Novel compounds for the treatment and prevention of neurological complications of viral infections - Patents.com

Abstract

The present invention relates to a compound of formula (I): [Formula 1] TIFF2024523429000006.tif45159 The present invention relates to a compound of formula (I), a metabolite of the compound of formula (I), a pharmaceutical composition comprising the compound of formula (I) or a metabolite thereof, and / or a pharmaceutical composition comprising Ophioglossum. The compound, metabolite, pharmaceutical composition and Ophioglossum are particularly useful for treating, preventing and / or alleviating symptoms of neurological complication(s) of viral infection disease caused by SARS-CoV-2.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to a compound of formula (I): [ka] The present invention relates to a compound of formula (I), a metabolite of the compound of formula (I), a pharmaceutical composition comprising the compound of formula (I) or a metabolite thereof, and / or Ophioglossum origanum. The compound, metabolite, pharmaceutical composition and Ophioglossum origanum are particularly useful for treating, preventing and / or alleviating symptoms of neurological complication(s) of viral infection disease caused by SARS-CoV-2. [Background technology]

[0002] 2. Background of the Invention The development of neurological disorders is associated with viral infections, which may cause neurological symptoms or result in immune responses that induce these pathological manifestations. Currently, this relationship is based mainly on epidemiological data on infection and seroprevalence in patients with neurological disorders. Neurological symptoms, including seizures, status epilepticus, encephalitis, severe neuromyopathy, acute disseminated encephalomyelitis, acute necrotizing encephalitis, Guillain-Barre syndrome, transverse myelitis, and acute flaccid myelitis, are all associated with severe viral respiratory infections.

[0003] Of particular interest is the viral infectious disease caused by the SARS-CoV-2 virus, which has caused a global medical emergency that is claiming a substantial number of lives every day. Although the main complication of coronavirus disease 2019 (COVID-19) caused by the SARS-CoV-2 virus is respiratory failure, a significant number of patients have been reported with neurological symptoms affecting both the peripheral and central nervous systems. Neurological symptoms including headache, anosmia, anageusia, confusion, seizures, and encephalopathy have been frequently reported in COVID-19 patients, and SARS-CoV-2 RNA has been detected in brain biopsies in more than 30% of fatal COVID-19 cases. It is assumed that SARS-CoV-2 infection, in the long term, accelerates the aging phenotype of various tissues, including the brain of survivors. It is assumed that the chronic and long-term effects of SARS-CoV-2 infection in the CNS need to be closely monitored even after the pandemic has ended. It is noteworthy that besides SARS-CoV-2, several other viruses are associated with major brain disorders such as Alzheimer's disease, Parkinson's disease, and multiple sclerosis.

[0004] To date, there are no known therapies to treat, prevent and / or alleviate the symptoms of the viral infection disease, particularly the neurological complication(s) caused by the viral infection disease SARS-CoV-2. Summary of the Invention

[0005] The objective technical problem of the present invention was to provide novel compounds for use in the treatment of neurological complication(s) of a viral infectious disease, in particular a viral infectious disease caused by SARS-CoV-2.

[0006] The objective technical problem is solved by the embodiments presented herein and characterized in the claims.

[0007] The inventors have surprisingly found that in a mouse model of coronavirus infection, treatment with the compound of formula (I) results in improved clinical scores and reduced weight loss in animals compared to treatment with vehicle (see Example 1 and Figure 1 for details). The compound of formula (I) further shows a surprising ability to rescue the loss of neuronal cells induced by N-nitroso-N-methyl-urea in a mouse model (Example 2, Figure 2). The inventors have further associated treatment with the compound of formula (I) with induction of increased expression of neuroglobin in neuronal cells, which appears to be an unexpected result (Example 4, Figure 4). Notably, this unexpected observation allows the use of the compound of formula (I) to modulate the expression of neuroglobin in neuronal cells of a subject to treat, prevent and / or alleviate the symptoms of neurological complication(s) of viral infection disease, as encompassed by the present invention.

[0008] The present invention is summarized in the following embodiments.

[0009] In a first embodiment, the present invention relates to a compound of formula (I) for use in the treatment, prevention and / or alleviation of symptoms of a neurological complication(s) of a viral infectious disease. [ka] (In the formula, R 1 , R 2 and R 3 is H or -C(O)-C 14 -alkyl, where R 1 , R 2 and R 3 At least one of the following is -C(O)-C 14 -alkyl) The present invention relates to a compound of the formula:

[0010] In certain embodiments, the present invention provides a method for the preparation of a compound comprising the steps of: 1 , R 2 or R 3 -C(O)-C 14 -alkyl.

[0011] In a further specific embodiment, the present invention provides a compound comprising R 1 , R 2 and R 3 Any two of -C(O)-C 14 -alkyl.

[0012] In yet a further specific embodiment, the present invention provides a compound comprising R 1 , R 2 and R 3 -C(O)-C 14 -alkyl.

[0013] In again a further specific embodiment, the invention relates to a compound for use of formula (I) which is tripentadecanoin.

[0014] In a further embodiment, the present invention provides a metabolite of a compound of formula (I) comprising HO-C(O)-C 14 -alkyl or a pharma- ceutically acceptable salt thereof.

[0015] In yet a further embodiment, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or a metabolite of a compound of formula (I) and a pharma- ceutically acceptable carrier for use in the treatment, prevention and / or alleviation of a neurological complication(s) of a viral infectious disease.

[0016] In yet a further embodiment, the present invention relates to Ophiopogon for use in the treatment, prevention and / or alleviation of symptoms of neurological complication(s) of a viral infectious disease.

[0017] In certain embodiments, the invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein the viral infection disease is caused by SARS-CoV-2, SARS-CoV-1, MERS, influenza virus, human immunodeficiency virus (HIV), varicella-zoster virus (VZV), herpes simplex virus (HSV), poliovirus, Epstein-Barr virus (EBV), cytomegalovirus (CMV), Japanese encephalitis virus, Venezuelan equine encephalitis virus, California encephalitis virus, or Zika virus.

[0018] In further specific embodiments, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein the viral infection disease is caused by SARS-CoV-2, SARS-CoV-1, or MERS.

[0019] In again a further specific embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the viral infectious disease is caused by SARS-CoV-2.

[0020] In again a further specific embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the neurological complication of the viral infection disease is damage to the central nervous system, in particular the brainstem.

[0021] In again a further particular embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the symptom of damage to the central nervous system, in particular the brainstem, is difficulty in breathing and / or heart rhythm disorders.

[0022] In again a further specific embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the neurological complication(s) of the viral infection disease comprises damage to the peripheral nervous system.

[0023] In again a further specific embodiment, the invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein the symptom of damage to the peripheral nervous system is muscle weakness, loss of taste and / or smell, pain in the extremities, and / or fatigue.

[0024] In again a further particular embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the symptom of the neurological complication(s) of the viral infectious disease is headache and / or seizures.

[0025] In again a further particular embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein preventing the neurological complication(s) of a viral infection disease is preventing the onset of a neurodegenerative disease, such as Alzheimer's disease or Parkinson's disease.

[0026] In again a further specific embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein preventing the neurological complication(s) of a viral infectious disease will prevent cardiopulmonary failure.

[0027] In again further specific embodiments, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention, wherein the neurological complication(s) of the viral infection disease comprises perivascular encephalitis, interstitial encephalitis, neuronal cell loss, and / or axonal degeneration.

[0028] In a further particular embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, which upregulates expression of neuroglobin, preferably in neuronal cells, when the compound of formula (I) is administered to a subject.

[0029] In again a further specific embodiment, the present invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein upregulated expression of neuroglobin inhibits apoptosis of neuronal cells.

[0030] In again a further specific embodiment, the invention relates to a compound for use according to the invention, a metabolite for use according to the invention, a pharmaceutical composition for use according to the invention or an Ophiopogon for use according to the invention, wherein the compound of formula (I) is to be administered in a dosage of between 1 mg / day and 1000 mg / day. [Brief description of the drawings]

[0031] [Figure 1] FIG. 1: A, B: Comparison of clinical scores between vehicle and compound of formula (I) (herein, tripentadecanoin) treatment in a mouse coronavirus infection model; C, D: Comparison of weight loss between vehicle and compound of formula (I) (herein, tripentadecanoin) treatment in a mouse coronavirus infection model. [Diagram 2]FIG. 2: Tripentadecanoin, a representative compound of formula (I), exhibits neuroprotective effects in a mouse model of N-nitroso-N-methylurea photoreceptor degeneration. [Diagram 3] Figure 3: A. Representative images of young or old cells, untreated or treated with herb B-Ophioglossum thermale (10 μg / ml) or SBC003-tripentadecanoin (30 μM). Top panels show cells stained with fluorescent whitener 28 to reveal bud scars. Bottom panels show Hsp104-GFP signal. Arrows point to protein deposition due to senescence. B. Percentage of cells with Hsp104-GFP foci. Mean ± SD. p-values ​​are corrected p-values ​​from ANOVA comparing with vehicle only. C. Mean fluorescence intensity of cytoplasmic Hsp104-GFP. Mean ± SD. p-values ​​are corrected p-values ​​obtained from ANOVA comparing with vehicle only. D. Fluorescence intensity of Hsp104-GFP foci is comparable in all conditions. Mean ± SD. [Figure 4] Figure 4: A: Yeast genes whose expression was upregulated upon treatment with a compound of formula (I) (herein, tripentadecanoin) compared to vehicle; B: Images of old cells untreated or treated with tripentadecanoin. Bud scars stained with FB28 (top panel). HSP104-GFP fluorescent signal (bottom panel). Arrows point to protein deposits induced by senescence. B. Percentage of cells with Hsp104-GFP foci. Mean ± SD. p values ​​are corrected p values ​​from ANOVA comparing wild type control (black stars) or wild type treated with tripentadecanoin (light grey star). **<0.01; ****<0.0001; ns=not significantly different. [Diagram 5] FIG. 5: Effect of treatment with a compound of formula (I) (herein, tripentadecanoin) on the expression of neuroglobin in mouse primary cortical neurons. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Detailed Description of the Invention Compounds for use in the present invention are described below, with it being understood that all possible combinations of the following definitions are also envisaged.

[0033] In one embodiment, the present invention relates to a compound of formula (I) for use in the treatment, prevention and / or alleviation of symptoms of a neurological complication(s) of a viral infectious disease. [ka] R 1 , R 2 and R 3 is H or -C(O)-C 14 -alkyl, where R 1 , R 2 and R 3 At least one of the following is -C(O)-C 14 -alkyl.

[0034] In one embodiment, R 1 , R 2 or R 3 -C(O)-C 14 -alkyl. In other words, R 1 , R 2 and R 3 One of them is -C(O)-C 14 -alkyl, R 1 , R 2 and R 3 The remaining two are H.

[0035] In a further embodiment, R 1 , R 2 and R 3 Any two of the following are -C(O)-C 14 -alkyl. It can further be R 1 , R 2 and R 3 This means that one of the residues is H.

[0036] Preferably, R 1 , R 2 and R 3 -C(O)-C 14 More preferably, the compound of formula (I) is tripentadecanoin, which, as understood herein, is R 1 , R 2 and R 3 is -C(O)-tetradecan-1-yl.

[0037] R 1 , R 2 and R 3 Compounds of formula (I) in which at least one of R 1 , R 2 and R 3 -C(O)-C 14 As one of skill in the art will appreciate, upon administration to a subject, preferably a human subject, the ester bond in the glyceride portion of the compound of formula (I) may be hydrolyzed, for example, in an enzyme-catalyzed reaction, to produce another glyceride encompassed by formula (I), or glycerol, and an ester of the formula HO-C(O)-C 14 -alkyl to produce a carboxylic acid (or a salt thereof, particularly a pharma- ceutically acceptable salt thereof), which may also be referred to as a metabolite of the compound of formula (I).

[0038] Thus, in a further embodiment, the present invention relates to a metabolite of the compound of formula (I) for use in the treatment, prevention and / or alleviation of the symptoms of neurological complication(s) of a viral infectious disease. Preferably, the metabolite of the compound of formula (I) is HO-C(O)-C 14 In certain embodiments where the compound of formula (I) is tripentadecanoin, the metabolite HO-C(O)-C 14 -alkyl or a pharma- ceutically acceptable salt thereof is n-pentadecanoic acid or a pharma- ceutically acceptable salt thereof.

[0039] The compounds of the invention and / or metabolites of the compounds of the invention can be administered to a patient in the form of a pharmaceutical composition, which may optionally contain one or more pharma- ceutically acceptable excipient(s) and / or carrier(s).Thus, the present invention relates to a pharmaceutical composition comprising a compound of the invention or a metabolite of a compound of the invention and a pharma- ceutically acceptable carrier for use in treating, preventing and / or alleviating the symptoms of neurological complication(s) of a viral infectious disease.

[0040] Depending on the route of administration, the compound of the present invention or the metabolite of the present invention can be provided in various pharmaceutical formulations. Some of the pharmaceutical formulations may require a protective coating on the formulation, for example, to prevent the degradation of the compound of the present invention or the metabolite of the present invention in the digestive tract. The compound of the present invention (or the metabolite of the present invention) can be formulated as a syrup, infusion, injection, spray, tablet, capsule, caplet, lozenge, liposome, suppository, cataplasm, bandage, sustained release capsule, powder, or sustained release formulation.

[0041] The compound of the present invention or the metabolite of the compound of the present invention is preferably administered orally. Therefore, the pharmaceutical form particularly preferred for the administration of the compound of the present invention or the metabolite is a form suitable for oral administration. Preparations for oral administration are usually provided in dosage units and may contain conventional excipients such as binders, fillers, diluents, tableting, lubricants, surfactants, disintegrants, colorants, flavorings and wetting agents. Tablets may be coated according to methods well known in the art. Suitable fillers include or are preferably cellulose, mannitol, lactose and similar agents. Suitable disintegrants include or are preferably starch, polyvinylpyrrolidone and starch derivatives such as sodium starch glycolate. Suitable lubricants include or are preferably magnesium stearate, for example. Suitable wetting agents include or are preferably sodium lauryl sulfate. These solid oral compositions can be prepared by conventional mixing, filling or tableting methods. The mixing operation can be repeated to disperse the active agent in a composition containing a large amount of filler. These procedures are known to those skilled in the art.

[0042] According to the present disclosure, pharmaceutical compositions comprising a compound of the invention or a metabolite of a compound of the invention as a liquid composition for oral administration can be provided in the form of, for example, an aqueous solution, emulsion, syrup or elixir, or in the form of a dry product to be reconstituted with water or a suitable liquid carrier at the time of use. Liquid compositions can contain conventional additives such as suspending agents, for example, sorbitol, syrup, methylcellulose, gelatin, hydroxyethylcellulose, carboxymethylcellulose, aluminum stearate gel or edible hydrogenated fats and oils; emulsifying agents, for example, lecithin, sorbitan monooleate, or acacia; non-aqueous carriers (which may include edible oils), for example, almond oil, fractionated coconut oil, oily esters, for example, glycerol esters, propylene glycol or ethyl alcohol; preservatives, for example, methyl or propyl p-hydroxybenzoate or sorbic acid; penetration enhancers, for example, dimethyl sulfoxide (DMSO); pH buffer systems, for example, phosphate buffers, carbonate buffers, citrate buffers, citrate-phosphate buffers and other pharma- ceutically acceptable buffer systems; solubilizing agents, for example, beta-cyclodextrin, and, if desired, conventional flavors or colorants.

[0043] The oral formulation may optionally further comprise a taste-masking component to optimize the taste of the oral formulation. Examples of such taste-masking components may be citrus, liquorice, mint, grape, blackcurrant or eucalyptus based flavors that are well known to those skilled in the art.

[0044] Further preferred administration forms of the compounds of the present invention or metabolites of the compounds of the present invention include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the final solution or dispersion form must be sterile and fluid. Sterilization of infusion or injection solutions can be achieved by any number of techniques recognized in the art, including, but not limited to, the addition of preservatives such as antibacterial or antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid or thimersal. In addition, isotonic agents such as sugars or salts, especially sodium chloride, may be incorporated into infusion or injection solutions.

[0045] Typically, such a solution or dispersion comprises a solvent or dispersion medium, such as water-buffered aqueous solution, such as a biocompatible buffer solution (e.g., citrate buffer), ethanol, polyol, such as glycerol, propylene glycol, polyethylene glycol, suitable mixtures thereof, surfactants, or vegetable oils.The compounds of the present invention can also be formulated into liposomes, particularly for parenteral administration.Liposomes offer the advantage of extended half-life in circulation and sustained, more extensive release of encapsulated drugs, compared to free drugs.

[0046] The preparation of a sterile injection solution containing one or several of the compounds of the present invention can be achieved by incorporating each compound in the required amount in a suitable solvent with various ingredients listed above, followed by sterilization as required. To obtain a sterile powder, the above solution can be vacuum dried or freeze-dried as required. The preferred diluent of the present invention is water, a physiologically acceptable buffer solution, a physiologically acceptable buffered salt solution or a salt solution. The preferred carrier is cocoa butter and vitebesole.

[0047] Further excipients that can be used with the various pharmaceutical forms of the compounds of the present invention include those listed below in a non-limiting manner: a) binders, such as lactose, mannitol, crystalline sorbitol, dibasic phosphates, calcium phosphate, sugars, crystalline cellulose, carboxymethylcellulose, hydroxyethylcellulose, polyvinylpyrrolidone, etc.; b) lubricants, such as magnesium stearate, talc, calcium stearate, zinc stearate, stearic acid, hydrogenated vegetable oils, leucine, glycerides and sodium stearyl fumarate; c) disintegrants, such as starches, croscarmellose, sodium methylcellulose, agar, bentonite, alginic acid, carboxymethylcellulose, polyvinylpyrrolidone, etc. You can choose from.

[0048] Other suitable excipients can be found in the Handbook of Pharmaceutical Excipients published by the American Pharmaceutical Association, which is incorporated herein by reference.

[0049] A further embodiment of the present invention relates to a compound for use according to the present invention or a metabolite of a compound for use according to the present invention, wherein the treatment dosage is 1 mg / day to 1000 mg / day. In a further embodiment, the treatment dosage is 1 mg / day to 1000 mg / day. The lower limit is, for example, 1 mg / day, 5 mg / day, 10 mg / day, 20 mg / day, 25 mg / day or 50 mg / day. The upper limit is, for example, 1000 mg / day, 900 20 mg / day, 800 mg / day, 750 mg / day, 700 mg / day, 600 mg / day, 500 mg / day, 250 mg / day, 200 mg / day. It is understood that each upper limit can be combined with each lower limit. In a preferred embodiment, the dosage is 10 mg / day to 200 mg / day.

[0050] In a further embodiment, the present invention relates to a pharmaceutical composition for use according to the present invention, in which the compound of formula (I) or the metabolite of the compound of formula (I) is to be administered in an amount of 1 mg / day to 1000 mg / day. The lower limit is, for example, 1 mg / day, 5 mg / day, 10 mg / day, 20 mg / day, 25 mg / day or 50 mg / day. The upper limit is, for example, 1000 mg / day, 900 mg / day, 800 mg / day, 750 mg / day, 700 mg / day, 600 mg / day, 500 mg / day, 250 mg / day, 200 mg / day. It is understood that each upper limit can be combined with each lower limit. In a preferred embodiment, the dosage is 10 mg / day to 200 mg / day.

[0051] As understood herein, the compounds for use according to the invention, metabolites of compounds of formula (I) for use according to the invention, or pharmaceutical compositions for use according to the invention may be prepared in any form such as oral dosage forms (powders, tablets, capsules, soft capsules, aqueous formulations, syrups, elixirs, pills, powders, sachets, granules), or topical preparations (creams, ointments, lotions, gels, balms, patches, pastes, spray solutions, aerosols, etc.), or injectable preparations (solutions, suspensions, emulsions).

[0052] It should be noted that the compounds of formula (I), particularly tripentadecanoin, can be obtained from herbs or human / animal milk. The compounds of the present invention can be obtained from plants of the genus Ophioglossum. Thus, in a further embodiment, the present invention relates to Ophioglossum for use in treating, preventing and / or alleviating the symptoms of neurological complication(s) of viral infectious diseases.

[0053] Last but not least, it's a snowflake's snowflake Refer to the genus Ophioglossum L.、Ophioglossum thermal Com.、Ophioglossum thermal Komarov、Ophioglossum austro-asiaticum Nishida、Ophioglossum austroasiaticum Nish.、Ophioglossum petiolatum L.、Ophioglossum pendulum L.、Ophioderma pendula(L.)Presl.、Ophioglossum reticulatum L.、Ophioglossum vulgatum L.、Ophioglossum pedunculosum Desv.、Ophioglossum parvifolium Grev.and HK.、Ophioglossum petiolatum Hook.、Ophioglossum petiolatum Hooker tenerum Ophioglossum pycnostichum(Fern.) A.&D. Love、Ophioglossum pycnostichum(Fernald) A.Love & D.Love;O.vulgatum var.pycnostichum Fernald、Ophioglossum crotalophoroides Walt.、Ophioglossum crotalophoroides Walter var.crotalophoroids、Ophioglossum crotalophoroides Walter var.nanum Osten ex JSLicht.、Ophioglossum azoricum、Ophioglossum azoricum C.Presl、Ophioglossum vulgatum Linnaeus var.pseudopodum(SFBlake)Farwell、Ophioglossum dendroneuron EPSt.John;O.ellipticum Hooker&Greville;O.mononeuronE.P.St.John, Ophioglossum dendroneuron EPSt.John, Ophioglossum Linnaeus, Ophioglossum palmatum L., 5 Ophioglossum mononeuron EPSt.John, Ophioglossum austroasiaticum, Ophioglossum bergianum, Ophioglossum bucharicum, Ophioglossum californicum, Ophioglossum caroticaule, Ophioglossum convexum, Ophioglossum californicum Prantl, Ophioglossum concinnum, Ophioglossum concinnum Brack., Ophioglossum costatum, Ophioglossum costatum R.Br., Ophioglossum coriaceum, Ophioglossum decipiens, Ophioglossum dietrichiae, Ophioglossum dudadae, Ophioglossum engelmannii, Ophioglossum engelmannii Prantl, Ophioglossum ellipticum Hook.&Grev., Ophioglossum fernandezianum, Ophioglossum gomezianum, Ophioglossum gracile, Ophioglossum gramineum Willd., Ophioglossum gramineum, Ophioglossum harrisii, Ophioglossum intermedium, Ophioglossum kawamurae, Ophioglossum lancifolium, Ophioglossum latifolium, Ophioglossum litorale, Ophioglossum loureirianum, Ophioglossum lusitanicum L., Ophioglossum lusitanicum L.ssp. Californicum (Prantl)RTClausen, Ophioglossum Lusitanicum L.var.californicum (Prantl) Broun, Ophioglossum moultoni, Ophioglossum namegatae, Ophioglossum nudicaule, Ophioglossum nudicaule Lf, Ophioglossum nudicaule Lfvar.minus RTClausen, Ophioglossum nudicaule Lfvar.tenerum (Mett.ex Prantl)RTClausen, Ophioglossum oblongum, Ophioglossum obovatum, Ophioglossum opacum, Ophioglossum ovatum, Ophioglossum parvifolium, Ophioglossum parvum, Ophioglossum pendulum, Ophioglossum pendulum L.ssp.falcatum (C.Presl)RTClausen, Ophioglossum pendulum L.ssp.Pendulum, Ophioglossum petiolatum, Ophioglossum polyphyllum, Ophioglossum polyphyllum A.Braun, Ophioglossum polyphyllum A.Braun ex Schub., Ophioglossum pumilio, Ophioglossum pusillum, Ophioglossum pusillum Raf., Ophioglossum raciborskii, Ophioglossum ramosii, Ophioglossum reticulatum, Ophioglossum rubellum, Ophioglossum savatieri, Ophioglossum scariosum, Ophioglossum schmidii, Ophioglossum simplex, Ophioglossum thermal, Ophioglossum thomasii, Ophioglossum timorense, Ophioglossum tenerum Mett.ex Prantl、Ophioglossum usterianum、Ophioglossum vulgatum、Ophioglossum vulgatum.auct.non L.、Ophioglossum vulgatum L.var.alaskanum(EGBritton)C.Chr.、Ophioglossum vulgatum L.var.pseudopodum(SFBlake)Farw.、Ophioglossum vulgatum L.var.pycnostichum Fernald、Ophioglossaceae Martinov、Cheiroglossa palmata(L.)C.Presl、Ophioglossum eliminatum Khand.&Goswami、Ophioglossum namegatae Nish.&Kurita、Ophioglossum nipponicum Miyabe &Kudo is a species of Ophioglossum oleosum Khand.

[0054] Preferred honeycombs are Ophioglossum thermale, Ophioglossum petiolatum, Ophioglossum reticulatum, Ophioglossum parvifolium, Ophioglossum vulgatum, Ophioglossum austroasiaticum, Ophioglossum azoricum, Ophioglossum californicum, Ophioglossum costatum, Ophioglossum crotalophoroides, Ophioglossum engelmanii, Ophioglossum lusitanicum, Ophioglossum nudicaule, Ophioglossum polyphyllum, Ophioglossum pusillum, and / or Ophioglossum pycnosticum. Particularly preferred honeycombs are Ophioglossum thermale, Ophioglossum petiolatum, Ophioglossum reticulatum, Ophioglossum vulgatum, and / or Ophioglossum austro-asiaticum Nishida.

[0055] The most preferred file is Ophioglossum thermale.

[0056] One embodiment of the present invention relates to Ophiopogon for use according to the invention in an amount (understood herein as dosage regimen) corresponding to an administration of 1 mg / day to 1000 mg / day of a compound of formula (I), preferably tripentadecanoin.

[0057] A further embodiment relates to an amount of Aloe barbadensis for use according to the invention corresponding to an administration of 1 mg / day to 1000 mg / day of a compound of formula (I), preferably tripentadecanoin. The lower limit is, for example, 1 mg / day, 5 mg / day, 10 mg / day, 20 mg / day, 25 mg / day or 50 mg / day of a compound of formula (I), preferably tripentadecanoin contained in Aloe barbadensis. The upper limit is, for example, 1000 mg / day, 900 mg / day, 800 mg / day, 750 mg / day, 700 mg / day, 600 mg / day, 500 mg / day, 250 mg / day, 200 mg / day of a compound of formula (I), preferably tripentadecanoin contained in Aloe barbadensis. It should be understood that each upper limit can be combined with each lower limit. In a preferred embodiment, the dosage is 10 mg / day to 200 mg / day.

[0058] Alternatively, the present invention relates to a Calyx for use according to the present invention, wherein the Calyx is administered to a subject / patient in an amount of 10 mg to 10000 mg / day of dry Calyx powder. The lower limit is, for example, 10 mg / day, 20 mg / day, 30 mg / day, 40 mg / day, 50 mg / day, 100 mg / day, 150 mg / day, 200 mg / day, 300 mg / day, 500 mg / day, 700 mg / day. The upper limit is, for example, 10000 mg / day, 8000 mg / day, 6000 mg / day, 5000 mg / day, 2500 mg / day, 1000 mg / day. It is to be understood that each upper limit can be combined with each lower limit.

[0059] In a further embodiment, the present invention relates to a pharmaceutical composition for use in the treatment, prevention and / or alleviation of a neurological complication(s) of a viral infectious disease comprising an amount of Ophiopogon corresponding to a dosage of 1 mg / day to 1000 mg / day of a compound of formula (I), preferably tripentadecanoin.

[0060] Alternatively, the present invention relates to a pharmaceutical composition for use, in which the cabbage should be administered in an amount of 10 mg to 10000 mg / day of dry cabbage powder. The lower limit is, for example, 10 mg / day, 20 mg / day, 30 mg / day, 40 mg / day, 50 mg / day, 100 mg / day, 150 mg / day, 200 mg / day, 300 mg / day, 500 mg / day, 700 mg / day. The upper limit is, for example, 10000 mg / day, 8000 mg / day, 6000 mg / day, 5000 mg / day, 2500 mg / day, 1000 mg / day. It should be understood that each upper limit can be combined with each lower limit.

[0061] The cabbage filet for use according to the invention, preferably in the amounts indicated herein, as well as the pharmaceutical compositions of the invention comprising the cabbage filet described herein, can be prepared in any form, such as oral dosage forms (powders, tablets, capsules, soft capsules, aqueous formulations, syrups, elixirs, pills, powders, sachets, granules), or topical preparations (creams, ointments, lotions, gels, balms, patches, pastes, spray solutions, aerosols, etc.), or injectable preparations (solutions, suspensions, emulsions).

[0062] The compound for use according to the invention, the metabolite of the compound for use according to the invention, the pharmaceutical composition for use according to the invention or Ophiopogon for use according to the invention are particularly useful in the treatment, prevention and / or alleviation of symptoms of neurological complication(s) of a viral infectious disease.

[0063] Within the scope of the present invention, any viral infection disease that may lead to neurological complications, in particular symptomatic neurological complications, is included. The viral infection disease may be caused by DNA viruses (double-stranded or single-stranded), RNA viruses (single-stranded or double-stranded, positive or negative stranded), reverse transcribing viruses, or any emerging virus, whether enveloped or non-enveloped.

[0064] In certain embodiments of the present invention, the viral infection disease is associated with a respiratory viral infection. Preferably, the respiratory virus described herein is a virus selected from the group of rhinovirus, RSV, parainfluenza, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, and cytomegalovirus.

[0065] In certain embodiments of the present invention, the viral infection disease relates to a DNA virus infection.Preferably, the DNA virus described herein is selected from the group consisting of adenovirus, rhinovirus, RSV, influenza virus, parainfluenza virus, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, cytomegalovirus, bocavirus, polyomavirus, and cytomegalovirus.

[0066] In certain embodiments of the present invention, the viral infection disease relates to an RNA virus infection. The RNA virus can be an enveloped or coated virus, or a non-enveloped or naked RNA virus. The RNA virus can be a single-stranded RNA (ssRNA) virus or a double-stranded RNA (dsRNA) virus. The single-stranded RNA virus can be a positive-sense ssRNA virus or a negative-sense ssRNA virus. Preferably, the RNA virus described herein is selected from the group consisting of rhinovirus, RSV, influenza virus, parainfluenza virus, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, and cytomegalovirus.

[0067] In certain embodiments of the present invention, the viral infectious disease relates to a coronavirus infection. Preferably, the coronavirus described herein is a coronavirus from a genus selected from the group of α-CoV, β-CoV, γ-CoV and δ-CoV. More preferably, the coronavirus described herein is a virus of the α-CoV or β-CoV genus. In certain embodiments, the coronavirus described herein is selected from the group consisting of human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), Middle East respiratory syndrome-related coronavirus (MERS-CoV or "novel coronavirus 2012"), severe acute respiratory syndrome coronavirus (SARS-CoV or "SARS classic"), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 or "novel coronavirus 2019").

[0068] Preferably, the viral infection is an RNA viral infection, most preferably a coronavirus infection caused by a coronavirus selected from the non-limiting group including MERS-CoV, SARS-CoV and SARS-CoV-2. Most preferably, the viral infection is a SARS-CoV-2 infection.

[0069] In one embodiment within the scope of the present invention, the viral infection disease is caused by SARS-CoV-2, SARS-CoV-1, MERS, influenza virus, human immunodeficiency virus (HIV), varicella-zoster virus (VZV), herpes simplex virus (HSV), poliovirus, Epstein-Barr virus (EBV), cytomegalovirus (CMV), Japanese encephalitis virus, Venezuelan equine encephalitis virus, California encephalitis virus or Zika virus. Preferably, the viral infection is an RNA viral infection, most preferably a coronavirus infection by a coronavirus selected from the non-limiting group including MERS-CoV, SARS-CoV and SARS-CoV-2. Most preferably, the viral infection is a SARS-CoV-2 infection. Thus, in a preferred embodiment of the present invention, the viral infection disease is caused by a coronavirus, preferably SARS-CoV-2, SARS-CoV-1 or MERS. More preferably, the viral infection disease is caused by SARS-CoV-2. SARS-CoV-2 is known to cause a viral infectious disease called CoVID-19.

[0070] Viral infectious diseases caused by variants of the viruses described herein are also encompassed by the present invention. In particular, the variants of SARS-CoV-2 are selected from the group consisting of lineage B.1.1.207, lineage B.1.1.7, cluster 5, 501.V2 variant, lineage P.1, lineage B.1.429 / CAL.20C, lineage B.1.427, lineage B.1.526, lineage B.1.525, lineage B.1.1.317, lineage B.1.1.318, lineage B.1.351, lineage B.1.617 and lineage P.3. In certain embodiments, the SARS-CoV-2 variants described herein are SARS-CoV-2 variants described by the Nextstrain clades selected from the group consisting of 19A, 20A, 20C, 20G, 20H, 20B, 20D, 20F, 20I and 20E. In certain embodiments, the SARS-CoV-2 virus described herein is a SARS-CoV-2 variant comprising at least one mutation in the spike protein selected from the group consisting of D614G, E484K, N501Y, S477G / N, P681H, E484Q, L452R and P614R. In certain embodiments of the invention, the SARS-CoV-2 variant described herein is a SARS-CoV-2 variant derived from a variant described herein. In certain embodiments, the SARS-CoV-2 virus described herein is a SARS-CoV-2 variant having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity to the viral genomic sequence of at least one SARS-CoV-2 variant described herein.

[0071] Any possible neurological complication of a viral infection disease may be treated by using a compound for use according to the invention, a metabolite of a compound for use according to the invention, a pharmaceutical composition for use according to the invention, or an Ophiopogon for use according to the invention.

[0072] In one embodiment, the neurological complication of viral infection disease is damage to the central nervous system. In particular, the neurological complication of viral infection disease is damage to the brainstem. Damage to the brainstem can appear in several different ways. In particular, damage to the brainstem has been shown to occur as a complication of viral infection disease caused by SARS-CoV-2.

[0073] In certain embodiments, treating, preventing and / or alleviating a symptom of a viral infection will treat, prevent and / or alleviate a symptom of brain stem injury.

[0074] The part of the brainstem that is commonly attacked by viruses is the ventrolateral medulla, which is a part of the medulla oblongata of the brainstem and plays a major role in regulating arterial blood pressure and / or respiration.In other words, within the scope of the present invention, damage to the central nervous system can include damage to the ventrolateral medulla.In certain instances, viruses can invade the central nervous system and attack the nerve centers in the brainstem that control respiration and heart rate, as discussed herein, causing asymptomatic sudden death.Therefore, in certain embodiments, preventing neurological complications of viral infection disease is preventing asymptomatic sudden death.

[0075] Viruses can also cause cardiopulmonary failure.Another symptom of damage to the central nervous system, especially the brainstem, is respiratory distress and / or heart rhythm disorder.Therefore, in certain embodiments, treating, preventing and / or alleviating the symptoms of viral infection disease is treating, preventing and / or alleviating the symptoms of respiratory distress and / or heart rhythm disorder.

[0076] In certain embodiments, the central nervous system injury may include injury to the nucleus tractus solitarii. The nucleus tractus solitarii is a series of pure sensory nuclei (clusters of nerve cell bodies) that form vertical columns of gray matter embedded in the medulla oblongata. The inputs of the nucleus tractus solitarii include the facial nerve via the chorda tympani, glossopharyngeal and vagus nerves, the chemoreceptors and mechanoreceptors of the common visceral afferent pathway (GVA) in the carotid body via the glossopharyngeal nerve, the aortic body via the vagus nerve, and the sinoatrial node, as well as the chemically and mechanically sensitive neurons of the GVA with terminations located in the heart, lungs, airways, digestive system, pharynx, and taste information from the liver via the glossopharyngeal and vagus nerves. Further inputs include inputs from the nasal cavity, soft palate, and paranasal sinuses via the facial nerve. As known to those skilled in the art, the neurons that innervate the nucleus tractus solitarii mediate the gag reflex, carotid sinus reflex, aortic reflex, cough reflex, baroreceptor reflex and chemoreceptor reflex, as well as respiratory reflex and digestive reflex that regulates motility and secretion. Outputs include the paraventricular nucleus of the hypothalamus and the central nucleus of the amygdala, as well as other nuclei of the brainstem. Any of these processes can be disrupted by infection with a virus and the development of a viral infectious disease. In particular, symptoms can include anosmia (also called olfactory disorder), dysphagia (understood to include difficulty in swallowing), and / or additional gastrointestinal disorders.

[0077] In certain embodiments of the invention, treating, preventing and / or alleviating a neurological complication of a viral infection disease will treat, prevent and / or alleviate a symptom of damage to the nucleus tractus solitarii. Further treating, preventing and / or alleviating a neurological complication(s) of a viral infection disease will treat, prevent and / or alleviate a symptom of anosmia (also called olfactory impairment), dysphagia (understood to include difficulty in swallowing), and / or further gastrointestinal disorders.

[0078] In certain embodiments, the damage to the central nervous system may include damage to the dorsal vagus nucleus, which is located in the medulla oblongata of the brainstem.The dorsal vagus nucleus plays a role in the innervation of the digestive tract, lungs, and chest and abdomen.Damage to the dorsal vagus nucleus may result in, among other things, cardiopulmonary failure.Therefore, in certain embodiments of the present invention, preventing the neurological complication(s) of viral infection disease will prevent cardiopulmonary failure.

[0079] In certain embodiments, the damage to the central nervous system may include damage to the olfactory bulb. As understood herein, damage to the olfactory bulb may result in loss of smell and / or loss of taste. Therefore, in certain embodiments of the present invention, treating, preventing and / or alleviating the symptoms of neurological complication(s) of viral infection disease is treating, preventing and / or alleviating the symptoms of loss of smell and / or loss of taste.

[0080] In certain embodiments of the present invention, damage to the central nervous system may result in neurodegenerative diseases. Neurodegenerative diseases is a comprehensive disease term that describes the progressive loss of neuronal structure or function, including neuronal death. Neuronal damage or death results in a gradual deterioration of functions controlled by the affected area of ​​the nervous system. A selected group of neurodegenerative disorders includes Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), dementia, dementia with Lewy bodies (DB), frontotemporal dementia (FTD), and brain atrophy. Apoptosis, or programmed cell death, plays an important role in both physiological and pathological conditions. There is growing evidence that the rate of apoptotic cell death is elevated in various acute and chronic neurological diseases, including neurodegenerative diseases. Apoptosis is characterized by neuronal shrinkage, chromatin condensation, and DNA fragmentation, whereas necrotic cell death is associated with cytoplasmic and mitochondrial swelling followed by dissolution of the cell membrane. Evidence of DNA fragmentation has been found in several degenerative neurological disorders, including AD, HD and ALS.

[0081] In certain embodiments, the damage to the central nervous system may include damage to the substantia nigra, which is known to those skilled in the art to be causally related to the development of Parkinson's disease.

[0082] Parkinson's disease is a degenerative disorder of the central nervous system. It results from the death of dopamine-producing cells in the substantia nigra, a region of the midbrain. The cause of cell death is unknown. Parkinson's disease is the second most common neurodegenerative disorder and manifests as bradykinesia, rigidity, resting tremor, and postural instability. PD affects approximately 7 million people worldwide and approximately 1 million in the United States. The annual number of new cases of PD is 8-18 per 100,000 people per year. Levodopa has been the most widely used treatment for 30 years, but has very limited efficacy. Research into neuroprotection is at the forefront of PD research.

[0083] As such, the present invention further relates to embodiments in which treating, preventing and / or alleviating a symptom of a neurological complication(s) of a viral infection disease is treating, preventing and / or alleviating a symptom of a neurodegenerative disease, such as Alzheimer's disease or Parkinson's disease.

[0084] In certain embodiments, the damage to the central nervous system may include damage to the motor cortex. Damage to the motor cortex may result in headache, seizures, muscle weakness, malaise and / or fatigue. Thus, the neurological complication(s) of viral infection disease may include headache, seizures, muscle weakness, malaise and / or fatigue. Furthermore, treating, preventing and / or alleviating the symptoms of viral infection disease may include treating, preventing and / or alleviating headache, seizures, muscle weakness, malaise and / or fatigue.

[0085] Furthermore, in certain embodiments, the neurological complication(s) of a viral infection disease may include perivascular encephalitis, interstitial encephalitis, neuronal cell loss, and / or axonal degeneration. Thus, treating, preventing, and / or alleviating a symptom of the neurological complication(s) of a viral infection disease may result in treating, preventing, and / or alleviating a symptom of perivascular encephalitis, interstitial encephalitis, neuronal cell loss, and / or axonal degeneration.

[0086] Furthermore, in certain embodiments, the neurological complication(s) of a viral infection can include loss of consciousness, confusion, and / or altered mental status, and thus treating, preventing, and / or alleviating a symptom of the neurological complication(s) of a viral infection can be treating, preventing, and / or alleviating a symptom of loss of consciousness, confusion, and / or altered mental status.

[0087] In certain embodiments, the neurological complication(s) of a viral infectious disease includes damage to the peripheral nervous system. Therefore, the neurological complication(s) of a viral infectious disease is the prevention of damage to the peripheral nervous system. In certain embodiments, the complication(s) includes Guillain-Barre syndrome. As known to those skilled in the art, Guillain-Barre syndrome is believed to be caused by the reaction of the subject's immune system to an infectious disease, particularly a viral infectious disease. Guillain-Barre syndrome is associated with infections of cytomegalovirus, Epstein-Barr virus, varicella-zoster virus, dengue virus, Zika virus, and hepatitis virus. Guillain-Barre syndrome has also been reported to be associated with SARS-CoV-2 infection. Thus, in certain embodiments, the neurological complication(s) of a viral infectious disease is due to an autoimmune response to the viral infectious disease. In certain embodiments, the complication(s) includes Guillain-Barre syndrome.

[0088] In certain embodiments, the neurological complication(s) of the viral infection disease comprises an inflammatory disease of the nervous system.As understood herein, the inflammatory disease of the nervous system described herein can be an inflammatory disease of the parasympathetic nervous system, an inflammatory disease of the central nervous system, or an inflammatory disease of the peripheral nervous system.In certain embodiments, the inflammatory disease of the nervous system is selected from the group consisting of multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and Huntington's disease.

[0089] As known to those skilled in the art, viruses replicate efficiently by applying diverse strategies that hijack the host's cellular machinery and exploit its cycle progression, particularly by manipulating the proteostasis pathway at different stages. Protein homeostasis, also called proteostasis, is the result of a coordinated network that acts to maintain a dynamic equilibrium between protein translation, folding, and clearance. It includes molecular chaperones, mainly heat shock proteins (sometimes also called HSPs), that allow correct protein folding, maintenance of native conformation, and coordination with the protein degradation machinery. Without being bound by theory, it can be assumed that the neurological complication(s) of viral infection disease may be related, at least in part, to the interplay between proteostasis and viral infection disease. It is noted that cells use their potential to degrade and recycle their own components as a means to kill intracellular pathogens, including viral infections. For example, autophagy represents an innate immune defense mechanism against viruses by delivering viruses and / or viral proteins to the lysosome for degradation. In response, viruses have evolved mechanisms to interfere with proteolytic pathways in order to maintain the correct concentration and function of viral proteins.

[0090] Furthermore, without being bound by theory, it is noted that the compounds of formula (I), preferably tripentadecanoin, are useful for treating, preventing and / or alleviating the symptoms of neurological complication(s) of viral infectious diseases through affecting the expression of neuroglobin protein.

[0091] Expression of neuroglobin has been demonstrated to be neuroprotective, neurorescue, and anti-apoptotic. As known to those skilled in the art, neuroglobin is downregulated in several neurodegenerative diseases / models, and its downregulation correlates with poor prognosis. In contrast, overexpression of neuroglobin has shown therapeutic effects in disease models of neurodegenerative disorders. Neuroglobin is an intracellular heme protein expressed in the central and peripheral nervous system, cerebrospinal fluid, retina, and endocrine tissues. The heme group of the protein coordinates an Fe(III) ion. During cerebral ischemia, neuroglobin is able to bind O2 with higher affinity than under normal conditions due to the fact that the heme-Fe atom shifts from ferric (Fe(III)) to ferric (Fe(II)) form. Neuroglobin has been shown to scavenge reactive oxygen and nitrogen species within neurons. More importantly, neuroglobin has been shown to inhibit the intrinsic apoptotic pathway, bind to mitochondrial permeability transition pore (MPTP) components (VDAC), and prevent the release of cytochrome c. Neuroglobin is therefore an essential protein for regulating neuronal survival. Although neuroglobin is primarily (approximately 90%) localized in the cytoplasm, growing evidence has revealed that it also associates with mitochondria. Neuroglobin, in particular, is a highly conserved protein, with only 6% of amino acid positions differing between mouse and human neuroglobin.

[0092] In vivo experiments have shown that increasing the level of neuroglobin significantly protects both the heart and brain from hypoxic / ischemic and / or oxidative stress-related injury, while decreasing the level of neuroglobin can lead to exacerbation of tissue damage.Therefore, in certain embodiments, the neurological complication(s) of viral infection disease includes hypoxia, hypoxic / ischemic and / or oxidative stress-related injury.It is hypothesized that overexpression of human neuroglobin protects neurons from mitochondrial dysfunction and neurodegenerative disorders such as Alzheimer's disease, and plays a shielding role in cancer cells.

[0093] Neuroglobin is understood herein as a protein with preferably at least 90% sequence identity to the sequence of SEQ ID NO: 1, more preferably neuroglobin is a protein with at least 90% sequence identity to the sequence of SEQ ID NO: 1, even more preferably neuroglobin is a protein of the sequence of SEQ ID NO: 1. SEQ ID NO: 1 is the sequence of human (Homo sapiens) neuroglobin. For reference purposes, the sequence of mouse (Mus musculus) neuroglobin is as follows: SEQ ID NO: 2.

[0094] The inventors have surprisingly found that treating yeast cells with a compound of formula (I), herein tripentadecanoine, significantly increases the expression of YHB1, the yeast homologue of neuroglobin (see Example 3 for details). The inventors have further surprisingly found that treating cells with a compound of formula (I), herein tripentadecanoine, significantly reduces HSP-104 aggregation (as observed via the GFP-HSP104 locus). However, this effect cannot be observed in cells in which the neuroglobin homologue YHB1 is knocked out (see Example 3 for details). Without being bound by theory, it has been demonstrated that treatment with a compound of formula (I), particularly tripentadecanoine, retards the formation of p-bodies in cells, and it is hypothesized that the compound of formula (I), particularly tripentadecanoine, may target p-body regulation of YHB1 mRNA decay in budding yeast and p-body regulation of neuroglobin mRNA decay in humans.

[0095] More surprisingly, the present inventors have shown that when mouse neurons are treated with a compound of formula (I), herein tripentadecanoin, an increase in the expression of neuroglobin is observed. As shown in Example 4, an approximately six-fold increase in the expression level of neuroglobin is observed.

[0096] Thus, the present invention relates to an embodiment in which, when administered to a subject, the compound of formula (I) upregulates the expression of neuroglobin, preferably in neuronal cells.Preferably, the present invention relates to an embodiment in which, when the expression of neuroglobin is upregulated, it inhibits apoptosis of neuronal cells.

[0097] As known to those skilled in the art, subjects (patients) suffering from neurological complication(s) of viral infectious diseases (especially viral infectious diseases caused by SARS-CoV-2) could benefit from increased expression of neuroglobin in neuronal cells. However, to date, it is not clear to those skilled in the art how the expression of neuroglobin could be increased in the neuronal cells of said subjects (patients). It should be noted that the unexpected discovery of the relationship between the administration of a compound according to formula (I) and the expression of neuroglobin in neuronal cells makes it possible to qualify subjects (patients) suffering from neurological complication(s) of viral infectious diseases for treatment with the compound of formula (I) described herein, its metabolites, pharmaceutical compositions described herein of Ophiopogon as described herein.

[0098] In a further embodiment, the present invention relates to a compound of formula (I) as defined herein, or Ophiopogon as defined herein, for use as a functional food for the treatment, prevention and / or alleviation of symptoms of a neurological complication(s) of a viral infection disease as defined herein.

[0099] Functional foods refer to foods that have been endowed with additional functions (often related to health promotion or disease prevention) by adding new ingredients or enriching existing ingredients. The term can also be applied to traits that have been deliberately bred into existing edible plants, such as purple or gold potatoes with enriched anthocyanin or carotenoid content, respectively. Functional foods are "designed to have physiological benefits beyond basic nutritional function and / or reduce the risk of chronic disease, are similar in appearance to conventional foods, and can be consumed as part of the regular diet" (USDA Agricultural Research Service, AgResearch Magazine. November 2014; USDA Agricultural Research Service, Agricultural Research Service. July 2010).

[0100] In a further embodiment, the present invention relates to a compound of formula (I) as defined herein, or Ophiopogon as defined herein, for use as a dietary supplement for the treatment, prevention and / or alleviation of symptoms of a neurological complication(s) of a viral infectious disease as defined herein.

[0101] In a further embodiment, the present invention relates to the non-therapeutic use of a functional food or dietary supplement comprising a compound of formula (I) as defined herein or comprising Ophiopogon as defined herein, for upregulating the expression of neuroglobin in a subject, preferably in neuronal cells.As understood herein, when the expression of neuroglobin is upregulated, apoptosis of neuronal cells is inhibited.

[0102] In a further embodiment of the present invention, the functional food for humans and / or animals comprises a compound of formula (I), preferably tripentadecanoin, in a dosage of 1 μg (microgram) / day to 50 mg / day, preferably 1 μg (microgram) / day to 20 mg / day. The lower limit is, for example, 1 μg (microgram) / day, 2 μg (microgram) / day, 3 μg (microgram) / day, 4 μg (microgram) / day, 5 μg (microgram) / day, 7 μg (microgram) / day, 10 μg (microgram) / day, 20 μg (microgram) / day, 25 μg (microgram) / day, 50 μg (microgram) / day, 100 μg (microgram) / day, 200 μg (microgram) / day, 300 μg (microgram) / day, 400 μg (microgram) / day or 500 μg (microgram) / day. The upper limit is, for example, 50 mg / day, 40 mg / day, 30 mg / day, 20 mg / day, 10 mg / day, 5 mg / day, 3 mg / day, 2 mg / day, 1 mg / day, 900 μg (micrograms) / day. It should be understood that each upper limit can be combined with each lower limit. In one embodiment, the dosage is 1 μg (micrograms) / day to 20 mg / day. In another embodiment, the dosage is 1 μg (micrograms) / day to 900 μg (micrograms) / day.

[0103] Various modifications and variations of the present invention will be apparent to those skilled in the art without departing from the scope of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be covered by the present invention.

[0104] This invention is illustrated by the following examples which are not intended to be construed as limiting. EXAMPLES

[0105] Example 1 Tripentadecanoin was tested in a mouse model of coronavirus infection. The aim of this study was to investigate the therapeutic efficacy of tripentadecanoin in MHV-infected mice. Mouse hepatitis virus (MHV) causes acute infection of the liver and lungs of mice, as well as persistent infection of the gastrointestinal tract and central nervous system (CNS). The virus initially caused hind-limb paralysis, but repeated passage in mice selected a more virulent mutant that primarily caused encephalitis. This virus was named JHM virus (JHMV) and was subsequently shown to be a coronavirus related to other MHV strains (Bergmann, C., Lane, T. & Stohlman, S. Coronavirus infection of the central nervous system: host-virus stand-off Nat Rev Microbiol 2006;4:121-132). JMHV is now widely used to study virus-induced neurological diseases, especially demyelination. It is considered to be a suitable model of coronavirus-induced neurological complications. CNS infection with MHV provides an animal model for acute viral encephalomyelitis and multiple sclerosis, a human demyelinating disease. MHV-induced demyelinating disease is typified in mice, which control viral replication but fail to completely clear the virus. Acute infection induces CNS inflammation and initiates the demyelinating process. Animals that are unable to control viral replication quickly enough die from encephalomyelitis within 5-10 days. Survivors of acute infection usually clear infectious virus within 2 weeks. However, these animals still fail to acquire sterile immunity, as evidenced by viral antigens (Ag) and RNA persisting in the CNS. MHV persistence is associated with chronic CNS inflammation and ongoing primary demyelination.

[0106] Twenty 5-week-old C57BL / 6J male mice were randomized into two groups: vehicle control or tripentadecanoin 50 mg / kg. Tripentadecanoin or vehicle control treatment was started 3 days after virus infection and continued for a total of 19 days until day 21. MHV-infected mice were clinically scored as follows: 0 - asymptomatic; 1 - limp tail; 2 - unsteady gait with difficulty righting; 3 - hind limb weakness and severe loss of righting; 4 - hind limb paralysis; 5 - moribund.

[0107] The experimental results are shown in Figure 1. In this preliminary study of MHV-infected mice with a small sample size, tripentadecanoin showed promising neurorescue effects in reducing the clinical severity of virus-induced neuropathology (P<0.05 on days 9, 10, or 14) (Figure 1). Linear regression analysis of phase 1 showed statistical significance between the two groups (Figure 1).

[0108] Example 2 Tripentadecanoin, a representative compound of formula (I), exhibits neuroprotective effects in a mouse model of N-nitroso-N-methylurea (NMU) photoreceptor degeneration.

[0109] Eighteen C57BL / 6J female mice, aged 8–12 weeks, were randomized into three groups: 1) NMU + vehicle; 2) NMU + tripentadecanoine 20 mg / kg; 3) NMU + tripentadecanoine 50 mg / kg. NMU at a dose of 50 mg / kg was injected i.p. into all mice. Tripentadecanoine (or vehicle) was administered daily by oral gavage starting 3 days before NMU and continued until 7 days after NMU challenge. Retinas were imaged by spectral-domain optical coherence tomography (OCT) 5 days before NMU exposure and 7 days after NMU. All eyes were enucleated and processed for histological hematoxylin and eosin (H&E) staining. The thickness of photoreceptors was measured from different locations on OCT images and H&E slides, respectively. Photoreceptor thickness on H&E slides was quantified by a single blinded observer using automated Leica software (Leica, Heerbrugg) and results were expressed as the area under the curve (AUC-1.75 to +1.75 μm) of the outer nuclear layer (ONL) and the number of rows of photoreceptor nuclei.

[0110] Results: Histological analysis showed that the AUC under the ONL was significantly increased in the tripentadecanoin-treated groups compared to the vehicle control group, i.e., 83.08 ± 19.05 (p < 0.001) at 50 mg / kg, 73.58 ± 14.45 (p < 0.01) at 20 mg / kg, and 43.46 ± 29.86 at vehicle control (Figure 2). The number of photoreceptor nuclei rows was significantly increased in the tripentadecanoin-treated groups compared to the vehicle control across all regions from the center to the periphery, e.g., 7.0 ± 1.7 (p < 0.001) at 50 mg / kg and 6.4 ± 1.2 (p < 0.01) at 20 mg / kg in the mid-peripheral region compared to 3.8 ± 2.5 in the vehicle control. In vivo OCT images showed increased thickness of photoreceptor layers versus controls, with neural retinal thickness in the 50 mg / kg tripentadecanoin group being significantly increased in the peripheral (p<0.05), midperipheral (p<0.05), and central retina (p<0.01) compared to vehicle controls.

[0111] Conclusion: Tripentadecanoin exhibits potent and dose-dependent neuroprotective effects against NMU-induced neuronal (herein retinal) degeneration.

[0112] Example 3 Although yeast populations can grow freely, yeast mother cells have a finite life span and can only produce a certain number of daughter cells, typically 25, in laboratory conditions. The rate of cell death increases with the number of daughter cells produced, a phenomenon called replicative senescence. In old yeast cells, senescence-induced protein deposits recruit a specific set of chaperones and co-chaperones.

[0113] Hsp104 expressed endogenously as a fusion with a green fluorescent protein tag (Hsp104-GFP) forms foci in old cells, and their presence (percentage of cells with aggregates at a particular age), number (number of foci per cell) and size (fluorescence brightness) can be assessed in hundreds of cells, making it a good model for assessing the biology of aggregates during aging.

[0114] To test whether tripentadecanoin is active in yeast, cells were treated with different concentrations of the purified compound (1 μM, 10 μM, and 30 μM) and an extract of the plant Ophioglossum thermale from which it is derived (10 μg / ml). These cells were allowed to age in the presence of the compound, and after 10–11 generations, cells were imaged to count their age and assessed for whether they contained senescence-associated protein deposits of Hsp104-GFP (Figure 3A). Tripentadecanoin-treated cells of the same age as the herbal extract and untreated cells (vehicle only, 0.3% ethanol) were both found to be less likely to have Hsp104-GFP foci. To statistically validate these results, more than 75 cells were analyzed in each condition (Figure 3B). This result was further confirmed by focusing on one concentration of tripentadecanoin (30 μM) and analyzing more than 500 cells in three independent experiments (Figure 3C-D). Thus, tripentadecanoin was shown to be a potent effector of one of the major aging factors identified in yeast cells and conserved in most, if not all, eukaryotes.

[0115] Potential targets of the compound of formula (I) were identified using RNAseq. Yeast cells (Saccharomyces cerevisiae) were treated with tripentadecanoin (30 μM) for 5 h and the mRNA abundance of all genes in cells treated with compound or vehicle alone for 5 h was quantitatively monitored. Samples were treated in triplicate by Genewiz. 157 mRNAs were identified that showed significantly different expression between the two groups. Among these hits was Yhb1, a flavohemoglobin that plays a role in nitrosative stress response (Figure 4A). Following the results of the RNAseq survey, PHO84, YHB1 or VTC4 were knocked out and the percentage of old cells with Hsp104-GFP was measured as before. While pho84Δ cells were similar to wild-type cells, significantly more vtc4Δ and yhb1Δ mutant cells contained senescence-induced deposits (Figure 4A). Exposure of wild-type and pho84Δ to tripentadecanoin (30 μM) reduced the percentage of cells with Hsp104-GFP, but not vtc4Δ or yhb1Δ mutant cells. Interestingly, many old vtc4Δ or yhb1Δ mutant cells contained multiple Hsp104-GFP foci instead of just one (Figure 4B). These studies demonstrated that tripentadecanoin exerts its function in a yeast natural aging model in a manner dependent on the yeast neuroglobin gene.

[0116] The experimental results are shown in Figure 4.

[0117] Example 4 - Expression of neuroglobin in mouse neurons Preparation of healthy neurons: Primary mouse cortical neurons were prepared from 16-17 day embryos of C57BL / 6J mice fetuses, yielding 95-97% neurons and 3-5% astrocytes. At DIV5 / 6, mouse primary cortical neurons were treated with vehicle (ethanol) or increasing concentrations of tripentadecanoin (100 or 1000 nM) for 3 h (T3) or 24 h (T24). Neuroglobin mRNA was amplified using qPCR method.

[0118] The quantity and quality of RNA was assessed using capillary electrophoresis. Complementary DNA (cDNA) was synthesized by reverse transcription of total RNA in the presence of oligo(dT) and Roche's "Transcriptor reverse transcriptase". The amount of cDNA was then adjusted before the PCR step. qPCR reactions were performed using the Roche Licht Cycler system according to the supplier's instructions. In this experiment, Rps28 (ribosomal protein S28) was used as a reference marker (also called housekeeping gene).

[0119] The reaction mix (10 μL final) was prepared as follows: - 2.5 μL cDNA -Primers and TaqMan probes - A mixture of reagents containing taq DNA polymerase and MgCl2

[0120] In this experiment, the following primers were used: Forward primer: CCCTATCTATGTGTGTCTG (SEQ ID NO: 3) Reverse primer: TGAGGACCAAGGTATAGA (SEQ ID NO: 4) Probe: ATCTGCCTGTTGTAGTCTTAGCCTC (SEQ ID NO: 5)

[0121] The expression of the gene encoding neuroglobin was weak. At 3 hours, 1000 nM tripentadecanoin treatment induced a significant increase in the expression of neuroglobin compared to the level of the vehicle control (p<0.001). Triplicate experiments were reproducible, and the yield of the PCR reaction was similar in the three wells of each experimental condition. In addition, the higher concentration of the compound according to formula (I) showed a stronger effect.

[0122] The experimental results are shown in Figure 5.

Claims

1. A composition for use in the treatment, prevention and / or alleviation of the symptoms of neurological complications (s) of viral infectious diseases, comprising a compound of formula (I): 【Chemical Formula 1】 wherein, R １ , R ２ and R ３ are independently selected from H or -C(O)-C １４ -alkyl, provided that at least one of R １ , R ２ and R ３ is -C(O)-C １４ -alkyl, Composition.

2. R １ , R ２ or R ３ is -C(O)-C １４ -alkyl, the composition according to claim 1.

3. R １ , R ２ and R ３ any two of which are -C(O)-C １４ -alkyl, the composition according to claim 1.

4. R １ , R ２ and R ３ are -C(O)-C １４ -alkyl, the composition according to claim 1.

5. The composition according to claim 1, wherein the compound is tripentadecanoin.

6. A composition for use in the treatment, prevention and / or alleviation of the symptoms of neurological complications (s) of viral infectious diseases, comprising a metabolite of the compound according to claim 1, wherein the metabolite is HO-C(O)-C １４ -alkyl or a pharmaceutically acceptable salt thereof, Composition.

7. A composition for use in treating, preventing and / or alleviating the symptoms of neurological complications (plural) of a viral infectious disease, the composition comprising an extract of Ophioglossum. **Claim 8**: (i) the viral infectious disease is caused by SARS-CoV-2, SARS-CoV-1, MERS, influenza virus, human immunodeficiency virus (HIV), varicella-zoster virus (VZV), herpes simplex virus (HSV), poliovirus, Epstein-Barr virus (EBV), cytomegalovirus (CMV), Japanese encephalitis virus, Venezuelan equine encephalitis virus, California encephalitis virus or Zika virus; (ii) the neurological complication of the viral infectious disease is damage to the central nervous system; (iii) the neurological complication(s) of the viral infectious disease includes damage to the peripheral nervous system; or (iv) the symptoms of the neurological complication(s) of the viral infectious disease are headache and / or seizure; The composition according to any one of claims 1 to 7. **Claim 9** Preventing the neurological complication(s) of the viral infectious disease is preventing the onset of neurodegenerative diseases such as Alzheimer's disease or Parkinson's disease, the composition according to any one of claims 1 to 7. **Claim 10** Preventing the neurological complication(s) of the viral infectious disease amounts to preventing heart failure, the composition according to any one of claims 1 to 7. **Claim 11** The neurological complication(s) of the viral infectious disease includes perivascular encephalitis, interstitial encephalitis, neuronal loss, and / or axonal degeneration, the composition according to any one of claims 1 to 7. **Claim 12** The compound of formula (I) upregulates the expression of neuroglobin upon administration to a subject, the composition according to any one of claims 1 to 7. **Claim 13** The composition according to claim 12, wherein the up-regulated expression of neuroglobin inhibits apoptosis of nerve cells.

14. The composition according to any one of claims 1 to 7, wherein the compound of formula (I) should be administered at a dose of 1 mg / day to 1000 mg / day.

Images