Compositions and methods for cell type specific gene expression in the inner ear

JP2024522618A5Pending Publication Date: 2025-06-11DECIBEL THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023575795
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-06-11
Filing Date
2022-06-10
Publication Date
2025-06-11

AI Technical Summary

Technical Problem

Current therapies are inadequate for treating sensorineural hearing loss and vestibular dysfunction, which are often caused by genetic mutations, diseases, infections, or aging, leading to debilitating conditions such as dizziness and balance problems.

Method used

Development of nucleic acid vectors that express polynucleotides in a cell type-specific manner in the inner ear using microRNA target sequences to ensure precise gene expression in targeted cell types, reducing off-target effects.

Benefits of technology

The vectors enable targeted treatment of hearing loss and vestibular dysfunction by promoting cell type-specific gene expression, potentially restoring hearing and balance functions while minimizing toxicity to non-targeted cells.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides a nucleic acid vector comprising a polynucleotide and a promoter operably linked to a microRNA target sequence of a microRNA that is differentially expressed between different inner ear cell types. Such vectors and compositions comprising the same can be used to prevent or reduce off-target expression of the polynucleotide, thus achieving cell type-specific expression of the polynucleotide in the inner ear. Thus, the nucleic acid vectors and compositions described herein can be used to treat subjects suffering from or at risk of developing hearing loss or vestibular dysfunction.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on Jun. 10, 2022 has the name 51124-090WO2_Sequence_Listing_6_10_22_ST25 and is 239,852 bytes in size. [Background technology]

[0002] Hearing loss is a major public health issue, estimated to affect nearly 15% of school-age children and one in three people by age 65. The most common type of hearing loss is sensorineural hearing loss, which is a type of hearing loss caused by defects in cells of the inner ear, such as cochlear hair cells, or in the neural pathways that run from the inner ear to the brain. Sensorineural hearing loss is often acquired and has a variety of causes, including acoustic trauma, disease or infection, head trauma, ototoxic drugs, and aging. Sensorineural hearing loss also has genetic causes, such as mutations in genes involved in the development and function of cells in the inner ear. Mutations in more than 90 such genes have been identified, including mutations inherited in an autosomal recessive, autosomal dominant, or X-linked pattern.

[0003] Factors that disrupt the development, survival, or integrity of cells in the cochlea, such as genetic mutations, disease or infection, ototoxic drugs, head trauma, and aging, can affect vestibular cells as well and therefore also contribute to vestibular dysfunction. Indeed, patients with mutations that disrupt hair cell development or function may exhibit both hearing loss and vestibular dysfunction, or only one of the disorders. Massive loss of vestibular sensory cells can be very debilitating, causing bouts of dizziness accompanied by nausea, imbalance, and incapacity. Approximately 35% of US adults over the age of 40 exhibit balance disorders, and this percentage increases dramatically with age, leading to interruptions in daily activities, mood and cognition decline, and increased rates of falls in the elderly.

[0004] Thus, there is a need for therapies that can be used to treat hearing loss or vestibular dysfunction. Summary of the Invention

[0005] The present invention provides nucleic acid vectors designed to express a polynucleotide of interest (e.g., a transgene encoding a protein or polynucleotide that can be transcribed to produce an inhibitory RNA) in a cell type specific manner in the inner ear. These vectors include a promoter operably linked to the polynucleotide of interest and a polynucleotide that can be transcribed to produce a miRNA target sequence that is recognized by a microRNA (miRNA) that is differentially expressed in different inner ear cell types (e.g., a miRNA that is not expressed in a cell type in which the polynucleotide of interest is suitable for expression and is expressed in an inner ear cell type in which it is desirable to prevent or reduce expression of the polynucleotide of interest). The vectors can include one or more different polynucleotides of interest and one or more polynucleotides that can be transcribed to produce a miRNA target sequence (e.g., one or more copies of a polynucleotide that can be transcribed to produce the same miRNA target sequence, or one or more copies of each of a plurality of different polynucleotides that can each be transcribed to produce a different miRNA target sequence). The invention also provides methods of using the nucleic acid vectors to treat hearing loss (e.g., sensorineural hearing loss), tinnitus, or vestibular dysfunction (e.g., vertigo, dizziness, disequilibrium, bilateral vestibular dysfunction, oscillopsia, or balance disorders) in a subject, such as a human subject.

[0006] In a first aspect, the invention provides a nucleic acid vector comprising: (i) a first polynucleotide capable of being transcribed to produce an expression product (e.g., a polynucleotide capable of being transcribed to produce a protein or an inhibitory RNA molecule); and (ii) a first promoter operably linked to at least one polynucleotide capable of being transcribed to produce a microRNA (miRNA) target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides capable of being transcribed to produce a miRNA target sequence), where the first polynucleotide is suitable for expression in a first inner ear cell type but not in a different, second inner ear cell type, and the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the first promoter is recognized by a miRNA expressed in the second inner ear cell type but not in the first inner ear cell type. In some embodiments, the expression product transcribed from the first polynucleotide promotes conversion of the first inner ear cell type to the second inner ear cell type. In some embodiments, the first polynucleotide is expressed in a first inner ear cell type but not in a second inner ear cell type.

[0007] In some embodiments, the vector comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides that can be transcribed to produce miRNA target sequences. In some embodiments, the vector comprises a polynucleotide that can be transcribed to produce a first miRNA target sequence and a polynucleotide that can be transcribed to produce a second miRNA target sequence, where each miRNA target sequence is recognized by a different miRNA. In some embodiments, the vector further comprises a polynucleotide that can be transcribed to produce a third miRNA target sequence, where each of the first, second, and third miRNA target sequences is recognized by a different miRNA. In some embodiments, the vector comprises at least two copies (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of a polynucleotide that can be transcribed to produce the same miRNA target sequence. In some embodiments, the vector comprises at least three copies (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of a polynucleotide that can be transcribed to produce the same miRNA target sequence. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the first promoter is the same. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence is located 3' of the first polynucleotide.

[0008] In some embodiments, the vector further comprises a WPRE sequence located 3' to the first polynucleotide, and each polynucleotide that can be transcribed to produce a miRNA target sequence is located between the first polynucleotide and the WPRE sequence.

[0009] In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence is within the 3'UTR of a first polynucleotide. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence is within the 5'UTR of a first polynucleotide.

[0010] In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the first promoter is independently targeted by a miRNA listed in Table 2. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0011] In some embodiments, the first inner ear cell type is a cochlear supporting cell, and the second inner ear cell type is a cochlear hair cell or a spiral ganglion neuron. In some embodiments, the second inner ear cell type is a cochlear hair cell. In some embodiments, the second inner ear cell type is a spiral ganglion neuron.

[0012] In some embodiments, the first inner ear cell type is a vestibular supporting cell, and the second inner ear cell type is a vestibular hair cell or a vestibular ganglion neuron.In some embodiments, the second inner ear cell type is a vestibular hair cell.In some embodiments, the second inner ear cell type is a vestibular type I hair cell.In some embodiments, the second inner ear cell type is a vestibular ganglion neuron.

[0013] In some embodiments, the first inner ear cell type is a vestibular type II hair cell and the second inner ear cell type is a vestibular type I hair cell. In some embodiments, the first inner ear cell type is a vestibular type II hair cell and the second inner ear cell type is a vestibular ganglion neuron.

[0014] In some embodiments, the first polynucleotide is a transgene encoding a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system. In some embodiments, the first polynucleotide is a transgene encoding a protein. In some embodiments, the transgene is a wild type version of a gene listed in Table 4. In some embodiments, the transgene is a polynucleotide listed in Table 5. In some embodiments, the first polynucleotide can be transcribed to produce an inhibitory RNA. In some embodiments, the inhibitory RNA is an siRNA, shRNA, or shRNA-mir. In some embodiments, the inhibitory RNA is an inhibitory RNA that targets Sox2 (e.g., an inhibitory RNA described herein). In some embodiments, the first polynucleotide encodes a component of a gene editing system. In some embodiments, the first polynucleotide can be transcribed to produce a guide RNA. In some embodiments, the first polynucleotide encodes a nuclease. In some embodiments, the first polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2.

[0015] In some embodiments, the first promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter. In some embodiments, the first promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter. In some embodiments, the first promoter is an inner ear cell type-specific promoter listed in Table 12 (e.g., a supporting cell-specific promoter or a hair cell-specific promoter listed in Table 12).

[0016] In some embodiments, the vector further comprises a second polynucleotide that can be transcribed to produce an expression product, wherein the second polynucleotide is different from the first polynucleotide.

[0017] In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, a second polynucleotide, and at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, where the second polynucleotide is suitable for expression in a first inner ear cell type but not in a second inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the second polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence is located between the second polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 3'UTR of the second polynucleotide. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 5'UTR of the first polynucleotide.

[0018] In some embodiments, the second polynucleotide is operably linked to a second promoter. In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a second promoter, and a second polynucleotide. In some embodiments, expression of the second polynucleotide is not regulated by a miRNA target sequence. In some embodiments, the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the second polynucleotide operably linked to the second promoter, the second polynucleotide being suitable for expression in a third inner ear cell type but not suitable for expression in a different fourth inner ear cell type, and the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the second polynucleotide, and each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the second polynucleotide is located between the second polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the second promoter is within the 3'UTR of the second polynucleotide. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the second promoter is within the 5'UTR of the second polynucleotide.

[0019] In some embodiments, the vector further comprises a third polynucleotide that can be transcribed to produce an expression product, wherein the third polynucleotide is distinct from the first polynucleotide and the second polynucleotide.

[0020] In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, a second polynucleotide, a third polynucleotide, and at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, where the third polynucleotide is suitable for expression in a first inner ear cell type but not in a second inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the third polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence is located between the third polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 3'UTR of the third polynucleotide. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 5'UTR of the first polynucleotide.

[0021] In some embodiments, the first polynucleotide is operably linked to a first promoter, and the second and third polynucleotides are operably linked to a second promoter. In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide, and a third polynucleotide. In some embodiments, expression of the second and third polynucleotides is not regulated by the miRNA target sequence. In some embodiments, the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of a third polynucleotide operably linked to a second promoter, where the second and third polynucleotides are suitable for expression in a third inner ear cell type but not in a different fourth inner ear cell type, and the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the third polynucleotide, where each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to a second promoter is located between the third polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to a second promoter is within the 3'UTR of the third polynucleotide. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is within the 5'UTR of a second polynucleotide.

[0022] In some embodiments, the first polynucleotide and the second polynucleotide are operably linked to a first promoter, and the third nucleic acid is operably linked to a second promoter. In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, a second polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a second promoter, and a third polynucleotide. In some embodiments, expression of the third polynucleotide is not regulated by the miRNA target sequence. In some embodiments, the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the third polynucleotide operably linked to the second promoter, the third polynucleotide being suitable for expression in a third inner ear cell type, but not suitable for expression in a different fourth inner ear cell type, and the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type, but not in the third inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the second polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the first promoter is located between the second polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the first promoter is located within the 3'UTR of the second polynucleotide. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the first promoter is located within the 5'UTR of the first polynucleotide. In some embodiments, the vector further comprises a WPRE sequence located 3' of the third polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the second promoter is located between the third polynucleotide and the WPRE sequence.In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is within the 3'UTR of a third polynucleotide. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is within the 5'UTR of a third polynucleotide.

[0023] In some embodiments, the first polynucleotide is operably linked to a first promoter, the second polynucleotide is operably linked to a second promoter, and the third polynucleotide is operably linked to a third promoter.

[0024] In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide, a third promoter, and a third polynucleotide. In some embodiments, the expression of the second and third polynucleotides is not regulated by the miRNA target sequence. In some embodiments, the vector comprises, in 5' to 3' order, a first promoter, a first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, a third promoter, and a third polynucleotide. In some embodiments, the expression of the third polynucleotide is not regulated by the miRNA target sequence. In some embodiments, the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of a third polynucleotide operably linked to a third promoter, the third polynucleotide being suitable for expression in a fifth inner ear cell type but not a different sixth inner ear cell type, and the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the third promoter is recognized by a miRNA expressed in the sixth inner ear cell type but not in the fifth inner ear cell type. In some embodiments, the vector further comprises a WPRE sequence located 3' of the second polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the second promoter is located between the second polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the second promoter is within the 3'UTR of the second polynucleotide. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is within the 5'UTR of a second polynucleotide.In some embodiments, the vector further comprises a WPRE sequence located 3' of the third polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the third promoter is located between the third polynucleotide and the WPRE sequence. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the third promoter is within the 3'UTR of the third polynucleotide. In some embodiments, each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to the third promoter is within the 5'UTR of the third polynucleotide.

[0025] In some embodiments, the fourth inner ear cell type is different from the second inner ear cell type. In some embodiments, the first inner ear cell type is the same as the fourth inner ear cell type. In some embodiments, the first inner ear cell type is different from the fourth inner ear cell type.

[0026] In some embodiments, the fourth inner ear cell type is the same as the second inner ear cell type. In some embodiments, the third inner ear cell type is different from the first inner ear cell type. In some embodiments, the third inner ear cell type is the same as the second inner ear cell type. In some embodiments, the third inner ear cell type is different from the second inner ear cell type.

[0027] In some embodiments, the third inner ear cell type is the same as the first inner ear cell type. In some embodiments, the sixth inner ear cell type is different from the fourth and second inner ear cell type. In some embodiments, the sixth inner ear cell type is the same as either the fourth inner ear cell type or the second inner ear cell type. In some embodiments, the sixth inner ear cell type is the same as the fourth and second inner ear cell type.

[0028] In some embodiments, the fifth inner ear cell type is different from the first and third inner ear cell types. In some embodiments, the fifth inner ear cell type is the same as either the first inner ear cell type or the third inner ear cell type. In some embodiments, the fifth inner ear cell type is the same as the first and third inner ear cell types.

[0029] In some embodiments, the second promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter. In some embodiments, the second promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter. In some embodiments, the second promoter is an inner ear cell type-specific promoter listed in Table 12 (e.g., a supporting cell-specific promoter or a hair cell-specific promoter listed in Table 12). In some embodiments, the second polynucleotide is a transgene that encodes a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system. In some embodiments, the second polynucleotide is a transgene that encodes a protein. In some embodiments, the transgene is a wild-type version of a gene listed in Table 4. In some embodiments, the transgene is a polynucleotide listed in Table 5. In some embodiments, the second polynucleotide can be transcribed to produce an inhibitory RNA. In some embodiments, the inhibitory RNA is an siRNA, shRNA, or shRNA-mir. In some embodiments, the inhibitory RNA is an inhibitory RNA targeting Sox2 (e.g., an inhibitory RNA described herein). In some embodiments, the second polynucleotide encodes a component of a gene editing system. In some embodiments, the second polynucleotide can be transcribed to produce a guide RNA. In some embodiments, the second polynucleotide encodes a nuclease. In some embodiments, the second polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides that can be transcribed to produce a miRNA target sequence are operably linked to a second promoter.In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is independently targeted by a miRNA listed in Table 2. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0030] In some embodiments, the third promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter. In some embodiments, the third promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter. In some embodiments, the third promoter is an inner ear cell type-specific promoter listed in Table 12 (e.g., a supporting cell-specific promoter or a hair cell-specific promoter listed in Table 12). In some embodiments, the third polynucleotide is a transgene that encodes a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system. In some embodiments, the third polynucleotide is a transgene that encodes a protein. In some embodiments, the transgene is a wild-type version of a gene listed in Table 4. In some embodiments, the transgene is a polynucleotide listed in Table 5. In some embodiments, the third polynucleotide can be transcribed to produce an inhibitory RNA. In some embodiments, the inhibitory RNA is an siRNA, shRNA, or shRNA-mir. In some embodiments, the inhibitory RNA is an inhibitory RNA targeting Sox2 (e.g., an inhibitory RNA described herein). In some embodiments, the third polynucleotide encodes a component of a gene editing system. In some embodiments, the third polynucleotide can be transcribed to produce a guide RNA. In some embodiments, the third polynucleotide encodes a nuclease. In some embodiments, the third polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides that can be transcribed to produce a miRNA target sequence are operably linked to a third promoter.In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the third promoter is independently targeted by a miRNA listed in Table 2. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the third promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0031] In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the second promoter is the same. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the third promoter is the same.

[0032] In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is the same as each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is the same as each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is the same as each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is the same as each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter, and is the same as each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter.

[0033] In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is different from each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is different from each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter is different from each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter. In some embodiments, each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a first promoter is different from each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a second promoter and is different from each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to a third promoter.

[0034] In some embodiments, at least one polynucleotide that can be transcribed to produce an miRNA target sequence is operably linked to both a first promoter and a second promoter, to both a first promoter and a third promoter, to both a second promoter and a third promoter, or independently to the first, second, and third promoter (e.g., two or more of the polynucleotides that can be transcribed to produce an expression product are regulated by the same miRNA target sequence or by a set of miRNA target sequences that include a shared miRNA target sequence).

[0035] In some embodiments, the third inner ear cell type is a cochlear supporting cell, and the fourth inner ear cell type is a cochlear hair cell or a spiral ganglion neuron. In some embodiments, the fourth inner ear cell type is a cochlear hair cell. In some embodiments, the fourth inner ear cell type is a spiral ganglion neuron.

[0036] In some embodiments, the third inner ear cell type is a vestibular supporting cell, and the fourth inner ear cell type is a vestibular hair cell or a vestibular ganglion neuron. In some embodiments, the fourth inner ear cell type is a vestibular hair cell. In some embodiments, the fourth inner ear cell type is a vestibular type I hair cell. In some embodiments, the fourth inner ear cell type is a vestibular ganglion neuron.

[0037] In some embodiments, the third inner ear cell type is a vestibular type II hair cell and the fourth inner ear cell type is a vestibular type I hair cell. In some embodiments, the third inner ear cell type is a vestibular type II hair cell and the fourth inner ear cell type is a vestibular ganglion neuron.

[0038] In some embodiments, the fifth inner ear cell type is a cochlear supporting cell, and the sixth inner ear cell type is a cochlear hair cell or a spiral ganglion neuron. In some embodiments, the sixth inner ear cell type is a cochlear hair cell. In some embodiments, the sixth inner ear cell type is a spiral ganglion neuron.

[0039] In some embodiments, the fifth inner ear cell type is a vestibular supporting cell, and the sixth inner ear cell type is a vestibular hair cell or a vestibular ganglion neuron. In some embodiments, the sixth inner ear cell type is a vestibular hair cell. In some embodiments, the sixth inner ear cell type is a vestibular type I hair cell. In some embodiments, the sixth inner ear cell type is a vestibular ganglion neuron.

[0040] In some embodiments, the fifth inner ear cell type is a vestibular type II hair cell and the sixth inner ear cell type is a vestibular type I hair cell. In some embodiments, the fifth inner ear cell type is a vestibular type II hair cell, and the sixth inner ear cell type is a vestibular ganglion neuron.

[0041] In some embodiments, (a) the first polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2, or can be transcribed to produce an inhibitory RNA targeting Sox2; (b) the first promoter is a CMV promoter, a FGFR3 promoter, a LFNG promoter, or a SLC1A3 promoter; (c) each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-194; (d) the first inner ear cell type is a cochlear supporting cell; and (e) the second inner ear cell type is a cochlear hair cell. In some embodiments, the first polynucleotide encodes Atoh1, and the second polynucleotide encodes Ikzf2. In some embodiments, the first polynucleotide encodes Atoh1, the second polynucleotide encodes Gfi1, and the third polynucleotide encodes Pou4f3.

[0042] In some embodiments, (a) the first polynucleotide encodes GJB2; (b) the first promoter is a GJB2 promoter, a CMV promoter, an FGFR3 promoter, an LFNG promoter, or an SLC1A3 promoter; (c) each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124, or miR-194; (d) the first inner ear cell type is a cochlear supporting cell; and (e) the second inner ear cell type is a spiral ganglion neuron.

[0043] In some embodiments, (a) the first polynucleotide encodes Atoh1 or dnSox2 or is capable of being transcribed to produce an inhibitory RNA targeting Sox2; (b) the first promoter is a CMV promoter, a GFAP promoter, a SLC6A14 promoter, or a SLC1A3 promoter; (c) each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-135b; (d) the first inner ear cell type is a vestibular supporting cell; and (e) the second inner ear cell type is a vestibular hair cell.

[0044] In some embodiments, (a) the first polynucleotide encodes Atoh1 or dnSox2 or is capable of being transcribed to produce an inhibitory RNA targeting Sox2; (b) the first promoter is a CMV promoter, a GFAP promoter, a SLC6A14 promoter, or a SLC1A3 promoter; (c) each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135; (d) the first inner ear cell type is a vestibular supporting cell; and (e) the second inner ear cell type is a vestibular ganglion neuron.

[0045] In some embodiments, (a) the first polynucleotide encodes dnSox2 or can be transcribed to produce an inhibitory RNA targeting Sox2, (b) the first promoter is the MYO15 promoter, (c) each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135, (d) the first cochlear cell type is a type II hair cell, and (e) the second cochlear cell type is a vestibular ganglion neuron. In some embodiments, each miRNA target sequence present is independently targeted by one of miR-18a, miR-124a, miR-100, or miR-135.

[0046] In some embodiments, the inhibitory RNA targeting Sox2 is an siRNA. In some embodiments, the inhibitory RNA targeting Sox2 is an shRNA. In some embodiments, the siRNA or shRNA targeting Sox2 has a nucleobase sequence that includes a portion of at least 8 contiguous nucleobases, which sequence has at least 80% complementarity to an equal length portion of the target region of an mRNA transcript of the human or mouse SOX2 gene. In some embodiments, the target region is an mRNA transcript of the human SOX2 gene. In some embodiments, the target region is at least 8-21 contiguous nucleobases of any one of SEQ ID NOs: 52-70, at least 8-22 contiguous nucleobases of SEQ ID NO: 74 or SEQ ID NO: 75, or at least 8-19 contiguous nucleobases of any one of SEQ ID NOs: 71-73. In some embodiments, the siRNA or shRNA has a nucleobase sequence that includes a portion of at least 8 contiguous nucleobases, which sequence has at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of any one of SEQ ID NOs: 52-75. In some embodiments, the siRNA or shRNA has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to any one of SEQ ID NO:58, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, and SEQ ID NO:75. In some embodiments, the shRNA comprises the sequence of nucleotides 2234-2296 of SEQ ID NO:76 or nucleotides 2234-2296 of SEQ ID NO:78. In some embodiments, the shRNA is embedded in a microRNA (miRNA) backbone.In some embodiments, the shRNA is embedded in a miR-30 or mir-E backbone. In some embodiments, the shRNA comprises the sequence of nucleotides 2109-2426 of SEQ ID NO:76, nucleotides 2109-2408 of SEQ ID NO:66, nucleotides 2109-2426 of SEQ ID NO:78, or nucleotides 2109-2408 of SEQ ID NO:79. In some embodiments, the siRNA comprises a sense strand and an antisense strand selected from the following pairs: SEQ ID NO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, and SEQ ID NO:86 and SEQ ID NO:87.

[0047] In some embodiments, the polynucleotide encoding the dnSox2 protein has the sequence of SEQ ID NO: 50 or SEQ ID NO: 51. In some embodiments, the dnSox2 protein is a Sox2 protein lacking most or all of the high mobility group domain (HMGD), a Sox2 protein in which a nuclear localization signal within the HMGD has been mutated, a Sox2 protein in which the HMGD has been fused to an engrailed repressor domain, or a C-terminally truncated Sox2 protein that contains only the DNA binding domain.

[0048] In some embodiments, the nucleic acid vector is a plasmid, a cosmid, an artificial chromosome, or a viral vector. In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP.A, PHP.eb, or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has an AAV8 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an AAV2(quadY-F) capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has a DJ / 9 capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has a PHP.eb capsid.

[0049] In another aspect, the invention provides a pharmaceutical composition comprising a nucleic acid vector of the invention and a pharma- ceutically acceptable carrier, excipient, or diluent. In another aspect, the present invention provides a kit comprising the nucleic acid vector or pharmaceutical composition of the present invention.

[0050] In another aspect, the invention provides a method for expressing a polynucleotide in a first inner ear cell type, but not a second inner ear cell type, in a subject in need of the polynucleotide by locally administering to the middle or inner ear of the subject an effective amount of a nucleic acid vector or pharmaceutical composition of the invention.

[0051] In another aspect, the invention provides a method of reducing off-target expression of a polynucleotide in the inner ear of a subject (e.g., reducing off-target expression in a specific inner ear cell type) by locally administering to the middle or inner ear of a subject an effective amount of a nucleic acid vector or pharmaceutical composition of the invention.

[0052] In some embodiments of any of the aforementioned aspects, the subject suffers from or is at risk of developing hearing loss, vestibular dysfunction, or tinnitus. In another aspect, the present invention provides a method of treating a subject suffering from or at risk of developing hearing loss, vestibular dysfunction, or tinnitus, comprising administering to the subject an effective amount of a nucleic acid vector or pharmaceutical composition of the present invention.

[0053] In some embodiments of any of the aforementioned aspects, the subject suffers from or is at risk of developing a vestibular dysfunction. In some embodiments of any of the above aspects, the vestibular dysfunction is vertigo, dizziness, imbalance, bilateral vestibular dysfunction, oscillopsia, or balance disorder.In some embodiments of any of the above aspects, the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction.In some embodiments of any of the above aspects, the vestibular dysfunction is associated with a genetic mutation.In some embodiments, the genetic mutation is a mutation in a gene listed in Table 4.In some embodiments of any of the above aspects, the vestibular dysfunction is idiopathic vestibular dysfunction.

[0054] In some embodiments of any of the foregoing aspects, the subject suffers from or is at risk of developing hearing loss (e.g., sensorineural hearing loss, including auditory neuropathy and hearing impairment). In some embodiments of any of the foregoing aspects, the hearing loss is genetic hearing loss. In some embodiments, the genetic hearing loss is autosomal dominant hearing loss, autosomal recessive hearing loss, or X-linked hearing loss. In some embodiments, the genetic hearing loss is a disease associated with a mutation in a gene listed in Table 4. In some embodiments of any of the foregoing aspects, the hearing loss is acquired hearing loss. In some embodiments, the acquired hearing loss is noise-induced hearing loss, age-related hearing loss, disease or infection-related hearing loss, head trauma-related hearing loss, or ototoxic drug-induced hearing loss.

[0055] In some embodiments of any of the aforementioned aspects, the ototoxic drug is an aminoglycoside, an antitumor drug, ethacrynic acid, furosemide, a salicylate, or quinine. In some embodiments of any of the foregoing aspects, the hearing loss or vestibular dysfunction is or is associated with age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher Syndrome Type 1, Usher Syndrome Type 2, or bilateral vestibular dysfunction.

[0056] In some embodiments of any of the foregoing aspects, the hearing loss is or is associated with age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, or Usher syndrome type 2, and the first polynucleotide encodes Atoh1. In some embodiments, the second polynucleotide encodes Ikzf2. In some embodiments, the second polynucleotide encodes Pou4f3 and the third polynucleotide encodes Gfi1.

[0057] In some embodiments of any of the foregoing aspects, the method further comprises administering to the subject one or more (e.g., 1, 2, 3, 4, 5, or more) additional nucleic acid vectors. In some embodiments, the subject is further administered a vector comprising a polynucleotide encoding Ikzf2. In some embodiments, the subject is further administered a vector comprising a polynucleotide encoding Pou4f3 and a vector comprising a polynucleotide encoding Gfi1.

[0058] In some embodiments of any of the foregoing aspects, the hearing loss or vestibular dysfunction is or is associated with DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, Usher syndrome type 2, or bilateral vestibular dysfunction, and the first polynucleotide encodes dnSox2. In some embodiments, the second polynucleotide encodes Atoh1. In some embodiments, the subject is further administered a vector comprising a polynucleotide encoding Atoh1.

[0059] In some embodiments of any of the aforementioned aspects, at least one of the one or more additional nucleic acid vectors comprises a promoter operably linked to a polynucleotide that can be transcribed to produce an expression product (e.g., Ikzf2, Pou4f3, Gfi1, or Atoh1) and a polynucleotide that can be transcribed to produce a miRNA target sequence.

[0060] In some embodiments of any of the aforementioned aspects, none of the additional nucleic acid vectors comprises a polynucleotide that can be transcribed to produce a miRNA target sequence. In another aspect, the invention provides a method of treating a disease listed in Table 4 in a subject in need of treatment by locally administering an effective amount of a nucleic acid vector or pharmaceutical composition of the invention to the middle or inner ear of the subject, wherein the first polynucleotide is a wild type version of a gene associated with a disease listed in Table 4 that is mutated in the subject.

[0061] In some embodiments of any of the aforementioned aspects, the method further comprises assessing vestibular function of the subject prior to administering the nucleic acid vector or pharmaceutical composition. In some embodiments of any of the aforementioned aspects, the method further comprises assessing vestibular function of the subject after administering the nucleic acid vector or pharmaceutical composition.

[0062] In some embodiments of any of the aforementioned aspects, the method further comprises assessing the subject's hearing prior to administering the nucleic acid vector or pharmaceutical composition. In some embodiments of any of the aforementioned aspects, the method further comprises assessing the subject's hearing after administering the nucleic acid vector or pharmaceutical composition.

[0063] In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to the inner ear. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to the middle ear. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to the semicircular canal. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered transtympanic or intratympanic. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to the perilymph. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to the endolymph. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to or through the oval window. In some embodiments of any of the preceding aspects, the nucleic acid vector or pharmaceutical composition is administered to or through the round window.

[0064] In some embodiments of any of the foregoing aspects, the nucleic acid vector or pharmaceutical composition is administered in an amount sufficient to prevent or alleviate vestibular dysfunction, delay the onset of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, prevent or alleviate hearing loss, prevent or alleviate tinnitus, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing, increase the number of vestibular hair cells and / or cochlear hair cells, promote maturation of vestibular hair cells and / or cochlear hair cells, increase regeneration of vestibular hair cells and / or cochlear hair cells, treat bilateral vestibular dysfunction, treat oscillopia, treat balance disorders, improve function of one or more inner ear cell types, improve survival of inner ear cells, increase proliferation of inner ear cells, increase production of type I vestibular hair cells, or increase the number of type I vestibular hair cells.

[0065] In some embodiments of any of the aforementioned aspects, the subject is a human. In another aspect, the present invention provides an inner ear cell comprising a nucleic acid vector or pharmaceutical composition of the present invention. In some embodiments, the inner ear cell is a cochlear supporting cell. In some embodiments, the inner ear cell is a vestibular supporting cell. In some embodiments, the inner ear cell is a cochlear hair cell. In some embodiments, the inner ear cell is a vestibular hair cell. In some embodiments, the inner ear cell is a vestibular type I hair cell. In some embodiments, the inner ear cell is a vestibular type II hair cell. In some embodiments, the inner ear cell is a spiral ganglion neuron. In some embodiments, the inner ear cell is a vestibular ganglion neuron. In some embodiments, the inner ear cell is a human inner ear cell.

[0066] definition To facilitate understanding of the present invention, certain terms are defined below. Terms defined herein have meanings commonly understood by those of ordinary skill in the art relevant to the present invention. Terms such as "a", "an", and "the" are not intended to refer to only a single entity, but include general classes for which specific examples may be used for illustration. While the terms herein are used to describe specific embodiments of the present invention, their use is not intended to limit the present invention, except as outlined in the claims.

[0067] As used herein, the term "about" refers to a value within 10% above or below the stated value. As used herein, any value provided in a range of values ​​includes both the upper and lower limits, as well as any value subsumed within the limits.

[0068] As used herein, "administration" refers to providing or giving a therapeutic agent (e.g., a vector for expressing a transgene in inner ear cells) to a subject by any effective route. Exemplary routes of administration are described herein below.

[0069] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include cells isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or cells isolated from a common organ, tissue system, blood vessel, or other structure and / or region in the body.

[0070] As used herein, the term "cochlear hair cells" refers to a group of specialized cells in the inner ear that are involved in sensing sound. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and genetic mutations that disrupt the function of cochlear hair cells are implicated in hearing loss and hearing impairment.

[0071] As used herein, the term "complementarity" or "complementary" of a nucleic acid means that a nucleotide sequence in one strand of a nucleic acid forms hydrogen bonds with another sequence on an opposing nucleic acid strand due to the orientation of its nucleobase groups. Complementary bases in DNA are usually A and T, and C and G. In RNA, they are usually C and G, and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a duplex, in which all bases in the duplex bind to complementary bases by Watson-Crick pairing. "Substantial" or "sufficient" complementarity means that the sequence in one strand is not completely and / or perfectly complementary to the sequence in the opposing strand, but sufficient binding occurs between the bases on the two strands to form a stable hybrid complex under a set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using the sequence and standard mathematical calculations, or by empirically determining the Tm using routine methods. The Tm includes the temperature at which the population of hybridization complexes formed between two nucleic acid strands is 50% denatured (i.e., the population of double-stranded nucleic acid molecules is half-dissociated into single strands). At temperatures below the Tm, the formation of hybridization complexes is favored, while at temperatures above the Tm, melting or separation of the strands in the hybridization complexes is favored. The Tm of a nucleic acid of known G+C content in 1M NaCl aqueous solution can be estimated, for example, using Tm=81.5+0.41(%G+C), although other known Tm calculations take into account structural properties of the nucleic acid.

[0072] As used herein, the terms "effective amount," "therapeutically effective amount," and "sufficient amount" of a composition, vector construct, or viral vector described herein refer to an amount sufficient to produce a beneficial or desired result, including a clinical result, when administered to a subject, including a mammal, e.g., a human, and thus "effective amount" or its synonyms depend on the context in which it is applied. For example, in the context of treating hearing loss or vestibular dysfunction, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to the response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that corresponds to such an amount will vary depending on various factors, such as, for example, the given drug, pharmaceutical formulation, route of administration, type of disease or disorder, subject (e.g., age, sex, weight) or host identity to be treated, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition, vector construct, or viral vector of the present disclosure is an amount that produces a beneficial or desired result in a subject compared to a control. As defined herein, a therapeutically effective amount of a composition, vector construct, or viral vector of the present disclosure can be readily determined by one of ordinary skill in the art by routine methods well known in the art. Dosage regimens can be adjusted to obtain the optimal therapeutic response.

[0073] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, such as a human cell (e.g., a human vestibular supporting cell)).

[0074] As used herein, the term "express" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end processing), (3) translation of the RNA into a polypeptide or protein, and (4) post-translational modification of the polypeptide or protein. The term "expression product" refers to a protein or RNA molecule produced by any of these events.

[0075] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, such as a human cell (e.g., a human vestibular supporting cell)). Exogenous materials include materials supplied from an external source to an organism or culture extracted therefrom.

[0076] As used herein, the term "heterologous" refers to a combination of elements that do not occur in nature. For example, a heterologous transgene refers to a transgene that is not naturally expressed by the promoter to which it is operably linked.

[0077] As used herein, the terms "increase" and "decrease" refer to the adjustment of the amount of a metric function, expression, or activity, respectively, to an increase or decrease, compared to a reference. For example, following administration of a composition in the manner described herein, the amount of a marker of a metric described herein (e.g., transgene expression) may be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more in a subject relative to the amount of the marker prior to administration. Generally, the metric is measured at a time point following administration when the recited effect is achieved, e.g., at least 1 week, 1 month, 3 months, or 6 months after the start of a treatment regimen.

[0078] As used herein, the term "inner ear cell type" refers to a cell type found in the inner ear (e.g., the cochlear system and / or the vestibular system) of a subject (e.g., a human subject). The types of cells in the inner ear include cochlear hair cells (further divided into inner and outer hair cells), type I vestibular hair cells, type II vestibular hair cells, vestibular dark cells, vestibular fibrocytes, Scarpa's ganglion neurons (vestibular ganglion neurons), endothelial cells of the vestibular capillaries, vestibular supporting cells, cochlear supporting cells (including border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, first row Deiters cells, second row Deiters cells, third row Deiters cells, and Hensen cells), Clausius cells, spiral eminence cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, spiral ganglion neurons, endothelial cells of the cochlear capillaries, fibrocytes, cells of Reissner's membrane, and glial cells.

[0079] As used herein, "locally" or "local administration" refers to administration to a particular site in the body for a local, rather than a systemic, effect. Examples of local administration are epidermal administration, inhalation administration, intra-articular administration, intrathecal administration, intravaginal administration, intravitreal administration, intrauterine administration, intralesional administration, lymph node administration, intratumoral administration, administration to the middle or inner ear, and administration to a mucous membrane of a subject, where administration is intended to produce a local, rather than a systemic, effect.

[0080] As used herein, the term "operably linked" refers to a first molecule bound to a second molecule, where the molecules are positioned such that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single contiguous molecule, and may or may not be adjacent. For example, a promoter is operably linked to a transcribable polynucleotide molecule of interest if the promoter regulates the transcription of the transcribable polynucleotide molecule of interest in a cell. Furthermore, two portions of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without the presence of any intervening nucleotides.

[0081] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule to which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule capable of transporting another nucleic acid to which it is ligated. Certain plasmids can replicate autonomously in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Certain plasmids can induce the expression of genes to which they are operatively linked.

[0082] As used herein, the term "polynucleotide" refers to a polymer of nucleosides. Typically, polynucleotides are composed of nucleosides found naturally in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. The term encompasses molecules containing nucleosides or nucleoside analogs, including chemically or biologically modified bases, modified backbones, and the like, whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. When the application refers to polynucleotides, it is understood that both DNA and RNA, and in each case both single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" can refer to the polynucleotide material itself and / or to sequence information (i.e., a series of letters used as abbreviations for bases) that biochemically characterize a particular nucleic acid. Polynucleotide sequences presented herein are presented in the 5' to 3' orientation unless otherwise indicated.

[0083] As used herein, the term "promoter" refers to a recognition site on DNA that is bound by an RNA polymerase. The polymerase drives transcription of a transgene.

[0084] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharma- ceutically acceptable excipients, diluents, and / or carriers, administered to a subject, such as a mammal (e.g., a human), to prevent, treat, or control a particular disease or condition that affects or may affect the subject.

[0085] As used herein, the term "pharmacologically acceptable" refers to compounds, substances, compositions and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without undue toxicity, irritation, allergic response and other significant complications, commensurate with a reasonable benefit / risk ratio.

[0086] As used herein, the term "supporting cells" refers to specialized epithelial cells in the cochlea and vestibular system of the inner ear that reside between the hair cells. Supporting cells help maintain the structural integrity of the sensory organs during sound stimuli and head movements and maintain an environment within the epithelium that allows the hair cells to function. Supporting cells are also involved in the development, survival, death, and phagocytosis of cochlear and vestibular hair cells.

[0087] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene of interest. Transcriptional regulatory elements can include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals) that control or aid in the control of gene transcription. Examples of transcriptional regulatory elements are described, for example, in Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).

[0088] As used herein, the term "transfection" refers to any of a variety of techniques commonly used for the introduction of exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, nucleofection, squeezeporation, sonoporation, optical transfection, magnetofection, imperfection, and the like.

[0089] As used herein, the terms "subject" and "patient" refer to an animal (e.g., a mammal, such as a human). The subject treated according to the methods described herein may be a subject diagnosed with hearing loss (e.g., sensorineural hearing loss or hearing impairment) and / or vestibular dysfunction (e.g., dizziness, vertigo, imbalance or loss of balance, bilateral vestibular dysfunction, oscillopsia, or balance disorders) or at risk of developing these conditions. Diagnosis may be performed by any method or technique known in the art. One of skill in the art will understand that the subject treated according to the present disclosure may have undergone standard testing or may have been identified as a subject at risk due to the presence of one or more risk factors associated with a disease or condition without testing.

[0090] As used herein, the phrase "suitable for expression" refers to a polynucleotide that is intended for expression in an inner ear cell type, and includes, but is not limited to, (i) polynucleotides that are expressed in an inner ear cell type, and (ii) polynucleotides that regulate a gene or protein expressed in an inner ear cell type.

[0091] As used herein, the terms "transduction" and "transducing" refer to a method of introducing a vector construct or a portion thereof into a cell. When the vector construct is contained in a viral vector, such as, for example, an AAV vector, transduction refers to viral infection of a cell and the subsequent transfer and integration of the vector construct or a portion thereof into the cellular genome.

[0092] As used herein, "treatment" and "treating" in reference to a disease or condition refer to an approach to obtain a beneficial or desired result, e.g., a clinical result. Beneficial or desired results may include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, whether detectable or undetectable, reduction in the extent of the disease or condition, stabilization (i.e., not worsening) of the disease, disorder, or condition, prevention of the spread of the disease or condition, delay or slowing of the progression of the disease or condition, amelioration or alleviation of the disease or condition, and remission (partial or complete). "Ameliorating" or "alleviating" a disease or condition means that the extent and / or undesirable clinical symptoms of the disease, disorder, or condition are reduced and / or the time course of progression is delayed or prolonged compared to the extent or time course in the absence of treatment. "Treatment" may also mean prolonging survival compared to the expected survival in the absence of treatment. Those in need of treatment include those already suffering from the disease or condition as well as those susceptible to the disease or condition or those in need of prevention of the disease or condition.

[0093] As used herein, the term "vector" includes nucleic acid vectors, e.g., DNA vectors such as plasmids, cosmids, or artificial chromosomes, RNA vectors, viruses, or any other suitable replicon (e.g., viral vectors). A variety of vectors have been developed to deliver polynucleotides encoding exogenous proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express the transgenes described herein include vectors that include regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other useful vectors for expression of transgenes include polynucleotide sequences that increase the translation rate of the transgene or improve the stability or nuclear export of mRNA resulting from gene transcription. To induce efficient transcription of genes carried on the expression vector, these sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0094] As used herein, the term "vestibular hair cells" refers to a group of specialized cells in the inner ear that are involved in sensing motion and contribute to balance and spatial orientation. There are two types of vestibular hair cells: type I hair cells and type II hair cells. Vestibular hair cells are located in the semicircular canal end organs and otolithic organs of the inner ear. Damage to vestibular hair cells and genetic mutations that disrupt the function of vestibular hair cells are involved in vestibular dysfunction such as vertigo, bilateral vestibular dysfunction, oscillopia, and balance disorders.

[0095] As used herein, the term "vestibular sensory epithelium" refers to any of vestibular type I hair cells, vestibular type II hair cells, and vestibular supporting cells. As used herein, the term "wild type" refers to the most frequent genotype for a particular gene in a given organism. [Brief description of the drawings]

[0096] [Figure 1] 1 is a plasmid map of transgene plasmid P742. [Diagram 2] 1 is a plasmid map of transgene plasmid P744. [Diagram 3] 1 is a plasmid map of transgene plasmid P745. [Figure 4] 1 is a plasmid map of transgene plasmid P746. [Diagram 5] 1 is a plasmid map of the transgene plasmid P747. [Figure 6] 1 is a plasmid map of transgene plasmid P002. [Figure 7] A series of photomicrographs showing GFP expression in HEK293-T cells transfected with different AAV vectors. Each pair of panels (e.g., A and A', B and B', etc.) shows the same field of cells showing GFP expression (A, B, C, D, E, F, and G) and DAPI nuclear staining (A', B', C', D', E', F', and G') for each of the different AAV vectors. [Figure 8]1 is a plasmid map of transgene plasmid P740. [Figure 9] 1 is a plasmid map of transgene plasmid P741. [Figure 10] 1 is a plasmid map of transgene plasmid P743. [Figure 11] 1 is a plasmid map of the transgene plasmid P750. [Figure 12] 1 is a plasmid map of transgene plasmid P752. [Figure 13] 1 is a plasmid map of transgene plasmid P753. [Figure 14] 1 is a plasmid map of transgene plasmid P754. [Figure 15] 1 is a plasmid map of transgene plasmid P755. [Figure 16] 1 is a plasmid map of transgene plasmid P748. [Figure 17] 1 is a plasmid map of transgene plasmid P749. [Figure 18] 1 is a plasmid map of transgene plasmid P751. [Figure 19] 1 is a plasmid map of transgene plasmid P1137. [Figure 20] 1 is a plasmid map of transgene plasmid P1138. [Figure 21] 1 is a plasmid map of transgene plasmid P1139. [Figure 22] 1 is a plasmid map of transgene plasmid P1140. [Figure 23] 1 is a plasmid map of transgene plasmid P1141. [Figure 24] 1 is a plasmid map of transgene plasmid P1142. [Diagram 25] 1 is a plasmid map of transgene plasmid P1143. [Figure 26] 1 is a plasmid map of transgene plasmid P1144. [Figure 27A] 1 is a series of micrographs of cells transfected alone (-miR96) with plasmid P1137, which contains one copy of a polynucleotide that can be transcribed to produce a miR-96 target sequence (top row), or with plasmid P1142, which contains four copies of a polynucleotide that can be transcribed to produce a miR-96 target sequence (bottom row). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 27B] 1 is a series of micrographs of cells co-transfected with miR-96 (+miR-96) and plasmid P1137, which contains one copy of a polynucleotide that can be transcribed to produce a miR-96 target sequence (top row), or plasmid P1142, which contains four copies of a polynucleotide that can be transcribed to produce a miR-96 target sequence (bottom row). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 28A] 1 is a series of micrographs of cells transfected with plasmid P1138, which contains one copy of a polynucleotide that can be transcribed to produce a miR-182 target sequence (top row), or with plasmid P1143, which contains four copies of a polynucleotide that can be transcribed to produce a miR-182 target sequence (bottom row), alone (-miR-182). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 28B] 1 is a series of micrographs of cells co-transfected with miR-182 (+miR-182) and plasmid P1138, which contains one copy of a polynucleotide that can be transcribed to produce a miR-182 target sequence (top row), or plasmid P1143, which contains four copies of a polynucleotide that can be transcribed to produce a miR-182 target sequence (bottom row). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 29A]1 is a series of micrographs of cells transfected with plasmid P1139, which contains one copy of a polynucleotide that can be transcribed to produce a miR-183 target sequence (top row), or with plasmid P1144, which contains four copies of a polynucleotide that can be transcribed to produce a miR-183 target sequence (bottom row), alone (-miR-183). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 29B] 1 is a series of micrographs of cells co-transfected with plasmid P1139, which contains one copy of a polynucleotide that can be transcribed to produce a miR-183 target sequence (top row), or with plasmid P1144, which contains four copies of a polynucleotide that can be transcribed to produce a miR-183 target sequence (bottom row), and with miR-183 (+miR-183). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 30A] 1 is a series of micrographs of cells transfected with plasmid P1140, which contains one copy of each polynucleotide that can be transcribed to produce miR-96, miR-182, and miR-183 targeting sequences (top row), or with plasmid P1141 alone, which contains three copies of each polynucleotide that can be transcribed to produce miR-96, miR-182, and miR-183 targeting sequences (bottom row) (-miR-183 / 96 / 182). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Figure 30B]1 is a series of micrographs of cells co-transfected with miR-96, miR-182, and miR-183 (+miR-183 / 96 / 182) and plasmid P1140, which contains one copy of each polynucleotide that can be transcribed to produce miR-96, miR-182, and miR-183 targeting sequences (top row), or plasmid P1141, which contains three copies of each polynucleotide that can be transcribed to produce miR-96, miR-182, and miR-183 targeting sequences (bottom row). Bright field and fluorescent (GFP) channels from the same field of cells are shown separately. [Diagram 31] 1 is a bar graph showing the percentage of cells expressing GFP after transfection with the indicated plasmids alone or co-transfected with the appropriate miRNA(s). Copy numbers of the miRNA target sequence are indicated for each plasmid. [Figure 32A] 1 is a series of photomicrographs of regions of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of the CMV promoter. Explants are shown that were infected sequentially with AAV807 (a control vector expressing eGFP under the control of the CMV promoter but lacking any miRNA target sequence) ("AAV807"), AAV1026 (made from transgene plasmid P1142 containing four copies of a polynucleotide that can be transcribed to produce miR-96 target sequences) ("AAV1026"), or AAV1027 (made from transgene plasmid P1143 containing four copies of a polynucleotide that can be transcribed to produce miR-182 target sequences) ("AAV1027"). Sections were also stained with antibodies against Myo7a to stain hair cells and Sox2 to stain supporting cells. For each AAV vector infection, channels showing only Myo7a staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Figure 32B]1 is a series of photomicrographs of regions of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of a CMV promoter. Explants infected with AAV807 ("AAV807"), AAV1028 (generated from transgene plasmid P1144 containing four copies of a polynucleotide that can be transcribed to produce miR-183 targeting sequences) ("AAV1028"), or AAV1029 (generated from transgene plasmid P1141 containing three copies of each of a polynucleotide that can be transcribed to produce miR-96 targeting sequences, miR-182 targeting sequences, and miR-183 targeting sequences) ("AAV1029") are shown. Sections were also stained with an antibody against Myo7a to stain hair cells and an antibody against Sox2 to stain supporting cells. For each AAV vector infection, channels showing only Myo7a staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Diagram 33] 1 is a plasmid map of transgene plasmid P1315. [Diagram 34] 1 is a plasmid map of transgene plasmid P1316. [Diagram 35] 1 is a plasmid map of transgene plasmid P1317. [Diagram 36] 1 is a plasmid map of transgene plasmid P1318. [Figure 37A]1 is a series of photomicrographs of regions of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of the LFNG promoter. Explants infected with AAV851 (a control vector expressing eGFP under the control of the LFNG promoter but lacking any miRNA target sequences) ("AAV851"), AAV1146 (made from transgene plasmid P1316 containing four copies of a polynucleotide that can be transcribed to produce miR-96 target sequences) ("AAV1146"), or AAV1147 (made from transgene plasmid P1317 containing four copies of a polynucleotide that can be transcribed to produce miR-182 target sequences) ("AAV1147") are shown. Tissues were also stained with antibodies against Myo7a to stain hair cells and Sox2 to stain supporting cells. For each AAV vector transfection, channels showing only Myo7a staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Figure 37B] 1 is a series of photomicrographs of regions of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of the LFNG promoter. Explants infected with AAV851 ("AAV851"), AAV1148 (made from transgene plasmid P1318 containing four copies of a polynucleotide that can be transcribed to produce miR-183 targeting sequences) ("AAV1148"), or AAV1145 (made from transgene plasmid P1315 containing three copies of each of a polynucleotide that can be transcribed to produce miR-96 targeting sequences, miR-182 targeting sequences, and miR-183 targeting sequences) ("AAV1145") are shown. Tissues were also stained with antibodies against Myo7a to stain hair cells and Sox2 to stain supporting cells. For each AAV vector transfection, channels showing only Myo7a staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Figure 38A]Figure 1 is a series of photomicrographs of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of the CMV promoter. Explants infected sequentially with AAV807, AAV1026, or AAV1027 are shown. Sections were also stained with an antibody against Pou4f3 to stain hair cell nuclei and an antibody against Sox2 to stain supporting cell nuclei. For each AAV vector infection, channels showing only Pou4f3 staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Figure 38B] A series of photomicrographs of neonatal mouse cochlear explants taken 5 days after infection with various AAV vectors expressing eGFP under the control of the CMV promoter. Explants infected with AAV807, AAV1028, or AAV1029 are shown. Sections were also stained with an antibody against Pou4f3 to stain hair cell nuclei and an antibody against Sox2 to stain supporting cell nuclei. For each AAV vector infection, channels showing only Pou4f3 staining (top row), only Sox2 staining (middle row), and only GFP (bottom row) are shown. [Figure 39] 1 is a bar graph showing the percentage of hair cells in mouse utricle explants that were GFP positive when infected with AAV851, AAV1145, AAVV1146, AAV1147, or AAV1148. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0097] Described herein are compositions and methods for treating hearing loss and / or vestibular dysfunction. The invention features a nucleic acid vector (e.g., a viral vector, such as an adeno-associated virus (AAV) vector) that includes at least one promoter, at least one polynucleotide that can be transcribed to produce a desired expression product (e.g., a transgene encoding a protein of interest), and at least one polynucleotide that can be transcribed to produce a microRNA (miRNA) target sequence. The nucleic acid vector described herein can be used to express the polynucleotide that can be transcribed to produce a desired expression product (e.g., to produce a protein encoded by the transgene) in a first inner ear cell type (e.g., an inner ear cell type that does not express an endogenous miRNA that binds to the miRNA target sequence transcribed from the vector), and to reduce or inhibit expression of the polynucleotide that can be transcribed to produce a desired expression product (e.g., to produce a protein encoded by the transgene) in a second inner ear cell type (e.g., an inner ear cell type that expresses an endogenous miRNA that recognizes the miRNA target sequence transcribed from the vector). Thus, the compositions described herein can be used to achieve cell type specific expression of a polynucleotide of interest in a particular inner ear cell type and can therefore be administered to a subject (a mammalian subject, e.g., a human) to treat a disorder caused by a genetic mutation in an inner ear cell, such as inherited hearing loss (e.g., sensorineural hearing loss), hearing impairment, or auditory neuropathy, or to treat a disorder caused by loss or damage to cochlear or vestibular inner ear cells (e.g., hair cells or ganglion neurons), such as sensorineural hearing loss, hearing impairment, auditory neuropathy, tinnitus, dizziness, vertigo, imbalance, bilateral vestibular dysfunction, and oscillopia.

[0098] inner ear cells The inner ear has two major parts: the cochlea, which is responsible for hearing, and the vestibular system, which is responsible for balance. Both the cochlea and the vestibular system contain specialized cell types, including hair cells, supporting cells, and ganglion neurons.

[0099] Hair cells are the sensory cells of the auditory and vestibular systems present in the inner ear. Cochlear hair cells are the sensory cells of the auditory system and are composed of two main cell types: inner hair cells, which are responsible for sound detection, and outer hair cells, which are thought to amplify low-level sounds. Vestibular hair cells, including type I and type II hair cells, are located in the semicircular canal end organs and otolithic organs of the inner ear and are involved in kinesthesia, which contributes to balance and spatial orientation. Cochlear hair cells are essential for normal hearing, and damage or loss of cochlear hair cells, as well as genetic mutations that disrupt the function of cochlear hair cells, are involved in hearing loss and hearing impairment. Damage or loss of vestibular hair cells, as well as genetic mutations that disrupt the function of vestibular hair cells, are involved in vestibular dysfunction, such as dizziness, vertigo, loss of balance, bilateral vestibular dysfunction, oscillopia, and balance disorders.

[0100] Supporting cells are nonsensory cells that reside between hair cells and perform a series of diverse functions in the cochlea and vestibular system, including providing a structural scaffold that allows mechanical stimulation of hair cells, maintaining the ionic composition of the endolymph and perilymph, and regulating synapse formation at ribbon synapses. After trauma or toxicity, supporting cells can expel damaged hair cells from the epithelium, phagocytose hair cell debris, and potentially generate new hair cells. Within the cochlea, supporting cells can be subdivided into five different types: 1) Hensen cells, 2) Deiters cells, 3) pillar cells, 4) inner phalangeal cells, and 5) border cells, all of which have distinct morphologies and gene expression patterns. Mutations in genes expressed in cochlear supporting cells, as well as damage, injury, degeneration, or loss (e.g., death) of these cells, have been associated with hearing loss (e.g., sensorineural hearing loss, auditory neuropathy, and hearing loss) and tinnitus. Similarly, mutations in genes expressed in vestibular supporting cells, and damage, injury, degeneration, or loss (eg, death) of these cells, are associated with vestibular dysfunction.

[0101] Ganglion neurons are bipolar neurons that form connections between the hair cells of the inner ear and the brain. The cochlea contains spiral ganglion neurons, which form afferent synapses with inner and outer hair cells. The axons of the spiral ganglion neurons make up the cochlear nerve, the auditory portion of the eighth cranial nerve. Death, damage, or degeneration of spiral ganglion neurons can cause sensorineural hearing loss, and certain types of hearing impairments are thought to result from mutations in genes expressed in spiral ganglion neurons. The vestibular system contains vestibular ganglion neurons (also called Scarpa's ganglion neurons), which innervate the vestibular hair cells of the vestibular system (e.g., the utricle, saccule, and semicircular canals). The axons of the vestibular ganglion neurons make up the vestibular nerve, the vestibular portion of the eighth cranial nerve. Death, damage, or degeneration of vestibular ganglion neurons, whether due to genetic mutations, disease or infection, head trauma, ototoxic drugs, or aging, can cause vestibular dysfunction.

[0102] Cell type-specific gene expression in inner ear cells Gene therapy has emerged as a promising treatment for treating hearing loss and vestibular dysfunction. It offers the possibility of restoring hearing to subjects suffering from hearing loss, hearing impairment, auditory neuropathy, or vestibular dysfunction due to specific gene mutations, and can also be used to deliver genes that regulate the formation or differentiation of inner ear cells to promote hair cell regeneration in subjects suffering from hearing loss or vestibular dysfunction due to hair cell loss or damage. However, the development of gene therapy for treating hearing loss and vestibular dysfunction is further complicated by the diversity of cell types in the inner ear. Off-target gene expression (e.g., expression of a gene in cells that do not normally express it) can cause toxicity and damage or kill cells. Thus, there is a need for new approaches that can be used to promote cell-type-specific gene expression in specific cell types (e.g., the cell type in which the gene is normally expressed, or the cell type to be genetically modified) and limit off-target expression.

[0103] The present inventors have developed a new approach for cell type specific gene expression in the inner ear based on the use of miRNA target sequences. This approach includes a nucleic acid vector that includes at least one promoter, at least one polynucleotide that can be transcribed to produce a desired expression product (e.g., one, two, three, or more polynucleotides, such as a transgene encoding a protein or a polynucleotide that can be transcribed to produce an inhibitory RNA molecule), and at least one polynucleotide that can be transcribed to produce a miRNA target sequence. The polynucleotide that can be transcribed to produce a miRNA target sequence is located in the vector so that it is operably linked to the same promoter as the polynucleotide it regulates (e.g., a polynucleotide that can be transcribed to produce a desired expression product), and is also typically transcribed as part of the same RNA transcript as the desired expression product. The miRNA target sequences for use in the vectors described herein are target sequences of miRNAs that are differentially expressed by different inner ear cell types. For example, the vector can include a polynucleotide that can be transcribed to produce a target sequence of a miRNA that is not expressed in a first inner ear cell type but is expressed in a second inner ear cell type. When both cell types are transduced with the vector, the miRNA expressed in the second cell type can recognize (e.g., bind) the miRNA target sequence and thus block translation of the messenger RNA (mRNA) transcribed from the vector in the second cell type or degrade the mRNA. In this example, only the first cell type can produce the expression product (e.g., protein) encoded by the polynucleotide. Further selectivity can be achieved by using cell type-specific promoters or by using multiple different miRNA target sequences (e.g., target sequences recognized by different miRNAs).The vectors described herein can contain a single polynucleotide that can be transcribed to produce a desired expression product, or multiple different polynucleotides that can be transcribed to produce different expression products (e.g., 2, 3, 4, 5, 6, 7, 8, or more polynucleotides, each of which can be transcribed to produce a different expression product), which can be expressed using the same or different promoters and can be controlled by the same or different miRNA target sequences. In embodiments where the vector contains multiple polynucleotides that can be transcribed to produce different expression products (e.g., multiple transgene sequences), the vector can be designed for cell type-specific expression of some or all of the polynucleotides (e.g., associated with a polynucleotide that can be transcribed to produce an miRNA target sequence that regulates expression). In some embodiments where the vector contains multiple polynucleotides that can be transcribed to produce a desired expression product (e.g., multiple transgene sequences), not all of the polynucleotides are necessarily associated with a polynucleotide that can be transcribed to produce an miRNA target sequence that regulates expression. The different configurations of promoters, polynucleotides that can be transcribed to produce a desired expression product, and polynucleotides that can be transcribed to produce miRNA target sequences that can be used to regulate gene expression are described in further detail herein.

[0104] The vectors described herein can be used to solve two different problems related to cell type specific gene expression. Both problems involve expressing a polynucleotide (e.g., a transgene encoding a protein) in a first cochlear cell type but not in a second cochlear cell type, but they differ in the relationship between the first and second cochlear cell types. The first problem involves expressing a polynucleotide that can be transcribed to produce a desired expression product (e.g., to increase the specificity of expression) in a first cochlear cell type but not in a second cochlear cell type. For example, the vectors described herein can be used to express a polynucleotide in cochlear hair cells but not in spiral ganglion neurons. To accomplish this, the vector includes a polynucleotide that can be transcribed to produce a target sequence for a miRNA that is expressed by spiral ganglion neurons but not by hair cells. The second problem concerns expressing a polynucleotide that can be transcribed to produce a desired expression product in a first inner ear cell type but not in a second inner ear cell type, where expression of the polynucleotide changes the identity of the first inner ear cell type (e.g., by inducing differentiation of the first inner ear cell type) to produce a second inner ear cell type. For example, the vectors described herein can be used to express a transgene in a vestibular supporting cell that promotes differentiation of the vestibular supporting cell into a vestibular hair cell. Once the hair cell is produced, expression of the transgene may no longer be necessary and may impair further maturation or function of the hair cell. In such an embodiment, the vector must include a polynucleotide that can be transcribed to produce a target sequence for a miRNA that is expressed by the second inner ear cell type (e.g., the inner ear cell type into which the first inner ear cell is transformed) but not by the first inner ear cell type. A vector that includes a polynucleotide that can be transcribed to produce a miRNA target sequence can be used to address both of these problems.

[0105] Expression of a single polynucleotide In some embodiments, a vector for cell type specific expression of a polynucleotide comprises a polynucleotide that can be transcribed to produce a desired expression product (e.g., a transgene encoding a protein or a polynucleotide that can be transcribed to produce an inhibitory RNA molecule) and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence. The promoter can be a cell type specific promoter (e.g., an inner ear cell type specific promoter such as the promoters listed in Table 12) or a ubiquitous promoter. In some embodiments, a vector comprises a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., a target sequence for one miRNA). One or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a polynucleotide that can be transcribed to produce a miRNA target sequence) can be included in the vector. In other embodiments, the vector comprises polynucleotides that can be transcribed to produce target sequences for at least two different miRNAs (e.g., the vector comprises at least two different polynucleotides that can be transcribed to produce miRNA target sequences, each of which can be transcribed to produce a target sequence for a different miRNA, such that the vector can be used to produce target sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different miRNAs). The vector can comprise one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of each of the different polynucleotides that can be transcribed to produce the different miRNA target sequences.

[0106] Expression of two polynucleotides In some embodiments, a vector comprises two polynucleotides (e.g., two different polynucleotides, such as two transgenes, each encoding a different protein) that can be transcribed to produce a desired expression product. A vector comprising two such polynucleotides can be designed such that expression of both polynucleotides is regulated by at least one miRNA target sequence, or such that expression of only one of the two polynucleotides is regulated by at least one miRNA target sequence. In embodiments in which a vector is designed such that expression of both polynucleotides is regulated by at least one miRNA target sequence, expression of both polynucleotides can be regulated by the same miRNA target sequence(s) or by different miRNA target sequences.

[0107] In one embodiment, a single promoter is operably linked to both polynucleotides that can be transcribed to produce a desired expression product. In this embodiment, expression of both polynucleotides is regulated by the same miRNA target sequence(s). The promoters can be cell type specific promoters (e.g., inner ear cell type specific promoters such as those listed in Table 12) or ubiquitous promoters. In some embodiments, a vector comprises a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., a target sequence for one miRNA). One or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of a polynucleotide that can be transcribed to produce a miRNA target sequence) can be included in a vector. In other embodiments, the vector comprises polynucleotides that can be transcribed to produce target sequences for at least two different miRNAs (e.g., the vector comprises at least two different polynucleotides that can be transcribed to produce miRNA target sequences, each of which can be transcribed to produce a target sequence for a different miRNA, such that the vector can be used to produce target sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different miRNAs). The vector can comprise one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of each of the different polynucleotides that can be transcribed to produce the different miRNA target sequences.A vector can include the following components, in 5' to 3' order: a promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), and one or more polynucleotides that can be transcribed to produce a miRNA target sequence (e.g., one or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence, or one or more copies of each of a plurality of different polynucleotides, each of which can be transcribed to produce a different miRNA target sequence). Such vectors can be used to achieve cell type-specific expression of both the first and second polynucleotides in a first inner ear cell type relative to a second inner ear cell type (e.g., to increase the specificity of expression of both polynucleotides and / or to "turn off" expression of both polynucleotides when the first inner ear cell type transforms into the second inner ear cell type). An element allowing for co-expression of two polynucleotides that can be transcribed to produce a desired expression product, such as an internal ribosome entry site (IRES) or a sequence encoding a 2A peptide (e.g., the foot and mouth disease virus 2A sequence (F2A), the equine rhinitis A virus 2A sequence (E2A), the porcine teschovirus-1 2A sequence (P2A), or the Thosea asigna virus 2A sequence (T2A)), can be located between the first and second polynucleotides.

[0108] In some embodiments, each polynucleotide that can be transcribed to produce a desired expression product is operably linked to its own promoter (e.g., the vector includes two promoters, one operably linked to each polynucleotide). Each promoter can be independently selected from a cell type specific promoter and a ubiquitous promoter. In some embodiments, the two promoters are different. The two promoters can have different cell type specificity (e.g., one promoter is a supporting cell specific promoter and the other promoter is a hair cell specific promoter, or one promoter is a hair cell specific promoter and the other promoter is a ubiquitous promoter) or the same cell type specificity (e.g., one promoter is a supporting cell specific promoter and the other promoter is a different supporting cell specific promoter). In other embodiments, the first promoter and the second promoter are two copies of the same promoter (e.g., each polynucleotide that can be transcribed to produce a desired expression product is operably linked to different copies of the same ubiquitous promoter or the same hair cell-specific promoter, which may allow one polynucleotide to be regulated by a miRNA target sequence and the other polynucleotide to be not regulated by a miRNA target sequence or to be regulated by a different miRNA target sequence).

[0109] In some embodiments, in a vector containing two promoters, the expression of only one polynucleotide that can be transcribed to produce a desired expression product is regulated by a miRNA target sequence. For example, the vector can include, in the order from 5' to 3', a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, and a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), or a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), and one or more polynucleotides that can be transcribed to produce a miRNA target sequence. As described above, a vector can contain one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of a polynucleotide that can be transcribed to produce a miRNA target sequence for only one miRNA, or a vector can contain one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of at least two different polynucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different polynucleotides), each of which can be transcribed to produce a target sequence for a different miRNA. Such vectors can be used to express one polynucleotide that can be transcribed to produce a desired expression product (e.g., a polynucleotide associated with a polynucleotide that can be transcribed to produce a miRNA target sequence) in a particular inner ear cell type and express the other polynucleotide that can be transcribed to produce a desired expression product more broadly or in a different cell type.Such vectors can also be used to "turn off" expression of one polynucleotide that can be transcribed to produce a desired expression product upon cell differentiation (e.g., in embodiments in which a miRNA expressed in a "differentiated" cell type recognizes a miRNA target sequence associated with the expression product), while allowing another polynucleotide that can be transcribed to produce a desired expression product that is not regulated by the miRNA target sequence to be expressed both before and after differentiation.

[0110] In some embodiments, in a vector containing two promoters, the expression of both polynucleotides is regulated by a miRNA target sequence. The vector can include the following components in 5' to 3' order: a first promoter, a first polynucleotide (e.g., a first transgene) that can be transcribed to produce a desired expression product, one or more polynucleotides that can be transcribed to produce a miRNA target sequence (e.g., one or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence, or one or more copies of each of a plurality of different polynucleotides, each of which can be transcribed to produce a different miRNA target sequence), a second promoter, a second polynucleotide (e.g., a second transgene) that can be transcribed to produce a desired expression product, and one or more polynucleotides that can be transcribed to produce a miRNA target sequence (e.g., one or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence, or one or more copies of each of a plurality of different polynucleotides, each of which can be transcribed to produce a different miRNA target sequence). The miRNA target sequences that regulate the expression of the first and second polynucleotides may be completely different (e.g., each polynucleotide is regulated by a different miRNA target sequence, or by a completely different set of miRNA target sequences), the same, or partially different (e.g., the first polynucleotide is regulated by a first set of miRNA target sequences and the second polynucleotide is regulated by a second set of miRNA target sequences, where at least one miRNA target sequence differs between the first and second set of miRNA target sequences and where at least one miRNA target sequence is included in both the first and second set of miRNA target sequences).Vectors in which the first and second polynucleotides are associated with polynucleotides that can be transcribed to produce different (e.g., completely different or partially different) miRNA target sequences can be used to regulate expression of the first and second polynucleotides in different inner ear cell types (e.g., to reduce or inhibit off-target expression). Such vectors can also be used to "turn off" expression of the first polynucleotide when the first cell type differentiates into the second cell type (e.g., in embodiments in which a miRNA expressed in the second cell type recognizes the miRNA target sequence associated with the first polynucleotide) and / or to "turn on" expression of the second polynucleotide in the "differentiated" second cell type (e.g., in embodiments in which a miRNA expressed in the first cell type but not in the second cell type recognizes the miRNA target sequence associated with the second polynucleotide).

[0111] Expression of the three polynucleotides In some embodiments, the vector comprises three polynucleotides (e.g., three different polynucleotides, such as three transgenes, each encoding a different protein) that can be transcribed to produce a desired expression product. A vector comprising three polynucleotides can be designed such that expression of only one polynucleotide is regulated by at least one miRNA target sequence, such that expression of two of the three polynucleotides is regulated by at least one miRNA target sequence, or such that expression of all three polynucleotides is regulated by at least one miRNA target sequence. In embodiments in which the vector is designed such that expression of two or all three polynucleotides is regulated by at least one miRNA target sequence, expression of all three polynucleotides can be regulated using the same miRNA target sequence or set of miRNA target sequences, expression of each polynucleotide (e.g., two or all three polynucleotides) that is regulated by a miRNA target sequence can be independently regulated by one or more miRNA target sequences (e.g., expression of each polynucleotide is regulated by a different miRNA target sequence or set of miRNA target sequences), or expression of two polynucleotides can be regulated by the same miRNA target sequence or set of miRNA target sequences, but the third polynucleotide is not regulated by a miRNA target sequence or is independently regulated by a different miRNA target sequence or set of miRNA target sequences.

[0112] In one embodiment, a single promoter is operably linked to all three polynucleotides that can be transcribed to produce a desired expression product. In this embodiment, the expression of all three polynucleotides is regulated by the same miRNA target sequence(s). The promoter can be a cell type specific promoter (e.g., an inner ear cell type specific promoter such as the promoters listed in Table 12) or a ubiquitous promoter. In some embodiments, the vector comprises a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., a target sequence of one miRNA). One or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a miRNA target sequence) can be included in the vector. In other embodiments, the vector comprises polynucleotides that can be transcribed to produce target sequences for at least two different miRNAs (e.g., the vector comprises at least two different polynucleotides that can be transcribed to produce miRNA target sequences, each of which can be transcribed to produce a target sequence for a different miRNA, such that the vector can be used to produce target sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different miRNAs). The vector can comprise one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of each of the different polynucleotides that can be transcribed to produce the different miRNA target sequences.A vector can include the following components, in 5' to 3' order: a promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene), and one or more polynucleotides that can be transcribed to produce a miRNA target sequence (e.g., one or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence, or one or more copies of each of a plurality of different polynucleotides, each of which can be transcribed to produce a different miRNA target sequence). Such vectors can be used to achieve cell type-specific expression of all three transgenes in a first inner ear cell type relative to a second inner ear cell type (e.g., to increase the specificity of expression of all three polynucleotides and / or to "turn off" expression of all three polynucleotides when the first inner ear cell type transforms into the second inner ear cell type). Elements enabling coexpression of the three polynucleotides, such as an IRES or a sequence encoding a 2A peptide (e.g., an F2A, E2A, P2A, or T2A sequence), can be located between the first, second, and third polynucleotides.

[0113] In some embodiments, each polynucleotide that can be transcribed to produce a desired expression product is operably linked to its own promoter. Each promoter can be independently selected from a cell type specific promoter and a ubiquitous promoter. In some embodiments, all three promoters are different. The three promoters can have different cell type specificity (e.g., one promoter is a ubiquitous promoter and the other two promoters are supporting cell specific promoters, or the promoters include one each of a supporting cell specific promoter, a hair cell specific promoter, and a ubiquitous promoter) or the same cell type specificity (e.g., all three promoters are supporting cell specific promoters or hair cell specific promoters). In some embodiments, all three promoters are the same (e.g., the vector contains three copies of the same promoter, such that each polynucleotide is operably linked to a different copy of the same supporting cell-specific promoter, the same hair cell-specific promoter, or the same ubiquitous promoter, thereby allowing polynucleotides associated with the same promoter to be differentially regulated, e.g., a first polynucleotide may be regulated by one or more miRNA target sequences, a second polynucleotide may be regulated by a different miRNA target sequence or a different set of miRNA target sequences, and a third polynucleotide may be regulated by yet another different miRNA target sequence or a different set of miRNA target sequences, or may not be regulated by any miRNA target sequences). In some embodiments, two of the promoters are the same (e.g., the vector includes two copies of the same promoter, e.g., two copies of the same supporting cell-specific or ubiquitous promoter, such that two of the polynucleotides are independently operably linked to different copies of the same promoter) and the third promoter is different (e.g., a different supporting cell-specific or ubiquitous promoter, or a promoter with different cell type specificity, such as a hair cell-specific promoter).This also allows two polynucleotides associated with the same promoter to be differentially regulated (e.g., each polynucleotide can be associated with a different miRNA target sequence or set of miRNA target sequences, or one polynucleotide may be regulated by an miRNA target sequence and the other polynucleotide may not be regulated by an miRNA target sequence), while a third polynucleotide associated with a different promoter may be regulated by the same miRNA target sequence or set of miRNA target sequences, regulated by a different miRNA target sequence or different set of miRNA target sequences, or not regulated by an miRNA target sequence.

[0114] In some embodiments, a vector containing three polynucleotides (e.g., three transgenes) that can be transcribed to produce a desired expression product may contain two promoters, such that one promoter is operably linked to one polynucleotide and the other promoter is operably linked to the two polynucleotides. Each promoter can be independently selected from a cell type specific promoter and a ubiquitous promoter. In some embodiments, the two promoters are different. The promoters can have different cell type specificity (e.g., one promoter is a ubiquitous promoter and the other promoter is a supporting cell specific promoter, or one promoter is a supporting cell specific promoter and the other promoter is a hair cell specific promoter) or the same cell type specificity (e.g., both promoters are supporting cell specific promoters or hair cell specific promoters). In other embodiments, the two promoters are the same (e.g., the vector contains two copies of the same promoter, such as the same ubiquitous promoter or the same supporting cell-specific or hair cell-specific promoter, such that one copy of the promoter is operably linked to one polynucleotide and the other copy of the promoter is operably linked to two polynucleotides, thereby allowing polynucleotides associated with the same promoter to be differentially regulated, e.g., one polynucleotide is regulated by one or more miRNA target sequences, while two polynucleotides are not regulated by miRNA target sequences or are regulated by one or more different miRNA target sequences). Elements allowing for co-expression of two polynucleotides that can be transcribed to produce a desired expression product, such as an IRES, or a sequence encoding a 2A peptide (e.g., F2A, E2A, P2A, or T2A sequence), can be located between the two polynucleotides operably linked to a single promoter.

[0115] In some embodiments, in a vector containing two or three promoters, the expression of only one polynucleotide that can be transcribed to produce a desired expression product is regulated by a miRNA target sequence. An example of a vector containing two promoters can include, in the order from 5' to 3', a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), and a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene). In another example, a vector can include, in 5' to 3' order, a first promoter, a first polynucleotide (e.g., a first transgene) that can be transcribed to produce a desired expression product, a second polynucleotide (e.g., a second transgene) that can be transcribed to produce a desired expression product, a second promoter, a third polynucleotide (e.g., a third transgene) that can be transcribed to produce a desired expression product, and one or more polynucleotides that can be transcribed to produce a miRNA target sequence. An IRES, or a sequence encoding a 2A peptide (e.g., an F2A, E2A, P2A, or T2A sequence) can be located between the two polynucleotides that can be transcribed to produce a desired expression product and are operably linked to the same promoter in both of these vectors.An example of a vector containing three promoters, where only one gene is regulated by a miRNA target sequence, can include, in 5' to 3' order, a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), a third promoter, and a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene). In other examples, the one or more polynucleotides that can be transcribed to produce a miRNA target sequence can be located 3' of the second polynucleotide and 5' of the third promoter, or 3' of the third polynucleotide. Such vectors can be used to express one polynucleotide (e.g., a polynucleotide associated with one or more polynucleotides that can be transcribed to produce a miRNA target sequence) in a particular cell type and express other transgenes more broadly or in one or more different cell types. Such vectors can also be used to "turn off" expression of one polynucleotide upon cell differentiation (e.g., in embodiments where an miRNA expressed in a "differentiated" cell type recognizes an miRNA target sequence associated with a polynucleotide), while allowing other polynucleotides to be expressed both before and after differentiation.

[0116] In some embodiments, in a vector containing two or three promoters, two polynucleotides that can be transcribed to produce a desired expression product are regulated by a miRNA target sequence. An example of a vector containing two promoters can include, in 5' to 3' order, a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, and a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene). In another example, a first polynucleotide may be expressed by a first promoter and not regulated by a miRNA target sequence, and a second promoter may be operably linked to a second and a third polynucleotide, as well as one or more polynucleotides that can be transcribed to produce a miRNA target sequence (a vector may include, in 5' to 3' order, a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene), and one or more polynucleotides that can be transcribed to produce a miRNA target sequence). An IRES, or a sequence encoding a 2A peptide (e.g., an F2A, E2A, P2A, or T2A sequence) may be located between the two polynucleotides, which can be transcribed to produce a desired expression product, and are operably linked to the same promoter in both of these vectors.An example of a vector containing three promoters can include, in 5' to 3' order, a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a third promoter, and a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene). In such a vector, the first and second, first and third, or second and third polynucleotides can be regulated by one or more miRNA target sequences. The one or more miRNA target sequences used to regulate the two polynucleotides in a vector containing three promoters can be the same (e.g., the same miRNA target sequence or set of miRNA target sequences) or different (e.g., completely different miRNA target sequences or sets of partially different miRNA target sequences).

[0117] In some embodiments, in a vector containing two or three promoters, all three polynucleotides are regulated by miRNA target sequences. An example of a vector containing two promoters can include, in the order of 5' to 3', a first promoter, a first polynucleotide (e.g., a first transgene) that can be transcribed to produce a desired expression product, one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide (e.g., a second transgene) that can be transcribed to produce a desired expression product, a third polynucleotide (e.g., a third transgene) that can be transcribed to produce a desired expression product, and one or more polynucleotides that can be transcribed to produce a miRNA target sequence. In a vector containing two promoters, either the first and second polynucleotides, or the second and third polynucleotides, are operably linked to a single promoter and are regulated by the same miRNA target sequence or set of miRNA target sequences. The one or more miRNA target sequences used to regulate one polynucleotide and the remaining two polynucleotides in such a vector may be the same (e.g., the same miRNA target sequence or set of miRNA target sequences) or different (e.g., completely different miRNA target sequences or sets of partially different miRNA target sequences). An example of a vector containing three promoters can include, in 5' to 3' order, a first promoter, a first polynucleotide that can be transcribed to produce a desired expression product (e.g., a first transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a second promoter, a second polynucleotide that can be transcribed to produce a desired expression product (e.g., a second transgene), one or more polynucleotides that can be transcribed to produce a miRNA target sequence, a third promoter, a third polynucleotide that can be transcribed to produce a desired expression product (e.g., a third transgene), and one or more polynucleotides that can be transcribed to produce a miRNA target sequence.In such vectors, the one or more miRNA target sequences used to regulate the three polynucleotides may be completely different (e.g., each polynucleotide is regulated by a different miRNA target sequence or set of miRNA target sequences), may be the same (e.g., all three polynucleotides are regulated by the same miRNA target sequence or set of miRNA target sequences), or may be partially different (e.g., each polynucleotide is regulated by a set of miRNA target sequences, each set including at least one miRNA target sequence shared by all three sets and at least one miRNA target sequence unique to each set). In some embodiments, two of the three nucleic acids may be regulated by the same miRNA target sequence or set of miRNA target sequences, while the third nucleic acid is regulated by a different miRNA target sequence or a set of completely or partially different miRNA target sequences. In some embodiments, two of the three polynucleotides are each regulated by a set of partially different miRNA target sequences, and the third nucleic acid is regulated by a completely different miRNA target sequence or a set of completely different miRNA target sequences.

[0118] Any of the vectors containing three polynucleotides that can be transcribed to produce a desired expression product can contain a polynucleotide that can be transcribed to produce a miRNA target sequence for only one miRNA, or can contain at least two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) different polynucleotides that can each be transcribed to produce a target sequence for a different miRNA, and each polynucleotide that can be transcribed to produce a miRNA target sequence can be present in the vector in one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies). In vectors comprising two promoters, where all three polynucleotides are regulated by miRNA target sequences, and vectors comprising three promoters, where two polynucleotides or all three polynucleotides are regulated by miRNA target sequences, the miRNA target sequences regulating the expression of each polynucleotide (or pair of polynucleotides, as in the case of a vector comprising two promoters) may be completely different, the same, or partially different (e.g., a first polynucleotide is associated with a first set of miRNA target sequences, and each of the second and third polynucleotides, or pair of polynucleotides, is associated with a second (and / or third, in the case of a vector comprising three independently regulated polynucleotides) set of miRNA target sequences, where at least one miRNA target sequence differs between the first and second (and / or third) sets of miRNA target sequences, and where at least one miRNA target sequence is included in both the first and second (and / or third) sets of miRNA target sequences). Vectors in which two or all three polynucleotides are associated with different (e.g., completely different or partially different) miRNA target sequences can be used to regulate expression of the first polynucleotide, the second polynucleotide, and / or the third polynucleotide in different inner ear cell types (e.g., to reduce or inhibit off-target expression).Such vectors can also be used to "turn off" expression of the one or two polynucleotides when a first inner ear cell type differentiates into a second inner ear cell type (e.g., in embodiments where an miRNA expressed in the second inner ear cell type recognizes an miRNA target sequence associated with the one or two polynucleotides) and / or to "turn on" expression of the remaining polynucleotide(s) in the "differentiated" second cell type (e.g., in embodiments where an miRNA expressed in the first cell type but not in the second cell type recognizes an miRNA target sequence associated with the remaining polynucleotide(s).

[0119] Expression of four or more polynucleotides In some embodiments, a vector comprises four or more polynucleotides (e.g., 4, 5, 6, 7, 8, 9, 10, or more different polynucleotides) that can be transcribed to produce a desired expression product. Such vectors can be designed such that the expression of only one of the polynucleotides contained in the vector is regulated by at least one miRNA target sequence, such that the expression of a subset (fewer than all) of the polynucleotides contained in the vector is regulated by at least one miRNA target sequence, or such that the expression of all polynucleotides contained in the vector is regulated by at least one miRNA target sequence. Vectors comprising four or more polynucleotides can be constructed by extending the principles described above for three polynucleotides to further encompass four polynucleotides. For example, polynucleotides expressed in the same cell type can be operably linked to the same promoter and / or associated with polynucleotides that can be transcribed to produce the same miRNA target sequence(s). Polynucleotides to be expressed in different cell types can be operably linked to different promoters (e.g., promoters with different cell type specificity) and can be associated with polynucleotides that can be transcribed to produce different miRNA target sequences (e.g., sets of completely different miRNA target sequences or partially different miRNA target sequences) or that can be transcribed to produce the same miRNA target sequence (e.g., to prevent off-target expression of the polynucleotide in the same cell type). Polynucleotides that are not intended for regulation using miRNA target sequences can be operably linked to promoters that are not operably linked to polynucleotides that can be transcribed to produce miRNA target sequences. The promoter(s) used to express the polynucleotides that can be transcribed to produce the desired expression product can be a cell type-specific promoter (e.g., an inner ear cell type-specific promoter, such as the promoters listed in Table 12) or a ubiquitous promoter.Each polynucleotide regulated by a miRNA target sequence can be associated with at least one polynucleotide that can be transcribed to produce a miRNA target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides that can be transcribed to produce a miRNA target sequence). When a polynucleotide that can be transcribed to produce a desired expression product is associated with multiple polynucleotides that can be transcribed to produce a miRNA target sequence, the polynucleotides that can be transcribed to produce a miRNA target sequence can be the same (e.g., a polynucleotide that can be transcribed to produce a target sequence of a single miRNA can be present in multiple copies) or different (e.g., at least two different polynucleotides, each of which can be transcribed to produce a target sequence of a different miRNA, in which case each polynucleotide that can be transcribed to produce a different miRNA target sequence can be present in one or more copies). When multiple polynucleotides that can be transcribed to produce a desired expression product are operably linked to a single promoter, elements allowing for coexpression of the polynucleotides, such as an IRES, or a sequence encoding a 2A peptide (e.g., an F2A, E2A, P2A, or T2A sequence), can be located between each of the polynucleotides operably linked to the promoter.

[0120] Delivery of multiple vectors A vector described herein (e.g., a vector comprising a polynucleotide that can be transcribed to produce a desired expression product and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence) can be administered in combination with one or more additional vectors (e.g., one, two, three, four, five, or more additional vectors). In some embodiments, a vector described herein is administered in combination with one additional vector. In some embodiments, the one or more additional vectors are also vectors of the invention (e.g., a vector comprising a polynucleotide that can be transcribed to produce a desired expression product and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence). For example, two or more vectors described herein (e.g., two, three, four, five, six, or more vectors described herein) can be administered in combination. In some embodiments, the one or more additional vectors do not comprise a polynucleotide that can be transcribed to produce a miRNA target sequence.

[0121] In some embodiments, the vector described herein and one or more additional vectors are administered simultaneously (e.g., administration of all vectors occurs within 15 minutes, 10 minutes, 5 minutes, 2 minutes). The vectors can also be administered simultaneously by co-formulation. The vector described herein and one or more additional vectors can also be administered sequentially. Sequential or substantially simultaneous administration of each vector can be by any suitable route, including local administration to the middle or inner ear (e.g., administration to or via the round window, oval window, or semicircular canal). The vectors can be administered by the same route or different routes. For example, both vectors can be administered locally to the inner ear. The vectors described herein can be administered up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to 16 hours, up to 17 hours, up to 18 hours, up to 19 hours, up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours, up to 24 hours, or up to 1-7 days, 1-14 days, 1-21 days, or 1-30 days immediately before or after one or more additional vectors.

[0122] miRNA target sequence The vectors described herein include one or more polynucleotides that can be transcribed to produce a miRNA target sequence, each of which is recognized by a miRNA that is differentially expressed among different inner ear cell types (e.g., expressed in a first inner ear cell type and not expressed in a second inner ear cell type). Each vector can include one or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a polynucleotide that can be transcribed to produce a single miRNA target sequence), and / or one or more different polynucleotides, each of which can be transcribed to produce a miRNA target sequence that is recognized by a different miRNA (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different polynucleotides, each of which can be transcribed to produce a target sequence for a different miRNA), each of which can be included in the vector in one or more copies (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies).

[0123] The polynucleotide that can be transcribed to produce the miRNA target sequence is located in the vector so that it is operably linked to the same promoter as the polynucleotide that is regulated by the miRNA target sequence (e.g., the polynucleotide that can be transcribed to produce the desired expression product). For example, if the polynucleotide that is regulated by the miRNA target sequence is a transgene (a polynucleotide that codes for a protein), the polynucleotide that can be transcribed to produce the miRNA target sequence can be located in the 3' untranslated region (UTR) of the transgene (e.g., between the stop codon and the end of the polyA sequence of the transgene). The polynucleotide that can be transcribed to produce the miRNA target sequence can also be located in the 5' UTR of the transgene or in the transgene coding sequence, as long as the location of the polynucleotide that can be transcribed to produce the miRNA target sequence does not interfere with the expression of the transgene in cells that do not express the miRNA that binds to the miRNA target sequence. When a polynucleotide that can be transcribed to produce a miRNA target sequence is located within a transgene coding sequence, the polynucleotide may be adjacent to a cleavage site such that, if translation is not inhibited by a miRNA that recognizes the miRNA target sequence, the resulting polypeptide can be cleaved to excise the miRNA target sequence and join the 5' and 3' portions of the protein encoded by the transgene coding sequence to form a full-length protein. To regulate expression of multiple polynucleotides (e.g., in embodiments where a single promoter is operably linked to two, three, or more polynucleotides that can be transcribed to produce a desired expression product), the polynucleotide that can be transcribed to produce a miRNA target sequence can be operably linked to a promoter that drives expression of the polynucleotides and can be located 3' of the final polynucleotide operably linked to the promoter (e.g., within the 3'UTR of the final polynucleotide) or 5' of a first polynucleotide operably linked to the promoter (e.g., within the 5'UTR of the first polynucleotide).

[0124] Table 2 below provides a list of miRNAs expressed in one or more inner ear cell types and the target sequence for each miRNA.

[0125] [Table 1-1]

[0126] [Table 1-2]

[0127] By including one or more polynucleotides capable of being transcribed to produce an miRNA target sequence of Table 2 in the vectors described herein, off-target expression of the polynucleotide included in the vector (e.g., a polynucleotide operably linked to the same promoter as the polynucleotide capable of being transcribed to produce an miRNA target sequence) can be prevented or reduced to improve or achieve cell type specific expression of the polynucleotide in a particular cell type of interest. For example, for cell type specific expression of a polynucleotide in cochlear supporting cells, the vector can include a polynucleotide that can be transcribed to produce a desired expression product (e.g., a transgene encoding Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, and / or Gjb2) and a target sequence for a miRNA that is transcribed to express in a cell type other than cochlear supporting cells (e.g., a miRNA target sequence for a miRNA that is expressed in cochlear hair cells but not in cochlear supporting cells, e.g., miR-183, miR-96, miR-182, miR-18a, miR-140, and / or a transgene encoding a miRNA that is transcribed to produce a desired expression product). or miR-194, and / or a miRNA target sequence of a miRNA expressed in spiral ganglion neurons but not in cochlear supporting cells, e.g., miR-183, miR-96, miR-182, miR-18a, miR-124a, and / or miR-194), can be operably linked to one or more polynucleotides capable of producing the miRNA.For cell type specific expression of a polynucleotide in a vestibular supporting cell, the vector can include a ubiquitous promoter (e.g., CMV) or a supporting cell specific promoter (e.g., GFAP promoter, SLC6A14 promoter, or SLC1A3 promoter) operably linked to a polynucleotide that can be transcribed to produce a desired expression product (e.g., a transgene encoding Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, and / or Gjb2), and one or more polynucleotides that can be transcribed to produce a target sequence of a miRNA expressed in a cell type other than a vestibular supporting cell (e.g., a miRNA target sequence of a miRNA expressed in vestibular ganglion neurons but not in vestibular supporting cells, e.g., miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, and / or miR-135). To specifically express a polynucleotide in type II vestibular hair cells, the vector can include a hair cell-specific promoter (e.g., the MYO15 promoter) operably linked to a polynucleotide that can be transcribed to produce a desired expression product (e.g., a transgene encoding a dominant-negative Sox2 protein (dnSox2) or a polynucleotide that can be transcribed to produce an inhibitory RNA, such as an shRNA, directed to Sox2), and one or more polynucleotides that can be transcribed to produce a target sequence of a miRNA expressed in a cell type other than a vestibular hair cell (e.g., a miRNA target sequence of a miRNA expressed in vestibular ganglion neurons but not in vestibular hair cells, e.g., miR-18a, miR-124a, miR-100, and / or miR-135). Sequences of exemplary plasmids containing a transgene and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence are provided in Table 3 below.

[0128] [Table 2-1]

[0129]

Table 2-2

[0130]

Table 2-3

[0131]

Table 2-4

[0132]

Table 2-5

[0133]

Table 2-6

[0134]

Table 2-7

[0135]

Table 2-8

[0136]

Table 2-9

[0137]

Table 2-10

[0138]

Table 2-11

[0139]

Table 2-12

[0140]

Table 2-13

[0141]

Table 2-14

[0142]

Table 2-15

[0143]

Table 2-16

[0144]

Table 2-17

[0145]

Table 2-18

[0146]

Table 2-19

[0147]

Table 2-20

[0148]

Table 2-21

[0149]

Table 2-22

[0150]

Table 2-23

[0151]

Table 2-24

[0152]

Table 2-25

[0153]

Table 2-26

[0154]

Table 2-27

[0155]

Table 2-28

[0156]

Table 2-29

[0157]

Table 2-30

[0158]

Table 2-31

[0159]

Table 2-32

[0160]

Table 2-33

[0161]

Table 2-34

[0162]

Table 2-35

[0163]

Table 2-36

[0164]

Table 2-37

[0165]

Table 2-38

[0166]

Table 2-39

[0167]

Table 2-40

[0168]

Table 2-41

[0169]

Table 2-42

[0170]

Table 2-43

[0171]

Table 2-44

[0172]

Table 2-45

[0173]

Table 2-46

[0174]

Table 2-47

[0175]

Table 2-48

[0176]

Table 2-49

[0177]

Table 2-50

[0178]

Table 2-51

[0179]

Table 2-52

[0180]

Table 2-53

[0181]

Table 2-54

[0182]

Table 2-55

[0183]

Table 2-56

[0184]

Table 2-57

[0185]

Table 2-58

[0186]

Table 2-59

[0187]

Table 2-60

[0188]

Table 2-61

[0189]

Table 2-62

[0190]

Table 2-63

[0191]

Table 2-64

[0192]

Table 2-65

[0193]

Table 2-66

[0194]

Table 2-67

[0195]

Table 2-68

[0196]

Table 2-69

[0197]

Table 2-70

[0198]

Table 2-71

[0199]

Table 2-72

[0200]

Table 2-73

[0201]

Table 2-74

[0202]

Table 2-75

[0203]

Table 2-76

[0204]

Table 2-77

[0205]

Table 2-78

[0206]

Table 2-79

[0207]

Table 2-80

[0208]

Table 2-81

[0209]

Table 2-82

[0210]

Table 2-83

[0211]

Table 2-84

[0212]

Table 2-85

[0213]

Table 2-86

[0214]

Table 2-87

[0215]

Table 2-88

[0216]

Table 2-89

[0217]

Table 2-90

[0218]

Table 2-91

[0219]

Table 2-92

[0220]

Table 2-93

[0221]

Table 2-94

[0222]

Table 2-95

[0223]

Table 2-96

[0224]

Table 2-97

[0225]

Table 2-98

[0226]

Table 2-99

[0227]

Table 2-100

[0228]

Table 2-101

[0229]

Table 2-102

[0230]

Table 2-103

[0231] [Table 2-104]

[0232] Expression of Exogenous Nucleic Acids in Mammalian Cells One platform that can be used to achieve therapeutically effective intracellular concentrations of exogenous polynucleotides in mammalian cells is through stable expression of the polynucleotide (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells, or by episomal concatemer formation in the nucleus of mammalian cells). To introduce exogenous polynucleotides into mammalian cells, the polynucleotides can be incorporated into vectors. Vectors can be introduced into cells by a variety of methods, including transformation, transfection, transduction, direct uptake, projectile bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in further detail in, for example, Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.

[0233] Polynucleotides can also be introduced into mammalian cells by targeting the vector containing the polynucleotide of interest to cell membrane phospholipids.For example, vector molecules can be linked to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids, to target the vector to the phospholipids on the extracellular surface of cell membrane.Such constructs can be produced using methods well known to those skilled in the art.

[0234] The vectors described herein can be used to express one or more exogenous polynucleotides in inner ear cells that can be transcribed to produce a desired expression product. The polynucleotides can be polynucleotides that encode proteins, inhibitory RNAs (e.g., siRNAs or shRNAs), or components of gene editing systems. In some embodiments, the polynucleotides are polynucleotides that correspond to the wild-type form of a gene involved in hearing loss and / or vestibular dysfunction (e.g., a polynucleotide that encodes the wild-type form of a protein). Mutations in various genes, such as myosin 7A (MYO7A), POU class 4 homeobox 3 (POU4F3), solute carrier family 17 member 8 (SLC17A8), gap junction protein beta 2 (GJB2), claudin 14 (CLDN14), cochlin (COCH), protocadherin-associated 15 (PCDH15), and transmembrane 1 (TMC1), have been associated with sensorineural hearing loss and / or hearing impairment, and some of these mutations, such as mutations in MYO7A, POU4F3, and COCH, have also been associated with vestibular dysfunction. In some embodiments, the polynucleotide is a polynucleotide that is normally expressed in healthy inner ear cells (e.g., a polynucleotide corresponding to a gene involved in the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells). The polynucleotide can also encode a protein, an inhibitory RNA, or a component of a gene editing system that regulates (e.g., promotes or improves) the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells.

[0235] Polynucleotides encoding proteins In some embodiments, the vectors described herein contain a polynucleotide corresponding to a wild-type version of a gene involved in hearing loss and / or vestibular dysfunction. Examples of such genes are listed in the second column of Table 4 below. A vector containing a wild-type version of a gene in the second (right) column can be administered to a subject to treat the associated disease or condition listed in the first (left) column.

[0236] [Table 3-1]

[0237] [Table 3-2]

[0238] [Table 3-3]

[0239] [Table 3-4]

[0240] [Table 3-5]

[0241] The vectors described herein can be used to express polynucleotides that are normally expressed in healthy inner ear cells, such as polynucleotides corresponding to genes involved in the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells. The nucleic acid can also encode a polynucleotide, an inhibitory RNA, or a component of a gene editing system that modulates (e.g., promotes or improves) the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells. Exemplary polynucleotides that can be expressed in inner ear cells using the vectors described herein are provided in Table 5 below, along with the inner ear cell type(s) in which they can be expressed. Accession numbers for the polynucleotides in Tables 4 and 5 are provided in Table 6.

[0242] [Table 4-1]

[0243] [Table 4-2]

[0244] [Table 4-3]

[0245] [Table 5-1]

[0246] [Table 5-2]

[0247] [Table 5-3]

[0248] [Table 5-4]

[0249]

Table 5-5

[0250]

Table 5-6

[0251]

Table 5-7

[0252]

Table 5-8

[0253]

Table 5-9

[0254]

Table 5-10

[0255]

Table 5-11

[0256]

Table 5-12

[0257]

Table 5-13

[0258]

Table 5-14

[0259]

Table 5-15

[0260]

Table 5-16

[0261]

Table 5-17

[0262]

Table 5-18

[0263]

Table 5-19

[0264]

Table 5-20

[0265]

Table 5-21

[0266]

Table 5-22

[0267]

Table 5-23

[0268]

Table 5-24

[0269]

Table 5-25

[0270]

Table 5-26

[0271]

Table 5-27

[0272]

Table 5-28

[0273]

Table 5-29

[0274]

Table 5-30

[0275]

Table 5-31

[0276]

Table 5-32

[0277]

Table 5-33

[0278]

Table 5-34

[0279] [Table 6-1]

[0280] [Table 6-2]

[0281] In some embodiments, the vector comprises a polynucleotide encoding a dominant negative protein, such as a dominant negative Sox2 (dnSox2) protein. Dominant-negative Sox2 proteins can be made by mutating two nuclear localization signals within the high mobility group domain of Sox2 (as described in Li et al., J Biol Chem 282:19481-92 (2007)), by generating a Sox2 polynucleotide lacking all or most of the high mobility group domain (as described in Kishi et al., Development 127:791-800 (2000)), by generating a Sox2 polynucleotide in which the high mobility group domain is fused to an engrailed repressor domain (as described in Kishi et al., Development 127:791-800 (2000)), or by generating a Sox2 polynucleotide encoding only the Sox2 DNA-binding domain (e.g., Pan and Schultz, Biology of Reproduction 85:409-416 (2011), Hutz et al., Carcinogenesis 85:409-416 (2011)). 35:942-950 (2013) and Gaete et al., Neural Development 7:13 (2012), can be produced by generating a C-terminal truncated version of Sox2 that can compete with wild-type Sox2 by binding to a Sox2 recognition site on DNA, but lacks the transactivation domain. In some embodiments, a dominant negative Sox2 protein can be produced by generating a C-terminal truncated version of Sox2 that can compete with wild-type Sox2 by binding to a Sox2 recognition site on DNA, but lacks the transactivation domain, as described in ATGTATAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAGCTTCGGGGGGCGGCGGCGGAGGAGGCAACGCCACGGCGGCGGCGACCGGCGGCAACCAGAAGAACAGCCCGGACCGCGTCACGGGGCCCATGAACGCCTTCATGGTATGGTCCCGGGGGCAGCTGGGTAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCGGAGTGGAAACTTTTGTCCGAGACCGAGAAGCGGCCGTTCATCGACGAGGCCAAGCGGCTGCGCGCTCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCGCTGGGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTTCCCGGAGGCTTGCTGGCCCCCGGCGGGAACAGCATGGCGAGCGGGGTTGGGGTGGGCGCCGGCCTGGGTGCGGGCGTGAACCAGCGCATGGACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGAGCAGCTGGGCTACCCGCAGCACCCGGGCCTCAACGCTCACGGCGCGGCACAGATGCAACCGATGCACCGCTACGACGTCAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCCGGTATGGCGCTGGGCTCCATGGGCTCTGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTACCTCCCCGGCGCCGAGGTGCCGGAGCCCGCTGCGCCCAGTAGACTGCACATGGCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTGTCGCAC (SEQ ID NO: 50), or encoded by the following sequence.

[0282] ATGTATAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAGCTTCGGGGGGCGGCGGCGGAGGAGGCAACGCCACGGCGGCGGCGACCGGCGGCAACCAGAAGAACAGCCCGGACCGCGTCACGGGGCCCATGAACGCCTTCATGGTATGGTCCCGGGGGCAGCTGGGTAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCGGAGTGGAAACTTTTGTCCGAGACCGAGAAGCGGCCGTTCATCGACGAGGCCAAGCGGCTGCGCGCTCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCGCTGGGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTTCCCGGAGGCTTGCTGGCCCCCGGCGGGAACAGCATGGCGAGCGGGGTTGGGGTGGGCGCCGGCCTGGGTGCGGGCGTGAACCAGCGCATGGACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGAGCAGCTGGGCTACCCGCAGCACCCGGGCCTCAACGCTCACGGCGCGGCACAGATGCAACCGATGCACCGCTACGACGTCAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCCGGTATGGCGCTGGGCTCCATGGGCTCTGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTACCTCCCCGGCGCCGAGGTGCCGGAGCCCGCTGCGCCCAGTAGACTGCACATGGCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTGTCGCACATG (SEQ ID NO: 51).

[0283] Inhibitory RNA In some embodiments, the polynucleotide can be transcribed to produce an inhibitory RNA molecule, such as a small interfering RNA (siRNA) molecule or a small hairpin RNA (shRNA) molecule, e.g., a molecule that acts via the RNA interference (RNAi) pathway. In some embodiments, the inhibitory RNA molecule is directed to Sox2 (e.g., a molecule that can reduce the expression level (e.g., protein level or mRNA level) of Sox2). Inhibitory RNA molecules directed to Sox2 include siRNA molecules and shRNA molecules that target full-length Sox2. siRNAs are double-stranded RNA molecules that are typically about 19-25 base pairs in length. shRNAs are RNA molecules that contain a hairpin turn that reduces expression of a target gene via RNAi. As described in Silva et al., Nature Genetics 37:1281-1288 (2005) and Fellmann et al., Cell Reports 5:1704-1713 (2013), shRNAs can also be embedded into the backbone of miRNAs (e.g., miRNA-30 or mir-E, to produce shRNA-mirs) to achieve highly efficient target gene knockdown. Exemplary Sox2 shRNA and siRNA target sequences are provided in Tables 8 and 9 below. Sequences of plasmids containing exemplary Sox2 shRNAs embedded in miRNA backbones are provided in Table 10 below. Exemplary Sox2 siRNA sequences are provided in Table 11 below.

[0284] [Table 7]

[0285] [Table 8]

[0286] [Table 9-1]

[0287]

Table 9-2

[0288]

Table 9-3

[0289]

Table 9-4

[0290]

Table 9-5

[0291]

Table 9-6

[0292]

Table 9-7

[0293]

Table 9-8

[0294]

Table 9-9

[0295]

Table 9-10

[0296]

Table 9-11

[0297]

Table 9-12

[0298]

Table 10

[0299] In some embodiments, the siRNA or shRNA targeting Sox2 is selected from human (e.g., human Sox2 mRNA in NCBI Reference Sequence: NM_003106.4) or mouse (e.g., mouse Sox2 in NCBI Reference Sequence: NM_011443.4). mRNA) SOX2 gene mRNA transcript of the target region of the SOX2 gene has a nucleic acid sequence that includes a portion of at least 8 contiguous nucleic acid bases (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleic acid bases) having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). In some embodiments, the target region is at least 8 to 21 (e.g., 8 to 21, 9 to 21, 10 to 21, 11 to 21, 12 to 21, 13 to 21, 14 to 21, 15 to 21, 16 to 21, 17 to 21, 18 to 21, 19 to 21, 20 to 21, or all 21) consecutive nucleic acid bases of any one or more of SEQ ID NOs: 52 to 70. In some embodiments, the target region is at least 8 to 19 (e.g., 8 to 19, 9 to 19, 10 to 19, 11 to 19, 12 to 19, 13 to 19, 14 to 19, 15 to 19, 16 to 19, 17 to 19, 18 to 19, or all 19) consecutive nucleic acid bases of any one of SEQ ID NOs: 71 to 73. In some embodiments, the target region is at least 8-22 (e.g., 8-22, 9-22, 10-22, 11-22, 12-22, 13-22, 14-22, 15-22, 16-22, 17-22, 18-22, 19-22, 20-22, 21-22, or all 22) contiguous nucleobases of SEQ ID NO: 74 or 75.

[0300] In some embodiments, the siRNA or shRNA targets SEQ ID NO:58, SEQ ID NO:71, SEQ ID NO:72, or SEQ ID NO:73, SEQ ID NO:74, or SEQ ID NO:75.

[0301] In some embodiments, the shRNA has at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to the full length of SEQ ID NO:58, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, or SEQ ID NO:75. In some embodiments, the shRNA has 100% complementarity to the full length of SEQ ID NO:58, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, or SEQ ID NO:75.

[0302] In some embodiments, a polynucleotide that can be transcribed to produce an shRNA comprises the sequence of nucleotides 2234-2296 of SEQ ID NO: 76 or nucleotides 2234-2296 of SEQ ID NO: 78. In some embodiments, a polynucleotide that can be transcribed to produce an shRNA has the sequence of nucleotides 2234-2296 of SEQ ID NO: 76 or nucleotides 2234-2296 of SEQ ID NO: 78. In some embodiments, the shRNA is embedded in a miRNA backbone. In some embodiments, the miRNA backbone and the shRNA comprise the sequence of nucleotides 2109-2426 of SEQ ID NO: 76, nucleotides 2109-2408 of SEQ ID NO: 77, nucleotides 2109-2426 of SEQ ID NO: 78, or nucleotides 2109-2408 of SEQ ID NO: 79. In some embodiments, the miRNA backbone and shRNA have the sequence of nucleotides 2109-2426 of SEQ ID NO: 76, nucleotides 2109-2408 of SEQ ID NO: 77, nucleotides 2109-2426 of SEQ ID NO: 78, or nucleotides 2109-2408 of SEQ ID NO: 79. These polynucleotide sequences can be operably linked to a promoter in a vector described herein, and can optionally be regulated by one or more miRNA target sequences to improve cell type specific expression.

[0303] In some embodiments, the siRNA is a pair of nucleotide sequences (sense and antisense strands) selected from SEQ ID NO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, and SEQ ID NO:86 and SEQ ID NO:87.

[0304] The siRNA and shRNA molecules used in the methods and compositions described herein can target the mRNA sequence of Sox2 (e.g., human Sox2 mRNA or mouse Sox2 mRNA). The siRNA and shRNA molecules can be delivered using a vector described herein, such as a viral vector (e.g., an AAV vector), and they can be expressed using a cell type-specific promoter (e.g., a hair cell-specific promoter or a supporting cell-specific promoter) or using a ubiquitous promoter (e.g., a ubiquitous pol II or pol III promoter).

[0305] Inhibitory RNA molecules can be modified to include, for example, modified nucleotides, such as 2'-fluoro, 2'-o-methyl, 2'-deoxy, unlocked nucleic acid, 2'-hydroxy, phosphorothioate, 2'-thiouridine, 4'-thiouridine, 2'-deoxyuridine. Without wishing to be bound by theory, it is believed that certain modifications may increase nuclease resistance and / or serum stability, or reduce immunogenicity.

[0306] In some embodiments, the inhibitory RNA molecule reduces the level and / or activity or function of Sox2. In some embodiments, the inhibitory RNA molecule inhibits expression of Sox2. In other embodiments, the inhibitory RNA molecule increases the degradation of Sox2 and / or reduces the stability (i.e., half-life) of Sox2. The inhibitory RNA molecule can be chemically synthesized or can be transcribed in vitro.

[0307] The generation and use of inhibitory therapeutics based on non-coding RNA, such as ribozymes, RNase P, siRNA, and miRNA, are also known in the art, as described, for example, in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press 2010.

[0308] Gene editing components In some embodiments, the vector is a component of a gene editing system or comprises a polynucleotide encoding a component of a gene editing system. For example, a component of a gene editing system can be used to introduce modifications (e.g., insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations) into genes expressed in inner ear cells. Exemplary gene editing systems include zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), and clustered regularly interspaced short palindromic repeat (CRISPR) systems. Methods based on ZFNs, TALENs, and CRISPRs are described, for example, in Gaj et al., Trends Biotechnol. 31:397-405, 2013.

[0309] CRISPR refers to a set of clustered regularly interspaced short palindromic repeats (or a system that includes that set). A CRISPR system refers to a system derived from CRISPR and Cas (CRISPR associated proteins) or another nuclease that can be used to silence or mutate genes expressed in inner ear cells. The CRISPR system is a naturally occurring system found in bacterial and archaeal genomes. CRISPR loci are composed of alternating repeat sequences and spacer sequences. In naturally occurring CRISPR systems, the spacer is usually a sequence foreign to the bacterium (e.g., a plasmid or phage sequence). CRISPR systems have been modified for use in gene editing (e.g., altering, silencing, and / or enhancing specific genes) in eukaryotes. See, e.g., Wiedenheft et al., Nature 482:331, 2012. For example, such modifications of the system include introducing a plasmid containing a specially designed CRISPR and one or more appropriate Cas proteins into a eukaryotic cell. CRISPR loci are transcribed into RNA and processed by Cas proteins into small RNAs that contain repeat sequences flanked by spacers. The RNA acts as a guide to direct Cas proteins to silence specific DNA / RNA sequences depending on the spacer sequence. See, e.g., Horvath et al., Science 327:167, 2010; Makarova et al., Biology Direct 1:7, 2006; Pennisi, Science 341:833, 2013. In some examples, CRISPR systems include Cas9 proteins, which are nucleases that cut both strands of DNA. See, e.g., ibid.

[0310] In some embodiments, in a CRISPR system for use as described herein, e.g., according to one or more methods described herein, the CRISPR spacer is derived from a target gene sequence, e.g., a gene expressed in an inner ear cell.

[0311] In some embodiments, the polynucleotide comprises a guide RNA (gRNA) for use in a clustered regularly interspaced short palindromic repeats (CRISPR) system for gene editing. In some embodiments, the polynucleotide comprises or encodes a zinc finger nuclease (ZFN) that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of a gene expressed in an inner ear cell, or an mRNA that encodes a ZFN. In some embodiments, the polynucleotide comprises or encodes a TALEN that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of a gene expressed in an inner ear cell, or an mRNA that encodes a TALEN.

[0312] For example, gRNAs can be used in a CRISPR system to engineer modifications in genes (e.g., genes expressed in inner ear cells). In other examples, ZFNs and / or TALENs can be used to engineer modifications in genes (e.g., genes expressed in inner ear cells). Exemplary modifications include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations. The modifications can be introduced into the gene in a cell, for example, in vitro, ex vivo, or in vivo. In some embodiments, the modification reduces (e.g., knocks down or knocks out) the level and / or activity of a gene expressed in an inner ear cell, e.g., the modification is a negative regulator of function. In yet another example, the modification corrects a defect (e.g., a mutation that causes a defect) in a gene expressed in an inner ear cell (e.g., a gene involved in sensorineural hearing loss or vestibular dysfunction, such as the genes listed in Table 4).

[0313] In certain embodiments, the CRISPR system is used to edit (e.g., add or delete base pairs) a target gene, e.g., a gene expressed in inner ear cells. In other embodiments, the CRISPR system is used to introduce a premature stop codon, e.g., thereby reducing expression of the target gene. In yet other embodiments, the CRISPR system is used to reversibly turn off a target gene, e.g., similar to RNA interference. In some embodiments, the CRISPR system is used to guide Cas to the promoter of a target gene, e.g., a gene expressed in inner ear cells, thereby sterically blocking RNA polymerase.

[0314] In some embodiments, a CRISPR system can be generated to edit genes expressed in inner ear cells (e.g., genes involved in sensorineural hearing loss or vestibular dysfunction) using techniques described, for example, in U.S. Publication No. 20140068797; Cong, Science 339:819, 2013; Tsai, Nature Biotechnol., 32:569, 2014, and U.S. Patent Nos. 8,871,445, 8,865,406, 8,795,965, 8,771,945, and 8,697,359.

[0315] In some embodiments, CRISPR interference (CRISPRi) technology can be used to transcriptionally suppress specific genes, such as genes expressed in inner ear cells (such as mutant forms of genes involved in sensorineural hearing loss or vestibular dysfunction). In CRISPRi, an engineered Cas9 protein (e.g., nuclease-deficient dCas9, or a dCas9 fusion protein, such as a dCas9-KRAB or dCas9-SID4X fusion) can pair with a sequence-specific guide RNA (sgRNA). The Cas9-gRNA complex can inhibit RNA polymerase, thereby preventing transcription elongation. The complex can also inhibit transcription initiation by preventing the binding of transcription factors. The CRISPRi method is specific, has minimal off-target effects, and is multiplexable, e.g., multiple genes can be simultaneously suppressed (e.g., using multiple gRNAs). The CRISPRi method also allows for reversible gene suppression.

[0316] In some embodiments, CRISPR-mediated gene activation (CRISPRa) can be used for transcriptional activation of one or more genes, e.g., genes expressed in inner ear cells (e.g., genes involved in sensorineural hearing loss or vestibular dysfunction), as described herein. In CRISPRa technology, a dCas9 fusion protein recruits a transcriptional activator. For example, dCas9 can be used to recruit a polypeptide (e.g., an activation domain) such as VP64 or p65 activation domain (p65D), and can be used with an sgRNA (e.g., a single sgRNA or multiple sgRNAs) to activate one or more genes, e.g., endogenous gene(s). Using multiple sgRNAs can recruit multiple activators, which can increase activation efficiency. Various activation domains and single or multiple activation domains can be used. In addition to engineering dCas9 to recruit activators, sgRNAs can also be engineered to recruit activators. For example, an RNA aptamer can be incorporated into the sgRNA to recruit a protein (e.g., an activation domain) such as VP64. In some instances, the synergistic activation mediator (SAM) system can be used for transcriptional activation. In SAM, the MS2 aptamer is added to the sgRNA. MS2 recruits the MS2 coat protein (MCP) fused to p65AD and heat shock factor 1 (HSF1). CRISPRi and CRISPRa technologies are described in detail, for example, in Dominguez et al., Nat. Rev. Mol. Cell Biol. 17:5, 2016, which is incorporated herein by reference.

[0317] promoter Recognition and binding of polynucleotides by mammalian RNA polymerase is important for gene expression. Thus, sequence elements can be included within a polynucleotide that exhibit high affinity for transcription factors that recruit RNA polymerase and promote assembly of a transcription complex at the transcription start site. Such sequence elements include, for example, mammalian promoters, whose sequences can be recognized and bound by specific transcription initiation factors and ultimately RNA polymerase. Promoter sequences are typically located upstream of the translation start site (e.g., within 2 kilobases upstream of the translation start site). Examples of mammalian promoters are described in the online publication Smith, et al., Mol. Sys. Biol., 3:73, the disclosure of which is incorporated herein by reference. The promoters used in the methods and compositions described herein can be ubiquitous promoters or cell type specific promoters (e.g., promoters that induce or increase expression of a polynucleotide in one or more specific cell types, such as hair cells or supporting cells).Examples of ubiquitous promoters include the CAG promoter, the cytomegalovirus (CMV) promoter, the smCBA promoter (described in Haire et al., Invest. Opthalmol. Vis. Sci. 47:3745-3753, 2006), the dihydrofolate reductase (DHFR) promoter, the human β-actin promoter, the phosphoglycerate I kinase (PGK) promoter, the EF1α promoter, the apolipoprotein E-human α1-antitrypsin promoter (hAAT), the CK8 promoter, the mouse U1 promoter (mU1a), the early growth response 1 (EGR1) promoter, the thyroxine-binding globulin (TBG) promoter, the chicken β-actin (C BA) promoter, hybrid CMV enhancer / chicken β-actin promoter, SV40 early promoter, eukaryotic translation initiation factor 4A1 (EIF4A1) promoter, ferritin heavy chain (FerH) promoter, ferritin light chain (FerL) promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, heat shock protein family A member 5 (HSPA5) gene, heat shock protein family A member 4 (HSPA4) promoter, and ubiquitin B (UBB) promoter. Alternatively, promoters derived from viral genomes can be used for stable expression of polynucleotides in primate (e.g., human) cells. Examples of functional viral promoters that can be used to express polynucleotides in primate (e.g., human) cells include the adenovirus late promoter, the vaccinia virus 7.5K promoter, the tk promoter of HSV, the mouse mammary tumor virus (MMTV) promoter, the LTR promoter of HIV, the Moloney virus promoter, the Epstein-Barr virus (EBV) promoter, and the Rous sarcoma virus (RSV) promoter. Pol II promoters (e.g., the ubiquitous promoters described above or the cell type-specific promoters listed in Table 12 below) can be used to express any of the protein-encoding transgenes described herein.Pol III promoters, including the ubiquitous pol III promoters U6, H1, and 7SK, can be used to express a polynucleotide that is an shRNA or siRNA.

[0318] Cell type-specific promoters that can be included in the vectors described herein to express polynucleotides that can be transcribed to produce a desired expression product and polynucleotides that can be transcribed to produce miRNA target sequences in one or more inner ear cell types include hair cell-specific promoters and supporting cell-specific promoters. Exemplary inner ear cell type-specific promoters are provided in Table 12 below.

[0319] [Table 11-1]

[0320] [Table 11-2]

[0321] Exemplary Myo15 promoters are described in International Application Publication Nos. WO2019210181 and WO2020163761A1, and U.S. Patent Application Publication No. US20210236654; exemplary SLC6A14 promoters are described in International Application Publication Nos. WO2021091950 and PCT / US2022 / 027679; exemplary OCM promoters are described in International Application Publication No. WO2021091938; and exemplary CABP2 promoters are described in International Application Publication No. An exemplary GJB2 promoter is described in International Publication No. WO2021067448, exemplary SLC26A4, LGR5, and SYN1 promoters are described in International Publication No. WO2021231567, and exemplary GFAP promoters are described in International Publication Nos. WO2021231885, WO2021067448, and WO2021231567, the disclosures of which are incorporated herein by reference.

[0322] Once a polynucleotide is incorporated into nuclear DNA or the nucleus of a mammalian cell, transcription of the polynucleotide can be induced by methods well known in the art. For example, expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of transcription factors and / or RNA polymerase to the mammalian promoter to regulate gene expression. The chemical reagent can function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent can function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, such that the rate of transcription of genes located downstream of the promoter increases in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to mammalian cells to promote gene expression according to established protocols. Further control of expression of the polynucleotides described herein can be achieved using conditional regulatory elements, such as the Cre recombinase system, including FLEx-Cre, as described in Saunders et al., Front Neural Circuits 6:47 (2012).

[0323] Other DNA sequence elements that may be included in polynucleotides for use in the compositions and methods described herein (e.g., polynucleotides comprising a promoter operably linked to a polynucleotide that can be transcribed to produce a desired expression product and a polynucleotide that can be transcribed to produce a miRNA target sequence) include enhancer sequences. Enhancers represent another class of regulatory elements that induce a conformational change in a polynucleotide that includes a gene of interest such that the DNA adopts a three-dimensional orientation that favors the binding of transcription factors and RNA polymerase at the transcription start site. Thus, polynucleotides for use in the compositions and methods described herein include those that include a polynucleotide of interest and a polynucleotide that can be transcribed to produce a miRNA target sequence, and further include mammalian enhancer sequences. Many enhancer sequences are now known from mammalian genes, including enhancers from genes encoding mammalian globin, elastase, albumin, alpha-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses capable of infecting eukaryotic cells. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer. Additional enhancer sequences that induce activation of eukaryotic gene transcription include the CMV enhancer and the RSV enhancer. The enhancer can be spliced ​​into the vector containing the polynucleotide encoding the protein of interest, for example, at the 5' or 3' position of the gene. In a preferred orientation, the enhancer is located 5' to the promoter, and the promoter is located 5' to the polynucleotide encoding the protein of interest.

[0324] A nucleic acid vector comprising a promoter operably linked to a polynucleotide capable of being transcribed to produce a desired expression product and a polynucleotide capable of being transcribed to produce a miRNA target sequence as described herein may comprise a Woodchuck Post-Transcriptional Regulatory Element (WPRE). The WPRE acts at the transcriptional level to increase the total amount of mRNA in a cell by facilitating nuclear export of the transcript and / or by increasing the efficiency of polyadenylation of the nascent transcript. Addition of a WPRE to a vector can substantially increase transgene expression levels from several different promoters both in vitro and in vivo. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0325] (Sequence number 88).

[0326] In another embodiment, the WPRE has the sequence: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTCTCCTGTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGCTGTGGGCACTGACAATTCCGTGGTGTTATTTGTGGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTCAACGCTTTATTTGTGTAAATTTGTGTAAGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAAAATTGCATTCATTTTATGTTCAGGTTCAGGGGAGAGTGTGGGAGGTTTTTTTAAA (sequence number 89) In some embodiments, the nucleic acid vectors comprising a promoter operably linked to a polynucleotide capable of being transcribed to produce a desired expression product and a polynucleotide capable of being transcribed to produce a miRNA target sequence described herein, contain a reporter sequence that may be useful for verifying expression of the polynucleotide or the protein encoded by the polynucleotide, for example, in cells and tissues (e.g., inner ear cells). Reporter sequences that may be provided in a transgene and incorporated into the vectors described herein include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters known in the art. When associated with regulatory elements (e.g., promoters) that drive their expression, the reporter sequences provide a signal that is detectable by conventional means, including enzyme assays, radioassays, colorimetric, fluorescent or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assaying for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the presence of the vector carrying the signal can be visually measured by color or light production in a luminometer.

[0327] Methods for delivering exogenous nucleic acid to target cells Techniques that can be used to introduce polynucleotides, such as polynucleotides that can be transcribed to produce desired expression products associated with polynucleotides that can be transcribed to produce miRNA target sequences, into target cells (e.g., mammalian cells) are well known in the art. For example, electroporation can be used to permeabilize mammalian cells (e.g., human target cells) by applying an electrostatic potential to the cells of interest. Mammalian cells, such as human cells, exposed in this way to an external electric field are then susceptible to the uptake of exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. A similar technique, Nucleofection™, utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and protocols useful for carrying out this technique are described in detail in, for example, Distler et al., Experimental Dermatology, 14:315 (2005), and US2010 / 0317114, the disclosures of each of which are incorporated herein by reference.

[0328] Further techniques useful for transfection of target cells include squeeze poration. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores that form in response to applied stress. This technique is advantageous in that it does not require vectors to deliver nucleic acid to cells, such as human target cells. Squeeze poration is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the disclosure of which is incorporated herein by reference.

[0329] Lipofection is another technique useful for transfection of target cells. This method involves loading nucleic acid into liposomes, which often present cationic functional groups, such as quaternary amines or protonated amines, toward the exterior of the liposome. This promotes electrostatic interactions between the liposome and the cell due to the anionic nature of the cell membrane, ultimately leading to uptake of the exogenous nucleic acid, for example, by direct fusion of the liposome with the cell membrane or endocytosis of the complex. Lipofection is described in detail, for example, in U.S. Pat. No. 7,442,386, the disclosure of which is incorporated herein by reference. A similar technique that utilizes ionic interactions with the cell membrane to induce uptake of exogenous nucleic acid includes contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules that associate with polynucleotides to impart a positive charge that favors interaction with cell membranes include activated dendrimers (described, for example, in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimine, and diethylaminoethyl (DEAE)-dextran, the use of which as transfection agents is described in detail, for example, in Gulick et al., Current Protocols in Molecular Biology 40:I:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, as this method utilizes an applied magnetic field to induce the uptake of nucleic acids. This technology is described in detail, for example, in US2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0330] Another useful tool for inducing the uptake of exogenous nucleic acids by target cells is laser infection, also known as phototransfection, a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeabilize the cells and allow polynucleotides to penetrate the cell membrane. The biological activity of this technique has been found to be similar to, and in some cases superior to, electroporation.

[0331] Imperfection is another technique that can be used to deliver genetic material to target cells. This technique relies on the use of nanomaterials such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-like nanostructures are synthesized perpendicular to the surface of a substrate. DNA containing genes intended for intracellular delivery is attached to the surface of the nanostructures. A tip with an array of these needles is then pressed against a cell or tissue. Cells impaled by the nanostructures can express the delivered gene(s). An example of this technique is described in Shalek et al., PNAS 107:1870 (2010), the disclosure of which is incorporated herein by reference.

[0332] Magnetofection can also be used to deliver nucleic acids to target cells. The principle of magnetofection is to associate nucleic acids with cationic magnetic nanoparticles. The magnetic nanoparticles are made entirely of biodegradable iron oxide and are coated with different specific cationic proprietary molecules depending on the application. Their association with gene vectors (DNA, siRNA, viral vectors, etc.) is achieved by salt-induced colloidal aggregation and electrostatic interactions. The magnetic particles are then concentrated on the target cells under the influence of an external magnetic field generated by a magnet. This technique is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the disclosure of which is incorporated herein by reference.

[0333] Another useful tool for inducing the uptake of exogenous nucleic acid by target cells is sonoporation, which is a technique that uses sound (usually ultrasonic frequencies) to change the permeability of cell plasma membrane, permeabilizing the cell and allowing polynucleotides to penetrate the cell membrane.This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.

[0334] Microvesicles represent another potential vehicle that can be used to modify the genome of target cells according to the methods described herein. For example, microvesicles induced by co-overexpression of glycoprotein VSV-G and genome-modifying proteins, such as nucleases, can be used to efficiently deliver proteins to cells, and then catalyze the site-specific cleavage of endogenous polynucleotide sequences to prepare the genome of the cells for covalently incorporating a polynucleotide of interest (e.g., a gene or regulatory sequence). The use of such vesicles, also called Gesicle, to genetically modify eukaryotic cells is described in detail, for example, in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein[abstract], Methylation changes in early embryonic genes in cancer[abstract], Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; 2015 May 13, Abstract No. 122.

[0335] Vectors for delivering exogenous nucleic acids to target cells In addition to achieving high transcription and translation rates, stable expression of exogenous polynucleotides in mammalian cells can be achieved by integrating the polynucleotide into the nuclear genome of mammalian cells. Various vectors have been developed for the delivery and integration of polynucleotides into the nuclear DNA of mammalian cells. Examples of expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors for use in the compositions and methods described herein include a promoter operably linked to a polynucleotide that can be transcribed to produce a desired expression product and a polynucleotide that can be transcribed to produce a miRNA target sequence, as well as additional sequence elements that are used, for example, for the expression of these agents and / or the integration of these polynucleotide sequences into the genome of mammalian cells. Vectors that can include a promoter operably linked to a polynucleotide that can be transcribed to produce a desired expression product and a polynucleotide that can be transcribed to produce a miRNA target sequence include plasmids (e.g., circular DNA molecules that can replicate autonomously in a cell), cosmids (e.g., pWE or sCos vectors), artificial chromosomes (e.g., human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), and viral vectors. Particular vectors that can be used to express a polynucleotide associated with a miRNA target sequence include plasmids that include regulatory sequences, such as enhancer regions that induce gene transcription. Other vectors useful for expressing a polynucleotide associated with a miRNA target sequence include polynucleotide sequences that increase the rate of translation or improve the stability or nuclear export of the mRNA resulting from transcription.To induce efficient transcription of the polynucleotide carried on the expression vector, these sequence elements include, for example, 5' and 3' untranslated regions, an internal ribosome entry site (IRES), and a polyadenylation signal site. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0336] Viral vectors for nucleic acid delivery Viral genomes provide a rich source of vectors that can be used to efficiently deliver polynucleotides of interest into the genome of target cells (e.g., mammalian cells, such as human cells). Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically integrated into the nuclear genome of mammalian cells by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include retroviruses (e.g., Retroviridae family viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai), positive strand RNA viruses such as picornaviruses and alphaviruses, as well as double-stranded DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, mutated vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma, avian C virus, mammalian C, B, and D viruses, oncoretroviruses, HTLV-BLV complex, lentiviruses, alpharetroviruses, gammaretroviruses, and spumaviruses (Coffin, JM, Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, 1996)).Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon leukemia virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which is incorporated herein by reference as it relates to viral vectors for use in gene therapy.

[0337] AAV vectors for nucleic acid delivery In some embodiments, the polynucleotides of the compositions and methods described herein are incorporated into rAAV vectors and / or virions to facilitate their introduction into cells. The rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a promoter, (2) a heterologous polynucleotide associated with a polynucleotide that can be transcribed to produce a miRNA target sequence, and (3) viral sequences that promote the stability and expression of the heterologous polynucleotide. The viral sequences may include sequences of AAV required in cis for DNA replication and packaging into virions (e.g., functional ITRs). Such rAAV vectors may also include marker or reporter genes. Useful rAAV vectors have one or more AAV WT genes deleted in whole or in part, but retain functional flanking ITR sequences. The AAV ITRs may be of any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITRs may be AAV2 ITRs. Methods for the use of rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0338] The polynucleotides and vectors described herein (e.g., polynucleotides that can be transcribed to produce a desired expression product and polynucleotides that include a promoter operably linked to a polynucleotide that can be transcribed to produce a miRNA target sequence) can be incorporated into rAAV virions to facilitate the introduction of the polynucleotide or vector into a cell. The capsid protein of AAV constitutes the outer, non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, that are required for virion assembly. Construction of rAAV virions is described, for example, in US5,173,414, US5,139,941, US5,863,541, US5,869,305, US6,057,152, and US6,376,237, as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0339] rAAV virions useful in combination with the compositions and methods described herein include those derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, and PHP (PHP.B, PHP.B2, PHP.B3, PHP.eb, PHP.S, PHP.A). When targeting inner ear cells, AAV1, AAV2, AAV8, AAV9, Anc80, 7m8, DJ, DJ / 9, PHP.B, PHP.B2, PHP.B3, PHP.eB, PHP.S, and PHP.A serotypes may be particularly useful. Serotypes evolved for transduction of the retina may also be used in the methods and compositions described herein. The construction and use of AAV vectors of different serotypes and AAV proteins are described, for example, in Chao et al., Mol. Ther. 2:619 (2000), Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000), Xiao et al., J. Virol. 72:2224 (1998), Halbert et al., J. Virol. 74:1524 (2000), Halbert et al., J. Virol. 75:6615 (2001), and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0340] Also useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0341] AAV virions with mutations in the virion capsid can be used to infect specific cell types more effectively than non-mutated capsid virions. For example, suitable AAV mutants can have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV virions that can be used in the methods described herein include capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0342] Pharmaceutical Compositions The vectors described herein can be incorporated into a vehicle for administration to a patient, such as a human patient suffering from hearing loss, hearing impairment, auditory neuropathy, tinnitus, or vestibular dysfunction (e.g., dizziness, vertigo, loss of balance or imbalance, bilateral vestibular dysfunction, oscillopsia, or balance disorder). Pharmaceutical compositions comprising the vectors described herein can be prepared using methods well known in the art. For example, such compositions can be prepared in a desired form, such as a lyophilized formulation or an aqueous solution, using, for example, a physiologically acceptable carrier, excipient, or stabilizer (Remington: The Science and Practice of Pharmacology 22nd edition, Allen, L. Ed. (2013), incorporated herein by reference).

[0343] The mixture of vectors described herein can be prepared in water, suitably mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (as described in US 5,466,468, the disclosure of which is incorporated herein by reference). In either case, the preparation may be sterile and may have sufficient fluidity to allow easy injection. The preparation may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersion, and by using surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be brought about by using agents that delay absorption, for example, aluminum monostearate and gelatin, in the composition.

[0344] For example, solutions containing the pharmaceutical compositions described herein may be suitably buffered if necessary, and liquid diluents may first be made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous vehicles that can be used will be known to those of skill in the art in light of the present disclosure. For example, a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection fluid or injected at the intended site of injection. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. For local administration to the ear (e.g., middle or inner ear), the composition may be formulated to include a synthetic perilymph solution. An exemplary synthetic perilymph solution is 20-200 mM NaCl, 1-5 mM KCl, 0.1-10 mM CaCl 2 , 1-10 mM glucose, and 2-50 mM HEPES, with a pH of about 6-9 and an osmolality of about 300 mOsm / kg. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Moreover, for human administration, the formulations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0345] Treatment method The compositions described herein can be administered to subjects suffering from or at risk of developing sensorineural hearing loss, hearing impairment, auditory neuropathy, tinnitus, and / or vestibular dysfunction by a variety of routes, including local administration to the middle or inner ear (e.g., administration to the perilymph or endolymph, e.g., administration to or through the oval window, round window, or semicircular canal (horizontal semicircular canal), or administration by transtympanic or intratympanic injection, e.g., administration to cells of the inner ear), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, transdermal, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most suitable route of administration in any given case will depend on the particular composition being administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time and route of administration), the age, weight, sex of the patient, the severity of the disease being treated, the diet of the patient, and the excretion rate of the patient. The compositions can be administered one or more times (eg, once a year, twice a year, three times a year, bimonthly, monthly, or biweekly).

[0346] Subjects who may be treated as described herein are those suffering from or at risk of developing sensorineural hearing loss and / or vestibular dysfunction (e.g., subjects suffering from or at risk of developing hearing loss, vestibular dysfunction, or both). The compositions and methods described herein can be used to treat subjects who have or are at risk of developing damage to inner ear cells such as hair cells (e.g., damage associated with acoustic trauma, disease or infection, head trauma, ototoxic drugs, or aging), who have or are at risk of developing sensorineural hearing loss, hearing impairment, or auditory neuropathy, who have or are at risk of developing vestibular dysfunction (e.g., dizziness, vertigo, disequilibrium, bilateral vestibular dysfunction, oscillopsia, or balance disorders), who have tinnitus (e.g., tinnitus alone or tinnitus associated with sensorineural hearing loss or vestibular dysfunction), who have a genetic mutation associated with hearing loss and / or vestibular dysfunction (e.g., a mutation in a gene listed in Table 4), or who have a family history of inherited hearing loss, hearing impairment, auditory neuropathy, tinnitus, or vestibular dysfunction. In some embodiments, the disease associated with damage or loss of inner ear cells (e.g., hair cells, such as cochlear hair cells and / or vestibular hair cells) is an autoimmune disease or condition in which an autoimmune response contributes to the damage or death of inner ear cells. Autoimmune diseases associated with sensorineural hearing loss and vestibular dysfunction include autoimmune inner ear disease (AIED), polyarteritis nodosa (PAN), Cogan's syndrome, relapsing polychondritis, systemic lupus erythematosus (SLE), Wegener's granulomatosis, Sjogren's syndrome, and Behcet's disease. Some infectious diseases, such as Lyme disease and syphilis, can also cause hearing loss and vestibular dysfunction (e.g., by inducing autoantibody production). Viral infections such as rubella, cytomegalovirus (CMV), lymphocytic choriomeningitis virus (LCMV), HSV types 1 and 2, West Nile virus (WNV), human immunodeficiency virus (HIV), varicella zoster virus (VZV), measles, and mumps can also cause hearing loss and vestibular dysfunction.In some embodiments, the subject suffers from or is at risk of developing hearing loss and / or vestibular dysfunction associated with or resulting from loss of hair cells (e.g., cochlear hair cells or vestibular hair cells). In some embodiments, the compositions and methods described herein can be used to treat a subject suffering from or at risk of developing oscillopia. In some embodiments, the compositions and methods described herein can be used to treat a subject suffering from or at risk of developing bilateral vestibular dysfunction. In some embodiments, the compositions and methods described herein can be used to treat a subject suffering from or at risk of developing a balance disorder. The methods described herein may include screening the subject for one or more mutations in genes known to be associated with hearing loss and / or vestibular dysfunction prior to treatment or administration with a composition described herein. Standard methods known to those of skill in the art (e.g., genetic testing) can be used to screen the subject for genetic mutations. The methods described herein may also include evaluating the subject's hearing and / or vestibular function prior to treatment or administration with a composition described herein. Hearing can be evaluated using standard tests such as hearing test, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emission. Vestibular function can be evaluated using standard tests such as eye movement tests (e.g., electronystagmography (ENG) or videonystagmography (VNG)), tests of vestibulo-ocular reflex (VOR) (e.g., head impulse test (Halmagyi-Curthoys test), which can be performed at the bedside or using video head impulse test (VHIT), or caloric reflex test), stabilometry, rotary chair test, ECOG, vestibular evoked myogenic potential test (VEMP), and specialized clinical balance tests such as those described in Mancini and Horak, Eur J Phys Rehabil Med, 46:239 (2010). These tests can also be used to evaluate hearing function and / or vestibular function in a subject after treatment or administration with the compositions described herein.The compositions and methods described herein can also be administered as a prophylactic treatment to patients at risk of developing hearing loss and / or vestibular dysfunction, such as patients with a family history of hearing loss or vestibular dysfunction (e.g., genetic hearing loss or vestibular dysfunction), patients who have a genetic mutation associated with hearing loss or vestibular dysfunction but have not yet exhibited hearing loss or vestibular dysfunction, or patients who are exposed to one or more risk factors for acquired hearing loss (e.g., acoustic trauma, disease or infection, head trauma, ototoxic drugs, or aging) or vestibular dysfunction (e.g., disease or infection, head trauma, ototoxic drugs, or aging). The compositions and methods described herein can also be used to treat subjects suffering from idiopathic vestibular dysfunction.

[0347] The compositions and methods described herein can be used to convert a first inner ear cell type into a second inner ear cell type. For example, the compositions and methods described herein can be used to convert supporting cells (e.g., cochlear supporting cells or vestibular supporting cells) into hair cells, and thus can be used to induce or increase hair cell regeneration (e.g., cochlear hair cell and / or vestibular hair cell regeneration) in a subject. A vector comprising a nucleic acid encoding Atoh1 can be used to convert supporting cells into hair cells. Such vectors can further comprise a nucleic acid encoding Gfi1, Pou4f3, and / or Ikzf2, or can be administered in combination with one or more additional vectors comprising a nucleic acid encoding Gfi1, Pou4f3, and / or Ikzf2. Subjects who may benefit from compositions that induce or increase hair cell regeneration include those suffering from hearing loss or vestibular dysfunction due to hair cell loss (e.g., hair cell loss associated with trauma (e.g., acoustic trauma or head trauma), disease or infection, ototoxic drugs, or aging), and subjects with abnormal hair cells (e.g., hair cells that do not function properly compared to normal hair cells), damaged hair cells (e.g., hair cell damage associated with trauma (e.g., acoustic trauma or head trauma), disease or infection, ototoxic drugs, or aging), or reduced hair cell numbers due to genetic mutations or congenital abnormalities. The compositions and methods described herein can also be used to promote or increase maturation of cochlear hair cells and / or vestibular hair cells, which may lead to improved hearing function and / or vestibular function, respectively.

[0348] In some embodiments, the compositions and methods described herein are used to convert type II vestibular hair cells into type I vestibular hair cells, which can increase the production of type I vestibular hair cells and / or increase the number of type I vestibular hair cells (e.g., the total number of type I vestibular hair cells in the vestibular system) and improve vestibular function. A vector that includes a polynucleotide that encodes a Sox2 inhibitor or can be transcribed to produce a Sox2 inhibitor can be used to convert type II vestibular hair cells into type I vestibular hair cells. Exemplary Sox2 inhibitors that can be included in the vectors described herein include polynucleotides that encode dnSox2 proteins and polynucleotides that can be transcribed to produce inhibitory RNA molecules directed against Sox2 (e.g., shRNA, siRNA, or shRNA-mir molecules directed against Sox2). Subjects who may benefit from compositions that promote or increase the production of type I vestibular hair cells or increase the number of type I vestibular hair cells include subjects suffering from or at risk of developing a vestibular dysfunction due to hair cell loss (e.g., loss of vestibular hair cells associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), subjects with abnormal vestibular hair cells (e.g., vestibular hair cells that do not function properly compared to normal vestibular hair cells), subjects with damaged vestibular hair cells (e.g., damage to vestibular hair cells associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), or subjects with a reduced number of vestibular hair cells due to a genetic mutation or congenital abnormality. By promoting the production of hair cells (e.g., cochlear hair cells and / or vestibular hair cells) and / or type I vestibular hair cells, the compositions and methods described herein can treat sensorineural hearing loss, hearing impairment, auditory neuropathy, tinnitus, or vestibular dysfunction associated with loss of hair cells or the absence of functional hair cells.

[0349] The compositions and methods described herein can also be used to prevent or reduce hearing loss and / or vestibular dysfunction caused by ototoxic drug-induced hair cell damage or death (e.g., cochlear and / or vestibular hair cell damage or death) in subjects who have been treated with an ototoxic drug or who are currently undergoing or will soon begin treatment with an ototoxic drug. Ototoxic drugs are toxic to cells of the inner ear and can cause sensorineural hearing loss, vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibular dysfunction, or oscillopia), tinnitus, or a combination of these symptoms. Drugs that have been found to be ototoxic include aminoglycoside antibiotics (e.g., gentamicin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, and amikacin), viomycin, antineoplastic agents (e.g., platinum-containing chemotherapy agents such as cisplatin, carboplatin, and oxaliplatin), loop diuretics (e.g., ethacrynic acid and furosemide), salicylates (e.g., aspirin, especially at high doses), and quinine. In some embodiments, the methods and compositions described herein can be used to treat bilateral vestibular dysfunction or oscillopsia due to aminoglycoside ototoxicity (e.g., to generate additional type I vestibular hair cells to replace damaged or dead cells and / or promote or increase hair cell regeneration in subjects suffering from aminoglycoside-induced bilateral vestibular dysfunction or oscillopsia).

[0350] In some embodiments, the compositions and methods described herein are used to treat a subject suffering from genetic hearing loss and / or vestibular dysfunction. In such embodiments, a vector can include a promoter operably linked to a polynucleotide encoding a wild-type form of a gene (e.g., a gene listed in Table 4) that is mutated in the subject, and a polynucleotide that can be transcribed to produce a miRNA target sequence recognized by a miRNA not expressed in an inner ear cell type that normally expresses that gene (e.g., a miRNA target sequence for a miRNA expressed in one or more inner ear cell types that do not normally express that gene, which prevents or reduces off-target expression of the polynucleotide in one or more inner ear cell types that do not normally express that gene). The compositions and methods described herein can also be used to deliver a polynucleotide listed in Table 5 to a corresponding inner ear cell type listed in Table 5, for example, using a vector that includes a polynucleotide listed in Table 5 and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence for one or more miRNAs expressed in one or more inner ear cell types other than the corresponding inner ear cell type of the polynucleotide listed in Table 5. When a polynucleotide delivered using a vector described herein corresponds to a gene that regulates the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells, administration of the vector to a subject can regulate the development, function, cell fate specification, regeneration, survival, proliferation, and / or maintenance of inner ear cells in the subject's inner ear.

[0351] Treatment may include administering various unit doses of a composition comprising a nucleic acid vector as described herein. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as the particular route of administration and formulation, is within the skill of one of ordinary skill in the clinical arts. The unit dose need not be administered as a single injection, but may include continuous infusion over a set period of time. To minimize damage to the inner ear, administration may be accomplished using a syringe pump to control the rate of infusion. If the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP.A, PHP.eb, or the like), the nucleic acid vector may be ... or PHP.S vector), the viral vector can be administered in a volume of 1 μL to 200 μL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μL), e.g., at about 1 × 10 9 Vector genome (VG) / mL ~ approx. 1 x 10 16 VG / mL (e.g., 1×10 9 VG / mL, 2×10 9 VG / mL, 3×10 9 VG / mL, 4×10 9 VG / mL, 5×10 9 VG / mL, 6×10 9 VG / mL, 7×10 9 VG / mL, 8×10 9 VG / mL, 9×10 9 VG / mL, 1×10 10 VG / mL, 2×10 10 VG / mL, 3×10 10 VG / mL, 4×10 10 VG / mL, 5×10 10 VG / mL, 6×10 10 VG / mL, 7×10 10 VG / mL, 8×10 10VG / mL、9×10 10 VG / mL、1×10 11 VG / mL、2×10 11 VG / mL、3×10 11 VG / mL、4×10 11 VG / mL、5×10 11 VG / mL、6×10 11 VG / mL、7×10 11 VG / mL、8×10 11 VG / mL、9×10 11 VG / mL、1×10 12 VG / mL、2×10 12 VG / mL、3×10 12 VG / mL、4×10 12 VG / mL、5×10 12 VG / mL、6×10 12 VG / mL、7×10 12 VG / mL、8×10 12 VG / mL、9×10 12 VG / mL、1×10 13 VG / mL、2×10 13 VG / mL、3×10 13 VG / mL、4×10 13 VG / mL、5×10 13 VG / mL、6×10 13 VG / mL、7×10 13 VG / mL、8×10 13 VG / mL、9×10 13 VG / mL、1×10 14 VG / mL、2×10 14 VG / mL、3×10 14 VG / mL、4×10 14 VG / mL、5×10 14 VG / mL、6×10 14 VG / mL、7×10 14 VG / mL、8×10 14 VG / mL、9×10 14 VG / mL、1×10 15 VG / mL、2×10 15 VG / mL、3×10 15 VG / mL、4×10 15 VG / mL、5×10 15 VG / mL、6×10 15 VG / mL、7×1015 VG / mL, 8×10 15 VG / mL, 9×10 15 VG / mL, or 1×10 16 The AAV vector may be administered to a patient at a dose of approximately 1×10 7 VG / ear ~ approx. 2 x 10 15 VG / ear (e.g. 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 The subject may be administered a dose of 100 mg / ear (VG / ear).

[0352] The compositions described herein can be administered in an amount sufficient to improve hearing, improve vestibular function (e.g., improve balance or reduce dizziness or vertigo), reduce tinnitus, treat bilateral vestibular dysfunction, treat oscillopia, treat balance disorders, treat genetic hearing loss, hearing impairment, or vestibular dysfunction, increase or induce hair cell regeneration (e.g., regeneration of cochlear hair cells and / or vestibular hair cells), increase the number of hair cells, increase hair cell maturation (e.g., maturation of regenerated hair cells), improve the function of one or more inner ear cell types, improve survival of inner ear cells (e.g., in subjects exposed to ototoxic drugs, acoustic trauma or head trauma, or a disease or infection that affects inner ear cells, or in elderly subjects), increase proliferation of inner ear cells, increase production of type I vestibular hair cells, or increase the number of type I vestibular hair cells. Hearing can be assessed using standard hearing tests (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to hearing measurements obtained before treatment. Vestibular function can be assessed using standard tests for balance and vertigo (e.g., eye movement tests (e.g., ENG or VNG), stabilometry tests, VOR tests (e.g., head impulse tests (Halmagyi-Curthoys tests, e.g., VHIT) or caloric reflex tests), rotary chair tests, ECOG, VEMP, and specialized clinical balance tests) and may be improved by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to measurements obtained before treatment. In some embodiments, the composition is administered in an amount sufficient to improve the subject's ability to understand language.The compositions described herein can also be administered in an amount sufficient to delay or prevent the onset or progression of sensorineural hearing loss and / or vestibular dysfunction (e.g., in subjects who have a genetic mutation associated with hearing loss or vestibular dysfunction, who have a family history of hearing loss or vestibular dysfunction (e.g., genetic hearing loss or vestibular dysfunction), or who have been exposed to risk factors associated with hearing loss or vestibular dysfunction (e.g., ototoxic drugs, head trauma, disease or infection, or acoustic trauma) but who have not yet exhibited hearing loss or vestibular dysfunction (e.g., vertigo, dizziness, or disequilibrium), or in subjects who exhibit mild to moderate hearing loss or vestibular dysfunction). Hair cell regeneration, maturation or survival, or the generation or number of type I vestibular hair cells can be indirectly assessed based on hearing tests or vestibular function tests, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to the hair cell regeneration or maturation, or the generation or number of type I vestibular hair cells before administration of the compositions described herein. These effects may occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of the compositions described herein. Depending on the dose and route of administration used for the treatment, the patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the composition. Depending on the results of the evaluation, the patient may receive additional treatment.

[0353] kit The compositions described herein can be provided in a kit for use in promoting hair cell regeneration (e.g., cochlear and / or vestibular hair cell regeneration), generating type I vestibular hair cells, improving inner ear function, and / or treating hearing loss (e.g., sensorineural hearing loss), auditory neuropathy, hearing impairment, tinnitus, or vestibular dysfunction (e.g., dizziness, imbalance, vertigo, bilateral vestibular dysfunction, balance disorders, or oscillopsia). The kit can include a nucleic acid vector comprising a promoter operably linked to a polynucleotide that can be transcribed to produce a desired expression product, and a polynucleotide that can be transcribed to produce a miRNA target sequence (e.g., a target sequence for a miRNA that is differentially expressed between different inner ear cell types). The nucleic acid vector may be packaged in an AAV viral capsid (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S). The kit may further include a package insert instructing a user of the kit, e.g., a physician, to practice the methods described herein. The kit may optionally include a syringe or other device for administering the composition. EXAMPLES

[0354] The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be merely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0355] Example 1 - Effect of miRNA target sequence on the expression of AAV vector-encoded acGFP in HEK293-T cells HEK293-T cells are known to express three miRNAs in the miR-183 cluster (mir-183, -96, and -182) to varying degrees. AAVs containing an acGFP transgene and target sequences for one or more of these miRNAs were used to infect HEK293-T cells to determine whether they induce GFP expression and whether that GFP expression is regulated by the presence of the miRNA target sequences.

[0356] The AAV viral vectors used in this experiment were synthesized as follows. HEK293-T cells (obtained from ATCC, Manassas, VA) were seeded in cell culture-treated dishes (15 cm) and grown in a container until they reached 70-80% confluence. Plasmids encoding GFP containing various miRNA target sequences (plasmids P742, P744, P745, P746, P747, Figures 1-5) or a transgene plasmid lacking any miRNA target sequence (plasmid P002, Figure 6) were individually mixed with the AAV2 rep / AAV8 cap-containing plasmid pXR8 (Addgene#112864) and the adenovirus helper plasmid pXX6-80 (Xiao et al., J Virol 72(3), pp.2224-32(1998)) at a molar ratio of 1:1:1, and 52.3 μg of the mixture was mixed with PEIMax (Polysciences). A total of 52.3 μg of the plasmid mixture was delivered onto each 15 cm plate containing cells. The cell culture medium and cells were then collected to extract and purify AAV. The AAV from the cells was released from the cells by three cycles of freeze-thawing, and the cell culture medium was collected to obtain secreted AAV. The AAV from the cell culture medium was concentrated by adding PEG8000 to the solution, incubating at 4° C., and centrifugation to collect the AAV particles. All AAV was passed through iodixanol density gradient centrifugation to purify the AAV particles, and the buffer was exchanged into PBS containing 0.01% Pluronic F68 by passing the purified AAV and buffer through a centrifugation column with a molecular weight cutoff of 100 kDa. Other AAV viral vectors described in this example and further examples herein were synthesized in a similar manner using the appropriate transgene plasmid (providing the promoter, transgene(s), and other elements required for expression of the transgene).

[0357] Next, HEK293-T cells were seeded in 96-well plates at a density of 10,000 cells / well in DMEM+GlutaMAX+10% PenStrep. 6The following AAVs were treated in triplicate at an MOI of viral genome (vg) / cell: Table 13 below lists the transgene plasmids and viral titers used for each AAV vector.

[0358] [Table 12]

[0359] Cells were incubated in virus-containing medium at 37°C and 5% CO 2 The wells were incubated at 4°C for 4 days. After 4 days, the medium + virus was aspirated and the cells were fixed by incubating the wells in 4% formaldehyde for 20 minutes at room temperature and then stained with DAPI to label the cell nuclei. The cells were imaged on a Zeiss inverted Apotome microscope to observe DAPI and endogenous GFP expression. The results are shown in Figure 7.

[0360] The positive control, which did not contain miRNA target sequences, produced very strong GFP expression in HEK293-T cells, indicating that the vector transduced the cells very well and expression was not downregulated. The low expression levels shown by the other viral vectors compared to the control suggest that the mir-183 cluster target sequences were indeed bound by endogenous HEK293-T miRNAs and downregulated GFP expression.

[0361] Example 2 - Effect of miRNA target sequence on the expression of AAV vector-encoded EGFP in HEK293T cells co-transfected with miRNA target sequence and complementary synthetic miRNA Plasmids containing a polynucleotide encoding nuclear GFP and one or more polynucleotides that can be transcribed to produce miRNA target sequences (P1137, P1138, P1139, P1140, P1141, P1142, P1143, or P1144) were transfected into HEK293T cells with or without co-transfection with their complementary synthetic miRNAs (miR-96, miR-182, or miR-183) from the Invitrogen miRVana product line as follows: Two 24-well plates were seeded at 40,000 cells / well. After 24 hours, the seeded plates were checked for confluence. Transfection was performed when the cells reached 70% or greater confluence. For cells transfected with both plasmid DNA and miRNA, a solution containing 8 ng / μl of plasmid DNA and 0.2 pMol / μL of miRNA in Opti-MEM was prepared. For plasmid-only transfections, solutions containing 8ng / μl of plasmid DNA were prepared in Opti-MEM. After these solutions were prepared, they were incubated at room temperature for 5 minutes and then diluted with an equal volume of 4% Lipofectamine 3000 in Opti-MEM. The solutions were then gently mixed and incubated at room temperature for an additional 10-15 minutes. 50μL of the appropriate DNA / miRNA / Lipo or DNA / Lipo complexes were added to the cells in each well and the plate was rocked to mix evenly. The plates were incubated in the IncuCyte instrument for 48 hours and imaged every 6 hours. After 48 hours, each sample was passed through a Sony fluorescence-activated cell sorter to calculate the percentage of GFP-positive cells in each sample.

[0362] Micrographs of cells treated with different plasmids containing polynucleotides that can be transcribed to produce various miRNA target sequences, with or without co-transfection with the appropriate miRNA, are shown in Figures 27A-B, 28A-B, 29A-B, and 30A-B, showing bright field and GFP channels separately. While miR-96 did not appear to reduce GFP expression in cells transfected with a plasmid containing one copy of a polynucleotide that can be transcribed to produce a miR-96 target sequence and only moderately reduced expression in cells transfected with a plasmid containing four copies of a polynucleotide that can be transcribed to produce a miR-96 target sequence (Figures 27A and 27B), both miR-182 and miR-183 significantly reduced GFP expression in cells transfected with plasmids containing one or four copies of a polynucleotide that can be transcribed to produce the corresponding miRNA target sequence (Figures 28A, 28B, 29A and 29B). A single copy of either polynucleotide that can be transcribed to produce a miR-182 or miR-183 target sequence reduced GFP expression by approximately six-fold in cells cotransfected with the appropriate miRNA. Four copies of polynucleotides that can be transcribed to produce these target sequences almost completely inhibited GFP expression (about 100-fold reduction). Plasmids containing one copy of each polynucleotide that can be transcribed to produce miRNA-96, miRNA-182, and miRNA-183 target sequences showed about 15-fold reduction in GFP expression in the presence of all three corresponding miRNAs. Plasmids containing three copies of each polynucleotide that can be transcribed to produce miRNA-96, miRNA-182, and miRNA-183 target sequences showed about 78-fold reduction in GFP expression in the presence of all three corresponding miRNAs. See Figure 30A and Figure 30B. These results are summarized in Figure 31.

[0363] Example 3 - Effect of miRNA target sequences on the expression of AAV vector-encoded eGFP in mouse cochlear explants The microRNAs mir-96, mir-182, and mir-183 are highly expressed in cochlear HCs. AAV viral vectors containing the H2B-eGFP transgene and target sequences for one or more of these miRNAs were used to infect neonatal mouse cochlear explants to determine whether they induce GFP expression and whether that GFP expression is regulated by the presence of the miRNA target sequences.

[0364] Sensory epithelia were dissected from P1 mice and plated in duplicate on Matrigel-treated MatTek 35 mm dishes with #0 10 mm coverslips. 150-200 μL of DMEM + 10% FBS + 10 μg / mL ciprofloxacin was added to each dish. Incubate at 37 °C / 5% CO 2 After incubation for 1 hour at 4°C, 1 × 10 11 1 viral genome was added to each dish.

[0365] [Table 13]

[0366] The explants were then incubated at 37 °C / 5% CO 2The explants were incubated at 4°C for 2 days. After 2 days, the medium and virus were removed and replaced with fresh medium without virus. The explants were then incubated for another 3 days and then fixed with 4% formaldehyde (PFA) for 20 min at room temperature. The explants were washed 3 times with PBS and then incubated in 10% normal donkey serum (NDS) in PBS + 0.1% TritonX for 20 min. The NDS was removed and the explants were incubated overnight at 4°C with primary antibodies specific for hair cells (e.g., antibody against myosin VIIa) and supporting cells (e.g., antibody against Sox2) (each diluted 1:1000 in PBS + 0.1% TritonX). The next day, the explants were washed 3 times with PBS and then incubated for 2-3 h at room temperature with labeled secondary antibodies (each diluted 1:1000 in PBS + 0.1% TritonX) that allow differentiation between the various primary antibodies. After incubation in the secondary antibody, the explants were washed five times with PBS and mounted on microscope slides using Fluoromount mounting medium. Slides were then imaged using a Zeiss LSM880 confocal microscope to differentiate and visualize hair cells and supporting cells and to detect GFP fluorescence. The results are shown in Figures 32A-B. In tissues infected with AAV1026 and AAV1027, which contain four copies of a polynucleotide that can be transcribed to produce miR-96 or miR-182 target sites, respectively, Figure 32A shows that GFP expression was restricted to supporting cells, but overall, was significantly reduced compared to AAV807. The same was true for tissues infected with AAV1028 or AAV1029, as shown in Figure 32B.

[0367] Example 4 - Effect of miRNA target sequence on expression of AAV vector-encoded eGFP under the control of a supporting cell promoter in mouse cochlear explants To further increase expression in supporting cells, the supporting cell-specific LFNG promoter and its associated upstream enhancer sequence were used to drive nuclear-targeted expression of H2B-eGFP fusion proteins in the presence of various miRNA target sequences in mouse cochlear explants. The LFNG promoter drives expression primarily in supporting cells, but also sporadic hair cell expression.

[0368] Sensory epithelia were dissected from P0–P2 mice and plated in duplicate on Matrigel-treated MatTek 35 mm dishes with #0 10 mm coverslips. 150–200 μL of DMEM + 10% FBS + 10 μg / mL ciprofloxacin was added to each dish. Incubate at 37°C / 5% CO 2 After incubation for 1 hour at 4°C, 1 × 10 11 1 viral genome was added to each dish.

[0369] [Table 14]

[0370] The explants were then incubated at 37°C / 5% CO 2The explants were incubated at 4°C for 2 days. Two days after the first administration of the vector, the medium and virus were removed and replaced with fresh medium without virus. The explants were then incubated for another 3 days and then fixed with 4% formaldehyde for 20 min at room temperature. The explants were washed 3 times with PBS and then incubated in 10% normal donkey serum (NDS) in PBS + 0.1% TritonX for 20 min. The NDS was removed and the explants were incubated overnight at 4°C with a primary antibody specific for hair cells (e.g., antibody against myosin VIIa) and a primary antibody specific for supporting cells (e.g., antibody against Sox2) (each diluted 1:1000 in PBS + 0.1% TritonX). The next day, the explants were washed 3 times with PBS and then incubated for 2-3 h at room temperature with a labeled secondary antibody (each diluted 1:1000 in PBS + 0.1% TritonX) that allows differentiation between the various primary antibodies. After incubation in the secondary antibody, the explants were washed five times with PBS and mounted on microscope slides using Fluoromount mounting medium. Slides were then imaged using a Zeiss LSM880 confocal microscope to differentiate and visualize hair cells and support cells and to detect GFP fluorescence. The results are shown in Figures 37A-B. As shown in Figure 37A, GFP was expressed in the nuclei of both hair cells and support cells in tissue infected with AAV851, which does not contain miRNA target sites. In tissue infected with AAV1146 and AAV1147, which contain four copies of a polynucleotide that can be transcribed to produce miR-96 or miR-182 target sites, respectively, GFP expression was restricted to supporting cells, including the supporting cells of the sensory epithelium (which are interdigitated with the hair cells), with strong expression outside the sensory epithelium and moderate expression inside the sensory epithelium.As shown in FIG. 37B, in tissues infected with AAV1148 and AAV1145, which contained four copies of a polynucleotide that could be transcribed to produce miR-183 target sites or three copies of a polynucleotide that could be transcribed to produce miR-182, miR-96, and miR-183 target sites, respectively, GFP expression was also restricted to supporting cells, including supporting cells of the sensory epithelium (which are interdigitated with hair cells), with strong expression outside the sensory epithelium and moderate expression inside the sensory epithelium.

[0371] Example 5 - Effect of miRNA target sequences on the expression of AAV vector-encoded eGFP under the control of the ubiquitous CMV promoter in mouse utricle explants Utricles were dissected from 8-week-old C57Bl / 6 mice and plated in triplicate into 35 mm Matsunami glass bottom dishes with 14 mm wells. 250 uL of DMEM / F12 + 5% FBS + 2.5 ug / mL ciprofloxacin was added to each dish and 1 x 10 of the AAV vectors shown in Table 14 above were added. 11 1 viral genome was added to each dish.

[0372] The explants were then incubated at 37°C / 5% CO 2The explants were incubated at 4°C for 2 days. After 2 days, the medium and virus were removed and 2 mL of fresh medium without virus was added to each dish. The explants were then incubated for another 3 days and then fixed with 4% formaldehyde for 1 h at room temperature. The explants were washed 3 times with PBS and then incubated for 1 h in 10% normal donkey serum (NDS) in PBS + 0.5% TritonX. The NDS / PBS was removed and the explants were incubated overnight at 4°C with a primary antibody specific for hair cells (e.g., antibody against Pou4f3) and a primary antibody specific for supporting cells (e.g., antibody against Sox2) (each diluted 1:500 in PBS + 0.5% TritonX). The next day, the explants were washed 3 times with PBS and then incubated for 2-3 h at room temperature with a labeled secondary antibody (each diluted 1:500 in PBS + 0.5% TritonX) that allows differentiation between the various primary antibodies. After incubation in secondary antibodies, explants were washed twice with PBS, once with DAPI, and twice more with PBS and mounted on microscope slides using Diamond Anti-Fade mounting medium. Slides were then imaged using a Zeiss LSM880 confocal microscope to visualize distinct hair cells and supporting cells and to detect GFP fluorescence. The results are shown in Figures 38A-B.

[0373] In the utricle, the hair cell layer lies above the supporting cell layer. As shown in Figure 38A, GFP was expressed in the nuclei of both hair cells (compare lower row with upper row) and supporting cells (compare lower row with middle row) in tissues infected with AAV807, which does not contain miRNA target sites. In tissues infected with AAV1026 and AAV1027, which contain four copies of a polynucleotide that can be transcribed to produce miR-96 or miR-182 target sites, respectively, GFP expression was restricted to supporting cells and cells outside the sensory epithelium, but overall was significantly reduced compared to AAV807. As shown in Figure 38B, in tissues infected with AAV1028 and AAV1029, which contained four copies of a polynucleotide that could be transcribed to produce a miR-183 target site, and three copies of a polynucleotide that could be transcribed to produce miR-182, miR-96, and miR-183 target sites, respectively, GFP expression remained strong but was restricted to supporting cells and cells outside the sensory epithelium.

[0374] Imaris 9.9.1 software was used to quantify hair cells and GFP. Hair cells were counted by creating spots using the Pou4f3 channel, setting a quality threshold, and manually removing false positives. A mask was created from these spots to surround the hair cells. GFP-positive nuclei were counted by creating spots in the same way as the GFP channel. GFP spots were then filtered by the mean or median intensity of the hair cell mask to identify nuclei that were both Pou4f3 and GFP positive. The percentage of GFP-positive hair cells in each tissue was then calculated. The data was then plotted using GraphPad Prism 9.3.1 software and is shown in Figure 39.

[0375] Example 6 - Effect of miRNA target sequence on expression of AAV vector-encoded Gjb2 in mouse cochlear explants Once both acGFP or eGFP expression and miRNA-driven reduction of its expression have been demonstrated in cochlear explants, a similar AAV vector containing mouse GJB2 (mGJB2) as a transgene is used. Deficiency of this gene in mice and its corresponding gene in humans (hGJB2) results in the loss of a critical gap junction protein in the cochlear sensory epithelium, improper function of supporting cells, and ultimately loss of hair cells. It is important that the gene therapy vector designed to restore proper expression of this protein drives expression of GJB2 primarily in supporting cells, not hair cells. We believe that this cell-specific expression is achieved by including various types and arrays of miRNA target sequences in the Gjb2 transcripts encoded by the AAV transgene vector. This is because miRNAs that bind to the miRNA target sequences encoded in the AAV vector are present in hair cells but not in supporting cells. We transfect neonatal cochlear explants using the AAV vectors disclosed in Table 15 to confirm that by placing 1 to 4 copies of target sequences complementary to these microRNAs in the 3'UTR of the transgene, mGJB2 expression in hair cells is reduced or eliminated.

[0376] Sensory epithelia were dissected from P0–P2 mice and plated in duplicate on Matrigel-treated MatTek 35 mm dishes with #0 10 mm coverslips. 150–200 μL of DMEM + 10% FBS + 10 μg / mL ciprofloxacin was added to each dish. Incubate at 37°C / 5% CO 2 After incubation for 1 hour at 4°C, 1 × 10 11 1 viral genome was added to each dish.

[0377] [Table 15]

[0378] After fixation with formaldehyde, the explants were washed three times with PBS and then incubated in 10% normal donkey serum (NDS) in PBS for 20 min. NDS was removed and the explants were incubated overnight at 4 °C with a primary antibody specific for hair cells (e.g., antibody against myosin VIIa), a primary antibody specific for supporting cells (e.g., antibody against Sox2), and a primary antibody specific for GJB2 (each diluted 1:1000 in PBS). The next day, the explants were washed three times with PBS and then incubated for 2–3 h at room temperature with a labeled secondary antibody (each diluted 1:1000 in PBS) that allows differentiation between the various primary antibodies. After incubation in the secondary antibodies, the explants were washed five times with PBS and mounted on microscope slides using Fluoromount mounting medium. The slides were then imaged using a Zeiss upright Apotome light microscope to differentiate and visualize the hair cells and supporting cells and to detect GJB2.

[0379] Example 7 - Administration of a composition comprising a nucleic acid vector comprising a polynucleotide encoding Gjb2 and a promoter operably linked to one or more polynucleotides that can be transcribed to produce a miRNA target sequence for a miRNA expressed in cochlear hair cells and / or spiral ganglion neurons but not in cochlear supporting cells According to the methods disclosed herein, a practitioner of the art can treat a patient (e.g., a human patient) with hearing loss associated with a mutation in GJB2 (e.g., DFNB1 or DFNA3) to improve or restore hearing. To this end, a practitioner of the art can administer a polynucleotide encoding Gjb2 (e.g., human Gjb2) and a ubiquitous promoter (e.g., CMV) operably linked to one or more miRNA target sequences of one or more miRNAs expressed in cochlear hair cells and / or spiral ganglion neurons but not in cochlear supporting cells (e.g., one or more target sequences of miR-183, miR-96, miR-182, miR-18a, miR-140, miR-124a, and / or miR-194), the GJB2 promoter, A composition comprising an AAV vector (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S) comprising a GJB2-specific or support cell-specific promoter (e.g., FGFR3 promoter, LFNG promoter, or SLC1A3 promoter) can be administered to a human patient. To treat hearing loss associated with a mutation in GJB2, a composition comprising an AAV vector can be administered to a patient, for example, by local administration to the inner ear (e.g., injection into the perilymph or injection into or through the round window membrane).

[0380] After administering the composition to the patient, a person skilled in the art can monitor the improvement of the patient in response to the treatment by various methods.For example, the doctor can monitor the patient's hearing by performing standard tests such as hearing test, ABR, electrocochleography (ECOG), and otoacoustic emission after administering the composition.The finding that the patient's hearing is improved in one or more tests after administering the composition compared to the hearing test results before administering the composition indicates that the patient is responding well to the treatment.Subsequent doses can be determined and administered as needed.

[0381] Exemplary embodiments of the present invention are described in the following paragraphs. E1. i. a first polynucleotide that can be transcribed to produce an expression product (e.g., a polynucleotide that can be transcribed to produce a protein or an inhibitory RNA), and ii. A nucleic acid vector comprising a first promoter operably linked to at least one polynucleotide that can be transcribed to produce a microRNA (miRNA) target sequence (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides that can be transcribed to produce a miRNA target sequence), the first polynucleotide is suitable for expression in a first inner ear cell type but not in a different second inner ear cell type; The nucleic acid vector, wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the first promoter is recognized by an miRNA that is expressed in the second inner ear cell type but not in the first inner ear cell type.

[0382] E2. The nucleic acid vector of E1, wherein the expression product transcribed from the first polynucleotide promotes conversion of the first inner ear cell type to the second inner ear cell type. E3. The nucleic acid vector of E1 or E2, wherein the first polynucleotide is expressed in the first inner ear cell type but not in the second inner ear cell type.

[0383] E4. The nucleic acid vector of any one of E1-E3, comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides that can be transcribed to produce miRNA target sequences.

[0384] E5. The nucleic acid vector of E4, comprising a polynucleotide that can be transcribed to produce a first miRNA target sequence and a polynucleotide that can be transcribed to produce a second miRNA target sequence, each miRNA target sequence being recognized by a different miRNA.

[0385] E6. The nucleic acid vector of claim E5, further comprising a polynucleotide that can be transcribed to produce a third miRNA target sequence, wherein each of the first, second, and third miRNA target sequences is recognized by a different miRNA.

[0386] E7. The nucleic acid vector of any one of E1-E5, comprising at least two copies (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of a polynucleotide that can be transcribed to produce the same miRNA target sequence.

[0387] E8. The nucleic acid vector of E7, comprising at least three copies (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more copies) of said polynucleotide that can be transcribed to produce the same miRNA target sequence.

[0388] E9. The nucleic acid vector of any one of E1 to E4, E7, and E8, wherein each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to the first promoter is the same.

[0389] E10. The nucleic acid vector of any one of E1 to E9, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence is located 3' of said first polynucleotide.

[0390] E11. The nucleic acid vector of E10, wherein the vector further comprises a WPRE sequence located 3' of the first polynucleotide, and each polynucleotide capable of being transcribed to produce a miRNA target sequence is located between the first polynucleotide and the WPRE sequence.

[0391] E12. The nucleic acid vector of E10 or E11, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 3'UTR of said first polynucleotide.

[0392] E13. The nucleic acid vector of any one of E1 to E9, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence is within the 5'UTR of said first polynucleotide.

[0393] E14. The nucleic acid vector of any one of E1-E13, wherein each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to said first promoter is independently targeted by a miRNA listed in Table 2.

[0394] E15. The nucleic acid vector of any one of E1-E14, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to said first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0395] E16. The nucleic acid vector of any one of E1-E15, wherein the first inner ear cell type is a cochlear supporting cell and the second inner ear cell type is at least one of a cochlear hair cell or a spiral ganglion neuron.

[0396] E17. The nucleic acid vector of E16, wherein said second inner ear cell type is a cochlear hair cell. E18. The nucleic acid vector of E16, wherein said second inner ear cell type is a spiral ganglion neuron.

[0397] E19. The nucleic acid vector of any one of E1-E15, wherein the first inner ear cell type is a vestibular supporting cell and the second inner ear cell type is at least one of a vestibular hair cell or a vestibular ganglion neuron.

[0398] E20. The nucleic acid vector of E19, wherein said second inner ear cell type is a vestibular hair cell. E21. The nucleic acid vector of E20, wherein said second inner ear cell type is a vestibular type I hair cell.

[0399] E22. The nucleic acid vector of E19, wherein said second inner ear cell type is a vestibular ganglion neuron. E23. The nucleic acid vector of any one of E1 to E15, wherein the first inner ear cell type is a vestibular type II hair cell and the second inner ear cell type is a vestibular type I hair cell.

[0400] E24. The nucleic acid vector of any one of E1-E15, wherein the first inner ear cell type is a vestibular type II hair cell and the second inner ear cell type is a vestibular ganglion neuron. E25. The nucleic acid vector of any one of E1 to E15, wherein the first polynucleotide is a transgene encoding a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system.

[0401] E26. The nucleic acid vector of E25, wherein said first polynucleotide is a transgene encoding a protein. E27. The nucleic acid vector of E26, wherein said transgene is a wild-type version of a gene listed in Table 4.

[0402] E28. The nucleic acid vector of E26, wherein said transgene is a polynucleotide listed in Table 5. E29. The nucleic acid vector of E25, wherein said first polynucleotide can be transcribed to produce an inhibitory RNA.

[0403] E30. The nucleic acid vector of E29, wherein said inhibitory RNA is an siRNA, shRNA, or shRNA-mir. E31. The nucleic acid vector of E29, wherein said inhibitory RNA is an inhibitory RNA that targets Sox2 (e.g., an inhibitory RNA described herein).

[0404] E32. The nucleic acid vector of E25, wherein the first polynucleotide encodes a component of a gene editing system. E33. The nucleic acid vector of E32, wherein the first polynucleotide can be transcribed to produce a guide RNA.

[0405] E34. The nucleic acid vector of E32, wherein said first polynucleotide encodes a nuclease. E35. The nucleic acid vector of any one of E1 to E15, wherein the first polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2.

[0406] E36. The nucleic acid vector of any one of E1 to E15, wherein the first promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter.

[0407] E37. The nucleic acid vector of any one of E1 to E15, wherein the first promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter.

[0408] E38. The nucleic acid vector of any one of E1 to E37, further comprising a second polynucleotide capable of being transcribed to produce an expression product, said second polynucleotide being different from said first polynucleotide.

[0409] E39. The nucleic acid vector of E38, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, the second polynucleotide, and the at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, wherein the second polynucleotide is suitable for expression in the first inner ear cell type but not in the second inner ear cell type.

[0410] E40. The nucleic acid vector of E38, wherein said second polynucleotide is operably linked to a second promoter. E41. The nucleic acid vector of E40, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, the at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the second promoter, and the second polynucleotide.

[0411] E42. The nucleic acid vector of E41, wherein expression of said second polynucleotide is not regulated by a miRNA target sequence. E43. The nucleic acid vector of E41, wherein the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the second polynucleotide operably linked to the second promoter, wherein the second polynucleotide is suitable for expression in a third inner ear cell type but not in a different, fourth inner ear cell type, and wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type.

[0412] E44. The nucleic acid vector of any one of E38 to E43, further comprising a third polynucleotide capable of being transcribed to produce an expression product, said third polynucleotide being distinct from said first polynucleotide and said second polynucleotide.

[0413] E45. The nucleic acid vector of E44, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, the second polynucleotide, the third polynucleotide, and the at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, wherein the third polynucleotide is suitable for expression in the first inner ear cell type but not in the second inner ear cell type.

[0414] E46. The nucleic acid vector of E44, wherein said first polynucleotide is operably linked to said first promoter, and said second and third polynucleotides are operably linked to said second promoter.

[0415] E47. The nucleic acid vector of E45, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, the at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the second promoter, the second polynucleotide, and the third polynucleotide.

[0416] E48. The nucleic acid vector of E47, wherein expression of said second and third polynucleotides is not regulated by a miRNA target sequence. E49. The nucleic acid vector of E47, wherein the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the third polynucleotide operably linked to the second promoter, wherein the second and third polynucleotides are suitable for expression in a third inner ear cell type but not in a different, fourth inner ear cell type, and wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type.

[0417] E50. The nucleic acid vector of E44, wherein said first polynucleotide and said second polynucleotide are operably linked to said first promoter, and said third polynucleotide is operably linked to a second promoter.

[0418] E51. The nucleic acid vector of E50, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, the second polynucleotide, the at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the second promoter, and the third polynucleotide.

[0419] E52. The nucleic acid vector of E51, wherein expression of said third polynucleotide is not regulated by a miRNA target sequence. E53. The nucleic acid vector of E51, wherein the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the third polynucleotide operably linked to the second promoter, wherein the third polynucleotide is suitable for expression in a third inner ear cell type but not in a different, fourth inner ear cell type, and wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type.

[0420] E54. The nucleic acid vector of E44, wherein the first polynucleotide is operably linked to the first promoter, the second polynucleotide is operably linked to the second promoter, and the third polynucleotide is operably linked to a third promoter.

[0421] E55. The nucleic acid vector of E54, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the second promoter, the second polynucleotide, the third promoter, and the third polynucleotide.

[0422] E56. The nucleic acid vector of E55, wherein expression of said second and third polynucleotides is not regulated by a miRNA target sequence. E57. The nucleic acid vector of E54, wherein the vector comprises, in 5' to 3' order, the first promoter, the first polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the second promoter, the second polynucleotide, at least one polynucleotide capable of being transcribed to produce a miRNA target sequence, the third promoter, and the third polynucleotide, wherein the second polynucleotide is suitable for expression in a third inner ear cell type but not suitable for expression in a different, fourth inner ear cell type, and wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the second promoter is recognized by a miRNA expressed in the fourth inner ear cell type but not in the third inner ear cell type.

[0423] E58. The nucleic acid vector of E57, wherein expression of the third polynucleotide is not regulated by a miRNA target sequence. E59. The nucleic acid vector of E57, wherein the vector further comprises at least one polynucleotide capable of being transcribed to produce a miRNA target sequence 3' of the third polynucleotide operably linked to the third promoter, wherein the third polynucleotide is suitable for expression in a fifth inner ear cell type but not in a different, sixth inner ear cell type, and wherein the miRNA target sequence transcribed from the at least one polynucleotide operably linked to the third promoter is recognized by a miRNA expressed in the sixth inner ear cell type but not in the fifth inner ear cell type.

[0424] E60. The nucleic acid vector of any one of E43, E49, E53, and E57, wherein the fourth inner ear cell type is different from the second inner ear cell type. E61. The nucleic acid vector of any one of E43, E49, E53, and E57, wherein the fourth inner ear cell type is the same as the second inner ear cell type.

[0425] E62. The nucleic acid vector of any one of E43, E49, E53, E57, E60, and E61, wherein the third inner ear cell type is different from the first inner ear cell type. E63. The nucleic acid vector of any one of E43, E49, E53, E57, E60, and E62, wherein the first inner ear cell type is the same as the fourth inner ear cell type.

[0426] E64. The nucleic acid vector of any one of E43, E49, E53, E57, and E60-E62, wherein the first inner ear cell type is different from the fourth inner ear cell type. E65. The nucleic acid vector of any one of E43, E49, E53, E57, E60, and E62, wherein the third inner ear cell type is the same as the second inner ear cell type.

[0427] E66. The nucleic acid vector of any one of E43, E49, E53, E57, E60-E62, and E64, wherein the third inner ear cell type is different from the second inner ear cell type. E67. The nucleic acid vector of any one of E43, E49, E53, E57, and E60, wherein the third inner ear cell type is the same as the first inner ear cell type.

[0428] E68. The nucleic acid vector of any one of E59 to E67, wherein the sixth inner ear cell type is distinct from the fourth and second inner ear cell type. E69. The nucleic acid vector of any one of E59, E60, and E62-E67, wherein the sixth inner ear cell type is the same as either the fourth inner ear cell type or the second inner ear cell type.

[0429] E70. The nucleic acid vector of any one of E59, E61, E62, E64, and E66, wherein the sixth inner ear cell type is the same as the fourth and second inner ear cell type. E71. The nucleic acid vector of any one of E59 to E70, wherein the fifth inner ear cell type is distinct from the first and third inner ear cell types.

[0430] E72. The nucleic acid vector of any one of E59 to E66 and E68 to E70, wherein the fifth inner ear cell type is the same as either the first inner ear cell type or the third inner ear cell type.

[0431] E73. The nucleic acid vector of any one of E59, E60, and E67-E69, wherein the fifth inner ear cell type is the same as the first and third inner ear cell type. E74. The nucleic acid vector of any one of E40 to E73, wherein the second promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter.

[0432] E75. The nucleic acid vector of any one of E40 to E74, wherein the second promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter.

[0433] E76. The nucleic acid vector of any one of E38 to E75, wherein the second polynucleotide is a transgene encoding a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system.

[0434] E77. The nucleic acid vector of E76, wherein said second polynucleotide is a transgene encoding a protein. E78. The nucleic acid vector of E77, wherein said transgene is a wild-type version of a gene listed in Table 4.

[0435] E79. The nucleic acid vector of E77, wherein said transgene is a polynucleotide listed in Table 5. E80. The nucleic acid vector of E76, wherein said second polynucleotide can be transcribed to produce an inhibitory RNA.

[0436] E81. The nucleic acid vector of E79, wherein said inhibitory RNA is an siRNA, shRNA, or shRNA-mir. E82. The nucleic acid vector of E79, wherein said inhibitory RNA is an inhibitory RNA that targets Sox2 (e.g., an inhibitory RNA described herein).

[0437] E83. The nucleic acid vector of E76, wherein the second polynucleotide encodes a component of a gene editing system. E84. The nucleic acid vector of E83, wherein said second polynucleotide can be transcribed to produce a guide RNA.

[0438] E85. The nucleic acid vector of E83, wherein said second polynucleotide encodes a nuclease. E86. The nucleic acid vector of any one of E38 to E75, wherein the second polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2.

[0439] E87. The nucleic acid vector of any one of E43-E86, wherein one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides capable of being transcribed to produce miRNA target sequences are operably linked to the second promoter.

[0440] E88. The nucleic acid vector of any one of E43-E87, wherein each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to said second promoter is independently targeted by a miRNA listed in Table 2.

[0441] E89. The nucleic acid vector of any one of E43-E88, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to said second promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0442] E90. The nucleic acid vector of any one of E43 to E89, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to said second promoter is the same.

[0443] E91. The nucleic acid vector of any one of E54 to E90, wherein the third promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter.

[0444] E92. The nucleic acid vector of any one of E54 to E91, wherein the third promoter is a CMV promoter, a MYO15 promoter, a LFNG promoter, a FGFR3 promoter, a SLC1A3 promoter, a GFAP promoter, or a SLC6A14 promoter.

[0445] E93. The nucleic acid vector of any one of E44 to E92, wherein the third polynucleotide is a transgene encoding a protein, a polynucleotide that can be transcribed to produce an inhibitory RNA, or encodes a component of a gene editing system.

[0446] E94. The nucleic acid vector of E93, wherein said third polynucleotide is a transgene encoding a protein. E95. The nucleic acid vector of E94, wherein said transgene is a wild-type version of a gene listed in Table 4.

[0447] E96. The nucleic acid vector of E94, wherein said transgene is a polynucleotide listed in Table 5. E97. The nucleic acid vector of E93, wherein said third polynucleotide can be transcribed to produce an inhibitory RNA.

[0448] E98. The nucleic acid vector of E97, wherein said inhibitory RNA is an siRNA, shRNA, or shRNA-mir. E99. The nucleic acid vector of E97, wherein said inhibitory RNA is an inhibitory RNA that targets Sox2 (e.g., an inhibitory RNA described herein).

[0449] E100. The nucleic acid vector of E93, wherein the third polynucleotide encodes a component of a gene editing system. E101. The nucleic acid vector of E100, wherein the third polynucleotide can be transcribed to produce a guide RNA.

[0450] E102. The nucleic acid vector of E100, wherein the third polynucleotide encodes a nuclease. E103. The nucleic acid vector of any one of E44 to E92, wherein the third polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2.

[0451] E104. The nucleic acid vector of any one of E59 to E103, wherein one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polynucleotides capable of being transcribed to produce miRNA target sequences are operably linked to the third promoter.

[0452] E105. The nucleic acid vector of any one of E59 to E104, wherein each polynucleotide that can be transcribed to produce a miRNA target sequence operably linked to said third promoter is independently targeted by a miRNA listed in Table 2.

[0453] E106. The nucleic acid vector of any one of E59 to E105, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to said third promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b.

[0454] E107. The nucleic acid vector of any one of E59 to E106, wherein each polynucleotide capable of being transcribed to produce a miRNA target sequence operably linked to said third promoter is the same.

[0455] E108. a. the first polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2 or is capable of being transcribed to produce an inhibitory RNA that targets Sox2; b. the first promoter is a CMV promoter, a FGFR3 promoter, a LFNG promoter, or a SLC1A3 promoter; c. each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-194; d. the first inner ear cell type is a cochlear supporting cell; e. The nucleic acid vector of any one of E1 to E15, E26 to E29, and E35 to E107, wherein the second inner ear cell type is a cochlear hair cell.

[0456] E109. The nucleic acid vector of E108, wherein the first polynucleotide encodes Atoh1 and the second polynucleotide encodes Ikzf2. E110. The nucleic acid vector of E108, wherein the first polynucleotide encodes Atoh1, the second polynucleotide encodes Gfi1, and the third polynucleotide encodes Pou4f3.

[0457] E111. a. the first polynucleotide encodes GJB2; b. the first promoter is a GJB2 promoter, a CMV promoter, a FGFR3 promoter, a LFNG promoter, or a SLC1A3 promoter; c. each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124, or miR-194; d. the first inner ear cell type is a cochlear supporting cell; e. The nucleic acid vector of any one of E1-E15, E26-E29, and E35-E107, wherein the second inner ear cell type is a spiral ganglion neuron.

[0458] E112. a. the first polynucleotide encodes Atoh1 or dnSox2 or is capable of being transcribed to produce an inhibitory RNA that targets Sox2; b. the first promoter is a CMV promoter, a GFAP promoter, a SLC6A14 promoter, or a SLC1A3 promoter; c. each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-135b; d. the first inner ear cell type is a vestibular supporting cell; e. The nucleic acid vector of any one of E1 to E15, E26 to E29, and E35 to E107, wherein the second inner ear cell type is a vestibular hair cell.

[0459] E113. a. the first polynucleotide encodes Atoh1 or dnSox2 or is capable of being transcribed to produce an inhibitory RNA that targets Sox2; b. the first promoter is a CMV promoter, a GFAP promoter, a SLC6A14 promoter, or a SLC1A3 promoter; c. each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135; d. the first inner ear cell type is a vestibular supporting cell; e. The nucleic acid vector of any one of E1-E15, E26-E29, and E35-E107, wherein the second inner ear cell type is a vestibular ganglion neuron.

[0460] E114. a. the first polynucleotide encodes dnSox2 or is capable of being transcribed to produce an inhibitory RNA that targets Sox2; b. the first promoter is the MYO15 promoter; c. each miRNA target sequence transcribed from the polynucleotide operably linked to the first promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135; d. the first inner ear cell type is a type II hair cell; e. The nucleic acid vector of any one of E1-E15, E26-E29, and E35-E107, wherein the second inner ear cell type is a vestibular ganglion neuron.

[0461] E115. The nucleic acid vector of E114, wherein each miRNA target sequence present is independently targeted by one of miR-18a, miR-124a, miR-100, or miR-135.

[0462] E116. The method according to any one of E31, E108, and E112 to E114, wherein said inhibitory RNA targeting Sox2 is an siRNA. E117. The method according to any one of E31, E108, and E112 to E114, wherein said inhibitory RNA targeting Sox2 is an shRNA.

[0463] E118. The method of E116 or E117, wherein the siRNA or shRNA targeting Sox2 has a nucleic acid base sequence comprising a portion of at least 8 consecutive nucleic acid bases that has at least 80% complementarity to an equal length portion of the target region of the mRNA transcript of the human or mouse SOX2 gene.

[0464] E119. The method of E118, wherein said target region is an mRNA transcript of said human SOX2 gene. E120. The method of E118, wherein the target region is at least 8 to 21 contiguous nucleobases of any one of SEQ ID NOs: 52-70, at least 8 to 22 contiguous nucleobases of SEQ ID NO: 74 or SEQ ID NO: 75, or at least 8 to 19 contiguous nucleobases of any one of SEQ ID NOs: 71-73.

[0465] E121. The method of E118, wherein the siRNA or shRNA has a nucleobase sequence comprising a portion of at least 8 consecutive nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of any one of SEQ ID NOs: 52-75.

[0466] E122. The method of E121, wherein the siRNA or shRNA has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to any one of SEQ ID NO:58, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, and SEQ ID NO:75.

[0467] The method according to E117, wherein the shRNA comprises the sequence of nucleotides 2234 to 2296 of SEQ ID NO: 76 or nucleotides 2234 to 2296 of SEQ ID NO: 78. E124. The method of any one of E117 to E123, wherein said shRNA is embedded in a microRNA (miRNA) backbone.

[0468] E125. The method of E124, wherein said shRNA is embedded in a miR-30 or mir-E backbone. E126. The method according to E125, wherein said shRNA comprises the sequence of nucleotides 2109 to 2426 of SEQ ID NO: 76, nucleotides 2109 to 2408 of SEQ ID NO: 66, nucleotides 2109 to 2426 of SEQ ID NO: 78, or nucleotides 2109 to 2408 of SEQ ID NO: 79.

[0469] E127. The method of any one of E116 and E118 to E120, wherein the siRNA comprises a sense strand and an antisense strand selected from the following pairs: SEQ ID NO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, and SEQ ID NO:86 and SEQ ID NO:87.

[0470] E128. The method according to any one of E35, E108, and E112 to E115, wherein the polynucleotide encoding the dnSox2 protein has the sequence of SEQ ID NO: 50 or SEQ ID NO: 51.

[0471] E129. The method according to any one of E35, E108, and E112 to E115, wherein the dnSox2 protein is a Sox2 protein lacking most or all of the high mobility group domain (HMGD), a Sox2 protein in which the nuclear localization signal within the HMGD has been mutated, a Sox2 protein in which the HMGD has been fused to an engrailed repressor domain, or a C-terminally truncated Sox2 protein containing only the DNA-binding domain.

[0472] E130. The method of any one of claims E1-E129, wherein the nucleic acid vector is a plasmid, cosmid, artificial chromosome, or viral vector. E131. The method of E130, wherein said nucleic acid vector is a viral vector.

[0473] E132. The method of E131, wherein said viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus. E133. The method of E132, wherein said viral vector is an AAV vector.

[0474] The method of E133, wherein the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP.A, PHP.eb, or PHP.S capsid.

[0475] E135. A pharmaceutical composition comprising the nucleic acid vector according to any one of E1 to E134 and a pharma- ceutically acceptable carrier, excipient, or diluent. E136. A kit comprising the nucleic acid vector according to any one of E1 to E134, or the pharmaceutical composition according to E135.

[0476] E137. A method for expressing a polynucleotide in a first inner ear cell type but not a second inner ear cell type in a subject in need thereof, comprising locally administering to the middle or inner ear of said subject an effective amount of a vector described in any one of E1 to E134 or a pharmaceutical composition described in E135.

[0477] E138. A method for reducing off-target expression of a polynucleotide in the inner ear of a subject (e.g., reducing off-target expression in a specific inner ear cell type), comprising locally administering to the middle ear or inner ear of the subject an effective amount of a vector described in any one of E1 to E134 or a pharmaceutical composition described in E135.

[0478] E139. The method of E137 or E138, wherein said subject suffers from or is at risk of developing hearing loss, vestibular dysfunction, or tinnitus. E140. A method for treating a subject suffering from or at risk of developing hearing loss, vestibular dysfunction, or tinnitus, comprising administering to the subject an effective amount of a vector described in any one of E1 to E134 or a pharmaceutical composition described in E135.

[0479] E141. The method of E139 or E140, wherein said subject suffers from or is at risk of developing vestibular dysfunction. E142. The method of any one of E139-E141, wherein said vestibular dysfunction comprises vertigo, dizziness, imbalance, bilateral vestibular dysfunction, oscillopsia, or balance disorders.

[0480] E143. The method of any one of E139 to E142, wherein said vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction.

[0481] E144. The method of any one of E139 to E143, wherein said vestibular dysfunction is associated with a genetic mutation. E145. The method of E144, wherein said genetic mutation is a mutation in a gene listed in Table 4.

[0482] E146. The method of E139 or E140, wherein said vestibular dysfunction is idiopathic vestibular dysfunction. E147. The method of E139 or E140, wherein said subject suffers from or is at risk of developing hearing loss (e.g., sensorineural hearing loss, including auditory neuropathy and hearing impairment).

[0483] E148. The method of any one of E139, E140, and E147, wherein said hearing loss is hereditary hearing loss. E149. The method of E148, wherein said hereditary hearing loss is autosomal dominant hearing loss, autosomal recessive hearing loss, or X-linked hearing loss.

[0484] The method of E148 or E149, wherein said inherited hearing loss is a disease associated with a mutation in a gene listed in Table 4. E150. E151. The method of any one of E139, E140, and E147, wherein said hearing loss is acquired hearing loss.

[0485] E152. The method of E151, wherein said acquired hearing loss is noise-induced hearing loss, age-related hearing loss, disease- or infection-related hearing loss, head trauma-related hearing loss, or ototoxic drug-induced hearing loss. E153. The method of E143 or E152, wherein said ototoxic drug is an aminoglycoside, an antitumor drug, ethacrynic acid, furosemide, a salicylate, or quinine.

[0486] E154. The method of E139 or E140, wherein said hearing loss or vestibular dysfunction is, or is associated with, age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher Syndrome Type 1, Usher Syndrome Type 2, or bilateral vestibular dysfunction.

[0487] E155. The method of E154, wherein the hearing loss is or is associated with age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, or Usher syndrome type 2, and wherein the first polynucleotide encodes Atoh1.

[0488] E156. The method of E155, wherein said second polynucleotide encodes Ikzf2. E157. The method of E155, wherein said second polynucleotide encodes Pou4f3 and said third polynucleotide encodes Gfi1.

[0489] E158. The method of any one of E137 to E157, wherein the method further comprises administering to the subject one or more (e.g., 1, 2, 3, 4, 5, or more) additional nucleic acid vectors.

[0490] E159. The method of E155, further comprising administering to said subject a vector comprising a polynucleotide encoding Ikzf2. E160. The method of E155, further administering to said subject a vector comprising a polynucleotide encoding Pou4f3 and a vector comprising a polynucleotide encoding Gfi1.

[0491] E161. The method of E154, wherein said hearing loss or vestibular dysfunction is or is associated with DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher Syndrome Type 1, Usher Syndrome Type 2, or bilateral vestibular dysfunction, and said first polynucleotide encodes dnSox2.

[0492] E162. The method of E161, wherein said second polynucleotide encodes Atoh1. E163. The method of E161, further administering to the subject a vector comprising a polynucleotide encoding Atoh1.

[0493] E164. The method of any one of E158 to E160 and E163, wherein at least one of the one or more additional nucleic acid vectors comprises a promoter operably linked to a polynucleotide that can be transcribed to produce an expression product (e.g., Ikzf2, Pou4f3, Gfi1, or Atoh1), and a polynucleotide that can be transcribed to produce a miRNA target sequence.

[0494] E165. The method of any one of E158 to E160 and E163, wherein none of said additional nucleic acid vectors comprises a polynucleotide that can be transcribed to produce a miRNA target sequence.

[0495] E166. A method of treating a disease listed in Table 4 in a subject in need thereof, comprising locally administering to the middle or inner ear of said subject an effective amount of a vector described in any one of E1-E134 or a pharmaceutical composition described in E135, wherein said first polynucleotide is a wild type version of a gene associated with said disease listed in Table 4 that is mutated in said subject.

[0496] E167. The method of any one of E137 to E166, wherein said method further comprises assessing vestibular function of said subject prior to administering said nucleic acid vector or pharmaceutical composition.

[0497] E168. The method of any one of E137 to E167, wherein the method further comprises assessing vestibular function of the subject after administering the nucleic acid vector or pharmaceutical composition.

[0498] E169. The method of any one of E137 to E168, wherein the method further comprises assessing the subject's hearing prior to administering the nucleic acid vector or pharmaceutical composition. E170. The method of any one of E137 to E169, wherein the method further comprises assessing the hearing of the subject after administering the nucleic acid vector or pharmaceutical composition.

[0499] E171. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered to the inner ear. E172. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered to the middle ear.

[0500] E173. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered to the semicircular canal. E174. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered transtympanic or intratympanic.

[0501] E175. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered into the perilymph. E176. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered into the endolymph.

[0502] E177. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered to or through the oval window. E178. The method of any one of E137 to E170, wherein said nucleic acid vector or pharmaceutical composition is administered to or through the round window.

[0503] E179. The method of any one of E137-E178, wherein said nucleic acid vector or pharmaceutical composition is administered in an amount sufficient to prevent or reduce vestibular dysfunction, delay the onset of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, prevent or reduce hearing loss, prevent or reduce tinnitus, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing, increase the number of vestibular hair cells and / or cochlear hair cells, promote maturation of vestibular hair cells and / or cochlear hair cells, increase regeneration of vestibular hair cells and / or cochlear hair cells, treat bilateral vestibular dysfunction, treat oscillopia, treat balance disorders, improve function of one or more inner ear cell types, improve survival of inner ear cells, increase proliferation of inner ear cells, increase production of type I vestibular hair cells, or increase the number of type I vestibular hair cells.

[0504] E180. An inner ear cell comprising the vector according to any one of E1 to E134, or the pharmaceutical composition according to E135. E181. The inner ear cell of E180, wherein said inner ear cell is a cochlear supporting cell.

[0505] E182. The inner ear cell of E180, wherein said inner ear cell is a vestibular supporting cell. E183. The inner ear cell of E180, wherein said inner ear cell is a cochlear hair cell. E184. The inner ear cell of E180, wherein said inner ear cell is a vestibular hair cell.

[0506] E185. The inner ear cell of E180, wherein said inner ear cell is a vestibular type I hair cell. E186. The inner ear cell of E180, wherein said inner ear cell is a vestibular type II hair cell. E187. The inner ear cell of E180, wherein said inner ear cell is a spiral ganglion neuron.

[0507] E188. The inner ear cell of E180, wherein said inner ear cell is a vestibular ganglion neuron. E189. The inner ear cell of any one of E180 to E188, wherein said inner ear cell is a human inner ear cell.

[0508] E190. The method of any one of E137 to E179, wherein the subject is a human. Other embodiments Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. Other embodiments are within the scope of the claims.

Claims

1. i. A first polynucleotide capable of being transcribed to produce an expression product; and ii. A vector comprising a promoter operably linked to at least one polynucleotide capable of being transcribed to produce a microRNA (miRNA) target sequence, wherein the first polynucleotide is suitable for expression in a first inner ear cell type but not suitable for expression in a different second inner ear cell type, and the miRNA target sequence is recognized by an miRNA that is expressed in the second inner ear cell type but not in the first inner ear cell type, said vector.

2. (i) Whether the expression product transcribed from the first polynucleotide promotes the conversion from the first inner ear cell type to the second inner ear cell type, (ii) Whether the first polynucleotide is expressed in the first inner ear cell type but not in the second inner ear cell type, (iii) Whether the vector comprises at least two polynucleotides capable of being transcribed to produce miRNA target sequences, (iv) Whether the vector comprises at least two copies of a polynucleotide capable of being transcribed to produce the same miRNA target sequence, (v) Whether each polynucleotide capable of being transcribed to produce an miRNA target sequence operably linked to the promoter is the same, (vi) Whether each polynucleotide capable of being transcribed to produce an miRNA target sequence is located 3' to the first polynucleotide, or (vii) Whether each miRNA target sequence transcribed from a polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-100, miR-124a, miR-140, miR-194, miR-135, or miR-135b, the vector according to Claim 1.

3. (i) Whether the vector comprises a polynucleotide capable of being transcribed to produce a first miRNA target sequence and a polynucleotide capable of being transcribed to produce a second miRNA target sequence, and each miRNA target sequence is recognized by a different miRNA, (ii) Whether the vector comprises at least three copies of the polynucleotide capable of being transcribed to produce the same miRNA target sequence, or (iii) The vector further includes a WPRE sequence located 3' to the first polynucleotide, and each polynucleotide capable of being transcribed to produce an miRNA target sequence is located between the first polynucleotide and the WPRE sequence. The vector according to claim 2.

4. The vector according to claim 3, further including a polynucleotide capable of being transcribed to produce a third miRNA target sequence, wherein each of the first, second, and third miRNA target sequences is recognized by a different miRNA.

5. (i) The first inner ear cell type is a cochlear supporting cell, and the second inner ear cell type is at least one of a cochlear hair cell or a spiral ganglion neuron, or (ii) The first inner ear cell type is a vestibular supporting cell, and the second inner ear cell type is at least one of a vestibular hair cell or a vestibular ganglion neuron, or (iii) The first inner ear cell type is a vestibular type II hair cell, and the second inner ear cell type is a vestibular type I hair cell, or (iv) The first inner ear cell type is a vestibular type II hair cell, and the second inner ear cell type is a vestibular ganglion neuron, or (v) The polynucleotide encodes Atonal BHLH transcription factor 1 (Atoh1), growth factor independence 1 transcriptional repressor (Gfi1), POU class 4 homeobox 3 (Pou4f3), IKAROS family zinc finger 2 (Ikzf2), dominant negative Sox2 (dnSox2), or gap junction protein beta 2 (Gjb2), or (vi) The promoter is a supporting cell-specific promoter, a hair cell-specific promoter, or a ubiquitous promoter, or (vii) The promoter is a cytomegalovirus (CMV) promoter, a myosin 15 (MYO15) promoter, an Lfng O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (Lfng) promoter, a fibroblast growth factor receptor 3 (FGFR3) promoter, a solute carrier family 1 member 3 (Slc1A3) promoter, a glial fibrillary acidic protein (GFAP) promoter, or a solute carrier family 6 member 14 (Slc6A14) promoter. The vector according to any one of claims 1 to 4. **Claim 6** (i) the second inner ear cell type is a cochlear hair cell, or (ii) the second inner ear cell type is a vestibular hair cell, the vector according to claim 5. **Claim 7** The vector according to claim 6, wherein the second inner ear cell type is a type I vestibular hair cell. **Claim 8** The vector according to any one of claims 1 to 4, further comprising a second polynucleotide capable of being transcribed to produce an expression product, wherein the second polynucleotide is different from the first polynucleotide. **Claim 9** (i) the second polynucleotide is operably linked to the promoter, the second polynucleotide is located 3' of the first polynucleotide, and at least one polynucleotide capable of being transcribed to produce an miRNA target sequence is located 3' of the second polynucleotide, and the second polynucleotide is suitable for expression in the first inner ear cell type but not suitable for expression in the second inner ear cell type, or (ii) the vector further comprises a third polynucleotide capable of being transcribed to produce an expression product, wherein the third polynucleotide is different from the first polynucleotide and the second polynucleotide, the vector according to claim 8. **Claim 10** The vector according to claim 9, wherein the third polynucleotide is operably linked to the promoter, the third polynucleotide is located 3' of the second polynucleotide, and at least one polynucleotide capable of being transcribed to produce an miRNA target sequence is located 3' of the third polynucleotide, and the third polynucleotide is suitable for expression in the first inner ear cell type but not suitable for expression in the second inner ear cell type. **Claim 11** a. the first polynucleotide encodes Atoh1, Gfi1, Pou4f3, Ikzf2, dnSox2, or Gjb2, b. the promoter is a CMV promoter, an FGFR3 promoter, an LFNG promoter, or an SLC1A3 promoter, c. each miRNA target sequence transcribed from a polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-194 d. the first inner ear cell type is a cochlear supporting cell, e. the second inner ear cell type is a cochlear hair cell, the vector according to any one of claims 1 to 4. **Claim 12** (i) the first polynucleotide encodes Atoh1 and the second polynucleotide encodes Ikzf2, or (ii) the first polynucleotide encodes Atoh1, the second polynucleotide encodes Gfi1, and the third polynucleotide encodes Pou4f3, the vector according to claim 11. **Claim 13** a. the first polynucleotide encodes GJB2, b. the promoter is a GJB2 promoter, a CMV promoter, an FGFR3 promoter, an LFNG promoter, or an SLC1A3 promoter, c. each miRNA target sequence transcribed from the polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124, or miR-194, d. the first inner ear cell type is a cochlear supporting cell, e. the second inner ear cell type is a spiral ganglion neuron, the vector according to any one of claims 1 to 4. **Claim 14** a. the first polynucleotide encodes Atoh1 or dnSox2, b. the promoter is a CMV promoter, a GFAP promoter, an SLC6A14 promoter or an SLC1A3 promoter, c. each miRNA target sequence transcribed from the polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-140, or miR-135b, d. the first inner ear cell type is a vestibular supporting cell, e. the second inner ear cell type is a vestibular hair cell, the vector according to any one of claims 1 to 4. **Claim 15** a. the first polynucleotide encodes Atoh1 or dnSox2, b. the promoter is a CMV promoter, a GFAP promoter, an SLC6A14 promoter or an SLC1A3 promoter, c. Each miRNA target sequence transcribed from a polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135, d. The first inner ear cell type is a vestibular supporting cell, e. The second inner ear cell type is a vestibular ganglion neuron, The vector according to any one of claims 1 to 4.

16. a. The first polynucleotide encodes dnSox2, b. The promoter is the MYO15 promoter, c. Each miRNA target sequence transcribed from a polynucleotide operably linked to the promoter is independently targeted by one of miR-183, miR-96, miR-182, miR-18a, miR-124a, miR-100, or miR-135, d. The first inner ear cell type is a vestibular type II hair cell, e. The second inner ear cell type is a vestibular ganglion neuron, The vector according to any one of claims 1 to 4.

17. The vector according to claim 16, wherein each miRNA target sequence is independently targeted by one of miR-18a, miR-124a, miR-100, or miR-135.

18. The vector according to any one of claims 1 to 4, wherein the vector is an AAV vector.

19. A pharmaceutical composition comprising the vector according to any one of claims 1 to 4 and a pharmaceutically acceptable carrier, excipient, or diluent.

20. A composition comprising the vector according to any one of claims 1 to 4 for use in a method of expressing the polynucleotide in a first inner ear cell type rather than a second inner ear cell type in a subject in need of the polynucleotide.

21. A composition comprising the vector according to any one of claims 1 to 4 for use in a method of reducing off-target expression of a polynucleotide in the inner ear of a subject.

22. A composition comprising the vector according to any one of claims 1 to 4 for use in a method of treating a subject suffering from or at risk of developing hearing loss, vestibular dysfunction, or tinnitus.

23. (i) whether the vestibular dysfunction includes rotatory vertigo, floating vertigo, disequilibrium, bilateral vestibular dysfunction, oscillopsia, or balance disorder, (ii) whether the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction, (iii) whether the vestibular dysfunction is idiopathic vestibular dysfunction, (iv) whether the vestibular dysfunction is related to gene mutation, (v) whether the hearing loss is hereditary hearing loss, (vi) whether the hearing loss is acquired hearing loss, (vii) whether the hearing loss or vestibular dysfunction is related to age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, Usher syndrome type 2, or bilateral vestibular dysfunction, the composition according to claim 22.

24. (i) whether the gene mutation is a mutation in the genes listed in Table 4, (ii) whether the hereditary hearing loss is autosomal dominant hearing loss, autosomal recessive hearing loss, or X-linked hearing loss, (iii) whether the hereditary hearing loss is a disease related to mutations in the genes listed in Table 4, (iv) whether the acquired hearing loss is noise-induced hearing loss, age-related hearing loss, disease or infection-related hearing loss, head trauma-related hearing loss, or ototoxic drug-induced hearing loss, (v) whether the ototoxic drug is an aminoglycoside, an antitumor drug, ethacrynic acid, furosemide, salicylate, or quinine, (vi) whether the hearing loss is related to age-related hearing loss, noise-induced hearing loss, DFNB61, DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, and the first polynucleotide encodes Atoh1, or (vii) whether the hearing loss or vestibular dysfunction is related to DFNB1, DFNB7 / 11, DFNA2, DFNB77, DFNB28, DFNA41, DFNB8, DFNB37, DFNA22, DFNB3, Usher syndrome type 1, Usher syndrome type 2, or bilateral vestibular dysfunction, and the first polynucleotide encodes dnSox2, the composition according to claim 23. Claim 25. (i) Whether the second polynucleotide encodes Ikzf2, (ii) Whether the second polynucleotide encodes Pou4f3 and the third polynucleotide encodes Gfi1, (iii) Whether the composition further comprises a vector comprising a polynucleotide encoding Ikzf2, (iv) Whether the composition further comprises a vector comprising a polynucleotide encoding Pou4f3 and a vector comprising a polynucleotide encoding Gfi1, (v) Whether the second polynucleotide encodes Atoh1, or (vi) The composition according to claim 24, wherein the composition further comprises a vector comprising a polynucleotide encoding Atoh1.