Products and Compositions

Abstract

Products, compositions and uses thereof are provided. In particular, nucleic acid products are provided that modulate, and in particular disrupt or inhibit, Factor XI (FXI) gene expression. The products may be oligomeric compounds comprising at least a first region of linked nucleosides having at least a first nucleobase sequence that is at least partially complementary to at least a portion of an RNA transcribed from the FXI gene, said first nucleobase sequence being selected from the following sequences: SEQ ID NOs: 1 to 250, or a portion thereof.

Description

[Technical field]

[0001] Nucleic acid products are provided that regulate, interfere with, or inhibit factor XI (FXI) gene expression. Methods, compounds, and compositions are provided for reducing FXI mRNA and FXI protein expression in animals. Such methods, compounds, and compositions are useful for treating, preventing, or ameliorating thromboembolic diseases, such as deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal failure (ESRD), including dialysis-associated thrombosis, or other procoagulant conditions. [Background technology]

[0002] The circulatory system requires mechanisms to prevent blood loss and to counter inappropriate intravascular occlusion. In general, coagulation involves a cascade of reactions that culminates in the conversion of soluble fibrinogen to an insoluble fibrin gel. Steps in the cascade include the conversion of an inactive zymogen to an active enzyme, which then catalyzes the next step in the cascade.

[0003] [Coagulation cascade] The coagulation cascade can be initiated via two branches: the main tissue factor pathway (also called the "extrinsic pathway") and the contact activation pathway (also called the "intrinsic pathway").

[0004] The tissue factor pathway is initiated by the cell surface receptor tissue factor (TF, also called factor III), which is constitutively expressed by extravascular cells (pericytes, cardiac myocytes, smooth muscle cells, and keratinocytes) and by vascular monocytes and endothelial cells upon induction by inflammatory cytokines or endotoxins (Drake et al., Am J Pathol 1989, 134:1087-1097). TF is the high-affinity cellular receptor for the serine protease coagulation factor VIIa. In the absence of TF, the catalytic activity of VIIa is very low, and binding to TF is required to make VIIa functional through an allosteric mechanism (Drake et al., Am J Pathol 1989, 134:1087-1097). The TF-VIIa complex activates factor X to factor Xa. Xa then combines with its cofactor, factor Va, to form the prothrombinase complex, which activates prothrombin (also known as factor II or factor 2) to thrombin (also known as factor IIa or factor 2a).

[0005] Thrombin activates platelets, converts fibrinogen to fibrin, and promotes fibrin cross-linking by activating factor XIII, thereby forming a stable plug at sites where TF is exposed on extravascular cells. In addition, thrombin enhances the coagulation cascade response by activating factors V and VIII.

[0006] The contact activation pathway is triggered by the activation of factor XII to factor XIIa. Factor XIIa converts XI to XIa, which converts IX to IXa. IXa combines with its cofactor VIIIa to convert X to Xa. The two pathways converge at this point, as factor Xa combines with factor Va to activate prothrombin (factor II) to thrombin (factor IIa). Factor XI enhances both clot formation and stability in vitro, but is not thought to be involved in the initiation of coagulation. Rather, factor XI is important in the propagation phase of clot growth (von de Borne et al., Blood Coagulation and Fibrinolysis, 2006, 17:251-257). In addition, the amplification of factor XI-dependent thrombin generation leads to activation of TAFI (thrombin-activatable fibrinolysis inhibitor), which renders the clot less susceptible to fibrinolysis (Bouma et al., J Thromb Haemost 1999;82:1703-1708).

[0007] [Inhibition of coagulation] The coagulation cascade is inhibited by at least three mechanisms: activated protein C, antithrombin, and tissue factor pathway inhibitor. Activated protein C is a serine protease that cleaves cofactors Va and VIIIa. Protein C is activated by thrombin, which contains thrombomodulin, and requires the coenzyme protein S to function. Antithrombin is a serine protease inhibitor (serpin) that inhibits the serine proteases thrombin, Xa, XIIa, XIa, and IXa. Tissue factor pathway inhibitor inhibits the action of Xa and the TF-VIIa complex. (Schwartz AL, et al., Trends Cardiovasc Med. 1997;7:234-239.)

[0008] [disease] Thrombosis is the pathological occurrence of a blood clot, and embolism occurs when the clot travels to another part of the body and interferes with the functioning of an organ. Thromboembolism can result in conditions such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Most cases of thrombosis are due to acquired extrinsic problems such as surgery, cancer, and immobility, but some cases are due to genetic predispositions such as antiphospholipid syndrome and factor V Leiden, an autosomal dominant disorder. (Bertina RM et al. Nature 1994;369:64-67.)

[0009] [Treatment] The most commonly used anticoagulants, warfarin, heparin, low molecular weight heparins (LMWHs), and the newer direct oral anticoagulants (DOACs), all have significant drawbacks. Warfarin is typically used to treat patients suffering from atrial fibrillation. The drug interacts with vitamin K-dependent clotting factors, including factors II, VII, IX, and X. Anticoagulant proteins C and S are also inhibited by warfarin. Pharmacotherapy using warfarin is further complicated by the fact that warfarin interacts with other medications, including drugs used to treat atrial fibrillation, such as amiodarone. Treatment with warfarin is difficult to predict, so patients must be closely monitored to detect any signs of abnormal bleeding.

[0010] Heparin works by activating antithrombin, which inhibits both thrombin and factor X (Bjork I, Lindahl U. Mol Cell Biochem. 1982 48:161-182). Treatment with heparin can cause an immune reaction that causes platelets to aggregate in blood vessels, potentially leading to thrombosis. This side effect is known as heparin-induced thrombocytopenia (HIT) and requires patient monitoring due to increased bleeding. Long-term treatment with heparin can also cause osteoporosis. LMWHs can also inhibit factor II, but to a lesser extent than unfractionated heparin (UFH). LMWHs have been implicated in the development of HIT.

[0011] Several direct oral anticoagulants are FDA approved for the treatment of thrombotic disorders, including four factor Xa inhibitors, betrixaban, apixaban, rivaroxaban, and edoxaban, and one direct thrombin inhibitor, dabigatran. (Smith, M., Surg Clin N Am 2018 98:219-238). Rivaroxaban, dabigatran, and edoxaban all exhibit increased bleeding compared to warfarin, especially increased risk of gastrointestinal bleeding.

[0012] Thus, there remains a need for therapies to treat thromboembolic disorders without the risk of increased bleeding. Accordingly, we aim to provide compounds, methods, and pharmaceutical compositions for treating such disorders.

[0013] It has been shown that double-stranded RNA (dsRNA), capable of binding complementary to expressed mRNA, can block gene expression by a mechanism named RNA interference (RNAi) (Fire et al., 1998, Nature. 1998 Feb 19;391(6669):806-1 1 and Elbashir et al., 2001, Nature. 2001 May 24;41 1(6836):494-8). Short dsRNAs direct gene-specific post-transcriptional silencing in many organisms, including vertebrates, making them a useful tool to study gene function. RNAi is mediated by the RNA-induced silencing complex (RISC), a sequence-specific multicomponent nuclease that destroys messenger RNAs that are homologous to the silencing trigger loaded into the RISC complex. Interfering RNAs (iRNAs), such as siRNAs, antisense RNAs, and microRNAs, are oligonucleotides that prevent the formation of proteins by gene silencing, i.e., by inhibiting gene translation of proteins through degradation of mRNA molecules. Gene silencing agents are becoming increasingly important for therapeutic applications in medicine.

[0014] According to Watts and Corey in the Journal of Pathology (2012; Vol 226, p365-379), there are algorithms available for designing nucleic acid silencing triggers, but all of these have severe limitations. Because the algorithms do not take into account factors such as the tertiary structure of the target mRNA or the involvement of RNA-binding proteins, various experimental methods may be required to identify potent siRNAs. Thus, the discovery of potent nucleic acid silencing triggers with minimal off-target effects is a complex process. The impending drug development of these molecules requires that they can be synthesized economically, distributed to target tissues, enter cells, and function within acceptable limits of toxicity. Thus, the objective is to provide compounds, methods, and pharmaceutical compositions for the treatment of thromboembolic diseases as described herein, including oligomeric compounds that modulate and inhibit gene expression by RNAi. Summary

[0015] Nucleic acid products that modulate, disrupt, or inhibit Factor XI (FXI) gene expression, and related therapeutic uses, are provided. Specific oligomeric compounds and sequences are described herein. This Summary is not intended to identify key features or essential features of the subject matter described herein, nor is it intended to be used to determine the scope of the subject matter. DETAILED DESCRIPTION AND EMBODIMENTS

[0016] Although the embodiments described below are exemplary, those skilled in the art will recognize that additional embodiments may be realized.

[0017] It will be understood that the benefits and advantages described herein may relate to one embodiment or to several embodiments, and the embodiments are not limited to those that solve any or all of the described problems or have any or all of the described benefits and advantages.

[0018] As will be apparent to one skilled in the art, features of different aspects and embodiments may be combined as appropriate and may be combined with any of the aspects described herein. [Brief description of the drawings]

[0019] The embodiments described below are by way of example only and refer to the following non-limiting drawings: [Figure 1a] FIG. 1 shows the stability of the duplexes in Table 2 in Example 2. [Figure 1b] Same as above [Figure 1c] Same as above [Figure 1d] Same as above [Figure 1e] Same as above [Figure 1f] Same as above [Figure 1g] Same as above [Figure 1h] Same as above [Figure 1i] Same as above [Figure 1j] Same as above [Figure 1k] Same as above [Figure 1l] Same as above [Figure 1m] Same as above [Figure 1n] Same as above [Figure 1o] Same as above [Figure 1p] Same as above [Figure 1q] Same as above [Figure 1r] Same as above [Figure 1s] Same as above [Figure 1t] Same as above [Figure 1u] Same as above [Figure 1v] Same as above [Figure 1w] Same as above [Figure 1x] Same as above [Figure 1y] Same as above [Figure 1z] Same as above [Figure 1zi] Same as above [Figure 1zii] Same as above [Figure 1ziii] Same as above [Figure 1ziv] Same as above [Figure 1zv]Same as above [Figure 1zvii] Same as above [Diagram 2] FIG. 2 shows the linear dose response of two independent F11 qPCR assays described in Example 2. [Diagram 3] 3 to 12 show the results of screening oligomeric compounds, including the oligonucleotides of Table 1a / 1b in Example 1, for FXI gene expression as a percentage of gene expression in untreated cells. [Figure 4] Same as above [Diagram 5] Same as above [Figure 6] Same as above [Figure 7] Same as above [Figure 8] Same as above [Figure 9] Same as above [Figure 10] Same as above [Figure 11] Same as above [Figure 12] Same as above [Figure 13] FIG. 13 provides dose-response curves for the 26 FXI lead compounds identified in Example 2. [Figure 14] FIG. 14 provides dose-response curves for five FXI lead compounds that were further identified from the results in FIG. [Figure 15] Figures 15 to 17 show the entire sequences of oligomeric compounds F11-91, F11-46, and F11-152. [Figure 16] Same as above [Figure 17] Same as above [Figure 18] FIG. 18 shows compounds selected for medicinal chemistry. [Figure 19] FIG. 19 shows the performance of the compounds shown in FIG. [Figure 20] FIG. 20 shows compounds designed based on the results shown in FIG. [Figure 21] FIG. 21 shows data for the compounds displayed in FIG. [Figure 22] FIG. 22 shows the structures of the compounds that were tested in humanized mice. [Diagram 23] FIG. 23 shows data obtained from studies in humanized mice. [Figure 24] FIG. 24 shows the design of an in vivo study with compound 91-Conv-31. [Diagram 25] FIG. 25 shows the performance of compounds in an in vivo test for knockdown of Factor XI activity. [Figure 26] FIG. 26 shows the molecular mechanisms underlying the specificity targeting tests carried out in the course of in vivo testing. [Figure 27] FIG. 27 shows the readout results of the test shown in FIG. [Figure 28] FIG. 28 presents data demonstrating the absence of side effects. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] [Definition] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, organic synthesis, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis and chemical analysis. Certain such techniques and procedures can be found, for example, in "Carbohydrate Modifications in Antisense Research," Sangvi and Cook, eds., American Chemical Society, Washington DC, 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 21st ed., 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications," Stanley T. Crooke, ed., CRC Press, Boca Raton, Florida; and Sambrook et al., "Molecular Cloning, A laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory Press, 1989, which are incorporated herein by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other materials referenced throughout this disclosure are hereby incorporated by reference in their entirety.

[0021] Unless otherwise stated, the following terms have the following meanings: As used herein, "additive" refers to any compound or mixture of compounds added to the compositions provided herein that is suitable for delivery of oligomeric compounds.

[0022] As used herein, "nucleoside" refers to a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety, and phosphate-linked nucleosides are also referred to as "nucleotides."

[0023] As used herein, "chemical modification" or "chemically modified" refers to a chemical difference in a compound compared to its naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. With respect to oligonucleotides, chemical modifications do not include differences in nucleobase sequence alone.

[0024] As used herein, "furanosyl" refers to a structure containing a five-membered ring that contains four carbon atoms and one oxygen atom.

[0025] As used herein, a "naturally occurring sugar moiety" refers to a ribofuranosyl found in naturally occurring RNA or a deoxyribofuranosyl found in naturally occurring DNA. A "naturally occurring sugar moiety" as referred to herein is also referred to as an "unmodified sugar moiety." In particular, such a "naturally occurring sugar moiety" or "unmodified sugar moiety" as referred to herein has -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2' position of the sugar moiety, and in particular has -H (DNA sugar moiety) at the 2' position of the sugar moiety.

[0026] As used herein, "sugar moiety" refers to the naturally occurring sugar moiety of a nucleoside or a modified sugar moiety. As used herein, "modified sugar moiety" refers to a substituted sugar moiety or sugar substitute.

[0027] As used herein, "substituted sugar moiety" refers to a furanosyl that is substituted. Substituted sugar moieties include, but are not limited to, furanosyl that contain substituents at the 2', 3', 5', and / or 4' positions. Certain substituted sugar moieties are bicyclic sugar moieties.

[0028] As used herein, a "2'-substituted sugar moiety" means a furanosyl that contains a substituent other than H or OH at the 2' position. Unless otherwise specified, the 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of the 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring).

[0029] As used herein, "MOE" means -OCH2CH2OCH3.

[0030] As used herein, "2'-F nucleoside" refers to a nucleoside that contains a sugar that contains a fluorine at the 2' position. Unless otherwise specified, the fluorine in a 2'-F nucleoside is in the ribo position (replacing the OH of natural ribose). Uniformly modified 2'-fluorinated (ribo)oligonucleotide duplexes hybridized to an RNA strand are not RNase H substrates, although ara analogs retain RNase H activity.

[0031] As used herein, the term "sugar surrogate" refers to structures that do not include furanosyl and can replace the naturally occurring sugar moiety of a nucleoside such that the resulting nucleoside subunits can be linked together and / or to other nucleosides to form oligomeric compounds that can hybridize to complementary oligomeric compounds. Such structures include rings that contain a different number of atoms than furanosyl (e.g., 4-, 6-, or 7-membered rings); replacement of the oxygen of furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures can also include substitutions corresponding to those described for the substituted sugar moiety (e.g., a 6-membered carbocyclic bicyclic sugar surrogate that optionally contains additional substituents). Sugar surrogates also include more complex sugar substitutes (such as the acyclic systems of peptide nucleic acids). Sugar surrogates include, but are not limited to, morpholino, cyclohexenyl, and cyclohexitol.

[0032] As used herein, "bicyclic sugar moiety" means a modified sugar moiety containing a 4- to 7-membered ring (including but not limited to, furanosyl) that contains a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4- to 7-membered ring is a sugar ring. In certain embodiments, the 4- to 7-membered ring is a furanosyl. In certain such embodiments, a bridge connects the 2' and 4' carbons of the furanosyl.

[0033] As used herein, "nucleotide" refers to a nucleoside that further comprises a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by a phosphate bond, and thus include, but are not limited to, "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0034] As used herein, "nucleobase" refers to a group of atoms that can be linked to a sugar moiety to produce a nucleoside that can be incorporated into an oligonucleotide and that can combine with a complementary naturally-occurring nucleobase of another oligonucleotide or nucleic acid. The nucleobase can be naturally occurring or modified.

[0035] As used herein, the term "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA, i.e., the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0036] As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase.

[0037] As used herein, "modified nucleoside" means a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides can include modified sugar moieties and / or modified nucleobases.

[0038] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0039] As used herein, "locked nucleic acid nucleoside" or "LNA" refers to a nucleoside that includes a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge.

[0040] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a substituent other than H or OH at the 2' position of the sugar moiety. Unless otherwise specified, 2'-substituted nucleosides are not bicyclic nucleosides.

[0041] As used herein, "deoxynucleoside" refers to a nucleoside containing a 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, 2'-deoxynucleosides may contain modified nucleobases or may contain RNA nucleobases (e.g., uracil).

[0042] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0043] As used herein, "modified oligonucleotide" means an oligonucleotide containing at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0044] As used herein, a "bond" or "linking group" means a group of atoms that joins two or more other groups of atoms.

[0045] As used herein, "internucleoside linkage" means a covalent bond between adjacent nucleosides in an oligonucleotide.

[0046] As used herein, a "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. As used herein, a "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage. In particular, the "modified internucleoside linkage" referred to herein can include modified phosphorus linking groups, such as phosphorothioate or phosphorodithioate internucleoside linkages.

[0047] As used herein, "terminal internucleoside linkage" means the linkage between the last two nucleosides of an oligonucleotide or a defined region thereof.

[0048] As used herein, a "phosphorus linking group" means a linking group that includes a phosphorus atom and can include naturally occurring phosphorus linking groups as found in naturally occurring RNA or DNA, such as a phosphodiester linking group, or modified phosphorus linking groups that are not commonly found in naturally occurring RNA or DNA, such as a phosphorothioate or phosphorodithioate linking group. Thus, phosphorus linking groups can include, but are not limited to, phosphodiesters, phosphorothioates, phosphorodithioates, phosphonates, methylphosphonates, phosphoramidates, phosphorothioamidates, thionoalkylphosphonates, phosphotriesters, thionoalkylphosphotriesters, and boranophosphates.

[0049] As used herein, "phosphorus internucleoside linking group" means a phosphorus linking group that directly links two nucleosides.

[0050] As used herein, "oligomeric compound" refers to a polymeric structure that includes two or more substructures. In certain embodiments, the oligomeric compound includes an oligonucleotide, such as a modified oligonucleotide. In certain embodiments, the oligomeric compound further includes one or more conjugate groups and / or end groups and / or ligands. In certain embodiments, the oligomeric compound consists of an oligonucleotide. In certain embodiments, the oligomeric compound includes a backbone of one or more linked monomeric sugar moieties, each linked monomeric sugar moiety being directly or indirectly bound to a heterocyclic base moiety. In certain embodiments, the oligomeric compound may also include monomeric sugar moieties that are not linked to a heterocyclic base moiety, thereby providing an abasic site. The oligomeric compound may be defined only in terms of the nucleobase sequence, i.e., by specifying the sequence of A, G, C, U (or T). In such cases, the structure of the sugar-phosphate backbone is not particularly limited and may or may not include modified sugars and / or modified phosphates. On the other hand, oligomeric compounds can be defined more comprehensively, i.e. by specifying not only the nucleobase sequence but also the structure of the backbone, in particular the sugar and / or phosphate modification state (unmodified, 2'-OMe modified, 2'-F modified, etc.).

[0051] As used herein, "terminal group" refers to one or more atoms attached to either or both of the 3' or 5' ends of an oligonucleotide. In certain embodiments, a terminal group comprises one or more terminal nucleosides.

[0052] As used herein, "conjugate" or "conjugate group" refers to an atom or group of atoms attached to an oligonucleotide or oligomeric compound. In certain embodiments, the conjugate group links a ligand to the modified oligonucleotide or oligomeric compound. In general, conjugate groups may modify one or more properties of the compound to which they are attached, including, but not limited to, the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties.

[0053] As used herein, "conjugate linker" or "linker" in the context of a conjugate group refers to a portion of a conjugate group, including any atom or group of atoms, that covalently links an oligonucleotide to another portion of the conjugate group. In certain embodiments, the point of attachment on an oligomeric compound is the 3' oxygen atom of the 3' hydroxyl group of the 3' terminal nucleoside of an oligonucleotide. In certain embodiments, the point of attachment on an oligomeric compound is the 5' oxygen atom of the 5' hydroxyl group of the 5' terminal nucleoside of an oligonucleotide. In certain embodiments, the bond for forming the bond to the oligomeric compound is a cleavable bond. In certain such embodiments, such a cleavable bond constitutes all or part of the cleavable moiety.

[0054] In certain embodiments, the conjugate group comprises a cleavable moiety (e.g., a cleavable bond or a cleavable nucleoside) and a ligand moiety, which may comprise one or more ligands, e.g., a glycocluster moiety, such as N-acetyl-galactosamine, also referred to as "GalNAc". In certain embodiments, the glycocluster moiety is distinguished by the number and identity of the ligand. For example, in certain embodiments, the glycocluster moiety comprises two GalNAc groups. For example, in certain embodiments, the glycocluster moiety comprises three GalNAc groups, which is particularly preferred. In certain embodiments, the glycocluster moiety comprises four GalNAc groups. Such ligand moieties are attached to the oligomeric compound via a cleavable moiety, such as a cleavable bond or a cleavable nucleoside. The ligands may be arranged in a linear or branched arrangement, such as a biantennary or triantennary arrangement.

[0055] As used herein, "cleavable moiety" refers to a bond or group that is cleavable under physiological conditions. In certain embodiments, the cleavable moiety is cleaved inside a cell or intracellular compartment, such as an endosome or lysosome. In certain embodiments, the cleavable moiety is cleaved by an endogenous enzyme, such as a nuclease. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is a phosphodiester bond.

[0056] As used herein, "cleavable bond" means any chemical bond that can be broken.

[0057] As used herein, "glycocluster" means a compound having one or more sugar residues attached to a linker group.

[0058] As used herein, "modified sugar" means any sugar that has one or more chemical modifications compared to a naturally occurring sugar.

[0059] As used herein, "sugar derivative" means any compound that can be synthesized using a sugar as a starting material or intermediate.

[0060] As used herein, "sugar" refers to a naturally occurring sugar, a modified sugar, or a sugar derivative. A sugar is a biomolecule that contains carbon (C), hydrogen (H), and oxygen (O) atoms. A sugar can include a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide, such as one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. A particularly preferred sugar is an N-acetyl-galactosamine moiety.

[0061] As used herein, a "chain" refers to an oligomeric compound comprising linked nucleosides. Linkers include, but are not limited to, phosphodiesters and variants thereof as disclosed herein. A chain can also be considered as a plurality of linked nucleotides, in which case the linker would be a covalent bond.

[0062] The term "construct" refers to a region of linked nucleosides defined in terms of nucleobase sequence and sugar modifications. A construct may correspond to, or be a part of, a chain or compound.

[0063] As used herein, "single strand" or "single-stranded" refers to an oligomeric compound that contains linked nucleosides joined in a contiguous sequence with no breaks between them. Such a single strand may contain a region of sufficient self-complementarity to allow the formation of a stable self-duplex in a hairpin configuration.

[0064] As used herein, "hairpin" refers to a single-stranded oligomeric compound that contains a duplex formed by base pairing between sequences in the self-complementary and oppositely oriented strands.

[0065] As used herein, "hairpin loop" refers to an unpaired loop of linked nucleosides within a hairpin that is generated as a result of hybridization of self-complementary sequences. The resulting structure appears as a loop or U-shape.

[0066] In particular, short hairpin RNAs, also called shRNAs, comprise a duplex region and a loop connecting the regions forming the duplex. The ends of the duplex region without the loop may be blunt-ended or may have (a) 3' and / or (a) 5' overhangs. Advantageously, the constructs are blunt-ended. Such molecules are also called "mxRNAs". As used herein, the term "mxRNA" is understood in particular as defined in WO 2020 / 044186 A2, which is incorporated herein by reference in its entirety. Particularly preferred hairpin RNAs according to the present invention are those shown in Tables 6 and 7 and Figures 15 to 18, 20 and 22.

[0067] As used herein, "direction" refers to the end-to-end chemical orientation of an oligonucleotide based on the chemical convention of numbering the carbon atoms of the sugar moiety, meaning that there is a 5' end defined by the 5' carbon of the sugar moiety and a 3' end defined by the 3' carbon of the sugar moiety. In a duplex or double-stranded oligonucleotide, each strand runs in an opposite 5' to 3' direction, allowing base pairing between them.

[0068] As used herein, "duplex," also abbreviated as "dup," refers to two or more complementary regions or strands of an oligonucleotide hybridized together by non-covalent sequence-specific interactions between them. Most commonly, hybridization in a duplex is between the nucleobases adenine (A) and thymine (T), and / or (A) adenine and uracil (U), and / or guanine (G) and cytosine (C). A duplex may be part of a single-stranded structure, in which case hybridization occurs by self-complementarity or as a result of hybridization between the respective strands of a double-stranded molecule.

[0069] As used herein, "double strand" or "double stranded" refers to a pair of oligomeric compounds that are hybridized to one another. In certain embodiments, a double-stranded oligomeric compound comprises a first and a second oligomeric compound.

[0070] As used herein, "expression" refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5' cap), and translation.

[0071] As used herein, "transcription" or "transcribed" refers to the first of several steps in DNA-based gene expression in which a target sequence of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. During transcription, a DNA sequence is read by RNA polymerase, which produces a complementary, antiparallel RNA sequence called the primary transcript.

[0072] As used herein, "target sequence" refers to a sequence to which an oligomeric compound is intended to hybridize to effect a desired activity with respect to expression of Factor XI. The oligonucleotide has sufficient complementarity to its target sequence to permit hybridization under physiological conditions.

[0073] As used herein, "nucleobase complementarity" or "complementarity", when referring to a nucleobase, refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In certain embodiments, complementary nucleobase refers to a nucleobase of an oligomeric compound that can base pair with a nucleobase of its target sequence. For example, if a nucleobase at a given position of an oligomeric compound can hydrogen bond with a nucleobase at a given position of a target sequence, the hydrogen bond position between the oligomeric compound and the target sequence is considered to be complementary in that nucleobase pair. Nucleobases that contain certain modifications may maintain the ability to pair with the corresponding nucleobase, thus still allowing nucleobase complementarity.

[0074] As used herein, "non-complementary" with respect to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0075] As used herein, "complementary" with respect to an oligomeric compound (e.g., linked nucleosides, oligonucleotides) refers to the capacity of such oligomeric compound, or a region thereof, to hybridize to a target sequence or a region of the oligomeric compound itself through nucleobase complementarity.

[0076] Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatching is tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80%> complementary. In certain embodiments, complementary oligomeric compounds or regions are 90%> complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.

[0077] As used herein, "self-complementary" with respect to an oligomeric compound means a compound that can fold back on itself and form a duplex as a result of nucleobase hybridization of internal complementary strand regions. Depending on how close together the stranded regions are and / or how long they are, the compound may form hairpin loops, junctions, bulges, or internal loops.

[0078] As used herein, "mismatch" means a nucleobase of an oligomeric compound that cannot pair with a nucleobase at the corresponding position of a target sequence or, if the oligomeric compound hybridizes as a result of self-complementarity, at the corresponding position of the oligomeric compound itself when the oligomeric compound and the target sequence and / or the self-complementary region of the oligomeric compound are aligned.

[0079] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an oligomeric compound with its target sequence). Although not limited to a particular mechanism, the most common pairing mechanisms involve hydrogen bonding, such as Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0080] As used herein, "specifically hybridize" refers to the ability of an oligomeric compound to hybridize to a nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.

[0081] As used herein, "fully complementary" with respect to an oligomeric compound or region thereof means that each nucleobase of an oligomeric compound or region thereof is capable of pairing with a nucleobase of a complementary nucleic acid target sequence or self-complementary region of an oligomeric compound. Thus, a fully complementary oligomeric compound or region thereof does not contain any mismatched or unhybridized nucleobases with respect to its target sequence or self-complementary region of an oligomeric compound.

[0082] As used herein, "percent complementarity" refers to the percentage of nucleobases of an oligomeric compound that are complementary to an equal length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of an oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0083] As used herein, "percent identity" means the number of nucleobases of a first nucleic acid that are of the same type (irrespective of chemical modification) as the nucleobase at the corresponding position of a second nucleic acid, divided by the total number of nucleobases of the first nucleic acid.

[0084] As used herein, "modulation" refers to a change in the amount or quality of a molecule, function, or activity compared to the amount or quality of the molecule, function, or activity prior to modulation. For example, modulation includes changes in either an increase (stimulation or induction) or decrease (inhibition or reduction) in gene expression.

[0085] As used herein, "type of modification" with respect to a nucleoside or a "type" of nucleoside refers to the chemical modification of the nucleoside and includes modified nucleosides and unmodified nucleosides. Thus, unless otherwise indicated, a "nucleoside having a first type of modification" may be an unmodified nucleoside.

[0086] As used herein, "differently modified" refers to chemical modifications or chemical substituents that are different from each other, including the absence of modification. Thus, for example, MOE nucleosides and unmodified naturally occurring RNA nucleosides are "differently modified", even though the naturally occurring nucleosides are unmodified. Similarly, DNA oligonucleotides and RNA oligonucleotides are "differently modified", even though both are naturally occurring unmodified nucleosides. Nucleosides that contain the same but different nucleobases are not differently modified. For example, a nucleoside that contains a 2'-OMe modified sugar moiety and an unmodified adenine nucleobase is not differently modified from a nucleoside that contains a 2'-OMe modified sugar moiety and an unmodified thymine nucleobase.

[0087] As used herein, "same type of modification" refers to modifications that are the same as each other, including the absence of modification.Thus, for example, two unmodified RNA nucleosides have "same type of modification", even if the RNA nucleosides are unmodified.Such nucleosides with the same type of modification may contain different nucleobases.

[0088] As used herein, "region(s)" or "portion(s)" refers to a plurality of linked nucleosides having a function or property as defined herein, with particular reference to the subject matter and definitions set forth herein. Typically, such a region or portion comprises at least 10, at least 11, at least 12, or at least 13 linked nucleosides. For example, such a region may comprise from 13 to 20 linked nucleosides, e.g., from 13 to 16 or from 18 to 20 linked nucleosides. Typically, a first region as defined herein consists essentially of from 18 to 20 nucleosides and a second region as defined herein consists essentially of from 13 to 16 linked nucleosides.

[0089] As used herein, "a pharma- ceutically acceptable carrier or diluent" means any substance suitable for use in administration to an animal. In certain embodiments, a pharma- ceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.

[0090] As used herein, "substituent" and "substituent group" refer to an atom or group that replaces an atom or group of a specified parent compound. For example, a substituent of a modified nucleoside is any atom or group that is different from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'-substituent is any atom or group other than H or OH at the 2' position of a nucleoside). Substituents can be protected or unprotected. In certain embodiments, the compounds of the present disclosure have a substituent at one or more positions of the parent compound. Substituents can also be further substituted with other substituents and can be attached to the parent compound directly or through a linking group such as oxygen or an alkyl or hydrocarbyl group.

[0091] Such substituents may be present as modifications on the sugar moiety, particularly those substituents present at the 2'-position of the sugar moiety. Unless otherwise indicated, groups that may be used as substituents include, but are not limited to, one or more of halo, hydroxyl, alkyl, alkenyl, alkynyl, acyl, carboxyl, alkoxy, alkoxyalkylene, and amino substituents. Certain substituents described herein may represent a modification directly attached to the ring of the sugar moiety (such as halo, such as fluoro, attached directly to the sugar ring) or a modification indirectly attached to the ring of the sugar moiety through an oxygen linking atom that is itself directly attached to the sugar moiety (such as alkoxyalkylene, such as methoxyethylene, attached to an oxygen atom, which generally provides a MOE substituent as described herein attached to the 2'-position of the sugar moiety).

[0092] As used herein, "alkyl" refers to a saturated linear or branched monovalent C 1-6 It refers to a hydrocarbon group, with methyl being the most preferred alkyl as the substituent at the 2' position of the sugar moiety. The alkyl group is typically attached to the 2' oxygen linking atom of the sugar, thus providing, in total, an -O-alkyl substituent, such as an -OCH3 substituent, on the sugar moiety of the oligomeric compounds described herein, as will be well understood by those of skill in the art.

[0093] As used herein, “alkylene” refers to a group having the general formula —C n H 2n - represents a saturated linear or branched divalent hydrocarbon radical of the formula: -, where n is 1 to 6. Methylene or ethylene are the preferred alkylenes.

[0094] As used herein, "alkenyl" refers to a straight or branched chain unsaturated monovalent C 2-6 It means a hydrocarbon group, with ethenyl or propenyl being the most preferred alkenyls as the substituent at the 2' position of the sugar moiety. As is well understood in the art, the degree of unsaturation present in the alkenyl group is the presence of at least one carbon-carbon double bond. The alkenyl group is typically attached to the oxygen linking atom at the 2' position of the sugar, thus providing, in total, an -Oalkenyl substituent, such as an -OCH2CH=CH2 substituent, on the sugar moiety of the oligomeric compounds described herein. This will be well understood by those skilled in the art.

[0095] As used herein, "alkynyl" refers to a straight or branched chain unsaturated C 2-6 It means a hydrocarbon group, and ethynyl is the most preferred alkynyl as the 2'-position substituent of the sugar moiety.As is well understood in the art, the degree of unsaturation present in the alkynyl group is the presence of at least one carbon-carbon triple bond.The alkynyl group is typically attached to the 2'-position oxygen linking atom of the sugar, thus providing, as a whole, an -O alkynyl substituent on the sugar moiety of the oligomeric compounds described herein.This will be well understood by those skilled in the art.

[0096] As used herein, "carboxyl" is a group having the general formula -CO2H.

[0097] As used herein, "acyl" means a group formed by removal of a hydroxyl group from a carboxyl group, as defined herein, and has the general formula -C(O)-X, where X is typically C 1-6 It is an alkyl.

[0098] As used herein, "alkoxy" refers to1-6 It refers to a group formed between an alkyl group, such as an alkyl group, and an oxygen atom, which is used to attach the alkoxy group to a parent molecule (e.g., the 2' position of a sugar moiety) or to another group, such as an alkylene group, as defined herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, and tert-butoxy. An alkoxy group as used herein may optionally include further substituents.

[0099] As used herein, alkoxyalkylene refers to an alkoxy group, as defined herein, linked to an alkylene group, also as defined herein, where the oxygen atom of the alkoxy group is linked to the alkylene group, which in turn is linked to the parent molecule. The alkylene group is typically linked to the 2' oxygen linking atom of the sugar, thus providing, in aggregate, an -O alkylene alkoxy substituent, such as an -OCH2CH2OCH3 substituent, on the sugar portion of the oligomeric compounds described herein. This is well understood by those of skill in the art and is commonly referred to as an MOE substituent, as defined herein and known in the art.

[0100] As used herein, "amino" includes primary, secondary, and tertiary amino groups.

[0101] As used herein, "halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine, and iodine.

[0102] It will also be understood that the oligomeric compounds described herein can have one or more non-hybridizing nucleosides (overhangs) at one or both ends of one or both strands and / or one or more internal non-hybridizing nucleosides (mismatches), so long as there is sufficient complementarity to maintain hybridization under physiologically relevant conditions. Alternatively, the oligomeric compounds described herein can be blunt ended on at least one end.

[0103] The term "comprising" is used herein to mean that the specified method steps or elements are inclusive, but that such steps or elements do not constitute an exclusive list, and therefore additional steps or elements may be present.

[0104] Furthermore, to the extent the term "includes" is used in either the detailed description or the claims, such term is intended to be inclusive in the same manner as the term "comprising" would be interpreted when "comprising" is used as a transitional term in a claim.

[0105] Each of the constructs of the invention may or may not have a phosphate modification at the 5'-terminus. Additionally, independently, each of the above constructs may or may not have a "3x GalNAc" attached to the 3'-terminus. Advantageously, the constructs have a 3x GalNAc ligand, such as the "toothbrush" moiety disclosed herein. Particularly preferred are constructs that additionally have a 5' phosphate, although this is not a strict requirement, in the absence of which the mammalian cell will add such a phosphate if one is not present on the administered molecule.

[0106] The following are aspects of this embodiment. Embodiment 1. An oligomeric compound capable of modulating, preferably inhibiting, expression of FXI, comprising at least a first region of linked nucleosides having at least a first nucleobase sequence that is at least partially complementary to at least a portion of an RNA transcribed from the FXI gene, wherein the first nucleobase sequence is selected from the following sequences: SEQ ID NO: 1 to 250, or SEQ ID NO: 1251 to 1500, or a portion thereof. Embodiment 2. The oligomeric compound of embodiment 1, further comprising at least a second region of linked nucleosides having at least a second nucleobase sequence that is at least partially complementary to the first nucleobase sequence and is selected from the following sequences: SEQ ID NOs: 251-500, or SEQ ID NOs: 1501-1750, or a subset thereof. Embodiment 3. The first nucleobase sequence is selected from the group consisting of SEQ ID NOs: 8, 13, 27, 39, 46, 91, 98, 103, 105, 109, 120, 140, 146, 151, 152, 163, 182, 183, 199, 207, 210, 218, 220, 223, 224, 238, and SEQ ID NOs: 1258, 1263, 1277, 1289, 3. The oligomeric compound according to embodiment 1 or 2, selected from 1296, 1341, 1348, 1353, 1355, 1359, 1370, 1390, 1396, 1401, 1402, 1413, 1432, 1433, 1449, 1457, 1460, 1468, 1470, 1473, 1474, 1488, or a portion thereof. Embodiment 4. The second nucleobase sequence is selected from the group consisting of SEQ ID NOs: 258, 263, 277, 289, 296, 341, 348, 353, 355, 359, 370, 390, 396, 401, 402, 413, 432, 433, 449, 457, 460, 468, 470, 473, 474, 488, or SEQ ID NOs: 1508, 1513, 1527, 4. The oligomeric compound of embodiment 3, selected from 1539, 1546, 1591, 1598, 1603, 1605, 1609, 1620, 1640, 1646, 1651, 1652, 1663, 1682, 1683, 1699, 1707, 1710, 1718, 1720, 1723, 1724, 1738, or a subset thereof. Embodiment 5. The oligomeric compound according to any of embodiments 1 to 4, wherein the first nucleobase sequence is selected from the following sequences: SEQ ID NO: 8, 46, 91, 146, 152, 207, or SEQ ID NO: 1258, 1296, 1341, 1396, 1402, 1457, or a portion thereof. Embodiment 6. The oligomeric compound of embodiment 5, wherein the second nucleobase sequence is selected from the following sequences: SEQ ID NO: 258, 296, 341, 396, 402, 457, or SEQ ID NO: 1508, 1546, 1591, 1646, 1652, 1707, or a portion thereof. Embodiment 7. The oligomeric compound according to any of embodiments 1 to 6, wherein the first nucleobase sequence is selected from the following sequences: SEQ ID NO: 46, 91, 152, or SEQ ID NO: 1296, 1341, 1402, or a portion thereof. Embodiment 8. The oligomeric compound according to embodiment 7, wherein the second nucleobase sequence is selected from the following sequences: SEQ ID NO: 296, 341, 402, or SEQ ID NO: 1546, 1591, 1652, or a portion thereof. Embodiment 9. The oligomeric compound according to any of embodiments 1 to 8, wherein the first nucleobase sequence is at least partially complementary to any of the following sequences: SEQ ID NOs: 1001 to 1250, or a portion thereof. Embodiment 10. The oligomeric compound of embodiment 3 and / or 4, wherein the first nucleobase sequence is at least partially complementary to any of the following sequences: SEQ ID NOs: 1008, 1013, 1027, 1039, 1046, 1091, 1098, 1103, 1105, 1109, 1120, 1140, 1146, 1151, 1152, 1163, 1182, 1183, 1199, 1207, 1210, 1218, 1220, 1223, 1224, 1238, or a portion thereof. Embodiment 11. The oligomeric compound according to embodiment 5 and / or 6, wherein the first nucleobase sequence is at least partially complementary to any of the following sequences: SEQ ID NOs: 1008, 1046, 1091, 1146, 1152, 1207, or a portion thereof. Embodiment 12. The oligomeric compound according to embodiment 7 and / or 8, wherein the first nucleobase sequence is at least partially complementary to any of the following sequences: SEQ ID NOs: 1046, 1091, 1152, or a portion thereof. Embodiment 13. An oligomeric compound capable of modulating, preferably inhibiting, expression of FXI, comprising at least a first region of linked nucleosides having at least a first nucleobase sequence that is at least partially complementary to at least a portion of an RNA transcribed from the FXI gene, wherein the RNA is selected from the following sequences: SEQ ID NOs: 1001 to 1250, or a portion thereof. Embodiment 14. The oligomeric compound according to embodiment 13, wherein the RNA is selected from the following sequences: SEQ ID NOs: 1008, 1013, 1027, 1039, 1046, 1091, 1098, 1103, 1105, 1109, 1120, 1140, 1146, 1151, 1152, 1163, 1182, 1183, 1199, 1207, 1210, 1218, 1220, 1223, 1224, 1238, or a portion thereof. Embodiment 15. The oligomeric compound according to embodiment 13 or 14, wherein the RNA is selected from the following sequences: SEQ ID NOs: 1008, 1046, 1091, 1146, 1152, 1207, or a portion thereof. Embodiment 16. The oligomeric compound according to any of embodiments 13 to 15, wherein the RNA is selected from the following sequences: SEQ ID NO: 1046, 1091, 1152, or a portion thereof. Embodiment 17. The oligomeric compound of any of embodiments 1 to 16, wherein the first region of linked nucleosides consists essentially of 18 to 20 linked nucleosides. Embodiment 18. The oligomeric compound of any of embodiments 2 to 17, wherein the second region of linked nucleosides consists essentially of 11 to 16, advantageously 12 to 15, or 13 to 16 linked nucleosides. Embodiment 19. The oligomeric compound according to any of embodiments 2 to 18, comprising at least one complementary duplex region comprising at least a portion of a first nucleoside region linked directly or indirectly to at least a portion of a second nucleoside region. Embodiment 20. The oligomeric compound according to embodiment 19, wherein each of the first nucleoside region and the second nucleoside region has a 5' to 3' orientation, thereby defining its 5' and 3' regions, respectively. Embodiment 21. The oligomeric compound according to embodiment 20, wherein the 5' region of the first nucleoside region is linked directly or indirectly, e.g. by complementary base pairing, to the 3' region of the second nucleoside region and / or the 3' region of the first nucleoside region is linked directly or indirectly to the 5' region of the second nucleoside region. Embodiment 22. The oligomeric compound of any of embodiments 1 to 21, further comprising one or more ligands. Embodiment 23. The oligomeric compound according to embodiment 21, wherein one or more ligands are attached to the second nucleoside region. Embodiment 24. The oligomeric compound according to embodiment 23, depending from embodiment 20, wherein the one or more ligands are attached at the 3' region of the second nucleoside region. Embodiment 25. The oligomeric compound according to any of embodiments 22 to 24, wherein the one or more ligands are any cell-targeting moiety, such as lipids, sugars, aptamers, vitamins and / or peptides, that bind to a specific target on the cell membrane or cell surface. Embodiment 26 The oligomeric compound according to embodiment 25, wherein one or more ligands comprise one or more sugars. Embodiment 27. The oligomeric compound according to embodiment 26, wherein the one or more sugars can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide. Embodiment 28. The oligomeric compound according to embodiment 27, wherein the one or more sugars comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. Embodiment 29. The oligomeric compound according to embodiment 28, wherein one or more sugars comprise one or more N-acetyl-galactosamine moieties. Embodiment 30. The oligomeric compound according to embodiment 29, comprising two or three, preferably three, N-acetyl-galactosamine moieties. Embodiment 31. The oligomeric compound according to any of embodiments 22 to 30, wherein the one or more ligands are attached to the oligomeric compound, preferably to the second nucleoside region thereof, in a linear or branched arrangement. The ligand has the following structure, also referred to herein as "toothbrush": It is preferred to have TIFF2024514887000002.tif75170. A particularly preferred embodiment of "GalNAc" (as used herein) is the structure above. Embodiment 32. The oligomeric compound according to embodiment 31, wherein the one or more ligands are attached to the oligomeric compound in a biantennary or triantennary arrangement. Embodiment 33. The oligomeric compound of embodiment 19, comprising a single strand comprising a first nucleoside region and a second nucleoside region, wherein the single strand dimerizes, whereby at least a portion of the first nucleoside region is linked, directly or indirectly, to at least a portion of the second nucleoside region, to form an at least partially complementary duplex region. Embodiment 34. The oligomeric compound according to embodiment 33, wherein the first nucleoside region has a greater number of linked nucleosides compared to the second nucleoside region, whereby the additional number of linked nucleosides of the first nucleoside region form a hairpin loop connecting the first nucleoside region and the second nucleoside region. Embodiment 35. The oligomeric compound according to embodiment 34, according to embodiment 20, wherein the hairpin loop is present in a 3' region of the first nucleoside region. Embodiment 36. The oligomeric compound according to embodiment 34 or 35, wherein the hairpin loop comprises 4 or 5 linked nucleosides. Embodiment 37. The oligomeric compound according to any of embodiments 1 to 36, comprising internucleoside linkages, wherein at least one internucleoside linkage is a modified internucleoside linkage. Embodiment 38. The oligomeric compound according to embodiment 37, wherein the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. Embodiment 39. The oligomeric compound according to embodiment 38, comprising from 1 to 15 phosphorothioate or phosphorodithioate internucleoside linkages. Embodiment 40. The oligomeric compound according to embodiment 39, comprising 7, 8, 9 or 10 phosphorothioate or phosphorodithioate internucleoside linkages. Embodiment 41. The oligomeric compound according to any of embodiments 38 to 40, depending from embodiment 20, comprising one or more phosphorothioate or phosphorodithioate internucleoside linkages in the 5' region of the first nucleoside region. Embodiment 42. The oligomeric compound according to any of embodiments 38 to 41, depending from embodiment 20, comprising one or more phosphorothioate or phosphorodithioate internucleoside linkages in a 5' region of the second nucleoside region. Embodiment 43. The oligomeric compound according to any of embodiments 38 to 42, depending on embodiment 34, comprising phosphorothioate or phosphorodithioate internucleoside linkages between at least two, preferably at least three, preferably at least four, preferably at least five adjacent nucleosides of the hairpin loop, depending on the number of nucleotides present in the hairpin loop. Embodiment 44. The oligomeric compound according to embodiment 43, comprising a phosphorothioate or phosphorodithioate internucleoside linkage between each adjacent nucleoside present in the hairpin loop. Embodiment 45. The oligomeric compound of any of embodiments 1 to 44, wherein at least one nucleoside comprises a modified sugar. Embodiment 46. The oligomeric compound according to embodiment 45, wherein the modified sugar is selected from 2' modified sugars; conformationally restricted nucleotide (CRN) sugars such as locked nucleic acid (LNA), (S) constrained ethyl bicyclic nucleic acid, and constrained ethyl (cEt), tricycloDNA; morpholino, non-locked nucleic acid (UNA), glycol nucleic acid (GNA), D-hexitol nucleic acid (HNA), and cyclohexene nucleic acid (CeNA), preferably 2'-O-methyl modified sugars. Additional 2' modified sugars include 2'-O-alkyl modified sugars, 2'-O-methoxyethyl modified sugars, 2'-O-allyl modified sugars, 2'-C-allyl modified sugars, 2'-deoxy modified sugars such as 2'-deoxyribose, 2'-F modified sugars, 2'-arabino-fluoro modified sugars, 2'-O-benzyl modified sugars, 2'-amino modified sugars, and 2'-O-methyl-4-pyridine modifications. Embodiment 47. The oligomeric compound according to embodiment 45 or 46, wherein the modified sugar is a 2'-F modified sugar. Embodiment 48. The oligomeric compound according to any one of embodiments 45 to 47, depending from embodiment 20, wherein the sugar of any of the nucleosides at positions 2 and 14 downstream from the first nucleoside in the 5' region of the first nucleoside region does not contain a 2'-O-methyl modification. Embodiment 49. The oligomeric compound according to any one of embodiments 45 to 48, which is dependent on embodiment 20, wherein the sugar of a nucleoside of the second nucleoside region corresponding in position to any one of the nucleosides of the first nucleoside region at any one of positions 9 to 11 downstream from the first nucleotide of the 5' region of the first nucleoside region does not contain a 2'-O-methyl modification. Embodiment 50. The oligomeric compound according to embodiment 48 or 49, wherein the sugar of any of the nucleosides at positions 2 and 14 downstream from the first nucleoside of the 5' region of the first nucleoside region comprises a 2'-F modification. Embodiment 51. The oligomeric compound according to any of embodiments 48 to 50, wherein the sugar of a nucleoside of a second nucleoside region corresponding in position to any of the nucleosides of the first nucleoside region at any of positions 9 to 11 downstream from the first nucleoside of the 5' region of the first nucleoside region contains a 2'-F modification. Embodiment 52. The oligomeric compound according to any of embodiments 45 to 51, which is dependent from embodiment 20, wherein one or more odd-numbered nucleosides starting from the 5' region of the first nucleoside region are modified and / or one or more even-numbered nucleotides starting from the 5' region of the first nucleoside region are modified, typically wherein the modification of the even-numbered nucleotides is a second modification different from the modification of the odd-numbered nucleotides. Embodiment 53. The oligomeric compound according to embodiment 52, wherein one or more of the odd-numbered nucleosides starting from the 3' region of the second nucleoside region are modified with a modification different from the modification of the odd-numbered nucleotides of the first nucleoside region. Embodiment 54. The oligomeric compound according to embodiment 52 or 53, wherein one or more of the even-numbered nucleosides starting from the 3' region of the second nucleoside region are modified by a modification different from the modification of the even-numbered nucleosides of the first nucleoside region according to embodiment 53. Embodiment 55. The oligomeric compound according to any of embodiments 52 to 54, wherein at least one or more of the modified even-numbered nucleosides of the first nucleoside region are adjacent to at least one or more differently modified odd-numbered nucleosides of the first nucleoside region. Embodiment 56. The oligomeric compound according to any of embodiments 52 to 55, wherein at least one or more of the modified even-numbered nucleosides of the second nucleoside region are adjacent to at least one or more differently modified odd-numbered nucleosides of the second nucleoside region. Embodiment 57. The oligomeric compound according to any of embodiments 52 to 56, wherein one or more sugars of odd-numbered nucleosides starting from the 5' region of the first nucleoside region are 2'-O-methyl modified sugars. Embodiment 58. The oligomeric compound according to any of embodiments 52 to 57, wherein one or more of the even-numbered nucleosides starting from the 5' region of the first nucleoside region is a 2'-F modified sugar. Embodiment 59. The oligomeric compound according to any of embodiments 52 to 58, wherein one or more sugars of odd-numbered nucleosides starting from the 3' region of the second nucleoside region are 2'-F modified sugars. Embodiment 60. The oligomeric compound according to any of embodiments 52 to 59, wherein one or more of the even-numbered nucleosides beginning with the 3' region of the second nucleoside region is a 2'-O-methyl modified sugar. Embodiment 61. The oligomeric compound according to any of embodiments 45 to 60, wherein the sugars of multiple adjacent nucleosides of the first nucleoside region are modified with a common modification. Embodiment 62. The oligomeric compound according to any of embodiments 45 to 61, wherein the sugars of multiple adjacent nucleosides of the second nucleoside region are modified with a common modification. Embodiment 63. The oligomeric compound according to any of embodiments 52 to 62, which is dependent from embodiment 34, wherein the sugars of multiple adjacent nucleosides of the hairpin loop are modified with a common modification. Embodiment 64. The oligomeric compound according to any of embodiments 61 to 63, wherein the common modification is a 2'-F modified sugar. Embodiment 65. The oligomeric compound according to any of embodiments 61 to 63, wherein the common modification is a 2'-O-methyl modified sugar. Embodiment 66. The oligomeric compound according to embodiment 65, wherein a plurality of adjacent 2'-O-methyl modified sugars are present on at least eight adjacent nucleosides of the first nucleoside region and / or the second nucleoside region. Embodiment 67. The oligomeric compound according to embodiment 65, wherein multiple adjacent 2'-O-methyl modified sugars are present on three or four adjacent nucleosides of the hairpin loop. Embodiment 68. The oligomeric compound according to embodiment 45, according to embodiment 34, wherein the hairpin loop comprises at least one nucleoside having a modified sugar. Embodiment 69. The oligomeric compound of embodiment 68, wherein at least one nucleoside is adjacent to a nucleoside having a different modified sugar. Embodiment 70. The oligomeric compound of embodiment 69, wherein the modified sugar is a 2'-O-methyl modified sugar and the different modified sugar is a 2'-F modified sugar. Embodiment 71. The oligomeric compound of any of embodiments 1 to 70, comprising one or more nucleosides having an unmodified sugar moiety. Embodiment 72. The oligomeric compound according to embodiment 71, wherein an unmodified sugar is present at a 5' region of the second nucleoside region. Embodiment 73. The oligomeric compound according to embodiment 71 or 72, which is dependent from embodiment 34, wherein the unmodified sugar is present in a hairpin loop. Embodiment 74. The oligomeric compound according to any of embodiments 1 to 73, wherein one or more nucleosides of the first nucleoside region and / or the second nucleoside region are inverted nucleosides linked to an adjacent nucleoside via a 3' carbon of its sugar to a 3' carbon of the sugar of the adjacent nucleoside, and / or one or more nucleosides of the first nucleoside region and / or the second nucleoside region are inverted nucleosides linked to an adjacent nucleoside via a 5' carbon of its sugar to a 5' carbon of the sugar of the adjacent nucleoside. Embodiment 75. The oligomeric compound of any one of embodiments 1 to 74, which is blunt ended. Embodiment 76. The oligomeric compound according to any of embodiments 1 to 74, wherein either the first nucleoside region or the second nucleoside region has an overhang. Embodiment 77. An oligomeric compound capable of modulating, preferably inhibiting, expression of FXI, comprising at least a first region of linked nucleosides having at least a first nucleobase sequence that is at least partially complementary to at least a portion of an RNA transcribed from the FXI gene, wherein the first nucleobase sequence is a modified sequence and is selected from the following sequences: Construct Nos. 501 to 750, or Construct Nos. 1751 to 2000, or a portion thereof. Embodiment 78. The oligomeric compound according to embodiment 77, further comprising at least a second region of linked nucleosides having at least a second nucleobase sequence that is at least partially complementary to the first nucleobase sequence, wherein the second nucleobase sequence is a modified sequence and is selected from the following sequences: Construct Nos. 751 to 1000, or Construct Nos. 2001 to 2250, or a subset thereof. 79. The first nucleobase sequence is selected from the group consisting of Construct Nos. 508, 513, 527, 539, 546, 591, 598, 603, 605, 609, 620, 640, 646, 651, 652, 663, 682, 683, 699, 707, 710, 718, 720, 723, 724, 738, and Construct Nos. 1758, 1763, 1770, 1775, 1776, 1777, 1778, 1779, 1780, 1781, 1782, 1783, 1790, 1791, 1792, 1793, 1794, 1795, 1796, 1797, 1800, 1801, 1802, 1803, 1804, 1805, 1806, 1807, 1808, 1809, 1810, 1811, 1812, 1813, 1814, 1815, 1816, 1817, 1818, 1819, 1820, 1821, 1822, 1823, 1824, 1825, 1826, 1827, 1828, 1829, 1830, 1831, 1832, 1833, 1834, 1835, 1836, 1837, 18 77, 1789, 1796, 1841, 1848, 1853, 1855, 1859, 1870, 1890, 1896, 1901, 1902, 1913, 1932, 1933, 1949, 1957, 1960, 1968, 1970, 1973, 1974, 1988, or a portion thereof. 80. The second nucleobase sequence is selected from the group consisting of Construct Nos. 758, 763, 777, 789, 796, 841, 848, 853, 855, 859, 870, 890, 896, 901, 902, 913, 932, 933, 949, 957, 960, 968, 970, 973, 974, 988, and Construct Nos. 2008, 2013, 80. The oligomeric compound of embodiment 79, selected from 2027, 2039, 2046, 2091, 2098, 2103, 2105, 2109, 2120, 2140, 2146, 2151, 2152, 2163, 2182, 2183, 2199, 2207, 2210, 2218, 2220, 2223, 2224, 2238, or a portion thereof. Embodiment 81. The oligomeric compound according to any of embodiments 77 to 80, wherein the first nucleobase sequence is selected from the following sequences: Construct No. 508, 546, 591, 646, 652, 707, or Construct No. 1758, 1796, 1841, 1896, 1902, 1957, or a portion thereof. Embodiment 82. The oligomeric compound according to embodiment 81, wherein the second nucleobase sequence is selected from the following sequences: Construct No. 758, 796, 841, 896, 902, 957, or Construct No. 2008, 2046, 2091, 2146, 2152, 2207, or a portion thereof. Embodiment 83. The oligomeric compound according to any of embodiments 77 to 82, wherein the first nucleobase sequence is selected from the following sequences: Construct No. 546, 591, 652, or Construct No. 1796, 1841, 1902, or a portion thereof. Embodiment 84. The oligomeric compound according to embodiment 83, wherein the second nucleobase sequence is selected from the following sequences: Construct No. 796, 841, 902, or Construct No. 2046, 2091, 2152, or a portion thereof. Embodiment 85. The oligomeric compound according to any of embodiments 77 to 84, further characterized according to any of embodiments 17 to 44, or 74 to 76. Embodiment 86. An oligomeric compound capable of modulating, preferably inhibiting, the expression of FXI, selected from the following sequences: SEQ ID NO: 2251 to 2253, or SEQ ID NO: 2284 to 2288, preferably SEQ ID NO: 2287. Embodiment 87. An oligomeric compound capable of modulating, preferably inhibiting, expression of FXI, selected from the following sequences: Construct Nos. 2254 to 2283. Embodiment 88. The oligomeric compound according to embodiment 86 or 87, further comprising one or more ligands. Embodiment 89. The oligomeric compound according to embodiment 88, wherein the one or more ligands are attached at the 3' region of the sequence, preferably at the 3' terminal nucleoside. Embodiment 90. The oligomeric compound according to embodiment 88, wherein one or more ligands are attached at a non-terminal position. Embodiment 91. The oligomeric compound according to any of embodiments 88 to 90, wherein the one or more ligands are any cell-targeting moiety, such as lipids, sugars, aptamers, vitamins and / or peptides, that bind to a specific target on a cell membrane or cell surface. Embodiment 92. The oligomeric compound according to embodiment 91, wherein one or more ligands comprise one or more sugars. Embodiment 93. The oligomeric compound according to embodiment 92, wherein the one or more sugars can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. A preferred monosaccharide is a hexose. Embodiment 94. The oligomeric compound according to embodiment 93, wherein the one or more sugars comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. Embodiment 95. The oligomeric compound according to embodiment 94, wherein one or more sugars comprise one or more N-acetyl-galactosamine moieties. Embodiment 96. The oligomeric compound according to embodiment 95, comprising two or three, preferably three, N-acetyl-galactosamine moieties. Embodiment 97. The oligomeric compound according to any of embodiments 88 to 96, wherein the one or more ligands are attached to the oligomeric compound in a linear or branched arrangement. Embodiment 98. The oligomeric compound according to embodiment 97, wherein the one or more ligands are attached to the oligomeric compound in a biantennary or triantennary arrangement. Embodiment 99. The oligomeric compound according to any of embodiments 86 to 98, wherein the sequence self-dimerizes to form an at least partially complementary duplex region. Embodiment 100. An oligomeric compound according to embodiment 99, having the nucleobase sequence and structure as shown in any of Figures 15 to 17 or 18 to 20, with construct numbers 2290 to 2292 being preferred, and construct number 2290 being particularly preferred. Embodiment 101. A composition comprising the oligomeric compound of any of embodiments 1 to 100 and a physiologically acceptable excipient. Embodiment 102. An oligomeric compound according to any of embodiments 1 to 100 for use in therapy. Embodiment 103. An oligomeric compound according to any of embodiments 1 to 100 for use in the treatment of a disease or disorder. Embodiment 104. A method of treating a disease or disorder comprising administering to an individual in need of treatment an oligomeric compound according to any of embodiments 1 to 100. The method of embodiment 104, wherein the oligomeric compound is administered to the individual subcutaneously or intravenously. Embodiment 106 The use of an oligomeric compound according to any one of embodiments 1 to 100 for use in research as a gene function analysis tool. Aspect 107. The use according to aspect 103 or the method according to aspect 104, wherein the disease or disorder is a thromboembolic disease. Aspect 108. The use or method according to aspect 107, wherein the thromboembolic disease is selected from the group consisting of deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end stage renal failure (ESRD), including dialysis-associated thrombosis, or other procoagulant conditions. Aspect 109. The use or method of aspect 108, wherein the thromboembolic disease is deep vein thrombosis, pulmonary embolism, or a combination thereof. Embodiment 110. Use of an oligomeric compound according to any of items 1 to 100 in the manufacture of a medicament for the treatment of a disease or disorder. The diseases and disorders are advantageously the same as those described herein above.

[0107] The molecules disclosed herein, including but not limited to the hairpin RNAs shown in Tables 6 and 7 and Figures 15-18, 20 and 22, are characterized by surprising and superior performance in in vivo situations; see, for example, the evidence shown in Figures 24 and 25. These data show long-term downregulation of Factor XI in response to administration of the constructs described herein. Further evidence of the surprising performance of several constructs can be found in the in vitro data provided in the Examples, including the data shown in Figure 19.

[0108] The figures provided herein depict exemplary methods and data. Although the methods are shown and described as a series of acts performed in a particular order, it should be understood and appreciated that the methods are not limited by that order. For example, some acts may occur in a different order than described herein. Additionally, some acts may occur simultaneously with other acts. Furthermore, in some cases, not all acts may be required to perform a method described herein.

[0109] Although the ordering of steps in the methods described herein is exemplary, steps may be performed in any suitable order, or simultaneously if desired. Additionally, steps may be added or substituted, or individual steps may be deleted, from any method without departing from the scope of the subject matter described herein. Aspects of any of the above-described embodiments may be combined with aspects of any of the other embodiments described to form further embodiments.

[0110] The above description of the preferred embodiments is given by way of example only, and it will be understood that various modifications may be made by those skilled in the art. The above description includes one or more examples of the embodiments. Of course, it is not possible to describe all possible modifications and variations of the above compounds, compositions or methods for the purpose of describing the above embodiments, but those skilled in the art will recognize that many further modifications and substitutions of the various embodiments are possible. Therefore, it is intended that the described embodiments include all such changes, modifications, and variations that fall within the scope of the appended claims. EXAMPLES

[0111] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting. Moreover, where specific embodiments are provided, the inventors contemplate the general application of those specific embodiments. For example, the disclosure of oligonucleotides having a particular motif or modification pattern provides reasonable support for additional oligonucleotides having the same or similar motif or modification pattern.

[0112] The synthesis of the RNAi constructs disclosed herein can be carried out using synthesis methods known to those skilled in the art, such as the synthesis method disclosed in https: / / en.wikipedia.org / wiki / Oligonucleotide_synthesis{retrieved February 16, 2022}, the method disclosed in this website is incorporated herein by reference in its entirety. The only difference from the synthesis method disclosed in this reference is that a GalNAc phosphoramidite immobilized on a support is used in the synthesis method during the first synthesis step.

[0113] The terms "construct number" and "SEQ ID NO:" are used equivalently herein, particularly with reference to the 67 nucleobase sequences. Nucleobase sequences generally do not carry information regarding modifications of the sugar phosphate backbone.

[0114] Example 1: Oligomeric compounds were synthesized using the oligonucleotides shown in Tables 1a and 1b below. TIFF2024514887000003.tif244170TIFF2024514887000004.tif238170TIFF2024514887000005.tif238170TIFF2024514887000006.tif2 39170TIFF2024514887000007.tif239170TIFF2024514887000008.tif238170TIFF2024514887000009.tif239170TIFF2024514887000010 .tif239170TIFF2024514887000011.tif239170TIFF2024514887000012.tif239170TIFF2024514887000013.tif239170TIFF2024514887000014.tif239170TIFF2024514887000015.tif239170TIFF2024514887000016.tif239170TIFF2024514887000017.tif184170In Table 1a above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine.

[0115] TIFF2024514887000018.tif234170TIFF2024514887000019.tif239170TIFF2024514887000020.tif238170TIFF2024514887000021.tif2 38170TIFF2024514887000022.tif238170TIFF2024514887000023.tif238170TIFF2024514887000024.tif238170TIFF2024514887000025 .tif239170TIFF2024514887000026.tif239170TIFF2024514887000027.tif239170TIFF2024514887000028.tif238170TIFF2024514887000029.tif239170TIFF2024514887000030.tif239170TIFF2024514887000031.tif238170TIFF2024514887000032.tif196170In Table 1b above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine; P represents a terminal phosphate group; m represents a methyl modification at the 2' position of the sugar of the parent nucleoside; f represents a fluoro modification at the 2' position of the sugar of the parent nucleoside. The target sequences in the Factor XI gene with which the antisense (guide) sequences of Table 1a / 1b interact are shown in Table 1c below.

[0116] TIFF2024514887000033.tif248170TIFF2024514887000034.tif249170TIFF2024514887000035.tif249170TIFF2024514887000036.tif249170TIFF2024514887000037.tif249170TIFF2024514887000038.tif249170In Table 1c above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine.

[0117] It should also be noted that the scope of this embodiment extends to sequences corresponding to those in Table 1a or Table 1b, where the 5' nucleoside of the antisense (guide) strand (first region as defined herein) may include any nucleobase that may be present in an RNA molecule, in other words, any nucleobase that may be either adenine (A), uracil (U), guanine or cytosine (C). In addition, the scope of this embodiment extends to sequences corresponding to those in Table 1a or Table 1b, where the 3' nucleoside of the sense (passenger) strand (second region as defined herein) may include any nucleobase that may be present in an RNA molecule, in other words, any nucleobase that may be either adenine (A), uracil (U), guanine or cytosine (C), but preferably a nucleobase that is complementary to the 5' nucleobase of the antisense (guide) strand (first region as defined herein). These additional sequences are shown in Tables 1d (unmodified) and 1e (chemically modified), where N and N' represent any RNA nucleobase that may be present at the 5'-terminal position of the antisense (guide) strand (first region defined herein) and the 3'-terminal position of the sense (passenger) strand (second region defined herein), respectively.

[0118] TIFF2024514887000039.tif242170TIFF2024514887000040.tif239170TIFF2024514887000041.tif239170TIFF2024514887000042.tif2 38170TIFF2024514887000043.tif238170TIFF2024514887000044.tif239170TIFF2024514887000045.tif238170TIFF2024514887000046 .tif239170TIFF2024514887000047.tif239170TIFF2024514887000048.tif239170TIFF2024514887000049.tif239170TIFF2024514887000050.tif239170TIFF2024514887000051.tif239170TIFF2024514887000052.tif239170TIFF2024514887000053.tif183170In Table 1d above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine; N represents any RNA nucleobase; N' represents any RNA nucleobase, preferably complementary to N.

[0119] TIFF2024514887000054.tif248170TIFF2024514887000055.tif238170TIFF2024514887000056.tif239170TIFF2024514887000057.tif2 39170TIFF2024514887000058.tif239170TIFF2024514887000059.tif239170TIFF2024514887000060.tif239170TIFF2024514887000061 .tif239170TIFF2024514887000062.tif239170TIFF2024514887000063.tif239170TIFF2024514887000064.tif239170TIFF2024514887000065.tif239170TIFF2024514887000066.tif239170TIFF2024514887000067.tif239170TIFF2024514887000068.tif183170In Table 1e above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine; P represents a terminal phosphate group; m represents a methyl modification at the 2' position of the sugar of the parent nucleoside; f represents a fluoro modification at the 2' position of the sugar of the parent nucleoside; N represents any RNA nucleobase; N' represents any RNA nucleobase, preferably complementary to N.

[0120] Example 2: The oligonucleotides shown in Table 1a / 1b above that target FXI mRNA in human hepatoma cells were screened as follows.

[0121] Native gel electrophoresis of random FXI oligomeric compounds: Oligomeric compounds containing the oligonucleotides shown in Table 1a / 1b above were dissolved in RNase-, DNase-free sterile water to a final concentration of 100 μM. Based on Table 2 below, 10 random oligomeric compounds were selected for validation. JPEG2024514887000069.jpg67170

[0122] 20% TBE gel electrophoresis was performed on the above oligomeric compounds in Table 2. 10 pm oligonucleotide / lane, stain: SybrGold. Figure 1 shows the stability of the resulting duplexes. Based on this QC data, we used all oligomeric compounds in the next screen.

[0123] Two independent F11 qPCR assays were validated for screening. Both assays yielded a linear dose-response with high sensitivity and efficiency, as shown in Figure 2. Two probes from different target gene regions were used due to known qPCR artifacts caused by siRNAs overlapping with the qPCR probe region.

[0124] Screening of F11 oligomeric compounds in hepatoma cell lines: Protocol details: Cell seeding: 10000 HepG2 cells / well. Transfection with Lipofectamine RNAiMax. Transfection: 20 nM compound, antibiotic-free EMEM medium 10% FBS, 72 hour incubation. Gene expression was measured by qPCR (Taqman chemistry), adjusted to a standard curve, and normalized to the reference gene GAPDH. Data are expressed as percentage of gene expression in untreated cells (NT).

[0125] The results of the screening are shown in Figures 3 to 12. Twenty-six oligomeric compounds with an 80% knockdown cutoff were selected for dose-response curves, the rationale for this selection being as shown in Table 3 below. TIFF2024514887000070.tif128170

[0126] Example 3: Dose-response curves for the 26 FXI lead compounds identified in Example 2 are shown in FIG. Dose-response curves for five FXI lead compounds are shown in FIG.

[0127] Example 4: IC50 values ​​are shown in Table 4 below for the 26 FXI lead compounds identified in Example 2. TIFF2024514887000071.tif158170

[0128] Example 5: The species cross-reactivities of the 26 FXI lead compounds identified in Example 2 are shown in Table 5 below. JPEG2024514887000072.jpg155170

[0129] Example 6: In addition to the data provided in Examples 3 to 5, oligonucleotides F11-46 / SEQ ID NO:46, F11-91 / SEQ ID NO:91 and F11-152 / SEQ ID NO:152 were identified as particularly preferred antisense oligonucleotides for use in the oligomeric compounds described herein. Based on this, these sequences were incorporated throughout the oligomeric compounds described herein in the following sequences SEQ ID NO:2251 to 2253 as shown in Table 6 below. Additionally, selected modifications were applied to SEQ ID NO:2251 to 2253 as shown in Table 6 below in SEQ ID NO:2254 to 2286. All sequences provided in Table 6 below are shown in the 5' to 3' orientation.

[0130] TIFF2024514887000073.tif249170TIFF2024514887000074.tif252170TIFF2024514887000075.tif246170 TIFF2024514887000076.tif239170TIFF2024514887000077.tif252170TIFF2024514887000078.tif203170

[0131] In Table 6 above, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine; m represents a methyl modification at the 2' position of the sugar of the parent nucleoside; f represents a fluoro modification at the 2' position of the sugar of the parent nucleoside; N / N'' / N'''' represents any RNA nucleobase; N' represents any RNA nucleobase, preferably complementary to N; (ps) represents a phosphorothioate internucleoside linkage; i represents an inverted internucleoside linkage, which can be either 3'-3' or 5'-5'; vp represents vinyl phosphonate; mvp stands for methyl vinyl phosphonate.

[0132] For each of the above constructs in Table 6, a ligand, such as a galnac ligand, is preferably attached to the 3' end of the sequence. Specifically, for SEQ ID NOs: 2251, 2252, and 2253, this can be shown as follows, respectively, where Galnac can represent any arrangement of Galnac linkages, but is preferably a triantennary Galnac linkage: UUGGUGUGAGCAUUGCUUGCAAUGCUCACACCAA - Galnac UUAUAAGAAAAUCAUCCUGAUGAUUUUCUUAUAA - Galnac UGGUUUCCAAUGAUGGAGCCAUCAUUGGAAACCA - Galnac.

[0133] Alternatively, for SEQ ID NOs: 2272 to 2273 shown in Table 6 above, binding of the ligand, preferably Galnac, can be to an internal, non-terminal nucleoside, such as to a nucleoside in the above sequence in which the nucleobase is modified and not shown.

[0134] Example 7: This example describes a structure-function relationship study of a construct comprising the nucleobase sequence of SEQ ID NO:91. FIG. 18 shows the constructs containing the nucleobase sequence of SEQ ID NO:91 that were tested. Testing is being carried out in primary hepatocytes.

[0135] Human adherent 5 donor hepatocytes (Sekisui XenoTech, HPCH05+) were thawed in 45mL of Human OptiThaw Hepatocyte Medium (Sekisui Xenotech, K8000), centrifuged at 200g for 5 minutes, and suspended in 2x WEM Complete (5% FBS, 2uM dexamethasone, Pen / Strep, 8ug / mL human insulin, 4mM GlutaMAX, 30mM HEPES pH7.4). 2x WEM Complete is composed of WEM (Gibco, A1217601) and 2x Hepatocyte Plating Supplement Pack (Gibco, CM3000) containing only 1x FBS. Hepatocytes are then plated onto 6-well collagen 1 coated plates (Gibco, A1142803) at 25000 cells / well, 50 uL per well, and allowed to recover and adhere for 4 hours at 37°C.

[0136] After 4 hours, dilute the GalNac-conjugated complex to 2 uM in basal WEM and use to create a 2x, 7-step, 5-fold dilution series. Add 50 uL of each dilution to the plated hepatocytes in the corresponding well to create a final dilution series from 1 to 0.000064 uM in 1x WEM Complete.

[0137] The cells are cultured at 37°C for 72 hours without disruption and then harvested for RNA isolation using the PureLink Pro96 Total RNA Purification Kit (Invitrogen, 12173011A) according to the manufacturer's protocol. The results are shown in Figure 19.

[0138] Based on these results, seven molecules were designed for further analysis (see next example). These molecules are shown in Figure 20. Performance data in primary hepatocytes is shown in Figure 21. Based on these data, the three molecules were tested in humanized mice; see Example 8 below.

[0139] Example 8: This example describes the testing of the three molecules identified in Example 7 in humanized mice. Table 7 below shows the nucleobase sequences (SEQ ID NO:) and complete modification information (Construct Number) of these three molecules. In Table 7 above, TIFF2024514887000079.tif71170, A stands for adenine; U stands for uracil; C stands for cytosine; G stands for guanine; m represents a methyl modification at the 2' position of the sugar of the parent nucleoside; f represents a fluoro modification at the 2' position of the sugar of the parent nucleoside; * represents a phosphorothioate internucleoside linkage; vp represents vinyl phosphonate; phos represents phosphonate; and 3galnac represents the toothbrush ligand defined herein above.

[0140] Figure 22 also shows the structures of these molecules, and Figure 23 shows the performance of these molecules after 5 days of administration. Based on these results, a construct designated "91-Conv-31" (structure shown in Figure 22) was selected for testing in non-human primates; see Example 9 below. Of note, this molecule is particularly short, containing only a total of 31 nucleotides.

[0141] Example 9: This example describes a pharmacodynamic study of a construct designated "91-Conv-31" (structure shown in Figure 22) following single / repeated subcutaneous injections in cynomolgus monkeys.

[0142] Materials and Methods For an overview of the study protocol, see Figure 24. A more detailed description is provided below.

[0143] Study Protocol TIFF2024514887000080.tif113170TIFF2024514887000081.tif241170TIFF2024514887000082.tif241170

[0144] 1 Research information 1.1 Research objectives The objective of this study is to determine the pharmacodynamics (PD) of the compounds selected for this study after single and repeated subcutaneous (SC) administration to male cynomolgus monkeys.

[0145] 1.2 Regulatory Compliance This study will be conducted according to standard animal procedures of the Institutional Animal Care and Use Committee (IACUC) with IACUC guidelines in accordance with the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals. This study will be conducted in accordance with this protocol and protocol amendments (if applicable) and related study-specific procedures, as well as applicable Standard Operating Procedures (SOPs) and generally accepted Good Laboratory Practice. This study is not considered to be within the scope of Good Laboratory Practice regulations.

[0146] 2. Test substance and vehicle information 2.1 Test Substance A compound as further specified above. TIFF2024514887000083.tif94170

[0147] 3. Identification of test system 3.1 Animal Identification TIFF2024514887000084.tif130170

[0148] 3.2 Animal care 3.2.1 Environmental conditions The room will be controlled and monitored for relative humidity (target average range 40% to 70%; deviations from this range for more than 3 hours will be recorded as deviations) and temperature (target average range 18°C ​​to 26°C; deviations from this range will be recorded as deviations) with 10 to 20 air changes per hour. The room will be on a 12-hour light / dark cycle, unless research activities require an interruption.

[0149] 3.2.2 Housing The animals are housed in pairs in cages during the acclimatization period in accordance with applicable animal welfare laws and regulations. During the experiment, the monkeys are housed individually in cages.

[0150] Food and feeding Animals are fed twice daily. Stock monkeys are fed approximately 120 grams of certified monkey diet daily. These amounts can be adjusted as needed based on group food intake or individual weight changes and / or certified dietary changes. Animals are fasted overnight before blood is collected for serum chemistry.

[0151] Drinking Water Reverse osmosis (RO) water was provided ad libitum to all animals.

[0152] 3.2.3 Food and water analysis RO water is analyzed every 3 months and all batches of feed are analyzed prior to use. Feed and water analyses are kept on facility records.

[0153] 3.2.4 Improving the environment Plenty of toys are provided.

[0154] 4. Administration of dosage formulation TIFF2024514887000085.tif90170

[0155] 4.1 Observation and Inspection 4.1.1 Clinical observations Cage-side observations of general health and appearance are made twice daily (approximately 9:30 AM and 4:00 PM). A physical examination of the animals is performed prior to the start of the study to ensure the animals' health. On dosing days, animals are observed 2, 4, and 6 hours after dosing. Any general condition, injection site, behavior, activity, excretion, respiration, or other abnormal observations noted throughout the study are recorded in the raw data. Additional clinical observations are made and recorded as necessary. If clinical observations indicate a deterioration in an animal's condition, a staff veterinarian or veterinary technician will evaluate each animal and the Investigator will be notified. The Investigator or designee will notify the Sponsor if warranted by the evaluation.

[0156] 4.1.2 Weight All animals are weighed weekly. On the day of dosing, animals are weighed prior to dosing to determine the dose volume to be administered.

[0157] 4.1.3 Blood collection for clinical pathology All blood samples are taken from a peripheral vein in restrained, unsedated animals. TIFF2024514887000086.tif77170(1) Blood collection for hematological testing: Collect whole blood (at least 1.0 mL) from animals into commercial tubes containing potassium (K2) EDTA at room temperature (RT). Blood samples are sent to a clinical pathology laboratory at RT and tested for the hematological parameters listed in Table 9. A blood smear will be prepared from each blood sample. The blood smear will be labeled, stained, and stored. The blood smear may be read to investigate the results of the hematology analyses. If additional blood smear testing is deemed necessary, the smear may then be evaluated and this evaluation will be documented in a study protocol amendment. (2) Blood collection for coagulation tests: Approximately 1.7 mL of blood is collected in a sodium citrate anticoagulant tube at room temperature and sent to the clinical pathology laboratory. The parameters listed in Table 9 are performed to test the coagulation function. (3) Blood Collection for Clinical Chemistry: Anticoagulant-free whole blood samples (approximately 1.2 mL) are collected, held at RT and upright for at least 30 minutes, and sent to the clinical pathology laboratory. Samples are processed to serum and tested for the parameters listed in Table 9.

[0158] 4.1.4 Blood Sampling for Pharmacodynamics (PD) TIFF2024514887000087.tif255170

[0159] 5 Protocol Modifications and Deviations Changes to an approved protocol shall be made in the form of an amendment approved by the Investigator and Sponsor. The amendment shall clearly describe the protocol change and include the effective date of the change and justification for the change. The Investigator and Principal Investigator may approve protocol changes by telephone or electronic means if they are not physically present when an emergency or significant change is required. Any approval of such changes made as above shall be properly documented and shall be accompanied by a properly executed written protocol amendment. The amendment shall be signed and dated by the Investigator within 45 days of the effective date.

[0160] All deviations from the protocol and SOPs and reasons for deviations will be documented and approved by the Principal Investigator. The sponsor's representative will be promptly notified of any deviations that may affect the outcome of the study and of any corrective actions taken. Any deviations from the protocol and SOPs that may affect data interpretation will be included in the final report.

[0161] 6 Archiving of materials Test article preparation, test article tracking, in-life data, protocol, protocol amendments (if applicable), and the original final report generated as a result of this study will be archived.

[0162] 7 Statistical analysis The following section does not apply to data recorded on unscheduled occasions; such data will be reported separately.

[0163] Unless otherwise stated later, all numerical data are subjected to calculation of group means and standard deviations using Microsoft Excel software. These descriptive statistics are presented for each data set of interest, determined by the variable under analysis and the data set classification variables (e.g., gender, measurement occasion, and any other relevant variables that may be used to identify at which subdivision the descriptive statistics should be reported).

[0164] If each group in the dataset contains fewer than three nonmissing values, the following inferential data analyses will not be performed. No inferential data analyses will be performed for toxicokinetic parameters and semi-quantitative data, e.g., urinary protein, urinary pH, urinary bilirubin, urinary occult blood, urinary glucose, and urinary ketones.

[0165] Whenever there are more than two groups, homogeneity of group variances is assessed using Levene's test at a significance level of 0.05. If differences between group variances are not found to be significant (p>0.05), a parametric one-way analysis of variance (ANOVA) is performed. If the ANOVA test indicates significant differences between means (p≦0.05), a group mean comparison between the control group and each treatment group is performed using Dunnett's test.

[0166] If the Levene test indicates unequal group variances (p ≤ 0.05) and the data set contains only positive values, a logarithmic transformation is performed. If the transformed data still do not pass the test for homogeneity of variances (p ≤ 0.05) or if the data contain zero and / or negative values, a nonparametric Kruskal-Wallis test is used to compare all groups considered. If the Kruskal-Wallis test is significant (p ≤ 0.05), pairwise group comparisons of interest are performed using the Dunnett test on ranks.

[0167] When only two groups are compared, a Levene test is performed as described above, but a two-sample t-test is performed instead of a one-way ANOVA, a Wilcoxon rank sum test is performed instead of a Kruskal-Wallis, and no Dunnett's test or Dunnett's test on ranks is performed.

[0168] Each pairwise group comparison of interest was performed via two-tailed tests at a significance level of 5%. Significant results were reported as either p≦0.001, p≦0.01, or p≦0.05, where p represents the observed probability.

[0169] [result] The results of the study are shown in Figures 25, 27 and 28. Figure 25 shows the performance of a construct named "91-Conv-31" (structure shown in Figure 22) in an in vivo study for knockdown of Factor XI activity. The effect of different dosages (expressed in mg / kg) and initial single or multiple administrations is shown and compared to a negative control (saline). Efficient and unexpectedly long-lasting knockdown is evident.

[0170] FIG. 26 shows the molecular mechanism underlying the tests on targeting specificity carried out in the course of in vivo studies. APTT stands for Activated Partial Thromboplastin Time. It measures the activity of the intrinsic pathway of coagulation, which is influenced by factors such as FXI. PT stands for Prothrombin Time, which evaluates the integrity of the extrinsic pathway of coagulation, which looks at the presence of factors such as VII, V, X, prothrombin, and fibrinogen.

[0171] FIG. 27 shows the readout results of the test shown in FIG. The % FXI plasma activity (Figure 25), together with the APTT and PT data (Figure 27), demonstrate that this molecule specifically targets FXI and has no off-target effects on the extrinsic coagulation pathway.

[0172] Figure 28 shows data demonstrating the absence of side effects. A panel of liver function and hematology parameters were evaluated. In particular, no elevation of liver enzyme levels and no changes in hematology parameters were found.

Claims

1. An oligomeric compound which inhibits expression of Factor XI ("FXI"), comprising a single stranded oligonucleotide, said single strand consisting of a modified or unmodified oligonucleotide selected from the group consisting of SEQ ID NOs: 2252, 2287, 2288, 2290-2292, 2297, 2300, 2303, 2306, 2309, 2312, 2315, 2321, 2324, 2327, 2332, 2334-2336, 2338, 2339, 2343, 2348, 2351, 2352, 2354, 2355, and 2357-2366.

2. 10. The oligomeric compound of claim 1 further comprising one or more ligands.

3. The oligomeric compound of claim 2 , wherein said one or more ligands are attached to the 3′ end of said oligonucleotide.

4. The oligomeric compound of claim 3, wherein said one or more ligands comprise one or more N-acetyl-galactosamine moieties.

5. The oligomeric compound of claim 1, wherein the terminal nucleoside of the oligomeric compound is an inverted nucleoside and is linked to an adjacent nucleoside via the 3' carbon of its sugar and the 3' carbon of the sugar of the adjacent nucleoside, or is linked to an adjacent nucleoside via the 5' carbon of its sugar and the 5' carbon of the sugar of the adjacent nucleoside.

6. A composition comprising the oligomeric compound of claim 1 and a physiologically acceptable additive.

7. 13. A method for treating a disease or disorder selected from the group consisting of deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease and end stage renal disease (ESRD), comprising administering to an individual in need of such treatment an oligomeric compound of claim 1.

8. The oligomeric compound of claim 1, wherein the single strand is an oligonucleotide selected from the group consisting of SEQ ID NOs: 2252, 2288, 2291-2292, 2297, 2300, 2303, 2306, 2309, 2312, 2315, 2321, 2324, 2327, 2332, 2334-2336, 2338, 2339, 2343, 2352, 2354, and 2357-2364.

9. The oligomeric compound described in claim 1, wherein the single strand consists of an oligonucleotide selected from the group consisting of SEQ ID NOs: 2287, 2290, 2348, 2351, 2355, and 2365.

10. The oligomeric compound described in claim 9, wherein the single strand consists of sequence number: 2287.

11. The oligomeric compound described in claim 8, wherein the single strand consists of sequence number: 2288.

12. The oligomeric compound described in claim 9, wherein the single strand consists of sequence number: 2290.

13. The oligomeric compound described in claim 9, wherein the single strand consists of sequence number: 2348.

14. The oligomeric compound described in claim 8, wherein the single strand consists of sequence number: 2291.

15. The oligomeric compound described in claim 8, wherein the single strand consists of sequence number: 2292.

16. The oligomeric compound described in claim 8, wherein the single strand consists of sequence number: 2297.

Images