Inducible mosaicism

Abstract

A system and method for generating multiple unique edits in a plant seed. In one example, the method includes introducing a nucleic acid encoding a DNA modifying enzyme, optionally encoding at least one guide RNA (gRNA), and an inducible system sequence into a plant cell or plant tissue, where the inducible system sequence is induced at a desired developmental stage of the plant and mediates expression of the DNA modifying enzyme in at least one of a flower bud initial cell and a flower bud reproductive organ, or translocates the DNA modifying enzyme to the nucleus, and (ii) mediates multiple edits in at least one of a flower bud initial cell and a flower bud reproductive organ. The method may also include regenerating the plant cell or plant tissue into a plant having multiple seeds containing the multiple unique edits.

Description

[Technical field]

[0001] The field of the present invention relates to plant biotechnology, specifically gene editing in plants. The field of the present invention further relates to an inducible gene editing system, which aims to obtain multiple edits in progeny by inducing the system at a desired stage of the plant's life cycle.

[0002] Sequence Listing This application is accompanied by a sequence listing entitled INDYMOS_ST25.txt, created on March 14, 2022, which is approximately 137 kilobytes in size. This sequence listing is incorporated herein by reference in its entirety. This sequence listing has been submitted herewith via EFS-Web and complies with 37 C.F.R. § 1.824(a)(2)-(6) and (b). [Background technology]

[0003] The development of scientific methods for improving the quantity and quality of crops is a major undertaking. For example, gene editing by targeted mutagenesis, insertion events, allele replacement, etc. is a very important technology that is widely used to improve both the quantity and quality of various crops. There are currently many methods for editing specific gene targets, including clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated sequence (Cas) enzymes, transcription activator-like effector nucleases (TALENs), meganucleases and zinc fingers. However, gene editing is not always an easy task.

[0004] Edits that turn off the function of a gene (commonly called "knockout") can be achieved relatively easily by genome editing. By using site-specific nucleases, such as Cas9 or Cas12a and associated CRISPR guide RNAs (gRNAs), small insertions or deletions ("indels") can be easily generated in the coding sequence of a target gene, which often results in a frameshift that truncates the protein or generates an aberrant sequence. In contrast to these well-known methods for knocking out genes, it can be very laborious to achieve other types of edits, such as edits that induce partial loss-of-function or gain-of-function alleles or edits that change the expression level of a gene or the function of the protein product. Many of these edits require allelic replacement, which is rather inefficient. Similarly, edits that remove entire exons or genes or chromosomal regions (large deletions) can be difficult to perform, as they may require simultaneous cleavage of two or more gRNA target sites. Similarly, edits to introduce SNPs - changing a cytosine nucleotide to a thymine nucleotide, for example, can use base editing techniques, but only within a specific window with respect to the target site. These are just a few examples where lack of perfect specificity or efficiency of the DNA modifying enzyme system used makes it difficult to obtain the desired editing results.

[0005] Regarding allelic replacement (sometimes called "allele swapping"), this is a method of editing that uses homologous recombination or homologous recombination repair to replace endogenous sequences in plant cells with new sequences that may be provided. While this is fairly easy to do in yeast and many animal systems, it is very difficult to do in plants because the non-homologous end joining pathway strongly favors DNA repair. Furthermore, this process requires the delivery of many donor DNAs to the break site to serve as templates for DNA repair by homologous recombination. This delivery is not easy to do, especially in plants. For this reason, allelic replacement in plants is typically very costly and labor intensive to achieve. For example, if one wishes to transform a plant and perform allelic replacement, one may need to generate 1000 stably transformed events to ensure that one allelic swap is generated in only one or two of the events. Efficiency is generally less than 1%, and in some cases 0-0.3%. Even with the best crop, line and construct designs, efficiency remains very low.

[0006] The applicant believes that the cost and labor intensity of producing allele replacements, large deletions, specific base editing and various other editing results are the main bottlenecks of plant breeding. Few methods have served to alleviate the extremely low efficiency of the process. Therefore, the present disclosure is directed to at least one of these or further problems.

[0007] Besides allele replacement, another major challenge of genome editing is the time and effort required to generate a wide diversity of sequences (allelic diversity of a locus). For example, generating diverse alleles for the coding sequence of a gene or generating expression diversity by modifying the regulatory region (promoter) of a gene can be quite time-consuming and costly. The present disclosure also relates in many embodiments to a cost-effective method for generating allelic series. These and other benefits will become apparent based on the detailed description below. Summary of the Invention [Means for solving the problem]

[0008] The object of the present invention is to address the problem of efficiently obtaining heritable edits in plants. To achieve the problem, one embodiment provides a method for generating multiple unique edits in progeny of a plant, comprising the steps of: (a) introducing an expression cassette into a plant cell or plant tissue, the expression cassette comprising (i.) a nucleic acid encoding a DNA modifying enzyme, (ii.) an optional nucleic acid encoding at least one guide RNA, and (iii.) an inducer operably linked to the nucleic acid encoding the DNA modifying enzyme; (b.) inducing the inducer at a desired plant development stage; and (c.) generating the plant cell or plant tissue into a plant having progeny, the progeny collectively comprising the multiple unique edits.

[0009] In one embodiment, the inducer is a transcription effector or a translocation effector, the inducer is induced by a chemical, the chemical is selected from an antibiotic, a metal, a steroid, a pesticide, a hormone, an alcohol, and an aldehyde, the antibiotic is tetracycline or a chemical mimic thereof, the metal is copper or a copper-containing compound, and the steroid is dexamethasone, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone, and any chemical mimic thereof. the glucocorticoid is dexamethasone, the insecticide is selected from the group consisting of tebufenozide, methoxyfenozide and any chemical mimics thereof, the hormone is selected from the group consisting of estrogen, oestrogen, 17-β-estradiol and any chemical mimics thereof, the alcohol is selected from the group consisting of ethanol and any chemical mimics thereof, and the aldehyde is selected from the group consisting of acetaldehyde and any chemical mimics thereof.

[0010] In another embodiment, the transcription effector is selected from the group consisting of an alcohol-dependent effector, a lactose-dependent effector, a galactose-dependent effector, and a lexA-dependent effector, and the alcohol-dependent effector is an alc effector. In one aspect, the alc effector is an Aspergillus nidulans alc effector comprising the alcA promoter.

[0011] In another embodiment, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding an alcR transcription factor activating gene, thereby forming an alcA / alcR inducible system. In one aspect, the method comprises applying alcohol at a desired plant developmental stage.

[0012] In another embodiment, the lactose-dependent effector is a pOp effector. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding an LhG4 transcription factor activating gene, thereby forming an LhG4 / pOp inducible system.

[0013] In another embodiment, the galactose-dependent regulon is a Gal4 UAS effector. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding a Gal4 transcription factor activating gene, thereby forming a GVG-inducible system or a VGE-inducible system.

[0014] In another embodiment, the lexA-dependent effector is at least one LexA operon. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding a LexA:VP16:ER activator, thereby forming an XVE-inducible system.

[0015] In one embodiment, the DNA modifying enzyme is selected from the group consisting of Meganuclease (MN), Zinc Finger Nuclease (ZFN), Transcription Activator-Like Effector Nuclease (TALEN), Chimeric FEN1-FokI, Mega-TAL and CRISPR nuclease. In one aspect, the CRISPR nuclease is a Cas nuclease, a Cas9 nuclease, a Cpf1 nuclease, a dCas9-FokI, a dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease, a Cas12a fused to a deaminase domain, a Cas12i nuclease, a Cas12j nuclease, a CasX nuclease, a CasY nuclease, a Cas13 nuclease, a Cas14 nuclease.

[0016] In another embodiment, the translocation factor is a glucocorticoid receptor. In one aspect, the glucocorticoid receptor comprises SEQ ID NO: 6. In another aspect, the glucocorticoid receptor is operably linked to a CRISPR nuclease. In another embodiment, the glucocorticoid receptor-linked CRISPR nuclease is a modified Cas12a nuclease ("GR-Cas12a") modified to include a glucocorticoid receptor binding domain. In one aspect, the GR-Cas12a comprises SEQ ID NO: 7. In another embodiment, the method further comprises that upon application of dexamethasone, GR-Cas12a translocates from the cytoplasm of the plant cell or plant tissue to the nucleus.

[0017] In another embodiment of the method, the unique edit is an indel mutation, a nucleotide substitution, an allelic substitution, a chromosomal translocation, or an insertion of a donor nucleic acid.

[0018] In another embodiment of the method, the plant cell or plant tissue is a dicotyledonous plant. In one aspect, the dicotyledonous plant cell or plant tissue is selected from the group consisting of Arabidopsis, sunflower, soybean, tomato, Brassica species, Populus (poplar), Eucalyptus, tobacco, Cannabis, potato, cotton, corn, rice, wheat, barley, sugarcane, Glycine tomentella, and other wild Glycine species.

[0019] In another embodiment of the method, the plant cell or plant tissue is a monocotyledonous plant. In one aspect, the monocotyledonous plant cell or plant tissue is selected from the group consisting of maize, wheat, rice, teosinte, sorghum, and barley. In another aspect, the monocotyledonous plant cell or plant tissue is maize.

[0020] In one embodiment, the plant cell or plant tissue is maize and the desired developmental stage is selected from the group consisting of VE, V1, V2, V(n), VT, R1, R2, R3, R4, R5 and R6 stages, where (n) is an integer representing the number of leaf collars present.

[0021] In another embodiment, the plant cell or plant tissue is soybean and the desired developmental stage is selected from the group consisting of VE, VC, V1, V2, V(n), R1, R2, R3, R4, R5, R6, R7 and R8 stages, where (n) is an integer representing the number of trifoils present.

[0022] In another embodiment, the method further comprises (d.) growing the progeny that collectively comprise the plurality of unique edits into seedlings, plantlets, immature plants, mature plants, or senescent plants; (e.) measuring at least one phenotype in the seedlings, plantlets, immature plants, mature plants, or senescent plants of step a.; and (f.) optionally, selecting the seedlings, plantlets, immature plants, mature plants, or senescent plants based on the measurement of the at least one phenotype.

[0023] In yet another embodiment, the method further comprises (d.) growing the progeny that collectively comprise the plurality of unique edits into seedlings, plantlets, immature plants, mature plants, or senescent plants; (e.) genotyping the seedlings, plantlets, immature plants, mature plants, or senescent plants of step a.; and (f.) optionally, selecting the seedlings, plantlets, immature plants, mature plants, or senescent plants based on the genotype of step b.

[0024] Another embodiment of the present invention is an edited plant produced by the methods described above.

[0025] Another embodiment of the present invention is an inducible gene editing system comprising an expression cassette comprising (a.) a nucleic acid encoding a DNA modifying enzyme, (b.) an optional nucleic acid encoding at least one guide RNA, and (c.) an inducer operably linked to the nucleic acid encoding the DNA modifying enzyme. In one embodiment, the system further comprises a cell harboring the expression cassette. In one aspect, the cell is a eukaryotic cell. In another aspect, the eukaryotic cell is a plant cell.

[0026] Brief description of the sequences in the sequence listing SEQ ID NO:1 is vector 24902. It contains the nucleotide sequence of the constitutively expressed GVG protein. See also FIG.

[0027] SEQ ID NO:2 is vector 25657. It contains the nucleotide sequence of Inecodon-optimized GR-LbCas12, which lacks a nuclear localization signal ("NLS") and has a glucocorticoid receptor ("GR") binding domain at the N-terminus separated by a long linker. The resulting chimeric GR-Cas12 is constitutively expressed but localized to the cytoplasm. In the presence of DEX, GR-Cas12a translocates to the nucleus. See also Figure 3.

[0028] SEQ ID NO:3 is vector 25765. It contains the nucleotide sequence of the AlcA / AlcR ethanol-dependent inducible system. See also FIG.

[0029] SEQ ID NO:4 is vector 25881. It contains the nucleotide sequence of the AlcA / AlcR ethanol-dependent inducible system to induce expression of Cas12a in the presence of ethanol and / or acetaldehyde. See also FIG. 5.

[0030] SEQ ID NO:5 is the amino acid sequence of the GVG protein.

[0031] SEQ ID NO:6 is the amino acid sequence of the glucocorticoid receptor.

[0032] SEQ ID NO:7 is the amino acid sequence of Cas12a protein with a fusion glucocorticoid receptor.

[0033] SEQ ID NO:8 is a 614 base pair gl1 fragment amplicon.

[0034] SEQ ID NO:9 is primer GL1_F used to generate the gl1 amplicon.

[0035] SEQ ID NO:10 is primer GL1_R used to generate the g1l amplicon.

[0036] SEQ ID NO:11 is an example gl1 consensus sequence.

[0037] SEQ ID NO:12 is a compilation of the gl1 sequence.

[0038] SEQ ID NO:13 is a compilation of the gl1 sequence.

[0039] SEQ ID NO:14 is a compilation of the gl1 sequence.

[0040] SEQ ID NO:15 is a compilation of the gl1 sequence.

[0041] SEQ ID NO:16 is a compilation of the gl1 sequence.

[0042] SEQ ID NO:17 is a compilation of the gl1 sequence.

[0043] SEQ ID NO:18 is a compilation of the gl1 sequence.

[0044] SEQ ID NO:19 is a compilation of the gl1 sequence.

[0045] SEQ ID NO:20 is a compilation of the gl1 sequence.

[0046] SEQ ID NO:21 is a compilation of the gl1 sequence.

[0047] SEQ ID NO:22 is a compilation of the gl1 sequence.

[0048] SEQ ID NO:23 is a compilation of the gl1 sequence.

[0049] SEQ ID NO:24 is a compilation of the gl1 sequence.

[0050] SEQ ID NO:25 is a compilation of the gl1 sequence.

[0051] SEQ ID NO:26 is a compilation of the gl1 sequence.

[0052] SEQ ID NO:27 is a compilation of the gl1 sequence.

[0053] SEQ ID NO:28 is a compilation of the gl1 sequence.

[0054] SEQ ID NO:29 is a compilation of the gl1 sequence.

[0055] SEQ ID NO:30 is a compilation of the gl1 sequence.

[0056] SEQ ID NO:31 is a compilation of the gl1 sequence.

[0057] SEQ ID NO:32 is a compilation of the gl1 sequence.

[0058] SEQ ID NO:33 is a compilation of the gl1 sequence.

[0059] SEQ ID NO:34 is a compilation of the gl1 sequence.

[0060] SEQ ID NO:35 is a compilation of the gl1 sequence.

[0061] SEQ ID NO:36 is a compilation of the gl1 sequence.

[0062] SEQ ID NO:37 is a compilation of the gl1 sequence.

[0063] SEQ ID NO:38 is a compilation of the gl1 sequence.

[0064] SEQ ID NO:39 is a compilation of the gl1 sequence.

[0065] SEQ ID NO:40 is a compilation of the gl1 sequence.

[0066] SEQ ID NO:41 is a compilation of the gl1 sequence.

[0067] SEQ ID NO:42 is a compilation of the gl1 sequence.

[0068] SEQ ID NO:43 is a compilation of the gl1 sequence.

[0069] SEQ ID NO:44 is a compilation of the gl1 sequence.

[0070] SEQ ID NO:45 is a compilation of the gl1 sequence.

[0071] SEQ ID NO:46 is a compilation of the gl1 sequence.

[0072] SEQ ID NO:47 is a compilation of the gl1 sequence.

[0073] SEQ ID NO:48 is a compilation of the gl1 sequence.

[0074] SEQ ID NO:49 is a compilation of the gl1 sequence.

[0075] SEQ ID NO:50 is a compilation of the gl1 sequence.

[0076] SEQ ID NO:51 is a compilation of the gl1 sequence.

[0077] SEQ ID NO:52 is a compilation of the gl1 sequence.

[0078] SEQ ID NO:53 is a compilation of the gl1 sequence.

[0079] SEQ ID NO:54 is a compilation of the gl1 sequence.

[0080] SEQ ID NO:55 is a compilation of the gl1 sequence.

[0081] SEQ ID NO:56 is a compilation of the gl1 sequence.

[0082] SEQ ID NO:57 is a compilation of the gl1 sequence.

[0083] SEQ ID NO:58 is a compilation of the gl1 sequence.

[0084] SEQ ID NO:59 is a compilation of the gl1 sequence.

[0085] SEQ ID NO:60 is a compilation of the gl1 sequence.

[0086] SEQ ID NO:61 is a compilation of the gl1 sequence.

[0087] SEQ ID NO:62 is a compilation of the gl1 sequence.

[0088] SEQ ID NO:63 is a compilation of the gl1 sequence.

[0089] SEQ ID NO:64 is a compilation of the gl1 sequence.

[0090] SEQ ID NO:65 is a compilation of the gl1 sequence.

[0091] SEQ ID NO:66 is a compilation of the gl1 sequence.

[0092] SEQ ID NO:67 is a compilation of the gl1 sequence.

[0093] SEQ ID NO:68 is a compilation of the gl1 sequence.

[0094] SEQ ID NO:69 is vector 27057. It contains the nucleotide sequence for dexamethasone-inducible expression of LbCas12a. cGal4VP16GR is constitutively expressed, and in the presence of DEX, it localizes to the nucleus, binds to the GAL4 UAS promoter, and drives the transcription of LbCas12a. The guide RNA targets the second exon of the Glabrous 1 (GL1) gene for phenotypic screening. The construct contains a kanamycin resistance cassette for selection of Arabidopsis transformants. The guide RNA is expressed using a ribozyme hammerhead design from the soybean S-adenosylmethionine synthetase (SAMS) promoter. See also FIG. 7. [Brief description of the drawings]

[0095] [Figure 1] FIG. 1 is a graphical representation of gl1 mutagenesis as a function of Cas12a expression. [Diagram 2] 1 is a plasmid map of Vector 24902. [Diagram 3] 1 is a plasmid map of Vector 25657. [Figure 4] 1 is a plasmid map of Vector 25765. [Diagram 5] 1 is a plasmid map of Vector 25881. [Figure 6] Photographs of the appearance of the wild type and the gl1 mutant in Arabidopsis. [Figure 7] 1 is a plasmid map of Vector 27057. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0096] definition While the following terms are believed to be well understood by those of ordinary skill in the art, the following definitions are set forth to facilitate the description of the subject matter disclosed herein.

[0097] All technical and scientific terms used herein are intended to have the same meaning as commonly understood by those skilled in the art, unless otherwise defined below. References to technology used herein are intended to refer to technology commonly understood in the art, including variations in technology and / or equivalent technical substitutions that would be apparent to those skilled in the art. While the following terms are believed to be fully understood by those skilled in the art, the following definitions are set forth to facilitate the description of the subject matter disclosed herein.

[0098] As used herein, "CRISPR enzyme" refers to any type I, II, IV or V enzyme isolated from a bacterial CRISPR system or any artificial, synthetic or otherwise modified homologue thereof. In particular, this definition encompasses Cas9, Cas12a (also known as Cpf1), Cas12i, Cas12j, Cms1, MAD7, Cas13, Cas14, etc., and mutants thereof. See U.S. Pat. No. 10,227,611, U.S. Pat. No. 10,000,772, U.S. Pat. No. 9,790,490, U.S. Pat. No. 9,896,696, U.S. Pat. No. 9,982,279, WO 2014 / 093595, WO 2017 / 184768, WO 2018 / 195545, all of which are incorporated herein by reference in their entirety. Additionally, modifications of these enzymes are within the scope of this definition, such as fusion enzymes that include a deaminase or exonuclease domain, a transposase domain, a reverse transcriptase domain, etc., such as Cas9-BE (a fusion of Cas9 and a base editor domain, such as APOBEC), Cas12a-BE (a fusion of Cas12a and a base editor domain, such as APOBEC, and optionally further including uracil DNA glycosylase) or Cas9-RT (a Cas enzyme fused to a reverse transcriptase domain, see WO 2020 / 191233, which is incorporated herein by reference in its entirety). Similarly, nuclease-inactive ("dCas") or nickase ("nCas") forms of these enzymes are within the scope of this definition. "CRISPR enzyme" and "CRISPR nuclease" are used interchangeably throughout.

[0099] As used herein, "inducible mosaicism" refers to the use of an inducible system to obtain mosaicism of editing in progeny plants. Applicable inducible systems include, but are not limited to, AlcA / AlcR inducible system, LhG4 / pOp inducible system, GVG inducible system and VGE inducible system. The inducible system is functionally, operably or physically linked to the CRISPR enzyme. After induction of the inducible system, the CRISPR enzyme is expressed or alternatively translocated to the nucleus. To obtain mosaicism in plants, it is important that induction occurs in line with the development of the plant tissue of interest. If mosaicism is desired during leaf development, induction will occur at about the time when leaf cells begin to develop and / or differentiate. If mosaicism is desired in the progeny of the plant, induction will occur at about the time when flower bud initial cells begin to develop.

[0100] As used herein, "chemical mimic" refers to a chemical that has a similar structure and / or effect to another chemical. For example, a chemical mimic of dexamethasone may share a similar structure with dexamethasone, or it may be a modified form of dexamethasone. In either case, the chemical mimic of dexamethasone may perform a similar function to dexamethasone in the DEX-inducible system. Furthermore, a chemical mimic of acetaldehyde may share a similar structure with acetaldehyde, or it may be a modified form of acetaldehyde. In either case, the chemical mimic of acetaldehyde may perform a similar function to acetaldehyde in the AlcA / AlcR-inducible system. Similarly, a chemical mimic of ethanol may be metabolized to acetaldehyde in order to function in the AlcA / AlcR-inducible system, similar to the metabolism of ethanol to acetaldehyde.

[0101] As used herein, "genotyping" refers to any analytical method that analyzes the genetic code of an organism or cell. Methods of genotyping include, among others, Sanger sequencing, next generation sequencing ("NGS"), polymerase chain reaction ("PCR") and TaqMan analysis. Genotyping may include PCR amplification of target regions followed by deconvolution of the chromatogram using Sanger sequencing and ICE analysis (see ice.synthego.com). Genotyping methods may be manual or automated. Genotyping includes whole genome sequencing, SNP detection, haplotype analysis, zygosity analysis and incidental presence analysis.

[0102] As used herein, "translocation effector" refers to a molecule (proteinaceous or otherwise) on which intracellular trafficking is dependent. For example, but not limited to, the glucocorticoid receptor acts as a translocation effector when fused to a heterologous protein.

[0103] In accordance with long-standing patent law convention, the terms "a," "an," and "the" refer to "one or more" when used in this application, including the claims. For example, the phrase "a cell" refers to one or more cells, and in certain embodiments may refer to a tissue and / or an organ. Similarly, the phrase "at least one," when used herein to refer to an entity, refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more of the applicable entity, including, but not limited to, all integer values ​​from 1 to 100, as well as integer values ​​greater than 100.

[0104] As used herein, the term "and / or" refers to and includes all possible combinations of one or more of the associated listed items, and the absence of combinations when interpreted as an alternative "or", referring to entities present alone or in combination. Thus, for example, the phrase "A, B, C, and / or D" includes not only A, B, C, and D individually, but also all combinations and subcombinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In certain embodiments, one or more of the elements referred to by "and / or" may also be present individually in single or multiple occurrences in combinations and / or subcombinations.

[0105] Unless otherwise indicated, all numerical values ​​expressing amounts of ingredients, reaction conditions, and the like used in the specification and claims should be understood in each case to be modified by the term "about". The term "about" as used herein, when referring to a measurable value, such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of the particular amount, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1%, such variations being appropriate for carrying out the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Thus, unless stated to the contrary, the numerical parameters set forth in the specification and the appended claims are approximations that may vary depending on the desired properties sought to be obtained by the subject matter disclosed herein. When the term "about" is used in connection with the present disclosure (e.g., in conjunction with temperature or molecular weight values), the exact value (i.e., without "about") may be preferred.

[0106] As used herein, the term "allele" refers to a variant or alternative sequence form at a locus. In diploids, a single allele is inherited separately from each parent at each locus to a progeny individual. Although the two alleles at a given locus present in a diploid organism occupy corresponding positions in a pair of homologous chromosomes, one skilled in the art will understand that the alleles in any particular individual do not necessarily represent all of the alleles present in a species.

[0107] Units, prefixes and symbols may be represented in SI accepted form. Unless otherwise indicated, nucleic acids are depicted left to right in 5' to 3' orientation, and amino acid sequences are depicted left to right in N-terminal to C-terminal orientation, respectively. Amino acids may be referred to herein by either their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their commonly accepted one-letter codes.

[0108] As used herein, the phrase "associated with" refers to a discernible and / or assessable relationship between two entities. For example, the phrase "associated with HI" refers to a trait, locus, gene, allele, marker, phenotype, etc., or expression thereof, whose presence or absence can affect the extent and / or degree to which a plant or its progeny will exhibit HI or haploid induction. Thus, a marker is "associated with" a trait if it is associated with the trait and the presence of the marker is an indication of whether and / or to what extent a desired trait or trait morphology will occur in a plant / germplasm containing the marker. Similarly, a marker is "associated with" an allele if it is associated with an allele and the presence of the marker is an indication of whether the allele is present in a plant / germplasm containing the marker. For example, an "associated with HI marker" refers to a marker whose presence or absence can be used to predict whether and / or to what extent a plant will exhibit haploid induction.

[0109] "Associated / operably linked to" can also refer to two nucleic acids that are physically or functionally related. For example, a promoter or regulatory DNA sequence is said to be "associated with" a DNA sequence encoding an RNA or protein if the two sequences are operably linked or if the regulatory DNA sequence is positioned so as to affect the level of expression of the coding or structural DNA sequence.

[0110] A "coding sequence" is a nucleic acid sequence which is transcribed into RNA, such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA, and then preferably translated in an organism to produce a protein.

[0111] As used herein, a "codon-optimized" sequence refers to a nucleotide sequence in which codons are selected to reflect a particular codon bias that a host cell or organism may have. This is typically done in such a way as to preserve the amino acid sequence of the polypeptide encoded by the optimized nucleotide sequence. In certain embodiments, the DNA sequence of the recombinant DNA construct comprises a sequence that is codon-optimized for the cell in which the construct is expressed (e.g., an animal, plant, or fungal cell). For example, a construct that is expressed in a plant cell may have all or a portion of its sequence (e.g., a first gene suppression element or a gene expression element) that is codon-optimized for expression in the plant. See, for example, U.S. Pat. No. 6,121,014, which is incorporated herein by reference. In embodiments, the polynucleotides of the present disclosure are codon-optimized for expression in a plant cell (e.g., a dicotyledonous or monocotyledonous plant cell) or a bacterial cell.

[0112] The term "comprising," which is synonymous with "comprising," "containing," and "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements and / or method steps. "Comprising" is a terminology that means that the specified elements and / or steps are present, but that other elements and / or steps can be added and still be included within the scope of the relevant subject matter.

[0113] As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specifically recited. When the phrase "consisting of" appears in a clause in the body of a claim rather than immediately following the preamble, it limits only the elements recited in that clause and does not exclude other elements from the claim as a whole.

[0114] As used herein, the phrase "consisting essentially of" (and grammatical variations) limits the scope of the associated disclosure or claims to certain materials and / or steps and those that do not materially affect the basic and novel characteristics of the disclosed and / or claimed subject matter. The terms "comprise", "including", "include", "comprises", "comprising", "having" and their conjugations mean "including, but not limited to". These terms specify the presence of stated features, integers, steps, operations, elements or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components or groups thereof. The term "consisting of" means "including and limited to".

[0115] With regard to the terms "comprising," "consisting essentially of," and "consisting of," when one of these three terms is used herein, the subject matter disclosed and claimed herein may, in certain embodiments, include the use of either of the other two terms. For example, when the subject matter relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence that, in certain embodiments, is at least 95% identical to a SEQ ID NO. It is understood that the disclosed subject matter herein also encompasses, in certain embodiments, a nucleic acid encoding a polypeptide that essentially consists of an amino acid sequence that is at least 95% identical to the SEQ ID NO, as well as a nucleic acid encoding a polypeptide that, in certain embodiments, consists of an amino acid sequence that is at least 95% identical to the SEQ ID NO. Similarly, it is also understood that, in certain embodiments, a method for the disclosed subject matter comprises the steps disclosed herein, in certain embodiments, a method for the disclosed subject matter consists essentially of the steps disclosed herein, and in certain embodiments, a method for the disclosed subject matter consists of the steps disclosed herein.

[0116] In the context of this disclosure, "corresponding to" or "corresponding to" means that when the amino acid sequence of a reference sequence is matched to a second amino acid sequence that differs from the reference sequence (e.g., a variant or homologous sequence), the amino acids "corresponding to" specific recited positions in the second amino acid sequence correspond to those positions in the reference amino acid sequence, but are not necessarily at the exact numerical positions with respect to the particular reference amino acid sequence of this disclosure.

[0117] As used herein, the term "event" refers to a genetically modified organism or cell, such as a genetically modified plant or seed, that is made to carry non-native DNA that would not normally be found in nature. An event can include a transgenic event in which a transgene is inserted into the DNA of an organism. An event can also include the insertion of a particular transgene into a particular location in a chromosome. An event can also include any combination of indels and point mutations.

[0118] As used herein, the term "gene" refers to a hereditary unit that comprises a sequence of DNA that occupies a specific location in a chromosome and contains the genetic instructions for a particular characteristic or trait in an organism.

[0119] A "genetic map" is a description, typically presented in graphical or tabular form, of the genetic linkage relationships among genetic loci on one or more chromosomes in a given species.

[0120] As used herein, a "gene regulatory network" (or "GRN") is a group of molecular regulators that interact with each other and with other substances in the cell to regulate gene expression levels of mRNA and protein. Regulators can be DNA, RNA, proteins, and complexes thereof. A GRN can also include a "gene family" as used herein. A "gene family" refers to a set of several similar genes that have roughly similar biochemical functions.

[0121] The term "domain" refers to a set of amino acids that are conserved at specific positions along an alignment of sequences of evolutionarily related proteins. While amino acids at other positions may vary between homologs, highly conserved amino acids at specific positions indicate amino acids that are likely to be essential for the structure, stability or function of the protein. Identified by their high degree of conservation in the aligned sequences of a family of protein homologs, they can be used as identifiers to determine whether any given polypeptide belongs to a previously identified group of polypeptides.

[0122] "Expression cassette" as used herein means a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in a suitable host cell, and includes a promoter operably linked to the nucleotide sequence of interest, which is operably linked to a termination signal. An expression cassette typically also includes sequences necessary for proper translation of the nucleotide sequence. An expression cassette containing a nucleotide sequence of interest may have at least one of its components that is heterologous to at least one of the other components. An expression cassette may be naturally occurring, but also obtained in a recombinant form useful for heterologous expression. Typically, however, an expression cassette is heterologous to the host, i.e., the particular nucleic acid sequence of the expression cassette does not naturally occur in the host cell, but must have been introduced into the host cell or an ancestor of the host cell by a transformation event. Expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to a certain external stimulus. In the case of multicellular organisms such as plants, the promoter may also be specific to a particular tissue or organ or developmental stage.

[0123] The expression cassette containing the nucleotide sequence of interest can be chimeric, meaning that at least one of its components is heterologous to at least one of the other components. The expression cassette can also contain the native promoter driving its native gene, but it has been obtained in a recombinant form useful for heterologous expression. Such use of the expression cassette ensures that it does not naturally occur in the cell into which it is introduced.

[0124] The expression cassette may also optionally include a transcriptional and / or translational termination region (i.e., a termination region) that is functional in plants. A variety of transcriptional terminators are available for use in the expression cassette and are responsible for terminating transcription across the heterologous nucleotide sequence of interest and modifying mRNA polyadenylation. The termination region may be native to the transcriptional initiation region, may be native to the operably linked nucleotide sequence of interest, may be native to the plant host, or may be derived from another source (i.e., foreign or heterologous to the promoter, nucleotide sequence of interest, plant host, or any combination thereof). Suitable transcriptional terminators include, but are not limited to, the CAMV 35S terminator, the tml terminator, the nopaline synthase terminator, and / or the pea rbcs E9 terminator. These may be used in both monocotyledonous and dicotyledonous plants. Additionally, the native transcriptional terminator of the coding sequence may be used. Any available terminator known to function in plants may be used in the context of the present disclosure.

[0125] The term "heterologous" when used in reference to a gene or polynucleotide or polypeptide refers to a gene or polynucleotide or polypeptide that is not present in its natural environment (i.e., altered by the hand of man) or includes a portion thereof. For example, a heterologous gene can include a polynucleotide from one species that has been introduced into another species. A heterologous gene can also include a polynucleotide that is native to an organism that has been modified in some way (e.g., mutated, added in multiple copies, linked to a non-native promoter or enhancer polynucleotide, etc.). A heterologous gene can further include plant gene polynucleotides, including plant genes in cDNA form, where the cDNA can be expressed in either sense (to produce mRNA) or antisense orientation (to produce an antisense RNA transcript complementary to the mRNA transcript). In one aspect of the disclosure, a heterologous gene is distinguished from an endogenous plant gene in that a heterologous gene polynucleotide is typically associated with a polynucleotide that includes a regulatory element, such as a promoter, that is not naturally associated with the gene of the protein encoded by the heterologous gene or the plant gene polynucleotide in a chromosome, or is associated with a part of the chromosome that is not found in nature (e.g., a gene expressed at a locus where the gene is not normally expressed). Furthermore, a "heterologous" polynucleotide refers to a polynucleotide that is not naturally associated with the host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring polynucleotide. A heterologous nucleic acid sequence or nucleic acid molecule can include a chimeric sequence, such as a chimeric expression cassette, in which the promoter and coding region are derived from multiple source organisms. The promoter sequence can be a constitutive promoter sequence, a tissue-specific promoter sequence, a chemically inducible promoter sequence, a wound-inducible promoter sequence, a stress-inducible promoter sequence, or a developmental stage-specific promoter sequence.

[0126] A "homologous" nucleic acid sequence is a nucleic acid sequence that is naturally associated with the host cell into which it is introduced.

[0127] The term "expression", when used in reference to a polynucleotide such as a gene, an ORF or a portion thereof, or a transgene in a plant, refers to the process of converting the genetic information encoded in the gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) by "transcription" of the gene (i.e., by the enzymatic action of RNA polymerase), and, where applicable (e.g., if the gene codes for a protein), into a protein by "translation" of the mRNA. Gene expression can be regulated at many stages in the process. For example, in the case of an antisense or dsRNA construct, respectively, expression can refer to the transcription of only the antisense RNA or only the dsRNA. In embodiments, "expression" refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. "Expression" can also refer to the production of a protein.

[0128] As used herein, a plant referred to as "haploid" has a reduced number of chromosomes (n) in a haploid plant, the chromosome set being equal to that of a gamete. In a haploid organism, only half of the normal number of chromosomes is present. Thus, haploids of diploid organisms (e.g., maize) exhibit haploidy, haploids of tetraploid organisms (e.g., ryegrass) exhibit diploidy, haploids of hexaploid organisms (e.g., wheat) exhibit triploidy, and so on. As used herein, a plant referred to as "doubled haploid" is generated by doubling the haploid set of chromosomes. A plant or seed obtained from a doubled haploid plant that has been selfed to any number of generations can still be identified as a doubled haploid plant. A doubled haploid plant is considered a homozygous plant. A plant will be considered to be doubled haploid if it is fertile even if the entire growing part of the plant does not consist of cells with two sets of chromosomes, i.e., a plant will be considered to be doubled haploid even if it is chimeric in the growing tissue if it contains viable gametes.

[0129] As used herein, the term "human-induced mutation" refers to any mutation that occurs as a result of direct or indirect human action. The term includes, but is not limited to, mutations obtained by any method of targeted mutagenesis.

[0130] As used herein, "introduced" refers to the delivery, expression, application, transport, transfer, penetration, or other similar terms that refer to the delivery of a desired target to a target, whether a nucleic acid or a protein, or a combination thereof. For example, a nucleic acid encoding a site-specific nuclease and optionally at least one guide RNA can be introduced into a plant cell.

[0131] As used herein, the terms "marker probe" and "probe" refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence by nucleic acid hybridization, e.g., a nucleic acid probe complementary to all or a portion of a marker or marker locus. Marker probes containing about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization.

[0132] As used herein, the term "molecular marker" may be used to refer to a genetic marker as defined above or its encoded product (e.g., protein) that is used as a reference point when identifying the presence / absence of an HI-associated locus. A molecular marker may be derived from a genomic nucleotide sequence or an expressed nucleotide sequence (e.g., RNA, cDNA, etc.). The term also refers to a nucleotide sequence that is complementary to or adjacent to a marker sequence, such as a nucleotide sequence used as a probe and / or primer that can amplify the marker sequence. Nucleotide sequences are "complementary" if they hybridize specifically in solution (e.g., according to Watson-Crick base pairing rules). The term also refers to a genetic marker that is characterized by the absence of a nucleotide sequence that is complementary to or adjacent to a marker sequence, such as a nucleotide sequence used as a probe and / or primer that can amplify the marker sequence.

[0133] As used herein, the terms "nucleotide sequence," "polynucleotide," "nucleic acid sequence," "nucleic acid molecule," and "nucleic acid fragment" refer to a polymer of RNA or DNA that is single- or double-stranded, and optionally contains synthetic, non-natural and / or altered nucleotide bases. "Nucleotides" are the monomeric units from which DNA or RNA polymers are built, and consist of a purine or pyrimidine base, a pentose, and a phosphate group. Nucleotides (usually found in their 5'-monophosphate form) are designated by their one-letter designation as follows: "A" stands for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" stands for cytidylate or deoxycytidylate, "G" stands for guanylate or deoxyguanylate, "U" stands for uridylate, "T" stands for deoxythymidylate, "R" stands for purine (A or G), "Y" stands for pyrimidine (C or T), "K" stands for G or T, "H" stands for A or C or T, "I" stands for inosine, and "N" stands for any nucleotide.

[0134] As used herein, the term "nucleotide sequence identity" refers to the presence of identical nucleotides at corresponding positions of two polynucleotides. Polynucleotides have "identical" sequences if the sequences of nucleotides in the two polynucleotides are the same when aligned for maximum matching (e.g., in a comparison window). Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. A comparison window is generally about 20-200 contiguous nucleotides. A "percentage of sequence identity" of a polynucleotide, such as about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99 or 100 percent sequence identity, can be determined by comparing two optimally aligned sequences over a comparison window, and the portions of the polynucleotide sequence in the comparison window can include additions or deletions (i.e., gaps) when compared to a reference sequence for optimal alignment of the two sequences. In one embodiment, the percentage is calculated by (a) determining the number of positions where identical nucleobases are present in both sequences, (b) dividing the number of matched positions by the total number of positions in the comparison window, and (c) multiplying the result by 100.

[0135] One example of a suitable algorithm for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., 1990. In some embodiments, the percentage of sequence identity refers to the sequence identity over the full length of one of the gDNA, cDNA or predicted protein sequences in the largest ORF of SEQ ID NO: 1 being compared. In some embodiments, the calculation for determining the percentage of nucleic acid sequence identity does not include any nucleotide position in the calculation where any of the compared nucleic acids contains an "N" (i.e., where any nucleotide can be present at that position).

[0136] The term "open reading frame" (ORF) refers to a nucleic acid sequence that encodes a polypeptide. In certain embodiments, an ORF includes a translation initiation codon (i.e., start codon), a translation termination (i.e., stop codon), and the nucleic acid sequence therebetween that encodes the amino acids present in the polypeptide. The terms "initiation codon" and "termination codon" refer to three adjacent units of nucleotides (i.e., codons) in a coding sequence that specify the initiation and chain termination, respectively, of protein synthesis (mRNA translation).

[0137] As used herein, the terms "phenotype," "phenotypic trait," or "trait" refer to one or more characteristics of a plant or plant cell. A phenotype may be observable with the naked eye or by any other means of assessment known in the art, such as microscopy, biochemical analysis, or electromechanical assays. In some cases, a phenotype is directly controlled by a single gene or locus (i.e., corresponds to a "single gene trait"). In other cases, a phenotype is the result of interactions between several genes, which in some embodiments also result from interactions between the plant and / or plant cell and its environment.

[0138] As used herein, the term "plant" may refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Types of plants that may be used in the methods of the present disclosure generally include, but are not limited to, the following genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, and the like. , Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Maize, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale,The variety of higher plants that are amenable to transformation techniques is as broad as the species, including both monocotyledonous and dicotyledonous plants, including species of the genera Allium and Triticum.

[0139] A plant cell is a plant cell obtained by culture from a cell taken from a plant. Thus, the term "plant cell" includes, but is not limited to, cells in seeds, suspension cultures, embryos, meristematic tissue parts, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores. The phrase "plant part" refers to a part of a plant from which a plant can be regenerated, including single cells and cell tissues such as intact plant cells in a plant, cell mass, and tissue culture. Examples of plant parts include, but are not limited to, pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds, as well as single cells and tissues derived from shoots, rhizomes, protoplasts, callus, etc.

[0140] As used herein, the term "primer" refers to an oligonucleotide that can anneal (and in some embodiments specifically anneal) to a nucleic acid target and serve as a point of initiation of DNA synthesis when placed under conditions that induce synthesis of a primer extension product (e.g., in the presence of nucleotides and agents for polymerization, such as DNA polymerase, and at a suitable temperature and pH). In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using the polymerase chain reaction, PCR).

[0141] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a strand of a double-stranded or higher order nucleic acid or a subsequence thereof) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, a probe has a length sufficient to form a stable and sequence-specific double-stranded molecule with its complement, and thus can be used in certain embodiments to detect a sequence of interest present in a plurality of nucleic acids.

[0142] As used herein, the terms "progeny" and "progeny plant" refer to a plant generated from one or more parent plants through vegetative or sexual reproduction. Progeny plants are obtained by cloning or selfing a single parent plant or by crossing two or more parent plants. For example, progeny plants are obtained by cloning or selfing a parent plant or by crossing two parent plants, including selfing and F1 or F2 or even other generations. F1 is the first generation progeny produced from a parent, at least one of which is used for the first time as a trait donor, while the second generation (F2) and subsequent generations of progeny (F3, F4, etc.) are samples produced from selfing, outcrossing, backcrossing and / or other crosses such as F1, F2, etc. Thus, the F1 may be (and in some embodiments is) a hybrid resulting from a cross between two pure breeding parents (i.e., the pure breeding parents are each homozygous for the trait or allele thereof of interest), while the F2 may be (and in some embodiments is) the progeny resulting from self-pollination of the F1 hybrid.

[0143] A "portion" or "fragment" of a polypeptide of the present disclosure will be understood to mean an amino acid sequence or nucleic acid sequence of reduced length compared to a reference amino acid sequence or nucleic acid sequence of the present disclosure. Such a portion or fragment according to the present disclosure may, if desired, be included in a larger polypeptide or nucleic acid of which it is a component (e.g., a tagged or fusion protein or expression cassette). In embodiments, a "portion" or "fragment" substantially retains an activity, e.g., insecticidal activity, of the full-length protein or nucleic acid (e.g., at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or even 100% activity) or has even higher activity, e.g., insecticidal activity, than the full-length protein).

[0144] The terms "protein," "peptide," and "polypeptide" are used interchangeably herein.

[0145] The term "promoter" as used herein generally refers to a polynucleotide upstream (5') of the translation start site of a coding sequence, which controls the expression of the coding sequence by providing recognition for RNA polymerase and other factors required for proper transcription. For example, a promoter can contain a region containing basal promoter elements recognized by RNA polymerase, the 5' untranslated region (UTR) of the coding sequence, and optionally a region containing introns.

[0146] As used herein, the term "recombination" refers to the exchange of DNA fragments between two DNA molecules or chromatids of paired chromosomes across regions of similar or identical nucleotide sequences ("crossing over"). It is understood that "recombination event" as used herein refers, in one embodiment, to meiotic crossing over.

[0147] As used herein, the term "recombinant" refers to a form of nucleic acid (e.g., DNA or RNA) or protein or organism that is not normally found in nature and thus has been produced by human intervention. As used herein, a "recombinant nucleic acid molecule" is a nucleic acid molecule that includes a combination of polynucleotides that do not occur together in nature and are the result of human intervention, such as a nucleic acid molecule that includes a combination of at least two polynucleotides that are heterologous to each other, or an artificially synthesized nucleic acid molecule, for example, a polynucleotide that is synthesized with an assembled nucleotide sequence and deviates from a polynucleotide that normally occurs in nature, or a nucleic acid molecule that includes a transgene that has been artificially integrated into the genomic DNA of a host cell and the associated adjacent DNA of the host cell's genome. Another example of a recombinant nucleic acid molecule is a DNA molecule that results from the insertion of a transgene into the genomic DNA of a plant, which may ultimately result in the expression of a recombinant RNA or protein molecule in the organism. As used herein, a "recombinant plant" is a plant that does not normally occur in nature and is the result of human intervention and contains a transgene or heterologous nucleic acid molecule that may be integrated into its genome. As a result of such genomic changes, the recombinant plant is distinct from the related wild-type plant. A "recombinant" bacterium is a bacterium not found in nature that contains a heterologous nucleic acid molecule. Such bacteria can be produced by transformation of a bacterium with the nucleic acid molecule, or by transfer, such as by conjugation of a plasmid from one bacterial strain to another, whereby the plasmid contains the nucleic acid molecule.

[0148] As used herein, the term "reference sequence" refers to a defined nucleotide sequence used as a basis for a nucleotide sequence comparison.

[0149] As used herein, the term "regenerate" and grammatical variations thereof refer to the production of plants from tissue culture.

[0150] "Regulatory element" refers to a nucleotide sequence located upstream (5' non-coding sequences), within or downstream (3' non-coding sequences) of a coding sequence that influences the transcription, RNA processing, or stability or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translational enhancer sequences, introns, terminators, and polyadenylation signal sequences. They include sequences that may be natural and synthetic sequences, as well as combinations of synthetic and natural sequences. Regulatory sequences may determine the level of expression, the spatial and temporal pattern of expression, and, in the case of a subset of promoters, expression under inducing conditions (regulation by external factors such as light, temperature, chemicals, and hormones).

[0151] As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a polynucleotide will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but will not hybridize to substantially other sequences. Stringent conditions are sequence-dependent and may be different under different circumstances.

[0152] Longer sequences typically hybridize specifically at higher temperatures. Extensive guidelines for nucleic acid hybridization can be found in Sambrook & Russell, 2001. In general, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (when the target sequence is present in excess, 50% of the probes are occupied at equilibrium at Tm). Exemplary stringent conditions are those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., more than 50 nucleotides).

[0153] Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. Further exemplary stringent hybridization conditions include 50% formamide, 5xSSC and 1% SDS or SSC incubated at 42°C, 1% SDS incubated at 65°C, with one or more washes in 0.2xSSC and 0.1% SDS at 65°C. For PCR, a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures can vary from about 32°C to 48°C (or higher), depending on primer length. Further guidance for determining hybridization parameters is provided in many references (see, for example, Ausubel et al., 1999).

[0154] As used herein, the term "trait" refers to a phenotype of interest, a gene that contributes to the phenotype of interest, and a nucleic acid sequence associated with the gene that contributes to the phenotype of interest. For example, an "HI trait" refers to a gene (e.g., matl in maize or Os03g27610 in rice) that contributes to a haploid induction and a nucleic acid sequence (e.g., an HI-associated gene product) that is associated with the presence or absence of a haploid induction phenotype.

[0155] As used herein, the term "transgene" refers to a nucleic acid molecule that is introduced into an organism or one or more of its ancestors by some form of artificial transfer technique. Artificial transfer techniques thus produce "transgenic organisms" or "transgenic cells." It is understood that although artificial transfer techniques may be performed on (or may develop into) cells therein and / or on ancestors, any progeny individual that has the artificially transferred nucleic acid molecule or a fragment thereof will still be considered transgenic even if one or more natural and / or assisted breedings result in the artificially transferred nucleic acid molecule being present in the progeny individual.

[0156] As used herein, the term "targeted mutagenesis" or "mutagenesis technique" refers to any method of mutagenesis that results in the deliberate mutagenesis of a selected gene. Targeted mutagenesis includes the methods CRISPR, TILLING, TALEN, and other methods that have not yet been disclosed but can be used to achieve the same result.

[0157] "Transformation" is a process for introducing heterologous nucleic acid into a host cell or organism. In certain embodiments, "transformation" refers to the stable integration of a DNA molecule into the genome (nucleus or plastid) of the organism of interest. In certain embodiments, introduction into the plant, plant part and / or plant cell is via bacterial-mediated transformation, particle bombardment transformation, calcium phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, liposome-mediated transformation, nanoparticle-mediated transformation, polymer-mediated transformation, virus-mediated nucleic acid delivery, whisker-mediated nucleic acid delivery, microinjection, sonication, infiltration, polyethylene glycol-mediated transformation, protoplast transformation or any other electrical, chemical, physical and / or biological mechanism or combination thereof that results in the introduction of nucleic acid into the plant, plant part and / or cell thereof. Procedures for transforming plants are well known and routine in the art and are described throughout the literature.

[0158] Non-limiting examples of methods for plant transformation include bacterial-mediated nucleic acid delivery (e.g., via bacteria from the genus Agrobacterium), viral-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker mediated nucleic acid delivery, liposome-mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium phosphate mediated transformation, cyclodextrin mediated transformation, electroporation, nanoparticle mediated transformation, sonication, infiltration, PEG-mediated nucleic acid uptake, and transformation via any other electrical, chemical, physical (mechanical) and / or biological mechanism (including any combination thereof) that results in the introduction of a nucleic acid into a plant cell. General guidelines for various plant transformation methods known in the art include Miki et al. ("Procedures for Introducing Foreign DNA into Plants" in Methods in Plant Molecular Biology and Biotechnology, Glick, B R and Thompson, J E, Eds. (CRC Press, Inc., Boca Raton, 1993), pages 67-88) and Rakowoczy-Trojanowska (2002, Cell Mol Biol Lett 7:849-858 (2002)).

[0159] "Transformed" and "transgenic" refer to a host organism, such as a bacterium or a plant, into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule may be stably integrated into the genome of the host, or the nucleic acid molecule may also exist as an extrachromosomal molecule. Such extrachromosomal molecules may be autonomously replicating. It is understood that a transformed cell, tissue or plant encompasses not only the end product of a transformation process, but also its transgenic progeny. A "non-transformed", "non-transgenic" or "non-recombinant" host refers to a wild-type organism, such as a bacterium or plant, that does not contain a heterologous nucleic acid molecule.

[0160] It is particularly contemplated that promoters may be mutated to potentially improve the usefulness of the elements for expression of transgenes in plants. Mutagenesis of these elements may be performed randomly, and the mutagenized promoter sequences may be screened for activity in a trial-and-error procedure. Alternatively, specific sequences that provide the promoter with the desired expression characteristics or that provide the promoter with expression-enhancing activity may be identified, and these or similar sequences may be introduced into the promoter by mutation. It is further contemplated that these sequences may be mutated to enhance their expression of transgenes in a particular species. Means for mutating DNA segments encoding the promoter sequences of the present invention are well known to those skilled in the art. As indicated, modifications to promoters or other regulatory elements may be made by random or site-specific mutagenesis procedures. Promoters and other regulatory elements may be modified by altering their structure by the addition or deletion of one or more nucleotides from the sequence encoding the corresponding unmodified sequence.

[0161] Mutagenesis may be performed according to any of the techniques known in the art, including, but not limited to, synthesizing oligonucleotides with one or more mutations in the sequence of a particular regulatory sequence. In particular, site-directed mutagenesis is a technique useful for the preparation of promoter mutants by specific mutagenesis of the underlying DNA. RNA-guided endonucleases ("RGENs", e.g., CRISPR / Cas9) may also be used. This technique further provides the ability to easily prepare and test sequence variants, incorporating one or more of the above considerations, for example, by introducing one or more nucleotide sequence changes into the DNA. Site-directed mutagenesis allows for the production of mutants by the use of specific oligonucleotide sequences encoding the DNA sequence of the desired mutation, as well as a sufficient number of flanking nucleotides to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on either side of the deletion junction to be traversed. Typically, primers of about 17 to about 75 nucleotides or more in length are preferred, with about 10 to about 25 or more residues on either side of the junction of the sequence to be modified.

[0162] When a clone containing a promoter has been isolated according to the present invention, it may be desirable to delimit the promoter region within the clone. One efficient targeting means for preparing a mutagenized promoter relies on the identification of putative regulatory elements within the promoter sequence. This may begin by comparison with promoter sequences known to be expressed in similar tissue-specific or developmentally specific patterns. Sequences shared between promoters with similar expression patterns are likely candidates for transcription factor binding and therefore likely elements that confer the expression pattern. Confirmation of these putative regulatory elements may be achieved by deletion analysis of each putative regulatory sequence, followed by functional analysis of each deletion construct by assaying a reporter gene operably linked to each construct. Thus, once a starting promoter sequence is provided, any of several different deletion mutants of the starting promoter may be readily prepared.

[0163] The invention disclosed herein provides polynucleotide molecules comprising regulatory element fragments that can be used to construct novel chimeric regulatory elements. Novel combinations comprising fragments of these polynucleotide molecules and at least one other regulatory element or fragment can be constructed and tested in plants and are considered to be within the scope of the present invention. Thus, the design, construction and use of chimeric regulatory elements is one embodiment of the present invention. The promoters of the present invention comprise homologs of cis elements known to affect gene regulation that show homology with the promoter sequences of the present invention.

[0164] A functional equivalent fragment of one of the transcription regulating nucleic acids described herein comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 base pairs of the transcription regulating nucleic acid. An equivalent fragment of the transcription regulating nucleic acid obtained by then removing the region coding for the 5'-non-translated region of the mRNA will provide only the (non-transcribed) promoter region. The 5'-non-translated region can be easily determined by methods known in the art (such as 5'-RACE analysis). Thus, some of the transcription regulating nucleic acids described herein are equivalent fragments of other sequences.

[0165] As shown above, deletion mutants of the promoter of the present invention can also be prepared randomly and then assayed. Following this procedure, a series of constructs, each containing a different portion (subclone) of the promoter, are prepared, and these constructs are then screened for activity. A suitable means for screening for activity is to link the deleted promoter or intron construct containing the deleted segment to a selectable or screenable marker and to isolate only cells that express the marker gene. In this way, several different deleted promoter constructs are identified that still retain the desired or even enhanced activity. The smallest segment required for activity is thereby identified through comparison of the selected constructs. This segment can then be used to construct a vector for the expression of a foreign gene.

[0166] The term "at least one expression cassette" as used herein refers in particular to DNA comprising sequences of an inducible system and nucleic acid encoding a DNA modifying enzyme expressed by the cell. In one example, the at least one expression cassette is a component of vector DNA and is expressed after transformation in the cell. The at least one expression cassette as used herein will often comprise multiple expression cassettes, such as an expression cassette comprising a nucleic acid encoding a regulatory sequence and a gRNA, an expression cassette comprising a regulatory sequence that initiates replication of donor DNA, an expression cassette comprising a regulatory sequence and a selectable marker, or some combination thereof, such as an expression cassette comprising DNA encoding a Cas enzyme and a gRNA under the control of sequences of an inducible system. The at least one expression cassette as used herein may comprise additional regulatory elements. This related term should be understood in a broad sense to include all sequences that may affect the construction or function of the at least one expression cassette. The regulatory elements may, for example, regulate transcription and / or translation in prokaryotes or eukaryotes. At least one expression cassette described herein may be downstream (3' direction) of the nucleic acid sequence to be expressed and may optionally contain additional regulatory elements such as transcriptional or translational enhancers. Each additional regulatory element may be operably linked to the nucleic acid sequence to be expressed (or the transcriptional regulatory nucleotide sequence). The additional regulatory elements may include additional promoters, minimal promoters, promoter elements, or transposon elements that may regulate or enhance the expression regulatory properties. At least one expression cassette may also contain one or more introns, one or more exons, and one or more terminators.

[0167] It is further contemplated that promoters combining elements from two or more promoters may be useful. For example, U.S. Patent No. 5,491,288 discloses combining a cauliflower mosaic virus promoter with a histone promoter. Thus, promoters disclosed herein, such as elements from the FMOS promoter, may be combined with elements from other promoters, FMOS or otherwise, so long as FMOS function is maintained. For example, in certain embodiments, introns in the FMOS promoter may be replaced with introns from other promoters, such as introns from the ubiquitin promoter. Still other FMOS promoters may be extended in some embodiments, for example, by fusing with introns from other promoters, such as fusing the FMOS promoter with an intron from the ubiquitin promoter.

[0168] The term "vector" refers to a composition for transferring, delivering or introducing a nucleic acid (or nucleic acids) into a cell. A vector includes a nucleic acid molecule that comprises the nucleotide sequence to be transferred, delivered or introduced. Example vectors include plasmids, cosmids, phagemids, artificial chromosomes, phage or viral vectors.

[0169] (Detailed Description) The present disclosure relates, inter alia, to systems and methods for improving gene editing efficiency, e.g., for reducing the number of transformations required to generate edits, e.g., new mutations or events, in the DNA of a plant.

[0170] In various embodiments, the present disclosure relates to methods for generating multiple unique edits in a seed of a plant, such as multiple unique allelic substitutions, multiple unique base insertions, multiple unique base deletions, or multiple unique point mutations.

[0171] One embodiment provides a method for generating multiple unique edits in progeny of a plant comprising the steps of: (a) introducing an expression cassette into a plant cell or plant tissue, the expression cassette comprising (i.) a nucleic acid encoding a DNA modifying enzyme, (ii.) an optional nucleic acid encoding at least one guide RNA, and (iii.) an inducer operably linked to the nucleic acid encoding the DNA modifying enzyme; (b.) inducing the inducer at a desired stage of plant development; and (c.) generating the plant cell or plant tissue into a plant having progeny, wherein the progeny collectively comprise the multiple unique edits. In one embodiment, the inducer is a transcription effector or a translocation effector, the inducer is induced by a chemical, the chemical is selected from an antibiotic, a metal, a steroid, a pesticide, a hormone, an alcohol, and an aldehyde, the antibiotic is tetracycline or a chemical mimic thereof, the metal is copper or a copper-containing compound, and the steroid is dexamethasone, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone, and any thereof. and chemical mimetics thereof, wherein the glucocorticoid is dexamethasone, the insecticide is selected from the group consisting of tebufenozide, methoxyfenozide and any chemical mimetics thereof, the hormone is selected from the group consisting of estrogen, estrogen, 17-β-estradiol and any chemical mimetics thereof, the alcohol is selected from the group consisting of ethanol and any chemical mimetics thereof, and the aldehyde is selected from the group consisting of acetaldehyde and any chemical mimetics thereof. In another embodiment, the transcriptional effector is selected from the group consisting of an alcohol-dependent effector, a lactose-dependent effector, a galactose-dependent effector, and a lexA-dependent effector, wherein the alcohol-dependent effector is an alc effector. In one aspect, the alc effector is an Aspergillus nidulans alc effector comprising an alcA promoter.

[0172] In another embodiment, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding an alcR transcription factor activating gene, thereby forming an alcA / alcR inducible system. In one aspect, the method comprises applying alcohol at a desired plant developmental stage.

[0173] In another embodiment, the lactose-dependent effector is a pOp effector. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding an LhG4 transcription factor activating gene, thereby forming an LhG4 / pOp inducible system.

[0174] In another embodiment, the galactose-dependent regulon is a Gal4 UAS effector. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding a Gal4 transcription factor activating gene, thereby forming a GVG-inducible system or a VGE-inducible system.

[0175] In another embodiment, the lexA-dependent effector is at least one LexA operon. In one aspect, the method further comprises an additional expression cassette comprising a nucleotide sequence encoding a LexA:VP16:ER activator, thereby forming an XVE-inducible system.

[0176] In one embodiment, the DNA modifying enzyme is selected from the group consisting of Meganuclease (MN), Zinc Finger Nuclease (ZFN), Transcription Activator-Like Effector Nuclease (TALEN), Chimeric FEN1-FokI, Mega-TAL and CRISPR nuclease. In one aspect, the CRISPR nuclease is a Cas nuclease, a Cas9 nuclease, a Cpf1 nuclease, a dCas9-FokI, a dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease, a Cas12a fused to a deaminase domain, a Cas12i nuclease, a Cas12j nuclease, a CasX nuclease, a CasY nuclease, a Cas13 nuclease, a Cas14 nuclease.

[0177] In another embodiment, the translocation factor is a glucocorticoid receptor. In one aspect, the glucocorticoid receptor comprises SEQ ID NO: 6. In another aspect, the glucocorticoid receptor is operably linked to a CRISPR nuclease. In another embodiment, the glucocorticoid receptor-linked CRISPR nuclease is a modified Cas12a nuclease ("GR-Cas12a") modified to include a glucocorticoid receptor binding domain. In one aspect, the GR-Cas12a comprises SEQ ID NO: 7. In another embodiment, the method further comprises that upon application of dexamethasone, GR-Cas12a translocates from the cytoplasm of the plant cell or plant tissue to the nucleus.

[0178] In another embodiment of the method, the unique edit is an indel mutation, a nucleotide substitution, an allelic substitution, a chromosomal translocation, or an insertion of a donor nucleic acid.

[0179] In another embodiment of the method, the plant cell or plant tissue is a dicotyledonous plant. In one aspect, the dicotyledonous plant cell or plant tissue is selected from the group consisting of Arabidopsis, sunflower, soybean, tomato, Brassica species, Populus (poplar), Eucalyptus, tobacco, Cannabis, potato, cotton, corn, rice, wheat, barley, sugarcane, Glycine tomentella, and other wild Glycine species.

[0180] In another embodiment of the method, the plant cell or plant tissue is a monocotyledonous plant. In one aspect, the monocotyledonous plant cell or plant tissue is selected from the group consisting of maize, wheat, rice, teosinte, sorghum, and barley. In another aspect, the monocotyledonous plant cell or plant tissue is maize.

[0181] In one embodiment, the plant cell or plant tissue is maize and the desired developmental stage is selected from the group consisting of VE, V1, V2, V(n), VT, R1, R2, R3, R4, R5 and R6 stages, where (n) is an integer representing the number of leaf collars present.

[0182] In another embodiment, the plant cell or plant tissue is soybean and the desired developmental stage is selected from the group consisting of VE, VC, V1, V2, V(n), R1, R2, R3, R4, R5, R6, R7 and R8 stages, where (n) is an integer representing the number of trifoils present.

[0183] In another embodiment, the method further comprises (d.) growing the progeny that collectively comprise the plurality of unique edits into seedlings, plantlets, immature plants, mature plants, or senescent plants; (e.) measuring at least one phenotype in the seedlings, plantlets, immature plants, mature plants, or senescent plants of step a.; and (f.) optionally, selecting the seedlings, plantlets, immature plants, mature plants, or senescent plants based on the measurement of the at least one phenotype.

[0184] In yet another embodiment, the method further comprises (d.) growing the progeny that collectively comprise the plurality of unique edits into seedlings, plantlets, immature plants, mature plants, or senescent plants; (e.) genotyping the seedlings, plantlets, immature plants, mature plants, or senescent plants of step a.; and (f.) optionally, selecting the seedlings, plantlets, immature plants, mature plants, or senescent plants based on the genotype of step b.

[0185] Another embodiment of the present invention is an edited plant produced by the methods described above.

[0186] Another embodiment of the present invention is an inducible gene editing system comprising an expression cassette comprising (a.) a nucleic acid encoding a DNA modifying enzyme, (b.) an optional nucleic acid encoding at least one guide RNA, and (c.) an inducer operably linked to the nucleic acid encoding the DNA modifying enzyme. In one embodiment, the system further comprises a cell harboring the expression cassette. In one aspect, the cell is a eukaryotic cell. In another aspect, the eukaryotic cell is a plant cell. EXAMPLES

[0187] Example 1. Alcohol-induced mosaicism In this example, mosaicism can be induced at a desired developmental stage of the plant organism, such as the development of a flower bud primordium, by application of ethanol to a plant containing an AlcR / AlcA inducible system operably linked to a GE system. In the AlcR / AlcA system, the AlcR transcription factor and AlcA promoter were isolated from Aspergillus nidulans. When a plant containing this system is exposed to ethanol, the plant metabolizes the ethanol to acetaldehyde, which, together with AlcR, activates the AlcA promoter, thereby driving expression of downstream genes.

[0188] Materials used: (1) Two chambers at 28°C during induction and for 2 weeks. (2) Arabidopsis plants were transformed with vector 25881, which contains an ethanol-inducible gene editing system for expression in Arabidopsis with a kanamycin selection marker containing three cassettes. In the first expression cassette, the dicot-optimized alcohol receptor gene (AlcR) from Aspergillus nidulans is driven by the constitutive promoter prAtEF1aA1. In the second expression cassette, prAlcA, a chimeric promoter consisting of a fusion of the AlcA promoter and the 35S minimal promoter (described in Caddick et al, 1998. Nature Biotechnology), drives the expression of Cas12a. In the presence of ethanol, AlcR binds to the AlcA promoter and activates transcription. The third expression cassette contains a gRNA targeting the second exon of the Glabrous1 (GL1) gene.

[0189] Treatments: (1) overnight soaking with 2% aqueous ethanol. (2) Control plants were grown under the same conditions except that they received no ethanol and were soaked with water only.

[0190] Compilation sampling: Harvest 8-16 siliques from various parts of the plant, germinate the seeds, and take the plants for sequencing, all seeds from one silique were placed in the same pot. After planting the seeds in soil, promote flowering and fruiting at 4C for 2 days.

[0191] After bolting, it takes about a month before the first siliques are ready to be harvested.

[0192] A. Immersion Treatment No.1 The plants were immersed in 2% ethanol. Controls were kept in a separate chamber without ethanol.

[0193] B.qRT PCR results We first tested the levels of Cas12a transcripts the next day and 6 days (144 hours) after an overnight soak (17 hours) in 2% ethanol, and named this experiment "1_6_days". We found that Cas12a was induced 17 hours after the start of soaking with 2% ethanol, but it returned to water control levels after 144 hours. To better estimate the temporal expression profile of induced Cas12a transcripts, we performed another experiment, named "time course", using a second batch of 25881 Arabidopsis plants, harvested 17, 46, 70 and 94 hours after soaking. In the second experiment ("time course"), a tray containing control plants was placed next to those soaked with 2% ethanol. After 17 hours, control plants showed activation of Cas12a transcripts, ostensibly from ethanol vapor coming from the 2% alc trays. For this reason, the day 1 (17 hours) water control data point from the "time course" experiment was excluded from the analysis.

[0194] We quantified the levels of Cas12a transcripts using TaqMan qRT-PCR (Table 1.) Based on the results from these experiments, we chose to soak in 2% ethanol every 4 days to maintain induced Cas12a.

[0195] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0196] We also performed an experiment to compare Cas12a expression in flowers and leaves. This experiment was performed using T2 plants from a subset of the T1 plants described above. The data show that alcohol induces Cas12a expression systemically (in leaves and flowers).

[0197] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0198] C. Expression Schedule Cas12a alcohol induction and gl1 mutagenesis To optimize the rate of gl1 mutagenesis, we divided the T1 event into four batches induced at various times after planting. The plants in the first batch were induced 23 days after transplanting into soil, while all of them were in the vegetative phase. The plants in the second batch were induced 34 days after transplanting, at which time all but two were in the vegetative phase. The plants in the third batch were induced 44 days after transplanting, at which time all were flowering. The plants in the fourth batch were induced 47 days after transplanting. To maintain activated Cas12a, all plants were immersed every fourth day after their first induction. Leaf samples were taken for all plants before induction and one day after induction. In addition, some plants were taken to measure Cas12a at later time points.

[0199] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0200] We selected a subset of T1 plants from each treatment to score the gl1 mutagenesis rate in the T2 generation. Eight to sixteen siliques from aged T1 plants were individually collected and all their seeds were sown onto individual 2" x 2" pots. The pots were stratified for four days at 4°C and then placed in a growth chamber set at 23°C with 12 hours of light. Leaves were scored for the glabrous phenotype by counting the number of seedlings without trichomes and dividing them by the total number of seedlings in the pot. Very few seedlings were mosaic, with one or more leaf sites that were glabrous and some with trichomes, and we scored those seedlings as glabrous. The mean glabrous 1 rate was calculated as the average rate of glabrous seedlings across all pots of the same T1 event.

[0201] [Table 4]

[0202] To evaluate the alleles generated by alcohol-inducible Cas12a, we picked individual T2 gl1 seedlings in 96-well plates for DNA extraction, PCR amplification and Sanger sequencing of the region around the targeting sequence in gl1. Multiple deletions in gl1 are not expected to result in glabrous seedlings when they are heterozygous because gl1 is recessive, and furthermore, trimeric deletions are likely to result in partial or no loss of function. To capture additional alleles of gl1 that were "masked" by heterozygosity or partial loss of function, we also sequenced wild-type seedlings in pools of five seedlings. A 614 base pair gl1 fragment was amplified using Q5 DNA polymerase (NEB) with primers GL1_F (CGTGTCACGAAAACCCATC) and GL1_R (TCAACTTAACCGGCCAAATC) and Sanger sequenced with primer GL1_F. The resulting trace chromatograms were analyzed using Synthego's ICE CRISPR analysis tool (www.biorxiv.org / content / 10.1101 / 251082v3) to characterize the edits.

[0203] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0204] Twenty-four plants (plants 01–24) were in the treatment group (i.e., 2% ethanol-soaked trays) and eight plants (plants 33–40) were in the control group (i.e., no ethanol). qRT PCR samples were collected at 17, 46, 70, and 94 h.

[0205] Seeds were collected from various parts of the Arabidopsis plant inflorescence and planted to evaluate gene editing of the glabrous1 target gene.

[0206] Editing will be assessed phenotypically by both observing the presence / absence of trichomes in leaves and by TaqMan and sequencing of gl1.

[0207] Example 2. DEX-induced mosaicism Two vectors for DEX-inducible Cas12a activity were constructed. In the first, vector 25657, the glucocorticoid receptor (GR) was fused to Cas12a driven by a constitutive promoter, prAtEF1aA1-07 (SEQ ID NO:2, FIG. 3). In version 2, vector 27057, there is a fusion of Gal4-VP16-GR driven by pr35S. Further details of these two constructs are provided below.

[0208] In the first example, the hormone-binding domain of the rat glucocorticoid receptor (GR) was fused to the editing enzyme of choice. By fusing the GR domain to Cas12a, it makes its nuclear localization dependent on the application of DEX. Arabidopsis plants were transformed with vector 25657, which contains sequences that allow the expression of DEX-inducible Cas12a ("GR-Cas12a"). GR-Cas12a lacks an NLS but contains a glucocorticoid receptor (GR) binding domain at the N-terminus separated by a long linker. The GR-Cas12 protein is constitutively expressed by the Arabidopsis promoter prAtEF1aA1, but remains localized to the cytoplasm. In the presence of glucocorticoids, such as dexamethasone ("DEX"), GR-Cas12a translocates to the nucleus. The vector also encodes a guide RNA targeting 5'-ccacatctctttagccctatcaa-3' in the second exon of the glabrous 1 (gl1) gene in Arabidopsis.

[0209] Transformed Arabidopsis plants are grown to the desired developmental stage, e.g., inflorescence development, at which point a glucocorticoid, e.g., dexamethasone, is applied to the plants. DEX application can be topical, root dipping, or otherwise. Plants are allowed to develop normally, and progeny are analyzed for mosaicism. Editing is evaluated phenotypically by observing the presence / absence of trichomes in leaves (see FIG. 6) and by both TaqMan and Sequencing of gl1. However, it has been found that the 25657 embodiment is not as efficient at editing as needed, either because the version of Cas12a is not sufficiently active or for other reasons related to the GR-Cas12a fusion. This problem is also reflected in the insufficiently high expression of Cas12a.

[0210] For vector 27057, the system is based on the interaction properties of steroids such as dexamethasone with the recombinant protein GVG, which is composed of the yeast (Saccharomyces cerevisiae) GAL4 DNA binding domain, the herpes simplex VP16 activation domain and the hormone binding domain derived from the rat (Rattus norvegicus) glucocorticoid receptor (GR). The hormone binding domain of the glucocorticoid receptor ("GR") has a size of 277 amino acids. In the absence of steroids, GVG interacts with a cytoplasmic complex containing heat shock protein 90 ("HSP90") and remains localized to the cytoplasm, thereby rendering it transcriptionally inactive. After treatment with the synthetic steroid hormone dexamethasone, the GVG / HSP90 interaction is disrupted and the GVG protein localizes to the cell nucleus, where it binds to a regulatory sequence consisting of multiple copies of GAL4 (GAL4 UAS) upstream of an activation sequence. When bound to this promoter region, the VP16 domain activates the transcription of downstream genes. This vector was transformed into the above Arabidopsis plants, and editing was assessed phenotypically by observing the presence / absence of trichomes in leaves, as well as by both TaqMan and sequencing of gl1.

[0211] Example 3. Induced mosaicism Other inducible systems can be used to obtain induced mosaicism when combined with gene editing techniques and deployed at the desired developmental stage. Useful systems include galactose-dependent effectors (e.g., the VGE inducible system) and lexA-dependent effectors (e.g., the LexA:VP16:ER activator (XVE inducible system)).

[0212] In the VGE system, the activator is, from N- to C-terminus, VP16:Gal4:ER. In this system, the effector is a promoter containing at least one, but typically four, five or six, Gal4-UAS elements upstream of a minimal promoter.

[0213] In lexA-dependent effector-based systems, such as the XVE-inducible system (I. Moore, et al., Transactivated and chemically inducible gene expression in plants, PLANT J., 45:651-683 (2006), as described in FIG. 3), the activator comprises a Lex:VP16 fusion protein further fused to a steroid receptor, for example, constitutively expressed by the 35S promoter. The steroid receptor can be the glucocorticoid receptor ("GR") or the estradiol receptor ("ER"). In the XVE system, the activator comprises, from the N- to C-terminus, a VP16 transcriptional activation domain and a lexA repressor domain fused to the human estrogen receptor ER ("Lex:VP16:ER" or "XVE"; these terms are used interchangeably). The effector is a promoter containing at least one, but typically 4, 5, 6, 7 or 8 lexA operators upstream of a minimal promoter, thereby activating transcription of the gene of interest. In the presence of an estrogen, such as 17-β-estradiol, XVE binds to multiple copies of the lexA domain and thus activates transcription of the downstream target - in this case, Cas12a. Alternatively, Cas12a can be constitutively expressed and XVE activates transcription of the gRNA molecule.

[0214] Other systems can be incorporated into the application to obtain inducible mosaicism, see Table 6 below.

[0215] [Table 6]

[0216] References Moore, et al., Transactivated and chemically inducible gene expression in plants, PLANT J., 45:651-683(2006). L. Borghi, Inducible Gene Expression Systems for Plants. In: Hennig L., Koehler C. (eds) Plant Developmental Biology. Methods in Molecular Biology (Methods and Protocols), vol 655. Humana Press, Totowa, NJ. doi.org / 10.1007 / 978-1-60761-765-5_5. Zuo and N.-H. Chua, Chemical-inducible systems for regulated expression of plant genes, CURRENT OP. BIOTECHNOL., 11(2):146-151(2000).

Claims

1. 1. A method for generating multiple unique edits in progeny of a plant, comprising: a. introducing an expression cassette into a plant cell or tissue, the expression cassette comprising: i. a nucleic acid encoding a DNA modifying enzyme; ii. any nucleic acid encoding at least one guide RNA; and iii. an inducer operably linked to the nucleic acid encoding a DNA modifying enzyme; and b. inducing said inducer at a desired stage of plant development; c. generating said plant cell or plant tissue into a plant having progeny, said progeny collectively comprising a plurality of unique edits; The method includes:

2. The method of claim 1 , wherein the inducer is a transcription effector or a translocation effector.

3. 10. The method of claim 1, wherein the inducer is induced by a chemical selected from an antibiotic, a metal, a steroid, a pesticide, a hormone, an alcohol, and an aldehyde.

4. 4. The method of claim 3, wherein the antibiotic is a tetracycline or a chemical mimetic thereof.

5. The method of claim 3 , wherein the metal is copper or a copper-containing compound.

6. 4. The method of claim 3, wherein the steroid is a glucocorticoid selected from the group consisting of dexamethasone, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone, and chemical mimetics thereof.

7. 7. The method of claim 6, wherein the glucocorticoid is dexamethasone.

8. 4. The method of claim 3, wherein the insecticide is selected from the group consisting of tebufenozide, methoxyfenozide, and chemical mimetics thereof.

9. 4. The method of claim 3, wherein the hormone is selected from the group consisting of estrogen, estrogen, 17-β-estradiol, and chemical mimetics thereof.

10. 4. The method of claim 3, wherein the alcohol is selected from the group consisting of ethanol and chemical mimetics thereof.

11. 4. The method of claim 3, wherein the aldehyde is selected from the group consisting of acetaldehyde and chemical mimetics thereof.

12. 3. The method of claim 2, wherein the transcriptional effector is selected from the group consisting of an alcohol-dependent effector, a lactose-dependent effector, a galactose-dependent effector, and a lexA-dependent effector.

13. 13. The method of claim 12, wherein the alcohol dependence effector is an alc effector, and the alc effector is an Aspergillus nidulans alc effector comprising the alcA promoter.

14. 14. The method of claim 13, further comprising an additional expression cassette comprising a nucleotide sequence encoding an alcR transcription factor activating gene, thereby forming an alcA / alcR inducible system.

15. 15. The method of claim 14, wherein the inducing in step b. comprises applying alcohol at the desired plant development stage.

16. The method of claim 2 , wherein the lactose-dependent effector is a pOp effector.

17. 17. The method of claim 16, further comprising an additional expression cassette comprising a nucleotide sequence encoding an LhG4 transcription factor activating gene, thereby forming an LhG4 / pOp inducible system.

18. The method of claim 2 , wherein the galactose-dependent regulon is a Gal4 UAS effector.

19. The method of claim 18, further comprising an additional expression cassette comprising a nucleotide sequence encoding a Gal4 transcription factor activating gene, thereby forming a GVG inducible system or a VGE inducible system.

20. The method of claim 2 , wherein the lexA-dependent effector is at least one LexA operon.

21. 21. The method of claim 20, further comprising an additional expression cassette comprising a nucleotide sequence encoding a LexA:VP16:ER activator, thereby forming an XVE-inducible system.

22. 2. The method of claim 1, wherein the DNA modifying enzyme is selected from the group consisting of Meganucleases (MN), Zinc Finger Nucleases (ZFN), Transcription Activator-Like Effector Nucleases (TALEN), chimeric FEN1-FokI, Mega-TAL, and CRISPR nucleases.

23. 23. The method of claim 22, wherein the CRISPR nuclease is a Cas nuclease, a Cas9 nuclease, a Cpf1 nuclease, a dCas9-FokI, a dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease, a Cas12a fused to a deaminase domain, a Cas12i nuclease, a Cas12j nuclease, a CasX nuclease, a CasY nuclease, a Cas13 nuclease, a Cas14 nuclease.

24. The method of claim 2 , wherein the translocation factor is a glucocorticoid receptor.

25. 25. The method of claim 24, wherein the glucocorticoid receptor comprises SEQ ID NO:6, the glucocorticoid receptor is operably linked to a CRISPR nuclease, and the glucocorticoid receptor-linked CRISPR nuclease is a modified Cas12a nuclease ("GR-Cas12a") modified to include a glucocorticoid receptor binding domain.

26. The method of claim 25, wherein the GR-Cas12a comprises SEQ ID NO:

7.

27. 27. The method of claim 26, wherein upon application of dexamethasone, the GR-Cas12a translocates from the cytoplasm to the nucleus of the plant cell or plant tissue.

28. 2. The method of claim 1, wherein the unique edit is an indel mutation, a nucleotide substitution, an allelic substitution, a chromosomal translocation, or an insertion of a donor nucleic acid.

29. 2. The method of claim 1, wherein the plant cell or plant tissue is a dicotyledonous plant, and the dicotyledonous plant cell or plant tissue is selected from the group consisting of Arabidopsis, sunflower, soybean, tomato, Brassica species, Populus (poplar), Eucalyptus, tobacco, Cannabis, potato, cotton, corn, rice, wheat, barley, sugarcane, Glycine tomentella, and other wild Glycine species.

30. 2. The method of claim 1, wherein the plant cell or plant tissue is a monocotyledonous plant, and the monocotyledonous plant cell or plant tissue is selected from the group consisting of maize, wheat, rice, teosinte, sorghum, and barley.

31. 31. The method of claim 30, wherein the monocotyledonous plant cell or plant tissue is maize.

32. 2. The method of claim 1, wherein the plant cell or plant tissue is maize and the desired developmental stage is selected from the group consisting of VE, V1, V2, V(n), VT, R1, R2, R3, R4, R5, and R6 stages, where (n) is an integer representing the number of leaf collars present.

33. 2. The method of claim 1, wherein the plant cell or plant tissue is soybean and the desired developmental stage is selected from the group consisting of VE, VC, V1, V2, V(n), R1, R2, R3, R4, R5, R6, R7, and R8 stages, where (n) is an integer representing the number of trilobules present.

34. 10. The method of claim 1 further comprising: growing the progeny, which collectively comprise the plurality of unique edits, into seedlings, plantlets, immature plants, mature plants, or senescent plants; determining at least one phenotype in the seedling, plantlet, immature plant, mature plant, or senescent plant of step a.; and Optionally, selecting a seedling, a plantlet, an immature plant, a mature plant, or a senescent plant based on said measurement of said at least one phenotype.

35. 10. The method of claim 1 further comprising: growing the progeny, which collectively comprise the plurality of unique edits, into seedlings, plantlets, immature plants, mature plants, or senescent plants; genotyping the seedling, plantlet, immature plant, mature plant, or senescent plant of step a.; and Optionally, selecting seedlings, plantlets, immature plants, mature plants, or senescent plants based on the genotype of step b.

36. 36. An edited plant produced by the method of any one of claims 1 to 35.

37. 1. An inducible gene editing system, comprising: a. a nucleic acid encoding a DNA modifying enzyme; b. any nucleic acid encoding at least one guide RNA; and c. an inducer operably linked to the nucleic acid encoding a DNA modifying enzyme.

1. An inducible gene editing system comprising an expression cassette comprising:

38. The system of claim 37, further comprising a cell harboring the expression cassette.

39. 40. The system of claim 38, wherein the cell is a eukaryotic cell, and the eukaryotic cell is a plant cell.

Images