, 3H), 2.38-2.17 (m, 5H), 1.89-1.59 (m, 9H). Example 5 Preparation of 5-(2-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)ethoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 5) [ka] Step 1: Preparation of tert-butyl 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinate

[0131] To a solution of tert-butyl 6-(piperazin-1-yl)nicotinate (800 mg, 3.04 mmol) in acetonitrile (20 mL) was added 2-bromoethanol (452 ​​mg, 3.65 mmol) and K2CO3 (839 mg, 6.08 mmol). The mixture was stirred at 85 °C for 12 hours. The mixture was diluted with ethyl acetate and then filtered. The filtrate was concentrated to give tert-butyl 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinate (760 mg, 78.9%), which was used directly in the next step. LCMS: 308.2 [M+H] + . Step 2: Preparation of tert-butyl 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinate

[0132] To a solution of tert-butyl 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinate (760 mg, 2.47 mmol) in THF (10 mL) was added 2-(2,6-dioxopiperidin-3-yl)-5-hydroxyisoindoline-1,3-dione (813 mg, 2.97 mmol) and PPh3 (1.01 g, 2.97 mmol), followed by DIAD (748 mg, 3.70 mmol). The reaction was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo. The residue was dissolved in ethyl acetate and washed with aqueous sodium chloride solution. The organic phase was concentrated to dryness, and the residue was purified by silica gel column chromatography (DCM / MeOH=20 / 1) to give tert-butyl 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinate (130 mg, 87.1%). LCMS: 564.3 [M+H] + . Step 3: Preparation of 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid

[0133] A solution of tert-butyl 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinate (130 mg, 0.23 mol) in DCM / TFA (3:1) was stirred at room temperature for 1 hour. After concentration in vacuo, 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid (120 mg) was obtained as a yellow oil, which was used directly in the next step. LCMS: 508.1 [M+H] + . Step 4: Preparation of 5-(2-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)ethoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0134] To a solution of 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid (120 mg, 0.236 mmol) in DMF (30 mL) was added (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (137 mg, 0.283 mmol), HATU (90 mg, 0.283 mmol), and DIEA (121 mg, 0.944 mmol). The mixture was stirred at room temperature for 3 hours and then extracted with ethyl acetate. The combined organic phase was washed with aqueous sodium chloride solution. After concentration in vacuo, the residue was purified by preparative HPLC to give the title compound (19 mg, 9%) as a yellow solid. LC-MS: (ES + ): m / z 940.3[M+1] + . 1 HNMR (400 MHz, CDCl3): δ: 8.99 (s, 1H), 8.35(s, 1H),8.29(s, 1H)7.77 (d, J=8.4Hz, 1H), 7.65(s, 1H)7.49-7.39 (m, 4H),7.30(s, 1H),7.29-7.10(s, 2H)7.07-7.07 (m, 2H), 6.95 (d, J=1.6Hz, 1H), 6.47 (s, 1H), 5.36-5.34 (m, 1H),4.97-4.94 (m, 1H), 4.31 (s, 2H),4.15-4.06 (m, 1H),3.57(s, 6H),2.86(s, 4H), 2.63 (s, 4H), 2.25-2.12 (m, 2H), 2.08-2.01 (m, 2H) ,1.92(s, 1H),1.85(s, 1H) Example 6 Preparation of 5-((5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)pentyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 6) [ka] Compound 6 was prepared by the same procedure described for compound 1 in step 3, replacing 7-bromoheptan-1-ol with 5-bromopentan-1-ol. LCMS: m / z=979.4[M] + . 1 HNMR (400 MHz, CDCl3-d): δ9.06 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.64 (m, 2H), 7.43-7.38 (m, 3H), 7.33-7.31 (m, 2H), 7.23-7.15 (m, 2H), 7.10-7.06 (m, 3H), 6.95-6.93(m, 1H), 6.51-6.48 (m, 1H), 4.97-4.93 (m, 1H), 4.38 (s, 1H), 4.12-4.07 (m, 3H), 3.56-3.47 (m, 6H), 2.90-2.73 (m, 3H), 2.49(s, 4H), 2.36-2.35 (m, 2H), 2.19-2.01 (m, 4H),1.88-1.50 (m, 10H). Example 7 Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 7) [ka] Step 1: Preparation of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one

[0135] A mixture of 6-bromohexanoyl chloride (45 mg, 0.21 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (94 mg, 0.21 mmol) and DIEA (136 mg, 1 mmol) in DCM (5 mL) was stirred at room temperature for 1 hour. The reaction mixture was quenched by adding water (5 mL). The organic phase was collected and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC (DCM / MeOH=10:1) to give the desired product as a white solid (150 mg, 98%). LC / MS: 624.5 [M+H] + . Step 2: Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0136] A mixture of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one (150 mg, 0.20 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (90.9 mg, 0.24 mmol), KCO (165.9 mg, 1.2 mmol), and KI (7.9 mg, 0.05 mmol) in DMF (3 mL) was stirred at 60 °C for 16 h. The reaction mixture was filtered, and the solution was concentrated in vacuo. The residue was purified by preparative TLC (DCM / MeOH=10:1) to give the desired product as a white solid (37 mg, 19.8%). LC / MS: 885.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.78 (br, 1H), 11.11 (s, 1H), 8.92 - 8.89 (m, 1H), 8.30 - 8.25 (m, 1H), 7.71 - 7.61 (m, 2H), 7.59 - 7.52 (m, 1H), 7.51 - 7.39 (m, 2H), 7.37 (s, 1H), 7.32 - 7.23 (m, 2H), 7.22 - 7. 12 (m, 3H), 7.07 - 6.96 (m, 1H), 5.09 (dd, J = 12.9, 5.3 Hz, 1H), 4.31 - 4.13 (m, 1H), 3.89 - 3.71 (m, 1H), 3.67 - 3.37 (m, 6H), 2.96 - 2.81 (m, 1H), 2.70 - 2.54 (m, 2H), 2.49 - 2.17 (m, 5H), 2.03 (d, J = 4.9 Hz, 2H), 1.95 - 1.67 (m, 3H), 1.65 - 1.41 (m, 4H), 1.39 - 1.02 (m, 5H), 1.00 - 0.70 (m, 1H). Example 8 Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 8) [ka] Step 1: Preparation of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one

[0137] To a solution of 7-bromoheptanoyl chloride (60 mg, 0.26 mmol) in DCM (5 mL) was added (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (145.8 mg, 0.26 mmol) and N,N-diisopropylethylamine (335.4 mg, 2.6 mmol). The reaction mixture was stirred at room temperature overnight. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (45 mg, 27%) as a white oil. LC / MS: 639.6 [M+H] + . Step 2: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0138] To a solution of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one (45 mg, 0.07 mmol) and 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (23 mg, 0.06 mmol) in acetonitrile at room temperature was added N,N-diisopropylethylamine (27.09 mg, 0.21 mmol) and KI (1.2 mg, 0.007 mmol). The reaction mixture was stirred at room temperature overnight. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (32 mg, 50.8%). LC / MS: 899.3 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.81 (br, 1H), 11.10 (s, 1H), 8.95 - 8.85 (m, 1H), 8.32 - 8.25 (m, 1H), 7.70 - 7.61 (m, 2H), 7.59 - 7.53 (m, 1H), 7.51 - 7.49 (m, 2H), 7.40 - 7.25 (m, 3H), 7.24 - 7.15 (m, 3H), 7.12 - 7.03 (m, 1H), 5.14 - 5.07 (m, 1H), 4.27 - 4.16 (m, 1H), 3.82 - 3.74 (m, 1H), 3.62 - 3.41 (m, 4H), 3.29 - 3.27 (m, 2H), 2.95 - 2.85 (m, 1H), 2.70 - 2.62 (m, 2H), 2.45 - 2.12 (m, 5H), 2.08 - 1.98 (m, 2H), 1.90 - 1.70 (m, 3H), 1.65 - 1.40 (m, 4H), 1.31 - 1.10 (m, 7H), 0.95 - 0.82 (m, 1H). Example 9 5-(4-((5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 9) [ka] Step 1: Preparation of tert-butyl 6-methylnicotinate

[0139] To a solution of 6-methylnicotinic acid (5.2 g, 37.9 mmol) in toluene (150 mL) were added DMAP (520 mg, 3.79 mmol) and BocO (12.37 g, 56.9 mmol). The mixture was stirred at 110° C. for 12 hours. After cooling to room temperature, the mixture was diluted with ethyl acetate and extracted with aqueous sodium chloride solution. The combined organic phases were concentrated in vacuo, and the residue was purified by silica gel column chromatography (eluted with 3% EtOAc in petroleum ether) to give the title product (5.09 g, 69%). LCMS: m / z 194.2 [M+1] + . Step 2: Preparation of tert-butyl 6-(bromomethyl)nicotinate

[0140] To a solution of tert-butyl 6-methylnicotinate (590 mg, 3.05 mmol) in carbon tetrachloride (10 mL) was added NBS (440 mg, 2.48 mmol) and AIBN (59 mg, 0.3 mmol). The mixture was stirred at 70° C. for 12 hours and then diluted with ethyl acetate. After extraction with aqueous sodium chloride, the combined organic phase was concentrated under vacuum. The residue was purified by silica gel column chromatography (eluted with 3% EtOAc in petroleum ether) to give the title product (320 mg, 38.5%). Step 3: Preparation of tert-butyl 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)nicotinate

[0141] To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (520 mg, 1.52 mmol) in CH3CN (10 mL) was added DIEA (770 mg, 5.96 mmol), and the mixture was stirred at room temperature for 20 minutes. To the reaction mixture was added tert-butyl 6-(bromomethyl)nicotinate (316 mg, 1.16 mmol), and the mixture was stirred at room temperature for 12 hours. The reaction was quenched with water and extracted with EtOAc (100 mL x 3). The combined organic phase was washed with brine and dried over Na2SO4. After filtration, the organic solvent was removed under vacuum. The residue was purified by column chromatography (DCM / MeOH=50 / 1) to give tert-butyl 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)nicotinate (480 mg, 59%). LCMS: m / z 534.3 [M+1] + . Step 4: Preparation of 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)nicotinic acid

[0142] tert-Butyl 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)nicotinate (480 mg, 0.9 mmol) was dissolved in 4N HCl / dioxane (30 mL) and stirred at room temperature for 5 hours. The mixture was concentrated in vacuo to give the title product (470 mg), which was used in the next step without further purification. LCMS: (ES + ): m / z 478.2[M+1] + . Step 5: Preparation of 5-(4-((5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0143] To a solution of 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)nicotinic acid (220 mg, 0.46 mmol) in DMF (5 mL) was added (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (240 mg, 536 mmol), HOBT (120 mg, 0.88 mmol), EDCI (170 mg, 0.89 mmol), and DIEA (350 mg, 2.713 mmol). The mixture was stirred at room temperature for 12 hours. The mixture was diluted with water and extracted with EtOAc (100 mL × 3). The combined organic phase was washed with brine and dried over Na2SO4. After filtration, the solvent was removed by rotary evaporation and the residue was purified by preparative HPLC to give the title product (27 mg, 6%) as a yellow solid. LCMS: m / z 454.2 [M+1] + . 1HNMR (400 MHz, CDCl3): δ: 8.91(s, 1H), 8.34 (s, 1H) 8.68 (d, J=8.4Hz, 1H) 8.20 (d, J=8Hz, 1H) 7.85-7.61 (m, 2H) 7.45-7.35 (m, 5H) 7.31 (s, 2H) 7.29-7.11(m, 2H) 7.10(s, 1H) 7.09-7.01 (m, 3H) 6.96 (d, J=8.0Hz, 1H) 5.98-5.91 (m, 1H) 4.21 (s, 1H) 4.11 (s, 1H) 4.12-3.89 (m, 1H) 3.72 (s, 3H) 3.35 (s, 6H) 2.92-2.71(m, 4H) 2.55 (s, 3H) 2.27-2.15(m, 1H) 2.14-2.09(m, 3H) Example 10 Preparation of 5-(4-((1-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 10) [ka] Step 1: Preparation of tert-butyl 4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate

[0144] To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (540 mg, 1.578 mmol) in DCM (20 mL) was added tert-butyl 4-formylpiperidine-1-carboxylate (350 mg, 1.643 mmol) and sodium triacetoxyborohydride (990 mg, 4.691 mmol). The mixture was stirred at room temperature overnight. The reaction mixture was extracted with ethyl acetate (40 mL x 4) and washed with aqueous sodium chloride solution. The organic phase was concentrated in vacuo, and the residue was purified by column chromatography with DCM / MeOH 100:1 to 50:1 to give the title compound (469 mg, 55.1%). LCMS: (ES + ): m / z 440 [M+1-Boc] + . Step 2: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindoline-1,3-dione

[0145] tert-Butyl 4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate (400 mg, 0.74 mmol) was dissolved in HCl / dioxane (10 mL) and the mixture was stirred at room temperature for 1.5 hours. The solid was collected by filtration to give the title compound (450 mg) as the HCl salt. LCMS: 440.2 [M+H] + . Step 3: Preparation of tert-butyl 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinate

[0146] To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindoline-1,3-dione (350 mg, 0.797 mmol) in DMSO (20 mL) was added tert-butyl 6-chloronicotinate (169 mg, 0.793 mmol), L-proline (70 mg, 10%), KCO (220 mg, 1.59 mmol), and CuI (35 mg, 10%). The mixture was stirred at 90 °C for 12 h. The mixture was extracted with EtOAc (50 mL × 4), and the organic phase was washed with aqueous sodium chloride (40 mL × 3). The organic phase was concentrated in vacuo, and the residue was purified by column chromatography (DCM / MeOH 20:1) to give the title compound (280 mg, 71.4%) as a yellow oil. LCMS:(ES + ): m / z 617.3 [M+H] + . Step 4: Preparation of 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinic acid

[0147] tert-Butyl 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinate (280 mg, 0.133 mmol) was dissolved in DCM (6 mL) and TFA (2 mL). The mixture was stirred at room temperature for 2 hours. After evaporation of the solvent in vacuo, the residue was dissolved in DCE and then concentrated to dryness in vacuo. The residue was azeotroped three times with DCE to give the title compound (340 mg) as a pale yellow oil. LCMS: (ES + ): m / z 562.2[M+1] + . Step 5: Preparation of 5-(4-((1-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0148] To a solution of 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinic acid (110 mg, 0.196 mmol) in DMF (20 mL) was added (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (70 mg, 0.156 mmol) and DIEA (300 mg, 2.34 mmol), followed by addition of HATU (89 mg, 0.234 mmol) at room temperature. The mixture was stirred at room temperature for 2 hours. After extraction with EtOAc (30 mL×4), the organic phase was concentrated in vacuo. The residue was purified by preparative HPLC to give the title product (18.8 mg) as a yellow solid. LCMS: (ES + ): m / z 992.3[M+1] + , 1 HNMR (400 MHz, CDCl3): δ: 10.20 (s, 1H), 8.34 (s, 1H), 8.18 (s, 1H), 8.06 (s, 1H), 7.77 (d, J=8.4Hz, 1H), 7.22-7.12 (m, 5H), 7.11-6.19 (m, 2H), 5.35-5.33 (m, 1H), 4.97-4.93 (m, 1H), 4.51-4.21(m, 3H), 3.91-3.85(m, 3H), 3.76 (s, 5H), 3.41-3.03(m, 8H), 2.91-2.71 (m, 4H), 1.71-1.59 (m, 1H), 1.54(d, J=6.8Hz, 4H), 1.45 (s, 2H). Example 11 Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 11) [ka] Step 1: Preparation of tert-butyl 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanoate

[0149] To a solution of tert-butyl 5-bromopentanoate (47 mg, 0.2 mmol) in ACN (10 mL) was added 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (75.7 mg, 0.2 mmol) and N,N-diisopropylethylamine (38.7 mg, 0.3 mmol). The reaction mixture was stirred at 60° C. overnight. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (60 mg, 60.1%) as a yellow solid. LC / MS: 498.8 [M+H] + . Step 2: Preparation of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid

[0150] To a solution of tert-butyl 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanoate (40 mg, 0.08 mmol) in DCM (10 mL) was added TFA (2 mL). The reaction was stirred at room temperature for 4 hours. The solution was concentrated in vacuo to give the crude product (35 mg, yield: 100%) as a yellow solid. LC / MS: 442.7 [M+H] + . Step 3: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0151] To a solution of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid (35 mg, 0.08 mmol) and (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (44.88 mg, 0.08 mmol) in DMF (10 mL) stirred under nitrogen at room temperature, HATU (36.48 mg, 0.096 mmol) and DIEA (15.48 mg, 0.12 mmol) were added. The reaction mixture was stirred at room temperature overnight. The solvent was removed in vacuo to give the crude product. The crude product was purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (40 mg, 57.4%). LC / MS: 871.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.84 (br, 1H), 11.12 (s, 1H), 9.57 - 9.51 (m, 1H), 8.96 - 8.90 (m, 1H), 8.38 - 8.35 (m, 1H), 7.77 (d, J = 8.5 Hz, 1H), 7.68 (d, J = 9.7 Hz, 1H), 7.57 (dd, J = 8.5, 3.0 Hz, 1H), 7.51 - 7.46 (m, 2H), 7.38 - 7.15 (m, 5H), 7.08 - 7.01 (m, 1H), 5.14 - 5.06 (m, 1H), 4.26 - 4.16 (m, 3H), 3.99 - 3.85 (m, 2H), 3.56 - 3.52 (m, 2H), 3.27 - 3.03 (m, 5H), 2.94 - 2.84 (m, 1H), 2.69 - 2.54 (m, 3H), 2.45 - 2.41 (m, 1H), 2.37 - 2.31 (m, 1H), 2.10 - 1.99 (m, 2H), 1.80 - 1.50 (m, 6H), 1.30 - 1.23 (m, 2H), 0.90 - 0.80 (m, 1H). Example 12 Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 12) [ka] Step 1: Preparation of 7-bromoheptanal

[0152] To a solution of 7-bromoheptan-1-ol (1 g, 5.52 mmol) in DMSO (30 mL) was added IBX (1.8 g, 6.62 mmol), and the mixture was stirred at room temperature for 12 hours. The mixture was diluted with water (30 mL) and filtered. The filtrate was extracted with EtOAc. The combined organic phase was washed with aqueous sodium bicarbonate and brine. The solvent was dried over Na2SO4 and then concentrated in vacuo to give 7-bromoheptanal (780 mg, 4.062 mmol) as a yellow oil. Step 2: Preparation of 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0153] To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (260 mg, 0.76 mmol) in DCM (20 mL) was added 7-bromoheptanal (161 mg, 0.83 mmol) at 0 °C. The mixture was stirred for 30 minutes, and then Na(OAc)3BH (483 mg, 2.28 mmol) was added. The mixture was stirred at room temperature for 12 hours, extracted with ethyl acetate, and washed with sodium chloride solution. The combined organic phases were dried over Na2SO4 and concentrated in vacuo to give 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (410 mg, 89%) as a yellow solid. LCMS: m / z 519[M+1] + . Step 3: Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0154] To a solution of 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (410 mg, 0.75 mmol) in DMSO (10 mL) was added (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (472 mg, 0.97 mmol) and DIEA (483 mg, 3.75 mmol). The mixture was stirred at 70° C. for 12 hours and filtered. The filtrate was extracted with ethyl acetate and washed with brine. The organic phase was dried over NaSO and concentrated in vacuo. The residue was purified by preparative HPLC to give the desired product (42.8 mg, 6%) as a yellow solid. LCMS: m / z 443[M+1] 2+ . 1 HNMR (400 MHz, DMSO): δ: 12.85 (s, 1H), 11.09 (s, 1H),8.81 (d, J=7.2Hz, 1H) 8.29 (s, 1H),7.77 (d, J=8.4Hz, 1H) 7.68 (s, 1H),7.58 (d, J=8.4Hz, 1H),7.53-7.45 (m, 3H),7.39 (s, 1H),7.29-7.21 (m, 1H) 7.18(d, J=8.8Hz, 3H),7.05(d, J=2.4Hz, 1H),5.12-5.10 (m, 2H),4.32 (s, 1H),4.22 (s, 2H),3.59-3.48(m, 4H),3.21-3.09 (m, 8H),2.95-2.81(m, 1H),2.69-2.52 (m, 2H),2.36 (d, J=14.0Hz, 1H),2.15 (s, 2H),2.05-2.01 (m, 1H),2.71 (s, 4H),1.34 (s, 6H),1.23 (s, 2H) Example 13 (S)-3-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 13) [ka] Step 1: Preparation of 6-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one

[0155] To a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (90 mg, 0.2 mmol) in DCM (5 mL) stirred under argon was added 6-bromohexanoyl chloride (43 mg, 0.2 mmol) and DIEA (130 mg, 1.0 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours. The mixture was concentrated in vacuo and purified by preparative TLC (DCM / MeOH=10:1) to give the title compound (120 mg, 96%) as a white solid. LC / MS: 623.6 [M+H] + . Step 2: Preparation of (S)-3-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0156] To a solution of 6-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one (110 mg, 0.18 mmol) in ACN (2 mL) stirred under argon at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (88 mg, 0.18 mmol), DIEA (116 mg, 0.9 mmol), and potassium iodide (6.0 mg, 0.04 mmol) were added. The reaction mixture was stirred at 25° C. for 16 hours. The crude product was concentrated in vacuo and purified by preparative TLC (DCM / MeOH=10:1) to give the title compound (13 mg, 8.3%). LC / MS: 872.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.80 (s, 1H), 10.97 (s, 1H), 10.49 (br, 1H), 8.84 (d, J = 7.4 Hz, 1H), 8.27 (s, 1H), 7.65 (s, 1H), 7.59 (d, J = 8.5 Hz, 2H), 7.49 (t, J = 7.9 Hz, 2H), 7.26 (t, J = 7.4 Hz, 1H), 7.22 - 7.19 (m, 2H), 7.18 - 7.15 (m, 1H), 7.07 - 7.00 (m, 1H), 5.07 (dd, J = 13.2, 5.0 Hz, 1H), 4.42 - 4.30 (m, 2H), 4.27 - 4.13 (m, 2H), 4.05 - 3.96 (m, 1H), 3.90 - 3.82 (m, 1H), 3.62 - 3.54 (m, 1H), 3.30 - 3.20 (m, 2H), 3.19 - 2.97 (m, 4H), 2.95 - 2.86 (m, 1H), 2.69 - 2.56 (m, 1H), 2.47 - 2.31 (m, 4H), 2.13 - 2.01 (m, 2H), 2.00 - 1.92 (m, 1H), 1.82 - 1.65 (m, 2H), 1.64 - 1.45 (m, 4H), 1.43 - 1.32 (m, 3H), 1.30 - 1.17 (m, 3H). Example 14 (S)-3-(5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 14) [ka] Step 1: Preparation of tert-butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate

[0157] To a solution of tert-butyl 5-bromopentanoate (50 mg, 0.21 mmol) in MeCN (5 mL) stirred at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (103 mg, 0.21 mmol), KI (35 mg, 0.21 mmol), and DIEA (109 mg, 0.84 mmol) were added. The reaction mixture was stirred at 60 °C for 12 h. The mixture was cooled to room temperature, poured into water (45 mL), and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na SO , and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (MeOH / DCM = 1:10) to give the desired product (100 mg, yield = 98.4%) as a yellow solid. LC / MS: 484.9 [M+H] + . Step 2: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid

[0158] A solution of tert-butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate (100 mg, 0.20 mmol) in TFA / DCM (1:5, 12 mL) was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo to give the crude product (100 mg, crude). LC / MS: 428.8 [M+H] + . Step 3: Preparation of (S)-3-(5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0159] To a solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid (100 mg, 0.20 mmol) in DMF (5 mL) was added HATU (94 mg, 0.25 mmol), DIEA (107 mg, 0.828 mmol), and (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (116 mg, 0.187 mmol) at room temperature. The reaction mixture was stirred at room temperature for 2 hours. The mixture was poured into water (45 mL) and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC (MeOH / DCM=1:10) to give the desired product (25 mg, 14.5% yield over two steps). LC / MS: 857.6 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.83 (br, 1H), 10.97 (s, 1H), 8.95 - 8.85 (m, 1H), 8.37 - 8.25 (m, 1H), 7.71 - 7.63 (m, 1H), 7.60 - 7.53 (m, 3H), 7.48 (t, J= 7.6 Hz, 2H), 7.25 (t, J= 7.6 Hz, 1H), 7.24 - 7.16 (m, 3H), 7.15 - 7.06 (m, 2H), 7.04 (dd, J= 8.4, 2.4 Hz, 1H), 5.09 - 5.04 (m, 1H), 4.40 - 4.30 (m, 1H), 4.28 - 4.15 (m, 2H), 3.95 - 3.75 (m, 1H), 3.65 - 3.41 (m, 5H), 3.22 - 3.10 (m, 2H), 2.98 - 2.85 (m, 2H), 2.60 - 2.52 (m, 2H), 2.47 - 2.28 (m, 3H), 2.28 - 2.15 (m, 1H), 2.09 - 1.94 (m, 2H), 1.88 - 1.70 (m, 2H), 1.65 - 1.40 (m, 4H), 1.31 (t, J= 7.2 Hz, 2H), 1.26 - 1.21 (m, 1H). Example 15 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 15) [ka] Step 1: Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-((1-(6,6-dimethoxyhexyl)piperidin-3-yl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone

[0160] A suspension of 6-bromo-1,1-dimethoxyhexane (21 mg, 0.09 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (50 mg, 0.09 mmol), KI (15 mg, 0.09 mmol) and DIEA (24 mg, 0.18 mmol) in DMF (2 mL) was stirred at 25° C. for 16 h. The solvent was removed in vacuo. The residue was purified by chromatography eluting with DCM / MeOH=20:1 to give the product (50 mg, 94%) as a yellow solid. LC / MS: 592.3 [M+H] + . Step 2: Preparation of (R)-6-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexanal

[0161] To a solution of (R)-(2-chloro-4-phenoxyphenyl)(4-((1-(6,6-dimethoxypentyl)piperidin-3-yl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (50 mg, 0.08 mmol) in ACN (2 mL) was added TsOH (14 mg, 0.08 mmol) and HOAc (14 mg, 0.08 mmol). The reaction mixture was stirred at 25 °C for 5 h. The mixture was concentrated in vacuo. The residue was dissolved in EtOAc (10 mL) and washed with saturated NaHCO3 solution. The organic phase was dried over Na2SO4 and concentrated in vacuo to give the title product (35 mg, 80%) as a yellow solid. LC / MS: 546.2 [M+H] + . Step 3: Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0162] A solution of (R)-6-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexanal (35 mg, 0.07 mmol), EtN (14 mg, 0.14 mmol), and 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (27 mg, 0.07 mmol) in DCM (5 mL) was stirred at 25° C. for 10 min. The mixture was cooled to 0° C., and NaBH(OAc) (22 mg, 0.11 mmol) was added in small portions. The mixture was stirred at 25° C. for 16 h. The solvent was removed in vacuo and the residue was purified by chromatography eluting with DCM / MeOH=20:1 to give the title product (15 mg, 24%) as a yellow solid. LC / MS: 872.3 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.79 (br, 1H), 10.97 (s, 1H), 10.60 (br, 1H), 8.83 (d, J = 7.5 Hz, 1H), 8.27 (s, 1H), 7.64 (s, 1H), 7.60 - 7.46 (m, 3H), 7.26 (t, J = 7.4 Hz, 1H), 7.23 - 7.06 (m, 4H), 7.04 - 7.01 (m, 1H), 5.09 - 5.04 (m, 1H), 4.42 - 4.13 (m, 4H), 4.09 - 3.93 (m, 1H), 3.92 - 3.78 (m, 1H), 3.72 - 3.41 (m, 2H), 3.29 - 3.17 (m, 3H), 3.14 - 2.85 (m, 4H), 2.77 - 2.52 (m, 4H), 2.42 - 2.30 (m, 3H), 2.13 - 1.60 (m, 3H), 1.77 - 1.65 (m, 1H), 1.58 - 1.45 (m, 3H), 1.41 - 1.19 (m, 5H). Example 16 Preparation of (S)-3-(5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 16) [ka] Step 1: Preparation of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one

[0163] To a mixture of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (113 mg, 0.20 mmol) and DIEA (77.8 mg, 0.60 mmol) in DCM (10 mL) was added 6-bromohexanoyl chloride (42.8 mg, 0.20 mmol) at 0 °C. The mixture was stirred at room temperature for 5 h. The mixture was concentrated in vacuo. The crude product was purified by silica gel chromatography with 4-8% MeOH in DCM to give the desired compound (80 mg, 64%). LC / MS: 623.5 [M+H] + . Step 2: Preparation of (S)-3-(5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0164] A mixture of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexan-1-one (50 mg, 0.08 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (38.8 mg, 0.08 mmol), DIEA (20 mg, 0.16 mmol), and NaI (1.2 mg, 0.008 mmol) in ACN (9 mL) was stirred at 90 °C under a N atmosphere for 18 h. The mixture was concentrated in vacuo. The residue was purified by silica gel chromatography with 5-10% MeOH in DCM to give the desired compound (38 mg, 70%). LC / MS: 871.4 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.75 (br, 1H), 10.96 (s, 1H), 8.91 (d, J = 6.8 Hz, 1H), 8.30 - 8.26 (m, 1H), 7.68 - 7.59 (m, 1H), 7.56 - 7.46 (m, 4H), 7.32 - 7.24 (m, 1H), 7.21 - 7.13 (m, 3H), 7.10 - 7.02 (m, 3H), 5.08 - 5.03 (m, 1H), 4.37 - 4.29 (m, 1H), 4.25 - 4.16 (m, 2H), 3.82 - 3.70 (m, 1H), 3.65 - 3.39 (m, 3H), 3.28 - 3.15 (m, 2H), 2.95 - 2.83 (m, 2H), 2.72 - 2.65 (m, 1H), 2.63 - 2.59 (m, 1H), 2.57 - 2.55 (m, 1H), 2.49 - 2.40 (m, 2H), 2.37 - 2.31 (m, 1H), 2.28 - 2.15 (m, 2H), 2.03-1.95 (m, 2H), 1.81 - 1.71 (m, 2H), 1.63 - 1.32 (m, 4H), 1.30 - 1.18 (m, 3H), 1.15 - 1.08 (s, 2H), 0.90 - 0.84 (m, 1H). Example 17 3-(5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 17) [ka] Step 1: Preparation of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one

[0165] To a mixture of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (113 mg, 0.20 mmol) and DIEA (77.8 mg, 0.60 mmol) in DCM (10 mL) was added 7-bromoheptanoyl chloride (45.7 mg, 0.20 mmol) at 0 °C. The mixture was stirred at room temperature for 5 h. The mixture was concentrated in vacuo. The crude product was purified by silica gel chromatography with 4-8% MeOH in DCM to give the desired compound (80 mg, 63%). LC / MS: 637.4 [M+H] + . Step 2: Preparation of 3-(5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0166] A mixture of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one (50 mg, 0.08 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (38.8 mg, 0.08 mmol), DIEA (20 mg, 0.16 mmol), and NaI (1.2 mg, 0.008 mmol) in ACN (9 mL) was stirred at 90 °C under a N atmosphere for 18 h. The mixture was concentrated in vacuo. The residue was purified by silica gel chromatography with 5–10% MeOH in DCM to give the desired compound (22 mg, 98% purity, 30% yield). Chiral chromatography analysis showed partial racemization. LC / MS: 885.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.75 (br, 1H), 10.96 (s, 1H), 8.92 - 8.86 (m, 1H), 8.32 - 8.25 (m, 1H), 7.72 - 7.60 (m, 1H), 7.57 - 7.46 (m, 4H), 7.32 - 7.20 (m, 1H), 7.21 - 7.15 (m, 3H), 7.08 - 7.02 (m, 3H), 5.06 (dd, J = 13.3, 5.1 Hz, 1H), 4.37 - 4.30 (m, 1H), 4.28 - 4.15 (m, 2H), 3.77 (d, J = 13.2 Hz, 1H), 3.61 - 3.45 (m, 3H), 3.29 - 3.21 (m, 2H), 3.02 - 2.79 (m, 2H), 2.69 - 2.55 (m, 2H), 2.40 - 2.29 (m, 3H), 2.25 - 2.12 (m, 2H), 2.07 - 1.91 (m, 3H), 1.88 - 1.73 (m, 2H), 1.63 - 1.55 (m, 1H), 1.50 - 1.32 (m, 4H), 1.28 - 1.23 (m, 3H), 1.17 - 1.08 (m, 3H), 0.89 - 0.78 (m, 1H). Example 18 Preparation of 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 18) [ka] Compound 18 was prepared similarly to the procedure described for compound 12. LCMS: m / z 436.8 [M+1] 2+ . 1HNMR (400 MHz, DMSO): δ: 12.91 (s, 1H), 11.12 (s, 1H), 8.81 (d, J=6.8Hz, 1H),8.31 (s, 1H), 7.77(d, J=8.8Hz, 1H) 7.72 (s, 1H),7.61 (s, 1H),7.51-7.48 (m, 3H),7.31 (s, 1H),7.15 (s, 1H),7.13 (s, 3H),7.05(d, J=2Hz, 1H),5.19-5.15 (m, 1H),4.35 (s, 1H),4.21 (s, 2H),3.61 (s, 6H),3.19 (s, 7H),2.91-2.87 (m, 1H),2.71-2.69 (m, 1H),2.50 (d, J=1.6Hz, 2H),2.12-2.08 (m, 2H),1.71(s, 4H),1.35(s, 4H),1.22(s, 3H) Example 19 5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 19) [ka] Compound 19 was prepared similarly to the procedure described for compound 14. LC / MS: 857.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.81 (br, 1H), 11.10 (s, 1H), 8.92 - 8.83 (m, 1H), 8.32 - 8.19 (m, 1H), 7.84 - 7.55 (m, 3H), 7.54 - 7.40 (m, 2H), 7.39 - 6.97 (m, 6H), 5.17 - 5.02 (m, 1H), 4.37 - 4.05 (m, 2H), 3.97 - 3.75 (m, 1H), 3.72 - 3.33 (m, 6H), 3.27 - 2.81 (m, 4H), 2.73 - 2.54 (m, 2H), 2.47 - 2.09 (m, 5H), 2.06 - 1.97 (m, 2H), 1.93 - 1.45 (m, 5H), 1.35 - 1.15 (m, 1H). Example 20 (S)-3-(5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 20) [ka] Compound 20 was prepared similarly to the procedure described for compound 14. LC / MS: 843.6 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.90 - 12.75 (m, 1H), 10.97 (s, 1H), 10.47 (br, 1H), 8.93 - 8.81 (m, 1H), 8.35 - 8.24 (m, 1H), 7.73 - 7.43 (m, 5H), 7.29 - 7.08 (m, 5H), 7.07 - 7.00 (m, 1H), 5.13 - 5.03 (m, 1H), 4.42 - 4.15 (m, 3H), 4.03 - 3.85 (m, 2H), 3.78 - 3.38 (m, 5H), 3.29 - 3.01 (m, 5H), 2.96 - 2.86 (m, 1H), 2.64 - 2.56 (m, 1H), 2.47 - 2.32 (m, 3H), 2.06 - 1.91 (m, 3H), 1.83 - 1.46 (m, 4H), 1.28 - 1.18 (m, 1H), 0.96 - 0.75 (m, 1H). Example 21 Preparation of (S)-3-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 21) [ka] Step 1: Preparation of (S)-3-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0167] To a solution of 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one (80 mg, 0.13 mmol) in DMF (5 mL) stirred under argon, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (63 mg, 0.13 mmol), DIEA (50 mg, 0.39 mmol) and potassium iodide (20 mg, 0.13 mmol) were added at room temperature. The reaction mixture was stirred at 70° C. for 15 hours. The crude product was concentrated in vacuo and purified by preparative TLC (DCM / MeOH=10:1) to give the title compound (30 mg, 26.0%). LC / MS: 886.3 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.79 (s, 1H), 10.97 (s, 1H), 10.25 (br, 1H), 8.83 (d, J = 7.3 Hz, 1H), 8.27 (s, 1H), 7.64 (s, 1H), 7.60 - 7.46 (m, 3H), 7.26 (t, J = 7.4 Hz, 1H), 7.22 - 7.01 (m, 5H), 5.06 (dd, J = 13.4, 5.1 Hz, 1H), 4.38 - 4.15 (m, 4H), 4.08 - 3.92 (m, 1H), 3.90 - 3.77 (m, 1H), 3.75 - 3.50 (m, 2H), 3.45 - 3.35 (m, 1H), 3.32 - 3.18 (m, 3H), 3.14 - 2.85 (m, 4H), 2.75 - 2.53 (m, 5H), 2.42 - 2.31 (m, 3H), 2.15 - 1.95 (m, 3H), 1.77 - 1.62 (m, 1H), 1.57 - 1.47 (m, 3H), 1.45 - 1.27 (m, 5H). Example 22 Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 22) [ka] Compound 22 was prepared similarly to the procedure described for compound 13. LC / MS: 901.2 [M+H] + . 1 H NMR (400 MHz, DMSO) δ = 12.87 (br, 1H), 11.10 (s, 1H), 8.83 (d, J=7.4, 1H), 8.26 (s, 1H), 7.78 - 7.67 (m, 1H), 7.65 - 7.56 (m, 2H), 7.50 - 7.45 (m, 2H), 7.35 - 7.23 (m, 2H), 7.22 - 7.14 (m, 3H), 7.06 - 7.01 (m, 1H), 5.15 - 5.05 (m, 1H), 4.38 - 4.30(m, 1H), 4.28 - 4.12 (m, 2H), 3.89 - 3.80 (m, 1H), 3.65 - 3.40 (m, 3H), 3.29 - 3.23 (m, 2H), 3.17 - 2.82 (m, 5H), 2.65 - 2.54 (m, 2H), 2.39 - 2.32 (m, 2H), 2.12 - 1.99 (m, 3H), 1.80 - 1.68 (m,1H), 1.60 - 1.44 (m, 4H), 1.40 - 1.20 (m, 7H), 0.94 - 0.73 (m, 1H). Example 23 Preparation of 5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 23) [ka] Compound 23 was prepared similarly to the procedure described for compound 11. LC / MS: 857.3 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.79 (br, 1H), 11.10 (s, 1H), 8.84 (d, J = 7.2 Hz, 1H), 8.27 (s, 1H), 7.72 (brs, 1H), 7.64 (s, 1H), 7.58 (d, J = 8.5 Hz, 1H), 7.49 (t, J = 7.9 Hz, 2H), 7.46 - 7.35 (m, 1H), 7.34 - 7.23 (m, 2H), 7.23 - 7.15 (m, 3H), 7.08 - 7.00 (m, 1H), 5.14 - 5.03 (m, 1H), 4.40 - 4.31 (m, 1H), 4.28 - 4.07 (m, 2H), 3.93 - 3.81 (m, 1H), 3.70 - 3.39 (m, 3H), 3.10 - 2.85 (m, 3H), 2.71 - 2.56 (m, 2H), 2.36 - 2.32 (m, 1H), 2.14 - 1.97 (m, 4H), 1.94 - 1.75 (m, 2H), 1.68 - 1.48 (m, 2H), 1.48 - 1.15 (m, 4H), 1.06 - 0.74 (m, 2H). Example 24 Preparation of (S)-3-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 24) [ka] Compound 24 was prepared similarly to the procedure described for compound 14. LC / MS: 843.4 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.81 (br, 1H), 10.96 (s, 1H), 8.84 (d, J = 7.3 Hz, 1H), 8.73 (s, 0.5H), 8.51 (d, J = 8.4 Hz, 0.5H), 8.27 (s, 1H), 7.64 (s, 1H), 7.59 (d, J = 8.5 Hz, 1H), 7.54 (d, J = 8.4 Hz, 1H), 7.50 - 7.46 (m, 2H), 7.26 (t, J = 7.4 Hz, 1H), 7.23 - 7.15 (m, 3H), 7.14 - 7.06 (m, 2H), 7.03 (dd, J = 8.5, 2.3 Hz, 1H), 5.10 - 5.05 (m, 1H), 4.39 - 4.30 (m, 2H), 4.25 - 4.17 (m, 2H), 3.89 - 3.82 (m, 1H), 3.50 - 3.32 (m, 4H), 3.06 - 3.00 (m, 1H), 2.94 - 2.88 (m, 3H), 2.76 - 2.66 (m, 2H), 2.62 - 2.56 (m, 1H), 2.47 - 2.33 (m, 3H), 2.18 - 1.92 (m, 4H), 1.89 - 1.80 (m, 2H), 1.59 - 1.52 (m, 1H), 1.47 - 1.34 (m, 2H). Example 25 Preparation of (S)-3-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 25) [ka] Step 1: Preparation of tert-butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate

[0168] To a solution of tert-butyl 5-bromopentanoate (200 mg, 0.84 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (410.37 mg, 0.84 mmol), and DIEA (326.87 mg, 2.53 mmol) in MeCN (20 mL) was added KI (14.00 mg, 0.084 mmol) at room temperature. The reaction mixture was stirred at 60° C. for 12 hours. The reaction mixture was evaporated in vacuo to give the crude product. The crude was purified by silica gel column chromatography with DCM / MeOH (50 / 1 to 10 / 1) to give the product (250 mg, 61%) as a yellow solid. LC / MS: 484.7 [M+H] + . Step 2: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid

[0169] tert-Butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate (250 mg, 0.52 mmol) was dissolved in DCM (10 mL) and TFA (2 mL). The reaction mixture was stirred at 25° C. for 5 hours. The mixture was concentrated to give the product (200 mg, 78%) as a brown solid. LC / MS: 428.8 [M+H] + . Step 3: Preparation of (S)-3-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0170] A solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid (50 mg, 0.10 mmol), HATU (53.24 mg, 0.14 mmol), and DIEA (45.23 mg, 0.35 mmol) in DCM (15 mL) was stirred for 10 min. (2-Chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (53.24 mg, 0.14 mmol) was added. The mixture was stirred at 25° C. for 2 h. The solvent was removed, and the residue was purified by silica gel column (DCM / MeOH=20 / 1) to give the product (35 mg, 0.04 mmol, 40%) as a yellow solid. LC / MS: 858.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.78 (s, 1H), 10.96 (s, 1H), 10.13 (br, 1H), 8.84 (d, J = 7.4 Hz, 1H), 8.27 (s, 1H), 7.64 (s, 1H), 7.60 - 7.46 (m, 3H), 7.26 (t, J = 7.4 Hz, 1H), 7.23 - 6.97 (m, 5H), 5.06 - 5.01 (m, 1H), 4.48 - 4.12 (m, 4H), 4.061 - 3.81 (m, 2H), 3.66 - 3.49 (m, 1H), 3.34 - 3.11 (m, 5H), 3.10 - 2.76 (m, 3H), 2.67 - 2.52 (m, 3H), 2.50 - 2.24 (m, 6H), 2.17 - 2.08 (m, 2H), 2.01 - 1.87 (m, 1H), 1.74 - 1.46 (m, 4H), 1.43 - 1.31 (m, 1H). Example 26 Preparation of 5-(4-(3-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)propyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 26) [ka] Compound 26 was prepared similarly to the procedure described for compound 15. LC / MS: 830.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.87 (s, 1H), 11.11 (s, 1H), 8.81 (s, 1H), 8.29 (s, 1H), 7.70 (s, 1H), 7.64 - 7.56 (m, 1H), 7.53 - 7.45 (m, 2H), 7.40 - 7.35 (m, 1H), 7.30 - 7.23 (m, 2H), 7.22 - 7.17 (m, 2H), 7.15 - 7.10 (m, 1H), 7.07 - 7.00 (m, 1H), 5.17 - 5.05 (m, 1H), 4.42 - 4.16 (m, 2H), 3.72 - 3.41 (m, 7H), 3.27 - 3.07 (m, 6H), 2.97 - 2.82 (m, 1H), 2.73 - 2.53 (m, 3H), 2.37 - 2.21 (m, 3H), 2.12 - 1.85 (m, 4H), 1.04 - 0.72 (m, 2H). Example 27 Preparation of 5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)butyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 27) [ka] Compound 27 was prepared similarly to the procedure described for compound 15. LC / MS: 844.4 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.97 (s, 1H), 11.11 (s, 1H), 8.86 (s, 1H), 8.30 (s, 1H), 7.80 - 7.59 (m, 2H), 7.54 - 7.43 (m, 3H), 7.39 - 7.29 (m, 3H), 7.26 - 7.16 (m, 3H), 5.21 - 4.98 (m, 1H), 4.35-4.13 (m, 2H), 3.72 - 3.35 (m, 9H), 3.27 - 3.18 (m, 4H), 3.01 - 2.93 (m, 1H), 2.80 - 2.51 (m, 4H), 2.41 - 2.19 (m, 4H), 2.08 - 1.79 (m, 4H), 0.96 - 0.69 (m, 2H). Example 28 Preparation of 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 28) [ka] Compound 28 was prepared similarly to the procedure described for compound 11. LCMS: m / z=886.3[M+1] + . 1HNMR (400 MHz, CDCl3): δ 11.06 (s, 1H), 8.85 (s, 1H), 8.229 (s, 1H), 7.69-7.67 (m, 1H), 7.58-7.56 (m, 1H), 7.51-7.49 (m, 2H), 7.32 (s, 1H), 7.28-7.21 (s, 2H), 7.19-7.15 (m, 3H), 7.01-6.99 (s, 1H), 6.65 (s, 1H), 5.32 (s, 2H), 5.11-5.08 (m, 1H), 4.35 (s, 1H), 4.19 (s, 1H), 3.91-3.88 (m, 2H), 2.68 (s, 1H), 2.39-2.31 (m, 5H), 2.09-1.99 (m, 8H), 1.60-1.42 (m, 8H), 0.85 (s, 4H). Example 29 5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 29) [ka] Compound 29 was prepared similarly to the procedure described for compound 15. LC / MS: 886.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.89 (br, 1H), 11.10 (s, 1H), 8.79 (s, 1H), 8.31 (s, 1H), 7.77 - 7.65 (m, 2H), 7.58 (d, J = 8.5 Hz, 1H), 7.54 - 7.45 (m, 2H), 7.44 - 7.32 (m, 1H), 7.30 - 7.17 (m, 4H), 7.04 (dd, J = 8.5, 2.4 Hz, 1H), 5.09 (dd, J = 12.8, 5.3 Hz, 1H), 4.64 - 4.46 (m, 1H), 4.30 - 4.12 (m, 1H), 3.81 - 3.65 (m, 1H), 3.57 - 3.38 (m, 4H), 3.17 - 3.02 (m, 3H), 2.98 - 2.79 (m, 3H), 2.71 - 2.53 (m, 3H), 2.46 - 2.21 (m, 3H), 2.20 - 1.86 (m, 5H), 1.81 - 1.42 (m, 6H), 1.40 - 1.27 (m, 6H). Example 30 Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 30) [ka] Compound 30 was prepared similarly to the procedure described for compound 15. LC / MS: 857.4 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.87 (br, 1H), 11.10 (s, 1H), 8.82 (br, 1H), 8.30 (s, 1H), 7.75 - 7.65 (m, 2H), 7.58 (d, J = 8.5 Hz, 1H), 7.52 - 7.46 (m, 2H), 7.41 - 7.31 (m, 1H), 7.29 - 7.16 (m, 4H), 7.07 - 7.01 (m, 1H), 5.13 - 5.06 (m, 1H), 4.59 - 4.45 (m, 1H), 3.61 - 3.43 (m, 5H), 3.07 - 2.77 (m, 5H), 2.72 - 2.55 (m, 4H), 2.45 - 2.25 (m, 3H), 2.15 - 1.87 (m, 4H), 1.80 - 1.46 (m, 6H), 1.42 -1.17 (m, 4H). Example 31 Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 31) [ka] Compound 31 was prepared similarly to the procedure described for compound 14. LCMS: m / z=872.3[M+1] + . 1HNMR (400 MHz, DMSO): δ: 12.91 (s, 1H), 11.09 (s, 1H), 9.71 (s, 1H), 9.01-8.98 (m, 1H), 8.31 (s, 1H), 7.81-7.79 (m, 1H), 7.70 (s, 1H), 7.60 (s, 1H), 7.59-7.49 (m, 3H), 7.45-7.35 (m, 1H), 7.21 (s, 1H), 7.19-7.16 (m, 2H), 7.02 (s, 1H), 5.19-5.09 (m, 1H), 4.31 (s, 2H), 3.89(s, 2H), 3.61(s, 1H), 3.39-2.91 (m, 8H), 2.92-2.85 (m, 1H), 2.69-2.59 (m, 1H), 2.45-2.35 (s, 1H), 2.21-2.01 (s, 3H), 1.75 (s, 2H), 1.62-1.52 (m, 3H), 1.49-1.32(m, 1H), 1.25 (s, 1H). Example 32 Preparation of (S)-3-(5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 32) [ka] Step 1: Preparation of benzyl (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate

[0171] To a solution of benzyl 4-formylpiperidine-1-carboxylate (60 mg, 0.24 mmol) in DCM (10 mL) stirred at room temperature under argon, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (117 mg, 0.24 mmol), MgSO (288 mg, 2.4 mmol), and TEA (49 mg, 0.48 mmol) were added. The reaction mixture was stirred at room temperature for 30 minutes, and then sodium triacetoxyborohydride (127 mg, 0.6 mmol) was added. The reaction mixture was stirred at room temperature for 1 hour. The solid was filtered off and washed with DCM (5 mL × 3). The combined solution was concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with PE:EA=1:1 to give the title product (100 mg, 74%) as a white solid. LC / MS: 560.8 [M+H] + . Step 2: Preparation of (S)-3-(1-oxo-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione

[0172] A solution of benzyl (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate (100 mg, 0.18 mmol) in TFA (4 mL) was stirred at 70° C. overnight. The mixture was concentrated in vacuo to give the crude product (136 mg) as a yellow solid, which was used in the next step without further purification. LC / MS: 426.8 [M+H] + . Step 3: Preparation of (S)-3-(5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0173] To a solution of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (90 mg, 0.16 mmol) in DCM (5 mL) stirred under argon was added triphosgene (14 mg, 0.05 mmol) and DIEA (124 mg, 0.96 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour. The solution was concentrated in vacuo. The residue was dissolved in DCM (5 mL). (S)-3-(1-oxo-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (136 mg) and DIEA (124 mg, 0.96 mmol) were added. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (2 mL) and the organic phase was separated. The organic phase was dried over Na2SO4 and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with DCM / MeOH=10:1 to give the product (30 mg, 20%) as a white solid. LC / MS: 898.4 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.81 (br, 1H), 10.97 (s, 1H), 8.90 (br, 1H), 8.29 (s, 1H), 7.64 (s, 1H), 7.62 - 7.44 (m, 4H), 7.29 - 7.15 (m, 4H), 7.13 - 7.01 (m, 2H), 5.07 (dd, J = 13.3, 5.1 Hz, 1H), 4.38 - 4.18 (m, 3H), 4.00 - 3.87 (m, 1H), 3.75 - 3.50 (m, 4H), 3.30 - 3.20 (m, 2H), 3.17 - 3.05 (m, 3H), 2.95 - 2.88 (m, 1H), 2.73 - 2.53 (m, 4H), 2.46 - 2.34 (m, 2H), 2.06 - 1.85 (m, 4H), 1.79 - 1.45 (m, 5H), 1.37 - 1.17 (m, 3H), 1.10 - 0.80 (m, 3H). Example 33 Preparation of 5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-((S)-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 33) [ka] Compound 33 was prepared similarly to the procedure described for compound 32. LC / MS: 913.2 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.79 (s, 1H), 11.11 (s, 1H), 8.90 (s, 1H), 8.28 (s, 1H), 7.76 - 7.62 (m, 2H), 7.57 (d, J = 8.5 Hz, 1H), 7.51 - 7.44 (m, 2H), 7.40 - 7.31 (m, 1H), 7.30 - 7.15 (m, 4H), 7.12 - 7.00 (m, 1H), 5.14 - 5.05 (m, 1H), 4.35 - 4.12 (m, 2H), 3.68 - 3.40 (m, 6H), 3.02 - 2.84 (m, 5H), 2.70 - 2.61 (m, 2H), 2.59 - 2.54 (m, 1H), 2.46 - 2.33 (m, 2H), 2.19 - 1.84 (m, 5H), 1.72 - 1.48 (m, 4H), 1.33 - 1.14 (m, 3H), 0.99 - 0.72 (m, 3H). Example 34 Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 34) [ka] Step 1: Preparation of 5-(4-(5,5-dimethoxypentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0174] To a solution of 5-bromo-1,1-dimethoxypentane (250 mg, 1.19 mmol) in DMSO (10 mL) was added 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (340 mg, 0.994 mmol) and DIEA (350 mg, 2.71 mmol). The mixture was stirred at 70 °C for 12 hours and extracted with ethyl acetate. The combined organic phases were washed with aqueous sodium chloride solution and then dried over Na SO . The solvent was removed in vacuo, and the residue was purified by preparative TLC (DCM / MeOH=10 / 1) to give the desired product (135 mg, 24%) as a yellow solid. Step 2: Preparation of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanal

[0175] 5-(4-(5,5-Dimethoxypentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (360 mg, 0.762 mmol) was dissolved in 2N HCl / dioxane (10 mL), and the reaction mixture was stirred at room temperature for 3 h. The mixture was adjusted to pH 8–9 with aqueous NaHCO3 and then extracted with EtOAc (40 mL × 3). The organic layer was washed with water and brine and dried over Na2SO4. The solvent was removed by rotary evaporation, and the residue was purified by preparative TLC (DCM / MeOH = 20 / 1) to give 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanal (240 mg, 70%). Step 3: Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0176] To a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (220 mg, 0.492 mmol) in DCM (3 mL) was added potassium acetate (72.3 mg, 0.738 mmol). The mixture was stirred for 30 minutes. A solution of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)pentanal (210 mg, 0.492 mmol) and AcOH (44.28 mg, 0.738 mmol) in DCM (5 mL) was added. After stirring for 30 minutes, sodium triacetoxyborohydride (312 mg, 1.476 mmol) was added, and the mixture was stirred at room temperature overnight. The mixture was extracted with EtOAc (30 mL x 3). The organic layer was washed with water and brine and dried over Na2SO4. The solvent was removed by rotary evaporation and the residue was purified by preparative HPLC to give 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (43.1 mg, 9.7%) as a white solid. LCMS: m / z = 860.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.87 (s, 1H), 11.09 (s, 1H),10.11 (s, 1H), 9.52 (s, 1H), 8.82 (d, J = 6.4 Hz, 1H), 8.29 (s, 1H), 7.69-7.59 (m, 1H) 7.58 (s, 1H), 7.56 (s, 1H), 7.50-7.48 (m, 2H), 7.45-7.44 (m, 1H), 7.42-7.40 (m, 1H), 7.25-7.23(m, 2H), 7.09-7.01 (s, 1H), 5.12-5.07 (m, 2H), 4.26-4.23 (m, 4H), 3.61 (s, 4H), 3.61-3.58(m, 2H), 3.21-3.12 (s, 9H), 2.99-2.81 (m, 2H), 2.69-2.52 (m, 2H), 2.40 (d, J = 2.4 Hz, 2H), 2.15(s, 1H), 2.09-1.98 (m, 2H), 1.35 (s, 2H). Example 35 Preparation of 4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonona-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 35) [ka] Step 1: Preparation of nona-8-ynoic acid

[0177] To a solution of lithium acetylide-ethylenediamine complex (2.20 g, 21.5 mmol, 90%) in DMSO (5 mL) was added 7-bromoheptanoic acid (1.50 g, 7.17 mmol) in DMSO (7 mL) dropwise at 0 °C. The solution was stirred at room temperature for 2 h. The reaction mixture was poured into ice / water, acidified with 1N HCl, and extracted with DCM. The organic layer was dried over Na2SO4 and concentrated in vacuo. The residue was purified by flash column chromatography (10-30% EA in PE) to give the title compound (713 mg, 64%) as a clear oil. LC / MS: 155.1 [M+H] + . 1 H NMR (400 MHz, CDCl3) δ 2.38 (t, J = 7.5 Hz, 2H), 2.21 (td, J = 7.0, 2.6 Hz, 2H), 1.96 (t, J = 2.6 Hz, 1H), 1.71 - 1.63 (m, 2H), 1.60 - 1.52 (m, 2H), 1.49 - 1.38 (m, 4H). Step 2: Preparation of tert-butyl nona-8-ynoate

[0178] To a solution of non-8-ynoic acid (900 mg, 5.84 mmol) and anhydrous N,N-dimethylformamide (85 mg, 1.17 mmol) in anhydrous DCM (20 mL) stirred under Ar at room temperature, oxalyl chloride (1.5 g, 11.68 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 1 h. The mixture was evaporated in vacuo, and the residue was dissolved in anhydrous THF (20 mL). The solution was cooled to 0 °C, and t-BuOK (1.3 g, 11.68 mmol) was added in small portions. The mixture was stirred at room temperature for 1 h. The reaction was quenched by adding ice water and extracted with EtO. The organic layer was dried over NaSO and evaporated in vacuo. The residue was purified by flash chromatography with PE / EA = 10:1 to give the title compound (657 mg, 53%) as a clear oil. LC / MS: 232.9 [M+Na] + . 1H NMR (400 MHz, CDCl3) δ 2.26 - 2.17 (m, 4H), 1.96 (t, J = 2.6 Hz, 1H), 1.65 - 1.52 (m, 4H), 1.46 (s, 9H), 1.45 - 1.30 (m, 4H). Step 3: Preparation of tert-butyl 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl)non-8-ynoate

[0179] A suspension of tert-butyl nona-8-ynoate (63 mg, 0.3 mmol), 4-bromo-2-(2,6-dioxopiperidin-3-yl)isoindole-1,3-dione (50 mg, 0.15 mmol), copper(I) iodide (6.3 mg, 0.033 mmol), bis(triphenylphosphine)palladium(II) chloride (11 mg, 0.017 mmol), and EtN (2 mL) in THF (5 mL) was stirred at 70 °C under Ar atmosphere for 10 h. The mixture was cooled to room temperature and filtered. The filtrate was evaporated in vacuo. The residue was purified by preparative TLC with PE / EA = 1:1 to give the title compound (48 mg, 68%) as a white solid. LC / MS: 488.7 [M+Na] + . Step 4: Preparation of 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl)non-8-ynoic acid

[0180] A solution of tert-butyl 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl)non-8-ynoate (30 mg, 0.06 mmol) in TFA (1 mL) and DCM (3 mL) was stirred at room temperature for 2 hours. The mixture was evaporated in vacuo to give the crude product (33 mg), which was used in the next step without further purification. LC / MS: 432.7 [M+Na] + . Step 5: Preparation of 4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonona-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0181] A mixture of 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl)non-8-ynoic acid (33 mg, 80% purity, 0.06 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (31 mg, 0.070 mmol), HATU (40 mg, 0.11 mmol), N,N-diisopropylethylamine (27 mg, 0.21 mmol), and DMF (5 mL) was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo and purified by preparative TLC with DCM / MeOH=10:1 to give the title compound (16.1 mg, 29%) as a white solid. LC / MS: 839.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.78 (br, 1H), 11.15 (br, 1H), 8.83 (s, 1H), 8.26 (s, 1H), 7.88 - 7.80 (m, 3H), 7.65 - 7 / 62 (m, 1H), 7.59 (d, J = 8.0 Hz, 1H), 7.49 (t, J = 7.7 Hz, 2H), 7.29 - 7.17 (m, 4H), 7.03 (d, J = 7.6 Hz, 1H), 5.18 - 5.12 (m, 1H), 4.35 - 4.06 (m, 2H), 3.91 - 3.76 (m, 1H), 3.05 - 2.85 (m, 2H), 2.70 - 2.57 (m, 2H), 2.37 - 2.35 (m, 2H), 2.30 - 2.20 (m, 3H), 1.63 - 1.48 (m, 8H), 1.36 - 1.25 (m, 5H). Example 36 Preparation of 4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepta-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 36) [ka] Compound 36 was prepared similarly to the procedure described for compound 35. LC / MS: 811.4 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.78 (br, 1H), 11.16 (s, 1H), 8.82 (d, J = 6.5 Hz, 1H), 8.26 (s, 1H), 7.91 - 7.87 (m, 3H), 7.64 (s, 1H), 7.58 (d, J = 8.3 Hz, 1H), 7.49 (t, J = 7.3 Hz, 2H), 7.30 - 7.25 (m, 1H), 7.28 - 7.22 (m, 3H), 7.07 - 7.02 (m, 1H), 5.18 - 5.11 (m, 1H), 4.39 - 4.14 (m, 2H), 3.90 - 3.80 (m, 1H), 3.07 - 2.81 (m, 2H), 2.70 - 2.58 (m, 2H), 2.43 - 2.31 (m, 2H), 2.15 - 2.02 (m, 3H), 1.78 - 1.61 (m, 4H), 1.60 - 1.30 (m, 3H), 1.30 - 1.03 (m, 2H). Example 37 Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 37) [ka] Step 1: Preparation of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutan-1-one

[0182] To a solution of (3-oxocyclobutyl)acetic acid (250 mg, 1.95 mmol) in DMF (10 mL) stirred at room temperature, HATU (890 mg, 2.34 mmol), DIEA (756 mg, 5.85 mmol), and (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (944 mg, 1.95 mmol) were added. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (40 mL) and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over NaSO, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH = 10:1) to give the desired product (1 g, 91.79%) as a yellow solid. LC / MS: 558.0 [M+H] + . Step 2: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0183] To a solution of 3-{2-[4-({5-[(2-chloro-4-phenoxyphenyl)carbonyl]-7H-pyrrolo[2,3-d]pyrimidin-4-yl}amino)piperidin-1-yl]-2-oxoethyl}cyclobutan-1-one (1 g, 1.79 mmol) in MeOH / DMF / AcOH (8 mL, 4 mL, 0.5 mL) stirred at room temperature, 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (678 mg, 1.79 mmol) and NaBHCN (169 mg, 2.685 mmol) were added. The reaction mixture was stirred at 60° C. for 1 hour. The mixture was concentrated in vacuo to provide the crude product. The crude product was purified by flash chromatography (DCM / MeOH=10:1) to give the desired product (290 mg, 18.44%) as a yellow solid. LC / MS: 884.1 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.76 (s, 1H), 11.09 (s, 1H), 10.1 (br, 1H), 8.83 (d, J= 7.2 Hz, 1H), 8.26 (s, 1H), 7.85 - 7.72 (m, 1H), 7.64 (s, 1H), 7.58 (d, J= 8.4 Hz, 1H), 7.48 (t, J= 8.4 Hz, 2H), 7.35 - 7.30 (m, 1H), 7.26 (t, J= 7.6 Hz, 2H), 7.2-7.16 (m, 3H), 7.03 (dd, J= 8.4, 2.4 Hz, 1H), 5.18 - 5.05 (m, 1H), 4.40 - 4.30 (m, 1H), 4.19 - 4.13 (m, 1H), 3.86 - 3.82 (m, 1H), 3.48 - 3.39 (m, 3H), 3.29 - 3.25 (m, 2H), 3.05 - 2.80 (m, 4H), 2.64 - 2.53 (m, 3H), 2.43 - 2.30 (m, 4H), 2.27 - 2.21 (m, 2H), 2.18 - 1.95 (m, 4H), 1.61 - 1.48 (m, 2H), 1.40 - 1.35 (m, 1H). Example 38 Preparation of 4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 38) [ka] Compound 38 was prepared similarly to the procedure described for compound 35. LC / MS: 825.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.77 (br, 1H), 11.15 (s, 1H), 8.83 (d, J = 7.3 Hz, 1H), 8.26 (s, 1H), 7.87 - 7.81 (m, 3H), 7.63 (s, 1H), 7.58 (d, J = 8.5 Hz, 1H), 7.52 - 7.46 (m, 2H), 7.26 (t, J = 7.4 Hz, 1H), 7.22 - 7.17 (m, 3H), 7.02 (dd, J = 8.5, 2.3 Hz, 1H), 5.15 (dd, J = 12.9, 5.3 Hz, 1H), 4.35 - 4.20 (m, 1H), 4.18 - 4.13 (m, 1H), 3.85 (d, J = 14.3 Hz, 1H), 3.32 - 3.26 (m, 1H), 3.05 - 2.98 (m, 1H), 2.92 - 2.84 (m, 1H), 2.63 - 2.53 (m, 3H), 2.42 - 2.32 (m, 3H), 2.09 - 2.01 (m, 3H), 1.64 - 1.51 (m, 6H), 1.44 - 1.29 (m, 2H). Example 39 Preparation of 3-(4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonona-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (compound 39) [ka] Compound 39 was prepared similarly to the procedure described for compound 35. LC / MS: 825.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.76 (br, 1H), 11.00 (br, 1H), 9.00 - 8.75 (m, 1H), 8.26 (br, 1H), 7.72 - 7.46 (m, 7H), 7.35 - 7.16 (m, 4H), 7.12 - 7.04 (m, 1H), 5.23 - 5.10 (m, 1H), 4.51 - 4.42 (m, 1H), 4.39 - 4.27 (m, 2H), 4.22 - 4.12 (m, 1H), 3.89 - 3.77 (m, 1H), 3.01 - 2.88 (m, 2H), 2.76 - 2.65 (m, 2H), 2.38 - 2.33 (m, 2H), 2.04 (s, 3H), 1.70 - 1.30 (m, 13H). Example 40 Preparation of 3-(4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (compound 40) [ka] Compound 40 was prepared similarly to the procedure described for compound 35. LC / MS: 811.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.76 (br, 1H), 11.00 (s, 1H), 8.82 (d, J = 7.4 Hz, 1H), 8.26 (s, 1H), 7.70 (d, J = 7.0 Hz, 1H), 7.64 (t, J = 3.4 Hz, 2H), 7.58 (d, J = 8.5 Hz, 1H), 7.54 - 7.43 (m, 3H), 7.28 - 7.24 (m, 1H), 7.20 - 7.18 (m, 2H), 7.02 (dd, J = 8.5, 2.4 Hz, 1H), 5.19 - 5.10 (m, 1H), 4.53 - 4.45 (m, 1H), 4.39 - 4.25 (m, 2H), 4.20 - 4.15 (m, 1H), 3.90 -3.81 (m, 1H), 3.29 - 3.25 (m, 1H), 3.04 - 2.85 (m, 3H), 2.70 - 2.66 (m, 1H), 2.62 - 2.54 (m, 2H), 2.40 - 2.33 (m, 2H), 2.10 - 1.98 (m, 3H), 1.63 - 1.36 (m, 8H), 1.29 - 1.21 (m, 1H). Example 41 Preparation of 3-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepta-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (compound 41) [ka] Compound 41 was prepared similarly to the procedure described for compound 35. LC / MS: 798.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.79 (s, 1H), 11.1-10.9(m, 1H), 8.82 (d, J = 7.6 Hz, 1H), 8.26 (s, 1H), 7.70 (d, J = 6.8 Hz, 1H), 7.63 (t, J = 3.6 Hz, 2H), 7.58 (d, J = 8.4 Hz, 1H), 7.54 - 7.43 (m, 3H), 7.30-7.23 (m, 1H), 7.23 - 7.14 (m, 3H), 7.02 (dd, J = 8.4, 2.4 Hz, 1H), 5.15 (dd, J = 13.2, 4.6 Hz, 1H), 4.50-4.45 (m, 1H), 4.35-4.28 (m, 2H), 4.20-4.10 (m,1H), 3.89-3.80 (m, 1H), 3.65-3.57 (m, 1H), 3.33-3.25 (m, 1H), 3.15-3.08 (m, 1H), 3.02 - 2.87 (m, 2H), 2.62 - 2.53 (m, 2H), 2.42 (t, J = 7.2 Hz, 2H), 2.09 - 1.97 (m, 3H), 1.72 - 1.60 (m, 3H), 1.55-1.46 (m, 1H), 1.41 - 1.31 (m, 2H). Example 42 Preparation of (S)-3-(5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (compound 42) [ka] Step 1: Preparation of 3-(2-diazoacetyl)cyclobutan-1-one

[0184] To a solution of 3-oxocyclobutane-1-carboxylic acid (2 g, 17.54 mmol) in DCM (10 mL) was added SOCl (3.84 mL). The reaction mixture was stirred at 20 °C for 2 hours. The mixture was evaporated to dryness under reduced pressure. To a solution of the residue in THF (5 mL) and acetonitrile (5 mL) was added (diazomethyl)trimethylsilane (2 M in hexane, 17.5 mL). The reaction mixture was stirred at 20 °C overnight and then evaporated under vacuum to give the crude product. The crude product was purified by column chromatography (silica gel, PE / EA = 2:1) to give the title compound (1.6 g, 52.8% yield) as a yellow oil. LC / MS: 139.1 [M+H] Step 2: Preparation of 2-(3-oxocyclobutyl)acetic acid

[0185] To a solution of 3-(2-diazoacetyl)cyclobutan-1-one (1.6 g, 9.27 mmol) in THF (30 mL) and water (15 mL) was added AgNO (1.87 g, 11.12 mmol). The reaction mixture was stirred at room temperature overnight and then evaporated in vacuo to remove THF. The aqueous phase was extracted with EA (20 mL x 3). The combined organic layers were dried over NaSO and evaporated in vacuo to give the title compound (1.0 g, 76.4% yield) as a yellow oil. LC / MS: 127.1 [MH] - . Step 3: Preparation of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutan-1-one

[0186] A solution of 2-(3-oxocyclobutyl)acetic acid (50 mg, 90% pure, 0.35 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (207.8 mg, 0.43 mmol), HATU (177.9 mg, 0.47 mmol), N,N-diisopropylethylamine (75.6 mg, 0.59 mmol) and DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM (1:10) to give the title compound (100 mg, 51%). LC / MS: 557.6 [M+H] + . Step 4: Preparation of (S)-3-(5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0187] A solution of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutan-1-one (100 mg, 0.18 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (87.5 mg, 0.18 mmol) and sodium cyanoborohydride (21.6 mg, 0.36 mmol) in DMF / MeOH / HOAc (16 mL, 5:10:1) was stirred at room temperature overnight. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (40 mg, 25.6%). LC / MS: 869.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.77 (s, 1H), 10.96 (s, 1H), 8.83 (d, J = 7.5 Hz, 1H), 8.26 (s, 1H), 7.64 (s, 1H), 7.58 (d, J = 8.5 Hz, 1H), 7.51 - 7.46 (m, 2H), 7.26 (t, J = 7.4 Hz, 1H), 7.21 - 7.16 (m, 3H), 7.08 - 7.01 (m, 2H), 5.06 (d, J = 12.7 Hz, 1H), 4.37 - 4.13 (m, 4H), 4.00 (s, 1H), 3.87 - 3.79 (m, 1H), 3.71-3.34 (m, 2H), 3.31 - 3.13 (m, 4H), 3.06 - 2.85 (m, 3H), 2.80 - 2.52 (m, 2H), 2.49 - 2.46 (m, 1H), 2.37 (s, 4H), 2.23 (s, 2H), 2.13 - 1.89 (m, 5H), 1.51 (br, 2H), 1.41 - 1.34 (m, 1H), 1.24 (s, 1H). Example 43 Preparation of 5-(4-(3-(2-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 43)

[0188] Compound 43 was prepared using the same method described in the preparation of compound 42. LC / MS: 884.4 [M+H]+ 1H NMR (400 MHz, DMSO) δ 12.81 - 12.75 (m, 1H), 11.09 (s, 1H), 8.92 - 8.86 (m, 1H), 8.33 - 8.25 (m, 1H), 7.67 - 7.63 (m, 2H), 7.59 - 7.42 (m, 3H), 7.35 - 7.30 (m, 1H), 7.29 - 7.11 (m, 5H), 7.07 - 7.01 (m, 1H), 5.10 - 5.06 (m, 1H), 4.28 - 4.20 (m, 1H), 3.79 - 3.35 (m, 8H), 2.94 - 2.84 (m, 1H), 2.68 - 2.55 (m, 3H), 2.46 - 2.08 (m, 9H), 2.05 - 1.80 (m, 3H), 1.78 - 1.72 (m, 3H), 1.27 - 1.20 (M, 1H). Example 44 Preparation of 5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 44) [ka] Step 1: Preparation of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde

[0189] A solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(2,2-dimethoxyethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (250 mg, 0.4 mmol) in THF / H2SO4 (10% aqueous) (30 mL, THF / H2SO4 = 1 / 1) was stirred at 70 °C for 1 h. The reaction mixture was adjusted to pH = 10 with sodium hydroxide solution (2 M) and extracted with EtOAc (15 mL × 3). The organic phase was dried over sodium sulfate and concentrated in vacuo to give the desired product (200 mg, 82%) as a yellow solid. LC / MS: 583. [M+1] + . Step 2: Preparation of 5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0190] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (100 mg, 0.17 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (64 mg, 0.17 mmol), TEA (52 mg, 0.51 mmol), and MgSO (408 mg, 3.4 mmol) in DCM (20 mL) was stirred under nitrogen at room temperature for 30 minutes. Sodium triacetoxyborohydride (72 mg, 0.34 mmol) was added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered and extracted with water. The organic phase was concentrated in vacuo to give the crude product, which was purified by preparative TLC (MeOH:DCM=1:10) to give the desired product (50 mg, 32%) as a yellow solid. LC / MS: 910.4 [M+1] + . 1H NMR (400 MHz, DMSO) δ 13.06 (br, 1H), 11.12 (d, J = 18.0 Hz, 2H), 8.46 (s, 1H), 8.11 - 8.02 (m, 1H), 7.84 (s, 1H), 7.74 - 7.61 (m, 2H), 7.54 - 7.45 (m, 2H), 7.38 - 7.18 (m, 6H), 7.14 - 7.02 (m, 2H), 5.08 (dd, J = 12.8, 5.3 Hz, 1H), 3.52 - 3.37 (m, 2H), 3.36 - 3.28 (m, 7H), 2.95 - 2.82 (m, 1H), 2.71 - 2.53 (m, 4H), 2.45 - 2.27 (m, 3H), 2.04 - 1.97 (m, 1H), 1.85 - 1.73 (m, 2H), 1.55 - 1.3.0 (m, 5H), 1.28 - 1.20 (m, 1H). Example 45 Preparation of (S)-3-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 45) [ka]

[0191] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (100 mg, 0.17 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (83 mg, 0.17 mmol), TEA (52 mg, 0.51 mmol), and MgSO (408 mg, 3.4 mmol) in DCM (20 mL) was stirred under nitrogen at room temperature for 30 minutes. Sodium triacetoxyborohydride (72 mg, 0.34 mmol) was added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered. The organic layer was washed with water and concentrated in vacuo to give the crude product, which was purified by preparative TLC (MeOH:DCM=1:10) to give the desired product (30 mg, 17.6%) as a yellow solid. LC / MS: 896.4 [M+1] + . 1 H NMR (400 MHz, DMSO) δ 13.06 (br, 1H), 11.14 (s, 1H), 10.96 (s, 1H), 8.46 (s, 1H), 8.05 (dd, J = 15.0, 2.1 Hz, 1H), 7.84 (s, 1H), 7.64 (d, J = 8.5 Hz, 1H), 7.65 - 7.39 (m, 3H), 7.35 - 7.18 (m, 5H), 7.12 - 7.02 (m, 4H), 5.06 (dd, J = 13.2, 5.0 Hz, 1H), 4.39 - 4.19 (m, 2H), 3.35 - 3.25 (m, 7H), 2.94 - 2.85 (m, 1H), 2.70 - 2.53 (m, 4H), 2.49 - 2.25 (m, 4H), 1.95 - 1.85 (m, 1H), 1.80 - 1.75 (m, 2H), 1.62 - 1.30 (m, 5H), 1.25 - 1.15(m,1H). Example 46 Preparation of (S)-3-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (Compound 46) [ka] Step 1: Preparation of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde

[0192] A solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (200 mg, 0.32 mmol) in THF / H2SO4 (10% aqueous) (20 mL, 1:1) was stirred at 70 °C for 1 h. The reaction mixture was adjusted to pH = 10 with sodium hydroxide solution (2 M) and extracted with EtOAc (100 mL). The organic phase was dried over sodium sulfate and evaporated in vacuo to give the desired product (150 mg, 82% yield) as a yellow solid. LC / MS: 570.1 [M+1] + . Step 2: Preparation of (S)-3-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione

[0193] A solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde (70 mg, 0.12 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (60 mg, 0.12 mmol), TEA (24 mg, 0.24 mmol), and MgSO (289 mg, 2.4 mmol) in DCM (10 mL) was stirred at room temperature under nitrogen for 30 minutes. To this solution was added sodium triacetoxyborohydride (64 mg, 0.3 mmol) in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered. The organic layer was washed with water and extracted with DCM (50 mL) to give the crude product, which was purified by preparative TLC (PE:EA=5:1) to give the desired product (20 mg, 19% yield) as a yellow solid. LC / MS: 882.0 [M+1] + 1 H NMR (400 MHz, DMSO) δ 13.05 (br, 1H), 11.14 (s, 1H), 10.96 (s, 1H), 8.46 (s, 1H), 8.04 (d, J = 16.6 Hz, 1H), 7.84 (s, 1H), 7.65 (d, J = 8.5 Hz, 1H), 7.59 - 7.46 (m, 3H), 7.39 - 7.14 (m, 5H), 7.11 - 7.03 (m, 3H), 5.05 (dd, J = 13.4, 5.1 Hz, 1H), 4.34 (d, J = 17.0 Hz, 1H), 4.21 (d, J = 16.9 Hz, 1H), 3.30 - 3.27 (m, 6H), 2.96 - 2.86 (m, 1H), 2.71 - 2.53 (m, 4H), 2.46 - 2.31 (m, 3H), 2.26 (d, J = 6.5 Hz, 2H), 2.02 - 1.92 (m, 1H), 1.88 - 1.78 (m, 2H), 1.76 - 1.62 (m, 2H), 1.38 - 1.19 (m, 3H). Example 47 Preparation of 5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 47) [ka]

[0194] A solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde (70 mg, 0.12 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (45 mg, 0.12 mmol), TEA (24 mg, 0.24 mmol) and MgSO (289 mg, 2.4 mmol) in DCM (10 mL) was stirred under nitrogen at room temperature for 30 minutes. Sodium triacetoxyborohydride (64 mg, 0.3 mmol) was added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered. The organic layer was washed with water and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC (MeOH:DCM=1:10) to give the desired product (20 mg, 18%) as a yellow solid. LC / MS: 898.1 [M+1] + . 1H NMR (400 MHz, DMSO) δ 13.05 (s, 1H), 11.14 (s, 1H), 11.09 (s, 1H), 8.46 (s, 1H), 8.08 - 8.01 (m, 1H), 7.84 (s, 1H), 7.72 - 7.61 (m, 2H), 7.54 - 7.45 (m, 2H), 7.37 - 7.18 (m, 6H), 7.13 - 7.02 (m, 2H), 5.08 (dd, J = 13.0, 5.4 Hz, 1H), 3.50 - 3.41 (m, 3H), 3.33 - 3.29 (m, 2H), 2.93 - 2.84 (m, 1H), 2.75 - 2.58 (m, 3H), 2.57 - 2.52 (m, 2H), 2.47 - 2.30 (m, 2H), 2.29 - 2.20 (m, 2H), 2.10 - 1.92 (m, 2H), 1.90 - 1.64 (m, 4H), 1.39 - 1.22 (m, 3H). Example 48 Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)azetidin-1-yl)piperidin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 48) [ka] Step 1: Preparation of benzyl 4-(3-(2-(tert-butoxy)-2-oxoethyl)azetidin-1-yl)piperidine-1-carboxylate

[0195] To a solution of tert-butyl 2-(azetidin-3-yl)acetate (200 mg, 0.96 mmol) in DCM (5 mL) stirred at room temperature, EtN (194 mg, 1.92 mmol), MgSO (300 mg), and [3-(4-oxopiperidin-1-yl)phenyl]methyl formate (224 mg, 0.96 mmol) were added. After stirring the mixture at room temperature for 30 minutes, NaBH(OAc) (406 mg, 1.92 mmol) was slowly added (0.5 equivalents per 30 minutes). The reaction mixture was stirred at room temperature for 1 hour. The mixture was filtered, and the filtrate was concentrated under pressure. The residue was purified by flash chromatography (MeOH / DCM = 1:10) to give the desired product (255 mg, 68.37%) as a colorless oil. LC / MS: 388.8 [M+H] + . Step 2: Preparation of tert-butyl 2-(1-(piperidin-4-yl)azetidin-3-yl)acetate

[0196] To a solution of tert-butyl 2-[1-(1-{3-[(formyloxy)methyl]phenyl}piperidin-4-yl)azetidin-3-yl]acetate (255 mg, 0.66 mmol) in MeOH (5 mL) stirred at room temperature was added Pd / C (70 mg, 0.66 mmol). The reaction mixture was stirred under H at room temperature for about 3 hours. The mixture was filtered, and the filtrate was concentrated under pressure to give the desired product (160 mg, yield=95.3%) as a white solid. LC / MS: 255.1 [M+H] + . Step 3: Preparation of tert-butyl 2-(1-(1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperidin-4-yl)azetidin-3-yl)acetate

[0197] To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-fluoroisoindole-1,3-dione (140 mg, 0.55 mmol) in NMP (5 mL) stirred at room temperature, 2-[1-(piperidin-4-yl)azetidin-3-yl]tert-butyl acetate (140 mg, 0.55 mmol) and DIEA (142 mg, 1.1 mmol) were added. The reaction mixture was stirred at 90 °C for 12 hours. The mixture was poured into water (25 mL) and extracted with EtOAc (30 mL × 2). The combined organic layers were washed with brine, dried over Na SO , and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (MeOH / DCM = 1:10) to give the desired product (70 mg, yield = 25.4%) as a yellow solid. LC / MS: 510.8 [M+H] + . Step 4: Preparation of 2-(1-(1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperidin-4-yl)azetidin-3-yl)acetic acid

[0198] A solution of tert-butyl 2-(1-{1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl}azetidin-3-yl)acetate (70 mg, 0.14 mmol) in TFA / DCM (1:5, 6 mL) was stirred at room temperature for 2 hours. The solution was concentrated in vacuo to give the crude product (80 mg, crude). LC / MS: 455.1 [M+H] + . Step 5: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)azetidin-1-yl)piperidin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione

[0199] To a solution of (1-{1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl}azetidin-3-yl)acetic acid (70 mg, crude, 0.14 mmol) in DMF (5 mL) stirred at room temperature, HOBt (22 mg, 0.156 mmol), EDCI (30 mg, 0.156 mmol), NMM (53 mg, 0.52 mmol), and N-{5-[(2-chloro-4-phenoxyphenyl)carbonyl]-7H-pyrrolo[2,3-d]pyrimidin-4-yl}piperidin-4-amine hydrochloride (63 mg, 0.14 mmol) were added. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (25 mL) and extracted with EtOAc (30 mL x 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC (MeOH / DCM=1:10) to give the desired product (30 mg, yield=24.2%) as a yellow solid. LC / MS: 884.1 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.75 (br, 1H), 11.09 (s, 1H), 8.83 (d, J= 7.2 Hz, 1H), 8.26 (s, 1H), 7.66-7.61 (m, 2H), 7.58 (d, J= 8.8 Hz, 1H), 7.47 (t, J= 8.0 Hz, 2H), 7.30 (s, 1H), 7.28 - 7.14 (m, 5H), 7.02 (dd, J= 8.8, 2.4 Hz, 1H), 5.09 - 5.04 (m, 1H), 4.40 - 4.30 (m, 1H), 4.18 - 4.13 (m, 1H), 3.95 - 3.73 (m, 3H), 3.13 - 3.05 (m, 2H), 3.03 - 2.95 (m, 1H), 2.94 - 2.86 (m, 1H), 2.84 - 2.73 (m, 2H), 2.70 - 2.65 (m, 2H), 2.62 - 2.54 (m, 2H), 2.34 - 2.21 (m, 2H), 2.10 - 1.95 (m, 4H), 1.74 - 1.64 (m, 2H), 1.58 - 1.45 (m, 2H), 1.43 - 1.30 (m, 2H), 1.22 - 1.15 (m, 2H). Example 49 Preparation of (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 49) [ka] Step 1: Preparation of N-(4-bromobenzyl)-5-fluoro-2-methoxybenzamide

[0200] A solution of 5-fluoro-2-methoxybenzoic acid (30 g, 176 mmol, 1.0 equiv.), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (80.5 g, 212 mmol, 1.2 equiv.), and N,N-diisopropylethylamine (45.6 g, 353 mmol, 2 equiv.) in N,N-dimethylformamide (300 mL) was stirred at 25° C. for 30 minutes. (4-Bromophenyl)methanamine (32.8 g, 176 mmol, 1.0 equiv.) was added to the solution, and the mixture was stirred at 25° C. for 12 hours. The solution was poured into water (500 mL) and extracted with ethyl acetate (500 mL × 3). The combined organic phase was washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by silica gel chromatography using 20%-30% ethyl acetate in petroleum ether as eluent to give the desired compound (56 g, 94% yield) as a white solid. 1 HNMR (400 MHz, CDCl3): δ 8.26 (br s, 1H), 7.94 (q, J = 2.0 Hz, 1H), 7.45 (d, J = 7.6 Hz, 2H), 7.22 (d, J = 8.0 Hz, 2H), 7.16 - 7.12 (m, 1H), 6.94 - 6.91 (m, 1H), 4.61 (d, J = 6.0 Hz, 2H), 3.91 (s, 3H). Step 2: Preparation of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]methyl]benzamide

[0201] To a solution of N-[(4-bromophenyl)methyl]-5-fluoro-2-methoxy-benzamide (46 g, 136 mmol, 1.0 equiv.) and 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (51.8 g, 204 mmol, 1.5 equiv.) in dioxane (500 mL) was added potassium acetate (26.7 g, 272 mmol, 2.0 equiv.) and 1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (9.95 g, 13.6 mmol, 0.1 equiv.). The suspension was degassed under vacuum and purged with nitrogen three times. The mixture was stirred under nitrogen at 90 °C for 12 h. The solution was poured into water (2 L) and extracted with ethyl acetate (1 L x 3). The combined organic phases were washed with brine (2 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The combined crude product was purified by silica gel chromatography using 20% ​​to 30% ethyl acetate in petroleum ether as the eluent. The crude product was triturated with petroleum ether (200 mL), filtered, and the filter cake was dried under vacuum to give the desired compound (50 g, 79% yield) as a white solid. LC / MS: 386.2 [M+H] + . Step 3: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0202] A mixture of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]methyl]benzamide (10.0 g, 26.0 mmol, 1.0 equiv), 3-iodo-1H-pyrazolo[3,4-d]pyrimidin-4-amine (6.78 g, 26.0 mmol, 1.0 equiv), 1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (3.80 g, 5.19 mmol, 0.2 equiv), potassium phosphate (16.5 g, 77.9 mmol, 3.0 equiv) in dioxane (200 mL) and water (40 mL) was degassed and purged with nitrogen three times, and the mixture was stirred at 110° C. under a nitrogen atmosphere for 60 hours. The reaction mixture was partitioned between ethyl acetate (1 L) and water (1 L). The organic phase was separated, washed with brine (1 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was triturated successively with acetonitrile (50 mL) and ethyl acetate (50 mL). The solid was collected and dried under vacuum to give the desired compound (6.0 g, 59% yield) as a pale yellow solid. LC / MS: 393.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6): δ 13.59 (s, 1H), 8.86 (t, J = 6.0 Hz, 1H), 8.22 (s, 1H), 7.64 (d, J = 8.0 Hz, 2H), 7.57 - 7.47 (m, 3H), 7.37 - 7.31 (m, 1H), 7.19 (dd, J = 4.4, 9.2 Hz, 1H), 4.59 (d, J = 6.0 Hz, 2H), 3.90 (s, 3H). Step 4: Preparation of N-[[4-[4-amino-1-[4-[4-(dimethoxymethyl)-1-piperidyl]-3-fluoro-phenyl]pyrazolo[3,4-d]pyrimidin-3-yl]phenyl]methyl]-5-fluoro-2-methoxy-benzamide

[0203] To a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl]-5-fluoro-2-methoxy-benzamide (12.0 g, 30.6 mmol, 1.0 equiv.) and 4-(dimethoxymethyl)-1-(2-fluoro-4-iodo-phenyl)piperidine (11.6 g, 30.6 mmol, 1.0 equiv.) in dimethyl sulfoxide (150 mL) was added copper iodide (3.24 g, 17.0 mmol, 0.55 equiv.), 2-(dimethylamino)acetic acid (3.50 g, 33.98 mmol, 1.1 equiv.), and sodium carbonate (7.20 g, 68.0 mmol, 2.2 equiv.). The suspension was degassed under vacuum and purged with nitrogen three times. The mixture was stirred under nitrogen at 110 °C for 12 h. The reaction mixture was partitioned between ethyl acetate (800 mL) and water (2.0 L). The aqueous layer was extracted with ethyl acetate (700 mL x 3). The combined organic layers were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product (15 g). The crude product was dissolved in ethyl acetate (420 mL) at reflux, and the solution was cooled to ambient temperature and then kept in a refrigerator (ca. 5°C) for 48 hours. The suspension was filtered, and the wet cake was washed with cold ethyl acetate (20 mL) to give the pure product (5.28 g). The mother liquor was concentrated, and the residue was recrystallized from ethyl acetate (100 mL) to give another crop (1.7 g) of pure product (total 6.98 g, 36% yield) as a gray solid. LC / MS: 644.2 [M+H] + . 1HNMR (400 MHz, CDCl3): δ 8.47 (s, 1H), 8.38 (t, J = 5.2 Hz, 1H), 7.99 (dd, J = 3.2, 9.2 Hz, 1H), 7.97 - 7.93 (m, 1H), 7.92 (s, 1H), 7.75 (d, J = 8.0 Hz, 2H), 7.56 (d, J = 8.0 Hz, 2H), 7.22 - 7.14 (m, 1H), 7.08 (t, J = 8.8 Hz, 1H), 6.97 (dd, J = 4.4, 8.8 Hz, 1H), 5.60 (br s, 2H), 4.78 (d, J = 6.0 Hz, 2H), 4.12 (d, J = 7.2 Hz, 1H), 3.97 (s, 3H), 3.53 (d, J = 12.0 Hz, 2H), 3.39 (s, 6H), 2.69 (t, J = 11.6 Hz, 2H), 1.88 (d, J = 12.0 Hz, 2H), 1.82 - 1.73 (m, 1H), 1.64 - 1.48 (m, 2H). Step 5: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(4-formylpiperidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0204] A solution of N-(4-(4-amino-1-(4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (1.03 g, 1.60 mmol) in THF (20 mL) and H2SO4 (2 M, 20 ml) was stirred at 70°C for 1 h. The reaction mixture was diluted with DCM (50 mL) and the pH was adjusted to 8 by dropwise addition of aqueous sodium hydroxide (2 M). The organic layer was evaporated in vacuo to give the desired product as a yellow solid (900 mg, 96% yield). LC / MS: 598.1 [M+1] + . Step 6: Preparation of (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0205] A solution of N-(4-(4-amino-1-(3-fluoro-4-(4-formylpiperidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (900 mg, 1.51 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (1.46 g, 3.02 mmol), and triethylamine (325 mg, 3.21 mmol) in DCM (60 mL) was stirred in air at room temperature for 1 hour. To this solution was added sodium triacetoxyborohydride (956 mg, 4.53 mmol) in small portions at 0° C. The reaction mixture was stirred overnight at room temperature and then partitioned between water (50 mL) and DCM (60 mL). The organic phase was dried over sodium sulfate and evaporated in vacuo. The crude product was triturated with MeOH to give the product as a white solid (1.0 g, 1.10 mmol, 73% yield). LC / MS: 910.4 [M+1] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.90 (t, J = 6.0 Hz, 1H), 8.38 (s, 1H), 8.05 - 7.99 (m, 2H), 7.74 (d, J = 8.1 Hz, 2H), 7.57 - 7.50 (m, 4H), 7.37 - 7.32 (m, 1H), 7.25 - 7.18 (m, 2H), 7.07 (d, J = 8.5 Hz, 2H), 5.05 (dd, J = 13.1, 4.9 Hz, 1H), 4.61 (d, J = 6.0 Hz, 2H), 4.33 (d, J = 17.2 Hz, 1H), 4.20 (d, J = 17.2 Hz, 1H), 3.91 (s, 3H), 3.42 (d, J = 10.4 Hz, 2H), 3.30 (br s, 4H), 2.96 - 2.85 (m, 1H), 2.77 - 2.67 (m, 2H), 2.64 - 2.52 (m, 5H), 2.43 - 2.30 (m, 1H), 2.24 (br d, J = 6.4 Hz, 2H), 2.01 - 1.66 (m, 4H), 1.38 - 1.25 (m, 2H). Example 50 Preparation of N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 50) [ka]

[0206] A solution of N-[(4-{4-amino-1-[3-fluoro-4-(4-formylpiperidin-1-yl)phenyl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (60 mg, 0.1 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione hydrochloride (57 mg, 0.15 mmol), and triethylamine (30 mg, 0.3 mmol) in DCM (5.0 mL) was stirred at room temperature under air. The reaction mixture was stirred at room temperature for 2 hours. Sodium triacetoxyborohydride (53 mg, 0.25 mmol) was then added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was evaporated in vacuo to give the crude product. The crude product was purified by preparative TLC (DCM:MeOH=10:1) to give the desired product as a white solid (31.8 mg, 0.034 mmol, 34% yield). LC / MS: 924 [M+1] + . 1 H NMR (400 MHz, DMSO) δ = 11.12 (s, 1H), 9.41 (s, 1H), 8.92 (t, J=6.2, 1H), 8.39 (s, 1H), 8.04 (dd, J=14.0, 2.4, 1H), 7.98 (d, J=8.9 Hz, 1H), 7.76 (dd, J=19.5, 8.3 Hz, 3H), 7.53 (dd, J=9.2, 3.4 Hz, 3H), 7.39 - 7.33 (m, 2H), 7.20 (dd, J=9.2, 4.3 Hz, 2H), 5.11 (dd, J=13.1, 5.1 Hz, 1H), 4.60 (s, 2H), 4.23 (m, 2H), 3.92 (m, 8H), 3.64 (s, 2H), 3.45 (d, J=10.4, 2H), 3.14-3.22 (m, 3H), 2.84-2.95 (m, 2H), 2.78 (t, J=11.6 Hz, 2H), 1.85-2.06 (m, 3H), 1.33-1.47 (m, 2H). Example 51 Preparation of (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 51) [ka]

[0207] A solution of N-[(4-{4-amino-1-[3-fluoro-4-(4-formylpiperidin-1-yl)phenyl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (60 mg, 0.1 mmol), (S)-2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dione benzenesulfonic acid (76 mg, 0.15 mmol), and triethylamine (30 mg, 0.3 mmol) in DCM (5.0 mL) was stirred at room temperature under air. The reaction mixture was stirred at room temperature for 2 hours. Sodium triacetoxyborohydride (53 mg, 0.25 mmol) was then added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was evaporated in vacuo to give the crude product. The crude product was purified by preparative TLC (DCM:MeOH=10:1) to give the desired product as a white solid (29.7 mg, 0.032 mmol, 32% yield). LC / MS: 927 [M+1] + . 1H NMR (400 MHz, DMSO) δ = 11.01 (s, 1H), 9.45 (s, 1H), 8.92 (s, 1H), 8.40 (s, 1H), 7.95-8.20 (m, 2H), 7.74 (d, J=7.2 Hz, 2H), 7.53 (m, 3H), 7.46 - 7.04 (m, 4H), 5.10 (br d, J=9.0 Hz, 1H), 4.61 (d, J=4.9 Hz, 2H), 4.34 (m, 3H), 3.92 (m, 5H), 3.46 (m, 3H), 3.15 - 3.35 (m, 6H), 2.85 - 2.96 (m, 2H), 2.70 - 2.79 (m, 3H), 2.11 - 1.69 (m, 6H). Example 52 Preparation of (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 52) [ka] Step 1: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0208] To a solution of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (200 mg, 0.42 mmol) in DMF (10 mL) stirred at room temperature was added 6-bromonicotinaldehyde (156 mg, 0.84 mmol) and K2CO3 (116 mg, 0.84 mmol). The reaction mixture was stirred at 100°C for 3 h. The mixture was cooled to room temperature, poured into water (40 mL), and extracted with EA (50 mL x 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH=10:1) to give the desired product (100 mg, 41.0%). LC / MS: 581.0 [M+H] + . Step 2: Preparation of (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0209] (S)-2-(2,6-Dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (63 mg, 0.13 mmol) and EtN (13 mg, 0.13 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Next, N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (75 mg, 0.13 mmol), HOAc (155 mg, 2.58 mmol), and NaBHCN (32 mg, 0.52 mmol) in DCM (4 mL) were added. The mixture was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (15 mL x 3). The organic layer was concentrated in vacuo. The residue was purified by preparative HPLC (ACN (15-30%) in water (0.1% FA)) to give the desired product as a white solid (16 mg, 13%). LC / MS: 893 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.98 - 10.91 (m, 1H), 8.89 - 8.82 (m, 1H), 8.26 - 8.25 (m, 1H), 8.07 - 8.02 (m, 1H), 7.62 (d, J = 8.2 Hz, 2H), 7.55 - 7.45 (m, 5H), 7.36 - 7.31 (m, 1H), 7.18 (dd, J = 9.1, 4.3 Hz, 1H), 7.05 (d, J = 8.1 Hz, 2H), 6.92 (d, J = 8.9 Hz, 1H), 5.08 - 4.96 (m, 2H), 4.57 (d, J = 6.1 Hz, 2H), 4.49 - 4.46 (m, 2H), 4.33 - 4.28 (m, 1H), 4.22 - 4.18 (m, 1H), 3.89 (s, 3H), 3.41 - 3.39 (m, 2H), 3.29 - 3.25 (m, 5H), 3.08 (t, J = 12.4 Hz, 2H), 2.94 - 2.85 (m, 1H), 2.62 - 2.52 (m, 4H), 2.40 - 2.30 (m, 1H), 2.18 - 2.06 (m, 2H), 2.10 - 1.92 (m, 3H). Example 53 Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (compound 53) [ka] Step 1: Preparation of tert-butyl 4-(tosyloxy)piperidine-1-carboxylate

[0210] To a solution of tert-butyl 4-hydroxypiperidine-1-carboxylate (2 g, 9.94 mmol) in pyridine (20 mL) stirred at room temperature, TsCl (2.27 g, 11.93 mmol) was added. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (80 mL) and extracted with EA (100 mL x 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (PE / EtOAc = 3:1) to give the desired product (2.2 g, 62%). LC / MS: 377.8 [M+Na] + . Step 2: Preparation of tert-butyl 4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidine-1-carboxylate

[0211] To a solution of tert-butyl 4-(tosyloxy)piperidine-1-carboxylate (2.2 g, 6.19 mmol) in DMF (2 mL) stirred at room temperature, CsCO (4.03 g, 12.38 mmol) and N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (2.43 g, 6.19 mmol) were added. The reaction mixture was stirred at 60 °C for 12 h. The mixture was cooled to room temperature, poured into water (75 mL), and extracted with EA (100 mL × 2). The combined organic layers were washed with brine, dried over NaSO, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH = 10:1) to give the desired product (2.5 g, 70%). LC / MS: 575.8 [M+H] + . Step 3: Preparation of N-(4-(4-amino-1-(piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0212] A solution of tert-butyl 4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidine-1-carboxylate (2.5 g, 4.34 mmol) in TFA / DCM (1:5, 30 mL) was stirred at room temperature for 2 hours. The solution was concentrated in vacuo. The residue was dissolved in DCM (100 mL) and washed with saturated sodium bicarbonate solution (100 mL x 2). The organic layer was dried over Na2SO4 and concentrated in vacuo to give the desired product (1.5 g, 72%). LC / MS: 476.0 [M+H] + . Step 4: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0213] To a solution of N-({4-[4-amino-1-(piperidin-4-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (700 mg, 1.47 mmol) in DMF (10 mL) stirred at room temperature, 4-fluorobenzaldehyde (365 mg, 2.94 mmol) and K2CO3 (406 mg, 2.94 mmol) were added. The reaction mixture was stirred at 100 °C for 3 h. The mixture was cooled to room temperature, poured into water (40 mL), and extracted with EA (50 mL × 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH = 10:1) to give the desired product (300 mg, 35%). LC / MS: 580.0 [M+H] + . Step 5: Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0214] (S)-2-(2,6-Dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dione benzenesulfonic acid (71 mg, 0.15 mmol) and EtN (15 mg, 0.15 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Next, N-(4-(4-amino-1-(1-(4-formylphenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (85 mg, 0.15 mmol), HOAc (176 mg, 2.93 mmol), and NaBHCN (37 mg, 0.59 mmol) in DCM (4 mL) were added. The solution was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (3 x 15 mL). The organic layers were combined and concentrated in vacuo. The residue was purified by preparative HPLC [ACN (20-40%) in water (0.1% FA)] to give the desired product as a white solid (26 mg, 19%). LC / MS: 892 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 8.87 (t, J = 6.3 Hz, 1H), 8.26 (s, 1H), 7.64 (d, J = 8.1 Hz, 2H), 7.55 - 7.47 (m, 4H), 7.37 - 7.31 (m, 1H), 7.18 (dd, J = 9.1, 4.3 Hz, 3H), 7.10 - 6.94 (m, 4H), 5.09 - 5.03 (m, 1H), 4.93 - 4.89 (m, 1H), 4.58 (d, J = 6.1 Hz, 2H), 4.35 - 4.10 (m, 2H), 3.95 - 3.80 (m, 5H), 3.48 - 3.35 (m, 2H), 3.31 - 3.19 (m, 3H), 3.15 - 2.85 (m, 4H), 2.63 - 2.53 (m, 4H), 2.44 - 2.34 (m, 2H), 2.47 - 2.25 (m, 2H), 2.09 - 1.95 (m, 3H). Example 54 Preparation of (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (compound 54) [ka] Step 1: Preparation of tert-butyl 3-(tosyloxy)azetidine-1-carboxylate

[0215] A solution of tert-butyl 3-hydroxyazetidine-1-carboxylate (1270 mg, 7.33 mmol), EtN (1113 mg, 11.00 mmol), and TsCl (1677 mg, 8.80 mmol) in DCM (20 mL) was stirred overnight at room temperature under N. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL x 3). The organic phase was washed with brine and concentrated in vacuo. The residue was purified by flash chromatography (PE / EA = 9 / 1) to give the desired product as a colorless oil (2.4 g, 100%). LC / MS: 328 [M+H] + . Step 2: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azetidine-1-carboxylate

[0216] A suspension of tert-butyl 3-(tosyloxy)azetidine-1-carboxylate (667 mg, 2.04 mmol), N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (800 mg, 2.04 mmol), and CsCO (1993 mg, 6.12 mmol) in DMF (10 mL) was stirred at 80° C. overnight. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL×3). The organic layer was washed with brine and concentrated in vacuo. The residue was purified by flash chromatography (DCM / MeOH=97 / 3) to give the desired product as a light brown solid (200 mg, 17.9%). LC / MS: 548 [M+H] + . Step 3: Preparation of N-(4-(4-amino-1-(azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0217] A solution of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azetidine-1-carboxylate (200 mg, 0.36 mmol) in DCM / TFA (8 mL, 3:1) was stirred at room temperature for 1 hour. The solution was concentrated in vacuo to give the desired product as a white solid (198 mg of TFA salt, 100%). LC / MS: 448 [M+H] + . Step 4: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0218] To a solution of N-(4-(4-amino-1-(azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (TFA salt, 198 mg, 0.36 mmol) and 6-bromonicotinaldehyde (136 mg, 0.73 mmol) in DMF (4 mL) was added K2CO3 (151 mg, 1.11 mmol). The mixture was stirred at 80 °C overnight. The reaction was quenched by adding water (10 mL) and extracted with EA (20 mL × 3). The organic layer was washed with brine and concentrated in vacuo. The residue was purified by flash chromatography (DCM / MeOH = 75 / 15) to give the desired product as a yellow solid (100 mg, 50%). LC / MS: 553 [M+H] + . Step 5: Preparation of (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0219] (S)-2-(2,6-Dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (84 mg, 0.17 mmol) and EtN (17 mg, 0.17 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Next, N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (95 mg, 0.17 mmol), HOAc (206 mg, 3.44 mmol), and NaBHCN (65 mg, 1.03 mmol) in DCM (4 mL) were added. The mixture was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (15 mL x 3). The organic phase was concentrated in vacuo. The residue was purified by preparative HPLC [ACN (15-25%) in water (0.1% FA)] to give the desired product as a white solid (13.8 mg, 9.3%). LC / MS: 865 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 8.87 (t, J = 6.1 Hz, 1H), 8.28 (s, 1H), 8.03 (s, 1H), 7.66 (d, J = 8.1 Hz, 2H), 7.56 - 7.47 (m, 5H), 7.37 - 7.30 (m, 1H), 7.18 (dd, J = 9.2, 4.3 Hz, 1H), 7.04 (d, J = 8.3 Hz, 2H), 6.50 (d, J = 8.4 Hz, 1H), 5.87 (t, J = 7.5 Hz, 1H), 5.06 - 5.02 (m, 1H), 4.57 (d, J = 6.1 Hz, 2H), 4.55 - 4.37 (m, 4H), 4.35 - 4.17 (m, 2H), 3.89 (s, 3H), 3.42 (s, 2H), 3.29 - 3.05 (m, 5H), 2.98 - 2.89 (m, 1H), 2.65 - 2.55 (m, 4H), 2.37 - 2.33 (m, 1H), 1.97 - 1.95 (m, 1H). Example 55 Preparation of N-(4-(4-amino-1-(1-(5-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (compound 55) [ka] Step 1: Preparation of tert-butyl 5-hydroxypentanoate

[0220] To a solution of 5-(tert-butoxy)-5-oxopentanoic acid (3.00 g, 6.96 mmol) in dry THF (60 mL) cooled to 0 °C was added NaBH (630 mg, 16.74 mmol). The solution was stirred until H evolution ceased, and then BF.OEt (2.71 g, 19.13 mmol) was added dropwise. The reaction was stirred at room temperature for 4 h. The reaction was quenched by adding H O (50 mL) at 0 °C. The mixture was extracted with EA (50 mL × 3). The combined organic layers were washed with saturated Na CO solution and brine, then concentrated in vacuo to give the crude product (2.50 g, 90.0%) as a colorless oil. LC / MS: 197.2 [M+Na] + . Step 2: Preparation of tert-butyl 5-oxopentanoate

[0221] To a solution of tert-butyl 5-hydroxypentanoate (500 mg, 2.87 mmol) in DCM (20 mL) stirred at room temperature under argon was added PDC (1.62 g, 4.30 mmol). The mixture was stirred at room temperature for 4 hours. The mixture was filtered and the filtrate was collected. The filtrate cake was washed with DCM (20 mL). The combined solution was concentrated in vacuo. The residue was purified by flash chromatography (0-65% EA in PE) to give the desired product (200 mg, 40.5%) as a colorless oil. LC / MS: 195.0 [M+Na] + . Step 3: Preparation of tert-butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate

[0222] To a solution of tert-butyl 5-oxopentanoate (90 mg, 0.52 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (254 mg, 0.52 mmol), and NaOAc (51 mg, 0.63 mmol) in MeOH (10 mL) was added NaBHCN (66 mg, 1.05 mmol). The reaction mixture was stirred overnight at room temperature. The reaction mixture was partitioned between DCM (50 mL) and water (30 mL). The organic layer was evaporated to give the crude product. The crude product was purified by flash chromatography (0-10% MeOH in DCM) to give the desired product (200 mg, 79.0% yield). LC / MS: 484.9 [M+H] + . Step 4: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid

[0223] To a solution of tert-butyl (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoate (200 mg, 0.41 mmol) in DCM (3 mL) was added TFA (1 mL). The mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated in vacuo to give the desired product (170 mg, 96.1% yield) as a pale yellow solid. LC / MS: 428.9 [M+H] + . Step 5: Preparation of N-(4-(4-amino-1-(1-(5-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0224] To a solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoic acid (177 mg, 0.41 mmol), N-(4-(4-amino-1-(pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (191 mg, 0.41 mmol) and DIEA (160 mg, 1.24 mmol) in DMF (10 mL) was added HOBT (61 mg, 0.45 mmol) and EDCI (87 mg, 0.45 mmol). The reaction mixture was stirred at room temperature overnight. The reaction mixture was partitioned between DCM (50 mL) and water (30 mL). The organic layer was evaporated to give the crude product. The crude product was purified by preparative HPLC (20-22% ACN in HO (0.1% FA)) to give the desired product (25 mg, 6.64% yield) as a white solid. LC / MS: 872.6 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 8.87 (t, J = 5.9 Hz, 1H), 8.87 - 8.26 (m, 1H), 7.63 (dd, J = 7.3, 5.3 Hz, 2H), 7.55 - 7.48 (m, 4H), 7.34 (td, J = 8.7, 3.5 Hz, 1H), 7.18 (dd, J = 9.1, 4.3 Hz, 1H), 7.02 (dd, J = 10.7, 7.8 Hz, 2H), 5.55 - 5.39 (m, 1H), 5.10 - 4.95 (m, 1H), 4.58 (d, J = 6.0 Hz, 2H), 4.32 (d, J = 15.9 Hz, 1H), 4.19 (d, J = 16.9 Hz, 1H), 4.07 - 3.87 (m, 4H), 3.87 - 3.56 (m, 3H), 3.54 - 3.41 (m, 1H), 3.26 - 3.18 (m, 4H), 2.95 - 2.85 (m, 1H), 2.60 - 2.52 (m, 1H), 2.48 - 2.41 (m, 4H), 2.39 - 2.23 (m, 6H), 2.00 - 1.91 (m, 1H), 1.59 - 1.42 (m, 4H). Example 56 Preparation of N-(4-(4-amino-1-(1-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (compound 58) [ka] Step 1: Preparation of tert-butyl 3-(tosyloxy)pyrrolidine-1-carboxylate

[0225] To a solution of tert-butyl (3-hydroxypyrrolidin-1-yl)formate (5 g, 26.6 mmol) in pyridine (50 mL) was added TsCl (6.1 g, 31.9 mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with DCM (100 mL) and then washed with water and brine. The organic phase was dried over Na2SO4 and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (PE / EA=3:1) to give the desired product (8 g, 87.9%) as a white solid. LC / MS: 364.0 [M+Na] + . Step 2: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)pyrrolidine-1-carboxylate

[0226] To a solution of tert-butyl (3-{[(4-methylbenzene)sulfonyl]oxy}pyrrolidin-1-yl)formate (2 g, 5.84 mmol) in DMF (20 mL) stirred at room temperature, N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (2.3 g, 5.84 mmol) and CsCO (3.8 g, 11.68 mmol) were added. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was poured into water (80 mL) and then extracted with EA (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over NaSO, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (10% MeOH in DCM) to give the desired product (2.3 g, 70.0%) as a yellow solid. LC / MS: 562.0 [M+H] + . Step 3: Preparation of N-(4-(4-amino-1-(pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0227] A solution of tert-butyl-3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)pyrrolidine-1-carboxylate (2.3 g, 4.09 mmol) in TFA / DCM (24 mL, 5:1) was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo. The residue was dissolved in saturated sodium bicarbonate solution (100 mL) and then extracted with DCM (100 mL x 2). The combined organic layers were washed with brine (200 mL), dried over Na2SO4, and concentrated in vacuo to give the desired product (1.2 g, 63.6%) as a brown solid. LC / MS: 462.0 [M+H] + . Step 4: Preparation of 5-bromo-2-(dimethoxymethyl)pyridine

[0228] To a solution of 5-bromopyridine-2-carbaldehyde (1 g, 5.37 mmol) in MeOH (10 mL) stirred at room temperature, trimethoxymethane (1.71 g, 16.13 mmol) and TsOH (278 mg, 1.61 mmol) were added. The reaction mixture was stirred at 70° C. for 2 hours. The mixture was concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (PE / EA=10:1) to give the desired product (600 mg, 48.1%). LC / MS: 232.0 [M+H] + . Step 5: Preparation of N-(4-(4-amino-1-(1-(6-(dimethoxymethyl)pyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0229] To a solution of N-({4-[4-amino-1-(pyrrolidin-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (160 mg, 0.35 mmol) in toluene (10 mL) stirred at room temperature, 5-bromo-2-(dimethoxymethyl)pyridine (123 mg, 0.53 mmol), BINAP (130 mg, 0.21 mmol), t-BuONa (67 mg, 0.7 mmol), and Pd(dba) (96 mg, 0.105 mmol) were added under Ar. The reaction mixture was stirred at 80° C. for 12 hours. The mixture was concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH=10:1) to give the desired product (60 mg, 28.2%). LC / MS: 635.0 [M+H] + . Step 6: Preparation of N-(4-(4-amino-1-(1-(6-formylpyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0230] To a solution of N-{[4-(4-amino-1-{1-[5-(dimethoxymethyl)pyridin-2-yl]piperidin-4-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (55 mg, 0.09 mmol) in THF (5 mL) stirred at room temperature was added HCl (0.2 mL). The reaction mixture was stirred at 50 °C for 12 h. The mixture was poured into HO (20 mL), the pH was adjusted to 7-8 with saturated sodium bicarbonate solution, and then extracted with EA (20 mL × 3). The combined organic layers were washed with brine (50 mL), dried over NaSO, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH = 10:1) to give the desired product (21 mg, 41.1%). LC / MS: 566.9 [M+H] + . Step 7: Preparation of N-(4-(4-amino-1-(1-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0231] To a solution of N-(4-(4-amino-1-(1-(6-formylpyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (21 mg, 0.03 mmol) in MeOH / DMF / HOAc (5 mL, 2:1:0.02) was added TEA (7.5 mg, 0.04 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (21.66 mg, 0.04 mmol), and NaBHCN (6.99 mg, 0.11 mmol). The mixture was stirred at 60° C. for 1 hour. The reaction was quenched by adding water (5 mL) and extracted with DCM (10 mL×2). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by preparative HPLC (ACN / H2O (0.1% FA), 10-40%) to give the desired compound (3 mg, 9.2%). LC / MS: 879.6 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.87 (t, J = 6.3 Hz, 1H), 8.39 - 8.27 (m, 2H), 7.91 (s, 1H), 7.62 (d, J = 8.0 Hz, 2H), 7.49 (t, J = 9.8 Hz, 3H), 7.37 - 7.31 (m, 1H), 7.27 - 7.14 (m, 2H), 7.11 - 6.93 (m, 3H), 5.68 - 5.60 (m, 1H), 5.04 (dd, J = 13.1, 5.1 Hz, 1H), 4.57 (d, J = 6.2 Hz, 2H), 4.32 (d, J = 17.4 Hz, 1H), 4.19 (d, J = 17.2 Hz, 1H), 3.94 - 3.82 (m, 4H), 3.69 - 3.64 (m, 2H), 3.53 - 3.50 (m, 4H), 3.29 - 3.25 (m, 3H), 2.94 - 2.86 (m, 1H), 2.68 - 2.52 (m, 6H), 2.42 - 2.28 (m, 2H), 1.99 - 1.90 (m, 1H). Example 57 Preparation of (S)—N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 59) [ka] Step 1: Preparation of (1-(5-iodopyridin-2-yl)piperidin-4-yl)methanol

[0232] To a solution of 2-fluoro-5-iodopyridine (2 g, 9.0 mmol) and piperidin-4-ylmethanol (1.2 g, 10.8 mmol) in DMF (50 mL) stirred at 25° C. under nitrogen, potassium carbonate (3.7 g, 27.0 mmol) was added. The reaction mixture was stirred at 100° C. for 2 hours. The reaction mixture was evaporated in vacuo to give the crude product, which was purified by silica gel column (PE:EA=10:1 to 1:1) to give the desired product (2 g, 69.8%) as a white solid. LC / MS: 319.0 [M+1] + . Step 2: Preparation of 1-(5-iodopyridin-2-yl)piperidine-4-carbaldehyde

[0233] To a solution of [1-(5-iodopyridin-2-yl)piperidin-4-yl]methanol (1 g, 3.1 mmol) in DCM (50 mL) stirred under nitrogen at 25 °C, Dess-Martin periodinane (2.0 g, 4.6 mmol) was added in small portions. The reaction mixture was stirred at 25 °C for 1 h. The reaction mixture was quenched with NaSO (2 M), extracted with DCM (200 mL), dried over sodium sulfate, and evaporated in vacuo to give the crude product. The crude product was purified by silica gel column (PE:EA = 10:1 to 1:1) to give the desired product (0.7 g, 70.9%) as a white solid. LC / MS: 317.0 [M+1] + . Step 3: Preparation of 2-(4-(dimethoxymethyl)piperidin-1-yl)-5-iodopyridine

[0234] To a solution of 1-(5-iodopyridin-2-yl)piperidine-4-carbaldehyde (700 mg, 2.2 mmol) in trimethoxymethane (15 mL) stirred at 25° C. under nitrogen, TsOH (40 mg, 0.2 mmol) was added. The reaction mixture was stirred at 100° C. for 2 hours. The reaction mixture was evaporated in vacuo to give the crude product. The crude product was purified by silica gel column (PE:EA=10:1 to 1:1) to give the desired product (0.6 g, 75.2%) as a white solid. LC / MS: 362.9 [M+1]+ . Step 4: Preparation of N-(4-(4-amino-1-(6-(4-(dimethoxymethyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0235] A mixture of 2-[4-(dimethoxymethyl)piperidin-1-yl]-5-iodopyridine (100 mg, 0.3 mmol), N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (108.3 mg, 0.3 mmol) and N 1 ,N 1 To a solution of 1,2-dimethylcyclohexane-1,2-diamine (39.3 mg, 0.3 mmol) in DMF (10 mL) was added copper(I) iodide (52.6 mg, 0.3 mmol) and cesium carbonate (269.8 mg, 0.8 mmol). The reaction mixture was stirred at 110 °C for 12 h. The reaction mixture was filtered and evaporated in vacuo to give the crude product. The crude product was purified by silica gel column (DCM:MeOH = 100:1 to 10:1) to give the desired product (20 mg, 11.5%) as a yellow solid. LC / MS: 627.0 [M+1] + . Step 5: Preparation of N-(4-(4-amino-1-(6-(4-formylpiperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0236] A solution of N-{[4-(4-amino-1-{6-[4-(dimethoxymethyl)piperidin-1-yl]pyridin-3-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (15 mg, 0.023 mmol) in THF / HSO (2N) (5 mL, 1:1) was stirred at 70° C. for 1 h. The mixture was diluted with EA (100 mL), neutralized with NaOH (2 M), dried over sodium sulfate, and evaporated in vacuo to give the desired product (10 mg, 71.9%) as a yellow solid. LC / MS: 581.0 [M+1] + . Step 6: Preparation of (S)—N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0237] To a solution of N-[(4-{4-amino-1-[6-(4-formylpiperidin-1-yl)pyridin-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (15 mg, 0.025 mmol), (3S)-3-[1-oxo-5-(piperazin-1-yl)-3H-isoindol-2-yl]piperidine-2,6-dione (8.47 mg, 0.025 mmol), and acetic acid (62 mg, 0.52 mmol) in CHOH / DMF (2 mL, 1:1) was added triethylamine (13.05 mg, 0.13 mmol) and NaBHCN (8.11 mg, 0.13 mmol) under nitrogen at 60° C. The reaction mixture was stirred at 60° C. for 1 hour. The reaction mixture was concentrated in vacuo. The residue was dissolved in EA (50 mL) and washed with water (10 mL x 2). The organic phase was dried over sodium sulfate and evaporated in vacuo to give the crude product. The crude product was purified by preparative HPLC to give the desired product (5 mg, 21.7%) as a white solid. LC / MS: 893.0 [M+1] + . 1 H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.90 (t, J = 6.1 Hz, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.32 (s, 1H), 8.24 (s, 1H), 8.12 (d, J = 9.2 Hz, 1H), 7.73 (d, J = 8.1 Hz, 2H), 7.58 - 7.48 (m, 3H), 7.40 - 7.32 (m, 1H), 7.23 - 7.17 (m, 1H), 7.08 - 6.96 (m, 3H), 6.61 - 6.49 (m, 3H), 5.15 - 5.01 (m, 1H), 4.60 (d, J = 6.1 Hz, 2H), 4.44 - 4.28 (m, 3H), 3.91 (s, 3H), 3.29 - 3.24 (m, 7H), 3.00 - 2.82 (m, 3H), 2.74 - 2.59 (m, 2H), 2.44 - 2.31 (m, 2H), 2.29 - 2.17 (d, J = 6.6 Hz, 2H), 2.02 - 1.73 (m, 4H), 1.34 - 1.05 (m, 2H). Example 58 Preparation of N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 60) [ka] Step 1: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0238] To a solution of N-({4-[4-amino-1-(pyrrolidin-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (300 mg, 0.65 mmol) in DMSO (5 mL) stirred at room temperature, 4-fluorobenzaldehyde (121 mg, 0.98 mmol) and K2CO3 (180 mg, 1.3 mmol) were added. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was poured into water (100 mL) and extracted with EA (100 mL × 2). The combined organic layers were washed with water, brine, dried over Na2SO4, and then concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (DCM / MeOH = 10:1) to give the desired product (100 mg, 27.2%). LC / MS: 566.0 [M+H] + . Step 2: Preparation of N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0239] To a solution of N-[(4-{4-amino-1-[1-(4-formylphenyl)pyrrolidin-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (100 mg, 0.18 mmol) in MeOH / DMF / HOAc (12 mL, 2:1:0.06) stirred at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (86 mg, 0.18 mmol), EtN (36 mg, 0.36 mmol), and NaBHCN (45 mg, 0.72 mmol) were added. The reaction mixture was stirred at 60° C. for 1 hour. The mixture was concentrated in vacuo, poured into water (50 mL), and extracted with EA (100 mL×2). The combined organic layers were washed with brine (200 mL), dried over NaSO, and concentrated in vacuo to give the crude product, which was purified by preparative HPLC to give the desired product (19 mg, 12.2%). LC / MS: 900.0 [M+Na] + . 1H NMR (400 MHz, DMSO) δ = 10.95 (s, 1H), 8.86 (t, J= 6.0 Hz 1H), 8.30 (s, 1H), 8.28 (s, 1H), 7.63 (d, J= 8.0 Hz, 2H), 7.52 - 7.47 (m, 5H), 7.36 - 7.31 (m, 1H), 7.18 (dd, J= 9.2, 4.4 Hz, 1H), 7.12 (d, J= 8.4 Hz, 2H), 7.06 - 7.01 (m, 2H), 6.56 (d, J= 8.4 Hz, 2H), 5.65 - 5.60 (m, 1H), 5.04 (dd, J= 13.2, 5.2 Hz, 1H), 4.57 (d, J= 6.0 Hz, 2H), 4.32 (d, J= 16.8 Hz, 1H), 4.19 (d, J= 16.8 Hz, 1H), 3.89 (s, 3H), 3.84 - 3.79 (m, 1H), 3.66 - 3.60 (m, 2H), 3.48 - 3.39 (m, 2H), 3.30 - 3.20 (m, 5H), 2.95 - 2.83 (m, 2H), 2.64 - 2.59 (m, 2H), 2.57 - 2.54 (m, 2H), 2.47 (s, 3H), 1.96 - 1.90 (m, 1H). Example 59 Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 61) [ka] Step 1: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0240] A mixture of N-(4-(4-amino-1-(azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (60 mg, 0.13 mmol), 4-fluorobenzaldehyde (25 mg, 0.20 mmol), and K2CO3 (56 mg, 0.41 mmol) in DMSO (5 mL) was stirred at 80 °C overnight. The reaction mixture was poured into water (5 mL) and extracted with EA (10 mL × 3). The combined organic layers were washed with water, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with DCM / MeOH = 10:1 to give the desired product (20 mg, 80% purity, 21.6% yield). LC / MS: 552.7 [M+H] + . Step 2: Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0241] To a solution of N-(4-(4-amino-1-(1-(4-formylphenyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (20 mg, 80% purity, 0.029 mmol) in MeOH / DMF (2:1, 3 mL) stirred at room temperature was added (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (22 mg, 0.045 mmol) and EtN (7 mg, 0.069 mmol). The mixture was stirred at room temperature for 30 minutes, and then AcOH (0.1 mL) and NaBHCN (4 mg, 0.064 mmol) were added. The reaction mixture was stirred at 60° C. for 1 hour. The mixture was concentrated in vacuo. The residue was poured into water (4 ml) and extracted with EA (8 mL x 3). The combined organic layers were washed with brine (10 mL), dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by preparative HPLC to give the desired product (8 mg, 31.9%). LC / MS: 864 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 8.86 (t, J = 6.1 Hz, 1H), 8.33 - 8.20 (m, 2H), 7.65 (d, J = 8.1 Hz, 2H), 7.53 - 7.48 (m, 3H), 7.37 - 7.31 (m, 1H), 7.24 - 7.11 (m, 3H), 7.08 - 6.98 (m, 2H), 6.52 (d, J = 8.5 Hz, 2H), 5.88 - 5.81 (m, 1H), 5.05 - 5.02 (m, 1H), 4.57 (d, J = 6.0 Hz, 2H), 4.42 - 4.16 (m, 6H), 3.89 (s, 3H), 3.42 - 3.36 (m, 4H), 3.28 - 3.25 (m, 5H), 2.97 - 2.83 (m, 2H), 2.69 - 2.54 (m, 2H), 2.41 - 2.31 (m, 2H), 1.98 - 1.92 (m, 1H). Example 60 Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 62) [ka] Step 1: Preparation of tert-butyl (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoate

[0242] To a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (100 mg, 0.2 mmol) in DMF (10 mL) was added TEA (41.51 mg, 0.4 mmol). The mixture was stirred under nitrogen at room temperature for 5 min. Then, tert-butyl-4-formylbenzoate (42.38 mg, 0.2 mmol) and NaBHCN (38.74 mg, 0.61 mmol) were added. The reaction mixture was stirred at 60 °C for 1 h. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL × 3). The organic phase was washed with brine and dried over NaSO. The solution was concentrated in vacuo, and the residue was purified by flash column chromatography with DCM:MeOH=10:1 to give the desired product (100 mg, 90% purity, 86.7% yield) as a yellow solid. LC / MS: 519.1 [M+H] + . Step 2: Preparation of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoic acid

[0243] A solution of tert-butyl (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoate (100 mg, 90% purity, 0.17 mmol) in DCM (3 mL) and TFA (1 mL) was stirred at room temperature for 2 hours. The mixture was concentrated to give the title compound (70 mg, 80% purity, 69.5% yield) as a yellow oil. LC / MS: 462.8 [M+H] + . Step 3: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azetidine-1-carboxylate

[0244] To a solution of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (500 mg, 1.27 mmol) in DMF (10 mL) was added tert-butyl-3-(tosyloxy)azetidine-1-carboxylate (502 mg, 1.52 mmol) and CsCO (1.24 g, 3.82 mmol). The reaction mixture was stirred at 80 °C for 16 h. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL × 2). The organic phase was washed with brine and dried over NaSO. The solution was concentrated in vacuo, and the residue was purified by flash column chromatography with DCM:MeOH = 10:1 to give the desired product (230 mg, 90% purity, 29.7%) as a yellow oil. LC / MS: 547.8 [M+H] + . Step 4: Preparation of N-(4-(4-amino-1-(azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0245] A solution of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azetidine-1-carboxylate (230 mg, 90% purity, 0.4 mmol) in DCM (8 mL) and TFA (2 mL) was stirred at room temperature for 2 h. The solvent was removed in vacuo and then dissolved in DCM (20 mL). The mixture was adjusted to pH 10 with saturated Na2CO3 solution. The organic phase was concentrated in vacuo to give the title compound (100 mg, 60.3%) as a yellow solid. LC / MS: 448.1 [M+H] + . Step 5: Preparation of (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0246] To a solution of 4-[(4-{2-[(3S)-2,6-dioxopiperidin-3-yl]-1-oxo-3H-isoindol-5-yl}piperazin-1-yl)methyl]benzoic acid (44 mg, 80% purity, 0.07 mmol) in THF (5 mL) was added N-({4-[4-amino-1-(azetidin-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (33.9 mg, 0.07 mmol), 1-hydroxybenzotrizole (15.3 mg, 0.11 mmol), EDCI (21.8 mg, 0.11 mmol), and TEA (22.9 mg, 0.22 mmol). The mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (15 mL) and extracted with DCM (10 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated in vacuo, and the residue was purified by preparative HPLC (ACN / H2O (0.1% FA), 10-40%) to give the desired compound (10 mg, 14.3%) as a white solid. LC / MS: 892.6 [M+H]+ . 1 H NMR (400 MHz, ) δ 10.95 (s, 1H), 8.88 (t, J = 6.0 Hz, 1H), 8.27 (s, 1H), 7.68 - 7.64 (m, 4H), 7.51 - 7.47 (m, 4H), 7.45 - 7.40 (m, 2H), 7.34 (td, J = 8.5, 3.3 Hz, 1H), 7.19 (dd, J = 9.1, 4.3 Hz, 1H), 7.05 (d, J = 8.1 Hz, 2H), 5.80 - 5.71 (m, 1H), 5.05 (dd, J = 13.2, 5.0Hz, 1H), 4.93 - 4.72 (m, 2H), 4.66 - 4.49 (m, 4H), 4.32 (d, J = 16.9 Hz, 1H), 4.20 (d, J = 16.9 Hz, 1H), 3.90 (s, 3H), 3.59 (s, 2H), 3.32 - 3.25 (m, 4H), 2.96 - 2.84 (m, 1H), 2.68 - 2.56 (m, 4H), 2.44 - 2.29 (m, 2H), 1.99 -1.91 (m, 1H). Example 61 Preparation of (N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 63) [ka] Step 1: Preparation of (N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0247] To a solution of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoic acid (44 mg, 80% purity, 0.07 mmol) in THF (5 mL) was added N-(4-(4-amino-1-(pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (34.9 mg, 0.07 mmol), 1-hydroxybenzotriazole (15.3 mg, 0.11 mmol), EDCI (21.8 mg, 0.11 mmol), and TEA (22.9 mg, 0.22 mmol). The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (10 mL) and extracted with DCM (10 mL × 2). The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated in vacuo, and the residue was purified by preparative HPLC (ACN / H2O (0.1% FA), 10-40%) to give the desired compound (4 mg, 6.3%). LC / MS: 906.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.94 - 8.86 (m, 1H), 8.25 - 8.12 (m, 1H), 7.75 - 7.28 (m, 11H), 7.25 - 7.15 (m, 1H), 7.10 - 6.97 (m, 2H), 5.62 - 5.35 (m, 1H), 5.05 (d, J = 8.7 Hz, 1H), 4.59 (d, J = 5.6 Hz, 2H), 4.32 (d, J = 16.2 Hz, 1H), 4.19 (d, J = 15.3 Hz, 1H), 4.06 - 3.72 (m, 6H), 3.67 (d, J = 6.4 Hz, 1H), 3.55 (d, J = 16.0 Hz, 2H), 3.32 - 3.18 (m, 4H), 2.90 (t, J = 12.8 Hz, 1H), 2.69 - 2.53 (m, 4H), 2.48 - 2.43 (m, 2H), 2.41 -2.28 (m, 2H), 2.02 - 1.86 (m, 1H). Example 62 Preparation of N-(4-(4-amino-1-(1-(6-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)hexanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 64) [ka] Step 1: Preparation of (S)-6-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)hexanoic acid

[0248] A suspension of 6-bromohexanoic acid (100 mg, 0.51 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (168.3 mg, 0.51 mmol), K2CO3 (212.3 mg, 1.54 mmol), and KI (85.1 mg, 0.51 mmol) in DMF (3 mL) was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo. The residue was dissolved in EA (50 mL), washed with water (10 mL), dried over Na2SO4, and evaporated in vacuo to give the crude product. The crude product was purified by flash column chromatography (DCM / MeOH = 10:1) to give the desired product (50 mg, purity = 90%, yield = 19.8%) as a white solid. LC / MS: 442.9 [M+H] + . Step 2: Preparation of N-(4-(4-amino-1-(1-(6-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)hexanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0249] A solution of (S)-6-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)hexanoic acid (50 mg, purity=90%), N-(4-(4-amino-1-(pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (69.9 mg, 0.15 mmol), HATU (86.4 mg, 0.23 mmol), and DIEA (58.7 mg, 0.45 mmol) in DMF (5 mL) was stirred at room temperature for 4 hours. The reaction mixture was concentrated in vacuo. The residue was dissolved in EA (50 mL), washed with water (10 mL), dried over Na2SO4, and evaporated in vacuo to give the crude product. The crude product was purified by preparative TLC (DCM / MeOH=10:1) to give the desired product (8 mg, 12.5%) as a white solid. LC / MS: 886.1 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.92 (s, 1H), 8.84 (t, J = 6.0 Hz, 1H), 8.24 (d, J = 3.8 Hz, 1H), 7.60 (d, J = 8.1 Hz, 2H), 7.52 - 7.45 (m, 4H), 7.33 - 7.28 (m, 1H), 7.17 - 7.14 (m, 1H), 7.10 - 7.02 (m, 2H), 5.51 - 5.34 (m, 1H), 5.06 - 4.97 (m, 1H), 4.54 (d, J = 6.1 Hz, 2H), 4.33 - 4.15 (m, 2H), 4.05 - 3.57 (m, 8H), 3.50 - 3.41 (m, 1H), 3.24 - 3.05 (m, 2H), 2.93 - 2.78 (m, 2H), 2.60 - 2.48 (m, 3H), 2.45 - 2.14 (m, 9H), 1.96 - 1.88 (m, 1H), 1.56 - 1.44 (m, 4H), 1.33 - 1.17 (m, 3H). Example 63 Preparation of N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 65) [ka] Step 1: Preparation of (1-(2-fluoro-4-nitrophenyl)pyrrolidin-3-yl)methanol

[0250] To a solution of 1,2-difluoro-4-nitrobenzene (2 g, 12.57 mmol) in CHCN (5 mL) was added pyrrolidin-3-ylmethanol (1.9 g, 13.83 mmol) and DIEA (4.9 g, 37.71 mmol). The reaction mixture was stirred at 80° C. for 3 hours. The solvent was removed in vacuo. The residue was purified by flash column chromatography with PE:EA=1:1 to give the desired product (1.8 g, 59.6%) as a yellow solid. LC / MS: 241.1 [M+H] + . Step 2: Preparation of (1-(4-amino-2-fluorophenyl)pyrrolidin-3-yl)methanol

[0251] To a solution of (1-(2-fluoro-4-nitrophenyl)pyrrolidin-3-yl)methanol (1.8 g, 7.49 mmol) in MeOH (20 mL) was added Pd / C (180 mg, 10%). The reaction mixture was stirred at room temperature under 1 atm of H for 2 hours. The catalyst was filtered off. The solution was concentrated in vacuo to give the desired product (1.3 g, 82.5%) as a brown oil. LC / MS: 211.1 [M+H] + . Step 3: Preparation of (1-(2-fluoro-4-iodophenyl)pyrrolidin-3-yl)methanol

[0252] To a solution of (1-(4-amino-2-fluorophenyl)pyrrolidin-3-yl)methanol (1.3 g, 6.1 mmol) in CHCN (30 mL) was added 1.9 mL of concentrated HCl (1.9 mL) and NaNO (630 mg, 9.13 mmol, dissolved in 8 mL of HO) at 0 °C. The mixture was stirred at 0 °C for 2 h, and then KI (3.16 g, 19.03 mmol) was added. The reaction mixture was stirred at room temperature for 17 h. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL × 3). The organic phase was washed with brine and dried over NaSO. The solvent was removed in vacuo. The residue was purified by flash column chromatography with PE:EA = 3:1 to give the desired product (1.5 g, 75.5%) as a yellow solid. LC / MS: 321.9 [M+H] + . Step 4: Preparation of 1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carbaldehyde

[0253] To a solution of oxalyl chloride (1.19 g, 9.34 mmol) in DCM (20 mL) was added DMSO (1.46 g, 18.68 mmol) at −78° C. The reaction mixture was stirred at −78° C. for 15 min, and then (1-(2-fluoro-4-iodophenyl)pyrrolidin-3-yl)methanol (1.5 g, 4.67 mmol) was added. The reaction mixture was stirred at −78° C. for another 15 min. TEA (1.9 g, 18.68 mmol) was added at −78° C. The final mixture was stirred at −78° C. for 30 min. The reaction mixture was allowed to warm to room temperature and stirred for 1 h. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL×3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo. The residue was purified by flash column chromatography with PE:EA=1:1 to give the desired product (1.2 g, 80.5%) as a yellow solid. LC / MS: 319.8 [M+H] + . Step 5: Preparation of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine

[0254] To a solution of 1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carbaldehyde (1.2 g, 3.76 mmol) in MeOH (20 mL) was added trimethoxymethane (600 mg, 5.46 mmol) and PTSA (97 mg, 1.36 mmol). The reaction was stirred at 60 °C for 12 h. The solvent was removed in vacuo. The residue was dissolved in EA (20 mL), washed with NaHCO3 solution, and dried over Na2SO4. The organic phase was concentrated and purified by flash column chromatography with PE:EA = 1:1 to give the desired product (720 mg, 41.9%) as a yellow solid. LC / MS: 365.8 [M+H] + . Step 6: Preparation of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0255] To a solution of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine (200 mg, 0.55 mmol) in 1,4-dioxane (5 mL) was added N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (429 mg, 1.09 mmol), CsCO (535 mg, 1.64 mmol), trans-N,N'-dimethylcyclohexane-1,2-diamine (156 mg, 1.09 mmol), and CuI (104 mg, 0.55 mmol). The reaction mixture was stirred under Ar at 100°C for 17 hours. The solid was filtered off, and the solution was concentrated in vacuo. The residue was purified by preparative TLC with DCM:MeOH=10:1 to give the desired product (100 mg, 60% purity, 17.3% yield) as a white solid. LC / MS: 629.9 [M+H] + . Step 7: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0256] To a solution of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (80 mg, 60% purity, 0.076 mmol) in THF (2 mL) was added H2SO4 (4 mL, 3 M in water). The reaction was stirred at 70 °C for 2 h. The reaction mixture was cooled to 0 °C, neutralized with NaHCO3 solution, and extracted with EA (10 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated in vacuo to give the desired product (40 mg, crude) as a yellow solid. LC / MS: 584.2 [M+H] + . Step 8: Preparation of N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0257] To a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dionebenzenesulfonic acid (11.26 mg, 0.034 mmol) in DMF (1 mL) and MeOH (1 mL) was added TEA (0.2 mL). The mixture was stirred at room temperature for 30 minutes. Next, N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (40 mg, crude), HOAc (0.5 mL), and NaBHCN (21.55 mg, 0.343 mmol) were added. The reaction mixture was stirred at room temperature for 1 hour. The reaction was quenched by adding HO (10 mL) and extracted with EA (5 mL x 3). The combined organic phase was washed with brine and dried over NaSO. The solution was concentrated in vacuo, and the residue was purified by preparative TLC with DCM:MeOH = 10:1 to give the desired product (6.9 mg, 10.1% for two steps) as a white solid. LC / MS: 896.5 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.90 (t, J = 6 Hz, 1H), 8.35 (s, 1H), 7.93 (d, J = 15.3 Hz, 1H), 7.83 (d, J = 8.8 Hz, 1H), 7.73 (d, J = 8.1 Hz, 2H), 7.56 - 7.50 (m, 3H), 7.38 - 7.31 (m, 1H), 7.23 - 7.16 (m, 1H), 7.12 - 7.04 (m, 2H), 6.88 (t, J = 9.5 Hz, 1H), 5.05 (dd, J = 13.3, 5.0 Hz, 1H), 4.60 (d, J = 6.0 Hz, 2H), 4.36 - 4.17 (m, 2H), 3.91 (s, 2H), 3.57 - 3.49 (m, 1H), 3.48 - 3.40 (m, 2H), 3.31 (s, 3H), 3.22 - 3.15 (m, 1H), 2.93 - 2.83 (m, 1H), 2.66 - 2.53 (m, 4H), 2.45 - 2.30 (m, 3H), 2.13 - 1.90 (m, 3H), 1.73 - 1.66 (m, 1H), 1.50 - 1.40 (m, 1H), 1.27 - 1.17 (m, 5H). Example 64 Preparation of N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 66) [ka] Step 1: Preparation of (1-(5-iodopyridin-2-yl)pyrrolidin-3-yl)methanol

[0258] To a solution of 2-fluoro-5-iodopyridine (2 g, 9 mmol) in DMF (20 mL) was added pyrrolidin-3-ylmethanol (1.09 g, 10.8 mmol) and potassium carbonate (3.73 g, 2.7 mmol). The reaction mixture was stirred at 100° C. for 2 hours. The reaction was quenched by adding water (50 mL) and extracted with EA (50 mL×3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by flash column chromatography with PE:EA=5:1 to give the desired product (2 g, 73.0%) as a yellow solid. LC / MS: 304.9 [M+H] + . Step 2: Preparation of 1-(5-iodopyridin-2-yl)pyrrolidine-3-carbaldehyde

[0259] To a solution of [1-(5-iodopyridin-2-yl)pyrrolidin-3-yl]methanol (2 g, 6.6 mmol) in DCM (30 mL) stirred at 0° C. under nitrogen, Dess-Martin periodinane (4.2 g, 9.9 mmol) was added in small portions. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (10 mL). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo to give the title compound (1.5 g, 75.7% yield) as a yellow solid. LC / MS: 302.9 [M+H] + . Step 3: Preparation of 2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine

[0260] To a solution of 1-(5-iodopyridin-2-yl)pyrrolidine-3-carbaldehyde (1.5 g, 5.0 mmol) in trimethoxymethane (20 mL) stirred under nitrogen at 25° C., TsOH (90 mg, 0.5 mmol) was added. The reaction was stirred at 100° C. for 2 hours. The reaction mixture was concentrated in vacuo, and the residue was purified by flash column chromatography with PE:EA=5:1 to give the desired product (500 mg, 28.0%) as a yellow solid. LC / MS: 348.9 [M+H] +. Step 4: Preparation of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0261] A solution of 2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine (120 mg, 0.34 mmol) in DMF (20 mL) was treated with N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (135 mg, 0.34 mmol), CsCO (336.8 mg, 1.03 mmol), copper(I) iodide (65.3 mg, 0.34 mmol), and N 1 ,N 1 -dimethylcyclohexane-1,2-diamine (49.02 mg, 0.34 mmol) was added. The reaction was stirred at 110 °C for 10 h. The solid was filtered off and washed with DCM (10 mL x 3). The solution was concentrated in vacuo, and the residue was purified by flash column chromatography with DCM:MeOH = 1:0 to 10:1 to give the desired product (20 mg, 9.4%). LC / MS: 613.0 [M+H] + . Step 5: Preparation of N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0262] A solution of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (15 mg, 0.025 mmol) in HSO / HO / THF (1 mL, 1 / 3 / 2) was stirred under nitrogen at 70° C. for 1 h. The mixture was diluted with EA (50 mL) and neutralized with NaOH (2 N). The organic phase was dried over NaSO. The solvent was removed in vacuo to give the title compound (12 mg, 86.5%) as a yellow solid. LC / MS: 567.0 [M+H] + . Step 6: Preparation of N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0263] To a solution of N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (12 mg, 0.02 mmol) in MeOH / DMF / HOAc (2 mL, 2:1:0.02) was added 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindole-1,3-dione (7 mg, 0.02 mmol), TEA (21.5 mg, 0.21 mmol), and NaBHCN (6.6 mg, 0.106 mmol). The reaction was stirred at 60° C. for 1 hour. The reaction mixture was cooled to room temperature and then quenched by adding water (5 mL) and extracted with DCM (5 mL×3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by silica gel column chromatography (DCM:MeOH = 100:1 to 10:1) to give the desired compound (10 mg, 53.7%). LC / MS: 878.9 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.90 (m, 1H), 8.67 (d, J = 2.7 Hz, 1H), 8.31 (s, 2H), 8.07 (dd, J = 9.0, 2.7 Hz, 1H), 7.72 (d, J = 8.2 Hz, 2H), 7.58 - 7.50 (m, 3H), 7.38 - 7.30 (m, 1H), 7.21 - 7.18 (m, 1H), 7.10 - 7.05 (m, 2H), 6.62 (d, J = 9.1 Hz, 1H), 5.09 - 5.03 (m, 1H), 4.60 (d, J = 6.1 Hz, 2H), 4.33 (d, J = 17.0 Hz, 1H), 4.21 (d, J = 16.9 Hz, 1H), 3.91 (s, 3H), 3.74 - 3.61 (m, 2H), 3.59 - 3.53 (m, 2H), 3.32 - 3.25 (m, 6H), 3.22 - 3.14 (m, 2H), 2.92 - 2.85 (m, 1H), 2.62 - 2.55 (m, 4H), 2.43 - 2.31 (m, 3H), 2.13 - 2.10 (m, 1H), 2.01 - 1.91 (m, 1H), 1.80 - 1.72 (m, 1H). Example 65 Preparation of 1-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 71) [ka] Step 1: Preparation of tert-butyl 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoate

[0264] To a solution of tert-butyl 6-bromohexanoate (200 mg, 0.8 mmol) in DMF (10 mL) was added 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (392 mg, 0.88 mmol) and K2CO3 (336 mg, 2.4 mmol). The reaction was stirred at 90 °C for 17 h. The solvent was evaporated in vacuo and the residue was purified by flash column chromatography with PE:EA = 1:2 to give the desired product (100 mg, 23%). LC / MS: 502.8 [M+H] + . Step 2: Preparation of 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoic acid

[0265] To a solution of tert-butyl 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoate (100 mg, 0.2 mmol) in DCM (3 mL) was added TFA (1 mL). The mixture was stirred at room temperature for 2 hours. The solvent was removed in vacuo to give the product (80 mg, crude). LC / MS: 446.7 [M+H] + . Step 3: Preparation of 1-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0266] To a solution of 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoic acid (80 mg, crude) in DCM (5 mL) was added HATU (102 mg, 0.27 mmol) and TEA (54 mg, 0.54 mmol). The mixture was stirred at room temperature for 5 minutes, and then (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (80 mg, 0.18 mmol) was added. The mixture was stirred at room temperature for 2 hours. The mixture was extracted with brine and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with DCM:MeOH=10:1 to give the desired product (19.5 mg, 11% for two steps). LC / MS: 876.1 [M+H] + . 1H NMR (400 MHz, CDCl3) δ 9.12 (d, J = 7.4 Hz, 1H), 8.37 (s, 1H), 7.46 - 7.37 (m, 5H), 7.33 (s, 1H), 7.23 (t, J = 7.4 Hz, 1H), 7.12 - 7.06 (m, 3H), 7.02 - 6.93 (m, 2H), 4.40 - 4.48 (m, 1H), 4.31 - 4.38 (m, 1H), 3.89 (s, 3H), 3.77 - 3.87 (m, 2H), 3.71 (s, 4H), 3.34 (t, J = 10.7 Hz, 1H), 3.20 - 3.12 (m, 1H), 2.87 - 2.81 (m, 2H), 2.70 - 2.52 (m, 5H), 2.36 (t, J = 7.5 Hz, 2H), 2.11 - 2.21 (m, 2H), 1.53 - 1.75 (m, 8H), 1.40 - 1.25 (m, 2H). Example 66 Preparation of 1-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 72) [ka] Step 1: Preparation of tert-butyl 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)pentanoate

[0267] A solution of tert-butyl 5-bromopentanoate (380 mg, 1.60 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (1.07 g, 3.20 mmol), K2CO3 (1.11 g, 8.00 mmol), and KI (266 mg, 1.60 mmol) in DMF (20 mL) was stirred at room temperature for 3 hours. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (50 mL × 3). The combined organic layers were dried over Na2SO4, filtered, and evaporated to give the crude compound. The crude product was purified by column chromatography (DCM:MeOH = 10:1) to give the desired product as a pale yellow solid (130 mg, 17%). LC / MS: 488.7 [M+H]+. Step 2: Preparation of 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)pentanoic acid

[0268] A solution of tert-butyl 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)pentanoate (130 mg, 0.27 mmol) in DCM (12 mL) and TFA (9 mL) was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo to give the desired compound as a yellow oil (115 mg, 98%). LC / MS: 432.8 [M+H]+ Step 3: Preparation of 1-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0269] A solution of 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)pentanoic acid (115 mg, 0.27 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (133 mg, 0.30 mmol), HATU (154 mg, 0.41 mmol), and N,N-diisopropylethylamine (174 mg, 1.35 mmol) in MeOH / DMF (2:1, 15 mL) was stirred at room temperature for 2 hours. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (40 mg, yield: 17%). LC / MS: 862.1 [M+H]+. 1H NMR (301 MHz, DMSO) δ 12.74 (s, 1H), 10.33 (s, 1H), 8.80 (s, 1H), 8.24 (d, J = 3.6 Hz, 1H), 7.70 - 7.56 (m, 2H), 7.45 (d, J = 7.7 Hz, 2H), 7.38 - 7.29 (m, 2H), 7.28 - 7.23 (m, 1H), 7.19 - 7.11 (m, 4H), 7.02 - 6.95 (m, 1H), 4.31 - 4.14 (m, 3H), 3.90 - 3.75 (m, 4H), 3.58 - 3.46 (m, 6H), 2.70 - 2. 45 (m, 2H), 2.48 - 2.19 (m, 8H), 2.10 - 1.90 (m, 3H), 1.58 - 1.38 (m, 6H). Example 67 Preparation of 1-(5-(4-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 73) [ka] Step 1: Preparation of benzyl 4-(2-(tert-butoxy)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carboxylate

[0270] To a solution of tert-butyl 2-(piperidin-4-yl)acetate (500 mg, 2.51 mmol), benzyl 4-oxopiperidine-1-carboxylate (584.8 mg, 2.51 mmol), and TEA (507 mg, 5.02 mmol) in DCM (15 mL) was added MgSO (3 g, 25.1 mmol). The reaction mixture was stirred at room temperature for 1 hour. NaBH(AcO) (1.3 g, 6.27 mmol) was added in portions over 3 hours. The reaction mixture was stirred at room temperature overnight. The solid was filtered off and washed with DCM (20 mL × 2). The solution was concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with MeOH:DCM = 1:10 to give the title compound as a white solid (850 mg, 80% purity, 65.1% yield). LC / MS: 417.2 [M+H] + . Step 2: Preparation of tert-butyl 2-([1,4'-bipiperidin]-4-yl)acetate

[0271] To a solution of benzyl 4-(2-(tert-butoxy)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carboxylate (850 mg, 80% purity, 1.63 mmol) in dry t-BuOH (20 mL) was added Pd / C (100 mg). The mixture was stirred under H2 at 20 °C overnight. The catalyst was filtered off. The solution was concentrated in vacuo to give the title product (320 mg, 90% purity, 62% yield) as a white solid. LC / MS: 227.1 [M-55] + . Step 3: Preparation of tert-butyl 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetate

[0272] A solution of tert-butyl 2-([1,4'-bipiperidin]-4-yl)acetate (320 mg, 90% purity, 1.02 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (269 mg, 1.02 mmol), HATU (463.6 mg, 1.22 mmol), and N,N-diisopropylethylamine (197.4 mg, 1.53 mmol) in DMF (15 mL) was stirred at room temperature for 4 hours. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (30 mg, 5.5%) as a white solid. LC / MS: 529.2 [M+H] + . Step 4: Preparation of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetic acid

[0273] A solution of tert-butyl 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetate (30 mg, 0.056 mmol) in DCM (5 mL) and TFA (2 mL) was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo to give the title compound (30 mg, 89.3% purity, 100% yield). LC / MS: 473.1 [M+H] + . Step 5: Preparation of 1-(5-(4-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0274] A solution of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetic acid (30 mg, 0.056 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (27.1 mg, 0.056 mmol), HATU (25.5 mg, 0.067 mmol), and N,N-diisopropylethylamine (11 mg, 0.084 mmol) in DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (15 mg, 29.4%) as a white solid. LC / MS: 901.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.89 (br, 1H), 10.35 (s, 1H), 9.36 (br, 1H), 9.00 - 8.92 (m, 1H), 8.29 (s, 1H), 7.68 (s, 1H), 7.58 (d, J = 8.5 Hz, 1H), 7.49 (t, J = 7.6 Hz, 2H), 7.42 (d, J = 8.4 Hz, 1H), 7.36 (s, 1H), 7.26 (t, J = 7.3 Hz, 1H), 7.19 (d, J = 8.1 Hz, 3H), 7.03 (d, J = 8.3Hz, 1H), 4.39 - 4.30 (m, 2H), 4.26 - 4.12 (m, 2H), 3.86 (s, 3H), 3.64 - 3.57 (m, 2H), 3.44 (d, J = 8.7 Hz, 2H), 3.33 - 3.25 (m, 1H), 3.07 - 2.98 (m, 3H), 2.73 - 2.65 (m, 2H), 2.40 - 2.31 (m, 2H), 2.16 - 1.83 (m, 8H), 1.72 - 1.31 (m, 8H), 1.27 - 1.20 (m, 1H). Example 68 Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 74) [ka] Step 1: Preparation of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde

[0275] To a solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (200 mg, 0.33 mmol) in THF (5 mL) was added sulfuric acid (2 M, 5 mL, 10 mmol). The mixture was stirred at 70 °C for 30 min. NaOH (1 M) was added to adjust the pH to 9, and then extracted with ethyl acetate (20 mL × 3). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated in vacuo to give the crude product (152 mg, 81%). LC / MS: 569.6 [M+H] + . Step 2: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0276] To a solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde (90 mg, 0.16 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride (53.1 mg, 0.16 mmol), and TEA (48.5 mg, 0.48 mmol) in DCM (15 mL) was added MgSO (192 mg, 1.6 mmol). The reaction mixture was stirred at room temperature for 1 h. NaBH(AcO) (101.7 mg, 0.48 mmol) was added portionwise over 3 h. The reaction mixture was stirred at room temperature for 5 h. The reaction mixture was concentrated under vacuum to give the crude product. The crude product was purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (40 mg, 98% purity, 25% yield). LC / MS: 885.4 [M+H] + . 1 H NMR (301 MHz, DMSO) δ 13.04 (s, 1H), 11.12 (s, 1H), 10.35 (s, 1H), 8.44 (s, 1H), 8.02 (d, J = 17.1 Hz, 1H), 7.83 (s, 1H), 7.63 (d, J = 8.5 Hz, 1H), 7.53 - 7.43 (m, 2H), 7.40 - 7.12 (m, 7H), 7.10 - 6.99 (m, 2H), 3.83 (s, 3H), 3.60 - 3.35 (m, 6H), 3.29 - 3.20 (m, 2H), 2.70 - 2.55 (m, 5H), 2.40 - 2.32 (m, 3H), 2.21 (d, J = 6.4 Hz, 2H), 1.80 (d, J = 12.3 Hz, 2H), 1.70 - 1.62 (m, 1H), 1.40 - 1.27 (m, 3H). Example 69 Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 75) [ka] Step 1: Preparation of tert-butyl 4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazepane-1-carboxylate

[0277] To a solution of 3-(2,4-dioxo-1,3-diazinan-1-yl)-4-methoxybenzoic acid (500 mg, 1.89 mmol) in DMF (5 mL) was added HATU (862 mg, 2.268 mmol), DIEA (489 mg, 3.78 mmol), and tert-butyl (1,4-diazepan-1-yl)formate (380 mg, 1.89 mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (45 mL) and extracted with EtOAc (50 mL x 2). The combined organic layers were washed with brine, dried over NaSO, and concentrated in vacuo to give the crude product. The crude product was purified by flash chromatography (MeOH / DCM = 1:10) to give the desired product (1 g, 94.7%). LC / MS: 391.2 [M-55] + . Step 2: Preparation of 1-(5-(1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0278] A solution of tert-butyl (4-{[3-(2,4-dioxo-1,3-diazinan-1-yl)-4-methoxyphenyl]carbonyl}-1,4-diazepan-1-yl)formate (1 g) in TFA / DCM (1:5, 12 mL) was stirred at room temperature for 2 hours. The solution was concentrated in vacuo. The residue was dissolved in DCM (50 mL) and washed with saturated sodium bicarbonate solution and brine. The organic layer was dried over Na2SO4 and concentrated in vacuo to give the desired product (500 mg, 83.0%). LC / MS: 347.1 [M+H] + . Step 3: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0279] To a solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carbaldehyde (80 mg, 0.14 mmol) in DCM (5 mL) was added 1-(5-(1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (97 mg, 0.28 mmol), EtN (28 mg, 0.28 mmol), and MgSO (200 mg, 1.66 mmol) at room temperature. The mixture was stirred at room temperature for 30 minutes, and then NaBH(OAc) (59 mg, 0.28 mmol) was added in small portions. The reaction mixture was stirred at room temperature for 1 hour. The mixture was filtered, and the filtrate was concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC (MeOH / DCM=1:10) to give the desired product (80 mg, 63.5%). LC / MS: 900.1 [M+H] + . 1H NMR (400 MHz, DMSO) δ 13.06 (br, 1H), 11.14 (s, 1H), 10.36 (s, 1H), 8.46 (s, 1H), 8.04 (d, J= 14.8 Hz, 1H), 7.84 (s, 1H), 7.64 (d, J= 8.4 Hz, 1H), 7.49 (t, J= 7.6 Hz, 2H), 7.39 - 7.30 (m, 3H), 7.29 - 7.14 (m, 6H), 7.13 - 7.00 (m, 2H), 3.85 (s, 3H), 3.65 - 3.55 (m, 4H), 3.45 - 3.35 (m, 2H), 3.29 - 3.25 (m, 2H), 2.78 - 2.55 (m, 8H), 2.49 - 2.20 (m, 2H), 1.85 - 1.75 (m, 4H), 1.30 - 1.25 (m, 2H). Example 70 Preparation of 1-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 76) [ka]

[0280] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (140 mg, 0.24 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (80 mg, 0.24 mmol), TEA (121 mg, 1.2 mmol), and MgSO (408 mg, 3.4 mmol) in DCM (20 mL) was stirred under nitrogen at room temperature for 30 minutes. Sodium triacetoxyborohydride (163 mg, 0.72 mmol) was added in small portions at 0° C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered. The organic layer was washed with water and concentrated in vacuo to give the crude product, which was purified by preparative TLC (MeOH:DCM=1:10) to give the desired product (55 mg, 25%) as a yellow solid. LC / MS: 900.0 [M+1] + . 1 H NMR (400 MHz, DMSO) δ 13.06 (br, 1H), 11.14 (s, 1H), 10.36 (s, 1H), 10.05 (br, 1H), 8.46 (s, 1H), 8.04 (d, J = 14.8 Hz, 1H), 7.84 (s, 1H), 7.64 (d, J = 8.3 Hz, 1H), 7.49 (t, J = 7.7 Hz, 2H), 7.45 - 7.37 (m, 1H), 7.33 (d, J = 8.1 Hz, 1H), 7.30 - 7.24 (m, 1H), 7.23 - 7.11 (m, 3H), 7.09 - 7.04 (m, 1H), 3.86 (s, 2H), 3.67 - 3.56 (m, 2H), 3.52 - 3.39 (m, 2H), 3.38 - 3.24 (m, 4H), 3.22 - 2.96 (m, 2H), 2.91 - 2.56 (m, 4H), 2.45 - 1.88 (m, 5H), 1.85 - 1.45 (m, 4H), 1.42 - 0.87 (m, 5H). Example 71 Preparation of (R)-1-(5-(4-(2-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 77) [ka] Step 1: Preparation of (R)-1-(5-(4-(2-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0281] A solution of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetic acid (70 mg, 0.15 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (84 mg, 0.15 mmol), HATU (86 mg, 0.23 mmol), and N,N-diisopropylethylamine (116 mg, 0.9 mmol) in DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated in vacuo and purified by preparative TLC with MeOH:DCM=1:10 to give the title compound (14 mg, 10%) as a white solid. LC / MS: 902.4 [M+H] + . 1H NMR (301 MHz, DMSO) δ 12.86 (br, 1H), 10.37 (s, 1H), 8.87 (br, 1H), 8.32 - 8.24 (m, 1H), 7.67 - 7.62 (m, 1H), 7.60 - 7.52 (m, 1H), 7.51 - 7.43 (m, 2H), 7.42 - 7.34 (m, 2H), 7.29 - 7.12 (m, 5H), 7.05 - 6.98 (m, 1H), 4.32 - 4.21 (m, 1H), 4.20 - 4.13 (m, 1H), 3.84 (s, 3H), 3.63 - 3.53 (m, 3H), 3.33 - 3.24 (m, 2H), 3.21 - 3.13 (m, 1H), 3.07 - 3.01 (m, 1H), 2.94 - 2.77 (m, 3H), 2.67 (t, J = 6.4 Hz, 2H), 2.35 - 2.23 (m, 2H), 2.10 - 1.70 (m, 10H), 1.67 - 1.46 (m, 6H), 1.19 - 1.15 (m, 1H). Example 72 Preparation of 1-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 78) [ka] Step 1: Preparation of 7-bromoheptanoyl chloride

[0282] A solution of 7-bromoheptanoic acid (1 g, 4.8 mmol) in thionyl chloride (20 mL) was stirred at 70° C. for 5 hours. The reaction mixture was evaporated in vacuo to give the desired product as a brown oil (1 g, 91%). LC / MS: 223.0 [M+H] + (Treatment with MeOH). Step 2: Preparation of 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one

[0283] To a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (106 mg, 0.22 mmol) and N,N-diisopropylethylamine (142.16 mg, 1.1 mmol) in ACN (10 mL) stirred under nitrogen at room temperature, 7-bromoheptanoyl chloride (50 mg, 0.22 mmol) was added. The mixture was stirred at room temperature for 5 hours. The solvent was removed in vacuo. The residue was partitioned between EtOAc and HO. The organic phase was dried over sodium sulfate and concentrated in vacuo to give the crude product. The crude product was purified by silica gel chromatography with CHCl / MeOH (100:1 to 10:1) to give the desired compound (60 mg, 41%) as a yellow solid. LC / MS: 637.9 [M+H] + . Step 3: Preparation of 1-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0284] To a solution of 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptan-1-one (60 mg, 0.09 mmol), 1-{2-methoxy-5-[(piperazin-1-yl)carbonyl]phenyl}-1,3-diazinane (31.20 mg, 0.09 mmol), and N,N-diisopropylethylamine (36.33 mg, 0.28 mmol) in ACN (10 mL) stirred under nitrogen at room temperature was added potassium iodide (3.1 mg, 0.02 mmol). The reaction mixture was stirred at 70° C. for 5 hours. The solvent was removed, and the residue was purified by column chromatography (DCM / MeOH=50:1 to 10:1) to give the product (21.3 mg, 0.024 mmol, 26%) as a yellow solid. LC / MS: 890.3 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.77 (s, 1H), 10.36 (s, 1H), 8.82 (d, J = 7.4 Hz, 1H), 8.26 (s, 1H), 7.64 (s, 1H), 7.60 - 7.55 (m, 1H), 7.51 - 7.44 (m, 2H), 7.43 - 7.31 (m, 2H), 7.26 (t, J = 7.4 Hz, 1H), 7.23 - 7.11 (m, 4H), 7.05 - 7.00 (m, 1H), 4.38 - 4.33 (m, 1H), 4.19 - 4.12 (m, 1H), 3.93 - 3.80 (m, 4H), 3.60 (t, J = 6.6 Hz, 2H), 3.56 - 3.40 (m, 3H), 3.22 - 2.93 (m, 4H), 2.74 - 2.66 (m, 2H), 2.46 - 2.19 (m, 5H), 2.19 - 1.99 (m, 2H), 1.73 - 1.64 (m, 1H), 1.58 - 1.44 (m, 4H), 1.43 - 1.24 (m, 7H). Example 73 Preparation of 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 79) [ka] Step 1: Preparation of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazepan-1-yl)methyl)benzoate

[0285] To a solution of 1-(5-(1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (80 mg, 0.23 mmol) in DMF (5 mL) was added tert-butyl 4-(bromomethyl)benzoate (69 mg, 0.25 mmol) and K2CO3 (64 mg, 0.46 mmol). The reaction was stirred at 75 °C for 17 h. The solvent was removed in vacuo and the residue was purified by preparative TLC with PE:EA=1:1 to give the desired product (72 mg, 58%). LC / MS: 537.2 [M+H] + . Step 2: Preparation of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazepan-1-yl)methyl)benzoic acid

[0286] To a solution of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazepan-1-yl)methyl)benzoate (72 mg, 0.13 mmol) in DCM (3 mL) was added TFA (1 mL). The reaction was stirred at room temperature for 2 hours. The solvent was removed in vacuo to give the product (80 mg), which was used in the next step without further purification. LC / MS: 481.0 [M+H] + . Step 3: Preparation of 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0287] To a solution of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazepan-1-yl)methyl)benzoic acid (80 mg, crude) in DCM (5 mL) was added HATU (114 mg, 0.3 mmol) and DIEA (97 mg, 0.75 mmol). The mixture was stirred at room temperature for 5 minutes, and (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (73 mg, 0.15 mmol) was added. The mixture was stirred at room temperature for 2 hours. The mixture was washed with brine and concentrated in vacuo to give the crude product. The crude product was purified by preparative TLC with DCM:MeOH=10:1 to give the desired product (25 mg, 21% for two steps). LC / MS: 910.1 [M+H] + . 1H NMR (400 MHz, DMSO) δ 12.77 (s, 1H), 10.34 (s, 1H), 8.85 (d, J = 6.8 Hz, 1H), 8.25 (s, 1H), 7.64 (s, 1H), 7.58 (d, J = 8.4 Hz, 1H), 7.48 (t, J = 7.2 Hz, 2H), 7.44 - 7.31 (m, 6H), 7.26 (t, J = 7.6 Hz, 1H), 7.23 - 7.17 (m, 3H), 7.16 - 7.11 (m, 1H), 7.03 (d, J = 8.8 Hz, 1H), 4.42 - 4.20 (m, 2H), 3.83 (s, 3H), 3.68 - 3.53 (m, 6H), 3.46 (s, 2H), 3.27 - 3.13(m, 2H), 2.75 - 2.60 (m, 4H), 2.59 - 2.53 (m, 1H), 2.23 - 1.92 (m, 3H), 1.86 - 1.66 (m, 3H), 1.60 - 1.48 (m, 2H). Example 74 Preparation of 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (Compound 80) [ka] Step 1: Preparation of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoate

[0288] A mixture of tert-butyl 4-(bromomethyl)benzoate (150 mg, 0.55 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (548 mg, 1.7 mmol), and DIEA (213 mg, 1.8 mmol) in DCM (20 mL) was stirred at room temperature for 4 hours. The solvent was removed in vacuo to give the crude product. The crude product was purified by preparative TLC to give the product (160 mg, 50%) as a yellow solid. LC / MS: 522.8 [M+H] + . Step 2: Preparation of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoic acid

[0289] To a solution of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoate (160 mg) in DCM (20 mL) was added TFA (6 mL). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated in vacuo to give the crude compound (180 mg), which was used in the next step without further purification. LC / MS: 466.7 [M+H] + . Step 3: Preparation of 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0290] A solution of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoic acid (83 mg, purity: 70%, 0.12 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methanone (60 mg, 0.12 mmol), HATU (57 mg, 0.15 mmol) and DIEA (48 mg, 0.37 mmol) in DMF (10 mL) was stirred at room temperature for 3 hours. The solvent was removed in vacuo to give the crude product. The crude product was purified by preparative TLC to give the title product (24 mg, 22%) as a white solid. LC / MS: 895.5 [M+H] + . 1 H NMR (400 MHz, DMSO) δ 12.75 (s, 1H), 10.33 (s, 1H), 8.85 (d, J = 7.5 Hz, 1H), 8.26 (s, 1H), 7.63 (s, 1H), 7.58 (d, J = 8.4 Hz, 1H), 7.50 - 7.46 (m, 2H), 7.42 - 7.36 (m, 4H), 7.34 (s, 1H), 7.26 (t, J = 7.4 Hz, 1H), 7.22 - 7.10 (m, 4H), 7.05 - 7.00 (m, 1H), 4.36 - 4.31 (m, 2H), 3.84 (s, 3H), 3.65 - 3.45 (m, 8H), 3.32 (s, 3H), 3.29 - 3.17 (m, 2H), 2.67 (t, J = 6.5 Hz, 2H), 2.46 - 2.37 (m, 3H), 2.15 - 2.00 (m, 2H), 1.62 - 1.52 (m, 2H). Example 75 Preparation of (S)—N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 85) [ka] Step 1: Preparation of (1-(2-fluoro-4-nitrophenyl)azetidin-3-yl)methanol

[0291] A mixture of 1,2-difluoro-4-nitrobenzene (2.0 g, 12.6 mmol), azetidin-3-ylmethanol (1.3 g, 15.1 mmol), and DIEA (4.9 g, 37.8 mmol) in ACN (15 mL) was stirred at 80° C. for 3 h. The solvent was removed in vacuo, and the residue was purified by flash column chromatography with PE:EA=1:1 to give the desired product (2.5 g, 88.1%). LC / MS: 227.0 [M+H] + . Step 2: Preparation of (1-(4-amino-2-fluorophenyl)azetidin-3-yl)methanol

[0292] To a solution of (1-(2-fluoro-4-nitrophenyl)azetidin-3-yl)methanol (2.5 g, 11.1 mmol) in MeOH (30 mL) was added Pd / C (0.25 g, 10%). The mixture was stirred under 1 atm H2 at room temperature overnight. The catalyst was filtered off and the solution was concentrated in vacuo to give the product (2 g, 91.8%). LC / MS: 197.1 [M+H] + . Step 3: Preparation of (1-(2-fluoro-4-iodophenyl)azetidin-3-yl)methanol

[0293] To a solution of (1-(4-amino-2-fluorophenyl)azetidin-3-yl)methanol (2.0 g, 10.2 mmol) in ACN (40 mL) and concentrated HCl (3.5 mL) was added an aqueous solution of NaNO (0.91 g, 13.2 mmol) (4 mL) at 0 °C. The mixture was stirred at 0 °C for 2 h, and then an aqueous solution of KI (4.3 g, 25.5 mmol) (6 mL) was added dropwise. The mixture was stirred at room temperature overnight. The mixture was diluted with water (15 mL) and extracted with DCM (40 mL × 3). The combined organic layers were concentrated in vacuo, and the residue was purified by flash column chromatography with PE:EA = 2:1 to give the desired product (1.0 g, 31.3%). LC / MS: 308.0 [M+H] + . Step 4: Preparation of 1-(2-fluoro-4-iodophenyl)azetidine-3-carbaldehyde

[0294] To a solution of (1-(2-fluoro-4-iodophenyl)azetidin-3-yl)methanol (1.0 g, 3.3 mmol) in DCM (10 mL) stirred under nitrogen at 0° C., Dess-Martin periodinane (2.1 g, 4.9 mmol) was added in small portions. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (10 mL). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo to give the desired product (0.8 g, 78.7% yield). LC / MS: 306.0 [M+H] + . Step 5: Preparation of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)azetidine

[0295] To a solution of 1-(2-fluoro-4-iodophenyl)azetidine-3-carbaldehyde (800 mg, 2.6 mmol) in MeOH (10 mL) was added acetyl chloride (310 mg, 3.9 mmol) stirred under nitrogen at 0° C. The mixture was stirred at 25° C. for 2 hours. The reaction was quenched by adding TEA (1 mL). The solvent was removed in vacuo, and the residue was purified by flash column chromatography with PE:EA=5:1 to give the desired product (500 mg, 53.8%). LC / MS: 352.0 [M+H] + . Step 6: Preparation of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0296] To a solution of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)azetidine (400 mg, 1.14 mmol) in DMSO (10 mL) was added N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (536.3 mg, 1.37 mmol), KCO (472.3 mg, 3.41 mmol), copper(I) iodide (119.3 mg, 0.62 mmol), and N,N-dimethylglycine (129.2 mg, 1.25 mmol). The reaction was stirred at 110° C. for 16 hours. The solid was filtered off and washed with DCM (20 mL×3). The combined solution was concentrated in vacuo and the residue was purified by flash with DCM:MeOH=10:1 to give the desired product (200 mg, 80% purity, 22.8% yield). LC / MS: 616.2 [M+H] + . Step 7: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(3-formylazetidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0297] To a solution of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (200 mg, 80% purity, 0.26 mmol) was added THF:HO:HSO (6 mL, 2:3:1). The mixture was stirred at room temperature overnight. The solvent was removed in vacuo and the residue was diluted with DCM (20 mL). The organic phase was washed with saturated NaHCO solution, brine and dried over NaSO. The solvent was removed in vacuo. The residue was purified by silica gel chromatography using PE / EA=1:1 to give the desired product (100 mg, 67.5%). LC / MS: 570.1 [M+H] + . Step 8: Preparation of (S)—N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0298] To a solution of N-(4-(4-amino-1-(3-fluoro-4-(3-formylazetidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (100 mg, 0.17 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (63.4 mg, 0.19 mmol), and TEA (88 mg, 0.87 mmol) in MeOH / DMF (6 mL, 2:1) was added AcOH (0.5 mL) and NaBHCN (44.1 mg, 0.70 mmol). The mixture was stirred at 60° C. for 1 hour. The reaction mixture was cooled to room temperature and quenched by adding water (5 mL). The mixture was extracted with DCM (15 mL x 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed and purified by preparative HPLC to give the desired compound (50 mg, 98.7% purity, 32.9% yield). LC / MS: 882.3 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.90 (t, J = 6.2 Hz, 1H), 8.35 (s, 1H), 7.93 - 7.89 (m, 1H), 7.85 - 7.83 (m, 1H), 7.73 (d, J = 8.1 Hz, 2H), 7.55 - 7.52 (m, 4H), 7.38 - 7.33 (m, 1H), 7.21 - 7.18 (m, 1H), 7.10 - 7.06 (m, 2H), 6.72 (t, J = 9.3 Hz, 1H), 5.08 - 5.03 (dd, 1H), 4.60 (d, J = 6.1 Hz, 2H), 4.34 (d, J = 17.2 Hz, 1H), 4.22 (d, J = 17.2 Hz, 1H), 4.12 - 4.10 (m, 2H), 3.91 (s, 3H), 3.69 - 3.63 (m, 2H), 3.32 - 3.27 (m, 3H), 3.04 - 2.85 (m, 3H), 2.68 - 2.55 (m, 6H), 2.39 - 2.33 (m, 2H), 1.96 - 1.91 (m, 1H). Example 76 Preparation of N-(4-(4-amino-1-(1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 92) [ka] Step 1: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0299] To a solution of N-({4-[4-amino-1-(pyrrolidin-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (200 mg, 0.43 mmol) in DMSO (5 mL) stirred at room temperature, 6-bromopyridine-3-carbaldehyde (121 mg, 0.65 mmol) and K2CO3 (120 mg, 0.86 mmol) were added. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was poured into water (100 mL) and then extracted with EA (100 mL × 2). The combined organic layers were washed with water, brine, dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by flash column chromatography (DCM / MeOH = 10:1) to give the desired product (150 mg, 61.1%). LC / MS: 566.9 [M+H] + . Step 2: Preparation of N-(4-(4-amino-1-(1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0300] To a solution of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (130 mg, 0.23 mmol) in MeOH / DMF / HOAc (12 mL, 2:1:0.05) stirred at room temperature, EtN (36 mg, 0.36 mmol) was added, and (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (86 mg, 0.18 mmol) and NaBHCN (45 mg, 0.72 mmol) were added. The reaction mixture was stirred at 60 °C for 1 h. The mixture was concentrated in vacuo, then poured into water (50 mL) and extracted with EA (100 mL x 2). The combined organic layers were washed with brine (200 mL), dried over Na2SO4, and concentrated in vacuo to give the crude product. The crude product was purified by preparative HPLC to give the desired product (18 mg, 8.9%). LC / MS: 879.0 [M+H] + . 1H NMR (400 MHz, DMSO) δ = 10.94 (s, 1H), 8.85 (t, J= 6.0 Hz, 1H), 8.28 (s, 1H), 8.18 (s, 1H), 7.99 (d, J= 2.0 Hz, 1H), 7.61 (d, J= 8.0 Hz, 2H), 7.53 - 7.45 (m, 5H), 7.36 - 7.31 (m, 1H), 7.18 (dd, J= 9.2, 4.4 Hz, 1H), 7.05 (s, 1H), 7.03 (s, 1H), 6.50 (d, J= 8.4 Hz, 2H), 5.62 - 5.57 (m, 1H), 5.04 (dd, J= 13.2, 5.2 Hz, 1H), 4.57 (d, J= 6.0 Hz, 2H), 4.32 (d, J= 16.8 Hz, 1H), 4.19 (d, J= 16.8 Hz, 1H), 4.01 - 3.91 (m, 2H), 3.89 (s, 3H), 3.86 - 3.72 (m, 3H), 3.65 - 3.55 (m, 2H), 3.38 (s, 2H), 3.32 - 3.25 (m, 4H), 2.94 - 2.84 (m, 2H), 2.62 - 2.58 (m, 1H), 2.56 - 2.52 (m, 3H), 1.98 - 1.92 (m, 1H). Example 77 Preparation of N-(4-(4-amino-1-(6-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 93) [ka] Compound 93 was prepared similarly to the procedure described for compound 66. LC / MS: 878.8 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.93 - 8.86 (m, 1H), 8.67 (s, 1H), 8.31 (s, 1H), 8.08 (d, J = 7.6 Hz, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.59 - 7.49 (m, 4H), 7.38 - 7.32 (m, 1H), 7.20 (dd, J = 9.1, 4.2 Hz, 1H), 7.14 - 7.04 (m, 2H), 6.62 (d, J = 9.0 Hz, 1H), 5.06 (dd, J = 13.0, 4.7 Hz, 1H), 4.60 (d, J = 5.9 Hz, 2H), 4.34 (d, J = 17.2 Hz, 1H), 4.21 (d, J = 16.7 Hz, 1H), 3.91 (s, 3H), 3.71 - 3.50 (m, 3H), 3.49 - 3.36 (m, 3H), 3.27 - 3.15 (m, 2H), 2.89 (d, J = 11.8 Hz, 1H), 2.70 - 2.53 (m, 6H), 2.48 - 2.41 (m, 4H), 2.17 - 2.10 (m, 1H), 1.99 - 1.94 (m, 1H), 1.80 - 1.72 (m, 1H). Example 78 Preparation of N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 94) [ka] Step 1: Preparation of 4-((5-fluoro-2-methoxybenzamido)methyl)benzoic acid

[0301] To a solution of methyl 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoate (7.1 g, 22.37 mmol) in THF / water (100 mL, 1:1) stirred at room temperature, LiOH—HO (4.7 g, 111.9 mmol) was added. The reaction mixture was stirred at room temperature for 12 hours. The mixture was concentrated in vacuo to 50 mL and then acidified with HCl (5 M) to pH=5-6. The solid was filtered, washed with water, and dried in vacuo to give the desired product (6 g, 88.42%). LC / MS: 304.0 [M+H] + . 1 H NMR (400 MHz, DMSO) δ = 8.89 (t, J= 6.0 Hz, 1H), 7.91 (d, J= 8.0 Hz, 2H), 7.50 (dd, J= 9.2, 3.2 Hz, 1H), 7.43 (d, J= 8.0 Hz, 2H), 7.37 - 7.31 (m, 1H), 7.18 (dd, J= 9.2, 4.4 Hz, 1H), 4.56 (d, J= 6.0 Hz, 2H), 3.89 (s, 3H). Step 2: Preparation of 4-((5-fluoro-2-methoxybenzamido)methyl)benzoyl chloride

[0302] To a solution of 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoic acid (3.9 g, 12.86 mmol) in DCM (50 mL) stirred at room temperature was added oxalyl chloride (2.2 mL, 25.72 mmol). The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated in vacuo to give the title compound (4.0 g, crude) as a brown oil. Step 3: Preparation of N-(4-(2,2-dicyanoacetyl)benzyl)-5-fluoro-2-methoxybenzamide

[0303] To a solution of 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoyl chloride (4 g, crude) and propanedinitrile (960 mg, 14.54 mmol) in acetone (40 mL) stirred at 5° C., NaOH (4 mL, 39.26 mmol, 40%) was added slowly. The reaction mixture was stirred at room temperature for 2 h. The mixture was diluted with water (40 mL), and HCl (5 M) was added to adjust the pH to 2-3. The solid was filtered, washed with water, and dried in vacuo to give the desired product (3.8 g, 84.10% for two steps) as a white solid. LC / MS: 351.8 [M+H] + . 1 H NMR (400 MHz, DMSO) δ = 10.89 (s, 1H), 8.86 (t, J= 6.0 Hz, 1H), 7.57 (d, J= 8.0 Hz, 2H), 7.50 (dd, J= 9.2, 3.2 Hz, 1H), 7.37 - 7.30 (m, 3H), 7.17 (dd, J= 9.2, 4.4 Hz, 1H), 4.52 (d, J= 6.0 Hz, 2H), 3.88 (s, 3H). Step 4: Preparation of N-(4-(2,2-dicyano-1-methoxyvinyl)benzyl)-5-fluoro-2-methoxybenzamide

[0304] To a solution of N-{[4-(2,2-dicyanoacetyl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (3.14 g, 8.94 mmol) in dioxane (40 mL) stirred at room temperature, NaHCO (6.0 g, 71.52 mmol) and dimethyl sulfate (8.45 g, 67.05 mmol) were added. The reaction mixture was stirred at 100 °C for 2.5 hours. The mixture was poured into water (60 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over NaSO, and concentrated in vacuo to give the title compound (3.5 g, crude) as a brown oil. LC / MS: 366.0 [M+H] + . Step 5: Preparation of N-(4-(5-amino-4-cyano-1H-pyrazol-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0305] To a solution of N-{[4-(2,2-dicyano-1-methoxyeth-1-en-1-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (6.2 g, crude) in MeOH / water (20 mL, 2:1) stirred in a sealed tube at room temperature, hydrazine (1.4 g, 34.16 mmol, 80%) was added. The reaction mixture was stirred at 100° C. for 12 hours. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL×2). The combined organic layers were washed with brine (200 mL), dried over NaSO, and concentrated in vacuo. The residue was purified by flash chromatography (DCM:MeOH=10:1) to give the desired product (2.36 g, 36.1% for two steps). LC / MS: 366.0 [M+H] + . 1 H NMR (400 MHz, DMSO) δ = 12.12 (s, 1H), 8.84 (s, 1H), 7.74 (d, J= 7.6 Hz, 2H), 7.51 (dd, J= 9.2, 3.2 Hz, 1H), 7.42 - 7.38 (m, 2H), 7.36 - 7.30 (m, 1H), 7.18 (dd, J= 9.2, 4.4 Hz, 1H), 6.46 (s, 1H), 4.53 (d, J= 6.0 Hz, 2H), 3.89 (s, 3H). Step 6: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0306] N-{[4-(5-amino-4-cyano-1H-pyrazol-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (2.36 g, 6.46 mmol) in formamide (30 mL) was stirred at 160° C. for 2 hours. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL×2). The combined organic layers were washed with brine (200 mL), dried over NaSO, and concentrated in vacuo. The residue was purified by flash chromatography (DCM:MeOH=10:1) to give the desired product (2.1 g, 82.8%). LC / MS: 393.0 [M+H] + . Step 7: Preparation of (R)-(1-(5-iodopyridin-2-yl)pyrrolidin-3-yl)methanol

[0307] To a solution of 2-fluoro-5-iodopyridine (3 g, 13.45 mmol) in DMF (30 mL) stirred at room temperature, (3R)-pyrrolidin-3-ylmethanol (2.04 g, 20.18 mmol) and K2CO3 (5.6 g, 40.36 mmol) were added. The reaction mixture was stirred at 100 °C for 12 hours. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na2SO4, and concentrated in vacuo. The residue was purified by flash chromatography (PE: EtOAc = 3:1) to give the desired product (3.0 g, 73.3%). LC / MS: 304.8 [M+H] + . Step 8: Preparation of (R)-1-(5-iodopyridin-2-yl)pyrrolidine-3-carbaldehyde

[0308] To a solution of oxalyl chloride (2.42 g, 19.07 mmol) in DCM (30 mL) stirred at −78° C., DMSO (3 g, 38.14 mmol) was added slowly over 15 min at −78° C. Next, a solution of [(3R)-1-(5-iodopyridin-2-yl)pyrrolidin-3-yl]methanol (2.9 g, 9.54 mmol) in DCM (5 mL) was added slowly. After 15 min, EtN (3.86 g, 38.14 mmol) was added. The reaction mixture was stirred at −78° C. for 30 min, then warmed to room temperature and stirred for 1 h. The mixture was diluted with DCM (65 mL), washed with brine, dried over NaSO, and concentrated in vacuo to give the title compound (3.0 g, crude) as a brown solid. LC / MS: 302.7 [M+H] + . Step 9: Preparation of (R)-2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine

[0309] To a solution of (3R)-1-(5-iodopyridin-2-yl)pyrrolidine-3-carbaldehyde (3 g, crude) in MeOH (30 mL) stirred at 0° C., acetyl chloride (1.56 g, 19.86 mmol) was added. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was quenched with EtN (2 mL) and concentrated in vacuo. The residue was purified by flash chromatography (PE: EtOAc = 5:1) to give the desired product (2.6 g, 78.3%). LC / MS: 348.7 [M+H] + . 1 H NMR (400 MHz, CDCl3) δ = 8.28 (d, J= 2.4 Hz, 1H), 7.61 (dd, J= 8.8, 2.4 Hz, 1H), 6.21 (d, J= 8.8 Hz, 1H), 4.29 (d, J= 7.6 Hz, 1H), 3.59 - 3.51 (m, 2H), 3.42 - 3.34 (m, 7H), 3.25 (dd, J= 10.8, 7.6 Hz, 1H), 2.73 - 2.63 (m, 1H), 2.16 - 2.05 (m, 1H), 1.94 - 1.84 (m, 1H). Step 10: Preparation of (R)—N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0310] To a solution of (R)-2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine (300 mg, 0.86 mmol) in DMSO (10 mL) was added N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (337 mg, 0.86 mmol), NaCO (182 mg, 1.72 mmol), copper(I) iodide (82 mg, 0.43 mmol), and N,N-dimethylglycine (89 mg, 0.86 mmol) under nitrogen at 25° C. The reaction was stirred at 110° C. for 16 hours. The mixture was filtered and washed with DCM. The solution was concentrated in vacuo, and the residue was purified by flash column chromatography (DCM:MeOH=10:1) to give the desired product (460 mg, 87.2%) as a yellow solid. LC / MS: 612.7 [M+H] + . Step 11: Preparation of (R)—N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0311] To a solution of (R)—N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (460 mg, 0.75 mmol) in anhydrous THF (2.5 mL) was added HCl (4N, 2.5 ml in dioxane), and the reaction mixture was stirred at room temperature for 4 hours. The solvent was removed in vacuo, and the residue was dissolved with DCM. The organic phase was washed with NaHCO3, brine, dried over Na2SO4, and concentrated in vacuo to give the title compound (300 mg, crude) as a yellow solid. LC / MS: 566.8 [M+H] + . Step 12: Preparation of N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0312] To a solution of (R)—N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (300 mg, crude) in MeOH / DMF (12 mL, 2:1) stirred at room temperature was added (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (260 mg, 0.53 mmol) and EtN (107 mg, 1.06 mmol). The mixture was stirred at room temperature for 30 minutes, and then AcOH (1 mL) and NaBHCN (134 mg, 2.12 mmol) were added. The reaction mixture was stirred at 60° C. under nitrogen for 1 hour. The mixture was diluted with water and extracted with DCM. The organic phase was washed with brine, dried over Na2SO4 and concentrated in vacuo. The residue was purified by preparative HPLC to give the desired compound (30.5 mg, 6.9%). LC / MS: 878.8 [M+H] + . 1 H NMR (400 MHz, DMSO) δ = 10.98 (s, 1H), 8.92 (t, J= 6.0 Hz, 1H), 8.70 (d, J= 2.4 Hz, 1H), 8.37 (s, 1H), 8.18 (d, J= 8.8 Hz, 1H), 7.73 (d, J= 8.0 Hz, 2H), 7.61 (d, J= 8.4 Hz, 1H), 7.57 - 7.50 (m, 3H), 7.39 - 7.33 (m, 1H), 7.23 - 7.15 (m, 3H), 6.71 (d, J= 8.8 Hz, 1H), 5.07 (dd, J= 13.2, 4.8 Hz, 1H), 4.61 (d, J= 6.0 Hz, 2H), 4.37 (d, J=17.2, 1H), 4.25 (d, J=17.2, 1H), 4.10 - 4.02 (m, 2H), 3.91 (s, 3H), 3.41 - 3.37 (m, 2H), 3.27 - 3.22 (m, 4H), 2.95 - 2.85 (m, 2H), 2.77 (d, J= 5.2 Hz, 2H), 2.65 - 2.55 (m, 1H), 2.45 - 2.30 (m, 2H), 2.27 - 2.24 (m, 2H), 1.98 - 1.93 (m, 2H), 1.91 - 1.85 (m, 2H). Example 79 Preparation of N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 95) [ka] Step 1: Preparation of (S)-(1-(2-fluoro-4-nitrophenyl)pyrrolidin-3-yl)methanol

[0313] To a solution of 1,2-difluoro-4-nitrobenzene (2.0 g, 12.6 mmol) in CH3CN (30 mL) was added (3S)-pyrrolidin-3-ylmethanol hydrochloride (1.91 g, 13.8 mmol) and DIEA (4.89 g, 37.8 mmol). The reaction was stirred at 80 °C for 3 h and then quenched by adding water. The mixture was extracted with EA, washed with brine, and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by flash with PE:EA = 1:1 to give the desired product (2.8 g, 90% purity, 82.5% yield) as a yellow solid. LC / MS: 241.1 [M+H] + . Step 2: Preparation of (S)-(1-(4-amino-2-fluorophenyl)pyrrolidin-3-yl)methanol

[0314] To a solution of (S)-(1-(2-fluoro-4-nitrophenyl)pyrrolidin-3-yl)methanol (2.8 g, 90% purity, 10.5 mmol) in methanol (40 mL) was added Pd / C (0.28 g, 10%). The reaction was stirred under 1 atm H2 atmosphere at 25 °C for 16 h. The catalyst was filtered off and washed with MeOH. The solution was concentrated in vacuo to give the desired product (2.2 g, 99.6%) as a brown oil. LC / MS: 211.1 [M+H] + . Step 3: Preparation of (S)-(1-(2-fluoro-4-iodophenyl)pyrrolidin-3-yl)methanol

[0315] To a solution of (S)-(1-(4-amino-2-fluorophenyl)pyrrolidin-3-yl)methanol (2.1 g, 9.98 mmol) in CHCN (30 mL) was added concentrated HCl (2.5 mL) and NaNO (827 mg, 11.98 mmol, dissolved in 5 mL of HO) at 0 °C. The mixture was stirred at 0 °C for 2 h, and KI (4.14 g, 24.97 mmol) was added. The reaction mixture was stirred at room temperature for 17 h. The reaction was quenched by adding water (40 mL) and extracted with EA (40 mL × 3). The organic phase was washed with brine and dried over NaSO. The solvent was removed in vacuo. The residue was purified by flash elution with PE:EA = 3:1 to give the desired product (2 g, 62.3%) as a yellow solid. LC / MS: 321.8 [M+H] + . Step 4: Preparation of (S)-1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carbaldehyde

[0316] To a solution of (S)-(1-(2-fluoro-4-iodophenyl)pyrrolidin-3-yl)methanol (1.9 g, 5.9 mmol) in DCM (20 mL) was added Dess-Martin periodinane (3.75 g, 8.8 mmol). The reaction was stirred at 25 °C for 2 h. The reaction was quenched with saturated NaSO solution and then extracted with EA. The organic phase was washed with brine and dried over NaSO. The solvent was removed in vacuo and the residue was purified by flash with PE:EA = 1:1 to give the desired product (2 g, 80% purity, 84.9% yield) as a white solid. LC / MS: 319.8 [M+H] + . Step 5: Preparation of (S)-3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine

[0317] To a solution of (S)-1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carbaldehyde (2.0 g, 80% purity, 5.0 mmol) in MeOH (20 mL) was added acetyl chloride (1.04 g, 13.2 mmol) stirred at 0° C. under nitrogen. The reaction was stirred at 25° C. for 2 hours. The reaction was quenched with TEA and the solvent was removed in vacuo. The residue was purified by flash column chromatography with PE:EA=1:1 to give the desired product (1.0 g, 90% purity, 49.2% yield) as a white solid. LC / MS: 365.7 [M+H] + . Step 6: Preparation of (S)—N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0318] To a solution of (S)-3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine (220 mg, 90% purity, 0.54 mmol) in DMSO (10 mL) was added N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (257.89 mg, 0.65 mmol), NaCO (127.72 mg, 1.2 mmol), copper(I) iodide (57.37 mg, 0.3 mmol), and N,N-dimethylglycine (62.13 mg, 0.6 mmol) under nitrogen at 25 °C. The reaction was stirred at 110 °C for 16 hours. The mixture was filtered and washed with DCM. The solvent was removed in vacuo and the residue was purified by flash with DCM:MeOH=10:1 to give the desired product (170 mg, 90% purity, 44.1% yield) as a yellow solid. LC / MS: 629.8 [M+H] + . Step 7: Preparation of (S)—N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0319] To a solution of (S)—N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (170 mg, 90% purity, 0.24 mmol) in DCM (4 mL) stirred at 25° C. under nitrogen was added HCl (4N in dioxane, 4 mL). The reaction was stirred at 25° C. for 4 hours. The mixture was made basic with saturated NaHCO3 solution and extracted with DCM. The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated in vacuo to give the desired product (160 mg, crude) as a yellow solid. LC / MS: 583.8 [M+H] + . Step 8: Preparation of N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0320] To a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (150 mg, 0.3 mmol) in MeOH / DMF / AcOH (5 mL, 2:1:0.02) was added (S)—N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (150 mg, 0.25 mmol), TEA (52 mg, 0.51 mmol), and NaBHCN (48 mg, 0.77 mmol). The reaction was stirred at 60° C. for 1 hour. The reaction mixture was cooled to room temperature and then quenched with water. The mixture was extracted with DCM, washed with brine, dried over Na2SO4, and concentrated in vacuo. The residue was purified by preparative TLC with DCM:MeOH=10:1 to give the desired product (60 mg, 26.0%) as a white solid. LC / MS: 896.7 [M+H] + . 1H NMR (400 MHz, ) δ 10.92 (s, 1H), 8.86 (t, J = 6.1 Hz, 1H), 8.32 (s, 1H), 7.89 (dd, J = 15.2, 2.5 Hz, 1H), 7.79 (dd, J = 8.8, 2.0 Hz, 1H), 7.69 (d, J = 8.2 Hz, 2H), 7.52 - 7.47 (m, 4H), 7.34 - 7.28 (m, 1H), 7.16 (dd, J = 9.1, 4.3 Hz, 1H), 7.03 (d, J = 8.2 Hz, 2H), 6.84 (t, J = 9.5 Hz, 1H), 5.02 (dd, J = 13.3, 5.1 Hz, 1H), 4.57 (d, J = 6.1 Hz, 2H), 4.30 (d, J = 17.0 Hz, 1H), 4.17 (d, J = 17.0 Hz, 1H), 3.88 (s, 3H), 3.51 - 3.45 (m, 1H), 3.42 - 3.37 (m, 2H), 3.27 - 3.25 (m, 3H), 3.21 - 3.11 (m, 2H), 2.90 - 2.81 (m, 1H), 2.60 - 2.52 (m, 6H), 2.41 - 2.24 (m, 4H), 2.07 - 2.01 (m, 1H), 1.95 - 1.89 (m, 1H), 1.69 - 1.62 (m, 1H). (Example 80) Preparation of N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 96) [ka] Compound 96 was prepared similarly to the procedure described for compound 95. LC / MS: 896.6 [M+H] + . 1H NMR (400 MHz, DMSO) δ 10.98 (s, 1H), 9.61 (bs, 1H), 8.93 - 8.90 (m, 1H), 8.38 (s, 1H), 7.99 - 7.85 (m, 2H), 7.73 (d, J = 8.2 Hz, 2H), 7.63 - 7.50 (m, 4H), 7.39 - 7.33 (m, 1H), 7.20 (m, 3H), 6.94 - 6.89 (m, 1H), 5.07 (m, 1H), 4.61 (d, J = 6.1 Hz, 2H), 4.39 - 4.35 (m, 1H), 4.26 - 4.22 (m, 1H), 4.08 - 4.02 (m, 2H), 3.91 (s, 3H), 3.74 - 3.63 (m, 3H), 3.54 - 3.36 (m, 4H), 3.28 - 3.13 (m, 5H), 2.95 - 2.76 (m, 3H), 2.64 - 2.56 (m, 1H), 2.43 - 2.34 (m, 1H), 2.26 - 2.18 (m, 1H), 2.00 - 1.94 (m, 1H), 1.82 - 1.74 (m, 1H). Example 81 Preparation of (S)—N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 97) [ka] Step 1: Preparation of (1-(5-iodopyridin-2-yl)azetidin-3-yl)methanol

[0321] To a solution of 2-fluoro-5-iodopyridine (2.2 g, 9.86 mmol) in DMA (100 mL) stirred under argon at room temperature, azetidin-3-ylmethanol (1.2 g, 9.86 mmol) and potassium carbonate (4.1 g, 29.59 mmol) were added. The reaction mixture was stirred at 100° C. overnight. The reaction was quenched by adding water (50 mL) and extracted with DCM (50 mL×3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by flash column chromatography with PE:EA=5:1 to give the desired product (1.5 g, 52.4%) as a yellow solid. LC / MS: 290.8 [M+H] + . Step 2: Preparation of 1-(5-iodopyridin-2-yl)azetidine-3-carbaldehyde

[0322] To a solution of [1-(5-iodopyridin-2-yl)azetidin-3-yl]methanol (1.4 g, 4.82 mmol) in DCM (80 mL) stirred at room temperature, Dess-Martin periodinane (3 g, 7.24 mmol) was added. The reaction mixture was stirred at room temperature for 4 hours. The solvent was removed in vacuo, and the residue was purified by flash with PE:EA=5:1 to give the desired product (700 mg, 50.3%) as a yellow solid. LC / MS: 306.7 [M+HO] + . Step 3: Preparation of 2-(3-(dimethoxymethyl)azetidin-1-yl)-5-iodopyridine

[0323] To a solution of 1-(5-iodopyridin-2-yl)azetidine-3-carbaldehyde (700 mg, 2.42 mmol) in MeOH (10 mL) stirred under argon at 0° C., acetyl chloride (381 mg, 4.859 mmol) was added. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched with TEA (1 mL). The solvent was removed in vacuo, and the residue was purified by flash column chromatography with PE:EA=5:1 to give the desired product (400 mg, 49.2%). LC / MS: 334.8 [M+H]+ . Step 4: Preparation of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)azetidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0324] To a solution of 2-[3-(dimethoxymethyl)azetidin-1-yl]-5-iodopyridine (200 mg, 0.59 mmol) in DMSO (13 mL) was added N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (282 mg, 0.71 mmol), NaCO (139.5 mg, 1.31 mmol), copper(I) iodide (63 mg, 0.32 mmol), and N,N-dimethylglycine (67.89 mg, 0.65 mmol) under nitrogen at 25 °C. The reaction was stirred at 110 °C overnight. The reaction was quenched by adding water (50 mL) and extracted with DCM (50 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by flash column chromatography with DCM:MeOH=10:1 to give the desired product (200 mg, 55.8%) as a white solid. LC / MS: 599.2 [M+H] + . Step 5: Preparation of N-(4-(4-amino-1-(6-(3-formylazetidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0325] To a solution of N-{[4-(4-amino-1-{6-[3-(dimethoxymethyl)azetidin-1-yl]pyridin-3-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (100 mg, 0.16 mmol) in DCM (10 mL) stirred at room temperature was added HCl / dioxane (10 mL). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo to give the title compound (110 mg, crude) as a yellow solid. LC / MS: 553.2 [M+H] + . Step 6: Preparation of (S)—N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide

[0326] To a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (105.6 mg, 0.217 mmol) in MeOH (6 mL) / DMF (3 mL) stirred under argon at room temperature, TEA (37 mg, 0.36 mmol) and N-[(4-{4-amino-1-[6-(3-formylazetidin-1-yl)pyridin-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (100 mg, 0.181 mmol) were added. NaBHCN (34 mg, 0.54 mmol) and AcOH (0.5 mL) were then added. The reaction mixture was stirred at 60 °C for 1 hour. The reaction mixture was cooled to room temperature and quenched by adding water (10 mL). The mixture was extracted with DCM (10 mL x 3). The combined organic phases were washed with brine and dried over Na2SO4. The solvent was removed in vacuo, and the residue was purified by flash chromatography with DCM:MeOH = 10:1 to give the desired product (30 mg, 97.65% purity, 18.7% yield) as a white solid. LC / MS: 864.5 [M+H]+ . 1 H NMR (400 MHz, DMSO) δ 10.97 (s, 1H), 8.93 (t, J = 6.0 Hz, 1H), 8.69 (s, 1H), 8.32 (s, 1H), 8.17 - 8.10 (m, 1H), 7.72 (d, J = 8.4 Hz, 2H), 7.59 - 7.48 (m, 4H), 7.38 - 7.32 (m, 1H), 7.20 (dd, J = 9.2, 4.3 Hz, 1H), 7.15 - 7.00 (m, 2H), 6.56 (d, J = 9.2 Hz, 1H), 5.06 (dd, J = 13.2, 5.1 Hz, 1H), 4.60 (d, J = 6.0 Hz, 2H), 4.40 - 4.05 (m, 5H), 3.91 (s, 3H), 3.80 - 3.62 (m, 2H), 3.35 - 3.25 (m, 3H), 3.20 - 2.80 (m, 4H), 2.73 - 2.55 (m, 4H), 2.43 - 2.35 (m, 2H), 2.11 - 1.88 (m, 2H), 1.25 - 1.20 (m, 1H). Testing compounds for BTK activity Example 82 BTK Degradation Activity of Exemplary Compounds of the Present Disclosure in the RAMOS Cell Line

[0327] RAMOS (ATCC) cells were cultured at 8 × 10 in RPMI growth medium containing 10% heat-inactivated FBS and 1 × penicillin-streptomycin. 5 The cells were plated at 1000 cells / well in a 24-well plate and then incubated overnight at 37°C. The next day, test compounds were administered to the cells by using 1000x stock solutions of compounds prepared at various concentrations in DMSO. After compound administration, the cells were then incubated at 37°C for 6 hours.

[0328] Upon completion, cells were harvested by centrifugation and dissolved in Laemmli sample buffer (1x; VWR International). Proteins in the cell lysates were separated by SDS-PAGE and transferred to Odyssey nitrocellulose membranes (Licor) using the iblot® dry blotting transfer system (ThermoFisher). Nonspecific binding was blocked by incubating the membrane with Intercept blocking buffer (Licor) for 1 hour at room temperature with gentle shaking. The membrane was then incubated overnight at 4°C with primary antibodies anti-BTK (Cell Signaling, Catalog No. 8547) and anti-GAPDH (Cell Signaling, Catalog No. 5179) diluted in Intercept blocking buffer containing 0.1% Tween® 20. The membrane was washed three times with TBS-T and then incubated with IRDye® 800CW goat anti-mouse IgG (1:20,000, Licor) or IRDye® 800CW goat anti-rabbit IgG (1:20,000, Licor) for 1 hour. After washing with TBS-T, the membrane was rinsed in TBS and scanned with an Odyssey® CLx imaging system (Licor). Bands were quantified using Image Studio™ software (Licor).

[0329] Figures 1 and 2 illustrate the BTK degradation activity of exemplary compounds of the present disclosure 13, 25, 34, 42, 48, 49, 51, 53, 54, 78, 93, and 96 in the RAMOS cell line 6 hours after administration.

[0330] Table 3 summarizes the BTK degradation activity of exemplary compounds of the present disclosure in the RAMOS cell line 6 hours after administration. 50 The DC value (i.e., the concentration of test compound at which 50% of the target protein is degraded) was calculated. 50 The designation "B" corresponds to a DC 50A value greater than or equal to 10 nM and less than 100 nM corresponds to a DC 50 This corresponds to a value greater than or equal to 100 nM. [Table 3-1] [Table 3-2] Example 83 REC-1 BTK C481S Generation of cell lines

[0331] The BTK gene in the REC-1 cell line (ATCC) was edited by CRISPR-Cas9 technology to generate a C to S point mutation at residue 481 of the BTK protein. For gene editing, we first used Alt-R CRISPR-Cas9 tracrRNA and crRNA BTK. C481S A gRNA complex was prepared using (5'-GUAGUUCAGGAGGCAGCCAU-3') (IDT-Integrated DNA Technologies), and then the gRNA complex and Alt-R Sp Cas9 nuclease V3 (IDT-Integrated DNA Technologies) were used to transduce BTK. C481S Ribonucleoprotein (RNP) complexes were prepared using a Neon Transfection System (Thermo Fisher Scientific) under three pulses of 1400 V for 10 ms. 5 REC-1 cells were transfected with BTK. C481SCells were electroporated using RNP complexes, the Alt-R Cas9 electroporation enhancer, and the BTK C481S Ultramer DNA oligo (5'-AGCTGCTGAGTCTGGAAGCGGTGGCGCATCTCCCTCAGATAGTTCAGGAGGGAGCCGTTGGCCATGTACTCAGTGATGATGAAGATGGGGCGCTGCTTGGTGCAG-3') (IDT-Integrated DNA Technologies). Cells were then plated in 96-well plates for 10 days and selected with 10 nM ibrutinib for five passages. The BTK C481S mutation was further validated by Sanger sequencing using gDNA extracted from these cells. BTK-dependent REC-1 and REC-1 BTK C481S Growth inhibitory activity of exemplary compounds of the present disclosure in cell lines

[0332] REC-1 (ATCC) and REC-1 BTK were cultured in 90 ul of RPMI growth medium containing 10% heat-inactivated FBS and 1x penicillin streptomycin. C481S Cells were plated at 8,000 cells / well in a 96-well plate and then incubated overnight at 37°C. The next day, test compounds were administered to the ...

Claims

1. A compound of formula (I) or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or a hydrate, or a deuterated derivative thereof: 【Chemistry 129】 (In the formula, X is CH or N; Y is CH or N; A is -C(O)-, -SO ２ -, -S(O)-, -O-, -S-, -NH-, -N(C １ ~C ５ alkyl)- and -C(O)NH(C １ ~C ５ alkyl)-; B is, 【Chemistry 130】 and However, B is 【Chemistry 131】 with the proviso that, if A is not -O-, R １ is H, C １ ~C ３ Alkyl, C １ ~C ３ Haloalkyl, dialkylamino, amino, -CN, hydroxyl, C １ ~C ４ selected from alkoxy and halogen; R ２ and R ３ are H, halogen, -CN, hydroxyl, dialkylamino group, C １ ~C ５ Alkyl, deuterated C １ ~C ５ Alkyl, C １ ~C ５ Alkoxy, deuterated C １ ~C ５ Alkoxy and C １ ~C ５ haloalkyl; Q is L-W １ Or L-W ２ and Where: L is a linker 2 to 20 carbon atoms in length, where one or more of the carbon atoms are optionally independently selected from C(=O), O, N(R ６ ), S, S(O), SO ２ , C(O)NH, C(O)NCH ３ , C(O)NCH ２ CH ３ , C ２ -Alkenyl, C ２ - is replaced by a group selected from alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl or heteroaryl, each of which is selected from 0, 1, 2 or 3 R ７ and W １ teeth, 【Chemistry 132】 is selected from R ４ is H, halogen, -CN, C １ ~C ５ Alkyl, C １ ~C ５ Alkoxy and C １ ~C ５ haloalkyl; W ２ teeth, 【Chemistry 133】 or absent, R ５ is H, halogen, -CN, C １ ~C ５ Alkyl, deuterated C １ ~C ５ Alkyl, C １ ~C ５ Alkoxy, deuterated C １ ~C ５ Alkoxy and C １ ~C ５ haloalkyl; R ６ are H and C, respectively. １ ~C ３ Alkyl, -C(=O)-(C １ ~C ３ alkyl), -C(=O)-O-(C １ ~C ３ alkyl) and -C(=O)-NH-(C １ ~C ３ alkyl), each of which is independently selected from 0, 1, 2 or 3 R ７ is replaced by R ７ are halogen, hydroxyl, amino group, and C １ ~C ３ Alkyl, C １ ~C ３ Alkoxy, C １ ~C ３ Haloalkyl, -N(R ６ ) ２ and -CN.

2. A is -O- or -C(O)-NH-CH ２ or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

3. R １ But, H, C １ ~C ３ Alkyl, C １ ~C ３ 2. The compound of claim 1, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof, selected from haloalkyl and halogen.

4. R １ is H, F, Cl, Br, I, -CF ３ , -CH ３ and 【Chemistry 134】 4. The compound of claim 3, selected from:

5. R １ is H, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

6. R １ is Br, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

7. R １ is Cl, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

8. R １ is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

9. R ２ and R ３ But, H, -OCD ３ , -CD ３ , halogen, C １ ~C ４ Alkyl and C １ ~C ４ 2. The compound of claim 1, wherein each independently is selected from the group consisting of alkoxy, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

10. R ２ and R ３ or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

11. R ２ is H, and R ３ is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

12. R ２ is F and R ３ is H, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

13. R ２ Ga-OCH ３ and R ３ is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

14. R ２ is -F, and R ３ Ga-OCH ３ 10. The compound of claim 9, wherein:

15. R ２ -OCD ３ and R ３ is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

16. R ２ is F and R ３ -OCD ３ 10. The compound of claim 9, wherein:

17. R ２ Ga-CD ３ and R ３ is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

18. R ２ is F and R ３ Ga-CD ３ 10. The compound of claim 9, wherein:

19. R ４ H, halogen, -CN and C １ ~C ４ 2. The compound of claim 1, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof, selected from haloalkyl.

20. R ４ is H, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

21. R ４ 20. The compound of claim 19, wherein is halogen, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

22. 22. The compound of claim 21 , wherein the halogen is selected from F, Cl, Br and I, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

23. 23. The compound of claim 22, wherein said halogen is F, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

24. R ５ H, halogen, deuterated C １ ~C ５ Alkoxy and C １ ~C ５ 2. The compound of claim 1, wherein the compound is selected from the group consisting of alkoxy, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

25. R ５ But, -OCH ３ or - OCD ３ 25. The compound of claim 24, wherein:

26. L is a linker 2-12 carbon atoms in length, where one or more of the carbon atoms are optionally and independently selected from C(=O), O, S, S(O), SO ２ , C(O)NH, C(O)NCH ３ , C(O)NCH ２ CH ３ , N.H., N.C.H. ３ , N.C.H. ２ CH ３ , C ２ -alkynyl, 【Chemistry 135】 or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof.

27. The compound is a compound of formula (IA): 【Chemistry 136】 2. A compound of formula (I) according to claim 1, wherein:

28. The compound is a compound of formula (IB): 【Chemistry 137】 2. A compound of formula (I) according to claim 1, wherein:

29. The compound is 5-((7-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)heptyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-((6-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)hexyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(3-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)propoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(2-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)ethoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-((5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperazin-1-yl)pentyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-((5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-((1-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)pyridin-2-yl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; (S)-3-(5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 3-(5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; (S)-3-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; (S)-3-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-(3-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)propyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)butyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonon-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohept-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 3-(4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonon-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 3-(4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 3-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohept-1-yn-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; (S)-3-(5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-(3-(2-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)-3-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; (S)-3-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione; 5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)azetidin-1-yl)piperidin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione; (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(5-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)pentanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-((S)-1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-((R)-1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-3-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)phenyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)azetidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)benzoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(6-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)hexanoyl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)-3-azabicyclo[3.1.0]hexan-3-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((1R,5S,6s)-6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)-3-azabicyclo[3.1.0]hexan-3-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((1R,5S,6r)-6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)-3-azabicyclo[3.1.0]hexan-3-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)picolinamide; 1-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; (R)-1-(5-(4-(2-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)-1,4-diazepane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; 1-(5-(4-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione; N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)picolinamide; N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)picolinamide; N-(4-(4-amino-1-(1-(1'-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)-[1,3'-biazetidin]-3-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1'-(1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)azetidin-3-yl)-[1,4'-bipiperidine]-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(1-(2-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)ethyl)azetidin-3-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(1-(2-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)ethyl)azetidin-3-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; Trans-N-(4-(4-amino-1-(1-(3-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)cyclobutyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; Cis-N-(4-(4-amino-1-(1-(3-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)piperazin-1-yl)cyclobutyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; Trans-N-(4-(4-amino-1-(1-((1S,3r)-3-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)cyclobutyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; Cis-N-(4-(4-amino-1-(1-(3-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)cyclobutyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-3-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-3-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(2-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)ethyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(1-(2-(4-(2-(2,6-dioxopiperidin-3-yl)-3-oxoisoindolin-5-yl)piperazin-1-yl)ethyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-(4-((1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)azetidin-3-yl)methyl)piperazin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)—N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)piperazin-1-yl)methyl)azetidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; 5-(4-((1-(4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)phenyl)azetidin-3-yl)methyl)piperazin-1-yl)-N-(2,6-dioxopiperidin-3-yl)picolinamide; 5-(4-((1-(4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)-2-fluorophenyl)azetidin-3-yl)methyl)piperazin-1-yl)-N-(2,6-dioxopiperidin-3-yl)picolinamide; 6-(4-((1-(4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)-2-fluorophenyl)azetidin-3-yl)methyl)piperazin-1-yl)-N-(2,6-dioxopiperidin-3-yl)nicotinamide; N-(4-(4-amino-1-(4-(3-((4-(4-((2,6-dioxopiperidin-3-yl)carbamoyl)phenyl)piperazin-1-yl)methyl)azetidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; and 5-(4-((1-(4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-N-(2,6-dioxopiperidin-3-yl)picolinamide 2. The compound of claim 1 , selected from:

30. 30. A pharmaceutical composition comprising a compound according to any one of claims 1 to 29, or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof, and at least one additional component selected from a pharma- ceutically acceptable carrier, a pharma- ceutically acceptable vehicle, and a pharma- ceutically acceptable excipient.

31. 31. The pharmaceutical composition of claim 30, wherein the compound is present in a therapeutically effective amount.

32. 32. A composition comprising a compound according to any one of claims 1 to 29, or a tautomer, stereoisomer or mixture of stereoisomers thereof, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof, or a pharmaceutical composition according to claim 30 or 31, for treating a condition modulated by Bruton's tyrosine kinase (BTK) in a subject in need of such treatment.

33. 33. The composition of claim 32, wherein the condition modulated by BTK is selected from cancer, lymphoma, leukemia, an immunological disease, an autoimmune disease, and an inflammatory disorder.

34. 33. The composition of claim 32, wherein the condition is selected from B cell malignancies, B cell lymphoma, diffuse large B cell lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, marginal zone lymphoma, non-Hodgkin's lymphoma, mantle cell lymphoma, follicular lymphoma, hairy cell leukemia, B cell non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma, bone cancer, bone metastases, arthritis, multiple sclerosis, osteoporosis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease, lupus, Sjogren's syndrome, chronic graft versus host disease, and disorders associated with renal transplantation.

35. 35. The composition of claim 34, wherein the condition is mantle cell lymphoma.

36. 35. The composition of claim 34, wherein the condition is chronic lymphocytic leukemia or small lymphocytic lymphoma.

37. 35. The composition of claim 34, wherein the condition is Waldenstrom's macroglobulinemia.

38. 35. The composition of claim 34, wherein the condition is marginal zone lymphoma.

39. 35. The composition of claim 34, wherein the condition is chronic graft-versus-host disease.

40. 35. The composition of claim 34, wherein the condition is multiple sclerosis.

41. 32. Use of a compound according to any one of claims 1 to 29 or a pharmaceutical composition according to claim 30 or 31 in the preparation of a medicament.

42. 32. A composition comprising a compound of any one of claims 1 to 29, or a tautomer, stereoisomer or mixture of stereoisomers, or a pharma- ceutically acceptable salt, or hydrate, or deuterated derivative thereof, or a pharmaceutical composition of claim 30 or 31, for use in a method of degrading BTK in a cell, wherein the method comprises the step of contacting the cell with the compound or pharmaceutical composition.

43. The composition described in claim 32, characterized in that the composition is administered to the subject in combination with another therapeutic agent.

44. 44. The composition of claim 43, wherein the therapeutic agent is selected from chlorambucil, ifosfamide, doxorubicin, mesalazine, thalidomide, lenalidomide, temsirolimus, everolimus, fludarabine, fostamatinib, paclitaxel, docetaxel, ofatumumab, rituximab, dexamethasone, prednisone, CAL-101, ibritumomab, tositumomab, bortezomib, pentostatin, endostatin, bendamustine, cyclophosphamide, vincristine, venetoclax, and lenalidomide.

Images