Compositions for the treatment of conditions and diseases associated with polycystin expression - Patents.com

Abstract

Alternative splicing events in genes can result in non-productive mRNA transcripts, which can then cause abnormal protein expression. Therapeutic agents that can target alternative splicing events in genes can regulate the expression level of functional protein in patients and / or inhibit abnormal protein expression. Such therapeutic agents can be used to treat conditions or diseases caused by protein deficiencies.

Description

[Technical field]

[0001] cross reference

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 145,288, filed February 3, 2021, which is incorporated by reference in its entirety herein.

[0002] This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. This ASCII copy was created on Mar. 11, 2022, is named 47991-732_601_SL.txt, and is 331,023 bytes in size. [Background technology]

[0003]

[0002] Alternative splicing events in genes can result in non-productive mRNA transcripts, which can then cause abnormal protein expression. Therapeutic agents that can target alternative splicing events in genes can regulate the expression levels of functional proteins in patients and / or inhibit abnormal protein expression. Such therapeutic agents can be used to treat conditions or diseases caused by protein deficiencies. Summary of the Invention

[0004]

[0003] In certain embodiments, described herein is a method of regulating expression of a target protein in a cell having a pre-mRNA transcribed from a target gene and including a nonsense-mediated RNA decay-inducing exon (NMD exon), comprising contacting the cell with an agent or a vector encoding the agent, whereby the agent modulates splicing of the NMD exon from the pre-mRNA, thereby regulating the level of processed mRNA processed from the pre-mRNA and regulating expression of the target protein in the cell, wherein the target protein is encoded by the PKD2 gene.

[0005]

[0004] In certain embodiments, described herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by modulating expression of a target protein in the cells of the subject, comprising contacting the cells of the subject with an agent or a vector encoding the agent, whereby the agent modulates splicing of a nonsense-mediated mRNA decay-directed exon (NMD exon) from a pre-mRNA transcribed from the target gene and containing the NMD exon, thereby modulating the level of processed mRNA processed from the pre-mRNA and modulating expression of the target protein in the cells of the subject, wherein the target protein is encoded by the PKD2 gene.

[0006]

[0005] In some embodiments, the target protein is polycystin 2. In some embodiments, the disease or condition is a disease or condition associated with a deficiency in the amount or activity of polycystin 2. In some embodiments, the disease or condition is a disease or condition associated with a deficiency in the amount or activity of polycystin 1.

[0007]

[0007] In some embodiments, the disease or condition is one that is associated with a deficiency in the amount or activity of a protein with which polycystin 2 functionally enhances, compensates for, replaces, or functionally interacts.

[0008]

[0008] In some embodiments, the agent (a) binds to a targeted portion of the pre-mRNA, (b) modulates binding of a factor involved in splicing of the NMD exon, or (c) a combination of (a) and (b).

[0009]

[0009] In some embodiments, the agent interferes with binding of a factor involved in splicing of the NMD exon to the region of the targeting moiety.

[0010] In some embodiments, the targeting portion of the pre-mRNA is proximal to the NMD exon.

[0010]

[0011] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream from the 5' end of the NMD exon.

[0011]

[0012] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide upstream from the 5' end of the NMD exon.

[0012]

[0013] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the 3' end of the NMD exon.

[0013]

[0014] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide downstream from the 3' end of the NMD exon.

[0014]

[0015] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream from the genomic site of GRCh38 / hg38:chr4:88031085.

[0015]

[0016] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, about 50, about 40, about 30, about 20, about 10, about 5, about 4, about 2, or about 1 nucleotide upstream from the genomic site of GRCh38 / hg38:chr4:88031085.

[0016]

[0017] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the genomic site GRCh38 / hg38:chr4:88031140.

[0017]

[0018] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide downstream from the genomic site of GRCh38 / hg38:chr4:88031140.

[0018]

[0019] In some embodiments, the targeting portion of the pre-mRNA is located in an intron region between two canonical exon regions of the pre-mRNA, the intron region containing the NMD exon.

[0019]

[0020] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with the NMD exon.

[0021] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with an intron upstream or downstream of the NMD exon.

[0020]

[0022] In some embodiments, the targeting portion of the pre-mRNA comprises a 5'NMD exon-intron junction or a 3'NMD exon-intron junction.

[0021]

[0023] In some embodiments, the targeted portion of the pre-mRNA is within an NMD exon.

[0024] In some embodiments, the targeted portion of the pre-mRNA comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleotides of an NMD exon.

[0022]

[0025] In some embodiments, the NMD exon comprises a sequence having at least 80%, at least 90%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2.

[0023]

[0026] In some embodiments, the NMD exon comprises a sequence selected from the group consisting of the sequences listed in Table 2.

[0027] In some embodiments, the pre-mRNA comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0024]

[0028] In some embodiments, the pre-mRNA is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0025]

[0029] In some embodiments, the targeting portion of the pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0026]

[0030] In some embodiments, the agent is an antisense oligomer (ASO), wherein the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 contiguous nucleic acids of a sequence selected from the group consisting of sequences listed in Table 4.

[0027]

[0031] In some embodiments, the targeted portion of the pre-mRNA is within the nonsense-mediated RNA decay-directed exon GRCh38 / hg38:chr4:88031085-88031140.

[0028]

[0032] In some embodiments, the targeted portion of the pre-mRNA is upstream or downstream of the nonsense-mediated RNA decay-directed exon GRCh38 / hg38:chr4:88031085-88031140.

[0029]

[0033] In some embodiments, the targeted portion of the pre-mRNA comprises the exon-intron junction of the nonsense-mediated RNA decay-guided exon GRCh38 / hg38:chr4:88031085 88031140.

[0030]

[0034] In some embodiments, the polycystin 2 expressed from the processed mRNA is full-length polycystin 2 or wild-type polycystin 2.

[0035] In some embodiments, the polycystin 2 expressed from the processed mRNA is at least partially functional compared to wild-type polycystin 2.

[0031]

[0036] In some embodiments, the polycystin 2 expressed from the processed mRNA is at least partially functional compared to full-length wild-type polycystin 2.

[0037] In some embodiments, the agent promotes the exclusion of the NMD exon from the pre-mRNA, thereby modulating the level of processed mRNA that is processed from the pre-mRNA and lacks the NMD exon.

[0032]

[0038] In some embodiments, the clearance of NMD exons from pre-mRNA in cells contacted with the agent is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, or greater than the clearance of NMD exons from pre-mRNA in control cells. , about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold increase.

[0033]

[0039] In some embodiments, the method results in increased levels of processed mRNA in the cell.

[0040] In some embodiments, the level of processed mRNA in cells contacted with an agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about An increase of at least about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0034]

[0041] In some embodiments, the agent increases expression of a target protein in a cell.

[0042] In some embodiments, the level of the target protein is increased by about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 1.1 to about 5-fold, about 1.1 to about 6-fold, about 1.1 to about 7-fold, about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold, as compared to the level of the target protein in a control cell.

[0035]

[0043] In some embodiments, the processed mRNA containing the NMD exon comprises a premature stop codon (PTC). In some embodiments, the premature stop codon (PTC) is downstream of the NMD exon. In some embodiments, the NMD exon comprises a premature stop codon (PTC).

[0036]

[0044] In some embodiments, the disease or condition is associated with a loss-of-function mutation in a target gene or target protein.

[0045] In some embodiments, the disease or condition is associated with haploinsufficiency of the target gene and the subject has a first allele that encodes functional polycystin 2 and a second allele in which no or reduced levels of polycystin 2 are produced, or a second allele that encodes non-functional or partially functional polycystin 2.

[0037]

[0046] In some embodiments, one or both alleles are hypomorphic or partially functional.

[0047] In some embodiments, the disease or condition is selected from the group consisting of polycystic kidney disease with or without polycystic liver disease, autosomal dominant polycystic kidney disease, and intracranial aneurysms.

[0038]

[0048] In some embodiments, the disease or condition is associated with a mutation in the PKD1 or PKD2 gene, and the subject has a first allele that encodes from the first allele (i) a target protein is not produced or is produced at a reduced level compared to the wild-type allele, or (ii) the produced target protein is non-functional or partially functional compared to the wild-type allele, and a second allele from the second allele (iii) a target protein is produced at a reduced level compared to the wild-type allele and the produced target protein is at least partially functional compared to the wild-type allele, or (iv) the produced target protein is partially functional compared to the wild-type allele.

[0039]

[0049] In some embodiments, the disease or condition is selected from the group consisting of polycystic kidney disease with or without polycystic liver disease, autosomal dominant polycystic kidney disease, and intracranial aneurysms.

[0040]

[0050] In some embodiments, the mutation is a hypomorphic mutation.

[0051] In some embodiments, the agent promotes the exclusion of the NMD exon from the pre-mRNA, thereby regulating the level of processed mRNA that is processed from the pre-mRNA and lacks the NMD exon, thereby increasing expression of the target protein in the cell.

[0041]

[0052] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises a backbone modification comprising a phosphorothioate or phosphorodiamidate linkage.

[0042]

[0053] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

[0043]

[0054] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises at least one modified sugar moiety.

[0055] In some embodiments, each sugar moiety is a modified sugar moiety.

[0044]

[0056] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer is an ASO having a length of 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-3 5 nucleobases, 10-30 nucleobases, 10-25 nucleobases, 10-20 nucleobases, 10-15 nucleobases, 11-50 nucleobases, 11-40 nucleobases, 11-35 nucleobases, 11-30 nucleobases, 11-25 nucleobases, 11-20 nucleobases, 11-15 nucleobases, 12-50 nucleobases, 12-40 nucleobases, 12-35 nucleobases, 12-30 nucleobases, 12-25 nucleobases, 12-20 nucleobases, or 12-15 nucleobases.

[0045]

[0057] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeted portion of the pre-mRNA.

[0046]

[0058] In some embodiments, the method comprises contacting the cell with a vector encoding the agent.

[0059] In some embodiments, the agent is a polynucleotide, including an antisense oligomer.

[0047]

[0060] In some embodiments, the vector is a viral vector.

[0061] In some embodiments, the viral vector is an adenovirus-associated viral vector.

[0062] In some embodiments, the polynucleotide further comprises a modified snRNA.

[0063] In some embodiments, the modified human snRNA is a modified U1 snRNA or a modified U7 snRNA.

[0048]

[0064] In some embodiments, the modified human snRNA is a modified U7 snRNA and the antisense oligomer has a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a sequence listed in Table 4 or Table 5.

[0049]

[0065] In some embodiments, the method further comprises assessing the processed mRNA level or expression level of the target protein.

[0066] In some embodiments, the subject is a human.

[0067] In some embodiments, the subject is a non-human animal.

[0068] In some embodiments, the subject is a fetus, embryo, or child.

[0069] In some embodiments, the cells are ex vivo.

[0050]

[0070] In some embodiments, the agent is administered to the subject by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, intravitreal, or intravenous injection.

[0071] In some embodiments, the method further comprises administering a second therapeutic agent to the subject.

[0051]

[0072] In some embodiments, the second therapeutic agent is a small molecule.

[0073] In some embodiments, the second therapeutic agent is an antisense oligomer.

[0074] In some embodiments, the second therapeutic agent corrects intron retention.

[0075] In some embodiments, the method treats a disease or condition.

[0052]

[0076] In certain embodiments, described herein are compositions comprising an agent or a vector encoding an agent, wherein the agent modulates splicing of a nonsense-mediated RNA decay-guided exon (NMD exon) from a pre-mRNA transcribed from a target gene and comprising the NMD exon, thereby modulating the level of processed mRNA processed from the pre-mRNA and modulating expression of a target protein in a cell having the pre-mRNA, wherein the target protein is encoded by the PKD2 gene.

[0053]

[0077] In certain embodiments, described herein are compositions comprising an agent or a vector encoding an agent, wherein the agent regulates splicing of a nonsense-mediated mRNA decay-directed exon (NMD exon) from a pre-mRNA transcribed from a target gene and comprising the NMD exon, thereby treating a disease or condition in a subject in need thereof by regulating the level of processed mRNA processed from the pre-mRNA and regulating expression of a target protein in cells of the subject, wherein the target protein is encoded by the PKD2 gene.

[0054]

[0078] In certain embodiments, described herein are pharmaceutical compositions comprising a composition described herein and a pharma- ceutically acceptable excipient and / or delivery vehicle.

[0055]

[0079] In certain embodiments, described herein are compositions comprising a viral vector encoding a nonsense-mediated RNA decay alternative splice site (NSASS) modulator or agent, wherein the agent modulates expression of a target protein in a cell comprising a pre-mRNA transcribed from a target gene and encoding the target protein, wherein the pre-mRNA comprises an alternative 5' splice site downstream of the canonical 5' splice site, wherein a processed mRNA generated by splicing of the pre-mRNA at the alternative 5' splice site is subject to nonsense-mediated RNA decay, and wherein the agent modulates processing of the pre-mRNA by modulating splicing at the alternative 5' splice site, and wherein the target gene is PKD2.

[0056]

[0080] In some embodiments, the agent modulates pre-RNA processing by preventing or reducing splicing at the canonical 5' splice site.

[0057]

[0081] In some embodiments, the agent modulates pre-RNA processing by promoting or increasing splicing at the canonical 5' splice site.

[0058]

[0082] In some embodiments, modulating splicing of the pre-mRNA at the alternative 5' splice site increases expression of the target protein in a cell.

[0059]

[0083] In some embodiments, the processed mRNA produced by splicing of the pre-mRNA at the alternative 5' splice site contains a premature termination codon (PTC).

[0060]

[0084] In some embodiments, the agent is a small molecule.

[0085] In some embodiments, the agent is a polypeptide.

[0086] In some embodiments, the polypeptide is a nucleic acid binding protein.

[0087] In some embodiments, the nucleic acid binding protein contains a TAL-effector or a zinc finger binding domain.

[0061]

[0088] In some embodiments, the nucleic acid binding protein is a Cas family protein.

[0089] In some embodiments, the polypeptide is associated with or complexed with one or more nucleic acid molecules.

[0062]

[0090] In some embodiments, the agent is an antisense oligomer (ASO) complementary to the targeted region of the pre-mRNA.

[0091] In some embodiments, the agent is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeted region of a pre-mRNA encoding the target protein.

[0063]

[0092] In some embodiments, the agents contain backbone modifications including phosphorothioate or phosphorodiamidate linkages.

[0093] In some embodiments, the agent comprises a phosphorodiamidate morpholino.

[0094] In some embodiments, the agent comprises a locked nucleic acid.

[0095] In some embodiments, the agent comprises a peptide nucleic acid.

[0096] In some embodiments, the agent comprises 2'-O-methyl.

[0064]

[0097] In some embodiments, the agent comprises a 2'-fluoro or a 2'-O-methoxyethyl moiety.

[0098] In some embodiments, the agent comprises at least one modified sugar moiety.

[0099] In some embodiments, each sugar moiety is a modified sugar moiety.

[0065]

[0100] In some embodiments, the agent is an antisense oligomer and the agent is an antisense oligomer having a length of 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-35 nucleobases , 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases.

[0066]

[0101] In some embodiments, the composition comprises a vector encoding the agent.

[0102] In some embodiments, the agent is a polynucleotide, including an antisense oligomer.

[0103] In some embodiments, the vector is a viral vector.

[0104] In some embodiments, the viral vector is an adenovirus-associated viral vector.

[0105] In some embodiments, the polynucleotide further comprises a modified snRNA.

[0106] In some embodiments, the modified human snRNA is a modified U1 snRNA or a modified U7 snRNA.

[0067]

[0107] In some embodiments, the modified human snRNA is a modified U7 snRNA and the antisense oligomer has a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a sequence listed in Table 4 or Table 5.

[0068]

[0108] Described herein, in certain embodiments, are compositions that include a nucleic acid molecule encoding an agent according to the compositions described herein.

[0109] In some embodiments, the nucleic acid molecule is incorporated into a viral delivery system.

[0110] In some embodiments, the viral delivery system is an adenovirus-associated vector.

[0111] In some embodiments, the viral vector is an adenovirus-associated viral vector.

[0069]

[0112] In certain embodiments, described herein is a method of modulating expression of a target protein in a cell comprising a pre-mRNA transcribed from a target gene and encoding said target protein, comprising contacting the cell with a viral vector encoding a nonsense-mediated RNA decay alternative splice site (NSASS) modulator or agent, wherein the pre-mRNA comprises an alternative 5' splice site downstream of the canonical 5' splice site, and a processed mRNA generated by splicing of the pre-mRNA at the alternative 5' splice site is subject to nonsense-mediated RNA decay, and the agent modulates splicing at the alternative 5' splice site, thereby modulating expression of the target protein, and wherein the target gene is PKD2.

[0070]

[0113] In some embodiments, the agent (a) binds to a targeted portion of a pre-mRNA, (b) modulates binding of a factor involved in splicing at an alternative 5' splice site, or (c) a combination of (a) and (b).

[0071]

[0114] In some embodiments, the agent interferes with binding of a factor involved in splicing at the alternative 5' splice site to a region of the targeting moiety.

[0115] In some embodiments, the targeting portion of the pre-mRNA is proximal to an alternative 5' splice site.

[0072]

[0116] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream from the alternative 5' splice site.

[0073]

[0117] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide upstream from the alternative 5' splice site.

[0074]

[0118] In some embodiments, the targeted portion of the pre-mRNA is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream from the alternative 5' splice site.

[0075]

[0119] In some embodiments, the targeted portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide downstream from the alternative 5' splice site.

[0076]

[0120] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream from the genomic site GRCh38 / hg38:chr4:88036480.

[0077]

[0121] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream from the genomic site at GRCh38 / hg38:chr4:88036480.

[0078]

[0122] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the genomic site GRCh38 / hg38:chr4:88036480.

[0079]

[0123] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the genomic site at GRCh38 / hg38:chr4:88036480.

[0080]

[0124] In some embodiments, the targeting portion of the pre-mRNA is located in the region between the canonical 5' splice site and the alternative 5' splice site.

[0125] In some embodiments, the targeting portion of the pre-mRNA is located in an exon region extended by splicing at an alternative 5' splice site.

[0081]

[0126] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with the alternative 5' splice site.

[0127] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with a region upstream or downstream of the alternative 5' splice site.

[0082]

[0128] In some embodiments, the targeted portion of the pre-mRNA is within an exon region extended by splicing at an alternative 5' splice site.

[0129] In some embodiments, the targeted portion of the pre-mRNA comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleotides of the exon region extended by splicing at the alternative 5' splice site.

[0083]

[0130] In some embodiments, the targeting portion of the pre-mRNA is located in an intron region between two canonical exons.

[0131] In some embodiments, the targeting portion of the pre-mRNA is located in one of the two canonical exons.

[0132] In some embodiments, the targeting portion of the pre-mRNA is located in a region that spans both an intron and a canonical exon.

[0084]

[0133] In some embodiments, the level of a target protein in a cell is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, about 2 to about 6 ... An increase of about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0085]

[0134] In some embodiments, modulation of pre-mRNA splicing increases the production of processed mRNA that encodes the target protein.

[0086]

[0135] In some embodiments, the level of processed mRNA encoding a target protein in cells contacted with a drug is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, or about 1.1 to about 10 times higher than the level of processed mRNA encoding a target protein in control cells. fold, about 2 to about 5 fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold increase.

[0087]

[0136] In some embodiments, the target protein is a canonical isoform of a protein.

[0137] In some embodiments, the processed mRNA produced by splicing of the pre-mRNA at the alternative 5' splice site contains a premature termination codon (PTC).

[0088]

[0138] In some embodiments, the NSASS modulating agent is a composition described herein.

[0139] In certain embodiments, described herein are pharmaceutical compositions comprising a composition described herein and a pharma- ceutically acceptable excipient and / or delivery vehicle.

[0089]

[0140] In certain embodiments, described herein are methods of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, comprising administering to the subject a pharmaceutical composition for a subject in need thereof, the pharmaceutical composition comprising a composition comprising a nonsense-mediated RNA decay alternative splice site (NSASS) modulator or a viral vector encoding the agent, the agent modulating expression of a target protein in a cell comprising a pre-mRNA transcribed from a target gene and encoding the target protein, the pre-mRNA comprising an alternative 5' splice site downstream of the canonical 5' splice site, splicing of the pre-mRNA at the alternative 5' splice site results in nonsense-mediated RNA decay of the alternatively spliced ​​mRNA, the agent modulating processing of the pre-mRNA by modulating splicing at the alternative 5' splice site, and the target gene is PKD2, and a pharmaceutically acceptable excipient.

[0090]

[0141] In certain embodiments, described herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, comprising administering to the subject a pharmaceutical composition described herein.

[0091]

[0142] In some embodiments, the disease is polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, or intracranial aneurysm.

[0143] In some embodiments, the disease or condition is a disease or condition associated with a deficiency in the amount or activity of polycystin 2 or polycystin 1.

[0092]

[0144] In some embodiments, the disease or condition is one that is associated with a deficiency in the amount or activity of a protein with which polycystin 2 functionally enhances, compensates for, replaces, or functionally interacts.

[0093]

[0145] In some embodiments, the disease or condition is caused by a deficiency in the amount or activity of a target protein.

[0146] In some embodiments, the agent increases the level of processed mRNA encoding a target protein in a cell.

[0094]

[0147] In some embodiments, the level of processed mRNA encoding a target protein in cells contacted with a drug is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, or about 1.1 to about 10 times higher than the level of processed mRNA encoding a target protein in control cells. fold, about 2 to about 5 fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold increase.

[0095]

[0148] In some embodiments, the agent increases expression of a target protein in a cell.

[0149] In some embodiments, the level of a target protein in a cell is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, about 2 to about 6 ... An increase of about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0096]

[0150] In some embodiments, the method further comprises assessing the mRNA or expression level of the target protein.

[0151] In some embodiments, the method further comprises evaluating the subject's genome for at least one genetic variation associated with the disease.

[0097]

[0152] In some embodiments, the at least one genetic variation is within a genetic locus associated with a disease.

[0153] In some embodiments, the at least one genetic variation is within a locus associated with expression of a gene associated with the disease.

[0098]

[0154] In some embodiments, the at least one genetic mutation is in the PKD2 locus.

[0155] In some embodiments, the at least one genetic variation is within a locus associated with PKD2 gene expression.

[0156] In some embodiments, the subject is a human.

[0157] In some embodiments, the subject is a non-human animal.

[0158] In some embodiments, the subject is a fetus, embryo, or child.

[0099]

[0159] In some embodiments, the cell(s) are ex vivo, or in a tissue or organ ex vivo.

[0160] In some embodiments, the agent is administered to the subject by intraventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation, or intravenous injection.

[0100]

[0161] In some embodiments, the method treats a disease or condition.

[0162] In certain embodiments, described herein are therapeutic agents for use in the methods described herein.

[0163] In certain embodiments, described herein are pharmaceutical compositions comprising a therapeutic agent described herein and a pharma- ceutically acceptable excipient.

[0101]

[0164] In certain embodiments, described herein are methods of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, comprising administering to the subject a pharmaceutical composition described herein by intraventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation, or intravenous injection.

[0102]

[0165] In some embodiments, the methods treat the subject.

[0166] In certain embodiments, described herein are methods of increasing expression of polycystin 2 protein in a cell having a processed mRNA encoding polycystin 2 protein, the processed mRNA including a translational regulatory element that inhibits translation of the processed mRNA, comprising contacting the cell with an agent or a vector encoding the agent, wherein the agent modulates the structure of the translational regulatory element, thereby increasing expression of polycystin 2 protein in the cell.

[0103]

[0167] In certain embodiments, described herein are methods of increasing expression of polycystin 2 protein in a cell having a processed mRNA encoding polycystin 2 protein, the processed mRNA including a translational regulatory element that inhibits translation of the processed mRNA, comprising contacting the cell with an agent or a vector encoding an agent, wherein the agent (a) binds to a targeting portion of the processed mRNA, (b) modulates the interaction of the translational regulatory element with a factor involved in translation of the processed mRNA, or (c) a combination of (a) and (b), thereby increasing expression of polycystin 2 protein in the cell.

[0104]

[0168] In certain embodiments, described herein is a method of modulating expression of a polycystin 2 protein in a cell, comprising contacting a cell with an agent or a vector encoding the agent, wherein the agent comprises an antisense oligomer having at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5.

[0105]

[0169] In certain embodiments, described herein are compositions comprising an agent or a vector encoding an agent, wherein the agent comprises an antisense oligomer having at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5.

[0106]

[0170] In certain embodiments, described herein is a composition comprising a vector encoding an agent, wherein the agent comprises a polynucleic acid comprising a sequence having at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5.

[0107]

[0171] In certain embodiments, described herein is a composition comprising an agent, wherein the agent comprises an antisense oligomer that binds to a targeting portion of a processed mRNA encoding a polycystin 2 protein, wherein the targeting portion of the processed mRNA comprises at least one nucleotide of the primary start codon of the processed mRNA or is within the 5'UTR of the processed mRNA.

[0108]

[0172] In certain embodiments, described herein is a composition comprising a vector encoding an agent, wherein the agent comprises a polynucleic acid comprising a sequence that binds to a targeting portion of a processed mRNA encoding a polycystin 2 protein, wherein the targeting portion of the processed mRNA comprises at least one nucleotide of the main start codon of the processed mRNA or is within the 5'UTR of the processed mRNA.

[0109]

[0173] In certain embodiments, described herein are compositions comprising an agent, wherein the agent modulates the structure of a translational regulatory element of a processed mRNA encoding polycystin 2 protein, thereby increasing expression of the polycystin 2 protein, and the translational regulatory element inhibits translation of the processed mRNA.

[0110]

[0174] In certain embodiments, described herein are compositions comprising a vector encoding an agent, where the agent modulates the structure of a translational regulatory element of a processed mRNA encoding polycystin 2 protein, thereby increasing expression of the polycystin 2 protein, and the translational regulatory element inhibits translation of the processed mRNA.

[0111]

[0175] In certain embodiments, described herein are compositions comprising an agent that increases translation of a processed mRNA in a cell, the processed mRNA encoding a polycystin 2 protein and that contains a translational regulatory element that inhibits translation of the processed mRNA, the agent modulates the structure of the translational regulatory element, thereby increasing the translation efficiency and / or translation rate of the processed mRNA, and the agent (a) binds to a targeted portion of the processed mRNA, (b) modulates the interaction of the translational regulatory element with a factor involved in the translation of the processed mRNA, or (c) a combination of (a) and (b).

[0112]

[0176] In certain embodiments, described herein are compositions comprising a vector encoding an agent, wherein the agent increases translation of a processed mRNA in a cell, the processed mRNA encoding a polycystin 2 protein and comprising a translational regulatory element that inhibits translation of the processed mRNA, the agent modulates the structure of the translational regulatory element, thereby increasing the translation efficiency and / or rate of the processed mRNA, and the agent (a) binds to a targeted portion of the processed mRNA, (b) modulates the interaction of the translational regulatory element with a factor involved in the translation of the processed mRNA, or (c) a combination of (a) and (b).

[0113]

[0177] In certain embodiments, described herein is a method of increasing expression of a target protein in a cell having a processed mRNA encoding the target protein, the processed mRNA comprising a translational regulatory element that inhibits translation of the processed mRNA, the method comprising delivering to the cell (1) a first agent or a first nucleic acid sequence encoding the first agent, and (2) a second agent or a second nucleic acid sequence encoding the second agent, wherein the first agent regulates splicing of a pre-mRNA transcribed from a target gene encoding the target protein, and the second agent regulates the structure of the translational regulatory element of the processed mRNA encoding the target protein, thereby increasing expression of the target protein in the cell, wherein the target protein is polycystin 2.

[0114]

[0178] In certain embodiments, described herein are methods of increasing expression of a target protein in a cell having a processed mRNA encoding the target protein, the processed mRNA comprising a translational regulatory element that inhibits translation of the processed mRNA, the method comprising delivering to the cell (1) a first agent or a first nucleic acid sequence encoding the first agent, and (2) a second agent or a second nucleic acid sequence encoding the second agent, wherein the first agent modulates splicing of a pre-mRNA transcribed from a target gene encoding the target protein, and the second agent (a) binds to a targeted portion of the processed mRNA, (b) modulates the interaction of the translational regulatory element with a factor involved in translation of the processed mRNA, or (c) a combination of (a) and (b), thereby increasing expression of the target protein in the cell, and wherein the target protein is polycystin 2. In some embodiments, the agent modulates the structure of the translational regulatory element. In some embodiments, the agent (a) binds to a targeted portion of the processed mRNA, (b) modulates the interaction of a translational regulatory element with a factor involved in the translation of the processed mRNA, or (c) a combination of (a) and (b). In some embodiments, the translational regulatory element is in the 5' untranslated region (5'UTR) of the processed mRNA. In some embodiments, the translational regulatory element comprises at least a portion of the 5'UTR of the processed mRNA. In some embodiments, the translational regulatory element comprises a secondary mRNA structure that involves base pairing with at least one nucleotide of the primary start codon of the processed mRNA. In some embodiments, the agent inhibits base pairing with at least one nucleotide of the primary start codon of the processed mRNA. In some embodiments, the secondary structure of the mRNA comprises a stem, a stem loop, a G-quadruplex, or any combination thereof. In some embodiments, the agent does not bind to the primary start codon. In some embodiments, the agent binds to at least one nucleotide of the primary start codon.In some embodiments, the agent inhibits or reduces the formation of a secondary mRNA structure that includes at least one nucleotide of the primary start codon of the processed mRNA. In some embodiments, the agent inhibits or reduces base pairing of at least one nucleotide of the primary start codon of the processed mRNA with another nucleotide of the processed mRNA, optionally the other nucleotide being another nucleotide of the 5'UTR of the processed mRNA. In some embodiments, the translational regulatory element includes at least a portion of an upstream open reading frame (uORF). In some embodiments, the agent promotes the formation of a secondary mRNA structure with at least a portion of the uORF. In some embodiments, the translational regulatory element includes an upstream start codon. In some embodiments, the agent promotes the formation of a secondary mRNA structure with base pairing with at least one nucleotide of the upstream start codon. In some embodiments, the agent does not bind to the upstream start codon. In some embodiments, the agent binds to the upstream start codon. In some embodiments, the agent promotes or increases the formation of a secondary mRNA structure that includes at least one nucleotide of the upstream start codon. In some embodiments, the agent promotes or increases base pairing of at least one nucleotide of the upstream start codon with another nucleotide of the processed mRNA, optionally the other nucleotide being another nucleotide of the 5'UTR of the processed mRNA. In some embodiments, the translational regulatory element comprises a G-quadruplex formed by a G-rich sequence of the processed mRNA. In some embodiments, the agent inhibits the formation of a G-quadruplex. In some embodiments, the G-rich sequence comprises at least a portion of the 5' untranslated region (5'UTR) of the processed mRNA. In some embodiments, the G-rich sequence is present in the 5' untranslated region (5'UTR) of the processed mRNA. In some embodiments, the G-rich sequence comprises a sequence according to the formula Gx-N1-7-Gx-N1-7-Gx-N1-7-Gx (SEQ ID NO: 227), where x > 3 and N is A, C, G, or U.In some embodiments, the G-rich sequence comprises the sequence GGGAGCCGGGCUGGGGCUCACACGGGGG (SEQ ID NO: 228). In some embodiments, at least one, two, three, or all four of the Gx sequences are structured, present in a secondary structure, or base-paired with another nucleotide, optionally the other nucleotide is C or U. In some embodiments, the agent unwinds, promotes the transformation, or inhibits or reduces the formation of a G-quadruplex. In some embodiments, the agent unwinds, promotes the transformation, or inhibits or reduces the base-pairing or structure of at least one, two, three, or all four of the Gx sequences of the G-quadruplex. In some embodiments, the targeting portion of the processed mRNA is within the 5'UTR of the processed mRNA. In some embodiments, the targeting portion of the processed mRNA has a sequence having at least 80% sequence identity to at least 8 consecutive nucleotides of a sequence selected from the group consisting of the sequences in Table 3. In some embodiments, the targeting portion of the processed mRNA comprises at least one nucleotide upstream of the codon immediately downstream of the main start codon of the processed mRNA. In some embodiments, the targeting portion of the processed mRNA is at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 150, 160, 180, or 200 nucleotides upstream from the main start codon of the processed mRNA. In some embodiments, the targeting portion of the processed mRNA is about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 150, 160, 180, 200, or 220 nucleotides upstream from the main start codon. In some embodiments, the processed mRNA has a sequence having at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 3. In some embodiments, the agent comprises an antisense oligomer. In some embodiments, the antisense oligomer has at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5.In some embodiments, the translational regulatory element inhibits translation of the processed mRNA by inhibiting translation efficiency and / or translation rate of the processed mRNA. In some embodiments, the agent increases expression of polycystin 2 protein in the cell by increasing translation efficiency and / or translation rate of the processed mRNA. In some embodiments, the antisense oligomer has about 100% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5. In some embodiments, the antisense oligomer has at least 80% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5. In some embodiments, the antisense oligomer has about 100% sequence identity to a sequence selected from the group consisting of the sequences in Table 4 or Table 5. In some embodiments, the agent modulates binding of one or more factors that modulate translation of the processed mRNA. In some embodiments, the antisense oligomer comprises a backbone modification comprising a phosphorothioate or phosphorodiamidate linkage. In some embodiments, the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl moiety, a 2'-fluoro moiety, or a 2'-O-methoxyethyl moiety. In some embodiments, the antisense oligomer comprises at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety.In some embodiments, the antisense oligomer is 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-35 nucleobases, Nucleic acid bases, 10-30 nucleobases, 10-25 nucleobases, 10-20 nucleobases, 10-15 nucleobases, 11-50 nucleobases, 11-40 nucleobases, 11-35 nucleobases, 11-30 nucleobases, 11-25 nucleobases, 11-20 nucleobases, 11-15 nucleobases, 12-50 nucleobases, 12-40 nucleobases, 12-35 nucleobases, 12-30 nucleobases, 12-25 nucleobases, 12-20 nucleobases,. or 12-15 nucleic acid bases. In some embodiments, the vector comprises a viral vector encoding the agent. In some embodiments, the viral vector comprises an adenoviral vector, an adeno-associated viral (AAV) vector, a lentiviral vector, a herpes simplex viral (HSV) viral vector, or a retroviral vector. In some embodiments, the agent further comprises a cell-penetrating peptide. In some embodiments, the agent comprises a cell-penetrating peptide conjugated to an antisense oligomer. In some embodiments, the antisense oligomer is a phosphorodiamidate morpholino oligomer. In some embodiments, the agent comprises a polynucleotide encoding a gene editing molecule or a genome editing molecule. In some embodiments, the agent comprises a polynucleic acid polymer that binds to a target motif in (i) a processed mRNA transcript, (ii) a pre-mRNA from which the processed mRNA transcript is processed, or (iii) a gene encoding the pre-mRNA. In some embodiments, the gene editing molecule comprises CRISPR-Cas9 or a functional equivalent thereof, and / or a polynucleic acid polymer that binds to a target motif in (i) the processed mRNA transcript, (ii) the pre-mRNA from which the processed mRNA transcript is processed, or (iii) a gene encoding the pre-mRNA. In some embodiments, the polynucleic acid polymer that binds to the target motif comprises a guide RNA (gRNA). In some embodiments, the agent increases expression of polycystin 2 protein in the cell. In some embodiments, the translation efficiency and / or translation rate of the processed mRNA encoding the polycystin 2 protein in the cell is increased. In some embodiments, the translation efficiency and / or translation rate of the processed mRNA encoding the polycystin 2 protein in a cell contacted with the agent or a vector encoding the agent is increased compared to the translation efficiency and / or translation rate of the processed mRNA in a control cell not contacted with the agent or a vector encoding the agent.In some embodiments, the translation efficiency and / or translation rate of processed mRNA encoding polycystin 2 protein in cells contacted with a drug or a vector encoding a drug is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 ... an increase of at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times. In some embodiments, the translation efficiency and / or translation rate of processed mRNA encoding polycystin 2 protein in a cell contacted with a drug or a vector encoding a drug is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 1.1 to about 10 ... about 9-fold, about 2-5-fold, about 2-6-fold, about 2-7-fold, about 2-8-fold, about 2-9-fold, about 3-6-fold, about 3-7-fold, about 3-8-fold, about 3-9-fold, about 4-7-fold, about 4-8-fold, about 4-9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold. In some embodiments, the level of polycystin 2 protein expressed in cells contacted with an agent or a vector encoding an agent is increased compared to the level of polycystin 2 protein in control cells not contacted with the agent or a vector encoding an agent.In some embodiments, the level of polycystin 2 protein expressed in cells contacted with an agent or a vector encoding an agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 1.1 to about 10 ... about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold increase. In some embodiments, the level of polycystin 2 protein expressed in cells contacted with an agent or a vector encoding an agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times higher than in the absence of the agent. , about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold. In some embodiments, the polycystin 2 protein translated from the processed mRNA is a functional polycystin 2 protein. In some embodiments, the polycystin 2 protein translated from the processed mRNA is a fully functional polycystin 2 protein. In some embodiments, the polycystin 2 protein translated from the processed mRNA is a wild-type polycystin 2 protein. In some embodiments, the polycystin 2 protein translated from the processed mRNA is a full-length polycystin 2 protein.In some embodiments, the processed mRNA transcript is a mutant processed mRNA transcript. In some embodiments, the processed mRNA transcript is not a mutant processed mRNA transcript. In some embodiments, the processed mRNA is processed from a pre-mRNA that is a mutant pre-mRNA. In some embodiments, the processed mRNA is processed from a pre-mRNA that is not a mutant pre-mRNA. In some embodiments, the agent is a therapeutic agent.

[0115]

[0179] In some embodiments, the level of the target protein expressed in the cell is increased by delivery of (1) a first agent or a first nucleic acid sequence encoding the first agent, and (2) a second agent or a second nucleic acid sequence encoding the second agent. In some embodiments, the level of the target protein expressed in the cell is increased compared to a control cell. In some embodiments, the control cell is a cell that has not been contacted with the first agent and has not been contacted with the second agent, or the control cell is a cell that has not been delivered with the first nucleic acid sequence encoding the first agent and has not been delivered with the second nucleic acid sequence encoding the second agent. In some embodiments, the control cell is a cell that has not been contacted with the first agent and has been contacted with the second agent, or the control cell is a cell that has not been delivered with the first nucleic acid sequence encoding the first agent and has been delivered with the second nucleic acid sequence encoding the second agent. In some embodiments, the control cell is a cell that has not been contacted with the second agent and that has been contacted with the first agent, or the control cell is a cell that has not been delivered with a second nucleic acid sequence encoding a second agent and that has been delivered with a first nucleic acid sequence encoding a first agent. In some embodiments, the level of the target protein expressed in the cells is increased by about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 1.1 to about 5-fold, about 1.1 to about 6-fold, about 1.1 to about 7-fold, about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold, as compared to a control cell.In some embodiments, the level of a target protein expressed in a cell to which (1) a first agent or a first nucleic acid sequence encoding a first agent, and (2) a second agent or a second nucleic acid sequence encoding a second agent are delivered is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, or about 1.1 to about 7 times higher than in the absence of the first agent or the second agent. , about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold. In some embodiments, the level of a target protein expressed in a cell to which (1) a first agent or a first nucleic acid sequence encoding a first agent, and (2) a second agent or a second nucleic acid sequence encoding a second agent are delivered is increased by at least about 1.5-fold compared to the absence of the first agent or the second agent.

[0116]

[0180] Also provided herein are pharmaceutical compositions comprising a therapeutic agent disclosed herein and a pharma- ceutically acceptable carrier or excipient.

[0181] Also provided herein is a pharmaceutical composition comprising a vector encoding a therapeutic agent disclosed herein and a pharma- ceutically acceptable carrier or excipient.

[0182] Also provided herein are pharmaceutical compositions comprising the compositions disclosed herein and a pharma- ceutically acceptable carrier or excipient.

[0117] Incorporation by Reference

[0183] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. [Brief description of the drawings]

[0118]

[0184] The novel features of the present disclosure are set forth with particularity in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings. [Figure 1]

[0185] 1 shows a schematic of a target pre-mRNA containing a nonsense-mediated mRNA decay-inducing exon (NMD exon) and therapeutic-mediated elimination of the nonsense-mediated mRNA decay-inducing exon to increase expression of a functional RNA or full-length target protein. A shows a cell divided into nuclear and cytoplasmic compartments. In the nucleus, the pre-mRNA transcript of the target gene is subjected to splicing to generate an mRNA that is transported to the cytoplasm and translated into a target protein. For this target gene, a portion of the mRNA contains a nonsense-mediated mRNA decay-inducing exon (NMD exon mRNA) that is degraded in the cytoplasm, so the target protein is not produced. B shows an example of the same cell divided into nuclear and cytoplasmic compartments. Treatment with a therapeutic agent such as an antisense oligomer (ASO) promotes the elimination of the nonsense-mediated mRNA decay-inducing exon, resulting in an increase in functional (productive) mRNA, which is then translated into high levels of the target protein. [Diagram 2]

[0186] Shown is a PKD2 NMD (nonsense-mediated mRNA decay)-induced exon inclusion event. NMD-induced exon inclusion event: UCSC genome browser snapshot of a region within the PKD2 gene that contains the NMD-induced alternative exon inclusion site event (chr4:88031085-88031140) indicated by the shaded area and black bar at the top (exons are rectangles, introns are lines with arrows). Shown are RNA-seq traces from four representative human kidney samples and mixed renal epithelial cells treated with cycloheximide (CHX) or DMSO control. [Diagram 3]

[0187] PKD2 NMD-induced alternative 5'ss events are shown. NMD-induced alternative 5'ss events: UCSC genome browser snapshot of a region within the PKD2 gene that contains an NMD-induced alternative 5' splice site event (chr4:88036355-88036480) indicated by the shaded area and black bar at the top (exons are rectangles, introns are lines with arrows). RNA-sequencing traces from four representative human kidney samples and mixed renal epithelial cells treated with cycloheximide (CHX) or DMSO control are shown. *Alternative_5ss refers to alternative 5' splice site. [Figure 4]

[0188] Validation of NMD induction events are shown. A shows a schematic of the NMD induction exon (chr4 88031085 88031140) event. B shows a schematic of the alternative 5' splice site (alternative 5'ss) (chr4 88036354 88036480) event. *Alternative 5'ss refers to alternative 5' splice site. In this example, the exon resulting from splicing at the alternative 5' splice site (alternative 5'ss) is longer than the corresponding canonical exon 3 (black bar) because it contains, in addition to the canonical exon 3 (black bar), an exonic region extended by splicing at the alternative 5' splice site (gray bar). Consistently, the intron resulting from splicing at the alternative 5' splice site (alternative 5'ss) is shorter than the corresponding canonical intron 3. C shows RT-PCR using RNA from human renal mixed epithelial cells and human renal cortical epithelial cells treated with either DMSO (-) or cycloheximide (CHX) (+). Primers were located in exons 2 and 4. [Diagram 5]

[0189] FIG. 5 shows the ASO walk design for NMD exon inclusion events. Shaded nucleotides correspond to NMD-induced exon 2X. FIG. 5 discloses SEQ ID NOs: 263-265, respectively, in the order of appearance. [Figure 6A]

[0190] FIG. 6 shows the ASO walk design for alternative 5'ss events. The shaded nucleotides correspond to the portion of extended exon 3 resulting from the selection of the alternative 5'ss shown. *Alternative 5ss refers to alternative 5' splice sites. FIG. 6 discloses SEQ ID NOs: 266-270, respectively, in the order shown. [Figure 6B] FIG. 6 shows the ASO walk design for alternative 5'ss events. The shaded nucleotides correspond to the portion of extended exon 3 resulting from the selection of the alternative 5'ss shown. *Alternative 5ss refers to alternative 5' splice sites. FIG. 6 discloses SEQ ID NOs: 266-270, respectively, in the order shown. [Figure 7A]

[0191] Productive PKD2 mRNA changes are shown using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in Figure 6A-B) for 24 h. [Figure 7B]

[0192] We show nonproductive PKD2 mRNA changes using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in Figure 6A-B) for 24 h. [Figure 8A]

[0193] Productive PKD2 mRNA changes are shown using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in Figure 5) for 24 h. [Figure 8B]

[0194] Figure 5 shows non-productive PKD2 mRNA changes using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in Figure 5) for 24 h. [Figure 9]

[0195] A-E show ASOs targeting two events to increase productive mRNA and protein production. A shows the effect of ASO combinations on non-productive exon inclusion NMD event utilization. B shows expression of EX2-EX3 productive mRNA with ASO combinations. C shows the effect of ASO combinations on non-productive alternative 5'ss NMD event utilization. D shows expression of EX3-EX4 productive mRNA with ASO combinations. E shows Western blot quantification of polycystin 2 (PKD2) protein following treatment with ASO combinations. [Figure 10]

[0196] 10 shows the upstream open reading frame macrowalk of PKD2. The shaded nucleotides correspond to the upstream open reading frame and the canonical start codon, respectively. FIG. 10 discloses SEQ ID NO: 271. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0119]

[0197] Certain details of the description are set forth to provide a thorough understanding of various embodiments. However, one of ordinary skill in the art will appreciate that the present disclosure may be practiced without these details. In other instances, well-known structures have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments. Unless otherwise required by context, throughout this specification and the claims that follow, the word "comprise" and variations thereof, such as "comprises" and "comprising," are intended to be interpreted in an open and inclusive sense, i.e., "including, but not limited to." Additionally, the headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed disclosure.

[0120]

[0198] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. It should also be noted that the term "or" is generally used in its sense to include "and / or" unless the context clearly dictates otherwise.

[0121]

[0199] As used herein, coordinates refer to coordinates of the genome reference assembly GRCh38 (Genome Research Consortium human build 38) (also known as Hg38 (Human genome build 38)).

[0122]

[0200] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below.

[0123]

[0201] Alternative splicing events in the PKD2 gene can result in non-productive mRNA transcripts and thus reduced protein expression, and therapeutic agents that can target alternative splicing events in the PKD2 gene can regulate (e.g., increase) the expression level of functional protein in patients. Such therapeutic agents can be used to treat conditions caused by deficiencies in polycystin 2 or polycystin 1.

[0124]

[0202] One alternative splicing event that can result in non-productive mRNA transcripts is the inclusion of extra exons in the mRNA transcript, which can induce nonsense-mediated mRNA decay. The present disclosure also provides compositions and methods for regulating the splicing of extra exons from PKD2 pre-mRNA to increase the production of mature mRNA that codes for a protein, and thus the production of translated functional polycystin 2. For example, the compositions and methods provided herein can promote the elimination of extra exons from PKD2 pre-mRNA, thereby regulating the level of processed mRNA that is processed from the pre-mRNA and lacks the extra exons.

[0125]

[0203] Another alternative splicing event that can result in a non-productive mRNA transcript is an alternative 5' splice site event. For example, an exon generated by splicing at an alternative 5' splice site (e.g., downstream of the canonical 5' ss) can be a longer exon than the corresponding canonical exon. For example, an intron generated by splicing at an alternative 5' splice site can be shorter than the corresponding canonical intron. The present disclosure provides compositions and methods for modulating alternative splicing of PKD2 pre-mRNA to increase the production of mature mRNA encoding a protein, thereby increasing the production of translated functional polycystin 2. For example, the compositions and methods provided herein can modulate the processing of PKD2 pre-mRNA by preventing or reducing splicing at alternative 5' splice sites.

[0126]

[0204] These compositions and methods include antisense oligomers (ASOs) that can promote constitutive splicing of the PKD2 pre-mRNA. In various embodiments, functional polycystin 2 can be increased using the methods of the present disclosure to treat conditions caused by deficiencies in polycystin 2 or polycystin 1.

[0127]

[0205] "Polycystin 2" (also known as APC2, PKD4, Pc-2, TRPP2, polycystin kidney disease 2, transient receptor potential cation channel), as referred to herein, includes any recombinant or naturally occurring form of polycystin 2 or a variant or homolog thereof that has or maintains polycystin 2 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to naturally occurring polycystin 2 over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion). In some embodiments, polycystin 2 is substantially identical to a protein identified by UniProt reference number Q13563, or a variant or homolog having substantial identity thereto.

[0128]

[0206] Autosomal dominant polycystic kidney disease (ADPKD) is a common genetic disorder that accounts for 8-10% of end-stage renal disease. ADPKD is genetically heterogeneous, with loci mapped to chromosome 16p13.3 (PKD1) (1) and chromosome 4q21-23 (PKD2). The predicted structures of polycystin-1 (encoded by PKD1) and polycystin-2 (encoded by PKD2), as well as their similar disease profiles, suggest involvement in a common signaling pathway that links extracellular adhesion events with changes in ion transport. Polycystin-1 and polycystin-2 have been shown to interact through their C-terminal cytoplasmic tails. This interaction resulted in the upregulation of polycystin-1, but not polycystin-2. The cytoplasmic tail of polycystin-2 (but not polycystin-1) formed homodimers through a region distinct from the domain required for interaction with polycystin-1. These results are consistent with a mechanism in which mutations in polycystin-2 inhibit the function of polycystin-1, thereby resulting in a disease presentation similar to polycystin-1 through distinct molecular lesions of a common signaling pathway that functions in normal duct formation. Data support the idea that polycystin-1 and polycystin-2 participate in a common signaling pathway that prevents cyst formation (Tsiokas et al., PNAS, Jun 1997, 94(13)6965-6970; incorporated herein by reference in its entirety). Data also support the idea that polycystin-1 and polycystin-2 expression participates in a common signaling pathway that regulates the transition that commonly occurs during prolonged periods of starvation, during which autophagy is downregulated and cell death is increased, and that polycystin-1 and polycystin-2 can regulate this survival-to-death starvation transition in mIMCD (Decuypere, et al., Int. J. Mol. Sci. 2021, 22, 13511). Furthermore, although it is known that dosage changes in PKD1 / PKD2 are important in the pathogenesis of ADPKD, how PKD1 / PKD2 expression is regulated remains poorly understood.However, there is evidence that PKD2 has an upstream open reading frame (uORF) that can repress PKD2 translation (Tang, et al., FASEB J. 2013 Dec;27(12):4998-5009).

[0129]

[0207] The terms "nonsense-dependent RNA decay exon" (or "NSE" or "NMD exon") and "NMD-inducing exon" (or NIE) are used interchangeably and can refer to an exon (e.g., a non-canonical exon) that can activate the NMD pathway when present in a mature RNA transcript. In a constitutive splicing event, the intron containing the NIE is normally spliced ​​out, but during an alternative or aberrant splicing event, the intron or a portion thereof (e.g., the NIE) can be retained. A mature mRNA transcript containing an NIE can be non-productive, for example, due to a frameshift that induces the NMD pathway. In some embodiments, the NMD exon is an exon that contains a premature stop codon (or premature termination codon (PTC)) or other sequence that promotes the degradation of a mature RNA transcript containing the NMD exon. The inclusion of an NIE in a mature RNA transcript can downregulate gene expression. In some embodiments, the NMD exon is an exon that results from an alternative splicing event. For example, the NMD exon may be an exon resulting from an alternative 5' splice site event. For example, the NMD exon may be an exon that contains a canonical exon and at least a portion of an intron adjacent to the canonical exon. For example, the NMD exon may be an exon that contains the entire canonical exon and at least a portion of an intron immediately downstream from the canonical exon. In some embodiments, the NMD exon is a region within an intron (e.g., a canonical intron).

[0130]

[0208] Alternative splicing can result in a mature mRNA transcript containing at least one NSE. The terms "mature mRNA" and "fully spliced ​​mRNA" are used interchangeably herein to refer to fully processed mRNA. Mature mRNAs containing NMD exons can be non-productive mRNAs, resulting in NMD of the mature mRNA. NIE-containing mature mRNAs can sometimes result in reduced protein expression compared to protein expression from the corresponding mature mRNAs that do not contain NIEs.

[0131]

[0209] Pseudo-splice sites have the same splicing recognition sequence as true splice sites, but are not used in the splicing reaction. These splice sites outnumber the true splice sites in the human genome by an order of magnitude and are suppressed by molecular mechanisms that are not well understood so far. Potential 5' splice sites have the consensus NNN / GUNNNN or NNN / GCNNNN, where N is any nucleotide and / is the exon-intron boundary. Potential 3' splice sites have the consensus NAG / N. The activation of these splice sites is positively influenced by the surrounding nucleotides that make them more similar to the optimal consensus of the native splice site, i.e., MAG / GURAGU and YAG / G, respectively, where M is C or A, R is G or A, and Y is C or U.

[0132]

[0210] Splice sites and their regulatory sequences can be readily identified by those skilled in the art using suitable publicly available algorithms, for example those listed in Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 6399-6413 (ncbi.nlm.nih.gov / pmc / articles / PMC2095810 / pdf / gkm680.pdf).

[0133] Splicing and nonsense-mediated mRNA decay

[0211] Intervening sequences or introns are removed by a large and highly dynamic RNA-protein complex called the spliceosome, which orchestrates a complex interplay between the primary transcript, small nuclear RNAs (snRNAs), and numerous proteins. The spliceosome assembles ad hoc in an orderly manner on each intron, starting with recognition of the 5' splice site (5'ss) by U1 snRNA or the 3' splice site (3'ss) by the U2 pathway, involving U2 accessory factor (U2AF) binding to the 3'ss region to facilitate U2 binding to the branch point sequence (BPS). U2AF is a stable heterodimer composed of a 65 kD subunit (U2AF65) encoded by U2AF2, which binds to polypyrimidine tracts (PPTs), and a 35 kD subunit (U2AF35) encoded by U2AF1, which interacts with a highly conserved AG dinucleotide in the 3'ss, stabilizing U2AF65 binding. In addition to the BPS / PPT units and 3'ss / 5'ss, accurate splicing requires auxiliary sequences or structures, known as intronic or exonic splicing enhancers or silencers, that activate or repress splice site recognition. These elements allow the recognition of true splice sites among the vast excess of cryptic or pseudo sites in the genomes of higher eukaryotes that have the same sequence but exceed the number of natural sites by an order of magnitude. The elements often have a regulatory function, but the exact mechanism of their activation or repression is not fully understood.

[0134]

[0212] The decision to splice or not can typically be modeled as a stochastic rather than a deterministic process, such that even the most well-defined splicing signals can be spliced ​​incorrectly. However, under normal conditions, pre-mRNA splicing proceeds with a surprisingly high fidelity. This is due, in part, to the activity of adjacent cis-acting auxiliary exonic and intronic splicing control elements (ESRs or ISRs). Typically, these functional elements are classified as either exonic or intronic splicing enhancers (ESEs or ISEs) or silencers (ESSs or ISSs) based on their ability to stimulate or inhibit splicing, respectively. Although there is evidence that some auxiliary cis-acting elements may act by influencing the dynamics of spliceosome assembly, e.g., the positioning of the complex between the U1 snRNP and the 5'ss, it seems highly likely that many elements function in concert with trans-acting RNA-binding proteins (RBPs). For example, the family of serine- and arginine-rich RBPs (SR proteins) is a family of conserved proteins that play a key role in exon definition. SR proteins promote exon recognition by recruiting components of the pre-spliceosome to adjacent splice sites or by antagonizing the effects of ESS in their vicinity. The repressive effect of ESS can be mediated by members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family, which can alter the recruitment of core splicing factors to adjacent splice sites. In addition to their role in splicing control, silencer elements are suggested to have a role in suppressing pseudoexons, which are a set of decoy intron splice sites with the typical spacing of an exon but which do not have a functional open reading frame. ESEs and ESSs, in cooperation with their cognate trans-acting RBPs, represent key components of the splicing control set that specify when, where, and how mRNA is assembled from its precursor.

[0135]

[0213] The sequences that mark exon-intron boundaries are degenerate signals of various strengths that can occur frequently within human genes. In multi-exon genes, different pairs of splice sites can be linked together in many different combinations to create a wide variety of transcripts from a single gene. This is generally referred to as alternative pre-mRNA splicing. Although most mRNA isoforms generated by alternative splicing can be transported from the nucleus and translated into functional polypeptides, different mRNA isoforms from a single gene can vary greatly in their translation efficiency. mRNA isoforms with premature termination codons (PTCs) or premature stop codons at least 50 bp upstream from the exon junction complex may be targeted for degradation by the nonsense-mediated mRNA decay (NMD) pathway. Mutations in conventional (BPS / PPT / 3'ss / 5'ss) and auxiliary splicing motifs can lead to aberrant splicing, such as exon skipping or cryptic (or pseudo) exon inclusion or splice site activation, and can contribute significantly to human morbidity and mortality. Both aberrant and alternative splicing patterns can be influenced by naturally occurring DNA variants in exons and introns.

[0136]

[0214] Considering that exon-intron boundaries can occur at any of three codon positions, it is clear that only a subset of alternative splicing events can maintain the canonical open reading frame. For example, only exons evenly divisible by 3 can be skipped or included in the mRNA without any change in the reading frame. Splicing events that are not in compatible phase can induce a frameshift. Unless cancelled by downstream events, the frameshift will certainly result in one or more PTCs, possibly resulting in their subsequent degradation by NMD. NMD is a translation-coupled mechanism that excludes mRNAs that contain PTCs. NMD can function as a surveillance pathway that exists in all eukaryotes. NMD can reduce errors in gene expression by removing mRNA transcripts that contain premature stop codons or PTCs. When these abnormal mRNAs are translated, they can lead to deleterious gain-of-function or dominant-negative activity of the resulting protein in some cases. NMD targets not only transcripts with PTCs but also a broad range of mRNA isoforms expressed from many endogenous genes, suggesting that NMD is a master regulator that drives both fine and coarse regulation of steady-state RNA levels in cells.

[0137] Target Gene

[0215] The present disclosure provides compositions and methods for modulating alternative splicing of a target to modulate the production of a mature mRNA encoding a functional protein, and thus the production of a translated functional target protein, where the target is PKD2. These compositions and methods include antisense oligomers (ASOs) that can promote canonical splicing of a target pre-mRNA, where the target is PKD2. In various embodiments, the functional target protein can be increased using the methods of the present disclosure to treat a condition caused by a deficiency of the target protein, where the target is selected from the group consisting of PKD2.

[0138]

[0216] In some embodiments, the method of the present invention is used to increase the production of a functional target protein to treat a condition in a subject in need thereof, where the target is PKD2. In some embodiments, the subject has a condition in which the target protein is not necessarily deficient compared to wild type, but the condition is nevertheless alleviated by an increase in the target protein, where the target is PKD2. In some embodiments, the condition is caused by a sporadic mutation. In some embodiments, the method of the present invention is used to reduce the production of a functional target protein to treat a condition in a subject in need thereof, where the target is PKD2. In some embodiments, the method of the present invention is used to modulate the production of a functional target protein to treat a condition in a subject in need thereof, where the target is PKD2.

[0139] Target transcript

[0217] In some embodiments, the disclosed method exploits the presence of NIE in pre-mRNA transcribed from the PKD2 gene. Splicing of the identified PKD2 NIE pre-mRNA species to generate functional mature PKD2 mRNA can be induced using a therapeutic agent (e.g., ASO) that stimulates skipping of NIE. The resulting mature PKD2 mRNA can be translated normally without activating the NMD pathway, thereby increasing the amount of polycystin 2 in the patient's cells and alleviating symptoms of conditions or diseases associated with PKD2 deficiency, such as polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, and intracranial aneurysms.

[0140]

[0218] Canonical splicing of the identified target NSE pre-mRNA transcript to generate a functional mature target mRNA can be induced using a therapeutic agent (e.g., an ASO) that promotes constitutive splicing of the target NSE pre-mRNA at the canonical splice site. In some embodiments, the resulting functional mature target mRNA is translated normally, thereby increasing the amount of functional target protein in the patient's cells and preventing symptoms of the target-associated disease.

[0141]

[0219] In various embodiments, the present disclosure provides therapeutic agents that can target PKD2 pre-mRNA to modulate splicing or protein expression levels. The therapeutic agent can be a small molecule, a nucleic acid oligomer, or a polypeptide. In some embodiments, the therapeutic agent is an ASO. Various regions or sequences on the PKD2 pre-mRNA can be targeted by therapeutic agents such as ASOs. In some embodiments, the ASO targets the PKD2 NSE pre-mRNA transcribed from the PKD2 gene. In some embodiments, the ASO targets the PKD2 NSE pre-mRNA transcribed from the PKD2 gene that includes a nonsense-mediated RNA decay exon (NSE). In some embodiments, the NSE includes a portion of the canonical intron 3 of the PKD2 pre-mRNA transcript (the intron downstream of the canonical exon 3 of the PKD2 pre-mRNA transcript). In some embodiments, the NSE includes the entire canonical exon 3 of the PKD2 pre-mRNA transcript. In some embodiments, the NSE comprises only a portion of the canonical intron 3 of the PKD2 pre-mRNA transcript and the entire canonical exon 3 of the PKD2 pre-mRNA transcript. In some embodiments, the NSE is included in the PKD2 pre-mRNA transcript by aberrant splicing. In some embodiments, the ASO targets a sequence within the NSE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within exon 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets an exonic sequence upstream (or 5') from the 5' splice site of intron 3 following exon 3 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets an exonic sequence downstream (or 3') from the 3' splice site of intron 2 preceding exon 3 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron adjacent to the 3' end of the NSE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript.In some embodiments, the ASO targets an intron sequence upstream (or 5') from the 3' splice site of intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets an intron sequence downstream (or 3') from the 5' splice site of intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron adjacent to the 5' end of the NSE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets an intron sequence upstream (or 5') from the 3' splice site of intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets an intron sequence downstream (or 3') from the 5' splice site of intron 2 or 3 or 4 of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that includes an exon-intron boundary of the PKD2 pre-mRNA transcript. In some embodiments, the exon is an NSE. An exon-intron boundary may refer to the junction of an exon sequence and an intron sequence. In some embodiments, the intron sequence may be adjacent to the 5' end of the NSE or the 3' end of the exon. In some embodiments, the ASO targets a sequence that includes both a portion of an intron and a portion of an exon.

[0142]

[0220] In some embodiments, the disease or condition that can be treated or alleviated using the methods or compositions disclosed herein is not directly related to the target protein (gene) targeted by the therapeutic agent. In some embodiments, the therapeutic agent provided herein may target a protein (gene) that is not directly related to the disease or condition, but the modulation of the expression of the target protein (gene) can treat or alleviate the disease or condition. For example, targeting a gene such as PKD2 with the therapeutic agent provided herein can treat or alleviate polycystic kidney disease with or without polycystic liver disease, autosomal dominant polycystic kidney disease, or intracranial aneurysm. In some embodiments, the target gene such as PKD2 is said to be applied to a pathway (kidney). In some embodiments, the target gene such as PKD2 is said to be applied to a pathway (polycystic kidney disease with or without polycystic liver disease, or autosomal dominant polycystic kidney disease). In some embodiments, the target gene such as PKD2 is said to be applied to a pathway (intracranial aneurysm).

[0143]

[0221] In various embodiments, the present disclosure provides therapeutic agents that can target PKD2 pre-mRNA transcripts to modulate splicing or protein expression levels. The therapeutic agent can be a small molecule, polynucleotide, or polypeptide. In some embodiments, the therapeutic agent is an ASO. Various regions or sequences on PKD2 pre-mRNA can be targeted by therapeutic agents such as ASOs. In some embodiments, the ASO targets PKD2 pre-mRNA transcripts that contain a NIE. In some embodiments, the ASO targets a sequence within the NIE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence upstream (or 5') from the 5' end of the NIE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence downstream (or 3') from the 3' end of the NIE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron adjacent to the 5' end of the NIE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron adjacent to the 3' end of the NIE of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that includes the NIE-intron boundary of the PKD2 pre-mRNA transcript. The NIE-intron boundary may refer to the junction of the intron sequence and the NIE region. The intron sequence may be adjacent to the 5' end of the NIE or the 3' end of the NIE. In some embodiments, the ASO targets a sequence within an exon of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron of the PKD2 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that includes both a portion of an intron and a portion of an exon of the PKD2 pre-mRNA transcript.

[0144]

[0222] In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides upstream (or 5' side) from the 5' end of the NIE. In some embodiments, the ASO targets a sequence about 1 to about 20 nucleotides, about 20 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 150 nucleotides, about 150 to about 200 nucleotides, about 200 to about 250 nucleotides, or about 250 to about 300 nucleotides upstream (or 5' side) from the 5' end of the NIE region. In some embodiments, the ASO may target a sequence more than 300 nucleotides upstream from the 5' end of the NIE. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3' side) from the 3' end of the NIE. In some embodiments, the ASO targets a sequence that is about 1 to about 20 nucleotides, about 20 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 150 nucleotides, about 150 to about 200 nucleotides, about 200 to about 250 nucleotides, or about 250 to about 300 nucleotides downstream from the 3' end of the NIE. In some embodiments, the ASO targets a sequence that is more than 300 nucleotides downstream from the 3' end of the NIE.

[0145]

[0223] In some embodiments, the ASO disclosed herein targets an NSE pre-mRNA transcribed from a PKD2 genomic sequence. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a genomic sequence that includes an NSE from the PKD2 genomic sequence. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a genomic sequence that includes an intron adjacent to the 3' end of the NSE and an intron adjacent to the 5' end of the NSE from the PKD2 genomic sequence. In some embodiments, the ASO targets an NSE pre-mRNA transcript that includes a sequence selected from the group consisting of pre-mRNA transcripts in Table 3. In some embodiments, the ASO targets a pre-mRNA sequence that includes an NSE from the PKD2 pre-mRNA sequence. In some embodiments, the ASO targets a pre-mRNA sequence that includes an intron adjacent to the 3' end of the NSE from the PKD2 pre-mRNA sequence. In some embodiments, the ASO targets a pre-mRNA sequence that includes an intron adjacent to the 5' end of the NSE from the PKD2 pre-mRNA sequence. In some embodiments, the transcript is selected from the group consisting of transcripts in Table 3.

[0146]

[0224] In some embodiments, the PKD2 NIE-containing pre-mRNA transcript is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3. In some embodiments, the PKD2 NIE pre-mRNA transcript comprises a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3.

[0147]

[0225] In some embodiments, the PKD2 NIE-containing pre-mRNA transcript comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3. In some embodiments, the PKD2 NIE-containing pre-mRNA transcript is encoded by a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3. In some embodiments, the targeting portion of the pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any one of the sequences listed in Table 2 or Table 3.

[0148]

[0226] In some embodiments, the pre-mRNA transcript comprises a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a pre-mRNA transcript of a PKD2 pre-mRNA transcript described herein or its complementary sequence. In some embodiments, the targeting portion of a pre-mRNA selected from the group consisting of PKD2 pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of a pre-mRNA transcript sequence of Table 2 or Table 3 or its complementary sequence. In some embodiments, the targeting portion of a PKD2 pre-mRNA comprises a sequence complementary to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleic acids of a sequence of Table 2 or Table 3 or its complementary sequence.

[0149]

[0227] In some embodiments, the ASO disclosed herein targets an NSE pre-mRNA transcribed from a PKD2 genomic sequence. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a PKD2 genomic sequence that includes an NSE. In some embodiments, the NSE includes exon 3. In some embodiments, the NSE is the third exon of the PKD2 transcript. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a PKD2 genomic sequence that includes exon 3 or 4. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a PKD2 genomic sequence that includes an intron adjacent to the 3' end of the NSE and an intron adjacent to the 5' end of the NSE. In some embodiments, the intron adjacent to the 3' end of the NSE is intron 3 and the intron adjacent to the 5' end of the NSE is intron 2. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a PKD2 genomic sequence that includes intron 2, exon 3, and intron 3. In some embodiments, the ASO targets an NSE pre-mRNA transcript that includes exon 3 and exon 4. In some embodiments, the ASO targets a PKD2 pre-mRNA sequence that includes an NSE. In some embodiments, the ASO targets a PKD2 pre-mRNA sequence that includes exon 3. In some embodiments, the ASO targets a PKD2 pre-mRNA sequence that includes an intron adjacent to the 3' end of the NSE. In some embodiments, the ASO targets a PKD2 pre-mRNA sequence that includes intron 3. In some embodiments, the ASO targets a PKD2 pre-mRNA sequence that includes an intron adjacent to the 5' end of the NSE.

[0150]

[0228] In some embodiments, the PKD2 pre-mRNA transcript is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to Ensembl reference number ENSG00000118762.8 or its complement. In some embodiments, the PKD2 pre-mRNA transcript comprises a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a PKD2 pre-mRNA transcript described herein or its complement.

[0151]

[0229] In some embodiments, the targeting portion of the PKD2 pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of a sequence in Table 3, or its complement. In some embodiments, the targeting portion of the PKD2 pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3, or its complement. In some embodiments, the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of the sequences in Table 4, or its complement.

[0152]

[0230] In some embodiments, the ASO disclosed herein targets an NSE pre-mRNA transcribed from a target genomic sequence. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a target genomic sequence that includes an NSE. In some embodiments, the ASO targets an NSE pre-mRNA transcript from a target genomic sequence that includes an intron adjacent to the 3' end of the NSE and an intron adjacent to the 5' end of the NSE. In some embodiments, the ASO targets an NSE pre-mRNA transcript that includes a sequence selected from the pre-mRNA transcript sequences in Table 3. In some embodiments, the ASO targets an NSE pre-mRNA transcript that includes a sequence selected from the pre-mRNA transcript sequences in Table 3 represented by Ensembl reference numbers. In some embodiments, the ASO targets a target pre-mRNA sequence that includes an NSE. In some embodiments, the ASO targets a target pre-mRNA sequence that includes an intron adjacent to the 3' end of the NSE. In some embodiments, the ASO targets a target pre-mRNA sequence that includes an intron adjacent to the 5' end of the NSE. In some embodiments, the transcript is selected from the group consisting of the transcript sequences in Table 3. In some embodiments, the transcript is selected from the group consisting of the transcript sequences in Table 3, represented by Ensembl reference numbers.

[0153]

[0231] In some embodiments, the target pre-mRNA transcript is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a gene sequence represented by an Ensembl reference number or its complement. In some embodiments, the target pre-mRNA transcript comprises a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target pre-mRNA transcript described herein or its complement.

[0154]

[0232] In some embodiments, the targeting portion of the target pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of the sequences of Table 2 or Table 3 or their complements. In some embodiments, the targeting portion of the target pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of the sequences of Table 3 or Table 2 or their complements as represented by Ensembl reference numbers. In some embodiments, the targeting portion of the target pre-mRNA comprises a sequence complementary to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleic acids of the sequences of Table 2 or Table 3 or their complements.

[0155]

[0233] In some embodiments, the ASO targets exon 3 of the PKD2 pre-mRNA, which contains the NSE. In some embodiments, the ASO targets a sequence about 2 nucleotides downstream (or 3') from the 5' splice site of intron 3 to about 4 nucleotides upstream (or 5') from the 3' splice site of intron 2. In some embodiments, the ASO targets a sequence about 2 nucleotides upstream (or 5') from the 5' splice site of intron 3 to about 4 nucleotides downstream (or 3') from the 3' splice site of intron 2. In some embodiments, the ASO has a sequence according to any one of the sequences listed in Table 4, or a complement thereof.

[0156]

[0234] In some embodiments, the ASO targets intron 3 of the PKD2 pre-mRNA, which contains an NSE. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides upstream (or 5') from the 3' splice site of intron 3. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3') from the 3' splice site of intron 3. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides upstream (or 5') from the 5' splice site of intron 3. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3') from the 5' splice site of intron 3. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3') from the 5' splice site of intron 3. In some embodiments, the ASO targets a sequence about 6 to about 100 nucleotides upstream (or 5') from the 3' splice site of intron 2. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3') from the 3' splice site of intron 2. In some embodiments, the ASO targets a sequence about 6 to about 100 nucleotides upstream (or 5') from the 5' splice site of intron 2. In some embodiments, the ASO targets a sequence about 4 to about 300 nucleotides downstream (or 3') from the 5' splice site of intron 2. In some embodiments, the ASO has a sequence according to any of the sequences in Table 4, or its complement.

[0157]

[0235] In some embodiments, the targeting portion of the PKD2 pre-mRNA is in intron 2, 3, or 4. In some embodiments, the targeting portion of the PKD2 pre-mRNA is in exon 2, 3, 4, or 5. In some embodiments, hybridization of the ASO with the targeting portion of the NSE pre-mRNA results in the inclusion of canonical exon 3, followed by increased production of polycystin 2. In some embodiments, hybridization of the ASO with the targeting portion of the NSE pre-mRNA results in the exclusion of a canonical exon, followed by decreased production of polycystin 2. In some embodiments, hybridization of the ASO with the targeting portion of the NSE pre-mRNA results in the inclusion or exclusion of a canonical exon, followed by modulating the production of polycystin 2. In some embodiments, the targeting portion of the PKD2 pre-mRNA is in exon 3 or 4. In some embodiments, the targeting portion of the PKD2 pre-mRNA is in intron 2. In some embodiments, the targeting portion of the PKD2 pre-mRNA is in intron 3.

[0158]

[0236] In some embodiments, the ASO targets exon 2x of the PKD2 NIE-containing pre-mRNA, which contains the NIE exon 2.

[0237] In some embodiments, the ASO targets exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2.

[0159]

[0238] In some embodiments, the ASO targets a sequence about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream (or 5') of the 5' end of exon 2x of PKD2. In some embodiments, the ASO targets a sequence about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr4:88031085 88031140 of PKD2.

[0160]

[0239] In some embodiments, the ASO targets a sequence up to about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, or 50 nucleotides upstream (or 5') of the 5' end of exon 2x of PKD2. In some embodiments, the ASO targets a sequence up to about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, or 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr4:88031085 88031140 of PKD2.

[0161]

[0240] In some embodiments, the ASO targets a sequence about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream (or 3') from the 3' end of exon 2x of PKD2. In some embodiments, the ASO targets a sequence about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream (or 3') of GRCh38 / hg38:chr4:88031085 88031140 of PKD2.

[0162]

[0241] In some embodiments, the ASO targets a sequence up to about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, or 50 nucleotides downstream (or 3') from the 3' end of exon 2x of PKD2. In some embodiments, the ASO targets a sequence up to about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, or 50 nucleotides downstream (or 3') of GRCh38 / hg38:chr4:88031085 88031140 of PKD2.

[0163]

[0242] In some embodiments, the ASO has a sequence complementary to a targeting portion of a pre-mRNA according to any one of the sequences listed in Table 2 or Table 3.

[0164]

[0243] In some embodiments, the ASO targets a sequence upstream from the 5' end of the NIE. For example, an ASO targeting a sequence upstream from the 5' end of the NIE (e.g., exon 2x of PKD2) comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to at least 8 consecutive nucleic acids of any one of the sequences listed in Table 2 or Table 3. For example, an ASO targeting a sequence upstream from the 5' end of the NIE (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140)) of PKD2 can comprise a sequence that has at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3.

[0165]

[0244] In some embodiments, the ASO targets a sequence containing an exon-intron boundary (or junction). For example, an ASO targeting a sequence containing an exon-intron boundary can include a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to at least 8 consecutive nucleic acids of any one of the sequences listed in Table 2 or Table 3. In some embodiments, the ASO targets a sequence downstream from the 3' end of the NIE. For example, an ASO targeting a sequence downstream from the 3' end of the NIE (e.g., exon 2x of PKD2) can include a sequence that has at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3. For example, an ASO that targets a sequence downstream from the 3' end of the NIE of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140)) can include a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the sequences listed in Table 2 or Table 3. In some embodiments, the ASO targets a sequence within the NIE.

[0166]

[0245] In some embodiments, the ASO targets exon 2x of the PKD2 NIE-containing pre-mRNA, which contains the NIE exon 2. In some embodiments, the ASO targets a sequence downstream (or 3') from the 5' end of exon 2x of the PKD2 pre-mRNA. In some embodiments, the ASO targets an exon 2x sequence upstream (or 5') from the 3' end of exon 2x of the PKD2 pre-mRNA.

[0167]

[0246] In some embodiments, the targeted portion of the PKD2 NIE-containing pre-mRNA is in intron 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. In some embodiments, hybridization of the ASO with the targeting portion of the NIE pre-mRNA results in at least one exon skipping of the NIE within intron 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, and subsequently increases polycystin 2 production. In some embodiments, the targeting portion of the PKD2 NIE-containing pre-mRNA is in intron 2 of PKD2. In some embodiments, the targeting portion of the PKD2 NIE-containing pre-mRNA is an intron of PKD2 (GRCh38 / hg38:chr4 88019572 88036219).

[0168]

[0247] In some embodiments, the disclosed methods and compositions are used to increase expression of PKD2 by inducing exon skipping of a NIE in a PKD2 NIE-containing pre-mRNA. In some embodiments, the NIE is a sequence within any of introns 1-50. In some embodiments, the NIE is a sequence within any of introns 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. In some embodiments, the NIE can be any PKD2 intron or a portion thereof. In some embodiments, the NIE is within intron 2 of PKD2. In some embodiments, the NIE is within an intron of PKD2 (GRCh38 / hg38:chr4 88019572 88036219).

[0169] Protein expression

[0248] In some embodiments, the mutation occurs at both alleles. In some embodiments, the mutation occurs at one of the two alleles. In some embodiments, a further mutation occurs at one of the two alleles. In some embodiments, the further mutation occurs at the same allele as the first mutation. In other embodiments, the further mutation is a trans mutation.

[0170]

[0249] In some embodiments, the methods described herein are used to increase the production of functional polycystin 2 protein or RNA. As used herein, the term "functional" refers to the amount of activity or function of polycystin 2 protein or RNA necessary to eliminate any one or more symptoms of the condition or disease being treated, e.g., polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, and intracranial aneurysms. In some embodiments, the methods are used to increase the production of partially functional polycystin 2 protein or RNA. As used herein, the term "partially functional" refers to any amount of activity or function of polycystin 2 protein or RNA that is less than the amount of activity or function necessary to eliminate or prevent any one or more symptoms of the disease or condition. In some embodiments, a partially functional protein or RNA has at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% less activity than a fully functional protein or RNA.

[0171]

[0250] In some embodiments, the method is a method of increasing expression of polycystin 2 by cells of a subject having a NIE-containing pre-mRNA encoding polycystin 2, the subject having polycystic kidney disease with or without polycystic liver cysts, autosomal dominant polycystic kidney disease, or intracranial aneurysm caused by a deficiency in the amount of activity of polycystin 2, the deficiency in the amount of polycystin 2 being caused by haploinsufficiency of polycystin 2. In such embodiments, the subject has a first allele that encodes functional polycystin 2 and a second allele that does not produce polycystin 2. In another such embodiment, the subject has a first allele that encodes functional polycystin 2 and a second allele that encodes non-functional polycystin 2. In another such embodiment, the subject has a first allele that encodes functional polycystin 2 and a second allele that encodes partially functional polycystin 2. In any of these embodiments, the antisense oligomer binds to a targeted portion of the NIE-containing pre-mRNA transcribed from the second allele, thereby inducing exon skipping of the NIE from the pre-mRNA, resulting in increased levels of mature mRNA encoding functional polycystin 2 and increased expression of polycystin 2 in cells of the subject.

[0172]

[0251] In some embodiments, the method is a method of decreasing expression of a target protein by cells of a subject having an NSE pre-mRNA encoding the target protein, the subject having a disease caused by an excess amount of activity of the target protein, the excess amount of the target protein being caused by a mutation, and the target being any one selected from the group consisting of PKD2. In some embodiments, the antisense oligomer binds to a targeting portion of the NSE pre-mRNA transcribed from an allele carrying a mutation, thereby increasing alternative splicing of the NSE into the pre-mRNA, causing a decrease in the level of mature mRNA encoding a functional target protein and a decrease in expression of the target protein in the cells of the subject. In a related embodiment, the method is a method of using an ASO to decrease expression of a functional protein or functional RNA. In some embodiments, an ASO is used to decrease expression of a target protein in cells of a subject having an NSE pre-mRNA encoding the target protein, the subject having an excess amount or function of the target protein.

[0173]

[0252] In some embodiments, the method is a method of modulating expression of a target protein by cells of a subject having an NSE pre-mRNA encoding the target protein, the subject having a disease caused by a deficiency or excess amount of activity of the target protein, the deficiency or excess amount of the target protein is caused by a mutation, and the target is any one selected from the group consisting of PKD2. In some embodiments, the antisense oligomer binds to a targeting portion of the NSE pre-mRNA transcribed from an allele carrying a mutation, thereby modulating alternative splicing of the NSE into the pre-mRNA, causing modulation of the level of mature mRNA encoding a functional target protein and modulation of expression of the target protein in the cells of the subject. In related embodiments, the method is a method of using an ASO to modulate expression of a functional protein or functional RNA. In some embodiments, an ASO is used to modulate expression of a target protein in cells of a subject having an NSE pre-mRNA encoding the target protein, the subject having an abnormal amount or function of the target protein.

[0174]

[0253] In some embodiments, the method is a method of increasing expression of polycystin 2 by cells of a subject having a NIE-containing pre-mRNA encoding polycystin 2, wherein the subject has polycystic kidney disease with or without polycystic liver cysts, autosomal dominant polycystic kidney disease, or intracranial aneurysms caused by a deficiency in the amount of polycystin 2 activity, and the deficiency in the amount of polycystin 2 is caused by autosomal recessive inheritance.

[0175]

[0254] In some embodiments, the method is a method of increasing expression of polycystin 2 by cells of a subject having a NIE-containing pre-mRNA encoding polycystin 2, wherein the subject has polycystic kidney disease with or without polycystic liver cysts, autosomal dominant polycystic kidney disease, or intracranial aneurysms caused by a deficiency in the amount of polycystin 2 activity, and wherein the deficiency in the amount of polycystin 2 is caused by autosomal dominant inheritance.

[0176]

[0255] In some embodiments, the method is a method of increasing expression of polycystin 2 by cells of a subject having a NIE-containing pre-mRNA encoding polycystin 2, wherein the subject has polycystic kidney disease with or without polycystic liver cysts, autosomal dominant polycystic kidney disease, or intracranial aneurysms caused by a deficiency in the amount of polycystin 2 activity, and wherein the deficiency in the amount of polycystin 2 is caused by X-linked dominant inheritance.

[0177]

[0256] In related embodiments, this method is a method of using ASO to increase the expression of protein or functional RNA.In some embodiments, ASO can be used to increase the expression of polycystin 2 in the cells of a subject that has NIE-containing pre-mRNA encoding polycystin 2, and the subject has a defect in the amount or function of polycystin 2, such as polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, or intracranial aneurysm.

[0178]

[0257] In some embodiments, NIE-containing pre-mRNA transcripts that code for proteins that cause a disease or condition are targeted by the ASOs described herein. In some embodiments, NIE-containing pre-mRNA transcripts that code for proteins that do not cause a disease are targeted by the ASOs. For example, a disease that is the result of a mutation or defect in a first protein in a particular pathway can be alleviated by targeting a NIE-containing pre-mRNA that codes for a second protein, thereby increasing the production of the second protein. In some embodiments, the function of the second protein can compensate for the mutation or defect in the first protein (that causes the disease or condition). In some embodiments, a subject has (a) a first allele that is wild type and (b) a second allele that is a mutant allele in which (i) polycystin 2 is produced at a reduced level compared to production from the wild type allele, (ii) polycystin 2 is produced in a form that has reduced function compared to the equivalent wild type protein, or (iii) no polycystin 2 or functional RNA is produced.

[0179]

[0258] In some embodiments, the subject (a) a first mutant allele, (i) polycystin 2 is produced at reduced levels compared to production from a wild-type allele; (ii) polycystin 2 is produced in a form that has reduced functionality compared to the equivalent wild-type protein, or (iii) a first mutant allele, wherein polycystin 2 or functional RNA is not produced; and (b) a second mutant allele, (i) polycystin 2 is produced at reduced levels compared to production from a wild-type allele; (ii) polycystin 2 is produced in a form that has reduced functionality compared to the equivalent wild-type protein, or (iii) a second mutant allele in which polycystin 2 is not produced; The NIE-containing pre-mRNA is transcribed from a first allele and / or a second allele, such that if the subject has the first variant allele (a)(iii), the second variant allele is not (b)(iii), and if the subject has the second variant allele (b)(iii), the first variant allele is not (a)(iii). In these embodiments, the ASO binds to a targeted portion of the NIE-containing pre-mRNA transcribed from the first allele or the second allele, thereby inducing exon skipping of the NIE from the NIE-containing pre-mRNA, causing an increase in the level of mRNA encoding polycystin 2 in the cells of the subject, and an increase in expression of the target protein or functional RNA. In these embodiments, the target protein or functional RNA having an increased expression level resulting from exon skipping of the NIE from the NIE-containing pre-mRNA can be in a form that has either reduced function compared to the equivalent wild-type protein (partially functional) or full function compared to the equivalent wild-type protein (fully functional).

[0180]

[0259] In some embodiments, the level of mRNA encoding polycystin-2 is increased by 1.1-10 fold compared to the amount of mRNA encoding polycystin-2 produced in control cells (e.g., those not treated with an antisense oligomer, or those treated with an antisense oligomer that does not bind to a targeted portion of the PKD2 NIE-containing pre-mRNA).

[0181]

[0260] In some embodiments, the subject treated with the methods of the present disclosure expresses partially functional polycystin 2 from one allele, where the partially functional polycystin 2 may be caused by a frameshift mutation, a nonsense mutation, a missense mutation, or a partial gene deletion. In some embodiments, the subject treated with the methods of the present disclosure expresses non-functional polycystin 2 from one allele, where the non-functional polycystin 2 may be caused by a frameshift mutation, a nonsense mutation, a missense mutation, a partial gene deletion in one allele. In some embodiments, the subject treated with the methods of the present disclosure has a PKD2 full gene deletion in one allele.

[0182] exon inclusion

[0261] In some embodiments, the encompassing NIE is the most abundant NIE in a population of NIE-containing pre-mRNAs transcribed from a gene encoding a target protein in a cell. In some embodiments, the encompassing NIE is the most abundant NIE in a population of NIE-containing pre-mRNAs transcribed from a gene encoding a target protein in a cell, and the population of NIE-containing pre-mRNAs includes two or more encompassing NIEs. In some embodiments, an antisense oligomer targeted to the most abundant NIE in a population of NIE-containing pre-mRNAs encoding a target protein induces exon skipping of one or more NIEs in the population (including the NIE to which the antisense oligomer is targeted or binds). In some embodiments, the targeted region is in the most abundant NIE in the NIE-containing pre-mRNA encoding polycystin 2.

[0183]

[0262] The degree of exon inclusion can be expressed as an exon inclusion percentage (e.g., the percentage of transcripts that contain a given NIE). Briefly, the exon inclusion percentage can be calculated as the percentage of the amount of RNA transcripts with exon inclusion relative to the sum of the average amount of RNA transcripts with exon inclusion and the average amount of RNA transcripts with exon exclusion.

[0184]

[0263] NSEs can arise as a result of splicing at an additional base pair.

[0264] The degree of alternative splicing can be expressed as the percentage of alternative splicing (e.g., the percentage of transcripts that contain a given NSE). Briefly, the percentage of alternative splicing can be calculated as the percentage of the amount of RNA transcripts with NSE relative to the sum of the average amount of RNA transcripts with NSE and the average amount of RNA transcripts with only canonical exons.

[0185]

[0265] In some embodiments, an inclusion NIE is an exon identified as an inclusion NIE based on a determination of inclusion of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50%. In an embodiment, the NIE contained is about 5% to about 100%, about 5% to about 95%, about 5% to about 90%, about 5% to about 85%, about 5% to about 80%, about 5% to about 75%, about 5% to about 70%, about 5% to about 65%, about 5% to about 60%, about 5% to about 55%, about 5% to about 50%, about 5% to about 45%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 10% to about 100%, about 10% to about 95%, about 10% to about 90%, About 10% to about 85%, about 10% to about 80%, about 10% to about 75%, about 10% to about 70%, about 10% to about 65%, about 10% to about 60%, about 10% to about 55%, about 10% to about 50%, about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 15% to about 100%, about 15% to about 95%, about 15% to about 90%, about 15% to about 85%, about 15% to about 80%, about 15% to about 75%, about 15% to about 70 %, about 15% to about 65%, about 15% to about 60%, about 15% to about 55%, about 15% to about 50%, about 15% to about 45%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 20% to about 100%, about 20% to about 95%, about 20% to about 90%, about 20% to about 85%, about 20% to about 80%, about 20% to about 75%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55%, about 20% to about 50%, about 20% to about Exons identified as inclusion NIEs based on a determination of inclusion of 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 25% to about 100%, about 25% to about 95%, about 25% to about 90%, about 25% to about 85%, about 25% to about 80%, about 25% to about 75%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, or about 25% to about 35%.ENCODE data (e.g., as described in Tilgner, et al., 2012, “Deep sequencing of subcellular RNA fractions shows splicing to be predominantly co-transcriptional in the human genome but inefficient for lncRNAs,” Genome Research 22(9):1616-25) can be used to help identify exon inclusion.

[0186]

[0266] In some embodiments, contacting a cell with an ASO complementary to a targeted portion of the PKD2 pre-mRNA transcript results in an increase in the amount of polycystin 2 produced by at least 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or 1000% compared to the amount of protein produced by the cell in the absence of the ASO / treatment. In some embodiments, the total amount of polycystin 2 produced by cells contacted with an antisense oligomer is about 20% to about 300%, about 50% to about 300%, about 100% to about 300%, about 150% to about 300%, about 20% to about 50%, about 20% to about 100%, about 20% to about 150%, about 20% to about 200%, about 20% to about 250%, about 50% to about 100%, about 50% to about 5 ... an increase of 0% to about 150%, about 50% to about 200%, about 50% to about 250%, about 100% to about 150%, about 100% to about 200%, about 100% to about 250%, about 150% to about 200%, about 150% to about 250%, about 200% to about 250%, at least about 10%, at least about 20%, at least about 50%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300%. In some embodiments, the total amount of polycystin 2 produced by cells contacted with an antisense oligomer is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 ... fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold. The control compound can be, for example, an oligonucleotide that is not complementary to the targeted portion of the pre-mRNA.

[0187]

[0267] In some embodiments, contacting a cell with an ASO complementary to a targeted portion of a PKD2 pre-mRNA transcript results in an increase in the amount of mRNA encoding PKD2 (including mature mRNA encoding a target protein). In some embodiments, the amount of mRNA encoding polycystin 2 or mature mRNA encoding polycystin 2 is increased by at least 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or 1000% compared to the amount of protein produced by the cell in the absence of the ASO / treatment. In some embodiments, the total amount of mRNA encoding polycystin 2 or mature mRNA encoding polycystin 2 produced in cells contacted with an antisense oligomer is about 20% to about 300%, about 50% to about 300%, about 100% to about 300%, about 150% to about 300%, about 20% to about 50%, about 20% to about 100%, about 20% to about 150%, about 20% to about 20% compared to the amount of mature RNA produced in untreated cells (e.g., untreated cells or cells treated with a control compound). 00%, about 20% to about 250%, about 50% to about 100%, about 50% to about 150%, about 50% to about 200%, about 50% to about 250%, about 100% to about 150%, about 100% to about 200%, about 100% to about 250%, about 150% to about 200%, about 150% to about 250%, about 200% to about 250%, at least about 10%, at least about 20%, at least about 50%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% increase.In some embodiments, the total amount of mRNA encoding polycystin 2 or mature mRNA encoding polycystin 2 produced in cells contacted with an antisense oligomer is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 10 ... about 7-fold, about 1.1-about 8-fold, about 1.1-about 9-fold, about 2-about 5-fold, about 2-about 6-fold, about 2-about 7-fold, about 2-about 8-fold, about 2-about 9-fold, about 3-about 6-fold, about 3-about 7-fold, about 3-about 8-fold, about 3-about 9-fold, about 4-about 7-fold, about 4-about 8-fold, about 4-about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold increase. The control compound can be, for example, an oligonucleotide that is not complementary to the targeted portion of the PKD2 NIE-containing pre-mRNA.

[0188]

[0268] In some embodiments, contacting a cell with an ASO complementary to a targeted portion of a PKD2 pre-mRNA transcript results in a decrease in the amount of polycystin 2 produced by at least 10, 20, 30, 40, 50, 60, 80, 100%, compared to the amount of protein produced by the cell in the absence of the ASO / treatment. In some embodiments, the total amount of polycystin 2 produced by cells contacted with an antisense oligomer is reduced by about 20% to about 100%, about 50% to about 100%, about 20% to about 50%, or about 20% to about 100%, compared to the amount of target protein produced by a control compound. In some embodiments, the total amount of polycystin 2 produced by cells contacted with an antisense oligomer is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 ... fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold. The control compound can be, for example, an oligonucleotide that is not complementary to the targeted portion of the pre-mRNA.

[0189]

[0269] In some embodiments, the level of mRNA encoding polycystin-2 is reduced by 1.1 to 10 fold compared to the amount of mRNA encoding polycystin-2 produced in control cells (e.g., those not treated with an antisense oligomer, or those treated with an antisense oligomer that does not bind to a targeted portion of a PKD2-containing pre-mRNA).

[0190]

[0270] In some embodiments, the level of mRNA encoding polycystin 2 is reduced by 1.1 to 10 fold compared to the amount of mRNA encoding polycystin 2 produced in control cells (e.g., those not treated with an antisense oligomer, or those treated with an antisense oligomer that does not bind to a targeted portion of the PKD2 pre-mRNA).

[0191]

[0271] In some embodiments of the present invention, the subject may have a mutation in PKD2. A variety of pathogenic variants, including missense variants, nonsense variants, single and double base insertions and deletions, complex insertions / deletions, and splice site variants, have been reported to cause PKD2 deficiency. In the presence of this pathogenic variant, approximately 2%-5% of the transcripts are correctly spliced, resulting in residual enzymatic activity. In some embodiments, the disease results from loss of function of PKD2 caused by PKD2 pathogenic variants that generate truncated proteins or proteins with altered conformation or reduced activity.

[0192]

[0272] In some embodiments, subjects with any of the PKD2 mutations known in the art and described above can be treated using the methods and compositions described herein. In some embodiments, the mutation is in any PKD2 intron or exon. In some embodiments, the mutation is in PKD2 exon 2, 3, or 4.

[0193]

[0273] The NIE may be of any length. In some embodiments, the NIE does not include the entire sequence of the intron. In some embodiments, the NIE includes the entire sequence of the intron, the entire sequence of the exon upstream of the intron, and the entire sequence of the exon downstream of the intron. In some embodiments, the NIE may be a portion of an intron. In some embodiments, the NIE may include a 5' end portion of a canonical intron sequence. In some embodiments, the NIE may include a canonical 5'ss sequence of a canonical intron. In some embodiments, the NIE may include a 3' end portion of a canonical intron. In some embodiments, the NIE may include a canonical 3'ss sequence of a canonical intron. In some embodiments, the NIE may be a portion of an intron that does not include the canonical 5'ss sequence of the intron. In some embodiments, the NIE may be a portion of an intron that does not include the canonical 3'ss sequence of the intron. In some embodiments, a NIE can be a portion within an intron that does not include either the canonical 5'ss sequence or the canonical 3'ss sequence of the intron. In some embodiments, a NIE can be 5 to 10 nucleotides, 10 to 15 nucleotides, 15 to 20 nucleotides, 20 to 25 nucleotides, 25 to 30 nucleotides, 30 to 35 nucleotides, 35 to 40 nucleotides, 40 to 45 nucleotides, 45 to 50 nucleotides, 50 to 55 nucleotides, 55 to 60 nucleotides, 60 to 65 nucleotides, 65 to 70 nucleotides, 70 to 75 nucleotides, 75 to 80 nucleotides, 80 to 85 nucleotides, 85 to 90 nucleotides, 90 to 95 nucleotides, or 95 to 100 nucleotides in length.In some embodiments, the NIE may be at least 10 nucleotides long, at least 20 nucleotides long, at least 30 nucleotides long, at least 40 nucleotides long, at least 50 nucleotides long, at least 60 nucleotides long, at least 70 nucleotides long, at least 80 nucleotides long, at least 90 nucleotides long, or at least 100 nucleotides long. In some embodiments, the NIE may be 100-200 nucleotides long, 200-300 nucleotides long, 300-400 nucleotides long, 400-500 nucleotides long, 500-600 nucleotides long, 600-700 nucleotides long, 700-800 nucleotides long, 800-900 nucleotides long, or 900-1,000 nucleotides long. In some embodiments, the NIE may be greater than 1,000 nucleotides long.

[0194]

[0274] The inclusion of an NIE leads to frameshifting and the introduction of a premature termination codon (PTC) (or premature stop codon) in the mature mRNA transcript, which may target the transcript for NMD. A mature mRNA transcript containing an NIE may be a non-productive mRNA transcript that does not result in protein expression. A PTC may be present at any position downstream of an NIE. In some embodiments, a PTC may be present in any exon downstream of an NIE. In some embodiments, a PTC may be present within an NIE. For example, when an mRNA transcript encoded by a PKD2 gene includes exon 2x of PKD2 pre-mRNA, a PTC may be induced in the mRNA transcript. For example, when an mRNA transcript encoded by PKD2 includes exons of PKD2 (GRCh38 / hg38:chr4:88031085 88031140).

[0195] Therapeutic Agents

[0275] In some embodiments, as used herein, a drug refers to a therapeutic agent. In some embodiments, as used herein, a therapeutic agent refers to a drug.

[0196]

[0276] In various embodiments of the present disclosure, compositions and methods are provided, including therapeutic agents, for modulating protein expression levels of PKD2. In some embodiments, provided herein are compositions and methods for modulating alternative splicing of PKD2 pre-mRNA. In some embodiments, provided herein are compositions and methods for inducing exon skipping in splicing of PKD2 pre-mRNA, e.g., for inducing skipping of NMD exons during splicing of PKD2 pre-mRNA. In other embodiments, therapeutic agents can be used to induce exon inclusion to reduce protein expression levels.

[0197]

[0277] The therapeutic agent disclosed herein can be an NIE repressor agent. The therapeutic agent can include a polynucleic acid polymer. The therapeutic agent disclosed herein can be an alternative splicing inhibitor. In some embodiments, the therapeutic agent can include a polynucleic acid polymer. In other embodiments, the therapeutic agent can include a small molecule. In other embodiments, the therapeutic agent can include a polypeptide. In some embodiments, the therapeutic agent is a nucleic acid binding protein, with or without complexation with a nucleic acid molecule. In other embodiments, the therapeutic agent is a nucleic acid molecule encoding another therapeutic agent. In further embodiments, the therapeutic agent is incorporated into a viral delivery system (e.g., an adenovirus-associated vector).

[0198]

[0278] According to one aspect of the disclosure, provided herein is a method of treating or preventing a condition or disease associated with a deficiency in functional polycystin 2 or polycystin 1, comprising administering to a subject an NIE inhibitor to increase the level of functional polycystin 2, where the agent binds to a region of a pre-mRNA transcript to reduce NIE inclusion in the mature transcript. For example, provided herein is a method of treating or preventing a condition associated with a deficiency in functional polycystin 2 or polycystin 1, comprising administering to a subject an NIE inhibitor to increase the level of functional polycystin 2, where the agent binds to a region of an intron containing an NIE (e.g., exon 2x of PKD2) of a pre-mRNA transcript or to an NIE activation regulatory sequence within the same intron. For example, provided herein is a method of treating or preventing a condition associated with a deficiency in functional polycystin 2 or polycystin 1, comprising administering to a subject an NIE inhibitor to increase the level of functional polycystin 2, wherein the agent binds to a region of an intron containing an NIE in a pre-mRNA transcript (e.g., a region of an intron containing an NIE in a pre-mRNA transcript (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2)) or an NIE activating regulatory sequence within the same intron. As another example, provided herein is a method of treating or preventing a condition associated with a deficiency in functional polycystin 2 or polycystin 1, comprising administering to a subject an alternative splicing inhibitor to increase the level of functional polycystin 2, wherein the agent binds to a region of an exon or intron in a pre-mRNA transcript (e.g., exon 3 or 4, intron 2, 3, or 4 of the human PKD2 gene).

[0199]

[0279] According to one aspect of the disclosure, provided herein is a method for treating or preventing a condition associated with a deficiency of functional polycystin 2 or polycystin 1, comprising administering to a subject an alternative splicing inhibitor to increase levels of functional polycystin 2, wherein the agent binds to a region of the pre-mRNA transcript and reduces the inclusion of NSEs in the mature transcript.

[0200]

[0280] Alternatively, for example, provided herein is a method for treating or preventing a condition associated with overexpression of a functional target protein, comprising administering to a subject an alternative splicing inhibitor to reduce the level of the functional target protein, wherein the agent binds to an exon or intron region of a pre-mRNA transcript, and the target protein is polycystin 2.

[0201]

[0281] When referring to a reduction in NIE inclusion in mature mRNA, the reduction may be complete, e.g., 100%, or partial. The reduction may be clinically significant. The reduction / correction may be compared to the level of NIE inclusion in subjects without treatment, or compared to the amount of NIE inclusion in a population of similar subjects. The reduction / correction may be at least 10% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction may be at least 20% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction may be at least 40% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction may be at least 50% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction may be at least 60% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction may be at least 80% less NIE inclusion compared to the average subject or pre-treatment subject. The reduction can be at least 90% less NIE inclusion compared to the average subject or pre-treatment subject.

[0202]

[0282] When reference is made to an increase in the level of active polycystin 2, the increase may be clinically significant. The increase may be relative to the level of active polycystin 2 in a subject not receiving treatment, or relative to the amount of active polycystin 2 in a population of similar subjects. The increase may be at least 10% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 20% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 40% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 50% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 80% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 100% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase may be at least 200% more active polycystin 2 compared to the average subject or pre-treatment subject. The increase can be at least 500% more active polycystin 2 compared to the average subject or the subject before treatment.

[0203]

[0283] When reference is made to a decrease in the level of functional polycystin 2, the decrease may be clinically significant. The decrease may be relative to the level of functional polycystin 2 in a subject not receiving treatment, or relative to the amount of functional polycystin 2 in a population of similar subjects. The decrease may be at least 10% less functional polycystin 2 compared to the average subject or pre-treatment subject. The decrease may be at least 20% less functional polycystin 2 compared to the average subject or pre-treatment subject. The decrease may be at least 40% less functional polycystin 2 compared to the average subject or pre-treatment subject. The decrease may be at least 50% less functional polycystin 2 compared to the average subject or pre-treatment subject. The decrease may be at least 80% less functional polycystin 2 compared to the average subject or pre-treatment subject. The decrease may be at least 100% less functional polycystin 2 compared to the average subject or pre-treatment subject.

[0204]

[0284] In embodiments where the NIE inhibitor comprises a polynucleic acid polymer, the polynucleic acid polymer can be about 50 nucleotides in length. The polynucleic acid polymer can be about 45 nucleotides in length. The polynucleic acid polymer can be about 40 nucleotides in length. The polynucleic acid polymer can be about 35 nucleotides in length. The polynucleic acid polymer can be about 30 nucleotides in length. The polynucleic acid polymer can be about 24 nucleotides in length. The polynucleic acid polymer can be about 25 nucleotides in length. The polynucleic acid polymer can be about 20 nucleotides in length. The polynucleic acid polymer can be about 19 nucleotides in length. The polynucleic acid polymer can be about 18 nucleotides in length. The polynucleic acid polymer can be about 17 nucleotides in length. The polynucleic acid polymer can be about 16 nucleotides in length. The polynucleic acid polymer can be about 15 nucleotides in length. The polynucleic acid polymer can be about 14 nucleotides in length. The polynucleic acid polymer can be about 13 nucleotides in length. The polynucleic acid polymer can be about 12 nucleotides in length. The polynucleic acid polymer can be about 11 nucleotides in length. The polynucleic acid polymer can be about 10 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 50 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 45 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 40 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 35 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 30 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 25 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 20 nucleotides in length. The polynucleic acid polymer can be between about 15 and about 25 nucleotides in length. The polynucleic acid polymer can be between about 15 and about 30 nucleotides in length. The polynucleic acid polymer can be between about 12 and about 30 nucleotides in length.

[0205]

[0285] In embodiments where the alternative splicing inhibitor comprises a polynucleic acid polymer, the polynucleic acid polymer may be about 50 nucleotides in length. In embodiments where the alternative splicing modulator comprises a polynucleic acid polymer, the polynucleic acid polymer may be about 50 nucleotides in length. The polynucleic acid polymer may be about 45 nucleotides in length. The polynucleic acid polymer may be about 40 nucleotides in length. The polynucleic acid polymer may be about 35 nucleotides in length. The polynucleic acid polymer may be about 30 nucleotides in length. The polynucleic acid polymer may be about 24 nucleotides in length. The polynucleic acid polymer may be about 25 nucleotides in length. The polynucleic acid polymer may be about 20 nucleotides in length. The polynucleic acid polymer may be about 19 nucleotides in length. The polynucleic acid polymer may be about 18 nucleotides in length. The polynucleic acid polymer may be about 17 nucleotides in length. The polynucleic acid polymer may be about 16 nucleotides in length. The polynucleic acid polymer may be about 15 nucleotides in length. The polynucleic acid polymer may be about 14 nucleotides in length. The polynucleic acid polymer may be about 13 nucleotides in length. The polynucleic acid polymer can be about 12 nucleotides in length. The polynucleic acid polymer can be about 11 nucleotides in length. The polynucleic acid polymer can be about 10 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 50 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 45 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 40 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 35 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 30 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 25 nucleotides in length. The polynucleic acid polymer can be between about 10 and about 20 nucleotides in length. The polynucleic acid polymer can be between about 15 and about 25 nucleotides in length. The polynucleic acid polymer can be between about 15 and about 30 nucleotides in length. The polynucleic acid polymer can be between about 12 and about 30 nucleotides in length.

[0206]

[0286] The sequence of the polynucleic acid polymer can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% complementary to the target sequence of the mRNA transcript, e.g., a partially processed mRNA transcript. The sequence of the polynucleic acid polymer can be 100% complementary to the target sequence of the pre-mRNA transcript.

[0207]

[0287] The sequence of the polynucleic acid polymer may have no more than four mismatches to the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have no more than three mismatches to the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have no more than two mismatches to the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have no more than one mismatch to the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have no mismatches to the target sequence of the pre-mRNA transcript.

[0208]

[0288] The polynucleic acid polymer can specifically hybridize to the target sequence of the pre-mRNA transcript.For example, the polynucleic acid polymer can have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity to the target sequence of the pre-mRNA transcript.Hybridization can be under high stringency hybridization conditions.

[0209]

[0289] The polynucleic acid polymer comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 4. The polynucleic acid polymer can comprise a sequence having 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 4. The polynucleic acid polymer is a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 4. The polynucleic acid polymer is a sequence having 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 4.

[0210]

[0290] When referring to the sequence of a polynucleic acid polymer, one skilled in the art will understand that one or more substitutions, optionally two substitutions, may be tolerated in the sequence to maintain the ability to hybridize with a target sequence or to maintain the ability to be recognized as a target sequence if the substitution is in the target sequence. The sequence identity criteria may be determined by BLAST sequence alignment using standard / default parameters. For example, a sequence can have 99% identity and still function according to the present disclosure. In other embodiments, a sequence can have 98% identity and still function according to the present disclosure. In another embodiment, a sequence can have 95% identity and still function according to the present disclosure. In another embodiment, a sequence can have 90% identity and still function according to the present disclosure.

[0211] Antisense oligomers

[0291] Provided herein is a composition comprising an antisense oligomer that induces exon skipping by binding to a targeted portion of a PKD2 NIE-containing pre-mRNA. As used herein, the terms "ASO" and "antisense oligomer" are used interchangeably and refer to an oligomer, such as a polynucleotide, that comprises a nucleobase that hybridizes to a target nucleic acid (e.g., a PKD2 NIE-containing pre-mRNA) sequence by Watson-Crick base pairing or wobble base pairing (GU). ASOs may have exact sequence complementarity to a target sequence or may have approximate complementarity (e.g., sufficient complementarity to bind to a target sequence and enhance splicing at a splice site). ASOs are designed to bind (hybridize) to a target nucleic acid (e.g., a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Typically, when an ASO hybridizes to a site other than the intended (targeted) nucleic acid sequence, it hybridizes to a limited number of sequences that are not the target nucleic acid (to a small number of sites other than the target nucleic acid). The design of ASO can take into account the occurrence of the nucleic acid sequence of the targeting portion of the pre-mRNA transcript, or the occurrence of sufficiently similar nucleic acid sequences in other sites within the genome or cellular pre-mRNA or transcriptome, so that the possibility of ASO binding to other sites and causing "off-target" effects is limited. Any antisense oligomer known in the art (e.g., those in PCT Application No. PCT / US2014 / 054151 (titled "Reducing Nonsense-Mediated mRNA Decay"), published as WO2015 / 035091 (herein incorporated by reference)) can be used to carry out the method described herein.

[0212]

[0292] In some embodiments, the ASO "specifically hybridizes" or is "specific" for the targeted portion of the target nucleic acid or NIE-containing pre-mRNA. Typically, such hybridization occurs at a T of substantially greater than 37° C., preferably at least 50° C., and typically between 60° C. and approximately 90° C. mSuch hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, T m is the temperature at which 50% of the target sequence hybridizes to a complementary oligonucleotide.

[0213]

[0293] Oligomers, such as oligonucleotides, are "complementary" to each other if hybridization occurs between two single-stranded polynucleotides in an antiparallel configuration. A double-stranded polynucleotide is "complementary" to another polynucleotide if hybridization can occur between one of the strands of a first and second polynucleotide. Complementarity (the degree to which one polynucleotide is complementary to another) can be quantified in terms of the proportion (e.g., percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other according to generally accepted base pairing rules. The sequence of an antisense oligomer (ASO) does not need to be 100% complementary to the sequence of its target nucleic acid to which it hybridizes. In certain embodiments, an ASO can include at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence complementarity to a target region within the targeted target nucleic acid sequence. For example, an ASO in which 18 of 20 nucleobases of an oligomeric compound are complementary to a target region and therefore specifically hybridize, exhibits 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered together or may be interspersed with complementary nucleobases, and need not be contiguous with each other or with complementary nucleobases. The percent complementarity of an ASO with a region of a target nucleic acid can be routinely determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0214]

[0294] ASO does not need to hybridize to all nucleobases in the target sequence, and the nucleobases that ASO hybridizes to can be continuous or non-contiguous. ASO can hybridize across one or more segments of pre-mRNA transcript such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop or hairpin structure can be formed). In certain embodiments, ASO hybridizes to non-contiguous nucleobases in target pre-mRNA transcript. For example, ASO can hybridize to nucleobases in pre-mRNA transcript that are separated by one or more nucleobases that ASO does not hybridize to.

[0215]

[0295] The ASOs described herein contain nucleobases that are complementary to nucleobases present in the target portion of the NIE-containing pre-mRNA. The term ASO encompasses oligonucleotides and any other oligomeric molecules that contain nucleobases that can hybridize to complementary nucleobases on the target mRNA but do not contain sugar moieties (e.g., peptide nucleic acids (PNAs)). ASOs can contain naturally occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the foregoing. The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and / or modified backbones. In some embodiments, all of the nucleotides of the ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the methods and compositions described herein will be apparent to one of skill in the art and can be found, for example, in U.S. Pat. No. 8,258,109 B2, U.S. Pat. No. 5,656,612, U.S. Patent Publication No. 2012 / 0190728, and Dias and Stein, Mol. Cancer Ther. 2002, 347-355, which are incorporated by reference in their entireties.

[0216]

[0296] The nucleobase or nucleobases of the ASO may be any naturally occurring unmodified nucleobase, such as adenine, guanine, cytosine, thymine, uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase so as to be capable of hydrogen bonding with a nucleobase present on the target pre-mRNA. Examples of modified nucleobases include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethylcytosine.

[0217]

[0297] The ASOs described herein also include a backbone structure that connects the components of the oligomer. The terms "backbone structure" and "oligomer linkage" can be used interchangeably and can refer to the connection between the monomers of the ASO. In naturally occurring oligonucleotides, the backbone includes a 3'-5' phosphodiester bond that connects the sugar moieties of the oligomer. The backbone structure or oligomer linkage of the ASOs described herein can include, but is not limited to, phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. For example, LaPlanche, et al., Nucleic Acids Res.14:9081(1986); Stec, et al., J.Am.Chem.Soc.106:6077(1984), Stein, et al., Nucleic Acids Res.16:3209(1988), Zon, et al., Anti-Cancer Drug Design 6:539 (1991); Zon, et al., Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)); Stec, et al., U.S. Patent No. 5,151,510; Uhlmann and Peyman, Chemical Reviews See 90:543 (1990). In some embodiments, the backbone structure of the ASO does not contain phosphorus, e.g., peptide nucleic acid (PNA), or peptide bonds in the linking groups including carbamate, amide, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphorothioate bond. In some embodiments, the backbone modification is a phosphoramidate bond.

[0218]

[0298] In some embodiments, the stereochemistry at each of the phosphorus internucleotide linkages of the ASO backbone is random. In some embodiments, the stereochemistry at each of the phosphorus internucleotide linkages of the ASO backbone is controlled and not random. For example, U.S. Patent Application Publication No. 2014 / 0194610, "Methods for the Synthesis of Functionalized Nucleic Acids," incorporated herein by reference, describes methods for independently selecting the handedness of chirality at each phosphorus atom in a nucleic acid oligomer. In some embodiments, the ASOs used in the methods of the disclosure, including but not limited to any of the ASOs described in Tables 5 and 6 herein, comprise ASOs with non-random phosphorus internucleotide linkages. In some embodiments, the compositions used in the methods of the disclosure comprise pure diastereomeric ASOs. In some embodiments, a composition used in the methods of the disclosure comprises an ASO having a diastereomeric purity of at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to about 100%.

[0219]

[0299] In some embodiments, the ASO has a non-random mixture of Rp and Sp configurations in its phospho-internucleotide linkages. For example, it has been suggested that antisense oligonucleotides require a mixture of Rp and Sp to achieve a good balance of activity and nuclease stability (Wan, et al., 2014, "Synthesis, biophysical properties and biological activity of second-generation antisense oligonucleotides containing chiral phosphorothioate linkages," Nucleic Acids Research 42(22):13456-13468, incorporated herein by reference). In some embodiments, the ASOs used in the methods of the disclosure, including but not limited to any of the ASOs described herein in SEQ ID NOs: 60-191, comprise about 5-100% Rp, at least about 5% Rp, at least about 10% Rp, at least about 15% Rp, at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, at least about 40% Rp, at least about 45% Rp, at least about 50% Rp. at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp, at least about 80% Rp, at least about 85% Rp, at least about 90% Rp, or at least about 95% Rp, with the remainder being Sp, or about 100% Rp.In some embodiments, an ASO for use in the methods of the disclosure, including but not limited to any of the ASOs described herein, comprises a sequence having at least about 80%, about 85%, about 90%, about 95%, about 97%, or about 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of any one of SEQ ID NOs: 60-191, and has an Rp of about 10% to about 100%, about 15% to about 100%, about 20% to about 100%, about 25% to about 100%, about 30% to about 100%, about 35% to about 100%, about 40% to about 100% Rp, about 45% to about 100% Rp, about 50% to about 100% Rp, about 55% to about 100% Rp, about 60% to about 100% Rp, about 65% to about 100% Rp, about 70% to about 100% Rp, about 75% to about 100% Rp, about 80% to about 100% Rp, about 85% to about 100% Rp, about 90% to about 100% Rp, or about 95% to about 100% Rp, about 20% to about 80% Rp, about 25% to about 75% Rp, about 30% to about 70% Rp, about 40% to about 60% Rp, or about 45% to about 55% Rp, with the remainder being Sp.

[0220]

[0300] In some embodiments, an ASO for use in the methods of the disclosure, including but not limited to any of the ASOs described herein, comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any one of SEQ ID NOs: 60-191, and has about 5-100% Sp, at least about 5% Sp, at least about 10% Sp, at least about 15% Sp, at least about 20% Sp, at least about 25% Sp, at least about 30% Sp, at least about 35% Sp, at least about 40% Sp, at least about 40% Sp, at least about 50% Sp, at least about 60% Sp, at least about 70% Sp, at least about 80% Sp, at least about 90% Sp, at least about 100% Sp, at least about 15% Sp, at least about 20% Sp, at least about 35% Sp, at least about 40% Sp, at least about 50% Sp, at least about 60% Sp, at least about 70% Sp, at least about 80% Sp, at least about 90% Sp, at least about 10 ... % Sp, at least about 30% Sp, at least about 35% Sp, at least about 40% Sp, at least about 45% Sp, at least about 50% Sp, at least about 55% Sp, at least about 60% Sp, at least about 65% Sp, at least about 70% Sp, at least about 75% Sp, at least about 80% Sp, at least about 85% Sp, at least about 90% Sp, or at least about 95% Sp, with the remainder being Rp, or about 100% Sp. In embodiments, the ASOs used in the methods of the disclosure, including but not limited to any of the ASOs described herein, comprise a sequence having at least about 80%, about 85%, about 90%, about 95%, about 97%, or about 100% sequence identity to a region containing at least 8 consecutive nucleic acids of any one of SEQ ID NOs: 60-191, and have about 10% to about 100% Sp, about 15% to about 100% Sp, about 20% to about 100% Sp, about 25% to about 100% Sp, about 30% to about 100% Sp, about 35% to about 100% Sp, about 40% to about 100% Sp, about 45% to about 100% Sp, about 50% to about 100% Sp, about 60% to about 100% Sp, about 70% to about 100% Sp, about 80% to about 100% Sp, about 90% to about 100% Sp, about 100% to about 100% Sp, about 110% to about 100% Sp, about 120% to about 100% Sp, about 130% to about 100% Sp, about 140% to about 100% Sp, about 150% to about 100% Sp, about 160% to about 100% Sp, about 170% to about 100% Sp, about 180% to about 100% Sp, about 190% to about 200% Sp, about 21% to about 210% Sp, about 22% to about 220% Sp, about 23% to about 230% Sp, about 24% to about 240% Sp, about 25% to about 250% Sp, about 26% to about 2 % Sp, about 45% to about 100% Sp, about 50% to about 100% Sp, about 55% to about 100% Sp, about 60% to about 100% Sp, about 65% to about 100% Sp, about 70% to about 100% Sp, about 75% to about 100% Sp, about 80% to about 100% Sp, about 85% to about 100% Sp, about 90% to about 100% Sp, or about 95% to about 100% Sp, about 20% to about 80% Sp, about 25% to about 75% Sp, about 30% to about 70% Sp, about 40% to about 60% Sp, or about 45% to about 55% Sp, with the remainder being Rp.

[0221]

[0301] Any of the ASOs described herein can contain sugar moieties that include ribose or deoxyribose as found in naturally occurring nucleotides, or modified sugar moieties or sugar analogs (including morpholine rings). Non-limiting examples of modified sugar moieties include 2' substituents, such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F;N3'->P5' phosphoramidate, 2' dimethylaminooxyethoxy, 2' dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O-guanidiniumethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the sugar moiety modification is selected from 2'-O-Me, 2'F, and 2'MOE. In some embodiments, the sugar moiety modification is an additional crosslinking linkage, such as a locked nucleic acid (LNA). In some embodiments, the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification. In some embodiments, the sugar moiety comprises a 2'4' constrained 2'O-methyloxyethyl (cMOE) modification. In some embodiments, the sugar moiety comprises a cEt 2',4' constrained 2'-O-ethyl BNA modification. In some embodiments, the sugar moiety comprises a tricycloDNA (tcDNA) modification. In some embodiments, the sugar moiety comprises an ethylene nucleic acid (ENA) modification. In some embodiments, the sugar moiety comprises an MCE modification. Modifications are known in the art and described in the literature, e.g., Jarver, et al., 2014, "A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications," Nucleic Acid Therapeutics 24(1):37-47, which is incorporated herein by reference for this purpose.

[0222]

[0302] In some embodiments, each monomer of the ASO is modified in the same way, for example, each bond of the backbone of the ASO contains a phosphorothioate bond, or each ribose sugar moiety contains a 2'O-methyl modification. Such modifications present on each of the monomeric components of the ASO are referred to as "uniform modifications". In some instances, a combination of different modifications may be desired, for example, an ASO may contain a combination of phosphorodiamidate bonds and sugar moieties containing morpholine rings (morpholinos). A combination of different modifications to an ASO is referred to as "mixed modifications" or "mixed chemistry".

[0223]

[0303] In some embodiments, the ASO comprises one or more backbone modifications. In some embodiments, the ASO comprises one or more sugar moiety modifications. In some embodiments, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some embodiments, the ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises a phosphorodiamidate morpholino (PMO). In some embodiments, the ASO comprises a peptide nucleic acid (PNA). Any of the ASOs described herein or any component of the ASO (e.g., nucleobase, sugar moiety, backbone) can be modified to achieve a desired property or activity of the ASO or to reduce an undesirable property or activity of the ASO. For example, the ASO, or one or more components of any ASO, can be modified to enhance binding affinity to the target sequence on the pre-mRNA transcript; to reduce binding to any non-target sequences; to reduce degradation by cellular nucleases (i.e., RNase H); to improve uptake of the ASO into the cell and / or the nucleus of a cell; to alter the pharmacokinetics or pharmacodynamics of the ASO; and / or to modulate the half-life of the ASO.

[0224]

[0304] In some embodiments, ASOs are composed of 2'-O-(2-methoxyethyl) (MOE) phosphorothioate modified nucleotides. ASOs composed of such nucleotides are particularly well suited for the methods disclosed herein; oligomers with such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable for oral delivery in some embodiments described herein. See, e.g., Geary, et al., J Pharmacol Exp Ther. 2001; 296(3): 890-7; Geary, et al., J Pharmacol Exp Ther. 2001; 296(3): 898-904.

[0225]

[0305] Methods for synthesizing ASOs will be known to those of skill in the art. Alternatively, or in addition, ASOs may be obtained from commercial sources.

[0226]

[0306] Unless otherwise specified, the left-hand end of a single-stranded nucleic acid (e.g., pre-mRNA transcript, oligonucleotide, ASO, etc.) sequence is the 5'-end, and the left-hand direction of a single-stranded or double-stranded nucleic acid sequence is referred to as the 5'-direction. Similarly, the right-hand end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3'-end or 3'-direction. Generally, a region or sequence that is 5' to a reference point in a nucleic acid is referred to as "upstream" and a region or sequence that is 3' to a reference point in a nucleic acid is referred to as "downstream". Generally, the 5'-direction or 5'-end of an mRNA is where the initiation or start codon is located, and the 3'-end or 3'-direction is where the stop codon is located. In some embodiments, nucleotides that are upstream of a reference point in a nucleic acid can be designated by a negative number, while nucleotides that are downstream of the reference point can be designated by a positive number. For example, a reference point (e.g., an inter-exon junction of an mRNA) can be designated as the "zero" site, the nucleotide immediately adjacent to and upstream of the reference point can be designated as "minus one," e.g., "-1," and the nucleotide immediately adjacent to and downstream of the reference point can be designated as "plus one," e.g., "+1."

[0227]

[0307] In some embodiments, the ASO is complementary to (and binds to) a targeted portion of a PKD2 NIE-containing pre-mRNA that is downstream (in the 3' direction) of the 5' splice site of the intron following the included exon in the PKD2 NIE-containing pre-mRNA (e.g., in the direction designated by a positive number relative to the 5' splice site). In some embodiments, the ASO is complementary to a targeted portion of a PKD2 NIE-containing pre-mRNA that is within a region from about +1 to about +500 relative to the 5' splice site of the intron following the included exon. In some embodiments, the ASO can be complementary to a targeted portion of a PKD2 NIE-containing pre-mRNA that is within a region between nucleotides +6 to +40,000 relative to the 5' splice site of the intron following the included exon.In some embodiments, the ASO is at least about +1 to about +40,000, about +1 to about +30,000, about +1 to about +20,000, about +1 to about +15,000, about +1 to about +10,000, about +1 to about +5,000, about +1 to about +4,000, about +1 to about +3,000, about +1 to about +2,000, about +1 to about +1,000, about +1 to about +500, about +1 to about +490, about +1 to about +480, about +1 to about +470, about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, about +1 to about +400, about +1 to about +390, about +1 to about +380, about +1 to about +370, about +1 to about +360, about +1 to about +350, about +1 to about +340 , about +1 to about +330, about +1 to about +320, about +1 to about +310, about +1 to about +300, about +1 to about +290, about +1 to about +280, about +1 to about +270, about +1 to about +260, about +1 to about +250, about +1 to about +240, about +1 to about +230, about +1 to about +220, about +1 to about +210, about +1 to about +200, about +1 to about +190, about +1 to about +180, about +1 to about +1 70, about +1 to about +160, about +1 to about +150, about +1 to about +140, about +1 to about +130, about +1 to about +120, about +1 to about +110, about +1 to about +100, about +1 to about +90, about +1 to about +80, about +1 to about +70, about +1 to about +60, about +1 to about +50, about +1 to about +40, about +1 to about +30, or about +1 to about +20. In some embodiments, the ASO is complementary to a targeting portion within a region from about +1 to about +100, about +100 to about +200, about +200 to about +300, about +300 to about +400, or about +400 to about +500 relative to the 5' splice site of the intron following the encompassing exon.

[0228]

[0308] In some embodiments, the ASO is complementary to (and binds to) a targeted portion of a PKD2 NIE-containing pre-mRNA that is upstream (in the 5' direction) of the 5' splice site of the intron following the included exon in the PKD2 NIE-containing pre-mRNA (e.g., in the direction designated by a negative number relative to the 5' splice site). In some embodiments, the ASO is complementary to a targeted portion of a PKD2 NIE-containing pre-mRNA that is within a region from about -4 to about -270 relative to the 5' splice site of the intron following the included exon. In some embodiments, the ASO can be complementary to a targeted portion of a PKD2 NIE-containing pre-mRNA that is within a region between nucleotides -1 to -40,000 relative to the 5' splice site of the intron following the included exon.In some embodiments, the ASO is at about -1 to about -40,000, about -1 to about -30,000, about -1 to about -20,000, about -1 to about -15,000, about -1 to about -10,000, about -1 to about -5,000, about -1 to about -4,000, about -1 to about -3,000, about -1 to about -2,000, about -1 to about -1,000, about -1 to about -500, about -1 to about -490, about -1 to about -480, about -1 to about -470, about -1 to about -460, about -1 to about -450, about -1 to about -440, about -1 to about -430, about -1 to about -420, about -1 to about -410, about -1 to about -400, about -1 to about -390, about -1 to about -380, about -1 to about -370, about -1 to about -360, about -1 to about -350, about -1 to about -340 , about -1 to about -330, about -1 to about -320, about -1 to about -310, about -1 to about -300, about -1 to about -290, about -1 to about -280, about -1 to about -270, about -1 to about -260, about -1 to about -250, about -1 to about -240, about -1 to about -230, about -1 to about -220, about -1 to about -210, about -1 to about -200, about -1 to about -190, about -1 to about -180, about -1 to about -1 In some embodiments, the targeting moiety is complementary to a targeting portion within a region of about -1 to about -70, about -1 to about -160, about -1 to about -150, about -1 to about -140, about -1 to about -130, about -1 to about -120, about -1 to about -110, about -1 to about -100, about -1 to about -90, about -1 to about -80, about -1 to about -70, about -1 to about -60, about -1 to about -50, about -1 to about -40, about -1 to about -30, or about -1 to about -20.

[0229]

[0309] In some embodiments, the ASO is complementary to a targeted region of the PKD2 NIE-containing pre-mRNA that is upstream (in the 5' direction) (e.g., in a direction designated by a negative number) of the 3' splice site of the intron preceding the included exon in the PKD2 NIE-containing pre-mRNA. In some embodiments, the ASO is complementary to a targeted portion of the PKD2 NIE-containing pre-mRNA that is within a region of about -1 to about -500 relative to the 3' splice site of the intron preceding the included exon. In some embodiments, the ASO is complementary to a targeted portion of the PKD2 NIE-containing pre-mRNA that is within a region of -1 to -40,000 relative to the 3' splice site of the intron preceding the included exon. In some embodiments, the ASO is at least about -1 to about -40,000, about -1 to about -30,000, about -1 to about -20,000, about -1 to about -15,000, about -1 to about -10,000, about -1 to about -5,000, about -1 to about -4,000, about -1 to about -3,000, about -1 to about -2,000, about -1 to about -1,000, About -1 to about -500, about -1 to about -490, about -1 to about -480, about -1 to about -470, about -1 to about -460, about -1 to about -450, about -1 to about -440, about -1 to about -430, about -1 to about -420, about -1 to about -410, about -1 to about -400, about -1 to about -390, about -1 to about -380, about -1 to about -370, about -1 to about -360, about -1 to about -350, about -1 to about -340 , about -1 to about -330, about -1 to about -320, about -1 to about -310, about -1 to about -300, about -1 to about -290, about -1 to about -280, about -1 to about -270, about -1 to about -260, about -1 to about -250, about -1 to about -240, about -1 to about -230, about -1 to about -220, about -1 to about -210, about -1 to about -200, about -1 to about -190, about -1 to about -180, about -1 to about -1 In some embodiments, the targeting moiety is complementary to a targeting portion within a region of about -1 to about -70, about -1 to about -160, about -1 to about -150, about -1 to about -140, about -1 to about -130, about -1 to about -120, about -1 to about -110, about -1 to about -100, about -1 to about -90, about -1 to about -80, about -1 to about -70, about -1 to about -60, about -1 to about -50, about -1 to about -40, about -1 to about -30, or about -1 to about -20.In some embodiments, the ASO is complementary to a targeting portion that is within a region of about -1 to about -100, about -100 to about -200, about -200 to about -300, about -300 to about -400, or about -400 to about -500 relative to the 3' splice site of the intron preceding the included exon.

[0230]

[0310] In some embodiments, the ASO is complementary to a targeted region of the PKD2 NIE-containing pre-mRNA that is downstream (in the 3' direction) (e.g., in the direction designated by a positive number) of the 3' splice site of the intron preceding the included exon in the PKD2 NIE-containing pre-mRNA. In some embodiments, the ASO is complementary to a targeted portion of the PKD2 NIE-containing pre-mRNA that is within a region of about +1 to about +40,000 relative to the 3' splice site of the intron preceding the included exon. In some embodiments, the ASO is at least about +1 to about +40,000, about +1 to about +30,000, about +1 to about +20,000, about +1 to about +15,000, about +1 to about +10,000, about +1 to about +5,000, about +1 to about +4,000, about +1 to about +3,000, about +1 to about +2,000, about +1 to about +1,000, about + +1 to about +500, about +1 to about +490, about +1 to about +480, about +1 to about +470, about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, about +1 to about +400, about +1 to about +390, about +1 to about +380, about +1 to about +370, about +1 to about +360, about +1 to about +350, about +1 to about +340, about +1 ~+330, ~+1~+320, ~+1~+310, ~+1~+300, ~+1~+290, ~+1~+280, ~+1~+270, ~+1~+260, ~+1~+250, ~+1~+240, ~+1~+230, ~+1~+220, ~+1~+210, ~+1~+200, ~+1~+190, ~+1~+180, ~+1~+170, ~+1~ is complementary to a targeting portion within a region of about +160, about +1 to about +150, about +1 to about +140, about +1 to about +130, about +1 to about +120, about +1 to about +110, about +1 to about +100, about +1 to about +90, about +1 to about +80, about +1 to about +70, about +1 to about +60, about +1 to about +50, about +1 to about +40, about +1 to about +30, about +1 to about +20, or about +1 to about +10.

[0231]

[0311] In some embodiments, the targeted portion of the PKD2 pre-mRNA is within the region from −4e relative to the 5′ end of the NSE to +2e relative to the 3′ end of the NSE.

[0232]

[0312] In some embodiments, the ASO is complementary to a targeted region of the PKD2 NIE-containing pre-mRNA that is upstream (in the 5' direction) (e.g., in a direction designated by a positive number) of the 3' splice site of the intron preceding the included exon in the PKD2 NIE-containing pre-mRNA. In some embodiments, the ASO is complementary to a targeted portion of the PKD2 NIE-containing pre-mRNA that is within a region of about +1 to about +40,000 relative to the 3' splice site of the intron preceding the included exon. In some embodiments, the ASO is at least about +1 to about +40,000, about +1 to about +30,000, about +1 to about +20,000, about +1 to about +15,000, about +1 to about +10,000, about +1 to about +5,000, about +1 to about +4,000, about +1 to about +3,000, about +1 to about +2,000, about +1 to about +1,000, about + +1 to about +500, about +1 to about +490, about +1 to about +480, about +1 to about +470, about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, about +1 to about +400, about +1 to about +390, about +1 to about +380, about +1 to about +370, about +1 to about +360, about +1 to about +350, about +1 to about +340, about +1 ~+330, ~+1~+320, ~+1~+310, ~+1~+300, ~+1~+290, ~+1~+280, ~+1~+270, ~+1~+260, ~+1~+250, ~+1~+240, ~+1~+230, ~+1~+220, ~+1~+210, ~+1~+200, ~+1~+190, ~+1~+180, ~+1~+170, ~+1~ is complementary to a targeting portion within a region of about +160, about +1 to about +150, about +1 to about +140, about +1 to about +130, about +1 to about +120, about +1 to about +110, about +1 to about +100, about +1 to about +90, about +1 to about +80, about +1 to about +70, about +1 to about +60, about +1 to about +50, about +1 to about +40, about +1 to about +30, about +1 to about +20, or about +1 to about +10.

[0233]

[0313] In some embodiments, the targeted portion of the PKD2 NIE-containing pre-mRNA is within a region from +100 to the 5' splice site of the intron following the included exon to -100 to the 3' splice site of the intron preceding the included exon. In some embodiments, the targeted portion of the PKD2 NIE-containing pre-mRNA is within the NIE. In some embodiments, the targeted portion of the PKD2 NIE-containing pre-mRNA includes the NIE and an intron boundary.

[0234]

[0314] ASOs can be of any length suitable for specific binding and effective splicing enhancement. In some embodiments, ASOs consist of 8-50 nucleobases. For example, ASOs can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, or 50 nucleobases long. In some embodiments, ASOs consist of more than 50 nucleobases. In some embodiments, the ASO is 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-35 nucleobases, 10-30 nucleobases, 10-25 nucleobases, 10-20 nucleobases, 10-15 nucleobases, 11-50 nucleobases, 11-40 nucleobases, 11-35 nucleobases, 11-30 nucleobases, 11-25 nucleobases, 11-20 nucleobases, 11-15 nucleobases, 12-50 nucleobases, 12-40 nucleobases, 12-3 ...50 nucleobases, 12-60 nucleobases, 12-70 nucleobases, 12-80 nucleobases, 12-90 nucleo ~30 nucleobases, 12-25 nucleobases, 12-20 nucleobases, 12-15 nucleobases, 13-50 nucleobases, 13-40 nucleobases, 13-35 nucleobases, 13-30 nucleobases, 13-25 nucleobases, 13-20 nucleobases, 14-50 nucleobases, 14-40 nucleobases, 14-35 nucleobases, 14-30 nucleobases, 14-25 nucleobases, 14-20 nucleobases , 15-50 nucleobases, 15-40 nucleobases, 15-35 nucleobases, 15-30 nucleobases, 15-25 nucleobases, 15-20 nucleobases, 20-50 nucleobases, 20-40 nucleobases, 20-35 nucleobases, 20-30 nucleobases, 20-25 nucleobases, 25-50 nucleobases, 25-40 nucleobases, 25-35 nucleobases, or 25-30 nucleobases in length. In some embodiments, the ASO is 18 nucleotides in length. In some embodiments, the ASO is 15 nucleotides in length. In some embodiments, the ASO is 25 nucleotides in length.

[0235]

[0315] In some embodiments, two or more ASOs are used that have different chemistries but are complementary to the same targeting portion of the NIE-containing pre-mRNA, hi some embodiments, two or more ASOs are used that are complementary to different targeting portions of the NIE-containing pre-mRNA.

[0236]

[0316] In some embodiments, the antisense oligonucleotides of the present disclosure are chemically linked to one or more moieties or conjugates (e.g., targeting moieties or other conjugates that enhance the activity or cellular uptake of the oligonucleotide). Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholesteryl moieties, aliphatic chains, such as dodecanediol or undecyl residues, polyamines, or polyethylene glycol chains, or adamantane acetic acid. Oligonucleotides containing lipophilic moieties and methods for their preparation are described in the published literature. In embodiments, the antisense oligonucleotides are conjugated to moieties, including, but not limited to, abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, such as N-acetylgalactosamine (GalNAc), N-Ac-glucosamine (GluNAc), or mannose (e.g., mannose-6-phosphate), lipids, or polyhydrocarbon compounds. As understood in the art and described in the literature, the conjugate can be attached to one or more of any nucleotides, including antisense oligonucleotides, at any of several positions on the sugar, base, or phosphate group, for example, using a linker. The linker can include a bivalent or trivalent branched linker. In embodiments, the conjugate is attached to the 3' end of the antisense oligonucleotide. Methods for preparing oligonucleotide conjugates are described, for example, in U.S. Pat. No. 8,450,467, "Carbohydrate conjugates as delivery agents for oligonucleotides," which is incorporated herein by reference.

[0237]

[0317] In some embodiments, the nucleic acid targeted by the ASO is a PKD2 NIE-containing pre-mRNA expressed in a cell, such as a eukaryotic cell. In some embodiments, the term "cell" may refer to a population of cells. In some embodiments, the cell is in a subject. In some embodiments, the cell is isolated from a subject. In some embodiments, the cell is ex vivo. In some embodiments, the cell is a condition or disease-related cell or cell line. In some embodiments, the cell is in vitro (e.g., cell culture).

[0238]

[0318] In some embodiments, the ASO that targets the pre-mRNA disclosed herein is selected from the group consisting of sequences listed in Table 4.

[0239] Pharmaceutical Compositions

[0319] Pharmaceutical compositions or preparations that contain the described compositions of agents, such as antisense oligonucleotides, and that are used in any of the described methods can be prepared according to conventional techniques that are well known in the pharmaceutical industry and described in the open literature.In embodiments, pharmaceutical compositions or preparations for treating subjects contain an effective amount of any of the antisense oligomers described herein, or their pharmaceutically acceptable salts, solvates, hydrates, or esters.The pharmaceutical preparations that contain antisense oligomers can further contain pharmaceutically acceptable excipients, diluents, or carriers.

[0240]

[0320] Pharmaceutically acceptable salts are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and are associated with a reasonable benefit / risk ratio (see, e.g., S. M. Berge, et al., J. Pharmaceutical Sciences, 66:1-19 (1977), which is incorporated herein by reference for this purpose). Salts may be added in any form during the final isolation and purification of the compounds. They can be prepared in situ or separately by reacting the free base form with a suitable organic acid. Examples of pharma-ceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other documented methodologies such as ion exchange. Other pharma-ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, gluconate, glycerol ... Examples of the salts include heptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Representative alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc.Further pharma-ceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations, formed where appropriate using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0241]

[0321] In some embodiments, the composition is formulated into any of many possible dosage forms, including, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. In embodiments, the composition is formulated as a suspension in an aqueous, non-aqueous, or mixed medium. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. Suspensions may also contain stabilizers. In embodiments, the pharmaceutical formulation or composition of the present invention includes, but is not limited to, a solution, an emulsion, a microemulsion, a foam, or a liposome-containing formulation (e.g., cationic or non-cationic liposomes).

[0242]

[0322] The pharmaceutical compositions or formulations described in the present invention may optionally include one or more penetration enhancers, carriers, excipients, or other active or inactive ingredients known to those skilled in the art or described in the published literature. In embodiments, the liposomes also include sterically stabilized liposomes, e.g., liposomes that include one or more specialized lipids. These specialized lipids result in liposomes with improved circulation longevity. In embodiments, the sterically stabilized liposomes include one or more glycolipids or are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. In some embodiments, a surfactant is included in the pharmaceutical formulation or composition. The use of surfactants in pharmaceuticals, formulations, and emulsions is well known in the art. In embodiments, the present disclosure uses penetration enhancers to affect efficient delivery of antisense oligonucleotides, for example, to aid diffusion across cell membranes and / or enhance the permeability of lipophilic drugs. In some embodiments, the penetration enhancer is a surfactant, a fatty acid, a bile salt, a chelating agent, or a non-chelating non-surfactant.

[0243]

[0323] In some embodiments, the pharmaceutical formulation comprises more than one antisense oligonucleotide. In embodiments, the antisense oligonucleotide is administered in combination with another drug or therapeutic agent.

[0244] Combination therapy

[0324] In some embodiments, provided herein are compositions comprising one or more NSE modulating agents. In some embodiments, provided herein are compositions comprising two or more NSE modulating agents. In some embodiments, provided herein are compositions comprising one or more ASOs complementary to a targeting region of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising two or more ASOs complementary to a targeting region of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising one or more ASOs complementary to the same targeting region of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising two or more ASOs complementary to the same targeting region of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising one or more ASOs complementary to different targeting regions of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising two or more ASOs complementary to different targeting regions of PKD2 pre-mRNA. In some embodiments, provided herein are compositions comprising one or more ASOs of Table 4. In some embodiments, provided herein are compositions comprising two or more ASOs of Table 4.

[0245]

[0325] In some embodiments, the therapeutic agents disclosed in the present disclosure (e.g., ASOs) can be used in combination with one or more additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents can include small molecules. For example, the one or more additional therapeutic agents can include small molecules described in WO2016128343A1, WO2017053982A1, WO2016196386A1, WO201428459A1, WO201524876A2, WO2013119916A2, and WO2014209841A2 (incorporated herein by reference in their entirety). In some embodiments, the one or more additional therapeutic agents can include tolvaptan (Jynarque®; Samsca). In some embodiments, the one or more additional therapeutic agents include ASOs that can be used to correct intron retention.

[0246] Treatment of the subject

[0326] Any of the compositions provided herein can be administered to an individual. An "individual" can be used interchangeably with a "subject" or a "patient." An individual can be a mammal, e.g., a human, or an animal such as a non-human primate, rodent, rabbit, rat, mouse, horse, donkey, goat, cat, dog, cow, pig, or sheep. In embodiments, an individual is a human. In embodiments, an individual is a fetus, embryo, or child. In other embodiments, an individual can be another eukaryotic organism (e.g., a plant). In some embodiments, a composition provided herein is administered to a cell ex vivo.

[0247]

[0327] In some embodiments, the compositions provided herein are administered to an individual as a method of treating a disease or disorder. In some embodiments, the individual has a genetic disease, such as any of the diseases described herein. In some embodiments, the individual is at risk of having a disease, such as any of the diseases described herein. In some embodiments, the individual is at increased risk of having a disease or disorder caused by an insufficient amount of protein or insufficient activity of a protein. When an individual is at "increased risk" of having a disease or disorder caused by an insufficient amount of protein or insufficient activity of a protein, the method involves preventative or prophylactic treatment. For example, an individual may be at increased risk of having such a disease or disorder due to a family history of the disease. Typically, an individual at increased risk of having such a disease or disorder will benefit from a preventative treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder). In embodiments, a fetus is treated in utero, for example, by administering an ASO composition directly or indirectly (e.g., via the mother) to the fetus.

[0248]

[0328] The suitable route for administration of the ASO of the present disclosure may vary depending on the cell type that the ASO is desired to be delivered to.The ASO of the present disclosure can be administered parenterally to patients, for example, by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection or intravenous injection.

[0249]

[0329] In embodiments, antisense oligonucleotides are administered with one or more agents that can facilitate the penetration of the subject antisense oligonucleotides across the blood-brain barrier by any method known in the art.For example, the delivery of agents by administration of adenoviral vectors to motor neurons in muscle tissue is described in U.S. Patent No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons," which is incorporated herein by reference.Direct delivery of vectors to the brain, for example, the striatum, thalamus, hippocampus, or substantia nigra, is described in U.S. Patent No. 6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain," which is incorporated herein by reference.

[0250]

[0330] In some embodiments, the antisense oligonucleotide is linked or conjugated to an agent that provides desirable pharmaceutical or pharmacodynamic properties. In embodiments, the antisense oligonucleotide is linked to a substance known in the art to enhance blood-brain barrier penetration or transport, such as an antibody against the transferrin receptor. In embodiments, the antisense oligonucleotide is linked to a viral vector, for example, to make the antisense compound more effective or to increase transport across the blood-brain barrier. In embodiments, osmotic blood-brain barrier disruption is achieved by the administration of sugars, such as mesoerythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myoinositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonise, or the like. This can be supplemented by infusions of thor, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids such as glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine.Methods and materials for enhancing penetration of the blood-brain barrier are described, for example, in U.S. Pat. No. 9,193,969, entitled "Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types," U.S. Pat. No. 4,866,042, entitled "Method for the delivery of genetic material across the blood brain barrier," U.S. Pat. No. 6,294,520, entitled "Material for passage through the blood-brain barrier," and U.S. Pat. No. 6,936,589, entitled "Parenteral delivery systems," each of which is incorporated herein by reference.

[0251]

[0331] In some embodiments, the ASOs of the disclosure are conjugated to dopamine reuptake inhibitors (DRIs), selective serotonin reuptake inhibitors (SSRIs), noradrenaline reuptake inhibitors (NRIs), norepinephrine-dopamine reuptake inhibitors (NDRIs), and serotonin-norepinephrine-dopamine reuptake inhibitors (SNDRIs), e.g., using the methods described in U.S. Pat. No. 9,193,969, incorporated herein by reference.

[0252]

[0332] In some embodiments, subjects treated with the methods and compositions are assessed for improvement in their condition using any method known and described in the art.

[0253]

[0333] In some cases, the therapeutic agent comprises a modified snRNA (e.g., a modified human snRNA). In some cases, the therapeutic agent comprises a vector (e.g., a viral vector) encoding the modified snRNA. In some embodiments, the modified snRNA is a modified U1 snRNA (see, e.g., Alanis et al., Human Molecular Genetics, 2012, Vol. 21, No. 11 2389-2398). In some embodiments, the modified snRNA is a modified U7 snRNA (see, e.g., Gadgil et al., J Gene Med. 2021; 23: e3321). Modified U7 snRNA can be made by any method known in the art, including those described in Meyer, K.; Schumperli, Daniel (2012), Antisense Derivatives of U7 Small Nuclear RNA as Modulators of Pre-mRNA Splicing. In: Stamm, Stefan; Smith, Christopher WJ; Luhrmann, Reinhard (eds.) Alternative pre-mRNA Splicing: Theory and Protocols (pp. 481-494), Chichester: John Wiley & Sons 10.1002 / 9783527636778.ch45, which is incorporated by reference in its entirety. In some embodiments, modified U7 (smOPT) does not compete with WT U7 (Stefanovic et al., 1995).

[0254]

[0334] In some embodiments, the modified snRNA comprises a smOPT modification. For example, the modified snRNA can comprise the sequence AAUUUUUGGAG (SEQ ID NO: 229). For example, the sequence AAUUUUUGGAG (SEQ ID NO: 229) can replace the sequence AAUUUGUCUAG (SEQ ID NO: 230) in the wild-type U7 snRNA to generate modified U&snRNA (smOPT). In some embodiments, the smOPT modification of U7 snRNA renders the particle functionally inactive in histone pre-mRNA processing (Stefanovic et al., 1995). In some embodiments, modified U7 (smOPT) is stably expressed in the nucleus at higher levels than WT U7 (Stefanovic et al., 1995). In some embodiments, the snRNA comprises a U1 snRNP targeting sequence. In some embodiments, the snRNA comprises a U7 snRNP targeting sequence. In some embodiments, the snRNA comprises a modified U7 snRNP targeting sequence, and the modified U7 snRNP targeting sequence comprises smOPT. In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that hybridizes with PKD2 pre-mRNA. In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that hybridizes with PKD2 mRNA.

[0255]

[0335] In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with a target region of a PKD2 pre-mRNA or a processed PKD2 mRNA, such as a target region of a PKD2 pre-mRNA that regulates the elimination of an NMD exon, a target region of a PKD2 pre-mRNA that regulates splicing at an alternative 5'ss, or a target region of a processed PKD2 mRNA that regulates the translation of PKD2 mRNA, such as a 5'UTR target region. In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that includes one or more sequences of an ASO disclosed herein. In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with a sequence of a PKD2 pre-mRNA having a mutation (e.g., a PKD2 NMD exon-containing pre-mRNA having a mutation). In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that includes two or more sequences that hybridize with two or more target regions of a PKD2 NMD exon-containing pre-mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with at least 8 consecutive nucleic acids of the PKD2 NMD exon-containing pre-mRNA. In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with any of the target regions of the PKD2 NMD exon-containing pre-mRNA disclosed herein. In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that includes two or more sequences that hybridize with two or more target regions of the PKD2 NMD exon-containing pre-mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with one or more sequences of an intron containing an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140)) of a pre-mRNA transcript, or hybridizes with an NMD exon activation regulatory sequence in the same intron.For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes to a region within an NMD exon or a region upstream or downstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). In some embodiments, the modified snRNA has a 5' region that is modified to include a single-stranded nucleotide sequence that hybridizes to a PKD2 NMD exon-containing pre-mRNA. In some embodiments, the modified snRNA has a 3' region that is modified to include a single-stranded nucleotide sequence that hybridizes to a PKD2 NMD exon-containing pre-mRNA.

[0256]

[0336] In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with a target region of the PKD2 pre-mRNA that regulates the elimination of the NMD exon. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a region that overlaps with the NMD exon and an intron upstream of the NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a region that overlaps with the NMD exon and an intron downstream of the NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to an intron sequence downstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to a 3' splice site of an intron sequence downstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to a 5' splice site of an intron sequence downstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to an intron sequence upstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2).For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to a splice site of an intron sequence upstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to a 3' splice site of an intron sequence upstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to the 5' splice site of an intron sequence upstream of an NMD exon (e.g., exon 2x of PKD2 (e.g., exon (GRCh38 / hg38:chr4:88031085 88031140) of PKD2).

[0257]

[0337] In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with a target region of PKD2 pre-mRNA that regulates splicing at an alternative 5'ss. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a region that overlaps with an alternative 5'ss of an intron of PKD2 pre-mRNA (e.g., an alternative 5'ss of intron 3 of PKD2 (e.g., GRCh38 / hg38:chr4 88036480 of PKD2)). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes to a region overlapping with an alternative 5'ss of an intron of a PKD2 pre-mRNA and an NMD exon upstream of the alternative 5'ss (e.g., an alternative 5'ss of intron 3 of PKD2 (e.g., GRCh38 / hg38:chr4 88036480 of PKD2) and an NMD exon upstream of the alternative 5'ss (e.g., exon 2)). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is complementary to an intron sequence downstream of an alternative 5'ss of an intron of a PKD2 pre-mRNA (e.g., an intron sequence downstream of an alternative 5'ss of intron 3 of PKD2 (e.g., GRCh38 / hg38:chr4 88036480 of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence complementary to a sequence of an NMD exon (e.g., an alternative exon) upstream of an alternative 5'ss of an intron of a PKD2 pre-mRNA (e.g., a sequence of an NMD exon (e.g., an alternative exon) upstream of an alternative 5'ss of intron 3 of PKD2 (e.g., GRCh38 / hg38:chr4 88036480 of PKD2). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence complementary to an alternative 5' splice site of an intron downstream of an NMD exon (e.g., an alternative 5' splice site of intron 3 of PKD2 (e.g., GRCh38 / hg38:chr4 88036480) downstream of an NMD exon (e.g., an alternative exon).

[0258]

[0338] In some embodiments, the modified snRNA is modified to include a single-stranded nucleotide sequence that hybridizes with a target region (e.g., a 5'UTR target region) of a PKD2 mRNA that regulates the translation of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a 5'UTR sequence of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with an upstream open reading frame start codon of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a sequence upstream of the upstream open reading frame start codon of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a sequence downstream of the upstream open reading frame start codon of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a sequence upstream of the canonical open reading frame start codon of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a sequence downstream of the first upstream open reading frame start codon of the processed PKD2 mRNA and upstream of the second upstream open reading frame start codon of the processed PKD2 mRNA. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes with a sequence upstream of the first upstream open reading frame start codon of the processed PKD2 mRNA and upstream of the second upstream open reading frame start codon of the processed PKD2 mRNA.For example, the modified snRNA can be modified to contain a single-stranded nucleotide sequence that hybridizes to a sequence upstream of the start codon of the first upstream open reading frame of the processed PKD2 mRNA, upstream of the start codon of the second upstream open reading frame of the processed PKD2 mRNA, and upstream of the start codon of the canonical open reading frame of the processed PKD2 mRNA.

[0259] Methods for identifying additional ASOs that induce exon skipping

[0339] Also within the scope of the present disclosure are methods for identifying or determining ASOs that induce exon skipping of PKD2 NIE-containing pre-mRNA. For example, the method can include identifying or determining ASOs that induce NIE skipping of PKD2 NIE-containing pre-mRNA. ASOs that specifically hybridize with different nucleotides in the target region of the pre-mRNA can be screened to identify or determine ASOs that improve the rate and / or extent of splicing of the target intron. In some embodiments, the ASOs can block or interfere with the binding site(s) of splicing repressor(s) / silencer. Any method known in the art can be used to identify (determine) ASOs that, when hybridized with the target region of an exon, produce the desired effect (e.g., NIE skipping, protein or functional RNA production). These methods can also be used to identify ASOs that induce exon skipping of an included exon by binding to an intron adjacent to the included exon or to a targeted region of a non-included exon. An example of a method that can be used is provided below.

[0260]

[0340] A round of screening, referred to as an ASO "walk", can be performed using ASOs designed to hybridize with target regions of the pre-mRNA. For example, the ASOs used in the ASO walk can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 3' splice site of the intron preceding the included exon (e.g., a portion of the sequence of the intron located upstream of the target / included exon) to approximately 100 nucleotides downstream of the 3' splice site of the intron preceding the target / included exon and / or from approximately 100 nucleotides upstream of the 5' splice site of the intron following the included exon to approximately 100 nucleotides downstream of the 5' splice site of the intron following the target / included exon (e.g., a portion of the sequence of the intron located downstream of the target / included exon). For example, a first ASO 15 nucleotides long can be designed to specifically hybridize to nucleotides +6 to +20 relative to the 3' splice site of the intron preceding the target / included exon. A second ASO can be designed to specifically hybridize to nucleotides +11 to +25 relative to the 3' splice site of the intron preceding the target / inclusive exon. The ASO is designed to span the target region of the pre-mRNA. In embodiments, the ASO can be tiled more closely, for example, every 1, 2, 3, or 4 nucleotides. Additionally, the ASO can be tiled from 100 nucleotides downstream of the 5' splice site to 100 nucleotides upstream of the 3' splice site. In some embodiments, the ASO can be tiled from about 1,160 nucleotides upstream of the 3' splice site to about 500 nucleotides downstream of the 5' splice site. In some embodiments, the ASO can be tiled from about 500 nucleotides upstream of the 3' splice site to about 1,920 nucleotides downstream of the 3' splice site.

[0261]

[0341] One or more ASOs, or a control ASO (scrambled sequence, an ASO with a sequence not expected to hybridize with the target region) are delivered, for example, by transfection, to a disease-related cell line expressing a target pre-mRNA (e.g., a NIE-containing pre-mRNA as described herein). The exon skipping effect of each ASO can be evaluated by any method known in the art, for example, by reverse transcriptase (RT)-PCR using primers spanning the splice junction as described in Example 4. In ASO-treated cells, the long RT-PCR products generated using primers spanning the region containing the included exon (e.g., including the adjacent exons of the NIE) are reduced or absent compared to control ASO-treated cells, indicating enhanced splicing of the target NIE. In some embodiments, exon skipping efficiency (or splicing efficiency of splicing an intron containing an NIE), the ratio of spliced:non-spliced ​​pre-mRNA, the rate of splicing, or the extent of splicing can be improved using the ASOs described herein. The amount of protein or functional RNA encoded by the target pre-mRNA can also be assessed to determine whether each ASO achieved the desired effect (e.g., enhanced functional protein production). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy, and ELISA.

[0262]

[0342] A second round of screening, termed an ASO "microwalk", can be performed using ASOs designed to hybridize to the target region of the pre-mRNA. The ASOs used in the ASO microwalk are tiled nucleotide by nucleotide to further refine the nucleotide sequence of the pre-mRNA that results in exon skipping (or enhanced splicing of the NIE) when hybridized with the ASO.

[0263]

[0343] The regions defined by ASOs promoting splicing of the target intron are explored in more detail by ASO “microwalks”, which involve ASOs spaced in 1-nt steps and longer ASOs (usually 18–25 nt).

[0264]

[0344] As described above for ASO walks, ASO microwalks are performed by delivering one or more ASOs, or control ASOs (ASOs with scrambled sequences, sequences that are not expected to hybridize with the target region), for example by transfection, to disease-related cell lines expressing the target pre-mRNA. The splicing-inducing effect of each ASO can be evaluated by any method known in the art, for example by reverse transcriptase (RT)-PCR (see, for example, Example 4) using primers that span the NIEs described herein. If the longer RT-PCR products generated using primers that span the NIEs are reduced or absent in ASO-treated cells compared to control ASO-treated cells, this indicates enhanced exon skipping (or splicing of the target intron containing the NIE). In some embodiments, exon skipping efficiency (or splicing efficiency of splicing the intron containing the NIE), the ratio of spliced:non-spliced ​​pre-mRNA, the rate of splicing, or the extent of splicing can be improved using the ASOs described herein. The amount of protein or functional RNA encoded by the target pre-mRNA can also be assessed to determine whether each ASO achieved the desired effect (e.g., enhanced functional protein production). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy, and ELISA.

[0265]

[0345] ASOs that result in exon skipping (or enhanced splicing of introns containing NIEs) and increased protein production when hybridized to a region of pre-mRNA can be tested in vivo using animal models, such as transgenic mouse models with full-length human genes knocked in or humanized mouse models of disease. The appropriate route for administration of the ASO can vary depending on the disease and / or cell type to which the delivery of the ASO is desired. The ASO can be administered, for example, by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, or intravenous injection. After administration, cells, tissues, and / or organs of the model animal can be evaluated by methods known in the art and described herein, for example, by assessing splicing (e.g., efficiency, rate, extent) and protein production to quantify the effect of ASO treatment. The animal model can also be any phenotypic or behavioral indicator of disease or disease severity.

[0266]

[0346] Methods for identifying or validating NMD-induced exons in the presence of an NMD inhibitor, such as cycloheximide, are also within the scope of this disclosure. An exemplary method is provided in Example 2.

[0347] Representative genes are summarized in Table 1. The sequences of each intron are summarized in Table 2.

[0267] [Table 1]

[0268] [Table 2-1]

[0269] [Table 2-2]

[0270] [Table 2-3]

[0271]

Table 2-4

[0272]

Table 2-5

[0273]

Table 2-6

[0274]

Table 2-7

[0275]

Table 2-8

[0276]

Table 2-9

[0277]

Table 2-10

[0278]

Table 2-11

[0279]

Table 2-12

[0280]

Table 2-13

[0281]

Table 2-14

[0282]

Table 2-15

[0283]

Table 2-16

[0284]

Table 3-1

[0285]

Table 3-2

[0286]

Table 3-3

[0287]

Table 3-4

[0288]

Table 3-5

[0289]

Table 3-6

[0290]

Table 3-7

[0291]

Table 3-8

[0292]

Table 3-9

[0293]

Table 3-10

[0294]

Table 3-11

[0295]

Table 3-12

[0296]

Table 3-13

[0297]

Table 3-14

[0298]

Table 3-15

[0299]

Table 3-16

[0300]

Table 3-17

[0301]

Table 3-18

[0302]

Table 3-19

[0303]

Table 3-20

[0304]

Table 3-21

[0305]

Table 3-22

[0306]

Table 3-23

[0307]

Table 3-24

[0308]

Table 3-25

[0309]

Table 3-26

[0310]

Table 3-27

[0311]

Table 3-28

[0312]

Table 3-29

[0313]

Table 3-30

[0314]

Table 3-31

[0315]

Table 3-32

[0316]

Table 3-33

[0317]

Table 3-34

[0318]

Table 3-35

[0319]

Table 3-36

[0320]

Table 3-37

[0321]

Table 3-38

[0322]

Table 3-39

[0323]

Table 3-40

[0324]

Table 3-41

[0325]

Table 3-42

[0326]

Table 3-43

[0327]

Table 3-44

[0328]

Table 3-45

[0329]

Table 3-46

[0330]

Table 3-47

[0331]

Table 4-1

[0332]

Table 4-2

[0333]

Table 4-3

[0334]

Table 4-4

[0335]

Table 4-5

[0336]

Table 5-1

[0337] [Table 5-2]

[0338] [Table 5-3]

[0339] [Table 5-4]

[0340] [Table 5-5]

[0341] [Table 5-6]

[0342] [Table 6-1]

[0343] [Table 6-2] EXAMPLES

[0344]

[0348] The present disclosure will be more specifically illustrated by the following examples, although it should be understood that the present disclosure is not limited in any way by these examples.

[0345] Example 1: Identification of NMD-induced exon inclusion events in transcripts by next-generation sequencing using RNAseq

[0349] Next generation sequencing was used to perform whole transcriptome shotgun sequencing to reveal a snapshot of the transcripts produced by the genes described herein to identify NIE inclusion events. To this end, polyA+RNA was isolated from nuclear and cytoplasmic fractions of human cells and cDNA libraries were constructed using Illumina's TruSeq Stranded mRNA library Prep Kit. The libraries were paired-end sequenced to obtain 100 nucleotide reads that were mapped to the human genome (Grch38 / hg38 assembly). Figure 2 shows the identification of different exemplary nonsense-mediated mRNA decay (NMD)-induced exons in the PKD2 gene.

[0346] Example 2: Confirmation of NIE by Cycloheximide Treatment

[0350] RT-PCR analysis using cytoplasmic RNA from DMSO-treated or cycloheximide-treated human renal mixed epithelial cells and human renal cortical epithelial cells with primers in the exons can confirm the presence of bands corresponding to NMD-induced exons. The content of the products was confirmed by sequencing. Densitometric analysis of the bands was performed to calculate the percentage of NMD exon inclusion in the total transcript. Treating cells with cycloheximide to inhibit NMD can lead to an increase in products corresponding to NMD-induced exons in the cytoplasmic fraction. Figure 4B shows the confirmation of exemplary NIE exons in various gene transcripts with cycloheximide treatment, respectively.

[0347] Example 3: NMD exonic region ASO walk

[0351] ASO walks were performed using ASOs for the NMD exon regions targeting sequences immediately upstream of the 3' splice site, across the 3' splice site, across the 5' splice site, and downstream of the 5' splice site. ASOs are designed to cover these regions by shifting 5 nucleotides at a time. Figure 5 shows an ASO walk in an exemplary NIE exon region.

[0348] Example 4: NMD exonic region ASO walk assessed by RT-PCR

[0352] ASO walk sequences can be evaluated, for example, by RT-PCR. PAGE can be used to show SYBR-safe stained RT-PCR products of human cells treated with ASOs targeting NMD exon regions described herein by gymnotic incorporation, transfection, or nucleofection. Products corresponding to NMD exon inclusion and full length are quantified and percent NMD exon inclusion is plotted. Full length products can be normalized to an internal mRNA control and fold change relative to control can be plotted. Figure 7A shows productive PKD2 mRNA changes assessed by probe-based RT-qPCR (see Example 5, normalized to RPL32) using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in Figures 6A-B) for 24 hours. FIG. 7B shows the change in non-productive PKD2 mRNA as assessed by probe-based RT-qPCR (see Example 5, normalized to RPL32) using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in FIG. 6A-B) for 24 hours. FIG. 8A shows the change in productive PKD2 mRNA as assessed by probe-based RT-qPCR (see Example 5, normalized to RPL32) using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in FIG. 5) for 24 hours. FIG. 8B shows the change in non-productive PKD2 mRNA as assessed by probe-based RT-qPCR (see Example 5, normalized to RPL32) using primary renal mixed epithelial cells transfected with 80 nM of the indicated ASO (see macrowalk in FIG. 5) for 24 hours.

[0349] Example 5: NMD exonic ASO walk assessed by RT-qPCR

[0353] The same ASO uptake experiments can be assessed by RT-qPCR, and SYBR-green or any probe-based RT-qPCR amplification results can be normalized to an internal mRNA control and plotted as fold change relative to sham to confirm the RT-qPCR results.

[0350] Example 6: Dose-dependent effects of selected ASOs in CXH-treated cells

[0354] PAGE can be used to show SYBR-safe stained RT-PCR products in RNAiMAX transfected mouse or human cells treated with mock (sham, RNAiMAX alone) or ASO targeting NMD exons at 30nM, 80nM, 200nM concentrations. Products corresponding to NMD exon inclusion and full length can be quantified and percent NMD exon inclusion can be plotted. Full length products can also be normalized to the HPRT internal control and fold change relative to sham can be plotted.

[0351] Example 7: Injection of selected ASOs

[0355] PAGE of SYBR-safe stained RT-PCR products from mice injected with PBS (1 μL) (-), or with ASO or Cep290 (negative control ASO; Gerard et al, Mol. Ther. Nuc. Ac., 2015), various concentrations of 2'-ASO (1 μL) (+). Products corresponding to NMD exon inclusion and full length can be quantified and percent NMD exon inclusion can be plotted. Full length products can be normalized to a GAPDH internal control and the fold change of injected ASO relative to injected PBS can be plotted.

[0352] Example 8: Identification of NMD-induced alternative splicing events in transcripts by next-generation sequencing using RNAseq

[0356] By analyzing 83 publicly available RNA sequencing (RNA-seq) datasets derived from human liver, kidney, central nervous system (CNS), and eye tissues, we identified non-productive AS events in organs known to be accessible by ASOs. Computational analysis uncovered 7,819 unique genes with a total of 13,121 different types of non-productive AS events. By cross-referencing these genes with gene-disease databases such as Orphanet (www.orpha.net / ), we identified 1,265 disease-associated genes with non-productive AS events. Many NMD-susceptible transcripts are efficiently degraded in the analyzed tissues and cannot be detected by RNAseq, so there are many more genes with non-productive AS events than have been identified so far. Figure 3 shows the identification of different exemplary nonsense-mediated mRNA decay (NMD)-induced alternative splicing events in the PKD2 gene.

[0353] Example 9: Confirmation of alternative splicing by cycloheximide treatment

[0357] To validate the in silico predictions and quantify the abundance of targetable non-productive AS events, cells were treated with cycloheximide (CHX), a translation inhibitor known to inhibit NMD. As expected, reverse transcriptase (RT)-PCR analysis showed that predicted non-productive PKD2 splicing events were consistently increased in various cell lines upon CHX treatment compared to DMSO-treated cells. This increase indicates that these non-productive AS events lead to transcript degradation by NMD. Figure 4B shows the confirmation of exemplary NIE exons in various gene transcripts with cycloheximide treatment, respectively.

[0354] Example 10: PKD2 exon, alternative 5'ss, and 5'UTR region ASO walk

[0358] To identify ASOs that prevent non-productive AS events of PKD2 mRNA transcripts and / or modulate translation, an initial systematic ASO walk was performed in 5-nt steps along the AS events of interest or the 5'UTR of PKD2. Figure 5 shows a systematic ASO walk along the NMD exon AS events of PKD2 pre-mRNA. Figures 6A and 6B show systematic ASO walks along alternative 5'ss AS events of PKD2 pre-mRNA. Figure 10 shows a systematic ASO walk along the 5'UTR of PKD2 mRNA. These ASOs can have a uniform phosphorothioate backbone and a methoxyethyl at the 2' ribose position (2'MOE-PS). These modifications have previously been shown to allow binding to RNA with high affinity and to confer resistance of the target RNA-ASO complex to both nuclease and RNase H cleavage. RT-PCR analysis from transfected cells identifies several ASOs that reduce AS in PKD2 mRNA and increase productive mRNA or promote translation of PKD2. The observed increase in PKD2 productive mRNA is confirmed by TaqMan qPCR. The observed increase in PKD2 translation is confirmed by Western blotting. The fold change in AS can be plotted against the increase in productive mRNA (qPCR) to show that the ASO is functioning by mechanism. The observed increase in PKD2 translation is confirmed by Western blotting. The fold change in translation can be plotted against the increase in polycystin 2 protein (Western blotting) to show that the ASO is functioning by mechanism. These results are expected to strongly suggest that upregulation of gene expression can be achieved by prevention of non-productive AS by ASO.

[0355] Example 11: Use of ASOs to increase cellular protein expression in a dose-dependent manner

[0359] Since the desired upregulation level varies depending on the target gene and disease, the positive ASO hits selected from the initial walk are used to determine whether the increase in productive mRNA can be titrated across non-productive AS events. Cells are transfected with increasing concentrations of exemplary PKD2 ASOs to demonstrate dose-dependent upregulation. Concentrations are selected based on ASO potency. RT-PCR results show a dose-dependent reduction in non-productive selective 3'ss selection in PKD2 compared to non-targeting ASO controls transfected at the same respective doses. Conversely, a dose-dependent increase in productive mRNA is observed compared to non-targeting ASO controls as measured by TaqMan qPCR. To determine whether the observed upregulation in productive mRNA translates into a dose-dependent increase in protein levels, polycystin 2 is measured in extracts from cells transfected with increasing concentrations of targeting ASOs. Initially, antibodies against PKD2 will be validated by small interfering (si)RNA-mediated knockdown of protein expression and Western blot analysis. Immunoblotting results of extracts from cells transfected with selected ASOs are expected to show a dose-dependent increase in polycystin 2. Non-targeting ASO controls are expected to show no significant effect on protein levels. Taken together, the data are expected to show that ASOs targeting various types of non-productive AS events result in a titratable increase in productive mRNA, resulting in increased protein expression. The titratable nature of TANGO ASO-mediated protein upregulation is expected to suggest that protein levels can be tightly controlled, reducing the risk of overexpression. This aspect of TANGO technology is expected to be particularly suited to addressing autosomal dominant haploinsufficiency diseases.

[0356] Example 12: Validation of the TANGO approach in vivo

[0360] To prove the in vivo applicability of the TANGO mechanism, positive hits can be selected from an ASO walk targeting non-productive exon inclusion events in PKD2. Non-productive AS events in the human PKD2 gene also occur in mice and are highly conserved at the sequence level (data not shown), allowing for testing of human-targeted ASOs in mice. Similar to other ASOs presented here, gymnotic (free) incorporation of increasing concentrations of PKD2 ASO leads to a dose-dependent reduction in AS and an inversely correlated increase in productive mRNA compared to non-targeted ASO controls. To confirm whether the observed ASO effects can be reproduced in vivo, ASOs are administered to mice or PBS is administered to mice by injection. RNA and protein can be extracted from treated mice 5 days after injection. RT-PCR analysis can be performed to show clear target engagement and consistent reduction of non-productive exon inclusion in ASO-treated mice compared to the control PBS cohort. This reduction can be effectively translated into a nearly 4-fold increase in productive mRNA as measured by TaqMan qPCR. Concomitantly, an increase in protein by Western blot can be detected using a validated antibody. These data provide an in vivo proof of concept for the TANGO approach, which leverages non-productive AS events to upregulate protein expression.

[0357] Example 13: TANGO (Targeted Augmentation of Nuclear Gene Output) for the Treatment of Genetic Diseases

[0361] TANGO (Targeted Enhancement of Nuclear Gene Output), a novel technology that exploits antisense-mediated regulation of pre-mRNA splicing, was developed to increase protein expression. TANGO prevents naturally occurring nonproductive splicing events that lead to either transcript degradation by nonsense-mediated mRNA decay (NMD) or nuclear retention. By doing so, TANGO increases the production of productive mRNAs and, consequently, full-length, fully functional proteins. We performed bioinformatics analysis of RNA sequencing (RNAseq) datasets to identify nonproductive events. More than 50% of protein-coding genes had nonproductive events. Of these, approximately 2,900 were disease-related. To validate the in silico predictions, we selected targets (e.g., PKD2) that represent different types of NMD-induced nonproductive alternative splicing (AS) events (cassette exons, alternative splice sites, and alternative introns) and quantified their abundance by treating cells with cycloheximide (CHX), a translation inhibitor known to inhibit NMD. RT-PCR analysis of selected targets was performed and an increase in non-productive mRNA was observed upon CHX treatment compared to DMSO-treated cells. Antisense oligonucleotides (ASOs) were designed to target three types of NMD-induced non-productive AS events, and TANGO ASOs are expected to modulate splicing to increase productive mRNA and protein in a dose-dependent manner in vitro. Consistent with the TANGO mechanism, the level of ASO-mediated upregulation is expected to be observed to be directly proportional to the abundance of the targeted NMD-induced event. Furthermore, injection of TANGO ASOs targeting non-productive AS events in PKD2 into wild-type mice is expected to lead to an increase in productive mRNA and polycystin 2. Because TANGO exploits naturally occurring non-productive AS, this novel approach can be used to upregulate gene expression from wild-type or hypomorphic alleles, which may provide a unique strategy for the treatment of genetic diseases.TANGO has been applied to the development of treatments for autosomal dominant haploinsufficiency disorders such as genetic epilepsy: TANGO ASOs that increase expression from the wild-type allele can be used to restore physiological levels of the defective protein.

[0358] Example 14: Transcript database and NMD junction labeling:

[0362] Annotated transcripts are downloaded from GENCODE (v.28) and REFSEQ (via UCSC). Each annotated inter-exonic junction is labeled "coding" or "NMD". A junction is labeled "NMD" only if it is found exclusively in transcripts labeled "nonsense_mediated_decay" (GENCODE) or "NR" (REFSEQ). RNA-seq Library Processing:

[0359]

[0363] All RNA-seq samples were collected using STAR 1 v2.6.1b to align to the hg38 genome and composite transcript databases to generate splice junction counts. Identification and quantification of putative NMD-induced splicing events:

[0360]

[0364] All samples were SUPPA2 2 We define annotated alternative splicing events. We then use different approaches to represent and quantify each type of alternative splicing: Exon inclusion (EI) and exon skipping (ES):"Skipped exon" events are parsed from SUPPA to obtain the inclusion and skipping junctions for each event. If the skipping junction is labeled "NMD", the event is labeled "ES_NMD". If any of the inclusion junctions are labeled "NMD", the event is labeled "EI_NMD". Otherwise, the event is labeled "Cassette exon". Inclusion and skipping junction counts are taken from the STAR output and these counts are summed over all events sharing the same alternatively spliced ​​exon. The final PSI of the inclusion is calculated as follows:

number

number

number

number

[0361] Disease association annotation:

[0365] Download gene-disease association data from Orphadata (http: / / www.orphadata.org), a public data repository of Orphanet. We extended the annotation to cover all gene symbol aliases.

[0362] Example 15: Cycloheximide (CHX) Treatment, Cell Culture, and Transfection

[0366] To measure the abundance of non-productive mRNA, cells are incubated with 50 μg / ml CHX (Cell Signaling Technology) dissolved in DMSO for 3 hours.

[0363]

[0367] For example, cells were grown in EMEM containing 10% FBS at 1 × 10 5 Cells are seeded in 24-well plates and reverse transfected with 80 nM ASO for initial screening or 1, 5, or 25 nM of the selected ASO using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. Total RNA is extracted 24 hours after transfection using RNeasy mini kit (Qiagen) and cDNA is synthesized using ImProm-II reverse transcriptase (Promega). Total protein is extracted 48 hours after transfection with RIPA buffer (Cell Signaling Technology).

[0364]

[0368] As another example, HEK293 cells were grown in EMEM containing 10% FBS and incubated at 7 × 10 5 Cells are seeded in 6-well plates and reverse transfected with 30, 60, and 120 nM antisense oligonucleotides (ASOs) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. Total RNA is extracted 24 hours after transfection using RNeasy mini kit (Qiagen) and cDNA is synthesized using ImProm-II reverse transcriptase (Promega). Total protein is extracted 48 hours after transfection with RIPA buffer (Cell Signaling Technology).

[0365]

[0369] As another example, Huh7 cells were grown in DMEM containing 10% FBS and diluted at 1 × 10 5 Cells are seeded in 12-well plates and reverse transfected with 5, 20, or 80 nM ASO using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. For RT-PCR analysis, cells are treated with 50 μg / mL CHX (Cell Signaling Technology) in DMSO for 3 h 21 h after transfection. Total RNA is extracted using RNeasy mini kit (Qiagen) 24 h after transfection and cDNA is synthesized using ImProm-II reverse transcriptase (Promega). Total protein is extracted with RIPA buffer (Cell Signaling Technology) 48 h after transfection.

[0366]

[0370] As another example, ReNcell VM cells are grown on laminin-coated flasks (2D culture) in complete NSC medium containing 20 ng / mL bFGF and EGF, respectively, until approximately 90% confluent. Cells are then detached by Accutase treatment, washed with PBS, and cultured with 3, 8, and 20 μM ASO for gymnotic (free) uptake in complete NSC medium in ultra-low attachment surface 24-well polystyrene plates. Total RNA is extracted 72 hours after adding ASO to the medium using RNeasy mini kit (Qiagen), and cDNA is synthesized using ImProm-II reverse transcriptase (Promega).

[0367] Example 16: qPCR and RT-PCR Assays

[0371] For productive mRNA expression analysis, TaqMan qPCR (Thermo Fisher SC) is performed for PKD2. SYBR green qPCR or probe-based qPCR is performed for human PKD2 using forward primer, reverse primer, and probe. Cycling conditions are, for example, 95°C for 30 seconds for denaturation, 60°C for 30 seconds for annealing, and 72°C for 60 seconds for extension, for 30 cycles. In another example, cycling conditions are 95°C for 30 seconds for denaturation, 55°C for 30 seconds for annealing, and 72°C for 30 seconds for extension, for 29 cycles. In another example, cycling conditions are 95°C for 30 seconds for denaturation, 55°C for 30 seconds for annealing, and 72°C for 75 seconds for extension, for 28 cycles. In another example, cycling conditions are 95°C for 30 seconds for denaturation, 56°C for 30 seconds for annealing, and 72°C for 75 seconds for extension, for 28 cycles. PCR products are separated on 5% polyacrylamide gels and quantified using Multi Gauge software Version 2.3.

[0368] Example 17: Western Blotting

[0372] Protein extracts are quantified by colorimetric assay using the Pierce BCA protein assay kit (ThermoFisher).

[0369]

[0373] For example, immunoblotting is performed with 25 μg of lysate. For another example, immunoblotting is performed with 60 μg of lysate. For another example, immunoblotting is performed with 120 μg of lysate. For another example, immunoblotting is performed with 30 μg of lysate. Purchase primary and secondary antibodies. Scan blots using a Typhoon RLA 9000 imager (General Electric). Perform densitometric analysis using Multi Gauge software Version 2.3.

[0370] Example 18: Flow Cytometry

[0374] Cells are lifted from culture plates in FACS buffer. Cells are stained with APC antibody (1:250). Data from 15,000 cells are collected on a Guava Easycyte 12HT (EMD Millipore) flow cytometer. Fluorescence minus 1 is used to determine the positive gate.

[0371] Example 19: PKD2 exonic region and 5'UTR vectored ASO walk

[0375] To identify vectored ASOs that may prevent non-productive AS events, a systematic vectored ASO walk can be performed in 5-nt or 2-nt steps along the AS events of interest. These vectored ASOs can be expressed from vectors as modified U1 snRNA or U7 snRNA containing the ASO sequence as a targeting sequence. Figure 5 shows a systematic vectored ASO walk along the NMD exon AS events of PKD2 pre-mRNA. Figures 6A and 6B show a systematic vectored ASO walk along the selective 5'ss AS events of PKD2 pre-mRNA. Figure 10 shows a systematic vectored ASO walk along the 5'UTR of PKD2 mRNA. The vectored ASOs are expressed as modified U7 snRNA. RT-PCR analysis from transfected cell lines can identify several vectored ASOs that lead to reduced AS in PKD2 mRNA and increased productive mRNA. The observed increase in PKD2 productive mRNA can be confirmed by TaqMan qPCR. Fold change in AS can be plotted against productive mRNA increase (qPCR) to demonstrate that the vectored ASO is functioning mechanistically.

[0372]

[0376] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present invention. It is understood that various alternatives to the embodiments of the present invention described herein may be used in practicing the present invention. It is intended that the following claims define the scope of the present invention, and that methods and structures within the scope of these claims and their equivalents are covered thereby.

[0373] Exemplary embodiment I

[0377] In certain embodiments, described herein is a method of modulating expression of a target protein in a cell having a pre-mRNA transcribed from a target gene and including a nonsense-mediated RNA decay-guided exon (NMD exon), comprising contacting the cell with an agent or a vector encoding the agent, whereby the agent modulates splicing of the NMD exon from the pre-mRNA, thereby modulating the level of processed mRNA processed from the pre-mRNA and modulating expression of the target protein in the cell, where the target protein is polycystin 2 and the target gene is the PKD2 gene.

[0374]

[0378] In certain embodiments, described herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by modulating expression of a target protein in cells of the subject, comprising contacting cells of the subject with an agent or a vector encoding the agent, whereby the agent modulates splicing of a nonsense-mediated mRNA decay-directed exon (NMD exon) from a pre-mRNA transcribed from the target gene and containing the NMD exon, thereby modulating the level of processed mRNA processed from the pre-mRNA and modulating expression of the target protein in the cells of the subject, wherein the target protein is polycystin 2 and the target gene is the PKD2 gene.

[0375]

[0379] In some embodiments, the agent (a) binds to a targeted portion of the pre-mRNA, (b) modulates binding of a factor involved in splicing of the NMD exon, or (c) a combination of (a) and (b).

[0376]

[0380] In some embodiments, the agent interferes with binding of a factor involved in splicing of the NMD exon to the region of the targeting moiety.

[0381] In some embodiments, the targeting portion of the pre-mRNA is proximal to the NMD exon.

[0377]

[0382] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, or 50 nucleotides upstream of the 5' end of the NMD exon.

[0378]

[0383] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide upstream of the 5' end of the NMD exon.

[0379]

[0384] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the 3' end of the NMD exon.

[0380]

[0385] In some embodiments, the targeting portion of the pre-mRNA is at least about 1500, 1000, 800, 700, 600, 500, 400, 300, 200, 100, 80, 70, 60, 50, 40, 300, 200, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 2, 1 nucleotide downstream from the 3' end of the NMD exon.

[0381]

[0386] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides upstream from the genomic site of GRCh38 / hg38:chr4:88031085.

[0382]

[0387] In some embodiments, the targeting portion of the pre-mRNA is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream from the genomic site of GRCh38 / hg38:chr4:88031085.

[0383]

[0388] In some embodiments, the targeting portion of the pre-mRNA is up to about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the genomic site GRCh38 / hg38:chr4:88031140.

[0384]

[0389] In some embodiments, the targeting portion of the pre-mRNA is about 1500, about 1000, about 800, about 700, about 600, about 500, about 400, about 300, about 200, about 100, about 80, about 70, about 60, or about 50 nucleotides downstream from the genomic site at GRCh38 / hg38:chr4:88031140.

[0385]

[0390] In some embodiments, the targeting portion of the pre-mRNA is located in an intron region between two canonical exon regions of the pre-mRNA, the intron region containing the NMD exon.

[0386]

[0391] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with the NMD exon.

[0392] In some embodiments, the targeted portion of the pre-mRNA at least partially overlaps with an intron upstream or downstream of the NMD exon.

[0387]

[0393] In some embodiments, the targeting portion of the pre-mRNA comprises a 5'NMD exon-intron junction or a 3'NMD exon-intron junction.

[0394] In some embodiments, the targeted portion of the pre-mRNA is within an NMD exon.

[0388]

[0395] In some embodiments, the targeted portion of the pre-mRNA comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleotides of an NMD exon.

[0389]

[0396] In some embodiments, the NMD exon comprises a sequence having at least 80%, at least 90%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2. In some embodiments, the NMD exon comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2.

[0390]

[0397] In some embodiments, the NMD exon comprises a sequence selected from the group consisting of the sequences listed in Table 2.

[0398] In some embodiments, the pre-mRNA comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0391]

[0399] In some embodiments, the pre-mRNA is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0392]

[0400] In some embodiments, the targeting portion of the pre-mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of a sequence selected from the group consisting of the sequences listed in Table 2 or Table 3.

[0393]

[0401] In some embodiments, the agent is an antisense oligomer (ASO), wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to at least 8 contiguous nucleic acids of a sequence selected from the group consisting of the sequences listed in Table 4.

[0394]

[0402] In some embodiments, the targeted portion of the pre-mRNA is within the nonsense-mediated RNA decay-directed exon GRCh38 / hg38:chr4:88031085 88031140.

[0395]

[0403] In some embodiments, the targeted portion of the pre-mRNA is upstream or downstream of the nonsense-mediated RNA decay-directed exon GRCh38 / hg38:chr4:88031085 88031140.

[0396]

[0404] In some embodiments, the targeting portion of the pre-mRNA comprises the exon-intron junction of exon GRCh38 / hg38:chr4:88031085 88031140.

[0397]

[0405] In some embodiments, the polycystin 2 expressed from the processed mRNA is full-length polycystin 2 or wild-type polycystin 2.

[0406] In some embodiments, the polycystin 2 expressed from the processed mRNA is at least partially functional compared to wild-type polycystin 2.

[0398]

[0407] In some embodiments, the polycystin 2 expressed from the processed mRNA is at least partially functional compared to full-length wild-type polycystin 2.

[0408] In some embodiments, the agent promotes the exclusion of the NMD exon from the pre-mRNA.

[0399]

[0409] In some embodiments, the clearance of NMD exons from pre-mRNA in cells contacted with the agent is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, or greater than the clearance of NMD exons from pre-mRNA in control cells. , about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold increase.

[0400]

[0410] In some embodiments, the agent increases the level of processed mRNA in the cell.

[0411] In some embodiments, the level of processed mRNA in cells contacted with an agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about An increase of at least about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0401]

[0412] In some embodiments, the agent increases expression of a target protein in a cell.

[0413] In some embodiments, the level of the target protein expressed from the pre-mRNA in the cells contacted with the agent is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 ... fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold increase.

[0402]

[0414] In some embodiments, the disease or condition is induced by a loss-of-function mutation in the target protein.

[0415] In some embodiments, the disease or condition is associated with haploinsufficiency of a gene encoding a target protein, and the subject has a first allele that encodes a functional target protein and a second allele in which the target protein is not produced or is produced at reduced levels, or a second allele that encodes a non-functional or partially functional target protein.

[0403]

[0416] In some embodiments, the disease or condition is selected from the group consisting of polycystic kidney disease with or without polycystic liver disease, autosomal dominant polycystic kidney disease, and intracranial aneurysms.

[0404]

[0417] In some embodiments, the disease or condition is associated with an autosomal recessive mutation in a gene encoding a target protein, and the subject has a first allele that encodes a target protein from which (i) the target protein is not produced or is produced at a reduced level compared to the wild-type allele, or (ii) the produced target protein is non-functional or partially functional compared to the wild-type allele, and a second allele from which (iii) the target protein is produced at a reduced level compared to the wild-type allele and the produced target protein is at least partially functional compared to the wild-type allele, or (iv) the produced target protein is partially functional compared to the wild-type allele.

[0405]

[0418] In some embodiments, the disease or condition is selected from the group consisting of polycystic kidney disease with or without polycystic liver disease, autosomal dominant polycystic kidney disease, and intracranial aneurysms.

[0406]

[0419] In some embodiments, the agent promotes the exclusion of the NMD exon from the pre-mRNA and increases expression of the target protein in the cell.

[0420] In some embodiments, the agent inhibits the exclusion of an NMD exon from a pre-mRNA encoding a target protein.

[0407]

[0421] In some embodiments, the clearance of NMD exons from pre-mRNA in cells contacted with the agent is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, or greater than the clearance of NMD exons from pre-mRNA in control cells. , about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold.

[0408]

[0422] In some embodiments, the agent reduces the level of processed mRNA in the cell.

[0423] In some embodiments, the level of processed mRNA in cells contacted with an agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, about 2 to about 5 times, about 2 to about A decrease of at least about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0409]

[0424] In some embodiments, the agent reduces expression of a target protein in a cell.

[0425] In some embodiments, the level of the target protein expressed from the pre-mRNA in the cells contacted with the agent is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 ... fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold.

[0410]

[0426] In some embodiments, the disease or condition is induced by a gain-of-function mutation in the target protein.

[0427] In some embodiments, a subject has an allele that causes a target protein to be produced at increased levels or that encodes a mutant target protein that exhibits increased activity in a cell.

[0411]

[0428] In some embodiments, the agent inhibits the exclusion of the NMD exon from the pre-mRNA encoding the target protein, thereby reducing expression of the target protein in the cell.

[0429] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises a backbone modification comprising a phosphorothioate or phosphorodiamidate linkage.

[0412]

[0430] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

[0413]

[0431] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer comprises at least one modified sugar moiety.

[0432] In some embodiments, each sugar moiety is a modified sugar moiety.

[0414]

[0433] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer is an ASO having a length of 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-3 5 nucleobases, 10-30 nucleobases, 10-25 nucleobases, 10-20 nucleobases, 10-15 nucleobases, 11-50 nucleobases, 11-40 nucleobases, 11-35 nucleobases, 11-30 nucleobases, 11-25 nucleobases, 11-20 nucleobases, 11-15 nucleobases, 12-50 nucleobases, 12-40 nucleobases, 12-35 nucleobases, 12-30 nucleobases, 12-25 nucleobases, 12-20 nucleobases, or 12-15 nucleobases.

[0415]

[0434] In some embodiments, the agent is an antisense oligomer (ASO), and the antisense oligomer is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeted portion of the pre-mRNA.

[0416]

[0435] In some embodiments, the method further comprises assessing the mRNA or expression level of the target protein.

[0436] In some embodiments, the subject is a human.

[0437] In some embodiments, the subject is a non-human animal.

[0438] In some embodiments, the subject is a fetus, embryo, or child.

[0439] In some embodiments, the cells are ex vivo.

[0417]

[0440] In some embodiments, the agent is administered to the subject by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, intravitreal, or intravenous injection.

[0441] In some embodiments, the method further comprises administering a second therapeutic agent to the subject.

[0418]

[0442] In some embodiments, the second therapeutic agent is a small molecule.

[0443] In some embodiments, the second therapeutic agent is an antisense oligomer.

[0444] In some embodiments, the second therapeutic agent corrects intron retention.

[0445] In some embodiments, the method treats a disease or condition.

[0419]

[0446] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay exon (NSE) modulating agent that interacts with a target motif in a pre-mRNA to modulate the exclusion of the NSE from the processed mRNA transcript and modulate the inclusion of a canonical exon in the processed mRNA transcript, wherein the target motif is located in (i) an intronic region between two canonical exons, (ii) one of the two canonical exons, or (iii) a region spanning both an intron and a canonical exon, and the NSE comprises (a) only a portion of the canonical exon, or (b) a canonical exon and at least a portion of the intron adjacent to the canonical exon, and wherein the NSE modulating agent modulates the exclusion of the NSE from the pre-mRNA transcript and modulates the inclusion of the canonical exon in the processed mRNA transcript.

[0420]

[0447] In some embodiments, NSE-modulating agents promote the exclusion of NSEs from pre-mRNA transcripts and promote the inclusion of canonical exons in the processed mRNA transcript.

[0421]

[0448] In some embodiments, the processed mRNA transcript encodes a target protein, and the NSE modulating agent increases expression of the target protein in cells containing the pre-mRNA.

[0449] In some embodiments, the target protein is polycystin 2.

[0422]

[0450] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay alternative 5' or 3' splice site (NSASS) modulator that interacts with a target motif in a pre-mRNA to modulate splicing at an alternative 5' or 3' splice site of the pre-mRNA and modulate the inclusion of a canonical exon in a processed mRNA transcript processed from the pre-mRNA, wherein the target motif is selected from the group consisting of (i) an intronic region between two canonical exons, (ii) one of the two canonical exons, or (iii) a composition located in a region spanning both an intron and a canonical exon, wherein modulating splicing at an alternative 5' or 3' splice site in the pre-mRNA modulates the exclusion of an exon from the pre-mRNA transcript, wherein the exon comprises (a) only a portion of the canonical exon, or (b) the canonical exon and at least a portion of the intron adjacent to the canonical exon, and wherein the NSASS modulating agent modulates the exclusion of the exon from the pre-mRNA transcript and modulates the inclusion of the canonical exon in the processed mRNA transcript.

[0423]

[0451] In some embodiments, NSASS-modulating agents promote the exclusion of exons resulting from splicing at alternative 5' or 3' splice sites from the pre-mRNA transcript and promote the inclusion of canonical exons in the processed mRNA transcript.

[0424]

[0452] In some embodiments, the processed mRNA transcript encodes a target protein, and the NSASS modulating agent increases expression of the target protein in cells containing the pre-mRNA.

[0453] In some embodiments, the target protein is selected from the group consisting of PKD2.

[0425]

[0454] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay exon (NSE) modulating agent for modulating expression of a target protein in a cell comprising a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an alternative nonsense-mediated RNA decay-induced (NMD) exon comprising an alternative 5' splice site upstream of and within the canonical exon relative to an intron following the canonical exon, or downstream of and within the canonical 5' splice site relative to an intron following the canonical exon, and wherein the NSE modulating agent modulates splicing of the pre-mRNA at the alternative 5' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 5' splice site modulates expression of the target protein in the cell.

[0426]

[0455] In some embodiments, the target protein is PKD2.

[0456] In some embodiments, splicing of the pre-mRNA at the alternative 5' splice site increases expression of the target protein in the cell.

[0427]

[0457] In some embodiments, the alternative nonsense-mediated RNA decay-induced (NMD) exon comprises an alternative 5' splice site upstream of and within the canonical exon relative to the intron following the canonical exon.

[0428]

[0458] In some embodiments, the alternative nonsense-mediated RNA decay-induced (NMD) exon comprises an alternative 5' splice site downstream of the canonical 5' splice site and within the intron relative to the intron following the canonical exon.

[0429]

[0459] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay alternative 5' or 3' splice site (NSASS) modulator for modulating expression of a target protein in a cell comprising a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an exon comprising an alternative 5' splice site either upstream of and within the canonical 5' splice site relative to an intron following the canonical exon, or downstream of and within the canonical 5' splice site relative to an intron following the canonical exon, and wherein the NSASS modulator modulates splicing of the pre-mRNA at the alternative 5' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 5' splice site modulates expression of the target protein in the cell.

[0430]

[0460] In some embodiments, the target protein is polycystin 2.

[0461] In some embodiments, splicing of the pre-mRNA at the alternative 5' splice site increases expression of the target protein in the cell.

[0431]

[0462] In some embodiments, the pre-mRNA comprises an exon that comprises an alternative 5' splice site upstream of the canonical 5' splice site and within the canonical exon relative to the intron following the canonical exon.

[0432]

[0463] In some embodiments, the pre-mRNA comprises an exon that comprises an alternative 5' splice site downstream of the canonical 5' splice site and within the intron relative to the intron following the canonical exon.

[0433]

[0464] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay exon (NSE) modulating agent for modulating expression of a target protein in a cell comprising a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an alternative nonsense-mediated RNA decay-induced (NMD) exon comprising an alternative 3' splice site downstream of and within the canonical exon relative to an intron preceding the canonical exon, or upstream of and within the canonical 3' splice site relative to an intron preceding the canonical exon, and wherein the NSE modulating agent modulates splicing of the pre-mRNA at the alternative 3' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 3' splice site modulates expression of the target protein in the cell.

[0434]

[0465] In some embodiments, the target protein is polycystin 2.

[0466] In some embodiments, splicing of the pre-mRNA at the alternative 3' splice site increases expression of the target protein in the cell.

[0435]

[0467] In some embodiments, the alternative nonsense-mediated RNA decay-induced (NMD) exon comprises an alternative 3' splice site downstream of and within the canonical exon relative to the intron preceding the canonical exon.

[0436]

[0468] In some embodiments, the alternative nonsense-mediated RNA decay (NMD) exon comprises an alternative 3' splice site upstream of and within the canonical 3' splice site relative to the intron preceding the canonical exon.

[0437]

[0469] In certain embodiments, described herein are compositions comprising a nonsense-mediated RNA decay alternative 5' or 3' splice site (NSASS) modulator that modulates expression of a target protein in a cell comprising a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an exon comprising an alternative 3' splice site downstream of and within the canonical 3' splice site relative to an intron preceding the canonical exon, or upstream of and within the canonical 3' splice site relative to an intron preceding the canonical exon, and wherein the NSASS modulator modulates splicing of the pre-mRNA at the alternative 3' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 3' splice site modulates expression of the target protein in the cell.

[0438]

[0470] In some embodiments, the target protein is polycystin 2.

[0471] In some embodiments, splicing of the pre-mRNA at the alternative 3' splice site increases expression of the target protein in the cell.

[0439]

[0472] In some embodiments, the pre-mRNA comprises an exon that comprises an alternative 3' splice site downstream of the canonical 3' splice site and within the canonical exon relative to the intron preceding the canonical exon.

[0440]

[0473] In some embodiments, the pre-mRNA comprises an exon that comprises an alternative 3' splice site upstream of the canonical 3' splice site and within the intron relative to the intron preceding the canonical exon.

[0441]

[0474] In some embodiments, the agent is a small molecule.

[0475] In some embodiments, the agent is a polypeptide.

[0476] In some embodiments, the polypeptide is a nucleic acid binding protein.

[0477] In some embodiments, the nucleic acid binding protein contains a TAL-effector or a zinc finger binding domain.

[0442]

[0478] In some embodiments, the nucleic acid binding protein is a Cas family protein.

[0479] In some embodiments, the polypeptide is associated with or complexed with one or more nucleic acid molecules.

[0480] In some embodiments, the agent is an antisense oligomer (ASO) complementary to the targeted region of the pre-mRNA.

[0443]

[0481] In some embodiments, the agent is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeted region of a pre-mRNA encoding the target protein.

[0444]

[0482] In some embodiments, the agents contain backbone modifications including phosphorothioate or phosphorodiamidate linkages.

[0483] In some embodiments, the agent comprises a phosphorodiamidate morpholino.

[0484] In some embodiments, the agent comprises a locked nucleic acid.

[0485] In some embodiments, the agent comprises a peptide nucleic acid.

[0486] In some embodiments, the agent comprises 2'-O-methyl.

[0487] In some embodiments, the agent comprises a 2'-fluoro or a 2'-O-methoxyethyl moiety.

[0488] In some embodiments, the agent comprises at least one modified sugar moiety.

[0489] In some embodiments, each sugar moiety is a modified sugar moiety.

[0445]

[0490] In some embodiments, the agent is an antisense oligomer and the agent is an antisense oligomer having a length of 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-35 nucleobases , 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases.

[0446]

[0491] Described herein, in certain embodiments, are compositions comprising a nucleic acid molecule encoding an agent according to the compositions provided herein.

[0492] In some embodiments, the nucleic acid molecule is incorporated into a viral delivery system.

[0493] In some embodiments, the viral delivery system is an adenovirus-associated vector.

[0447]

[0494] Provided herein, in certain embodiments, is a method of modulating protein expression comprising contacting a nonsense-mediated RNA decay exon (NSE) modulating agent with a target motif in a pre-mRNA, wherein the NSE comprises (i) only a portion of a canonical exon, or (ii) a canonical exon and at least a portion of an intron adjacent to the canonical exon, the pre-mRNA is processed to form a processed mRNA transcript, the NSE modulating agent modulates exclusion of the NSE from the pre-mRNA transcript and modulates inclusion of the canonical exon in the processed mRNA transcript, the processed mRNA transcript is translated, and the exclusion of the NSE and inclusion of the canonical exon modulates target protein expression compared to target protein expression of a comparable mRNA transcript comprising the NSE instead of the canonical exon.

[0448]

[0495] In some embodiments, the target motif is located in an intronic region between two canonical exons.

[0496] In some embodiments, the target motif is located in one of the two canonical exons.

[0449]

[0497] In some embodiments, the target motif is located in a region that spans both an intron and a canonical exon.

[0498] In some embodiments, the target protein is polycystin 2.

[0450]

[0499] In certain embodiments, described herein are methods of modulating expression of a target protein by a cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an alternative nonsense-directed RNA decay (NMD) exon comprising an alternative 3' splice site downstream of and within the canonical exon relative to an intron preceding the canonical exon, or upstream of and within the 3' splice site relative to an intron preceding the canonical exon, the method comprising contacting the cell with a nonsense-directed RNA decay exon (NSE) modulating agent, wherein the nonsense-directed RNA decay exon (NSE) modulating agent modulates splicing of the pre-mRNA at the alternative 3' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 3' splice site modulates expression of the target protein.

[0451]

[0500] In some embodiments, the target protein is polycystin 2.

[0501] In certain embodiments, described herein are methods of modulating expression of a target protein by a cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an alternative nonsense-mediated RNA decay-guided (NMD) exon comprising an alternative 5' splice site either upstream of and within the canonical 5' splice site relative to an intron following the canonical exon, or downstream of and within the canonical 5' splice site relative to an intron following the canonical exon, the method comprising contacting the cell with a nonsense-mediated RNA decay exon (NSE) modulating agent, wherein the nonsense-mediated RNA decay exon (NSE) modulating agent modulates splicing of the pre-mRNA at the alternative 5' splice site, thereby modulating processing of an mRNA transcript from the pre-mRNA, and wherein splicing of the pre-mRNA at the alternative 5' splice site modulates expression of the target protein.

[0452]

[0502] In some embodiments, the target protein is polycystin 2.

[0503] In some embodiments, nonsense-mediated RNA decay exon (NSE) modulating agents bind to targeted portions of pre-mRNA.

[0453]

[0504] In some embodiments, nonsense-mediated RNA decay exon (NSE) modulating agents bind to factors involved in splicing of the NSE or NMD exon.

[0505] In some embodiments, nonsense-mediated RNA decay exon (NSE) modulating agents inhibit the activity of factors involved in splicing of NMD exons.

[0454]

[0506] In some embodiments, nonsense-mediated RNA decay exon (NSE) modulating agents interfere with the binding of factors involved in splicing of the NMD exon to the region of the targeted portion of the pre-mRNA.

[0507] In some embodiments, modulation of pre-mRNA splicing increases expression of a target protein.

[0455]

[0508] In some embodiments, the level of a target protein in a cell is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, about 2 to about 6 ... An increase of about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

[0456]

[0509] In some embodiments, modulation of pre-mRNA splicing increases the production of processed mRNA that encodes the target protein.

[0457]

[0510] In some embodiments, the level of processed mRNA encoding a target protein in cells contacted with a therapeutic agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold increase.

[0458]

[0511] In some embodiments, the target protein is a canonical isoform of a protein.

[0512] In some embodiments, the target protein is polycystin 2.

[0513] In some embodiments, the nonsense-mediated RNA decay exon (NSE) modulating agent is a composition provided herein.

[0459]

[0514] In certain embodiments, described herein are pharmaceutical compositions comprising a therapeutic agent comprising a composition provided herein and a pharma- ceutical acceptable excipient and / or delivery vehicle.

[0460]

[0515] In certain embodiments, described herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, comprising administering to the subject a pharmaceutical composition provided herein.

[0461]

[0516] In certain embodiments, described herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, comprising: (a) a nonsense-mediated RNA decay exon (NSE) modulating agent that interacts with a target motif in a pre-mRNA to modulate the exclusion of the NSE from a processed mRNA transcript and modulates the inclusion of a canonical exon in the processed mRNA transcript;

[0517] The method includes administering to a subject a pharmaceutical composition comprising an NSE modulator, wherein the NSE comprises (i) only a portion of a canonical exon, or (ii) a canonical exon and at least a portion of an intron adjacent to the canonical exon, and (b) a pharma- ceutically acceptable excipient and / or delivery vehicle, wherein the disease or condition is treated or prevented in the subject by regulating expression of a target protein translated from a processed mRNA transcript upon administration of the NSE modulator.

[0462]

[0518] In some embodiments, the target protein is polycystin 2.

[0519] In certain embodiments, described herein are methods of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by modulating expression of a target protein in cells of the subject, wherein the cells of the subject have a pre-mRNA encoding the target protein, the pre-mRNA comprising (a) a canonical exon preceded by a canonical intron adjacent to the 5' end of the canonical exon, and (b) a canonical 3' splice site downstream of and within the canonical exon or adjacent to the intron preceding the canonical exon. and an alternative nonsense-mediated RNA decay-induced (NMD) exon that includes an alternative 3' splice site upstream of the canonical 3' splice site and within the canonical intron relative to an intron preceding the canonical intron, the method comprising contacting a cell with a therapeutic agent, wherein the therapeutic agent modulates processing of an mRNA transcript from the pre-mRNA by modulating splicing of the pre-mRNA at the alternative 3' splice site, wherein splicing of the pre-mRNA at the alternative 3' splice site modulates expression of a target protein in the cell of the subject.

[0463]

[0520] In some embodiments, the target protein is polycystin 2.

[0521] In certain embodiments, described herein are methods of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by modulating expression of a target protein in cells of the subject, wherein the cells of the subject have a pre-mRNA encoding the target protein, the pre-mRNA comprising (a) a canonical exon followed by a canonical intron adjacent to the 3' end of the canonical exon, and (b) a canonical 5' splice site upstream of and within the canonical exon relative to the intron following the canonical exon, or within the canonical exon. and an alternative nonsense-mediated RNA decay (NMD) exon comprising an alternative 5' splice site downstream of the canonical 5' splice site and within the canonical intron relative to an intron following the canonical intron, the method comprising contacting a cell with a therapeutic agent, wherein the therapeutic agent modulates processing of an mRNA transcript from the pre-mRNA by modulating splicing of the pre-mRNA at the alternative 5' splice site, wherein splicing of the pre-mRNA at the alternative 5' splice site modulates expression of a target protein in the cell of the subject.

[0464]

[0522] In some embodiments, the target protein is polycystin 2.

[0523] In some embodiments, the disease is polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, or intracranial aneurysm.

[0465]

[0524] In some embodiments, the disease or condition is caused by a deficiency in the amount or activity of a target protein.

[0525] In some embodiments, a Therapeutic Agent increases the level of processed mRNA encoding a target protein in a cell.

[0526] In some embodiments, the therapeutic agent increases expression of a target protein in a cell.

[0466]

[0527] In some embodiments, the level of processed mRNA encoding a target protein in cells contacted with a therapeutic agent is about 1.1 to about 10 times, about 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold increase.

[0467]

[0528] In some embodiments, the level of a target protein in a cell is about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, about 2 to about 6 ... An increase of about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fol...

Claims

1. A pharmaceutical composition for use as a medicament for treating a disease or condition, comprising an agent or a vector encoding the agent, and a pharma- ceutically acceptable excipient and / or delivery vehicle, wherein the agent comprises a sequence which is the reverse complement of a target sequence of a pre-mRNA transcribed from a target gene, the pre-mRNA comprising a nonsense-mediated RNA decay-inducing exon (NMD exon); The pharmaceutical composition, wherein the agent (a) binds to a target sequence in the pre-mRNA and (b) regulates splicing of the NMD exon from the pre-mRNA, thereby regulating the level of processed mRNA processed from the pre-mRNA and regulating expression of a target protein encoded by the pre-mRNA in a cell, and the target gene is PKD2.

2. The pharmaceutical composition described in claim 1, wherein the NMD exon is located in a region between two canonical exon regions of the pre-mRNA.

3. The target sequence of the pre-mRNA is selected from the group consisting of pre-mRNA ENST00000237596.7, pre-mRNA ENST00000502363.1, pre-mRNA ENST00000506367.1, pre-mRNA ENST00000506727.1, pre-mRNA ENST00000508588.5, pre-mRNA ENST00000511337.5, pre-mRNA ENST00000512858.1, transcript ENST00000237596.7, transcript ENST00000502363.1, transcript ENST00000506367.1, transcript ENST00000506727.1, transcript The pharmaceutical composition of claim 1 or 2, comprising a sequence having eight consecutive nucleic acids selected from the group consisting of ENST00000508588.5, transcript ENST00000511337.5, transcript ENST00000512858.1, and PKD2 5'UTR sequence (ENST00000237596.7).

4. The target sequence of the pre-mRNA is i) overlaps with an NMD exon; ii) within an NMD exon; iii) overlaps with an intron upstream or downstream of the NMD exon; or iv) containing a 5'NMD exon-intron junction or a 3'NMD exon-intron junction; The pharmaceutical composition according to any one of claims 1 to 3.

5. The pharmaceutical composition described in any one of claims 1 to 4, wherein the NMD exon is defined by the genomic site GRCh38 / hg38:chr4:88031085-88031140.

6. The target sequence of the pre-mRNA is i) upstream of the genomic site GRCh38 / hg38:chr4:88031085; ii) downstream of genomic site GRCh38 / hg38:chr4:88031085; iii) upstream of the genomic site GRCh38 / hg38:chr4:88031140; or iv) downstream of the genomic site GRCh38 / hg38:chr4:88031140; The pharmaceutical composition of any one of claims 1 to 5, wherein the amino acid sequence is more proximal than 1500 nucleotides, 1000 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides.

7. The pharmaceutical composition of claim 1, wherein the agent is a nonsense-mediated RNA decay alternative splice site (NSASS) modulator and the NMD exon is defined by the genomic site GRCh38 / hg38:chr4:88036354-88036480.

8. 8. The pharmaceutical composition of claim 7, wherein the processed mRNA produced by splicing of the pre-mRNA at the alternative 5' splice site contains a premature termination codon (PTC).

9. 8. The pharmaceutical composition of claim 7, wherein the agent modulates pre-mRNA processing by preventing or reducing splicing at an alternative 5' splice site.

10. 8. The pharmaceutical composition of claim 7, wherein the agent modulates pre-mRNA processing by promoting or increasing splicing at a canonical 5' splice site.

11. The pharmaceutical composition of claim 7, wherein modulating splicing of the pre-mRNA at the alternative 5' splice site increases expression of the target protein in the cell.

12. The target sequence of the pre-mRNA is Upstream of the genomic site GRCh38 / hg38:chr4:88036480; or downstream of the genomic site GRCh38 / hg38:chr4:88036480; The pharmaceutical composition of any one of claims 1 to 7, wherein the amino acid sequence is more proximal than 1500 nucleotides, 1000 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides.

13. 13. The pharmaceutical composition of any one of claims 1 to 7 or 12, comprising an agent which is an antisense oligomer (ASO).

14. The ASO comprising 8, 9, 10, 11, 12, 13, 14, 16, 16, 17, or 18 consecutive nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 1-226; ASO: (a) backbone modifications including phosphorothioate or phosphorodiamidate linkages; (b) phosphorodiamidate morpholino, locked nucleic acid, or peptide nucleic acid; (c) a 2'-O-methyl, a 2'-fluoro, or a 2'-O-methoxyethyl moiety; or (d) at least one modified sugar moiety; It may include, ASOs may be of the following lengths: 8-50 nucleobases, 8-40 nucleobases, 8-35 nucleobases, 8-30 nucleobases, 8-25 nucleobases, 8-20 nucleobases, 8-15 nucleobases, 9-50 nucleobases, 9-40 nucleobases, 9-35 nucleobases, 9-30 nucleobases, 9-25 nucleobases, 9-20 nucleobases, 9-15 nucleobases, 10-50 nucleobases, 10-40 nucleobases, 10-35 nucleobases, 10-30 nucleobases, 10-25 14. The pharmaceutical composition of claim 13, which may be a nucleobase, 10-20 nucleobases, 10-15 nucleobases, 11-50 nucleobases, 11-40 nucleobases, 11-35 nucleobases, 11-30 nucleobases, 11-25 nucleobases, 11-20 nucleobases, 11-15 nucleobases, 12-50 nucleobases, 12-40 nucleobases, 12-35 nucleobases, 12-30 nucleobases, 12-25 nucleobases, 12-20 nucleobases, or 12-15 nucleobases.

15. The pharmaceutical composition of any one of claims 1 to 14, wherein the pharmaceutical composition comprises a viral vector encoding a drug, the drug being a polynucleotide, and the polynucleotide further comprises a modified snRNA.

16. The pharmaceutical composition according to claim 15, wherein the modified human snRNA is a modified U1 snRNA or a modified U7 snRNA.

17. The method of claim 1, wherein the disease or condition is associated with a deficiency in the amount or activity of polycystin-2 or polycystin-1 in a subject, and optionally comprises: the disease or condition is associated with haploinsufficiency of the PKD2 gene, and the subject has a first allele that encodes functional polycystin 2 and a second allele in which no polycystin 2 is produced or a second allele that encodes non-functional polycystin 2; or The pharmaceutical composition according to any one of claims 1 to 16, wherein the disease or condition is associated with a mutation in the PKD1 gene or the PKD2 gene.

18. 18. The pharmaceutical composition of any one of claims 1 to 17, wherein the disease or condition is selected from the group consisting of polycystic kidney disease with or without polycystic liver, autosomal dominant polycystic kidney disease, and intracranial aneurysm.

19. A composition comprising a drug or a viral vector encoding a drug, wherein the drug comprises a sequence which is a reverse complement of a targeting portion of a pre-mRNA, the pre-mRNA being encoded by a PKD2 gene and comprising a nonsense-mediated RNA decay inducing exon (NMD exon), and the targeting portion of the pre-mRNA being selected from the group consisting of pre-mRNA ENST00000237596.7, pre-mRNA ENST00000502363.1, pre-mRNA ENST00000506367.1, pre-mRNA ENST00000506727.1, pre-mRNA ENST00000508588.5, pre-mRNA ENST00000511337.5, pre-mRNA ENST00000512858.1, transcript ENST00000237596.7 ... The composition comprises a sequence having eight consecutive nucleic acids of a sequence selected from the group consisting of ENST00000502363.1, transcript ENST00000506367.1, transcript ENST00000506727.1, transcript ENST00000508588.5, transcript ENST00000511337.5, transcript ENST00000512858.1, and PKD2 5'UTR sequence (ENST00000237596.7).

20. The drug, (a) binds to a targeting portion of the pre-mRNA; (b) modulating the binding of factors involved in splicing of NMD exons; or (c) a combination of (a) and (b); 20. The composition of claim 19.

Images