Treating inflammation with glucocorticoids and angiopoietin-like 7 (ANGPTL7) inhibitors

Abstract

The present disclosure provides methods for treating a subject having inflammation with an angiopoietin-like 7 (ANGPTL7) inhibitor and a glucocorticoid, methods for reducing glucocorticoid-induced eye pathology in a subject, and methods for identifying a subject at increased risk for developing a glucocorticoid-induced eye pathology.

Description

[Technical field]

[0001] Reference to sequence listing This application contains a Sequence Listing that has been submitted electronically as a text file of 111 kilobytes in size under the title 18923806702SEQ, created on February 22, 2022. The Sequence Listing is incorporated herein by reference.

[0002] The present disclosure relates generally to treating a subject having inflammation with an angiopoietin-like 7 (ANGPTL7) inhibitor and a glucocorticoid, methods of reducing glucocorticoid-induced eye pathology in a subject, and methods of identifying a subject at increased risk for developing a glucocorticoid-induced eye pathology. [Background technology]

[0003] Glucocorticoids (GCs) are one of the most commonly prescribed medications in the world for the treatment of multiple diseases and conditions. Due to their broad spectrum anti-inflammatory and immunosuppressive properties, the global market for GC use is expected to exceed $10 billion per year. Approximately 1.2% of the American population and approximately 0.85% of the UK population are prescribed therapeutic GCs annually. GCs also remain the go-to for treating a variety of ocular inflammatory diseases that involve almost all of the ocular tissues, such as the eyelid, conjunctiva, cornea, sclera, uvea, retina, and optic nerve. The routes of administration of GCs in the treatment of these disorders can be topical, intraocular, oral, systemic, intravitreal injection, implant, and periocular injection (including, for example, subconjunctival, subtenon, retrobulbar, and peribulbar). However, longer GC therapy may be associated with serious and unnecessary GC-induced ocular pathologies, including the development of posterior subcapsular cataracts, GC-induced ocular hypertension (GC-OHT), and iatrogenic open-angle glaucoma. Approximately 40% of individuals exposed to long-term steroids will develop steroid-induced ocular hypertension, and this risk may increase to approximately 90% in individuals who already have glaucoma. Therefore, it is desirable to reduce or prevent GC-induced ocular pathologies. Summary of the Invention

[0004] The present disclosure provides a method of treating a subject undergoing treatment with a steroid, the method comprising administering to the subject an ANGPTL7 inhibitor. The disclosure provides a method of treating a subject having inflammation, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid.

[0005] The disclosure also provides a method of treating a subject with rheumatoid arthritis, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid. The disclosure also provides a method of treating a subject having Graves' disease, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid.

[0006] The disclosure also provides a method of treating a subject having ocular inflammation, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid. The present disclosure provides a method of reducing steroid-induced ocular pathology in a subject treated with a steroid, comprising administering to the subject an ANGPTL7 inhibitor.

[0007] The present disclosure also provides a method of reducing glucocorticoid-induced ocular pathology in a subject treated with a glucocorticoid, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0008] The present disclosure provides a method of treating a subject having inflammation and receiving steroid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor. The disclosure also provides a method of treating a subject having inflammation and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0009] The disclosure also provides a method of treating a subject having rheumatoid arthritis and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0010] The disclosure also provides a method of treating a subject having Graves' disease and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0011] The disclosure also provides a method of treating a subject having ocular inflammation and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor. The disclosure provides a method of treating a subject undergoing glucocorticoid therapy, the subject suffering from inflammation, comprising obtaining or obtaining a biological sample from the subject, and performing or having performed sequence analysis on the biological sample to determine whether the subject has a genotype that includes a loss-of-function mutant nucleic acid molecule predicted for ANGPTL7, thereby determining whether the subject has a loss-of-function mutant nucleic acid molecule encoding an ANGPTL7 polypeptide predicted for ANGPTL7; administering or continuing to administer the glucocorticoid at a standard dose to the subject with an ANGPTL7 reference type, and administering an ANGPTL7 inhibitor to the subject; or determining whether the subject has a genotype that includes a loss-of-function mutant nucleic acid molecule predicted for ANGPTL7, the loss-of-function mutant nucleic acid molecule encoding an ANGPTL7 polypeptide predicted for ANGPTL7; Also provided are methods comprising administering or continuing administration of a glucocorticoid to a subject heterozygous for a loss-of-function mutant at or above a standard dose, and administering an ANGPTL7 inhibitor to the subject; or administering or continuing administration of a glucocorticoid to a subject homozygous for a predicted loss-of-function mutant in ANGPTL7 at or above a standard dose, wherein the presence of a genotype having the predicted loss-of-function mutant nucleic acid molecule encoding the ANGPTL7 polypeptide indicates a reduced risk of developing a glucocorticoid-induced eye condition in the subject.

[0012] The disclosure also provides a method for identifying a subject undergoing glucocorticoid treatment at increased risk for developing a glucocorticoid-induced eye condition, comprising determining or having determined in a biological sample obtained from the subject the presence or absence of a loss-of-function variant nucleic acid molecule encoding an ANGPTL7 polypeptide predicted in ANGPTL7, where if the subject is an ANGPTL7 reference, the subject is at increased risk for developing a glucocorticoid-induced eye condition, and where if the subject is heterozygous or homozygous for a loss-of-function variant predicted in ANGPTL7, the subject is not at increased risk for developing a glucocorticoid-induced eye condition.

[0013] The disclosure also provides a genomic nucleic acid molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in accordance with SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in accordance with SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in accordance with SEQ ID NO:6, or its complement; an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a uracil at a position corresponding to position 529 in accordance with SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in accordance with SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:10, or its complement; or a complement thereof; an mRNA molecule as described above having an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:11, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:12, or a complement thereof; or a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence has a thymine at a position corresponding to position 529 in accordance with SEQ ID NO:14, or a complement thereof; a thymine at a position corresponding to position 525 in accordance with SEQ ID NO:15, or a complement thereof; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:16, or a complement thereof; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:17, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:18, or a complement thereof.

[0014] The disclosure provides a genomic nucleic acid molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement; an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; or a cytosine at position corresponding to position 574 in accordance with SEQ ID NO: 18, or its complement; or a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence has a thymine at position corresponding to position 529 in accordance with SEQ ID NO: 14, or its complement; a thymine at position corresponding to position 525 in accordance with SEQ ID NO: 15, or its complement; an adenine at position corresponding to position 481 in accordance with SEQ ID NO: 16, or its complement; an adenine at position corresponding to position 563 in accordance with SEQ ID NO: 17, or its complement; or a cytosine at position corresponding to position 574 in accordance with SEQ ID NO: 18, or its complement.

[0015] The disclosure also provides an ANGPTL7 inhibitor for use in reducing or preventing a glucocorticoid-induced ocular condition in a subject receiving glucocorticoid treatment, the subject receiving glucocorticoid treatment comprising: a) administering to the subject an ANGPTL7 genomic nucleic acid molecule, an ANGPTL7 mRNA molecule, or an ANGPTL7 or a complement thereof at a position corresponding to position 4,325 in SEQ ID NO:5; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6; ii) an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence comprising: a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or a complement thereof; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or a complement thereof; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or a complement thereof; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or a complement thereof; or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 12, or its complement; iii) or a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence being a thymine at a position corresponding to position 529 in SEQ ID NO: 14, or its complement; a thymine at a position corresponding to position 525 in SEQ ID NO: 15, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 16, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 17, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or its complement.

[0016] The disclosure also provides an ANGPTL7 inhibitor for use in the preparation of a medicament for reducing or preventing a glucocorticoid-induced ocular condition in a subject receiving glucocorticoid treatment, the subject comprising: a) an ANGPTL7 genomic nucleic acid molecule, an ANGPTL7 mRNA molecule, or an ANGPTL7 genomic nucleic acid molecule; or a complement thereof at a position corresponding to position 4,325 in SEQ ID NO:5; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6; ii) an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence comprising: a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or a complement thereof; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or a complement thereof; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or a complement thereof; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or a complement thereof; or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 12, or its complement; iii) or a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence being a thymine at a position corresponding to position 529 in SEQ ID NO: 14, or its complement; a thymine at a position corresponding to position 525 in SEQ ID NO: 15, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 16, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 17, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or its complement.

[0017] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several features of the present disclosure. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0018] [Figure 1] FIG. 1 shows inhibition of dexamethasone-21-acetate (DEX-Ac)-induced ocular hypertension in Angptl7 knockout (KO) mice. [Diagram 2] Figure 1 shows the effect of ANGPTL7 siRNA on intraocular pressure (IOP) in wild-type mice. Intravitreal injection of 15 μg ANGPTL7-siRNA significantly reduced IOP in two of six siRNAs tested (n=6-8 / group) compared to PBS-treated (n=6) and naive (no injection, n=5) groups starting at week 2 through the end of the study. Error bars represent standard error of the mean (SEM). [Diagram 3] Figure 1 shows the effect of ANGPTL7 siRNA on ANGPTL7 expression in limbal rings of wild-type mice in vivo. qPCR results from microdissected limbal rings showed the greatest level of knockdown (>50%) of ANGPTL7 mRNA by siRNA #3 and #5 compared to PBS-treated or naive (no injection) mice, which is consistent with the reduction in IOP observed in mice injected with one of these two siRNAs (shown in Figure 1). Error bars represent SEM. [Figure 4] 1 shows the effect of ANGPTL7 siRNA in alleviating dexamethasone-21-acetate (DEX-Ac)-induced ocular hypertension. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Various terms relating to the aspects of the present disclosure are used throughout the specification and claims. Unless otherwise indicated, such terms are to be given their ordinary meaning in the art. Other terms that are specifically defined are to be interpreted in a manner consistent with the definitions set forth herein.

[0020] Unless expressly stated otherwise, no method or embodiment set forth herein is intended to be construed as requiring that its steps be performed in a particular order. Thus, unless a method claim specifically specifies in the claim or description that the steps are to be limited to a particular order, it is not intended to dictate order in any respect. This includes any possible implicit criteria of interpretation, including logical matters regarding the arrangement of steps or workflow, general meanings derived from grammatical construction or punctuation, or the number or type of embodiments described herein.

[0021] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. As used herein, the term "about" means that a cited numerical value is approximate and that small variations do not significantly affect the practice of the disclosed embodiments. When a numerical value is used, unless otherwise indicated by the context, the term "about" means that the numerical value can vary by ±10% and remain within the scope of the disclosed embodiments.

[0022] As used herein, the term "comprising" may in certain embodiments be replaced with "consisting" or "consisting essentially of," as desired.

[0023] As used herein, with respect to a nucleic acid molecule or polypeptide, the term "isolated" means that the nucleic acid molecule or polypeptide is in a state other than its native environment, e.g., away from blood and / or animal tissue. In some embodiments, an isolated nucleic acid molecule or polypeptide is substantially free of other nucleic acid molecules or other polypeptides, particularly other nucleic acid molecules or polypeptides of animal origin. In some embodiments, the nucleic acid molecule or polypeptide can be in a highly purified form, i.e., more than 95% pure or more than 99% pure. When used in this context, the term "isolated" does not exclude the presence of the same nucleic acid molecule or polypeptide in alternative physical forms, such as dimers or alternatively phosphorylated or derivatized forms.

[0024] As used herein, the terms "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "polynucleotide," or "oligonucleotide" can include polymeric forms of nucleotides of any length, can include DNA and / or RNA, and can be single-stranded, double-stranded, or multistranded. A strand of a nucleic acid also refers to its complement.

[0025] As used herein, the term "subject" encompasses any animal, including mammals. Mammals include, but are not limited to, farm animals (e.g., horses, cows, pigs, etc.), pet animals (e.g., dogs, cats, etc.), laboratory animals (e.g., mice, rats, rabbits, etc.), and non-human primates (e.g., apes and monkeys, etc.). In some embodiments, the subject is a human. In some embodiments, the subject is a patient under the care of a physician.

[0026] The present disclosure discloses that inhibition of ANGPTL7 activity, such as in Angptl7 KO mice, surprisingly and unexpectedly suppresses the increase in GC-mediated ocular hypertension. Thus, it is believed that, for example, by treating a subject undergoing glucocorticoid treatment of inflammation with an ANGPTL7 inhibitor, it is possible to reduce or prevent undesirable glucocorticoid-induced ocular pathology. It is believed that no ANGPTL7 inhibitor is known to have any association with reducing or preventing undesirable glucocorticoid-induced ocular pathology. Thus, subjects with ANGPTL7 reference types who are at increased risk of developing glucocorticoid-induced ocular pathology may be treated to prevent such glucocorticoid-induced ocular pathology, reduce its symptoms, and / or suppress the onset of symptoms. Thus, the present disclosure provides methods for identifying ANGPTL7 reference type subjects who are at risk for, or are receiving glucocorticoid treatment to identify or stratify the risk in such subjects of developing a glucocorticoid-induced eye condition such that subjects suffering from an active glucocorticoid-induced eye condition can be treated appropriately.

[0027] For the purpose of this disclosure, any particular subject can be classified as having one of three ANGPTL7 genotypes: i) ANGPTL7 reference type, ii) heterozygous for ANGPTL7 predicted loss-of-function variants, or iii) homozygous for ANGPTL7 predicted loss-of-function variants.A subject is an ANGPTL7 reference type if the subject does not have a copy of an ANGPTL7 predicted loss-of-function variant nucleic acid molecule.A subject is heterozygous for an ANGPTL7 predicted loss-of-function variant if the subject has a single copy of an ANGPTL7 predicted loss-of-function variant nucleic acid molecule.As used herein, an ANGPTL7 predicted loss-of-function variant nucleic acid molecule is any ANGPTL7 nucleic acid molecule (such as a genomic nucleic acid molecule, an mRNA molecule, or a cDNA molecule) that encodes an ANGPTL7 polypeptide with partial loss-of-function, complete loss-of-function, predicted partial loss-of-function, or predicted complete loss-of-function. The subject who has ANGPTL7 polypeptide with partial loss of function (or predicted partial loss of function) is ANGPTL7 hypomorphic.The predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 can be any nucleic acid molecule that encodes ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, Lys192Gln, Arg340His, Arg220His, Asn302Lys or Arg220Cys.In some embodiments, the predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 encodes ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP or Lys192Gln. A subject is homozygous for a predicted loss-of-function variant in ANGPTL7 if the subject has two copies of the ANGPTL7 predicted loss-of-function variant nucleic acid molecule.

[0028] For subjects who are genotyped or determined to be ANGPTL7 reference type, such subjects are at increased risk of developing glucocorticoid-induced ocular pathologies, such as, for example, ocular hypertension, increased intraocular pressure (IOP), preglaucoma, glaucoma, reduced corneal hysteresis, and posterior subcapsular cataract, or any combination thereof. In some embodiments, the IOP is corneal compensated intraocular pressure (IOPcc). In some embodiments, the IOP is Goldmann compensated IOP (IOPg). For subjects who are genotyped or determined to be either ANGPTL7 reference type or heterozygous for a predicted loss-of-function variant in ANGPTL7, such subjects can be treated with an ANGPTL7 inhibitor.

[0029] In any of the embodiments described herein, the glaucoma can be primary open-angle glaucoma, iatrogenic open-angle glaucoma, angle-closure glaucoma, normal tension glaucoma, congenital glaucoma, neovascular glaucoma, steroid-induced glaucoma, or glaucoma associated with ocular trauma.

[0030] In any of the embodiments described herein, the predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 is any ANGPTL7 nucleic acid molecule (e.g., genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) that encodes ANGPTL7 polypeptide with partial loss-of-function, complete loss-of-function, predicted partial loss-of-function, or predicted complete loss-of-function.For example, the predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 can be any nucleic acid molecule that encodes ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, Lys192Gln, Arg340His, Arg220His, Asn302Lys, or Arg220Cys. In some embodiments, the ANGPTL7 predicted loss-of-function mutant nucleic acid molecule encodes ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, or Lys192Gln.

[0031] In any of the embodiments described herein, the ANGPTL7 predicted loss-of-function polypeptide can be any ANGPTL7 polypeptide with partial loss-of-function, complete loss-of-function, predicted partial loss-of-function, or predicted complete loss-of-function.In any of the embodiments described herein, the ANGPTL7 predicted loss-of-function polypeptide can be any of the ANGPTL7 polypeptides described herein, including, for example, ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, Lys192Gln, Arg340His, Arg220His, Asn302Lys, or Arg220Cys.In some embodiments, the ANGPTL7 predicted loss-of-function polypeptide is ANGPTL7 Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, or Lys192Gln.

[0032] In any of the embodiments described herein, the inflammation can be acute or chronic inflammation. In some embodiments, acute inflammation is inflammation that is relatively short in duration, lasting from about a few minutes to about 1-2 days. Acute inflammation can be characterized by increased blood flow, exudation of fluid and plasma proteins (edema), and emigration of white blood cells, primarily neutrophils. In some embodiments, chronic inflammation is inflammation of longer duration, e.g., days to weeks or even longer, and is histologically associated with the presence of lymphocytes and macrophages, and proliferation of blood vessels and connective tissue. In any of the embodiments described herein, the inflammation is associated with rheumatoid arthritis, associated with Graves' disease, or is ocular inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis. In some embodiments, the inflammation is associated with Graves' disease. In some embodiments, the inflammation is ocular inflammation. In some embodiments, the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof. In some embodiments, the ocular inflammation is uveitis. In some embodiments, the ocular inflammation is juvenile idiopathic arthritis uveitis. In some embodiments, the ocular inflammation is scleritis. In some embodiments, the ocular inflammation is blepharitis. In some embodiments, the ocular inflammation is conjunctivitis. In some embodiments, the ocular inflammation is iritis. In some embodiments, the ocular inflammation is episcleritis.

[0033] In any of the embodiments described herein, the glucocorticoid-induced ocular pathology is selected from ocular hypertension, increased intraocular pressure (IOP), pre-glaucoma, glaucoma, decreased corneal hysteresis, and posterior subcapsular cataract, or any combination thereof. In some embodiments, the glucocorticoid-induced ocular pathology is ocular hypertension. In some embodiments, the glucocorticoid-induced ocular pathology is increased IOP. In some embodiments, the glucocorticoid-induced ocular pathology is pre-glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is decreased corneal hysteresis. In some embodiments, the glucocorticoid-induced ocular pathology is posterior subcapsular cataract.

[0034] The present disclosure provides a method of treating a subject undergoing treatment with a steroid, the method comprising administering to the subject an ANGPTL7 inhibitor. The disclosure provides a method of treating a subject having inflammation, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid.

[0035] The disclosure provides a method of treating a subject with rheumatoid arthritis, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid. The disclosure provides a method of treating a subject having Graves' disease, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid.

[0036] The disclosure provides a method of treating a subject having ocular inflammation, the method comprising administering to the subject an ANGPTL7 inhibitor and a glucocorticoid. The present disclosure provides a method of reducing steroid-induced ocular pathology in a subject treated with a steroid, comprising administering to the subject an ANGPTL7 inhibitor.

[0037] The present disclosure provides a method for reducing glucocorticoid-induced ocular pathology in a subject treated with a glucocorticoid, comprising administering to the subject an ANGPTL7 inhibitor.

[0038] The present disclosure provides a method of treating a subject having inflammation and receiving steroid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor. The present disclosure provides a method of treating a subject having inflammation and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0039] The present disclosure provides a method of treating a subject having rheumatoid arthritis and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor. The present disclosure provides a method of treating a subject having Graves' disease and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor.

[0040] The present disclosure provides a method of treating a subject having ocular inflammation and receiving glucocorticoid treatment, the method comprising administering to the subject an ANGPTL7 inhibitor. In any of the methods described herein, the inflammation can be acute inflammation or chronic inflammation. In some embodiments, the inflammation is acute inflammation. In some embodiments, the inflammation is chronic inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis, associated with Graves' disease, or is ocular inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis. In some embodiments, the inflammation is associated with Graves' disease. In some embodiments, the inflammation is ocular inflammation. In some embodiments, the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, episcleritis, diabetic macular edema, corneal trauma inflammation, pain or inflammation due to ocular surgery, or any combination thereof. In some embodiments, the ocular inflammation is uveitis. In some embodiments, the ocular inflammation is juvenile idiopathic arthritis uveitis. In some embodiments, the ocular inflammation is scleritis. In some embodiments, the ocular inflammation is blepharitis. In some embodiments, the ocular inflammation is conjunctivitis. In some embodiments, the ocular inflammation is iritis. In some embodiments, the ocular inflammation is episcleritis. In some embodiments, the ocular inflammation is diabetic macular edema. In some embodiments, the inflammation is ocular inflammation. In some embodiments, the ocular inflammation is associated with ocular surgery.

[0041] In any of the methods described herein, the subject may be or have been treated with steroids. In some embodiments, such a subject may have any of the inflammatory forms described herein. Steroids are used after some ocular surgeries, including but not limited to cataract extraction, YAGI laser capsulotomy, Descemet stripping automated endothelial keratoplasty (DSAEK), lamellar keratoplasty, penetrating keratoplasty, laser in-situ keratomileusis (LASIK), laser photorefractive keratectomy (PPK), pars plana vitrectomy (PPV), and intralesional injections. In some embodiments, the subject is or has been undergoing cataract extraction. In some embodiments, the subject is or has been undergoing YAG laser capsulotomy. In some embodiments, the subject is or has been undergoing DSAEK. In some embodiments, the subject is or has been undergoing lamellar keratoplasty. In some embodiments, the subject is or has been undergoing penetrating keratoplasty. In some embodiments, the subject is undergoing or has undergone LASIK. In some embodiments, the subject is undergoing or has undergone PPK. In some embodiments, the subject is undergoing or has undergone PPV. In some embodiments, the subject is undergoing or has undergone intralesional injection.

[0042] In any of the methods described herein, the glucocorticoid-induced ocular pathology is selected from ocular hypertension, increased intraocular pressure (IOP), pre-glaucoma, glaucoma, decreased corneal hysteresis, and posterior subcapsular cataract, or any combination thereof. In some embodiments, the glucocorticoid-induced ocular pathology is ocular hypertension. In some embodiments, the glucocorticoid-induced ocular pathology is increased IOP. In some embodiments, the glucocorticoid-induced ocular pathology is pre-glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is decreased corneal hysteresis. In some embodiments, the glucocorticoid-induced ocular pathology is posterior subcapsular cataract.

[0043] In any of the methods described herein, the glucocorticoid is selected from prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, deoxycorticosterone acetate (DOCA), aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, and fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, flurandenolide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof. In some embodiments, the glucocorticoid is prednisone. In some embodiments, the glucocorticoid is prednisolone. In some embodiments, the glucocorticoid is methylprednisolone. In some embodiments, the glucocorticoid is dexamethasone. In some embodiments, the glucocorticoid is betamethasone. In some embodiments, the glucocorticoid is triamcinolone. In some embodiments, the glucocorticoid is beclomethasone. In some embodiments, the glucocorticoid is fludrocortisone acetate. In some embodiments, the glucocorticoid is DOCA. In some embodiments, the glucocorticoid is aldosterone. In some embodiments, the glucocorticoid is budesonide. In some embodiments, the glucocorticoid is mometasone furoate. In some embodiments, the glucocorticoid is fluticasone propionate. In some embodiments, the glucocorticoid is hydrocortisone. In some embodiments, the glucocorticoid is cortisone acetate. In some embodiments, the glucocorticoid is fluticasone furoate. In some embodiments, the glucocorticoid is ophthalmic difluprednate.In some embodiments, the glucocorticoid is fluorometholone. In some embodiments, the glucocorticoid is loteprednol etabonate. In some embodiments, the glucocorticoid is medrysone. In some embodiments, the glucocorticoid is lumexolone. In some embodiments, the glucocorticoid is fluocinolone acetonide. In some embodiments, the glucocorticoid is clobetasol. In some embodiments, the glucocorticoid is halobetasol. In some embodiments, the glucocorticoid is diflorasone. In some embodiments, the glucocorticoid is fluocinonide. In some embodiments, the glucocorticoid is flurandenolide. In some embodiments, the glucocorticoid is neo-polydex. In some embodiments, the glucocorticoid is tobramycin-dexamethasone. In some embodiments, the glucocorticoid is difluprednate.

[0044] In any of the methods described herein, the glucocorticoid treatment is treatment with prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, DOCA, aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, or fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, fluocinolone acetonide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof. In some embodiments, the glucocorticoid treatment is treatment with prednisone. In some embodiments, the glucocorticoid treatment is treatment with prednisolone. In some embodiments, the glucocorticoid treatment is treatment with methylprednisolone. In some embodiments, the glucocorticoid treatment is treatment with dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with betamethasone. In some embodiments, the glucocorticoid treatment is treatment with triamcinolone. In some embodiments, the glucocorticoid treatment is treatment with beclomethasone. In some embodiments, the glucocorticoid treatment is treatment with fludrocortisone acetate. In some embodiments, the glucocorticoid treatment is treatment with DOCA. In some embodiments, the glucocorticoid treatment is treatment with aldosterone. In some embodiments, the glucocorticoid treatment is treatment with budesonide. In some embodiments, the glucocorticoid treatment is treatment with mometasone furoate. In some embodiments, the glucocorticoid treatment is treatment with fluticasone propionate.In some embodiments, the glucocorticoid treatment is treatment with hydrocortisone.In some embodiments, the glucocorticoid treatment is treatment with cortisone acetate. In some embodiments, the glucocorticoid treatment is treatment with fluticasone furoate. In some embodiments, the glucocorticoid treatment is treatment with ophthalmic difluprednate. In some embodiments, the glucocorticoid treatment is treatment with fluorometholone. In some embodiments, the glucocorticoid treatment is treatment with loteprednol etabonate. In some embodiments, the glucocorticoid treatment is treatment with medrysone. In some embodiments, the glucocorticoid treatment is treatment with lumexolone. In some embodiments, the glucocorticoid treatment is treatment with fluocinolone acetonide. In some embodiments, the glucocorticoid treatment is treatment with clobetasol. In some embodiments, the glucocorticoid treatment is treatment with halobetasol. In some embodiments, the glucocorticoid treatment is treatment with diflorasone. In some embodiments, the glucocorticoid treatment is treatment with fluocinonide. In some embodiments, the glucocorticoid treatment is treatment with flurandenolide. In some embodiments, the glucocorticoid treatment is treatment with neo-polydex. In some embodiments, the glucocorticoid treatment is treatment with tobramycin-dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with difluprednate.

[0045] In some embodiments, the ANGPTL7 inhibitor comprises an inhibitory nucleic acid molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense molecule, a small interfering RNA (siRNA) molecule, or a short hairpin RNA (shRNA) molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an siRNA molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an shRNA molecule. Such an inhibitory nucleic acid molecule can be designed to target any region of an ANGPTL7 nucleic acid molecule, such as an mRNA molecule. In some embodiments, the inhibitory nucleic acid molecule hybridizes to a sequence in a genomic nucleic acid molecule or an mRNA molecule of ANGPTL7 and reduces the expression of an ANGPTL7 polypeptide in a cell of a subject. In some embodiments, the ANGPTL7 inhibitor comprises an antisense RNA that hybridizes to a genomic nucleic acid molecule or an mRNA molecule of ANGPTL7 and reduces the expression of an ANGPTL7 polypeptide in a cell of a subject. In some embodiments, the ANGPTL7 inhibitor comprises siRNA that hybridizes with ANGPTL7 genomic nucleic acid molecule or mRNA molecule and reduces the expression of ANGPTL7 polypeptide in cells of a subject.In some embodiments, the ANGPTL7 inhibitor comprises shRNA that hybridizes with ANGPTL7 genomic nucleic acid molecule or mRNA molecule and reduces the expression of ANGPTL7 polypeptide in cells of a subject.

[0046] In some embodiments, the antisense nucleic acid comprises or consists of a nucleotide sequence shown in Table 1, Table 2, or Table 3.

[0047] [Table 1-1]

[0048] [Table 1-2]

[0049] [Table 1-3]

[0050]

Table 1-4

[0051]

Table 1-5

[0052]

Table 1-6

[0053]

Table 1-7

[0054]

Table 1-8

[0055]

Table 1-9

[0056]

Table 1-10

[0057]

Table 1-11

[0058]

Table 1-12

[0059]

Table 1-13

[0060]

Table 1-14

[0061]

Table 1-15

[0062]

Table 1-16

[0063]

Table 1-17

[0064]

Table 1-18

[0065]

Table 1-19

[0066]

Table 2-1

[0067]

Table 2-2

[0068]

Table 2-3

[0069]

Table 2-4

[0070] [Table 2-5]

[0071] [Table 2-6]

[0072] [Table 3-1]

[0073] [Table 3-2]

[0074] [Table 3-3]

[0075] [Table 3-4]

[0076] [Table 3-5]

[0077] [Table 3-6]

[0078] [Table 3-7]

[0079] In some embodiments, the siRNA molecule comprises or consists of the nucleotide sequences shown in Tables 4, 5, and 6 (sense and antisense strands).

[0080]

Table 4-1

[0081]

Table 4-2

[0082]

Table 4-3

[0083]

Table 4-4

[0084]

Table 4-5

[0085]

Table 4-6

[0086]

Table 4-7

[0087]

Table 4-8

[0088]

Table 4-9

[0089]

Table 4-10

[0090]

Table 4-11

[0091]

Table 4-12

[0092]

Table 4-13

[0093]

Table 4-14

[0094]

Table 4-15

[0095]

Table 4-16

[0096]

Table 4-17

[0097]

Table 4-18

[0098]

Table 4-19

[0099]

Table 4-20

[0100]

Table 4-21

[0101]

Table 4-22

[0102]

Table 4-23

[0103]

Table 4-24

[0104]

Table 4-25

[0105]

Table 4-26

[0106]

Table 4-27

[0107]

Table 4-28

[0108]

Table 4-29

[0109]

Table 4-30

[0110]

Table 4-31

[0111]

Table 4-32

[0112]

Table 4-33

[0113]

Table 4-34

[0114]

Table 4-35

[0115]

Table 4-36

[0116]

Table 5-1

[0117]

Table 5-2

[0118]

Table 5-3

[0119]

Table 5-4

[0120]

Table 5-5

[0121]

Table 5-6

[0122]

Table 5-7

[0123]

Table 5-8

[0124]

Table 5-9

[0125]

Table 5-10

[0126]

Table 6-1

[0127]

Table 6-2

[0128]

Table 6-3

[0129]

Table 6-4

[0130]

Table 6-5

[0131] [Table 6-6]

[0132] [Table 6-7]

[0133] [Table 6-8]

[0134] [Table 6-9]

[0135] [Table 6-10]

[0136] In some embodiments, the siRNA molecule comprises or consists of the nucleotide sequences shown in Tables 7 and 8 (sense and antisense strands).

[0137] [Table 7-1]

[0138] [Table 7-2]

[0139] [Table 8-1]

[0140] [Table 8-2]

[0141] [Table 8-3]

[0142]

Table 8-4

[0143]

Table 8-5

[0144]

Table 8-6

[0145] The inhibitory nucleic acid molecules disclosed herein may comprise RNA, DNA, or both RNA and DNA. The inhibitory nucleic acid molecules may also be linked or fused to a heterologous nucleic acid sequence (such as in a vector) or a heterologous label. For example, the inhibitory nucleic acid molecules disclosed herein may be in a vector that comprises the inhibitory nucleic acid molecule and a heterologous nucleic acid sequence, or as an exogenous donor sequence that comprises the inhibitory nucleic acid molecule and a heterologous nucleic acid sequence. The inhibitory nucleic acid molecules may also be linked or fused to a heterologous label. The label may be directly detectable (such as a fluorophore) or indirectly detectable (such as a hapten, enzyme, or fluorophore quencher). Such labels may be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Such labels include, for example, radioisotope labels, dyes, dyes, chromogens, spin labels, and fluorescent labels. The label may also be, for example, a chemiluminescent substance; a metal-containing substance; or an enzyme, resulting in the secondary generation of an enzyme-dependent signal. The term "label" may refer to a "tag" or hapten that can selectively bind to a conjugated molecule that is subsequently added with a substrate and used to generate a detectable signal. For example, biotin can be used as a tag with an avidin or streptavidin conjugate of horseradish peroxidase (HRP) to bind to the tag and can be probed using a colorimetric substrate (such as tetramethylbenzidine (TMB)) or a fluorogenic substrate to detect the presence of HRP. Exemplary labels that can be used as tags to facilitate purification include, but are not limited to, myc, HA, FLAG or 3XFLAG, 6XHis or polyhistidine, glutathione-S-transferase (GST), maltose binding protein, epitope tags, or the Fc portion of an immunoglobulin. Numerous labels include, for example, particles, fluorophores, haptens, enzymes and their colorimetric, fluorogenic, and chemiluminescent substrates, as well as other labels.

[0146] The disclosed inhibitory nucleic acid molecules can include, for example, nucleotides, or non-natural or modified nucleotides, such as nucleotide analogs or nucleotide substitutes. Such nucleotides include nucleotides that contain modified bases, sugars, or phosphate groups, or nucleotides that incorporate non-natural moieties into their structure. Examples of non-natural nucleotides include, but are not limited to, dideoxynucleotides, biotinylated nucleotides, aminated nucleotides, deaminated nucleotides, alkylated nucleotides, benzylated nucleotides, and fluorophore-labeled nucleotides.

[0147] The inhibitory nucleic acid molecules disclosed herein may also include one or more nucleotide analogs or substitutions. A nucleotide analog is a nucleotide that contains a modification to either the base, sugar, or phosphate moiety. Modifications to the base moiety include, but are not limited to, natural and synthetic modifications of A, C, G, and T / U, and different purine or pyrimidine bases, such as pseudouridine, uracil-5-yl, hypoxanthine-9-yl (I), and 2-aminoadenine-9-yl. Modified bases include 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (cytosine), and thymine. These include, but are not limited to, 8-substituted adenines and guanines, 5-halo (such as 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0148] Nucleotide analogs can also include modifications to the sugar moiety, including, but not limited to, natural and synthetic modifications of ribose and deoxyribose. Sugar modifications include the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C 1-10 Alkyl or C 2-10 Alkenyl, and C 2-10 Exemplary 2' sugar modifications include, but are not limited to, -O[(CH2) n O] m CH3, -O(CH2) n OCH3, -O(CH2) n NH2, -O(CH2) n CH3, -O(CH2) n -ONH2 and -O(CH2) n ON [(CH2) n Other modifications at the 2' position include, but are not limited to, C 1-10These include, but are not limited to, alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides, and the 5' position of the 5' terminal nucleotide. Modified sugars can also include those containing modifications at the bridging ring oxygen (such as CH2 and S). Nucleotide sugar analogs can also have sugar mimetics (such as cyclobutyl moieties) in place of the pentofuranosyl sugar.

[0149] Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include, but are not limited to, those in which the linkage between two nucleotides can be modified to contain phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl phosphonates and other alkyl phosphonates (including 3'-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3'-amino phosphoramidates and aminoalkyl phosphoramidates), thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates. These phosphate linkages or modified phosphate linkages between two nucleotides can be via 3'-5' linkages or 2'-5' linkages, and the linkages can contain reverse polarity (such as 3'-5' to 5'-3' or 2'-5' to 5'-2'). Various salts, mixed salts, and free acid forms are also included. Nucleotide alternatives also include peptide nucleic acids (PNAs).

[0150] In some embodiments, the antisense nucleic acid molecule is a gapmer in which the first 1-7 nucleotides at the 5' and 3' ends, respectively, have a 2'-methoxyethyl (2'-MOE) modification. In some embodiments, the first 5 nucleotides at the 5' and 3' ends, respectively, have a 2'-MOE modification. In some embodiments, the first 1-7 nucleotides at the 5' and 3' ends are RNA nucleotides. In some embodiments, the first 5 nucleotides at the 5' and 3' ends are RNA nucleotides. In some embodiments, each of the internucleotide backbone linkages is a phosphorothioate linkage.

[0151] In some embodiments, the siRNA molecule has terminal modification.In some embodiments, the 5'-end of the antisense strand is phosphorylated.In some embodiments, a 5'-phosphate analog that cannot be hydrolyzed, such as 5'-(E)-vinyl-phosphonate, is used.

[0152] In some embodiments, the siRNA molecule has a backbone modification. In some embodiments, modified phosphodiester groups linking consecutive ribose nucleosides have been shown to improve the stability and in vivo bioavailability of siRNA. The non-ester group (-OH, =O) of the phosphodiester bond can be replaced with sulfur, boron, or acetate to provide phosphorothioate, boranophosphate, and phosphonoacetate linkages. Replacing the phosphodiester group with a phosphotriester can also facilitate cellular uptake of siRNA and retention on serum components by eliminating their negative charge. In some embodiments, the siRNA molecule has a sugar modification. In some embodiments, the sugar is deprotonated (a reaction catalyzed by exo- and endonucleases) so that the 2'-hydroxyl can function as a nucleophile and attack the adjacent phosphorus in the phosphodiester bond. Such alternatives include 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluoro modifications.

[0153] In some embodiments, the siRNA molecule has base modifications, in some embodiments, the bases can be replaced with modified bases such as pseudouridine, 5'-methylcytidine, N6-methyladenosine, inosine, and N7-methylguanosine.

[0154] In some embodiments, siRNA molecules are conjugated to lipid.Lipid can be conjugated to 5' or 3' end of siRNA to improve their in vivo bioavailability by allowing them to associate with serum lipoprotein.Representative lipids include, but are not limited to, cholesterol and vitamin E, and fatty acids such as palmitate and tocopherol.

[0155] In some embodiments, an exemplary siRNA has the following formula: Sense:mN*mN* / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / *mN* / 32FN / Antisense: / 52FN / * / i2FN / *mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN*N*N where "N" is a base; "2F" is a 2'-F modification; "m" is a 2'-O-methyl modification; "I" is an internal base; and "*" is a phosphorothioate backbone linkage.

[0156] The present disclosure also provides a vector comprising any one or more of the inhibitory nucleic acid molecules disclosed herein. In some embodiments, the vector comprises any one or more of the inhibitory nucleic acid molecules disclosed herein and a heterologous nucleic acid. The vector can be a viral vector or a non-viral vector capable of transporting a nucleic acid molecule. In some embodiments, the vector is a plasmid or a cosmid (such as a circular double-stranded DNA to which additional DNA segments can be ligated). In some embodiments, the vector is a viral vector to which additional DNA segments can be ligated into the viral genome. Expression vectors include, but are not limited to, plasmids, cosmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses (such as cauliflower mosaic virus and tobacco mosaic virus), yeast artificial chromosomes (YACs), Epstein-Barr (EBV) derived episomes, and other expression vectors known in the art.

[0157] The present disclosure also provides compositions comprising any one or more of the inhibitory nucleic acid molecules disclosed herein. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a carrier and / or excipient. Examples of carriers include, but are not limited to, poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules. The carrier may comprise a buffered salt solution such as PBS, HBSS, and the like.

[0158] In some embodiments, the ANGPTL7 inhibitor comprises an anti-ANGPTL7 antibody. Antibodies specific to ANGPTL7 are described, for example, in U.S. Patent Application Publication Nos. 2013 / 0022983 and 2020 / 0399640, as well as in Comes et al., Genes Cells., 2011, 16, 243-259; Xu et al., FASEB J., 2020, 34, 13548-13560, and Kuchtey et al., Invest. Ophthalmol. Vis. Sci., 2008, 49, 3438-3448.

[0159] In some embodiments, the ANGPTL7 inhibitor comprises a nuclease agent that induces one or more nicks or double-strand breaks in the recognition sequence(s), or a DNA binding protein that binds to the recognition sequence in the ANGPTL7 genomic nucleic acid molecule. The recognition sequence can be located in the coding region of the ANGPTL7 gene, or in a regulatory region that affects the expression of the gene. The recognition sequence of the DNA binding protein or nuclease agent can be located in an intron, exon, promoter, enhancer, regulatory region, or any protein non-coding region. The recognition sequence can include or be adjacent to the start codon of the ANGPTL7 gene. For example, the recognition sequence can be located about 10, about 20, about 30, about 40, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from the start codon. As another example, two or more nuclease agents can be used, each of which targets a nuclease recognition sequence that includes or is adjacent to the start codon. As another example, two nuclease agents can be used, one targeting a nuclease recognition sequence that includes or is adjacent to the start codon and one targeting a nuclease recognition sequence that includes or is adjacent to the stop codon, and cleavage by the nuclease agents can result in the deletion of the coding region between the two nuclease recognition sequences. Any nuclease agent that induces a nick or double-stranded break in the desired recognition sequence can be used in the methods and compositions disclosed herein. Any DNA binding protein that binds to the desired recognition sequence can be used in the methods and compositions disclosed herein.

[0160] Suitable nuclease agents and DNA binding proteins for use herein include, but are not limited to, zinc finger proteins or zinc finger nucleases (ZFN) pairs, transcription activator-like effector (TALE) proteins or transcription activator-like effector nucleases (TALEN), or clustered regularly interspersed short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems. The length of the recognition sequence can vary, including, for example, recognition sequences that are about 30-36 bp for zinc finger proteins or ZFN pairs, about 15-18 bp for each ZFN, about 36 bp for TALE proteins or TALEN, and about 20 bp for CRISPR / Cas guide RNA.

[0161] In some embodiments, the CRISPR / Cas system can be used to modify ANGPTL7 genomic nucleic acid molecules in cells. The methods and compositions disclosed herein can use the CRISPR-Cas system by utilizing a CRISPR complex (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-specific cleavage of ANGPTL7 nucleic acid molecules.

[0162] Cas protein generally comprises at least one RNA recognition domain or RNA binding domain that can interact with gRNA. Cas protein may also comprise a nuclease domain (such as DNase domain or RNase domain), a DNA binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Suitable Cas proteins include, for example, wild-type Cas9 protein and wild-type Cpf1 protein (such as FnCpf1). Cas protein may have sufficient cleavage activity to create a double-stranded break in ANGPTL7 genomic nucleic acid molecule, or may be a nickase that creates a single-stranded break in ANGPTL7 genomic nucleic acid molecule. Additional examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasF), Cse5 (CasF), Cse6 (CasF), Cse7 (CasF), Cse8 (CasF), Cse9 (CasF), Cse1 (CasF), Cse2 (CasF), Cse3 (CasF), Cse4 (CasF), Cse5 (CasF), Cse6 (CasF), Cse7 (CasF), Cse8 (CasF), Cse9 (CasF), Cse1 ...1 (CasF), Cse1 (CasF), Cse1 (CasF), Cse1 (CasF), Cse1 (CasF), Cse1 (CasF), Cse Cas proteins include, but are not limited to, se4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, and homologs or modified forms thereof. Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, Cas proteins can be fused to a cleavage domain, an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. Cas proteins can be provided in any form. For example, the Cas protein may be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein may be provided in the form of a nucleic acid molecule, such as RNA or DNA, that encodes the Cas protein.

[0163] In some embodiments, the targeted gene modification of ANGPTL7 genomic nucleic acid molecule can be made by contacting a cell with Cas protein and one or more gRNAs that hybridize with one or more gRNA recognition sequences in the target genomic locus of ANGPTL7 genomic nucleic acid molecule.For example, the gRNA recognition sequence can be located within the region of SEQ ID NO: 1.The gRNA recognition sequence can also include or be adjacent to the position corresponding to position 4,291, 4,287, 4,243, 4,325, or 4,336 in SEQ ID NO: 1. For example, the gRNA recognition sequence can be located about 1000, about 500, about 400, about 300, about 200, about 100, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides away from the position corresponding to 4,291, 4,287, 4,243, 4,325, or 4,336 in SEQ ID NO: 1. The gRNA recognition sequence can include or be adjacent to the start codon of the ANGPTL7 genomic nucleic acid molecule or the stop codon of the ANGPTL7 genomic nucleic acid molecule. For example, the gRNA recognition sequence can be located about 10, about 20, about 30, about 40, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides away from the start codon or the stop codon.

[0164] The gRNA recognition sequence in the target genomic locus of the ANGPTL7 genomic nucleic acid molecule is located near a protospacer adjacent motif (PAM) sequence, which is a 2-6 base pair DNA sequence that immediately follows the DNA sequence targeted by the Cas9 nuclease. A standard PAM is the sequence 5'-NGG-3', where "N" is any nucleobase, followed by two guanine ("G") nucleobases. The gRNA can guide Cas9 to any location in the genome for gene editing, but editing will not occur at any site other than where Cas9 recognizes the PAM. In addition, 5'-NGA-3' can be a highly efficient non-canonical PAM for human cells. In general, the PAM is about 2-6 nucleotides downstream of the DNA sequence targeted by the gRNA. The PAM can be adjacent to the gRNA recognition sequence. In some embodiments, the gRNA recognition sequence can be adjacent to the PAM at the end b. In some embodiments, the gRNA recognition sequence can be adjacent to the PAM at the 5' end. For example, the cleavage site of the Cas protein can be about 1 to about 10, about 2 to about 5 base pairs, or 3 base pairs upstream or downstream of the PAM sequence. In some embodiments (such as when Cas9 from S. pyogenes or a closely related Cas9 is used), the PAM sequence of the non-complementary strand can be 5'-NGG-3', where N is any DNA nucleotide and is immediately 3' to the gRNA recognition sequence of the non-complementary strand of the target DNA. Thus, the PAM sequence of the complementary strand will be 5'-CCN-3', where N is any DNA nucleotide and is immediately 5' to the gRNA recognition sequence of the complementary strand of the target DNA.

[0165] gRNA is an RNA molecule that binds to Cas protein and directs Cas protein to a specific position in ANGPTL7 genomic nucleic acid molecule. Exemplary gRNA is an effective gRNA for inducing Cas enzyme to bind to or cleave ANGPTL7 genomic nucleic acid molecule, and gRNA comprises a DNA targeting segment that hybridizes with a gRNA recognition sequence in ANGPTL7 genomic nucleic acid molecule that includes or is adjacent to the position corresponding to 4,291, 4,287, 4,243, 4,325, or 4,336 in SEQ ID NO:1. For example, a gRNA can be selected to hybridize to a gRNA recognition sequence located about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from a position corresponding to 4,291, 4,287, 4,243, 4,325, or 4,336 in accordance with SEQ ID NO: 1. Other exemplary gRNAs include a DNA targeting segment that hybridizes to a gRNA recognition sequence present in an ANGPTL7 genomic nucleic acid molecule that includes or is adjacent to a start codon or a stop codon. For example, a gRNA can be selected such that it hybridizes to a gRNA recognition sequence located about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from the start codon or about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from the stop codon. Suitable gRNAs can include about 17 to about 25 nucleotides, about 17 to about 23 nucleotides, about 18 to about 22 nucleotides, or about 19 to about 21 nucleotides. In some embodiments, the gRNA can include 20 nucleotides.

[0166] Examples of suitable gRNA recognition sequences located within the ANGPTL7 reference gene are shown in Tables 9-17 as SEQ ID NOs: 25-165.

[0167]

Table 9

[0168]

Table 10

[0169]

Table 11-1

[0170]

Table 11-2

[0171]

Table 12-1

[0172]

Table 12-2

[0173]

Table 13-1

[0174]

Table 13-2

[0175]

Table 14-1

[0176]

Table 14-2

[0177] [Table 15]

[0178] [Table 16]

[0179] [Table 17]

[0180] Cas protein and gRNA form a complex, and Cas protein cuts target ANGPTL7 genomic nucleic acid molecule. Cas protein can cut nucleic acid molecule at a site inside or outside the nucleic acid sequence present in the target ANGPTL7 genomic nucleic acid molecule to which the DNA-directed segment of gRNA binds. For example, the formation of CRISPR complex (comprising gRNA hybridized to gRNA recognition sequence and complexed with Cas protein) can result in the cleavage of one or both strands within or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs therefrom) the nucleic acid sequence present in the ANGPTL7 genomic nucleic acid molecule to which the DNA-directed segment of gRNA binds.

[0181] Such a method can result in an ANGPTL7 genomic nucleic acid molecule in which, for example, the region of SEQ ID NO:1 is destroyed, the start codon is destroyed, the stop codon is destroyed, or the coding sequence is destroyed or deleted. Optionally, the cell can be further contacted with one or more additional gRNAs that hybridize with additional gRNA recognition sequences in the target genomic locus of the ANGPTL7 genomic nucleic acid molecule. By contacting the cell with one or more additional gRNAs (such as a second gRNA that hybridizes with a second gRNA recognition sequence), the cleavage by Cas protein can generate two or more double-strand breaks or two or more single-strand breaks.

[0182] In any of the embodiments described herein, the subject can also be treated with a therapeutic agent that treats or inhibits ocular pathology. Such therapeutic agents include, but are not limited to, prostaglandins, beta-blockers, alpha-adrenergic agonists, carbonic anhydrase inhibitors, rho kinase inhibitors, or miotics or cholinergic agents. In some embodiments, the therapeutic agent that treats or inhibits ocular disease is a prostaglandin. In some embodiments, the prostaglandin is XALATAN® (latanoprost), TRAVATAN Z® (travoprost), ZIOPTAN® (tafluprost), LUMIGAN® (bimatoprost), or VYZULTA® (latanoprostene bunod). In some embodiments, the prostaglandin is latanoprost, travoprost, tafluprost, bimatoprost, or latanoprostene bunod. In some embodiments, the therapeutic agent that treats or inhibits ocular disease is a beta-blocker. In some embodiments, the beta blocker is BETIMOL®, ISTALOL®, or TIMOPTIC® (timolol) or BETOPTIC® (betaxolol). In some embodiments, the beta blocker is timolol or betaxolol. In some embodiments, the therapeutic agent treating or inhibiting the ocular disease is an alpha-adrenergic agonist. In some embodiments, the alpha-adrenergic agonist is IOPIDINE® (apraclonidine) or ALPHAGAN® or QOLIANA® (brimonidine). In some embodiments, the alpha-adrenergic agonist is apraclonidine or brimonidine. In some embodiments, the therapeutic agent treating or inhibiting the ocular disease is a carbonic anhydrase inhibitor. In some embodiments, the carbonic anhydrase inhibitor is TRUSOPT® (dorzolamide) or AZOPT® (brinzolamide). In some embodiments, the carbonic anhydrase inhibitor is dorzolamide or brinzolamide.In some embodiments, the therapeutic agent treating or inhibiting an ocular disease is a rho kinase inhibitor.In some embodiments, the rho kinase inhibitor is RHOPRESSA® (netarsudil). In some embodiments, the rho kinase inhibitor is netarsudil. In some embodiments, the therapeutic agent treating or inhibiting an ocular disease is a miotic or cholinergic agonist. In some embodiments, the miotic or cholinergic agonist is ISOPTO® Carpine (pilocarpine). In some embodiments, the miotic or cholinergic agonist is pilocarpine.

[0183] In some embodiments, the method of treatment further comprises detecting the presence or absence of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule encoding an ANGPTL7 polypeptide in a biological sample from a subject.As used throughout this disclosure, "ANGPTL7 predicted loss-of-function mutant nucleic acid molecule" refers to any ANGPTL7 nucleic acid molecule (such as, for example, a genomic nucleic acid molecule, an mRNA molecule, or a cDNA molecule) that encodes an ANGPTL7 polypeptide with partial loss-of-function, complete loss-of-function, predicted partial loss-of-function, or predicted complete loss-of-function.

[0184] The present disclosure also provides a method of treating a subject undergoing glucocorticoid therapy. In some embodiments, the subject suffers from inflammation. In some embodiments, the method includes determining whether the subject has a loss-of-function variant nucleic acid molecule encoding an ANGPTL7 polypeptide predicted in ANGPTL7. In some embodiments, the determining step includes obtaining or obtaining a biological sample and performing or performing a sequence analysis on the biological sample to determine whether the subject has a genotype that includes a loss-of-function variant nucleic acid molecule predicted in ANGPTL7. In some embodiments, the method includes administering or continuing administration of the glucocorticoid at a standard dose to a subject who is an ANGPTL7 reference type, and administering an ANGPTL7 inhibitor to the subject. In some embodiments, the method includes administering or continuing administration of a glucocorticoid at a standard dose or a higher dose to a subject who is heterozygous for a loss-of-function variant predicted in ANGPTL7, and administering an ANGPTL7 inhibitor to the subject. In some embodiments, the method comprises administering or continuing to administer glucocorticoids to a subject homozygous for a predicted loss-of-function variant in ANGPTL7 at a standard dose or at a dose higher than the standard dose. The presence of a genotype having a predicted loss-of-function variant nucleic acid molecule encoding an ANGPTL7 polypeptide indicates that the subject is at a reduced risk of developing a glucocorticoid-induced eye condition. In some embodiments, the subject is of the ANGPTL7 reference type. In some embodiments, the subject is heterozygous for a predicted loss-of-function variant in ANGPTL7.

[0185] In some embodiments, the subject is ANGPTL7 reference type, the subject is administered or continues to be administered a glucocorticoid at a standard dose, and an ANGPTL7 inhibitor is administered. In some embodiments, the subject is heterozygous for a predicted loss-of-function variant in ANGPTL7, the subject is administered or continues to be administered a glucocorticoid at the same or higher than the standard dose, and an ANGPTL7 inhibitor is administered. In some embodiments, the subject is homozygous for a predicted loss-of-function variant in ANGPTL7, the subject is administered or continues to be administered a glucocorticoid at the same or higher than the standard dose.

[0186] Detecting the presence or absence of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule in a biological sample from a subject and / or determining whether the subject has an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule can be performed by any of the methods described herein. In some embodiments, these methods can be performed in vitro. In some embodiments, these methods can be performed in situ. In some embodiments, these methods can be performed in vivo. In any of these embodiments, the nucleic acid molecule can be present in a cell obtained from the subject.

[0187] The present disclosure also provides a method of treating a subject undergoing glucocorticoid therapy. In some embodiments, the subject suffers from inflammation. In some embodiments, the method includes determining whether the subject has a loss-of-function mutant polypeptide predicted in ANGPTL7. In some embodiments, the determining step includes obtaining or obtaining a biological sample and performing or performing an assay on the biological sample to determine whether the subject has a loss-of-function mutant polypeptide predicted in ANGPTL7. In some embodiments, the method includes administering or continuing to administer a glucocorticoid at a standard dose to a subject that does not have an ANGPTL7 predicted loss-of-function mutant polypeptide, and administering an ANGPTL7 inhibitor to the subject. In some embodiments, the method includes administering or continuing to administer a glucocorticoid at the same or higher than the standard dose to a subject that has an ANGPTL7 predicted loss-of-function mutant polypeptide. The presence of an ANGPTL7 predicted loss-of-function mutant polypeptide indicates that the subject is not at increased risk of developing a glucocorticoid-induced eye condition. In some embodiments, the subject has an ANGPTL7 predicted loss-of-function mutant polypeptide. In some embodiments, the subject does not have an ANGPTL7 predicted loss-of-function mutant polypeptide.

[0188] Detecting the presence or absence of an ANGPTL7 predicted loss-of-function polypeptide in a biological sample from a subject and / or determining whether a subject has an ANGPTL7 predicted loss-of-function polypeptide can be performed by any of the methods described herein. In some embodiments, these methods can be performed in vitro. In some embodiments, these methods can be performed in situ. In some embodiments, these methods can be performed in vivo. In any of these embodiments, the polypeptide can be present in a cell obtained from the subject.

[0189] In some embodiments, glucocorticoids can be increased (i.e., higher than standard doses) for subjects who are heterozygous or homozygous for loss-of-function variants predicted in ANGPTL7 compared to subjects who are ANGPTL7 reference type (which may receive standard doses). In some embodiments, the dose of glucocorticoids can be increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In addition, the dose of glucocorticoids in subjects who are heterozygous or homozygous for loss-of-function variants predicted in ANGPTL7 can be administered more frequently compared to subjects who are ANGPTL7 reference type.

[0190] Administration of glucocorticoid and / or ANGPTL7 inhibitor can be repeated, for example, after 1 day, 2 days, 3 days, 5 days, 1 week, 2 weeks, 3 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 2 months, or 3 months. Repeated administration can be the same dose or different dose. Administration can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. For example, according to a certain dosing regimen, subject can receive therapy for a long period of time (for example, 6 months, 1 year, or more).

[0191] Administration of the glucocorticoid and / or ANGPTL7 inhibitor can occur by any suitable route, including, but not limited to, parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Pharmaceutical compositions for administration are desirably sterile, substantially isotonic, and manufactured under GMP conditions. Pharmaceutical compositions may be provided in unit dosage form (i.e., dosage for a single administration). Pharmaceutical compositions may be formulated using one or more physiologically and pharma-ceutical acceptable carriers, diluents, excipients, or adjuvants. The formulation depends on the route of administration chosen. The term "pharmaceutical acceptable" means that the carrier, diluent, excipient, or adjuvant is compatible with the other ingredients of the formulation and is not substantially deleterious to the recipient thereof.

[0192] The administration of glucocorticoid and / or ANGPTL7 inhibitor can be administered in a single dosage form or in separate dosage forms. When administered as separate dosage forms, the glucocorticoid can be administered simultaneously with the ANGPTL7 inhibitor or after the ANGPTL7 inhibitor. In some embodiments, the glucocorticoid and the ANGPTL7 inhibitor are administered simultaneously. In some embodiments, the glucocorticoid and the ANGPTL7 inhibitor are administered sequentially. For example, in some embodiments, the glucocorticoid can be administered before the ANGPTL7 inhibitor. In some embodiments, the ANGPTL7 inhibitor is administered before the glucocorticoid.

[0193] The terms "treat", "treating", and "treatment" as well as "prevent", "preventing", and "prevention", when used herein in reference to inflammation, refer to eliciting a desired biological response (such as a therapeutic effect and a prophylactic effect, respectively). In some embodiments, a therapeutic effect includes one or more of: reduction / reduction of inflammation, reduction / reduction of the severity of inflammation (such as, for example, reducing or inhibiting the onset of inflammation), reduction / reduction of symptoms and inflammation-related effects, delaying the onset of symptoms and inflammation-related effects, reducing the severity of symptoms of inflammation-related effects, reducing the severity of acute episodes, reducing the number of symptoms and inflammation-related effects, reducing the latency of symptoms and inflammation-related effects, ameliorating symptoms and inflammation-related effects, reducing secondary symptoms, reducing secondary infections, preventing recurrence of inflammation, reducing the number or frequency of recurrent episodes, increasing the latency period between symptomatic episodes, increasing the time to sustained progression, accelerating recovery, and / or increasing the effectiveness of or decreasing resistance to alternative therapeutic agents following administration of a glucocorticoid or a composition comprising a glucocorticoid. A prophylactic effect can include complete or partial avoidance / suppression or delay (e.g., complete or partial avoidance / suppression or delay, etc.) of the onset / progression of inflammation following administration of a treatment protocol. Treating inflammation includes treating a subject already diagnosed with some form of inflammation at any clinical stage or clinical presentation, delaying the onset or progression or exacerbation or worsening of symptoms or signs of inflammation, and / or preventing and / or reducing the severity of inflammation.

[0194] The terms "treat," "treating," and "treatment," as well as "prevent," "preventing," and "prevention," when used herein in reference to glucocorticoid-induced ocular pathology, refer to eliciting a desired biological response (such as a therapeutic effect and a prophylactic effect, respectively). In some embodiments, a therapeutic effect includes a reduction / alleviation of glucocorticoid-induced ocular pathology, a reduction / alleviation of the severity of a glucocorticoid-induced ocular pathology (e.g., a reduction or inhibition of the onset of a glucocorticoid-induced ocular pathology), a reduction / alleviation of symptoms and glucocorticoid-induced ocular pathology-related effects, a delay in the onset of symptoms and glucocorticoid-induced ocular pathology-related effects, a reduction in the severity of symptoms of a glucocorticoid-induced ocular pathology-related effects, a reduction in the duration of an acute episode, or a decrease in the severity of an acute episode of a glucocorticoid-induced ocular pathology-related effects, such as a decrease in the severity of an acute episode of a glucocorticoid-induced ocular pathology-related effects, ... and / or one or more of the following: reduced severity, reduced number of symptoms and glucocorticoid-induced eye pathology related effects, reduced latency of symptoms and glucocorticoid-induced eye pathology related effects, amelioration of symptoms and glucocorticoid-induced eye pathology related effects, reduced secondary symptoms, reduced secondary infections, prevention of recurrence of glucocorticoid-induced eye pathology, reduced number or frequency of recurrent episodes, increased latency between symptomatic episodes, increased time to sustained progression, accelerated recovery, and / or increased efficacy or reduced resistance to alternative therapeutic agents. A prophylactic effect can include complete or partial avoidance / inhibition or delay (e.g., complete or partial avoidance / inhibition or delay) of the onset / progression of glucocorticoid-induced eye pathology following administration of an ANGPTL7 inhibitor. Treatment of glucocorticoid-induced eye pathology includes treatment of a subject already diagnosed with any form of glucocorticoid-induced eye pathology at any clinical stage or clinical presentation, delaying the onset or progression or aggravation or worsening of symptoms or signs of glucocorticoid-induced eye pathology, and / or preventing and / or reducing the severity of glucocorticoid-induced eye pathology.

[0195] The present disclosure also provides a method for identifying a subject undergoing glucocorticoid treatment who is at increased risk of developing glucocorticoid-induced eye pathology.In some embodiments, the method comprises determining or having determined the presence or absence of a loss-of-function variant nucleic acid molecule encoding an ANGPTL7 polypeptide predicted in ANGPTL7 in a biological sample obtained from the subject.If the subject is an ANGPTL7 reference type, the subject is at increased risk of developing glucocorticoid-induced eye pathology.If the subject is heterozygous or homozygous for a loss-of-function variant predicted in ANGPTL7, the subject is not at increased risk of developing glucocorticoid-induced eye pathology.

[0196] Having a single copy of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule protects a subject undergoing glucocorticoid treatment from developing a glucocorticoid-induced eye condition more than having no copy of the ANGPTL7 predicted loss-of-function mutant nucleic acid molecule. Without being limited to any particular theory or mechanism of action, it is believed that a single copy of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule (i.e., heterozygous for a loss-of-function mutant predicted in ANGPTL7) protects a subject undergoing glucocorticoid treatment from developing a glucocorticoid-induced eye condition, and it is also believed that having two copies of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule (i.e., homozygous for a loss-of-function mutant predicted in ANGPTL7) may protect a subject undergoing glucocorticoid treatment from developing a glucocorticoid-induced eye condition more than a subject having a single copy. Thus, in some embodiments, a single copy of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule may not provide complete protection, but may instead provide partial or incomplete protection to a subject undergoing glucocorticoid therapy from the development of a glucocorticoid-induced eye condition. Without wishing to be bound by any particular theory, there may be additional factors or molecules involved in the development of a glucocorticoid-induced eye condition that are still present in a subject having a single copy of an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule, resulting in less than complete protection from the development of a glucocorticoid-induced eye condition.

[0197] In some embodiments, the subject may have inflammation. In some embodiments, the inflammation can be acute inflammation or chronic inflammation. In some embodiments, the inflammation is acute inflammation. In some embodiments, the inflammation is chronic inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis, associated with Graves' disease, or is ocular inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis. In some embodiments, the inflammation is associated with Graves' disease. In some embodiments, the inflammation is ocular inflammation. In some embodiments, the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof. In some embodiments, the ocular inflammation is uveitis. In some embodiments, the ocular inflammation is juvenile idiopathic arthritis uveitis. In some embodiments, the ocular inflammation is scleritis. In some embodiments, the ocular inflammation is blepharitis. In some embodiments, the ocular inflammation is conjunctivitis. In some embodiments, the ocular inflammation is iritis. In some embodiments, the ocular inflammation is episcleritis.

[0198] In some embodiments, the glucocorticoid-induced ocular pathology is selected from ocular hypertension, increased intraocular pressure (IOP), pre-glaucoma, glaucoma, decreased corneal hysteresis, and posterior subcapsular cataract, or any combination thereof. In some embodiments, the glucocorticoid-induced ocular pathology is ocular hypertension. In some embodiments, the glucocorticoid-induced ocular pathology is increased IOP. In some embodiments, the glucocorticoid-induced ocular pathology is pre-glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is decreased corneal hysteresis. In some embodiments, the glucocorticoid-induced ocular pathology is posterior subcapsular cataract.

[0199] In some embodiments, the glucocorticoid treatment is treatment with prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, DOCA, aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, or fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, fluocinolone acetonide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof. In some embodiments, the glucocorticoid treatment is treatment with prednisone. In some embodiments, the glucocorticoid treatment is treatment with prednisolone. In some embodiments, the glucocorticoid treatment is treatment with methylprednisolone. In some embodiments, the glucocorticoid treatment is treatment with dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with betamethasone. In some embodiments, the glucocorticoid treatment is treatment with triamcinolone. In some embodiments, the glucocorticoid treatment is treatment with beclomethasone. In some embodiments, the glucocorticoid treatment is treatment with fludrocortisone acetate. In some embodiments, the glucocorticoid treatment is treatment with DOCA. In some embodiments, the glucocorticoid treatment is treatment with aldosterone. In some embodiments, the glucocorticoid treatment is treatment with budesonide. In some embodiments, the glucocorticoid treatment is treatment with mometasone furoate. In some embodiments, the glucocorticoid treatment is treatment with fluticasone propionate. In some embodiments, the glucocorticoid treatment is treatment with hydrocortisone. In some embodiments, the glucocorticoid treatment is treatment with cortisone acetate.In some embodiments, the glucocorticoid treatment is treatment with fluticasone furoate. In some embodiments, the glucocorticoid treatment is treatment with ophthalmic difluprednate. In some embodiments, the glucocorticoid treatment is treatment with fluorometholone. In some embodiments, the glucocorticoid treatment is treatment with loteprednol etabonate. In some embodiments, the glucocorticoid treatment is treatment with medrysone. In some embodiments, the glucocorticoid treatment is treatment with lumexolone. In some embodiments, the glucocorticoid treatment is treatment with fluocinolone acetonide. In some embodiments, the glucocorticoid treatment is treatment with clobetasol. In some embodiments, the glucocorticoid treatment is treatment with halobetasol. In some embodiments, the glucocorticoid treatment is treatment with diflorasone. In some embodiments, the glucocorticoid treatment is treatment with fluocinonide. In some embodiments, the glucocorticoid treatment is treatment with flurandenolide. In some embodiments, the glucocorticoid treatment is treatment with neo-polydex. In some embodiments, the glucocorticoid treatment is treatment with tobramycin-dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with difluprednate.

[0200] Determining whether a subject has an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule in a biological sample from the subject and / or whether a subject has an ANGPTL7 predicted loss-of-function mutant nucleic acid molecule can be performed by any of the methods described herein. In some embodiments, these methods can be performed in vitro. In some embodiments, these methods can be performed in situ. In some embodiments, these methods can be performed in vivo. In any of these embodiments, the nucleic acid molecule can be present in a cell obtained from the subject.

[0201] In some embodiments, if the subject is identified as having an increased risk of developing glucocorticoid-induced eye pathology, the subject is further treated with an ANGPTL7 inhibitor as described herein.For example, if the subject is an ANGPTL7 reference type and therefore has an increased risk of developing glucocorticoid-induced eye pathology, the subject is administered an ANGPTL7 inhibitor.In some embodiments, if the subject is heterozygous for a loss-of-function variant nucleic acid molecule predicted in ANGPTL7, the subject is administered an ANGPTL7 inhibitor.In some embodiments, the subject is an ANGPTL7 reference type.In some embodiments, the subject is heterozygous for a loss-of-function variant predicted in ANGPTL7.

[0202] The present disclosure also provides a method for detecting the presence or absence of ANGPTL7 predicted loss-of-function mutant genomic nucleic acid molecules in a biological sample from a subject, and / or ANGPTL7 predicted loss-of-function mutant mRNA molecules in a biological sample from a subject, and / or ANGPTL7 predicted loss-of-function mutant cDNA molecules produced from mRNA molecules in a biological sample from a subject. It is understood that gene sequences in a population and the mRNA molecules encoded by such genes may vary due to polymorphisms (such as single nucleotide polymorphisms). The sequences of ANGPTL7 mutant genomic nucleic acid molecules, ANGPTL7 mutant mRNA molecules, and ANGPTL7 mutant cDNA molecules provided herein are only exemplary sequences. Other sequences of ANGPTL7 mutant genomic nucleic acid molecules, mutant mRNA molecules, and mutant cDNA molecules are also possible.

[0203] Biological samples can be derived from any cell, tissue, or biological fluid from a subject. Biological samples can include any clinically significant tissue, such as bone marrow samples, tumor biopsies, fine needle aspirates, or samples of bodily fluids (such as blood, gingival crevicular fluid, plasma, serum, lymph, ascites, cyst fluid, or urine). In some embodiments, the sample includes a buccal swab. The biological samples used in the methods disclosed herein can vary based on the assay format, the nature of the detection method, and the tissue, cell, or extract used as the sample. Depending on the assay being used, the biological sample can be processed differently. For example, when detecting any ANGPTL7 variant nucleic acid molecule, a pretreatment designed to isolate or enrich the biological sample for genomic DNA can be employed. A variety of techniques may be used for this purpose. When detecting the level of any ANGPTL7 variant mRNA molecule, a variety of techniques can be used to enrich the biological sample containing mRNA molecules. A variety of methods can be used to detect the presence or level of mRNA molecules or the presence of specific variant genomic DNA loci.

[0204] In some embodiments, detecting a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7 in a subject comprises assaying or analyzing a biological sample obtained from the subject to determine whether an ANGPTL7 genomic nucleic acid molecule in the biological sample, and / or an ANGPTL7 mRNA molecule in the biological sample, and / or an ANGPTL7 cDNA molecule generated from the mRNA molecule in the biological sample contains one or more mutations that cause or are predicted to cause a loss of function (partial or complete).

[0205] In some embodiments, a method for detecting the presence or absence of a predicted loss-of-function mutant nucleic acid molecule (e.g., a genomic nucleic acid molecule, an mRNA molecule, and / or a cDNA molecule generated from an mRNA) in a subject includes performing an assay on a biological sample obtained from the subject, the assay determining whether the nucleic acid molecule in the biological sample comprises a particular nucleotide sequence.

[0206] In some embodiments, the nucleotide sequence includes (with respect to a genomic nucleic acid molecule) a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2; (with respect to an mRNA molecule) a uracil at a position corresponding to position 529 in accordance with SEQ ID NO:8; or (with respect to a cDNA molecule obtained from an mRNA molecule) a thymine at a position corresponding to position 529 in accordance with SEQ ID NO:14.

[0207] In some embodiments, the nucleotide sequence includes (with respect to a genomic nucleic acid molecule) a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO: 3; (with respect to an mRNA molecule) a uracil at a position corresponding to position 525 in accordance with SEQ ID NO: 9; or (with respect to a cDNA molecule obtained from an mRNA molecule) a thymine at a position corresponding to position 525 in accordance with SEQ ID NO: 15.

[0208] In some embodiments, the nucleotide sequence includes an adenine at a position corresponding to 4,243 in SEQ ID NO:4 (for a genomic nucleic acid molecule); an adenine at a position corresponding to 481 in SEQ ID NO:10 (for an mRNA molecule); or an adenine at a position corresponding to 481 in SEQ ID NO:16 (for a cDNA molecule obtained from an mRNA molecule).

[0209] In some embodiments, the nucleotide sequence includes an adenine at a position corresponding to position 4,325 in SEQ ID NO:5 (for a genomic nucleic acid molecule); an adenine at a position corresponding to position 563 in SEQ ID NO:11 (for an mRNA molecule); or an adenine at a position corresponding to position 563 in SEQ ID NO:17 (for a cDNA molecule obtained from an mRNA molecule).

[0210] In some embodiments, the nucleotide sequence includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO: 6 (for a genomic nucleic acid molecule); a cytosine at a position corresponding to position 574 in SEQ ID NO: 12 (for an mRNA molecule); or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18 (for a cDNA molecule obtained from an mRNA molecule).

[0211] In some embodiments, the nucleotide sequence comprises a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement.

[0212] In some embodiments, the nucleotide sequence comprises a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or its complement.

[0213] In some embodiments, the nucleotide sequence comprises a thymine at a position corresponding to position 529 in SEQ ID NO:14, or its complement; a thymine at a position corresponding to position 525 in SEQ ID NO:15, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:16, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:17, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO:18, or its complement.

[0214] In some embodiments, the biological sample comprises cell or cell lysate.Such method can further comprise, for example, obtaining biological sample comprising ANGPTL7 genomic nucleic acid molecule or mRNA molecule from subject, and optionally reverse transcribing mRNA into cDNA if it is mRNA.Such assay can comprise, for example, determining the uniqueness of these positions of specific ANGPTL7 nucleic acid molecule.In some embodiments, the method is an in vitro method.

[0215] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule in the biological sample, an ANGPTL7 mRNA molecule, or an ANGPTL7 cDNA molecule produced from an mRNA molecule in the biological sample, wherein the sequenced portion contains one or more mutations that cause or are predicted to cause a loss of function (partial or complete).

[0216] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 4,291 according to SEQ ID NO:2, or a complement thereof; sequencing at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 529 according to SEQ ID NO:8, or a complement thereof; and / or sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from the mRNA of the biological sample, wherein the sequenced portion includes a position corresponding to position 529 according to SEQ ID NO:14, or a complement thereof. If the sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2, a uracil at a position corresponding to position 529 in accordance with SEQ ID NO:8, or a thymine at a position corresponding to position 529 in accordance with SEQ ID NO:14, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0217] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 4,287 in SEQ ID NO:3, or a complement thereof; sequencing at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 525 in SEQ ID NO:9, or a complement thereof; and / or sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from the mRNA of the biological sample, wherein the sequenced portion includes a position corresponding to position 525 in SEQ ID NO:15, or a complement thereof. If the sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO:3, a uracil at a position corresponding to position 525 in accordance with SEQ ID NO:9, or a thymine at a position corresponding to position 525 in accordance with SEQ ID NO:15, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0218] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 4,243 according to SEQ ID NO:4, or a complement thereof; sequencing at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 481 according to SEQ ID NO:10, or a complement thereof; and / or sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from the mRNA of the biological sample, wherein the sequenced portion includes a position corresponding to position 481 according to SEQ ID NO:16, or a complement thereof. If the sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains an adenine at a position corresponding to position 4,243 in accordance with SEQ ID NO:4, an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:10, or an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:16, then the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0219] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 4,325 in SEQ ID NO:5, or a complement thereof; sequencing at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 563 in SEQ ID NO:11, or a complement thereof; and / or sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from the mRNA of the biological sample, wherein the sequenced portion includes a position corresponding to position 563 in SEQ ID NO:17, or a complement thereof. If the sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains an adenine at a position corresponding to position 4,325 in accordance with SEQ ID NO:5, an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:11, or an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:17, then the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0220] In some embodiments, the determining, detecting, or sequence analysis step includes sequencing at least a portion of the nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 4,336 according to SEQ ID NO:6, or a complement thereof; sequencing at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule of the biological sample, wherein the sequenced portion includes a position corresponding to position 574 according to SEQ ID NO:12, or a complement thereof; and / or sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from the mRNA of the biological sample, wherein the sequenced portion includes a position corresponding to position 574 according to SEQ ID NO:18, or a complement thereof. If the sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains a cytosine at a position corresponding to position 4,336 in accordance with SEQ ID NO:6, a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:12, or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:18, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0221] In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the ANGPTL7 genomic nucleic acid molecule in the biological sample, wherein the sequenced portion includes a position corresponding to position 4,291, or its complement, according to SEQ ID NO:2; position 4,287, or its complement, according to SEQ ID NO:3; position 4,243, or its complement, according to SEQ ID NO:4; position 4,325, or its complement, according to SEQ ID NO:5; or position 4,336, or its complement, according to SEQ ID NO:6. If a sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains i) a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2, a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO:3, an adenine at a position corresponding to position 4,243 in accordance with SEQ ID NO:4, an adenine at a position corresponding to position 4,325 in accordance with SEQ ID NO:5, or a cytosine at a position corresponding to position 4,336 in accordance with SEQ ID NO:6, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule of ANGPTL7.

[0222] In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the ANGPTL7 mRNA molecule in the biological sample, wherein the sequenced portion includes a position corresponding to position 529, or its complement, of SEQ ID NO:8; position 525, or its complement, of SEQ ID NO:9; position 481, or its complement, of SEQ ID NO:10; position 563, or its complement, of SEQ ID NO:11; or position 574, or its complement, of SEQ ID NO:12. If a sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains a uracil at a position corresponding to position 529 according to SEQ ID NO:8, a uracil at a position corresponding to position 525 according to SEQ ID NO:9, an adenine at a position corresponding to position 481 according to SEQ ID NO:10, an adenine at a position corresponding to position 563 according to SEQ ID NO:11, or a cytosine at a position corresponding to position 574 according to SEQ ID NO:12, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule for ANGPTL7.

[0223] In some embodiments, the determining, detecting, or sequence analysis step comprises sequencing at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule produced from an mRNA molecule in a biological sample, wherein the sequenced portion includes a position corresponding to position 529, or its complement, of SEQ ID NO: 14; position 525, or its complement, of SEQ ID NO: 15; position 481, or its complement, of SEQ ID NO: 16; position 563, or its complement, of SEQ ID NO: 17; or position 574, or its complement, of SEQ ID NO: 18. If a sequenced portion of the ANGPTL7 nucleic acid molecule in the biological sample contains a specific thymine corresponding to position 529 according to SEQ ID NO: 14, a thymine at a position corresponding to position 525 according to SEQ ID NO: 15, an adenine at a position corresponding to position 481 according to SEQ ID NO: 16, an adenine at a position corresponding to position 563 according to SEQ ID NO: 17, or a cytosine at a position corresponding to position 574 according to SEQ ID NO: 18, the ANGPTL7 nucleic acid molecule in the biological sample is a predicted loss-of-function mutant nucleic acid molecule of ANGPTL7.

[0224] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of ANGPTL7, i.e., a genomic nucleic acid molecule adjacent to a position corresponding to position 4,291 according to SEQ ID NO:2; an mRNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO:8; and / or a cDNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO:14; b) extending the primer through at least a position of the nucleotide sequence of ANGPTL7, i.e., the genomic nucleic acid molecule corresponding to position 4,291 according to SEQ ID NO:2; the mRNA molecule corresponding to position 529 according to SEQ ID NO:8; and / or the cDNA molecule corresponding to position 529 according to SEQ ID NO:14; and c) determining whether the extension product of the primer comprises a thymine at the position corresponding to position 4,291 according to SEQ ID NO:2, a uracil at the position corresponding to position 529 according to SEQ ID NO:8, and / or a thymine at the position corresponding to position 529 according to SEQ ID NO:14.

[0225] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of ANGPTL7, i.e., a genomic nucleic acid molecule adjacent to a position corresponding to position 4,287 according to SEQ ID NO:3; an mRNA molecule adjacent to a position corresponding to position 525 according to SEQ ID NO:9; and / or a cDNA molecule adjacent to a position corresponding to position 525 according to SEQ ID NO:15; b) extending the primer through at least a position of the nucleotide sequence of ANGPTL7, i.e., the genomic nucleic acid molecule corresponding to position 4,287 according to SEQ ID NO:3; the mRNA molecule corresponding to position 525 according to SEQ ID NO:9; and / or the cDNA molecule corresponding to position 525 according to SEQ ID NO:15; and c) determining whether the extension product of the primer comprises a thymine at the position corresponding to position 4,287 according to SEQ ID NO:3, a uracil at the position corresponding to position 525 according to SEQ ID NO:9, and / or a thymine at the position corresponding to position 525 according to SEQ ID NO:15.

[0226] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of ANGPTL7, i.e., a genomic nucleic acid molecule adjacent to a position corresponding to position 4,243 according to SEQ ID NO: 4; an mRNA molecule adjacent to a position corresponding to position 481 according to SEQ ID NO: 10; and / or a cDNA molecule adjacent to a position corresponding to position 481 according to SEQ ID NO: 16; b) extending the primer through at least a position of the nucleotide sequence of ANGPTL7, i.e., the genomic nucleic acid molecule corresponding to position 4,243 according to SEQ ID NO: 4; the mRNA molecule corresponding to position 481 according to SEQ ID NO: 10; and / or the cDNA molecule corresponding to position 481 according to SEQ ID NO: 16; and c) determining whether the extension product of the primer includes an adenine at a position corresponding to position 4,243 according to SEQ ID NO: 4, an adenine at a position corresponding to position 481 according to SEQ ID NO: 10, and / or an adenine at a position corresponding to position 481 according to SEQ ID NO: 16.

[0227] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of ANGPTL7, i.e., a genomic nucleic acid molecule adjacent to a position corresponding to position 4,325 according to SEQ ID NO:5; an mRNA molecule adjacent to a position corresponding to position 563 according to SEQ ID NO:11; and / or a cDNA molecule adjacent to a position corresponding to position 563 according to SEQ ID NO:17; b) extending the primer through at least a position of the nucleotide sequence of ANGPTL7, i.e., the genomic nucleic acid molecule corresponding to position 4,325 according to SEQ ID NO:5; the mRNA molecule corresponding to position 563 according to SEQ ID NO:11; and / or the cDNA molecule corresponding to position 563 according to SEQ ID NO:17; and c) determining whether the extension product of the primer includes an adenine at a position corresponding to position 4,325 according to SEQ ID NO:5, an adenine at a position corresponding to position 563 according to SEQ ID NO:11, and / or an adenine at a position corresponding to position 563 according to SEQ ID NO:17.

[0228] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of ANGPTL7, i.e., a genomic nucleic acid molecule adjacent to a position corresponding to position 4,336 according to SEQ ID NO:6; an mRNA molecule adjacent to a position corresponding to position 574 according to SEQ ID NO:12; and / or a cDNA molecule adjacent to a position corresponding to position 574 according to SEQ ID NO:18; b) extending the primer through at least a position of the nucleotide sequence of ANGPTL7, i.e., the genomic nucleic acid molecule corresponding to position 4,336 according to SEQ ID NO:6; the mRNA molecule corresponding to position 574 according to SEQ ID NO:12; and / or the cDNA molecule corresponding to position 574 according to SEQ ID NO:18; and c) determining whether the extension product of the primer includes a cytosine at a position corresponding to position 4,336 according to SEQ ID NO:6, a cytosine at a position corresponding to position 574 according to SEQ ID NO:12, and / or a cytosine at a position corresponding to position 574 according to SEQ ID NO:18.

[0229] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) contacting the biological sample with a primer that hybridizes to a portion of a nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule adjacent to a position corresponding to position 4,291 according to SEQ ID NO:2, position 4,287 according to SEQ ID NO:3, position 4,243 according to SEQ ID NO:4, position 4,325 according to SEQ ID NO:5, or position 4,336 according to SEQ ID NO:6; and b) hybridizing to at least a portion of a nucleotide sequence of an ANGPTL7 genomic nucleic acid molecule adjacent to a position corresponding to position 4,291 according to SEQ ID NO:2, position 4,287 according to SEQ ID NO:3, position 4,243 according to SEQ ID NO:4, position 4,336 according to SEQ ID NO:6. and c) determining whether the extension product of the primer contains a thymine at a position corresponding to position 4,291 according to SEQ ID NO:2, a thymine at a position corresponding to position 4,287 according to SEQ ID NO:3, an adenine at a position corresponding to position 4,243 according to SEQ ID NO:4, an adenine at a position corresponding to position 4,325 according to SEQ ID NO:5, or a cytosine at a position corresponding to position 4,336 according to SEQ ID NO:6.

[0230] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO:8; position 525 according to SEQ ID NO:9; position 481 according to SEQ ID NO:10; position 563 according to SEQ ID NO:11; or position 574 according to SEQ ID NO:12; and b) hybridizing to at least a portion of the nucleotide sequence of an ANGPTL7 mRNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO:8; position 525 according to SEQ ID NO:9; position 481 according to SEQ ID NO:10, position 563 according to SEQ ID NO:11; or position 574 according to SEQ ID NO:12. extending a primer through a portion of the nucleotide sequence of the mRNA molecule; and c) determining whether an extension product of the primer contains a uracil at a position corresponding to position 529 in SEQ ID NO:8, a uracil at a position corresponding to position 525 in SEQ ID NO:9, an adenine at a position corresponding to position 481 in SEQ ID NO:10, an adenine at a position corresponding to position 563 in SEQ ID NO:11, or a cytosine at a position corresponding to position 574 in SEQ ID NO:12.

[0231] In some embodiments, the determining, detecting, or sequence analysis step includes: a) contacting the biological sample with a primer that hybridizes to a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO: 14; position 525 according to SEQ ID NO: 15; position 481 according to SEQ ID NO: 16; position 563 according to SEQ ID NO: 17; or position 574 according to SEQ ID NO: 18; and b) hybridizing to at least a portion of the nucleotide sequence of an ANGPTL7 cDNA molecule adjacent to a position corresponding to position 529 according to SEQ ID NO: 14; position 525 according to SEQ ID NO: 15; position 481 according to SEQ ID NO: 16, position 563 according to SEQ ID NO: 17; or position 574 according to SEQ ID NO: 18. and c) determining whether an extension product of the primer comprises a thymine at a position corresponding to position 529 in SEQ ID NO:14, a thymine at a position corresponding to position 525 in SEQ ID NO:15, an adenine at a position corresponding to position 481 in SEQ ID NO:16, an adenine at a position corresponding to position 563 in SEQ ID NO:17, or a cytosine at a position corresponding to position 574 in SEQ ID NO:18.

[0232] In some embodiments, the assay comprises sequencing the entire nucleic acid molecule. In some embodiments, only the ANGPTL7 genomic nucleic acid molecule is analyzed. In some embodiments, only the ANGPTL7 mRNA is analyzed. In some embodiments, only the ANGPTL7 cDNA obtained from the ANGPTL7 mRNA is analyzed.

[0233] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, wherein the amplified portion includes a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or a complement thereof; a uracil at a position corresponding to position 529 in SEQ ID NO:8, or a complement thereof; and / or a thymine at a position corresponding to position 529 in SEQ ID NO:14, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and / or a thymine at a position corresponding to position 529 in SEQ ID NO:14, or its complement; and d) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; and / or a thymine at a position corresponding to position 529 in SEQ ID NO:14, or its complement; and d) detecting the detectable label.

[0234] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, wherein the amplified portion includes a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or a complement thereof; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or a complement thereof; and / or a thymine at a position corresponding to position 525 in SEQ ID NO:15, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and / or a thymine at a position corresponding to position 525 in SEQ ID NO:15, or its complement; and d) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,291 in SEQ ID NO:3, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; and / or a thymine at a position corresponding to position 525 in SEQ ID NO:15, or its complement; and d) detecting the detectable label.

[0235] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, wherein the amplified portion includes an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or a complement thereof; and / or an adenine at a position corresponding to position 481 in SEQ ID NO:16, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and / or a nucleotide sequence of the amplified nucleic acid molecule that comprises an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; and / or an adenine at a position corresponding to position 481 in SEQ ID NO:16, or its complement; and d) detecting the detectable label.

[0236] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, wherein the amplified portion includes an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or a complement thereof; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or a complement thereof; and / or an adenine at a position corresponding to position 563 in SEQ ID NO:17, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and / or a nucleotide sequence of the amplified nucleic acid molecule that comprises an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; and / or an adenine at a position corresponding to position 563 in SEQ ID NO:17, or its complement; and d) detecting the detectable label.

[0237] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, wherein the amplified portion includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or a complement thereof; a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or a complement thereof; and / or a cytosine at a position corresponding to position 574 in SEQ ID NO:18, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and / or a cytosine at a position corresponding to position 574 in SEQ ID NO:18, or its complement; and d) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement; a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or its complement; and / or a cytosine at a position corresponding to position 574 in SEQ ID NO:18, or its complement; and d) detecting the detectable label.

[0238] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, the amplified portion including a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or a complement thereof; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or a complement thereof; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or a complement thereof; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and (b) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement; and (c) detecting the detectable label.

[0239] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, the amplified portion including a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or its complement; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and (d) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a uracil at a position corresponding to position 529 in SEQ ID NO:8, or a complement thereof; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or a complement thereof; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or a complement thereof; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or a complement thereof; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or a complement thereof; and (e) detecting the detectable label.

[0240] In some embodiments, the determining, detecting, or sequence analyzing step includes: a) amplifying at least a portion of a nucleic acid molecule encoding an ANGPTL7 polypeptide, the amplified portion including a thymine at a position corresponding to position 529 in SEQ ID NO: 14, or a complement thereof; a thymine at a position corresponding to position 525 in SEQ ID NO: 15, or a complement thereof; an adenine at a position corresponding to position 481 in SEQ ID NO: 16, or a complement thereof; an adenine at a position corresponding to position 563 in SEQ ID NO: 17, or a complement thereof; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or a complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; and c) labeling the amplified nucleic acid molecule with a detectable label. and (b) contacting the amplified nucleic acid molecule with a support comprising a mutation-specific probe, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleic acid sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 529 in SEQ ID NO: 14, or its complement; a thymine at a position corresponding to position 525 in SEQ ID NO: 15, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 16, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 17, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or its complement; and (c) detecting the detectable label.

[0241] In some embodiments, the nucleic acid molecule is mRNA and the determining step further comprises reverse transcribing the mRNA into cDNA prior to the amplifying step. In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; and / or a thymine at a position corresponding to position 529 in SEQ ID NO:15, or its complement; and detecting the detectable label.

[0242] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; and / or a thymine at a position corresponding to position 525 in SEQ ID NO:15, or its complement; and detecting the detectable label.

[0243] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; and / or an adenine at a position corresponding to position 481 in SEQ ID NO:16, or its complement; and detecting the detectable label.

[0244] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; and / or an adenine at a position corresponding to position 563 in SEQ ID NO:17, or its complement; and detecting the detectable label.

[0245] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising a cytosine at a position corresponding to position 4,336 in SEQ ID NO: 6, or its complement; a cytosine at a position corresponding to position 574 in SEQ ID NO: 12, or its complement; and / or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or its complement; and detecting the detectable label.

[0246] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement; and detecting the detectable label.

[0247] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence of the amplified nucleic acid molecule comprising a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or its complement; and detecting the detectable label.

[0248] In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting a nucleic acid molecule in a biological sample with a mutation-specific probe comprising a detectable label, the mutation-specific probe comprising a thymine at a position corresponding to position 529 in SEQ ID NO: 14, or its complement; a thymine at a position corresponding to position 525 in SEQ ID NO: 15, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO: 16, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO: 17, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO: 18, or its complement; and detecting the detectable label.

[0249] Mutation-specific polymerase chain reaction techniques can be used to detect mutations (such as SNPs in nucleic acid sequences). Mutation-specific primers can be used because DNA polymerase will not extend if there is a mismatch with the template.

[0250] In some embodiments, the nucleic acid molecule in the sample is mRNA, and the mRNA is reverse transcribed into cDNA prior to the amplification step. In some embodiments, the nucleic acid molecule is present in a cell obtained from the subject.

[0251] In some embodiments, the assay involves contacting the biological sample with a primer or probe, such as a mutation-specific primer or a mutation-specific probe, that specifically hybridizes to an ANGPTL7 variant genomic sequence, variant mRNA sequence, or variant cDNA sequence under stringent conditions and does not hybridize to the corresponding ANGPTL7 reference sequence, and determining whether hybridization occurs.

[0252] In some embodiments, the assay comprises RNA sequencing (RNA-Seq). In some embodiments, the assay also comprises reverse transcribing mRNA into cDNA, such as by reverse transcription polymerase chain reaction (RT-PCR).

[0253] In some embodiments, the method utilizes probes and primers of sufficient nucleotide length to bind to the target nucleotide sequence and specifically detect and / or identify polynucleotides including mutant genomic nucleic acid molecules, mutant mRNA molecules, or mutant cDNA molecules of ANGPTL7. The operator can determine the hybridization or reaction conditions to achieve this result. The nucleotide length can be any length sufficient for use in the selected detection method, including any assay described or exemplified herein. Such probes and primers can specifically hybridize to the target nucleotide sequence under high stringency hybridization conditions. The probes and primers can have a perfect nucleotide sequence identity of consecutive nucleotides in the target nucleotide sequence, but the probes that are different from the target nucleotide sequence and retain the ability to specifically detect and / or identify the target nucleotide sequence can be designed by conventional methods. The probes and primers can have about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity or complementarity to the nucleotide sequence of the target nucleic acid molecule.

[0254] In some embodiments, to determine whether an ANGPTL7 nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) in a biological sample, or a complement thereof, contains a nucleotide sequence that includes a thymine at a position corresponding to position 4,291 in SEQ ID NO:2 (genomic nucleic acid molecule), a uracil at a position corresponding to position 529 in SEQ ID NO:8 (mRNA molecule), or a thymine at a position corresponding to position 529 in SEQ ID NO:14 (cDNA molecule), the biological sample is subjected to a nucleotide sequence analysis that includes a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, a uracil at a position corresponding to position 529 in SEQ ID NO:8, or a thymine at a position corresponding to position 529 in SEQ ID NO:14. and a second primer derived from a 3' flanking sequence adjacent to a thymine at a position corresponding to position 4,291 according to SEQ ID NO:2, a uracil at a position corresponding to position 529 according to SEQ ID NO:8, or a thymine at a position corresponding to position 529 according to SEQ ID NO:14, to produce an amplicon indicative of the presence of a SNP at a position encoding a thymine at a position corresponding to position 4,291 according to SEQ ID NO:2, a uracil at a position corresponding to position 529 according to SEQ ID NO:8, or a thymine at a position corresponding to position 529 according to SEQ ID NO:14. In some embodiments, the amplicon can range in length from the primer pair plus one nucleotide base pair to any length of an amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair to the limit of the amplification reaction, or up to about 20,000 nucleotide base pairs. Optionally, the primer pair flanks a region including a position that includes a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, a uracil at a position corresponding to position 529 in SEQ ID NO:8, or a thymine at a position corresponding to position 529 in SEQ ID NO:14, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of the position that includes a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, a uracil at a position corresponding to position 529 in SEQ ID NO:8, or a thymine at a position corresponding to position 529 in SEQ ID NO:14.

[0255] In some embodiments, to determine whether an ANGPTL7 nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) in a biological sample, or a complement thereof, contains a nucleotide sequence that includes a thymine at a position corresponding to position 4,287 in SEQ ID NO:3 (genomic nucleic acid molecule), a uracil at a position corresponding to position 525 in SEQ ID NO:9 (mRNA molecule), or a thymine at a position corresponding to position 525 in SEQ ID NO:15 (cDNA molecule), the biological sample is subjected to a nucleotide sequence that includes a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, a uracil at a position corresponding to position 525 in SEQ ID NO:9, or a thymine at a position corresponding to position 525 in SEQ ID NO:15. and a second primer derived from a 3' flanking sequence adjacent to a thymine at a position corresponding to position 4,287 according to SEQ ID NO:3, a uracil at a position corresponding to position 525 according to SEQ ID NO:9, or a thymine at a position corresponding to position 525 according to SEQ ID NO:15, to produce an amplicon indicative of the presence of a SNP at a position encoding a thymine at a position corresponding to position 4,287 according to SEQ ID NO:3, a uracil at a position corresponding to position 525 according to SEQ ID NO:9, or a thymine at a position corresponding to position 525 according to SEQ ID NO:15. In some embodiments, the amplicon can range in length from the primer pair plus one nucleotide base pair to any length of an amplicon that can be produced by a DNA amplification protocol. This distance can range from one nucleotide base pair to the limit of the amplification reaction, or up to about 20,000 nucleotide base pairs. Optionally, the primer pair flanks a region including a position that includes a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, a uracil at a position corresponding to position 525 in SEQ ID NO:9, or a thymine at a position corresponding to position 525 in SEQ ID NO:15, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of the position that includes a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, a uracil at a position corresponding to position 525 in SEQ ID NO:9, or a thymine at a position corresponding to position 525 in SEQ ID NO:15.

[0256] In some embodiments, to determine whether an ANGPTL7 nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) in a biological sample, or a complement thereof, contains a nucleotide sequence that includes an adenine at a position corresponding to position 4,243 in SEQ ID NO:4 (genomic nucleic acid molecule), an adenine at a position corresponding to position 481 in SEQ ID NO:10 (mRNA molecule), or an adenine at a position corresponding to position 481 in SEQ ID NO:16 (cDNA molecule), the biological sample is subjected to a nucleotide sequence analysis that includes an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, an adenine at a position corresponding to position 481 in SEQ ID NO:10, or an adenine at a position corresponding to position 481 in SEQ ID NO:16 (cDNA molecule). and a second primer derived from a 3' flanking sequence adjacent to an adenine at a position corresponding to 4,243 according to SEQ ID NO:4, an adenine at a position corresponding to 481 according to SEQ ID NO:10, or an adenine at a position corresponding to 481 according to SEQ ID NO:16, to produce an amplicon indicative of the presence of a SNP at a position encoding an adenine at a position corresponding to 4,243 according to SEQ ID NO:4, an adenine at a position corresponding to 481 according to SEQ ID NO:10, or an adenine at a position corresponding to 481 according to SEQ ID NO:16. In some embodiments, the amplicon can range in length from the primer pair plus one nucleotide base pair to any length of an amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair to the limit of the amplification reaction, or up to about 20,000 nucleotide base pairs. Optionally, the primer pair flanks a region including an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, an adenine at a position corresponding to position 481 in SEQ ID NO:10, or an adenine at a position corresponding to position 481 in SEQ ID NO:16, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of the position including an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, an adenine at a position corresponding to position 481 in SEQ ID NO:10, or an adenine at a position corresponding to position 481 in SEQ ID NO:16.

[0257] In some embodiments, to determine whether an ANGPTL7 nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) in a biological sample, or a complement thereof, contains a nucleotide sequence that includes an adenine at a position corresponding to position 4,325 in SEQ ID NO:5 (genomic nucleic acid molecule), an adenine at a position corresponding to position 563 in SEQ ID NO:11 (mRNA molecule), or an adenine at a position corresponding to position 563 in SEQ ID NO:17 (cDNA molecule), the biological sample is subjected to a nucleotide sequence analysis that includes an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, an adenine at a position corresponding to position 563 in SEQ ID NO:11, or an adenine at a position corresponding to position 563 in SEQ ID NO:17 (cDNA molecule). and a second primer derived from a 3' flanking sequence adjacent to an adenine at a position corresponding to 4,325 according to SEQ ID NO:5, an adenine at a position corresponding to 563 according to SEQ ID NO:11, or an adenine at a position corresponding to 563 according to SEQ ID NO:17, to produce an amplicon indicative of the presence of a SNP at a position encoding an adenine at a position corresponding to 4,325 according to SEQ ID NO:5, an adenine at a position corresponding to 563 according to SEQ ID NO:11, or an adenine at a position corresponding to 563 according to SEQ ID NO:17. In some embodiments, the amplicon can range in length from the primer pair plus one nucleotide base pair to any length of an amplicon that can be produced by a DNA amplification protocol. This distance can range from one nucleotide base pair to the limit of the amplification reaction, or up to about 20,000 nucleotide base pairs. Optionally, the primer pair flanks a region including an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, an adenine at a position corresponding to position 563 in SEQ ID NO:11, or an adenine at a position corresponding to position 563 in SEQ ID NO:17, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of the position including an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, an adenine at a position corresponding to position 563 in SEQ ID NO:11, or an adenine at a position corresponding to position 563 in SEQ ID NO:17.

[0258] In some embodiments, to determine whether an ANGPTL7 nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) in a biological sample, or a complement thereof, contains a nucleotide sequence that includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6 (genomic nucleic acid molecule), a cytosine at a position corresponding to position 574 in SEQ ID NO:12 (mRNA molecule), or a cytosine at a position corresponding to position 574 in SEQ ID NO:18 (cDNA molecule), the biological sample is subjected to a nucleotide sequence analysis that includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or a cytosine at a position corresponding to position 574 in SEQ ID NO:18. and a second primer derived from a 3' flanking sequence adjacent to a cytosine at a position corresponding to 4,336 according to SEQ ID NO:6, a cytosine at a position corresponding to 574 according to SEQ ID NO:12, or a cytosine at a position corresponding to 574 according to SEQ ID NO:18, to produce an amplicon indicative of the presence of a SNP at a position encoding a cytosine at a position corresponding to 4,336 according to SEQ ID NO:6, a cytosine at a position corresponding to 574 according to SEQ ID NO:12, or a cytosine at a position corresponding to 574 according to SEQ ID NO:18. In some embodiments, the amplicon can range in length from the primer pair plus one nucleotide base pair to any length of an amplicon that can be produced by a DNA amplification protocol. This distance can range from one nucleotide base pair to the limit of the amplification reaction, or up to about 20,000 nucleotide base pairs. Optionally, the primer pair flanks a region that includes a position that includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or a cytosine at a position corresponding to position 574 in SEQ ID NO:18, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of the position that includes a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or a cytosine at a position corresponding to position 574 in SEQ ID NO:18.

[0259] Similar amplicons can be generated from mRNA and / or cDNA sequences. PCR primer pairs can be derived from known sequences, for example, using computer programs designed for that purpose, such as the PCR primer analysis tools in Vector NTI version 10 (Informax Inc., Bethesda Md.), PrimerSelect (DNASTAR Inc., Madison, Wis.), and Primer3 (Version 0.4.0.COPYRGT., 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Additionally, sequences can be visually inspected and primers manually specified using known guidelines.

[0260] Illustrative examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Other methods include nucleic acid hybridization methods other than sequencing (fluorescence in situ hybridization (FISH)), including the use of labeled primers or probes on purified DNA, amplified DNA, and fixed cell preparations. In some methods, the target nucleic acid molecule can be amplified prior to or simultaneously with detection. Illustrative examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA). Other methods include, but are not limited to, ligase chain reaction, strand displacement amplification, and thermophilic SDA (tSDA).

[0261] Hybridization techniques can employ stringent conditions so that the probe or primer specifically hybridizes to its target. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target sequence detectably more than other non-target sequences, for example, at least 2-fold, at least 3-fold, at least 4-fold or more above background, including more than 10-fold above background. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence detectably more than other nucleotide sequences at least 2-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence detectably more than other nucleotide sequences at least 3-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence detectably more than other nucleotide sequences at least 4-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence to a detectably greater extent than other nucleotide sequences, at more than 10-fold background. Stringent conditions are sequence-dependent and will be different in different circumstances.

[0262] Suitable stringent conditions that promote DNA hybridization, such as 6x sodium chloride / sodium citrate (SSC) at about 45°C, followed by a 2x SSC wash at 50°C, are known or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. Typically, stringent conditions for hybridization and detection include conditions in which the salt concentration is less than about 1.5 M NaCl at pH 7.0-8.3. +ion, usually about 0.01 to 1.0 M Na + The conditions will be ionic concentration (or other salts) and temperature of at least about 30° C. for short probes (e.g., 10-50 nucleotides) and at least about 60° C. for longer probes (e.g., more than 50 nucleotides). Stringent conditions may be achieved by the addition of destabilizing agents such as formamide. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. The duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash will be at least long enough to reach equilibrium.

[0263] The present disclosure also provides a method for detecting the presence of a predicted loss-of-function polypeptide in ANGPTL7, comprising performing an assay on a sample obtained from a subject to determine whether the ANGPTL7 polypeptide in the subject contains one or more mutations that cause the polypeptide to have loss of function (partial or complete) or a predicted loss of function (partial or complete). The predicted loss-of-function polypeptide in ANGPTL7 can be any of the ANGPTL7 mutant polypeptides described herein. In some embodiments, the method detects the presence of Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, Lys192Gln, Arg340His, Arg220His, Asn302Lys, or Arg220Cys in ANGPTL7. In some embodiments, the method detects the presence of Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, or Lys192Gln in ANGPTL7.

[0264] In some embodiments, the method comprises assaying a sample from the subject to determine whether an ANGPTL7 polypeptide in the sample ends at position 176 and does not include an amino acid at a position corresponding to positions 177-346 in accordance with SEQ ID NO:19. In some embodiments, the method comprises assaying a sample from the subject to determine whether an ANGPTL7 polypeptide in the sample includes a histidine at a position corresponding to position 175 in accordance with SEQ ID NO:21. In some embodiments, the method comprises assaying a sample from the subject to determine whether an ANGPTL7 polypeptide in the sample includes an isoleucine at a position corresponding to position 161 in accordance with SEQ ID NO:22. In some embodiments, the method comprises assaying a sample from the subject to determine whether an ANGPTL7 polypeptide in the sample ends at position 187 and does not include an amino acid at a position corresponding to positions 188-346 in accordance with SEQ ID NO:19. In some embodiments, the method comprises assaying a sample from the subject to determine whether an ANGPTL7 polypeptide in the sample includes a glutamine at a position corresponding to position 192 in accordance with SEQ ID NO:24.

[0265] In some embodiments, the determining step comprises sequencing at least a portion of the polypeptide that includes a position corresponding to position 175 according to SEQ ID NO:21 or SEQ ID NO:19. In some embodiments, the determining step comprises sequencing at least a portion of the polypeptide that includes a position corresponding to position 161 according to SEQ ID NO:22 or SEQ ID NO:19. In some embodiments, the determining step comprises sequencing at least a portion of the polypeptide that includes a position corresponding to position 192 according to SEQ ID NO:24 or SEQ ID NO:19.

[0266] In some embodiments, the determining step comprises sequencing at least a portion of the ANGPTL7 polypeptide, which may include a position corresponding to any position C-terminal to position 176 according to SEQ ID NO:20. If an amino acid is detected in the ANGPTL7 polypeptide at a position corresponding to positions 177-346 according to SEQ ID NO:19, such an ANGPTL7 polypeptide is an NGPTL7 reference polypeptide. The absence of positions 177-346 according to SEQ ID NO:19 in an ANGPTL7 polypeptide indicates that the ANGPTL7 polypeptide ends at position 176 according to SEQ ID NO:20 and is an ANGPTL7 predicted loss-of-function polypeptide.

[0267] In some embodiments, the determining step comprises sequencing at least a portion of the ANGPTL7 polypeptide, which may include a position corresponding to any position C-terminal to position 187 according to SEQ ID NO:23. If an amino acid is detected in the ANGPTL7 polypeptide at a position corresponding to positions 188-346 according to SEQ ID NO:19, then such an ANGPTL7 polypeptide is an NGPTL7 reference polypeptide. The absence of positions 188-346 according to SEQ ID NO:19 in an ANGPTL7 polypeptide indicates that the ANGPTL7 polypeptide ends at position 187 according to SEQ ID NO:23 and is an ANGPTL7 predicted loss-of-function polypeptide.

[0268] In some embodiments, the determining step comprises an immunoassay for detecting at least a portion of a polypeptide comprising a position corresponding to position 175 according to SEQ ID NO:21 or SEQ ID NO:19. In some embodiments, the determining step comprises an immunoassay for detecting at least a portion of a polypeptide comprising a position corresponding to position 161 according to SEQ ID NO:22 or SEQ ID NO:19. In some embodiments, the determining step comprises an immunoassay for detecting at least a portion of a polypeptide comprising a position corresponding to position 192 according to SEQ ID NO:24 or SEQ ID NO:19.

[0269] In some embodiments, the determining step comprises an immunoassay for detecting at least a portion of an ANGPTL7 polypeptide, which may include a position corresponding to any position C-terminal to position 176 according to SEQ ID NO:20. If an amino acid is detected in an ANGPTL7 polypeptide at a position corresponding to positions 177-346 according to SEQ ID NO:19, such an ANGPTL7 polypeptide is an NGPTL7 reference polypeptide. The absence of positions 177-346 according to SEQ ID NO:19 in an ANGPTL7 polypeptide indicates that the ANGPTL7 polypeptide ends at position 176 according to SEQ ID NO:20 and is a predicted loss-of-function polypeptide for ANGPTL7.

[0270] In some embodiments, the determining step comprises an immunoassay for detecting at least a portion of an ANGPTL7 polypeptide, which may include a position corresponding to any position C-terminal to position 187 according to SEQ ID NO: 23. If an amino acid is detected in an ANGPTL7 polypeptide at a position corresponding to positions 188-346 according to SEQ ID NO: 19, such an ANGPTL7 polypeptide is an NGPTL7 reference polypeptide. The absence of positions 188-346 according to SEQ ID NO: 19 in an ANGPTL7 polypeptide indicates that the ANGPTL7 polypeptide ends at position 187 according to SEQ ID NO: 23 and is a predicted loss-of-function polypeptide for ANGPTL7.

[0271] In some embodiments, if the subject does not have an ANGPTL7 predicted loss-of-function polypeptide, the subject is at increased risk of developing a glucocorticoid-induced eye condition. In some embodiments, if the subject has an ANGPTL7 predicted loss-of-function polypeptide, the subject is at decreased risk of developing a glucocorticoid-induced eye condition.

[0272] The present disclosure also provides isolated nucleic acid molecules that hybridize to an ANGPTL7 variant genomic nucleic acid molecule, an ANGPTL7 variant mRNA molecule, and / or an ANGPTL7 variant cDNA molecule (such as any of the genomic variant nucleic acid molecules, mRNA variant molecules, and cDNA variant molecules disclosed herein). In some embodiments, the isolated nucleic acid molecule hybridizes to a portion of an ANGPTL7 nucleic acid molecule that includes a position corresponding to position 4,291 according to SEQ ID NO:2, position 529 according to SEQ ID NO:8, or position 529 according to SEQ ID NO:14. In some embodiments, the isolated nucleic acid molecule hybridizes to a portion of an ANGPTL7 nucleic acid molecule that includes a position corresponding to position 4,287 according to SEQ ID NO:3, position 525 according to SEQ ID NO:9, or position 525 according to SEQ ID NO:15. In some embodiments, the isolated nucleic acid molecule hybridizes to a portion of an ANGPTL7 nucleic acid molecule that includes a position corresponding to position 4,243 according to SEQ ID NO:4, position 481 according to SEQ ID NO:10, or position 481 according to SEQ ID NO:16. In some embodiments, the isolated nucleic acid molecule hybridizes to a portion of an ANGPTL7 nucleic acid molecule that includes a position corresponding to position 4,325 according to SEQ ID NO:5, position 563 according to SEQ ID NO:11, or position 563 according to SEQ ID NO:17. In some embodiments, the isolated nucleic acid molecule hybridizes to a portion of an ANGPTL7 nucleic acid molecule that includes a position corresponding to position 4,336 according to SEQ ID NO:6, position 574 according to SEQ ID NO:12, or position 574 according to SEQ ID NO:18.

[0273] In some embodiments, such isolated nucleic acid molecules comprise at least about 5, at least about 8, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55 , at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, at least about 4000, or at least about 5000 nucleotides. In some embodiments, such isolated nucleic acid molecules comprise or consist of at least about 5, at least about 8, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, or at least about 25 nucleotides. In some embodiments, the isolated nucleic acid molecule comprises or consists of at least about 18 nucleotides. In some embodiments, the isolated nucleic acid molecule comprises or consists of at least about 15 nucleotides. In some embodiments, the isolated nucleic acid molecule comprises or consists of about 10 to about 35, about 10 to about 30, about 10 to about 25, about 12 to about 30, about 12 to about 28, about 12 to about 24, about 15 to about 30, about 15 to about 25, about 18 to about 30, about 18 to about 25, about 18 to about 24, or about 18 to about 22 nucleotides. In some embodiments, the isolated nucleic acid molecule comprises or consists of at least about 15 nucleotides.In some embodiments, the isolated nucleic acid molecule comprises or consists of at least 15 nucleotides to at least about 35 nucleotides.

[0274] In some embodiments, such isolated nucleic acid molecules hybridize under stringent conditions to ANGPTL7 variant nucleic acid molecules (e.g., genomic nucleic acid molecules, mRNA molecules, and / or cDNA molecules). Such nucleic acid molecules can be used, for example, as probes, primers, mutation-specific probes, or mutation-specific primers as described or exemplified herein, including, but not limited to, primers, probes, antisense RNA, shRNA, and siRNA, each of which is described in more detail elsewhere herein and can be used in any of the methods described herein.

[0275] In some embodiments, the isolated nucleic acid molecule hybridizes to at least about 15 contiguous nucleotides of a nucleic acid molecule that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an ANGPTL7 variant genomic nucleic acid molecule, an ANGPTL7 variant mRNA molecule, and / or an ANGPTL7 variant cDNA molecule. In some embodiments, the isolated nucleic acid molecule consists of or comprises about 15 to about 100 nucleotides, or about 15 to about 35 nucleotides. In some embodiments, the isolated nucleic acid molecule consists of or comprises about 15 to about 100 nucleotides. In some embodiments, the isolated nucleic acid molecule consists of or comprises about 15 to about 35 nucleotides.

[0276] In some embodiments, the isolated mutation-specific probe or mutation-specific primer comprises at least about 15 nucleotides, wherein the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence encoding an ANGPTL7 polypeptide, the portion including a position corresponding to position 4,291, or a complement thereof, in accordance with SEQ ID NO:2; position 529, or a complement thereof, in accordance with SEQ ID NO:8; or position 529, or a complement thereof, in accordance with SEQ ID NO:14. In some embodiments, the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence including positions 4,291-4,293, or a complement thereof, in accordance with SEQ ID NO:2; positions 529-531, or a complement thereof, in accordance with SEQ ID NO:8; and / or positions 529-531, or a complement thereof, in accordance with SEQ ID NO:14.

[0277] In some embodiments, the isolated mutation-specific probe or mutation-specific primer comprises at least about 15 nucleotides, wherein the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence encoding an ANGPTL7 polypeptide, the portion including a position corresponding to position 4,287, or a complement thereof, in accordance with SEQ ID NO:3; position 525, or a complement thereof, in accordance with SEQ ID NO:9; or position 525, or a complement thereof, in accordance with SEQ ID NO:15. In some embodiments, the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence including positions 4,285-4,287, or a complement thereof, in accordance with SEQ ID NO:3; positions 523-525, or a complement thereof, in accordance with SEQ ID NO:9; and / or positions 523-525, or a complement thereof, in accordance with SEQ ID NO:15.

[0278] In some embodiments, the isolated mutation-specific probe or mutation-specific primer comprises at least about 15 nucleotides, wherein the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence encoding an ANGPTL7 polypeptide, the portion including a position corresponding to position 4,243, or a complement thereof, in accordance with SEQ ID NO:4; position 481, or a complement thereof, in accordance with SEQ ID NO:10; or position 481, or a complement thereof, in accordance with SEQ ID NO:16. In some embodiments, the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence including positions 4,243-4,245, or a complement thereof, in accordance with SEQ ID NO:4; positions 481-483, or a complement thereof, in accordance with SEQ ID NO:10; and / or positions 481-483, or a complement thereof, in accordance with SEQ ID NO:16.

[0279] In some embodiments, the isolated mutation-specific probe or mutation-specific primer comprises at least about 15 nucleotides, wherein the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence encoding an ANGPTL7 polypeptide, the portion including a position corresponding to position 4,325, or a complement thereof, in accordance with SEQ ID NO:5; position 563, or a complement thereof, in accordance with SEQ ID NO:11; or position 563, or a complement thereof, in accordance with SEQ ID NO:17. In some embodiments, the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence including positions 4,324-4,326, or a complement thereof, in accordance with SEQ ID NO:5; positions 562-564, or a complement thereof, in accordance with SEQ ID NO:11; and / or positions 562-564, or a complement thereof, in accordance with SEQ ID NO:17.

[0280] In some embodiments, the isolated mutation-specific probe or mutation-specific primer comprises at least about 15 nucleotides, wherein the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence encoding an ANGPTL7 polypeptide, the portion including a position corresponding to position 4,336, or its complement, in accordance with SEQ ID NO:6; position 574, or its complement, in accordance with SEQ ID NO:12; or position 574, or its complement, in accordance with SEQ ID NO:18. In some embodiments, the mutation-specific probe or mutation-specific primer comprises a nucleotide sequence that is complementary to a portion of a nucleotide sequence including positions 4,336-4,338, or their complement, in accordance with SEQ ID NO:6; positions 574-576, or their complement, in accordance with SEQ ID NO:12; and / or positions 574-576, or their complement, in accordance with SEQ ID NO:18.

[0281] In some embodiments, the mutation-specific probe or the mutation-specific primer comprises DNA. In some embodiments, the mutation-specific probe or the mutation-specific primer comprises RNA.

[0282] In some embodiments, the probes and primers described herein (including mutation-specific probes and mutation-specific primers) have nucleotide sequences that specifically hybridize to any of the nucleic acid molecules disclosed herein or their complements. In some embodiments, the probe or primer specifically hybridizes to any of the nucleic acid molecules disclosed herein under stringent conditions.

[0283] In some embodiments, the primers can be used in second generation or high throughput sequencing, including mutation specific primers. Sometimes the primers can be modified, including mutation specific primers. In particular, the primers can include various modifications used in various steps of, for example, Massive Parallel Signature Sequencing (MPSS), Polony sequencing, and 454 pyrosequencing. Modified primers can be used in several steps of the process, including biotinylated primers in the cloning step, and fluorescently labeled primers used in the bead loading and detection steps. Polony sequencing is typically performed using paired-end tag libraries, where each molecule of DNA template is about 135 bp in length. Biotinylated primers are used in the bead loading and emulsion PCR steps. Fluorescently labeled degenerate nonamer oligonucleotides are used in the detection step. The adapters can contain a 5'-biotin tag for immobilizing the DNA library on streptavidin-coated beads.

[0284] The probes and primers described herein can be used to detect nucleotide variations within any of the ANGPTL7 mutant genomic nucleic acid molecules, ANGPTL7 mutant mRNA molecules, and / or ANGPTL7 mutant cDNA molecules disclosed herein. The primers described herein can be used to amplify ANGPTL7 mutant genomic nucleic acid molecules, ANGPTL7 mutant mRNA molecules, or ANGPTL7 mutant cDNA molecules, or fragments thereof.

[0285] The present disclosure also provides a pair of primers comprising any of the primers described above.For example, if one of the 3' ends of the primer hybridizes with cytosine (rather than thymine) at the position corresponding to position 4,291 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO:1, the presence of the amplified fragment indicates the presence of an ANGPTL7 reference genomic nucleic acid molecule.On the contrary, if one of the 3' ends of the primer hybridizes with thymine (rather than cytosine) at the position corresponding to position 4,291 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO:2, the presence of the amplified fragment indicates the presence of an ANGPTL7 variant genomic nucleic acid molecule.In some embodiments, the nucleotide of the primer that is complementary to thymine at the position corresponding to position 4,291 in SEQ ID NO:2 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to cytosine (rather than uracil) at a position corresponding to position 529 of SEQ ID NO: 7 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type mRNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to uracil (rather than cytosine) at a position corresponding to position 529 of SEQ ID NO: 8 in a particular ANGPTL7 mRNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant mRNA molecule. In some embodiments, the nucleotide of the primer that is complementary to uracil at a position corresponding to position 529 of SEQ ID NO: 8 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to cytosine (rather than thymine) at a position corresponding to position 529 of SEQ ID NO: 13 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type cDNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to a thymine (rather than a cytosine) at a position corresponding to position 529 of SEQ ID NO:14 in a particular ANGPTL7 cDNA molecule, the presence of an amplified fragment will indicate the presence of an ANGPTL7 mutant cDNA molecule.In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 529 according to SEQ ID NO: 14 can be present at the 3' end of the primer.

[0286] The present disclosure also provides a pair of primers comprising any of the primers described above. For example, if one of the 3' ends of the primer hybridizes to guanine (rather than thymine) at the position corresponding to position 4,287 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO: 1, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type genomic nucleic acid molecule. Conversely, if one of the 3' ends of the primer hybridizes to thymine (rather than guanine) at the position corresponding to position 4,287 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO: 3, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant genomic nucleic acid molecule. In some embodiments, the nucleotide of the primer that is complementary to the thymine at the position corresponding to position 4,287 in SEQ ID NO: 3 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to guanine (rather than uracil) at the position corresponding to position 525 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO: 7, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type mRNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to uracil (rather than guanine) at a position corresponding to position 525 of SEQ ID NO: 9 in a particular ANGPTL7 mRNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant mRNA molecule. In some embodiments, the nucleotide of the primer that is complementary to uracil at a position corresponding to position 525 of SEQ ID NO: 9 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to guanine (rather than thymine) at a position corresponding to position 525 of SEQ ID NO: 13 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type cDNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to thymine (rather than guanine) at a position corresponding to position 525 of SEQ ID NO: 15 in a particular ANGPTL7 cDNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant cDNA molecule.In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 525 according to SEQ ID NO: 15 can be present at the 3' end of the primer.

[0287] The present disclosure also provides a pair of primers comprising any of the primers described above.For example, if one of the 3' ends of the primer hybridizes with thymine (rather than adenine) at the position corresponding to position 4,243 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO:1, the presence of the amplified fragment indicates the presence of an ANGPTL7 reference genomic nucleic acid molecule.On the other hand, if one of the 3' ends of the primer hybridizes with adenine (rather than thymine) at the position corresponding to position 4,243 in a particular ANGPTL7 nucleic acid molecule according to SEQ ID NO:4, the presence of the amplified fragment indicates the presence of an ANGPTL7 variant genomic nucleic acid molecule.In some embodiments, the nucleotide of the primer that is complementary to adenine at the position corresponding to position 4,243 in SEQ ID NO:3 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to uracil (rather than adenine) at a position corresponding to position 481 of SEQ ID NO: 7 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type mRNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to adenine (rather than uracil) at a position corresponding to position 481 of SEQ ID NO: 10 in a particular ANGPTL7 mRNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant mRNA molecule. In some embodiments, the nucleotide of the primer that is complementary to adenine at a position corresponding to position 481 of SEQ ID NO: 10 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to thymine (rather than adenine) at a position corresponding to position 481 of SEQ ID NO: 13 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type cDNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to an adenine (rather than a thymine) at a position corresponding to position 481 in a particular ANGPTL7 cDNA molecule according to SEQ ID NO:16, the presence of an amplified fragment will indicate the presence of an ANGPTL7 mutant cDNA molecule.In some embodiments, the nucleotide of the primer complementary to the adenine at a position corresponding to position 481 according to SEQ ID NO: 16 can be present at the 3' end of the primer.

[0288] The present disclosure also provides a pair of primers comprising any of the above-mentioned primers.For example, if one of the 3' ends of the primer hybridizes with guanine (rather than adenine) at the position corresponding to position 4,325 according to SEQ ID NO:1 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type genomic nucleic acid molecule.On the other hand, if one of the 3' ends of the primer hybridizes with adenine (rather than guanine) at the position corresponding to position 4,325 according to SEQ ID NO:5 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant genomic nucleic acid molecule.In some embodiments, the nucleotide of the primer that is complementary to the adenine at the position corresponding to position 4,325 according to SEQ ID NO:5 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to guanine (rather than adenine) at a position corresponding to position 563 of SEQ ID NO: 7 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type mRNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to adenine (rather than guanine) at a position corresponding to position 563 of SEQ ID NO: 11 in a particular ANGPTL7 mRNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant mRNA molecule. In some embodiments, the nucleotide of the primer that is complementary to adenine at a position corresponding to position 563 of SEQ ID NO: 11 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to guanine (rather than adenine) at a position corresponding to position 563 of SEQ ID NO: 13 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type cDNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to an adenine (rather than a guanine) at a position corresponding to position 563 of SEQ ID NO:17 in a particular ANGPTL7 cDNA molecule, the presence of an amplified fragment will indicate the presence of an ANGPTL7 mutant cDNA molecule.In some embodiments, the nucleotide of the primer complementary to the adenine at a position corresponding to position 563 according to SEQ ID NO: 17 can be present at the 3' end of the primer.

[0289] The present disclosure also provides a pair of primers comprising any of the above-mentioned primers.For example, if one of the 3' ends of the primer hybridizes with adenine (rather than cytosine) at the position corresponding to 4,336th position according to SEQ ID NO:1 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type genomic nucleic acid molecule.On the contrary, if one of the 3' ends of the primer hybridizes with cytosine (rather than adenine) at the position corresponding to 4,336th position according to SEQ ID NO:6 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant genomic nucleic acid molecule.In some embodiments, the nucleotide of the primer that is complementary to cytosine at the position corresponding to 4,336th position according to SEQ ID NO:6 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to adenine (rather than cytosine) at a position corresponding to position 574 of SEQ ID NO: 7 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type mRNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to cytosine (rather than adenine) at a position corresponding to position 574 of SEQ ID NO: 12 in a particular ANGPTL7 mRNA molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 variant mRNA molecule. In some embodiments, the nucleotide of the primer that is complementary to the cytosine at a position corresponding to position 574 of SEQ ID NO: 12 can be present at the 3' end of the primer. In addition, if one of the 3' ends of the primer hybridizes to adenine (rather than cytosine) at a position corresponding to position 574 of SEQ ID NO: 13 in a particular ANGPTL7 nucleic acid molecule, the presence of the amplified fragment will indicate the presence of an ANGPTL7 reference-type cDNA molecule. Conversely, if one of the 3' ends of the primer hybridizes to a cytosine (rather than an adenine) at a position corresponding to position 574 of SEQ ID NO:18 in a particular ANGPTL7 cDNA molecule, the presence of an amplified fragment will indicate the presence of an ANGPTL7 mutant cDNA molecule.In some embodiments, the nucleotide of the primer complementary to the cytosine at a position corresponding to position 574 according to SEQ ID NO: 18 can be present at the 3' end of the primer.

[0290] In the context of this disclosure, "specifically hybridizes" means that a probe or primer (e.g., a mutation-specific probe or a mutation-specific primer) does not hybridize to a nucleic acid sequence encoding an ANGPTL7 reference-type genomic nucleic acid molecule, an ANGPTL7 reference-type mRNA molecule, and / or an ANGPTL7 reference-type cDNA molecule.

[0291] In some embodiments, the probe (e.g., the mutation-specific probe) comprises a label. In some embodiments, the label is a fluorescent label, a radioactive label, or biotin. The present disclosure also provides a support comprising a substrate to which any one or more of the probes disclosed herein are attached. A solid support is a solid-state substrate or support to which a molecule such as any of the probes disclosed herein can associate. A form of solid support is an array. Another form of solid support is an array detector. An array detector is a solid support to which a plurality of different probes are attached in an array, grid, or other organized pattern. A form of solid-state substrate is a microtiter dish such as a standard 96-well format. In some embodiments, a multi-well glass slide can be used, usually containing one array per well.

[0292] The nucleotide sequence of the ANGPTL7 reference genomic nucleic acid molecule is set forth in SEQ ID NO:1. With reference to SEQ ID NO:1, position 4,291 is a cytosine. With reference to SEQ ID NO:1, position 4,287 is a guanine. With reference to SEQ ID NO:1, position 4,243 is a thymine. With reference to SEQ ID NO:1, position 4,325 is a guanine. With reference to SEQ ID NO:1, position 4,336 is an adenine.

[0293] There is a mutant genomic nucleic acid molecule of ANGPTL7 in which the cytosine at position 4,291 is replaced with a thymine, the nucleotide sequence of which is set forth in SEQ ID NO:2.

[0294] There is another mutant genomic nucleic acid molecule of ANGPTL7 in which the guanine at position 4,287 is replaced with a thymine. The nucleotide sequence of this mutant genomic nucleic acid molecule of ANGPTL7 is set forth in SEQ ID NO:3.

[0295] There is another mutant genomic nucleic acid molecule of ANGPTL7 in which the thymine at position 4,243 is replaced with an adenine. The nucleotide sequence of this mutant genomic nucleic acid molecule of ANGPTL7 is set forth in SEQ ID NO:4.

[0296] There is another mutant genomic nucleic acid molecule of ANGPTL7 in which the guanine at position 4,325 is replaced with an adenine, the nucleotide sequence of which is set forth in SEQ ID NO:5.

[0297] There is another mutant genomic nucleic acid molecule of ANGPTL7 in which the adenine at position 4,336 is replaced with a cytosine. The nucleotide sequence of this mutant genomic nucleic acid molecule of ANGPTL7 is set forth in SEQ ID NO:6.

[0298] The nucleotide sequence of the ANGPTL7 reference-type mRNA molecule is set forth in SEQ ID NO:7. With reference to SEQ ID NO:7, position 529 is a cytosine. With reference to SEQ ID NO:7, position 525 is a guanine. With reference to SEQ ID NO:7, position 481 is a uracil. With reference to SEQ ID NO:7, position 563 is a guanine. With reference to SEQ ID NO:7, position 574 is an adenine.

[0299] There is a mutant mRNA molecule of ANGPTL7 in which the cytosine at position 529 is replaced with uracil, the nucleotide sequence of which is set forth in SEQ ID NO:8.

[0300] There is another mutant mRNA molecule of ANGPTL7 in which guanine at position 525 is replaced by uracil. The nucleotide sequence of this mutant mRNA molecule of ANGPTL7 is set forth in SEQ ID NO:9.

[0301] There is another mutant mRNA molecule of ANGPTL7 in which uracil at position 481 is replaced with adenine. The nucleotide sequence of this mutant mRNA molecule of ANGPTL7 is set forth in SEQ ID NO:10.

[0302] There is another mutant mRNA molecule of ANGPTL7 in which the guanine at position 563 is replaced by an adenine. The nucleotide sequence of this mutant mRNA molecule of ANGPTL7 is set forth in SEQ ID NO:11.

[0303] There is another mutant mRNA molecule of ANGPTL7 in which the adenine at position 574 is replaced with a cytosine. The nucleotide sequence of this mutant mRNA molecule of ANGPTL7 is set forth in SEQ ID NO:12.

[0304] The nucleotide sequence of the ANGPTL7 reference type cDNA molecule is set forth in SEQ ID NO: 13. With reference to SEQ ID NO: 13, position 529 is a cytosine. With reference to SEQ ID NO: 13, position 525 is a guanine. With reference to SEQ ID NO: 13, position 481 is a thymine. With reference to SEQ ID NO: 13, position 563 is a guanine. With reference to SEQ ID NO: 13, position 574 is an adenine. With reference to SEQ ID NO: 13, position 574 is an adenine.

[0305] There is a mutant cDNA molecule of ANGPTL7 in which the cytosine at position 529 is replaced with a thymine, the nucleotide sequence of which is set forth in SEQ ID NO:14.

[0306] There is another mutant cDNA molecule of ANGPTL7 in which the guanine at position 525 is replaced by a thymine. The nucleotide sequence of this mutant cDNA molecule of ANGPTL7 is set forth in SEQ ID NO:15.

[0307] There is another mutant cDNA molecule of ANGPTL7 in which the thymine at position 481 is replaced with an adenine. The nucleotide sequence of this mutant cDNA molecule of ANGPTL7 is set forth in SEQ ID NO:16.

[0308] There is another mutant cDNA molecule of ANGPTL7 in which the guanine at position 563 is replaced by an adenine. The nucleotide sequence of this mutant cDNA molecule of ANGPTL7 is set forth in SEQ ID NO:17.

[0309] There is another mutant cDNA molecule of ANGPTL7 in which the adenine at position 574 is replaced with a cytosine. The nucleotide sequence of this mutant cDNA molecule of ANGPTL7 is set forth in SEQ ID NO:18.

[0310] The genomic nucleic acid molecule, mRNA molecule, and cDNA molecule can be derived from any organism. For example, the genomic nucleic acid molecule, mRNA molecule, and cDNA molecule can be an ortholog from another organism, such as human or non-human mammal, rodent, mouse, or rat. It is understood that gene sequences within a population can differ due to polymorphisms, such as single nucleotide polymorphisms. The examples provided herein are merely exemplary sequences. Other sequences are possible.

[0311] Also provided herein are functional polynucleotides that can interact with the disclosed nucleic acid molecules. Examples of functional polynucleotides include, but are not limited to, antisense molecules, aptamers, ribozymes, triplex-forming molecules, and external guide sequences. Functional polynucleotides can act as effectors, inhibitors, modulators, and stimulators of the specific activity of target molecules, or functional polynucleotides can have de novo activity independent of any other molecules.

[0312] The isolated nucleic acid molecules disclosed herein can include RNA, DNA, or both RNA and DNA. The isolated nucleic acid molecules can also be linked or fused to heterologous nucleic acid sequences, for example in a vector, or heterologous labels. For example, the isolated nucleic acid molecules disclosed herein can be present as exogenous donor sequences in or containing a vector that includes the isolated nucleic acid molecule and a heterologous nucleic acid sequence. The isolated nucleic acid molecules can also be linked or fused to heterologous labels. The labels can be directly detectable (e.g., fluorophores, etc.) or indirectly detectable (e.g., haptens, enzymes, or fluorophore quenchers, etc.). Such labels can be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Such labels include, for example, radioisotope labels, dyes, dyes, chromogens, spin labels, and fluorescent labels. The labels can also be, for example, chemiluminescent substances; metal-containing substances; or enzymes, resulting in enzyme-dependent secondary generation of a signal. The term "label" may refer to a "tag" or hapten that can selectively bind to a conjugated molecule that is subsequently added with a substrate and used to generate a detectable signal. For example, biotin can be used as a tag with an avidin or streptavidin conjugate of horseradish peroxidase (HRP) to bind to the tag and can be probed using a colorimetric substrate (such as tetramethylbenzidine (TMB)) or a fluorogenic substrate to detect the presence of HRP. Exemplary labels that can be used as tags to facilitate purification include, but are not limited to, myc, HA, FLAG or 3XFLAG, 6XHis or polyhistidine, glutathione-S-transferase (GST), maltose binding protein, epitope tags, or the Fc portion of an immunoglobulin. Numerous labels include, for example, particles, fluorophores, haptens, enzymes and their colorimetric, fluorogenic, and chemiluminescent substrates, as well as other labels.

[0313] The disclosed nucleic acid molecules can include, for example, nucleotides, or non-natural or modified nucleotides, such as, for example, nucleotide analogs or nucleotide substitutes. Such nucleotides include nucleotides that contain modified bases, sugars, or phosphate groups, or nucleotides that incorporate non-natural moieties into their structure. Examples of non-natural nucleotides include, but are not limited to, dideoxynucleotides, biotinylated nucleotides, aminated nucleotides, deaminated nucleotides, alkylated nucleotides, benzylated nucleotides, and fluorophore-labeled nucleotides.

[0314] The nucleic acid molecules disclosed herein can also include one or more nucleotide analogs or nucleotide substitutes. A nucleotide analog is a nucleotide that contains a modification to either the base moiety, sugar moiety, or phosphate moiety. Modifications to the base moiety include, but are not limited to, natural and synthetic modifications of A, C, G, and T / U, and different purine or pyrimidine bases, such as pseudouridine, uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. Modified bases include 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and 5-halocytosine, 5-propynyluracil and 5-propynylcytosine, 6-azouracil, 6-azocytosine and 6-azothymine. Examples of uracils and cytosines include, but are not limited to, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0315] Nucleotide analogs can also include modifications to the sugar moiety, including, but not limited to, natural and synthetic modifications of ribose and deoxyribose. Sugar modifications include the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C aryl groups. 1-10 Alkyl or C 2-10 Alkenyl, and C 2-10Exemplary 2' sugar modifications include, but are not limited to, -O[(CH2) n O] m CH3, -O(CH2) n OCH3, -O(CH2) n NH2, -O(CH2) n CH3, -O(CH2) n -ONH2 and -O(CH2) n ON [(CH2) n Other modifications at the 2' position include, but are not limited to, C 1-10 These include, but are not limited to, alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides, and the 5' position of the 5' terminal nucleotide. Modified sugars can also include those containing modifications at the bridging ring oxygen (such as CH2 and S). Nucleotide sugar analogs can also have sugar mimetics (such as cyclobutyl moieties) in place of the pentofuranosyl sugar.

[0316] Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include, but are not limited to, moieties that can be modified to include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates (including 3'-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3'-amino phosphoramidates and aminoalkyl phosphoramidates), thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates at the linkage between two nucleotides. These phosphate linkages or modified phosphate linkages between two nucleotides can be via 3'-5' linkages or 2'-5' linkages, and the linkages can contain reverse polarity (such as 3'-5' to 5'-3' or 2'-5' to 5'-2'). Various salts, mixed salts, and free acid forms are also included. Nucleotide alternatives also include peptide nucleic acids (PNAs).

[0317] The present disclosure also provides a vector comprising any one or more of the nucleic acid molecules disclosed herein. In some embodiments, the vector comprises any one or more of the nucleic acid molecules disclosed herein and a heterologous nucleic acid. The vector can be a viral vector or a non-viral vector capable of transporting the nucleic acid molecule. In some embodiments, the vector is a plasmid or a cosmid (such as a circular double-stranded DNA to which additional DNA segments can be ligated). In some embodiments, the vector is a viral vector to which additional DNA segments can be ligated into the viral genome. Expression vectors include, but are not limited to, plasmids, cosmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses (such as cauliflower mosaic virus and tobacco mosaic virus), yeast artificial chromosomes (YACs), Epstein-Barr (EBV) derived episomes, and other expression vectors known in the art.

[0318] Desirable regulatory sequences for mammalian host cell expression may include, for example, viral elements directing high levels of polypeptide expression in mammalian cells, such as retroviral LTRs, cytomegalovirus (CMV) (e.g., CMV promoter / enhancer), Simian Virus 40 (SV40) (e.g., SV40 promoter / enhancer), adenovirus (e.g., adenovirus major late promoter (AdMLP)), polyoma derived promoters and / or enhancers, as well as strong mammalian promoters (e.g., native immunoglobulin promoters and actin promoters). Methods for expressing polypeptides in bacterial or fungal cells (e.g., yeast cells) are also well known. The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter).

[0319] The percent identity (or percent complementarity) between particular stretches of nucleotide sequences in a nucleic acid molecule or amino acid sequences in a polypeptide can be routinely determined using the BLAST program (Basic Local Alignment Search Tool) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), or by using the Gap program (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using default settings that employ the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482-489). As used herein, when percent sequence identity is referred to, a higher percentage of sequence identity is preferred over a lower one.

[0320] The present disclosure also provides compositions comprising any one or more of the isolated nucleic acid molecules, genomic nucleic acid molecules, mRNA molecules, and / or cDNA molecules disclosed herein. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a carrier and / or excipient. Examples of carriers include, but are not limited to, poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules. The carrier may comprise a buffered salt solution such as PBS, HBSS, and the like.

[0321] As used herein, the phrase "corresponding to" or grammatical variations thereof, when used in the context of numbering a particular nucleotide or sequence of nucleotides or position, refers to the numbering of the designated reference sequence when the particular nucleotide or sequence of nucleotides is compared to a given reference sequence (e.g., SEQ ID NO:1, SEQ ID NO:7, or SEQ ID NO:13). In other words, the residue (e.g., nucleotide or amino acid) number or residue (e.g., nucleotide or amino acid) position of a particular polymer is designated with reference to the reference sequence, not by the actual position number of the residue within the particular nucleotide or nucleotide sequence. For example, a particular nucleotide sequence can be aligned to a reference sequence by introducing gaps to optimize residue matching between the two sequences. In these cases, although gaps exist, the numbering of the residues in the particular nucleotide or nucleotide sequence is done with reference to the reference sequence to which it is aligned.

[0322] For example, a nucleic acid molecule comprising a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence comprises a thymine at a position corresponding to position 4,291 according to SEQ ID NO:2, means that when the nucleotide sequence of the ANGPTL7 genomic nucleic acid molecule is aligned against the sequence of SEQ ID NO:2, the sequence of ANGPTL7 has a thymine residue at a position corresponding to position 4,291 of SEQ ID NO:2. The same applies to an mRNA molecule comprising a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence comprises a uracil at a position corresponding to position 529 according to SEQ ID NO:8, and to a cDNA molecule comprising a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence comprises a thymine at a position corresponding to position 529 according to SEQ ID NO:14. In other words, these phrases refer to a nucleic acid molecule encoding an ANGPTL7 polypeptide, where a genomic nucleic acid molecule has a nucleotide sequence that includes a thymine residue that is homologous to the thymine residue at position 4,291 of SEQ ID NO:2 (or an mRNA molecule has a nucleotide sequence that includes a uracil residue that is homologous to the uracil residue at position 529 of SEQ ID NO:8, or a cDNA molecule has a nucleotide sequence that includes a thymine residue that is homologous to the thymine residue at position 529 of SEQ ID NO:14). As used herein, a polypeptide produced from such a nucleic acid molecule is referred to herein as "Arg177STOP."

[0323] As described herein, the position in the ANGPTL7 genomic nucleic acid molecule corresponding to position 4,291 in SEQ ID NO:2 can be identified, for example, by performing sequence comparison between the nucleotide sequence of a particular ANGPTL7 nucleic acid molecule and the nucleotide sequence of SEQ ID NO:2. For example, there are various computer algorithms that can be used to perform sequence comparison to identify the position of the nucleotide corresponding to position 4,291 in SEQ ID NO:2. For example, sequence comparison can be performed by using the NCBI BLAST algorithm (Altschul et al., Nucleic Acids Res., 1997, 25, 3389-3402) or CLUSTALW software (Sievers and Higgins, Methods Mol. Biol., 2014, 1079, 105-116). However, sequences can also be aligned manually.

[0324] The amino acid sequence of the reference polypeptide is set forth in SEQ ID NO: 19. With reference to SEQ ID NO: 19, the ANGPTL7 reference polypeptide is 346 amino acids long. With reference to SEQ ID NO: 19, position 175 is glutamine. With reference to SEQ ID NO: 19, position 177 is arginine. With reference to SEQ ID NO: 19, position 161 is phenylalanine. With reference to SEQ ID NO: 19, position 188 is tryptophan. With reference to SEQ ID NO: 19, position 192 is lysine.

[0325] There exists a mutant polypeptide of ANGPTL7 (Arg177STOP), the amino acid sequence of which is set forth in SEQ ID NO: 20. With reference to SEQ ID NO: 20, the ANGPTL7 mutant polypeptide ends at position 176. Thus, this mutant is 176 amino acids long. With reference to SEQ ID NO: 20, the ANGPTL7 mutant polypeptide does not contain the amino acids at positions corresponding to positions 177-346 of SEQ ID NO: 19.

[0326] There is another mutant polypeptide of ANGPTL7 (Gln175His), the amino acid sequence of which is set forth in SEQ ID NO: 21. With reference to SEQ ID NO: 21, the ANGPTL7 mutant polypeptide is 346 amino acids in length. With reference to SEQ ID NO: 21, position 175 is a histidine.

[0327] There is another mutant polypeptide of ANGPTL7 (Phe161Ile), the amino acid sequence of which is set forth in SEQ ID NO: 22. With reference to SEQ ID NO: 22, the ANGPTL7 mutant polypeptide is 346 amino acids in length. With reference to SEQ ID NO: 22, position 161 is an isoleucine.

[0328] There exists a mutant polypeptide of ANGPTL7 (Trp188STOP), the amino acid sequence of which is set forth in SEQ ID NO: 23. With reference to SEQ ID NO: 23, the ANGPTL7 mutant polypeptide ends at position 187. Thus, this mutant is 187 amino acids long. With reference to SEQ ID NO: 23, the ANGPTL7 mutant polypeptide does not contain the amino acids at positions corresponding to positions 188-346 of SEQ ID NO: 19.

[0329] There is another mutant polypeptide of ANGPTL7 (Lys192Gln), the amino acid sequence of which is set forth in SEQ ID NO: 24. With reference to SEQ ID NO: 24, the ANGPTL7 mutant polypeptide is 346 amino acids long. With reference to SEQ ID NO: 24, position 192 is glutamine.

[0330] The present disclosure also provides a combination of a glucocorticoid and an ANGPTL7 inhibitor for use in treating inflammation. The present disclosure also provides a combination of a glucocorticoid and an ANGPTL7 inhibitor for use in preparing a medicament for treating inflammation. In any of the embodiments described herein, the subject is identified as having any of the ANGPTL7 variant nucleic acid molecules and / or polypeptides described herein. The glucocorticoid can be any of the glucocorticoids described herein. The ANGPTL7 inhibitor can be any of the ANGPTL7 inhibitors described herein. The combination of a glucocorticoid and an ANGPTL7 inhibitor can be used to treat or prevent glucocorticoid-induced eye conditions in a subject undergoing or to undergo glucocorticoid treatment for inflammation, etc.

[0331] The present disclosure also provides an ANGPTL7 inhibitor for use in reducing or preventing glucocorticoid-induced ocular pathology in a subject undergoing glucocorticoid therapy. The present disclosure also provides an ANGPTL7 inhibitor for use in the preparation of a medicament for reducing or preventing glucocorticoid-induced ocular pathology in a subject undergoing glucocorticoid therapy. In any of the embodiments described herein, the subject is identified as having any of the ANGPTL7 variant nucleic acid molecules and / or polypeptides described herein. The glucocorticoid therapy can be treatment with any of the glucocorticoids described herein. The ANGPTL7 inhibitor can be any of the ANGPTL7 inhibitors described herein. The glucocorticoid-induced ocular pathology can be any of the glucocorticoid-induced ocular pathology described herein.

[0332] In any of the embodiments described herein, a subject is identified as having a genomic nucleic acid molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence has a thymine at a position corresponding to position 4,291 in SEQ ID NO:2, or its complement; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3, or its complement; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4, or its complement; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5, or its complement; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6, or its complement. In any of the embodiments described herein, the subject is identified as having an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, wherein the nucleotide sequence has a uracil at a position corresponding to position 529 in SEQ ID NO:8, or its complement; a uracil at a position corresponding to position 525 in SEQ ID NO:9, or its complement; an adenine at a position corresponding to position 481 in SEQ ID NO:10, or its complement; an adenine at a position corresponding to position 563 in SEQ ID NO:11, or its complement; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12, or its complement. In any of the embodiments described herein, the subject is identified as having a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a thymine at a position corresponding to position 529 in accordance with SEQ ID NO: 14, or its complement; a thymine at a position corresponding to position 525 in accordance with SEQ ID NO: 15, or its complement; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO: 16, or its complement; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO: 17, or its complement; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO: 18, or its complement.

[0333] In some embodiments, the subject may have inflammation. In some embodiments, the inflammation can be acute inflammation or chronic inflammation. In some embodiments, the inflammation is acute inflammation. In some embodiments, the inflammation is chronic inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis, associated with Graves' disease, or is ocular inflammation. In some embodiments, the inflammation is associated with rheumatoid arthritis. In some embodiments, the inflammation is associated with Graves' disease. In some embodiments, the inflammation is ocular inflammation. In some embodiments, the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof. In some embodiments, the ocular inflammation is uveitis. In some embodiments, the ocular inflammation is juvenile idiopathic arthritis uveitis. In some embodiments, the ocular inflammation is scleritis. In some embodiments, the ocular inflammation is blepharitis. In some embodiments, the ocular inflammation is conjunctivitis. In some embodiments, the ocular inflammation is iritis. In some embodiments, the ocular inflammation is episcleritis.

[0334] In some embodiments, the glucocorticoid-induced ocular pathology is selected from ocular hypertension, increased intraocular pressure (IOP), pre-glaucoma, glaucoma, decreased corneal hysteresis, and posterior subcapsular cataract, or any combination thereof. In some embodiments, the glucocorticoid-induced ocular pathology is ocular hypertension. In some embodiments, the glucocorticoid-induced ocular pathology is increased IOP. In some embodiments, the glucocorticoid-induced ocular pathology is pre-glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is glaucoma. In some embodiments, the glucocorticoid-induced ocular pathology is decreased corneal hysteresis. In some embodiments, the glucocorticoid-induced ocular pathology is posterior subcapsular cataract.

[0335] In some embodiments, the glucocorticoid treatment is treatment with prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, DOCA, aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, or fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, fluocinolone acetonide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof. In some embodiments, the glucocorticoid treatment is treatment with prednisone. In some embodiments, the glucocorticoid treatment is treatment with prednisolone. In some embodiments, the glucocorticoid treatment is treatment with methylprednisolone. In some embodiments, the glucocorticoid treatment is treatment with dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with betamethasone. In some embodiments, the glucocorticoid treatment is treatment with triamcinolone. In some embodiments, the glucocorticoid treatment is treatment with beclomethasone. In some embodiments, the glucocorticoid treatment is treatment with fludrocortisone acetate. In some embodiments, the glucocorticoid treatment is treatment with DOCA. In some embodiments, the glucocorticoid treatment is treatment with aldosterone. In some embodiments, the glucocorticoid treatment is treatment with budesonide. In some embodiments, the glucocorticoid treatment is treatment with mometasone furoate. In some embodiments, the glucocorticoid treatment is treatment with fluticasone propionate. In some embodiments, the glucocorticoid treatment is treatment with hydrocortisone. In some embodiments, the glucocorticoid treatment is treatment with cortisone acetate.In some embodiments, the glucocorticoid treatment is treatment with fluticasone furoate. In some embodiments, the glucocorticoid treatment is treatment with ophthalmic difluprednate. In some embodiments, the glucocorticoid treatment is treatment with fluorometholone. In some embodiments, the glucocorticoid treatment is treatment with loteprednol etabonate. In some embodiments, the glucocorticoid treatment is treatment with medrysone. In some embodiments, the glucocorticoid treatment is treatment with lumexolone. In some embodiments, the glucocorticoid treatment is treatment with fluocinolone acetonide. In some embodiments, the glucocorticoid treatment is treatment with clobetasol. In some embodiments, the glucocorticoid treatment is treatment with halobetasol. In some embodiments, the glucocorticoid treatment is treatment with diflorasone. In some embodiments, the glucocorticoid treatment is treatment with fluocinonide. In some embodiments, the glucocorticoid treatment is treatment with flurandenolide. In some embodiments, the glucocorticoid treatment is treatment with neo-polydex. In some embodiments, the glucocorticoid treatment is treatment with tobramycin-dexamethasone. In some embodiments, the glucocorticoid treatment is treatment with difluprednate.

[0336] In some embodiments, the ANGPTL7 inhibitor comprises an inhibitory nucleic acid molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense nucleic acid molecule, an siRNA, or an shRNA that hybridizes with the ANGPTL7 nucleic acid molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense nucleic acid. In some embodiments, the inhibitory nucleic acid molecule comprises an siRNA. In some embodiments, the inhibitory nucleic acid molecule comprises an shRNA.

[0337] In some embodiments, the ANGPTL7 inhibitor comprises a Cas protein and a gRNA that hybridizes with a gRNA recognition sequence in an ANGPTL7 genomic nucleic acid molecule.In some embodiments, the Cas protein is Cas9 or Cpf1.In some embodiments, the gRNA recognition sequence comprises or is adjacent to the position corresponding to SEQ ID NO: 1, ... In some embodiments, the gRNA recognition sequence is located about 1000, about 500, about 400, about 300, about 200, about 100, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides from a position corresponding to position 4,291 in accordance with SEQ ID NO: 1, position 4,287 in accordance with SEQ ID NO: 1, position 4,243 in accordance with SEQ ID NO: 1, position 4,325 in accordance with SEQ ID NO: 1, or position 4,336 in accordance with SEQ ID NO: 1. In some embodiments, the PAM sequence is about 2 to about 6 nucleotides downstream of the gRNA recognition sequence. In some embodiments, the gRNA comprises about 17 nucleotides to about 23 nucleotides. In some embodiments, the gRNA recognition sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 165.

[0338] All patent documents, websites, other publications, accession numbers, etc. cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item was specifically and individually indicated to be so incorporated by reference. If various versions of a sequence are associated with accession numbers at various times, the version associated with the accession number at the effective filing date of this application is meant. Effective filing date means the earlier of the actual filing date or the filing date of the priority application that refers to the accession number, if applicable. Similarly, if different versions of publications, websites, etc. are published at different times, the version last published at the effective filing date of the application is meant unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the present disclosure can be used in combination with any other feature, step, element, embodiment, or aspect, unless otherwise indicated. Although the present disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be made within the scope of the appended claims.

[0339] The following examples are provided to describe the embodiments in more detail. They are intended to illustrate, not limit, the claimed embodiments. The following examples provide those skilled in the art with disclosure and description of how the compounds, compositions, articles, devices and / or methods described herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the scope of any claims. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some error and deviation can be accounted for. Unless otherwise indicated, parts are parts by weight, temperature is °C or is ambient temperature, and pressure is at or near atmospheric pressure. EXAMPLES

[0340] Example 1: ANGPTL7 KO mice inhibit DEX-Ac-induced ocular hypertension in mice Weekly periocular CF injections of DEX-Ac in both eyes of ANGPTL7 WT mice significantly increased IOP (see Figure 1). IOP measurements in DEX-Ac-treated (n=18) and vehicle-treated (n=6) mice show increased IOP from weeks 1 to 6; **p < 0.01, ***p < 0.001, ****p < 0.0001. In contrast, weekly periocular CF injections of DEX-Ac in both eyes of ANGPTL7 KO mice did not increase IOP (see Figure 1). IOP measurements in DEX-Ac-treated (n=20) and vehicle-treated (n=12) ANGPTL7 KO mice showed no effect on IOP increase from weeks 1 to 6.

[0341] Example 2: In vivo evaluation of ANGPTL7 siRNA in wild-type mice The ability of dsRNA to reduce ANGPTL7 RNA levels and / or reduce IOP in vivo in wild-type mice was investigated.

[0342] Six different siRNAs (siRNA#1-6, see below) targeting ANGPTL7 were tested in C57BL / 6J wild-type mice and IOP was monitored over time. C57BL / 6J mice were intravitreally injected with 15 μg of siRNA or PBS control, respectively. Naïve animals received no injections. After 6 weeks, animals were sacrificed, eyes were harvested, and limbal rings were carefully microdissected. qPCR was performed on limbal rings dissected from mouse eyes enriched against the trabecular meshwork (TM) for ANGPTL7 expression. Data are expressed as percentage message remaining relative to baseline values ​​and shown as mean ± standard error of the mean (SEM).

[0343] [Table 18]

[0344] The results of the in vivo evaluation are shown in Figures 2 and 3. As shown in Figure 2, IOP was significantly reduced 2 weeks after injection in mice treated with two of the six siRNAs (siRNA#3 and #5, n=6-8 / group) compared to PBS-treated (n=6) or naive (no injection, n=5) groups. Naive and PBS-treated animals maintained IOP at baseline for the duration of the study (weeks 0-6). In contrast, mice treated with siRNA#3 and #5 experienced a 2-4 mmHg reduction in IOP starting at week 2 and remained reduced until the end of the study (i.e., week 6) compared to PBS-treated or naive mice.

[0345] As shown in Figure 3, qPCR of limbal ring tissues taken at the end of the study (i.e., 6 weeks after siRNA administration) showed the highest level of knockdown (>50%) of ANGPTL7 mRNA in siRNA#3 and #5 compared to PBS-treated or naive mice. Such mRNA knockdown effect is consistent with the reduction in IOP observed in mice injected with one of these two siRNAs. The results suggest that inhibiting ANGPTL7 expression also reduces IOP, demonstrating the ability of exemplary dsRNA agents to reduce ANGPTL7 expression and also reduce IOP in vivo.

[0346] Example 3: In vivo knockdown of ANGPTL7 by siRNA in wild-type mice inhibits steroid-induced and other types of TM stress-associated IOP elevation in glaucoma The ability of dsRNA to reduce steroid-induced IOP in vivo in wild-type mice was further investigated. Weekly periocular CF injections of DEX-Ac suspension into both eyes maintained DEX-induced OHT and significantly elevated IOP in WT mice. Mice were divided into the following groups as shown in Figure 4: a) Vehicle (n=4), b) Vehicle+PBS (n=6), c) DEX-Ac (n=12), d) DEX-Ac+siRNA#3 (n=14), and e) DEX-Ac+siRNA#5 (n=14). Beginning 6 days after injection, IOP elevation was steeper and significantly higher in DEX-Ac-treated mice compared to vehicle-treated mice. Group c, DEX-Ac-treated mice, developed and sustained DEX-induced OHT and had significantly elevated IOP throughout the study. On day 22, siRNA targeting ANGPTL7 (#3 and #5) was intravitreally injected into groups d and e (DEX-Ac+siRNA#3 and DEX-Ac+siRNA#5) and IOP measurements were subsequently recorded. In groups d and e, IOP was significantly reduced compared to the DEX-Ac-treated group (c) and returned to baseline IOP within 1 week. IOP was maintained at baseline throughout the study, even though these mice continued to receive weekly DEX-Ac treatment.

[0347] In addition to those described herein, various modifications of the described subject matter will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in this application (including, but not limited to, journal articles, U.S. and non-U.S. patents, patent application publications, international patent application publications, gene bank accession numbers, etc.) is incorporated herein by reference in its entirety and for all purposes.

Claims

1. 1. A method for identifying a subject undergoing glucocorticoid treatment who is at increased risk for developing a glucocorticoid-induced eye condition, comprising: determining or having determined the presence or absence of a loss-of-function mutant nucleic acid molecule encoding a predicted angiopoietin-like 7 (ANGPTL7) polypeptide in a biological sample obtained from the subject; if the subject is of the ANGPTL7 reference type, the subject is at increased risk of developing the glucocorticoid-induced eye condition; The method, wherein the subject is not at increased risk of developing the glucocorticoid-induced eye condition if the subject is heterozygous or homozygous for a predicted loss-of-function variant in ANGPTL7.

2. 10. The method of claim 1, wherein the subject has rheumatoid arthritis, Graves' disease, or ocular inflammation.

3. 3. The method of claim 2, wherein the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof.

4. 4. The method of any one of claims 1 to 3, wherein the glucocorticoid treatment is treatment with prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, DOCA, aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, or fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, flurandenolide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof.

5. The method of any one of claims 1 to 4, wherein the predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 is a nucleic acid molecule encoding Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, Lys192Gln, Arg340His, Arg220His, Asn302Lys, or Arg220Cys.

6. The method according to any one of claims 1 to 4, wherein the predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 is a nucleic acid molecule encoding Arg177STOP, Gln175His, Phe161Ile, Trp188STOP, or Lys192Gln.

7. The predicted loss-of-function mutant nucleic acid molecule of ANGPTL7 is a genomic nucleic acid molecule having a nucleotide sequence including a thymine at a position corresponding to position 4,291 in SEQ ID NO:2; a thymine at a position corresponding to position 4,287 in SEQ ID NO:3; an adenine at a position corresponding to position 4,243 in SEQ ID NO:4; an adenine at a position corresponding to position 4,325 in SEQ ID NO:5; or a cytosine at a position corresponding to position 4,336 in SEQ ID NO:6; an mRNA molecule having a nucleotide sequence comprising: a uracil at a position corresponding to position 529 in SEQ ID NO:8; a uracil at a position corresponding to position 525 in SEQ ID NO:9; an adenine at a position corresponding to position 481 in SEQ ID NO:10; an adenine at a position corresponding to position 563 in SEQ ID NO:11; or a cytosine at a position corresponding to position 574 in SEQ ID NO:12; or a cDNA molecule produced from an mRNA molecule in the biological sample, the cDNA molecule having a nucleotide sequence comprising: a thymine at a position corresponding to position 529 in SEQ ID NO:14; a thymine at a position corresponding to position 525 in SEQ ID NO:15; an adenine at a position corresponding to position 481 in SEQ ID NO:16; an adenine at a position corresponding to position 563 in SEQ ID NO:17; or a cytosine at a position corresponding to position 574 in SEQ ID NO:

18. The method according to claim 6, wherein

8. a genomic nucleic acid molecule having a nucleotide sequence encoding an angiopoietin-like 7 (ANGPTL7) polypeptide, said nucleotide sequence having a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2, or a complement thereof; a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO:3, or a complement thereof; an adenine at a position corresponding to position 4,243 in accordance with SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 4,325 in accordance with SEQ ID NO:5, or a complement thereof; or a cytosine at a position corresponding to position 4,336 in accordance with SEQ ID NO:6, or a complement thereof; an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, said nucleotide sequence having a uracil at a position corresponding to position 529 in accordance with SEQ ID NO:8, or a complement thereof; a uracil at a position corresponding to position 525 in accordance with SEQ ID NO:9, or a complement thereof; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:10, or a complement thereof; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:11, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:12, or a complement thereof; or 1. A cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, the nucleotide sequence having a thymine at a position corresponding to position 529 in accordance with SEQ ID NO:14, or a complement thereof; a thymine at a position corresponding to position 525 in accordance with SEQ ID NO:15, or a complement thereof; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:16, or a complement thereof; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:17, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:18, or a complement thereof.

23. A pharmaceutical composition comprising a combination of a glucocorticoid and an ANGPTL7 inhibitor for use in treating inflammation in a subject identified as having:

9. 9. The pharmaceutical composition of claim 8, wherein the subject has rheumatoid arthritis, Graves' disease, or ocular inflammation.

10. 10. The pharmaceutical composition of claim 9, wherein the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof.

11. 11. The pharmaceutical composition of any one of claims 8 to 10, wherein the glucocorticoid is selected from prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, deoxycorticosterone acetate (DOCA), aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, and fluticasone furoate, or any combination thereof.

12. The pharmaceutical composition of any one of claims 8 to 11, wherein the ANGPTL7 inhibitor comprises an inhibitory nucleic acid molecule.

13. The pharmaceutical composition of claim 12 , wherein the inhibitory nucleic acid molecule comprises an antisense nucleic acid molecule, a small interfering RNA (siRNA), or a short hairpin RNA (shRNA) that hybridizes with an ANGPTL7 nucleic acid molecule.

14. The pharmaceutical composition of any one of claims 8 to 11, wherein the ANGPTL7 inhibitor comprises a Cas protein and a guide RNA (gRNA) that hybridizes to a gRNA recognition sequence in an ANGPTL7 genomic nucleic acid molecule.

15. 15. The pharmaceutical composition of claim 14, wherein the Cas protein is Cas9 or Cpf1.

16. 16. The pharmaceutical composition of claim 14 or 15, wherein the gRNA recognition sequence comprises or is adjacent to a position corresponding to position 4,291 in accordance with SEQ ID NO:1, position 4,287 in accordance with SEQ ID NO:1, position 4,243 in accordance with SEQ ID NO:1, position 4,325 in accordance with SEQ ID NO:1, or position 4,336 in accordance with SEQ ID NO:

1.

17. 16. The pharmaceutical composition of claim 14 or 15, wherein the gRNA recognition sequence is located about 1000, about 500, about 400, about 300, about 200, about 100, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides from a position corresponding to position 4,291 in accordance with SEQ ID NO:1, position 4,287 in accordance with SEQ ID NO:1, position 4,243 in accordance with SEQ ID NO:1, position 4,325 in accordance with SEQ ID NO:1, or position 4,336 in accordance with SEQ ID NO:

1.

18. The pharmaceutical composition of claim 14 or 15, wherein a protospacer adjacent motif (PAM) sequence is about 2 to about 6 nucleotides downstream of the gRNA recognition sequence.

19. The pharmaceutical composition of any one of claims 14 to 18, wherein the gRNA comprises from about 17 nucleotides to about 23 nucleotides.

20. The pharmaceutical composition according to any one of claims 14 to 18, wherein the gRNA recognition sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 165.

21. 1. A pharmaceutical composition for use in reducing or preventing glucocorticoid-induced ocular pathology in a subject receiving glucocorticoid therapy, comprising an angiopoietin-like 7 (ANGPTL7) inhibitor, The object is a) an ANGPTL7 reference type to an ANGPTL7 genomic nucleic acid molecule, an ANGPTL7 mRNA molecule, or an ANGPTL7 cDNA molecule; or b) i) a genomic nucleic acid molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, said nucleotide sequence having a thymine at a position corresponding to position 4,291 in accordance with SEQ ID NO:2, or a complement thereof; a thymine at a position corresponding to position 4,287 in accordance with SEQ ID NO:3, or a complement thereof; an adenine at a position corresponding to position 4,243 in accordance with SEQ ID NO:4, or a complement thereof; an adenine at a position corresponding to position 4,325 in accordance with SEQ ID NO:5, or a complement thereof; or a cytosine at a position corresponding to position 4,336 in accordance with SEQ ID NO:6, or a complement thereof; ii) an mRNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, said nucleotide sequence having a uracil at a position corresponding to position 529 in accordance with SEQ ID NO:8, or a complement thereof; a uracil at a position corresponding to position 525 in accordance with SEQ ID NO:9, or a complement thereof; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO:10, or a complement thereof; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO:11, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO:12, or a complement thereof; or iii) heterozygous to a cDNA molecule having a nucleotide sequence encoding an ANGPTL7 polypeptide, said nucleotide sequence having a thymine at a position corresponding to position 529 in accordance with SEQ ID NO: 14, or a complement thereof; a thymine at a position corresponding to position 525 in accordance with SEQ ID NO: 15, or a complement thereof; an adenine at a position corresponding to position 481 in accordance with SEQ ID NO: 16, or a complement thereof; an adenine at a position corresponding to position 563 in accordance with SEQ ID NO: 17, or a complement thereof; or a cytosine at a position corresponding to position 574 in accordance with SEQ ID NO: 18, or a complement thereof; 20. A pharmaceutical composition comprising:

22. 22. The pharmaceutical composition of claim 21, wherein the subject has inflammation, rheumatoid arthritis, Graves' disease, or ocular inflammation.

23. 23. The pharmaceutical composition of claim 22, wherein the ocular inflammation is selected from uveitis, juvenile idiopathic arthritis uveitis, scleritis, blepharitis, conjunctivitis, iritis, and episcleritis, or any combination thereof.

24. 24. The pharmaceutical composition of any one of claims 21 to 23, wherein the glucocorticoid treatment is treatment with prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, DOCA, aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, or fluticasone furoate, ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, flurandenolide, neo-poly-dex, tobramycin-dexamethasone, difluprednate, or any combination thereof.

25. The pharmaceutical composition of any one of claims 21 to 24, wherein the ANGPTL7 inhibitor comprises an inhibitory nucleic acid molecule.

26. 26. The pharmaceutical composition of claim 25, wherein the inhibitory nucleic acid molecule comprises an antisense nucleic acid molecule, a small interfering RNA (siRNA), or a short hairpin RNA (shRNA) that hybridizes with an ANGPTL7 nucleic acid molecule.

27. The pharmaceutical composition of any one of claims 21 to 24, wherein the ANGPTL7 inhibitor comprises a Cas protein and a guide RNA (gRNA) that hybridizes to a gRNA recognition sequence in an ANGPTL7 genomic nucleic acid molecule.

28. 28. The pharmaceutical composition of claim 27, wherein the Cas protein is Cas9 or Cpf1.

29. 29. The pharmaceutical composition of claim 27 or 28, wherein the gRNA recognition sequence comprises or is adjacent to a position corresponding to position 4,291 in accordance with SEQ ID NO:1, position 4,287 in accordance with SEQ ID NO:1, position 4,243 in accordance with SEQ ID NO:1, position 4,325 in accordance with SEQ ID NO:1, or position 4,336 in accordance with SEQ ID NO:

1.

30. 29. The pharmaceutical composition of claim 27 or 28, wherein the gRNA recognition sequence is located about 1000, about 500, about 400, about 300, about 200, about 100, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides from a position corresponding to position 4,291 in accordance with SEQ ID NO:1, position 4,287 in accordance with SEQ ID NO:1, position 4,243 in accordance with SEQ ID NO:1, position 4,325 in accordance with SEQ ID NO:1, or position 4,336 in accordance with SEQ ID NO:

1.

31. The pharmaceutical composition of claim 27 or 28, wherein a protospacer adjacent motif (PAM) sequence is about 2 to about 6 nucleotides downstream of the gRNA recognition sequence.

32. 32. The pharmaceutical composition of any one of claims 27 to 31, wherein the gRNA comprises from about 17 nucleotides to about 23 nucleotides.

33. The pharmaceutical composition according to any one of claims 27 to 31, wherein the gRNA recognition sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 165.

34. 1. A pharmaceutical composition for treating a subject having inflammation, comprising an angiopoietin-like 7 (ANGPTL7) inhibitor and a glucocorticoid, wherein the ANGPTL7 inhibitor is a double-stranded ribonucleic acid (dsRNA) inhibitory nucleic acid molecule for inhibiting expression of ANGPTL7, wherein the dsRNA inhibitory nucleic acid molecule comprises a sense strand and an antisense strand for forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides comprising 0, 1, 2, or 3 mismatches from one of the antisense sequences listed in Tables 4, 5, 6, 7, or 8, and wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides comprising 0, 1, 2, or 3 mismatches from a sense sequence listed in any one of Tables 4, 5, 6, 7, or 8 corresponding to the antisense sequence.

35. 35. The pharmaceutical composition of claim 34, wherein the sense strand comprises AGACAGUAUAAGCAAGGGUUA and the antisense strand comprises UAACCCUUGCUUAUACUGUCUCC, or the sense strand comprises ACACUUCCUUGUGUCUAUAGA and the antisense strand comprises UCUAUAGACACAAGGAAGUGUCG.

36. 36. The pharmaceutical composition of claim 34 or 35, wherein the glucocorticoid is selected from prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclomethasone, fludrocortisone acetate, deoxycorticosterone acetate (DOCA), aldosterone, budesonide, mometasone furoate, fluticasone propionate, hydrocortisone, cortisone acetate, and fluticasone furoate, or any combination thereof.

37. 36. The pharmaceutical composition of claim 34 or 35, wherein the glucocorticoid is selected from ophthalmic difluprednate, fluorometholone, loteprednol etabonate, medrysone, lumexolone, fluocinolone acetonide, clobetasol, halobetasol, diflorasone, fluocinonide, flurandenolide, neo-poly-dex, tobramycin-dexamethasone, and difluprednate, or any combination thereof.