IL-10-inducing polypeptides and uses thereof

JP2024528122A5Pending Publication Date: 2025-08-06アンテローム·エス·ア
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024505536
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-07-27
Filing Date
2022-07-26
Publication Date
2025-08-06

AI Technical Summary

Technical Problem

There is a need to increase IL-10 levels for therapeutic use without administering high doses of recombinant human IL-10, as high-dose recombinant human IL-10 has limitations such as side effects and antibody development.

Method used

Development of specific polypeptides, including those with sequences like SCFFYLP and KGSRSCFFYLP, which can induce and enhance IL-10 secretion from human cells, potentially using genetically modified bacteria to express these polypeptides.

Benefits of technology

These polypeptides effectively stimulate IL-10 secretion from human cells, offering a viable alternative to high-dose recombinant IL-10 therapy by mimicking natural IL-10 induction pathways, reducing inflammatory responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000055_0000
    Figure 00000055_0000
  • Figure 00000055_0001
    Figure 00000055_0001
  • Figure 00000055_0002
    Figure 00000055_0002
Patent Text Reader

Abstract

The present invention relates to polypeptides capable of inducing and / or enhancing the secretion of IL-10 from human cells. Thus, the present invention provides polypeptides that stimulate IL-10 release from human immune cells. The present invention also relates to nucleic acids encoding such polypeptides, cells expressing such polypeptides, respective pharmaceutical compositions and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to polypeptides capable of inducing and / or enhancing the secretion of IL-10 from human cells. The present invention also relates to nucleic acids encoding such polypeptides, cells expressing such polypeptides, respective pharmaceutical compositions and uses thereof. [Background technology]

[0002] The human gut microbiota (HIM) colonizes the human gastrointestinal tract (GIT), which is now considered a hidden human organ. 14 The HIM is a huge and complex community of individual bacteria. It has essential functions such as maintaining gut homeostasis, inhibiting pathogen growth, producing antibacterial compounds, and improving intestinal barrier function. A large body of evidence supports the fact that several GI disorders, including inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), alcoholic liver disease, and even brain activity (gut-brain axis), can result in an altered balance of the gut microbiota (dysbiosis), leading to the abnormal production of certain metabolites and proteins. In the past decade, a large body of literature has described the identification of bacterial metabolites and their potential impact on human health (Levy M, Thaiss CA, Elinav E. Metabolites: messengers between the microbiota and the immune system. Genes Dev. 2016;30(14):1589-97; Guo CJ, Chang FY, Wyche TP, Backus KM, Acker TM, Funabashi M, Taketani M, Donia MS, Nayfach S, Pollard KS, Craik CS, Cravatt BF, Clardy J, Voigt CA, Fischbach MA. Discovery of Reactive Microbiota-Derived Metabolites that Inhibit Host Proteases. Cell. 2017;168(3):517-526.e18).

[0003] Currently, studies of the interactions between bacterial proteins and human intestinal cells are emerging (Weigele BA, Orchard RC, Jimenez A, Cox GW, Alto NM. A systematic exploration of the interactions between bacterial effector proteins and host cell membranes.. Nat Commun. 2017;8(1):532; Guven-Maiorov E, Tsai CJ, Nussinov R. Structural host-microbiota interaction networks. PLoS Comput Biol. 2017;13(10):e1005579). Microbial proteins can have the ability to interact with many human receptors, such as GPCRs, kinase receptors, and transporters, and can affect many different signaling pathways involved in immune surveillance, metabolism, and cell integrity. Molecular mimicry between human and microbial proteins has been proposed: the Escherichia coli (E. coli) protein ClpB mimics human alpha-MSH, a neuropeptide that plays a key role in satiety signaling (Breton J, Tennoune N, Lucas N, Francois M, Legrand R, Jacquemot J, Goichon A, Guerin C, Peltier J, Pestel-Caron M, Chan P, Vaudry D, do Rego JC, Lienard F, Penicaud L, Fioramonti X, Ebenezer IS, Hokfelt T, Dechelotte P, Fetissov SO (2016) Gut Commensal E. coli Proteins Activate Host Satiety Pathways following Nutrient-Induced Bacterial Growth. Cell Metab.2016 Feb 9;23(2):324-34); Helicobacter Pylori CagA interacts with the human tumor suppressor TP53BP2 (Buti L, Spooner E, Van der Veen AG, Rappuoli R, Covacci A, Ploegh HL. (2011) Helicobacter pylori cytotoxin-associated gene A (CagA) subverts the apoptosis-stimulating protein of p53 (ASPP2) tumor suppressor pathway of the host. Proc Natl Acad Sci US A. 2011 May 31;108(22):9238-43); SLPA from Lactobacillus acidophilus is a DC-SIGN ligand functionally involved in the regulation of DC and T cell functions (Konstantinov SR, Smidt H, de Vos WM, Bruijns SC, Singh SK, Valence F, Molle D, Lortal S, Altermann E, Klaenhammer TR, van Kooyk Y. (2008) S layer protein A of Lactobacillus acidophilus NCFM regulates immature dendritic cell and T cell functions. Proc Natl Acad Sci US A.2008 Dec 9;105(49):19474-9; FAp2 from Fusobacterium nucleatum has been shown to bind tumor-expressed Gal-GalNAc to mediate colorectal adenocarcinoma enrichment and to bind the TIGIT receptor (Gur C, Ibrahim Y, Isaacson B, Yamin R, Abed J, Gamliel M, Enk J, Bar-On Y, Stanietsky-Kaynan N, Coppenhagen-Glazer S, Shussman N, Almogy G, Cuapio A5, Hofer E, Mevorach D, Tabib A, Ortenberg R, Markel G, Miklic K, Jonjic S, Brennan CA, Garrett WS, Bachrach G, Mandelboim O. (2015) Binding of the Fap2 protein of Fusobacterium nucleatum to human inhibitory receptor TIGIT protects tumors from immune cell attack. Immunity. February 17, 2015;42(2):344-355). .

[0004] Therefore, proteins from commensal bacteria may have therapeutic applications by mimicking host proteins and interacting directly with host cells and the immune system.

[0005] Interleukin-10 (IL-10) is an important immunoregulatory cytokine produced by various cell types, including lymphocytes, monocytes, macrophages, mast cells, and intestinal epithelial cells. (Shouval DS, Biswas A, Goettel JA, McCann K, Conaway E, Redhu NS, Mascanfroni ID, Al Adham Z, Lavoie S, Ibourk M, Nguyen DD, Samsom JN, Escher JC, Somech R, Weiss B, Beier R, Conklin LS, Ebens CL, Santos FG, Ferreira AR, Sherlock M, Bhan AK, Muller W, Mora JR, Quintana FJ, Klein C, Muise AM, Horwitz BH, Snapper SB (2014) Interleukin-10 receptor signaling in innate immune cells regulates mucosal immune tolerance and anti-inflammatory macrophage expression. function. Immunity. 2014 May 15;40(5):706-19), and its main function is to limit mucosal immune responses and maintain intestinal homeostasis.

[0006] IL-10 is often considered the "prototype anti-inflammatory cytokine" and is known to downregulate the expression of Th1 cytokines, MHC class II antigens, and costimulatory molecules in macrophages. Its inhibitory action is mainly exerted on the most typical inflammatory markers, such as IL-1, IL-6, TNF-α, GM-CSF, and IFN-γ. Three major pro-inflammatory cytokines, IL-1β, IL-6, and TNF-α, are involved in the development and maintenance of inflammatory conditions in many diseases. Although IL-10 can suppress both Th1- and Th2-type responses, its effect on the Th1 subpopulation is more prominent, and IL-10 is considered a promoter of Th2 responses (pleiotropic effects). In addition, IL-10 also enhances B cell survival, proliferation, antibody production, and production of anti-inflammatory factors, including soluble TNF-α receptors and IL-1RA.

[0007] Polymorphisms in the IL-10 locus confer risk for ulcerative colitis and Crohn's disease (Franke A, Balschun T, Karlsen TH, Sventoraityte J, Nikolaus S, Mayr G, Domingues FS, Albrecht M, Nothnagel M, Ellinghaus D, Sina C, Onnie CM, Weersma RK, Stokkers PC, Wijmenga C, Gazouli M, Strachan D, McArdle WL, Vermeire S, Rutgeerts P, Rosenstiel P, Krawczak M, Vatn MH; IBSEN study group, Mathew CG, Schreiber S (2008) Sequence variants in ILl0, ARPC2 and multiple other loci contribute to ulcerative colitis susceptibility. Nat Genet. 2008 Nov;40(11):1319-23; Franke A, McGovern DP, Barrett JC,… Parkes M. (2010) Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. Nat Genet. 2010 Dec;42(12):1118-25), mice and humans lacking either IL-10 or the IL-10 receptor (IL-10R) exhibit severe intestinal inflammation, a process dominated by T helper cell type 1 and type 17 immune responses and prominent pro-inflammatory cytokine secretion (Begue B, Verdier J, Rieux-Laucat F, Goulet O, Morali A, Canioni D, Hugot JP, Daussy C, Verkarre V, Pigneur B, Fischer A, Klein C, Cerf-Bensussan N, Ruemmele FM.(2011) Defective IL10 signaling defining a subgroup of patients with inflammatory bowel disease. Am J Gastroenterol. August;106(8):1544~55; Moran CJ, Walters TD, Guo CH, Kugathasan S, Klein C, Turner D, Wolters VM, Bandsma RH, Mouzaki M, Zachos M, Langer JC, Cutz E, Benseler SM, Roifman CM, Silverberg MS, Griffiths AM, Snapper SB, Muise AM. (2013) IL-10R polymorphisms are associated with very-early-onset ulcerative colitis. Inflamm Bowel Dis. January;19(1):115-23). .

[0008] In view of these, recombinant human IL-10 has emerged as a candidate drug in acute and chronic inflammatory diseases, autoimmune and allergic disorders, post-transplant rejection of transplanted organs and graft-versus-host disease, and infectious diseases. However, trials with high-dose recombinant human IL-10 have revealed several issues that limit its usefulness in therapeutic applications, related to side effects of high-dose recombinant human IL-10 and the development of antibodies against recombinant human IL-10 (Fioranelli M. 2014, Twenty-five years of studies and trials for the therapeutic application of IL-10 immunomodulating properties. From high doses administration to low dose medicine new paradigm. J Integr Cardiol 1: DOI: 10.15761 / JIC.1000102). [Prior art documents] [Patent documents]

[0009]

Patent Document 1

Patent document 2

Patent document 3

Patent document 4

Non-licensed literature

[0010]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Outdoor Track 8

Outdoor Tools9

Non - Patent Document 10

Non - Patent Document 11

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

Non-Patent Document 36

Non-Patent Document 37

Non-Patent Document 38

Non-Patent Document 39

Non-Patent Document 40

Non-Patent Document 41

Non-Patent Document 42

Non-Patent Document 43

Non-Patent Document 44

Non-Patent Document 45

Summary of the Invention

Problems to be Solved by the Invention

[0011] Thus, there is a need to increase IL-10 levels in therapeutic applications by means other than administering high doses of recombinant human IL-10. In view of this, it is an object of the present invention to provide compounds capable of inducing the secretion of (endogenous) IL-10. [Means for solving the problem]

[0012] This object is achieved by the subject matter hereinafter specifically provided and claimed in the appended claims.

[0013] Invention items The present invention provides, inter alia: 1. General formula (I): SCX1X2X3YLX4(I) (In the formula, X1 may be any amino acid; X2 may be any amino acid; X3 may be any amino acid or may be deleted; X4 is P or D) A polypeptide comprising or consisting of an amino acid sequence according to the invention. 2. General formula (Ia): KGSRSCX1X2X3YLX4(Ia) (wherein X1 to X4 are defined as in item 1) 2. The polypeptide according to item 1, comprising or consisting of an amino acid sequence according to 3. The polypeptide according to item 1 or 2, wherein X3 is deleted and X4 is P. 4. The polypeptide according to item 3, comprising or consisting of an amino acid sequence according to SEQ ID NO: 5 or 6. [SCFFYLP or KKGSRSCFFYLP] 5. The polypeptide according to item 1 or 2, wherein X3 can be any amino acid and X4 is D. 6. The polypeptide according to item 5, comprising or consisting of an amino acid sequence according to SEQ ID NO: 7 or 8. [SCFFIYLD or KGSRSCFFIYLD] 7. A polypeptide according to any one of items 1 to 6, comprising two cysteine ​​residues, optionally forming a disulfide bond. 8. A polypeptide according to any one of items 1 to 7, comprising two amino acid sequences according to any one of items 1 to 6, wherein the two amino acid sequences may be the same or different. 9. General formula (II): CX1X2X3YLX4X5X6X7X8X9KGSRX 10 C (II) (In the formula, X1 may be any amino acid; X2 may be any amino acid; X3 may be any amino acid or may be deleted; X4 is P or D; X5 may be any amino acid; X6 may be any amino acid or may be deleted, X7 may be any amino acid; X8 may be any amino acid; X9 is K or Q; X 10 may be any amino acid) A polypeptide comprising or consisting of an amino acid sequence according to the invention. 10. General formula (IIa): SCFFX3YLX4RX6GX8X9KGSRX 10 C (IIa) (In the formula, X3 is I or deleted, X4 is P or D; X6 is Q or deleted, X8 is T or Y; X9 is K or Q; X 10 is S or G) 10. The polypeptide according to any one of items 1 to 9, comprising or consisting of an amino acid sequence according to 11. The polypeptide according to item 9 or 10, wherein either X3 or X6 is deleted, but not X3 and X6. 12. The polypeptide of any one of items 1 to 11, having a length of at least 17 amino acids. 13. A polypeptide comprising or consisting of an amino acid sequence according to SEQ ID NO: 1, optionally in which 0, 1, 2, 3, 4, 5, 6, 7 or 8 amino acids may be substituted, added and / or deleted, provided that the serine residue at position 6 of SEQ ID NO: 1 is maintained. 14. The polypeptide according to item 13, comprising an amino acid sequence as defined in any one of items 1 to 13. 15. The polypeptide according to item 13 or 14, wherein the cysteine ​​residues at positions 7 and / or 23 of SEQ ID NO:1 are maintained. 16. The polypeptide according to any one of items 1 to 15, which does not comprise an amino acid sequence according to SEQ ID NO:2. 17. The polypeptide of any one of items 1 to 16, having a length of 120 or less amino acids. 18. The polypeptide according to any one of items 1 to 17, which is capable of inducing and / or enhancing IL-10 secretion from human cells. 19. The polypeptide according to item 18, wherein the human cell is a human immune cell, preferably a PBMC. 20. The polypeptide according to item 18 or 19, wherein the human cell is a monocyte. 21. The polypeptide according to any one of items 18 to 20, wherein IL-10 secretion from human cells stimulated with the polypeptide is the same as or higher than IL-10 secretion stimulated with lipopolysaccharide (LPS), for example 10 ng / ml or 100 ng / ml LPS. 22. A polypeptide according to any one of items 1 to 21, comprising or consisting of an amino acid sequence according to SEQ ID NO:1. 23. A polypeptide according to any one of items 1 to 22, comprising or consisting of an amino acid sequence according to SEQ ID NO:9. 24. A nucleic acid comprising a polynucleotide encoding a polypeptide according to any one of items 1 to 23. 25. The nucleic acid according to item 24, which is a DNA or RNA molecule, preferably selected from genomic DNA; cDNA; siRNA; rRNA; mRNA; antisense DNA; antisense RNA; ribozymes; complementary RNA and / or DNA sequences; RNA and / or DNA sequences with or without expression elements, regulatory elements, and / or promoters; vectors; and combinations thereof. 26. The nucleic acid according to item 24 or 25, wherein the nucleic acid sequence of the polynucleotide encoding the polypeptide shares at least 80% sequence identity with SEQ ID NO:10. 27. The nucleic acid according to any one of items 24 to 26, wherein the polynucleotide encoding the polypeptide is codon-optimized for expression in a prokaryotic cell, preferably a bacterium. 28. An expression cassette comprising a polynucleotide encoding a polypeptide according to any one of items 1 to 23 and a regulatory element operably linked thereto, preferably for expression in a prokaryotic cell such as a bacterium. 29. The expression cassette according to item 28, comprising regulatory elements for heterologous expression and / or overexpression of the encoded polypeptide. 30. A vector comprising the nucleic acid according to any one of items 24 to 27 or the expression cassette according to item 28 or 29. 31. A (host) cell which expresses a polypeptide according to any one of items 1 to 23; or which contains a nucleic acid according to any one of items 24 to 27, an expression cassette according to item 28 or 29, or a vector according to item 30. 32. The (host) cell according to item 31, which is a bacterium, preferably a genetically modified bacterium. 33. A genetically modified bacterium capable of inducing and / or enhancing IL-10 secretion from human cells, comprising a nucleic acid according to any one of items 24 to 27, an expression cassette according to item 28 or 29, or a vector according to item 30. 34. A genetically modified bacterium which (over)expresses a polypeptide according to any one of items 1 to 23. 35. A culture medium comprising a polypeptide according to any one of items 1 to 23, a (host) cell according to item 31 or 32, or a bacterium according to item 33 or 34. 36. The culture medium according to item 35, further comprising a (self) antigen. 37. An isolated human cell cultured using the culture medium according to item 35 or 36. 38. The cell according to item 37, which is a human immune cell, preferably a PBMC. 39. The cell according to item 37 or 38, which is a monocyte, macrophage, dendritic cell, or lymphocyte, preferably a T lymphocyte. 40. A pharmaceutical composition comprising a polypeptide according to any one of items 1 to 23, a nucleic acid according to any one of items 24 to 27, a vector according to item 30, a cell according to item 31 or 32, a bacterium according to item 33 or 34, or a human cell according to any one of items 37 to 39, and optionally a pharma- ceutically acceptable excipient or carrier. 41. A polypeptide according to any one of items 1 to 23, a nucleic acid according to any one of items 24 to 27, a vector according to item 30, a cell according to item 31 or 32, a bacterium according to item 33 or 34, a human cell according to any one of items 37 to 39, or a pharmaceutical composition according to item 40 for use in medicine. 42. A polypeptide, nucleic acid, vector, cell, bacterium, human cell, or pharmaceutical composition for use according to item 41 in the treatment of an inflammatory disease or an autoimmune disorder. 43. A polypeptide, a nucleic acid, a vector, a cell, a bacterium, a human cell, or a pharmaceutical composition for use according to item 41 in the treatment of inflammatory bowel disease (IBD). 44. A polypeptide, a nucleic acid, a vector, a cell, a bacterium, a human cell or a pharmaceutical composition for use according to item 41 in the treatment of allergies. 45. A method for reducing, treating, alleviating a symptom of an inflammatory disease or autoimmune disorder in a subject, or ameliorating an inflammatory disease or autoimmune disorder in a subject, comprising administering to the subject a polypeptide according to any one of items 1 to 23, a nucleic acid according to any one of items 24 to 27, a vector according to item 30, a cell according to item 31 or 32, a bacterium according to item 33 or 34, a human cell according to any one of items 37 to 39, or a pharmaceutical composition according to item 40. 46. ​​A method for inducing and / or enhancing IL-10 secretion in a subject, comprising administering to the subject a polypeptide according to any one of items 1 to 23, a nucleic acid according to any one of items 24 to 27, a vector according to item 30, a cell according to item 31 or 32, a bacterium according to item 33 or 34, a human cell according to any one of items 37 to 39, or a pharmaceutical composition according to item 40. 47. A method for inducing tolerance in a subject, comprising the step of administering to the subject a polypeptide according to any one of items 1 to 23, a nucleic acid according to any one of items 24 to 27, a vector according to item 30, a cell according to item 31 or 32, a bacterium according to item 33 or 34, a human cell according to any one of items 37 to 39, or a pharmaceutical composition according to item 40.

[0014] The invention, and in particular the items outlined above, are described in more detail below.

[0015] definition Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, the nomenclature and cell and tissue culture techniques used herein are those well known and commonly used in the art.

[0016] Such techniques are well described in the literature, such as Owen et al. (Kuby Immunology, 7th ed., 2013 - WH Freeman) and Sambrook et al. (Molecular cloning: A laboratory manual 4th ed., Cold Spring Harbor Laboratory Press - Cold Spring Harbor, NY, USA, 2012).

[0017] However, the following definitions apply more specifically with respect to the use of various terms throughout this specification.

[0018] The term "(poly)peptide" as used herein refers to a peptide and / or a polypeptide. The terms "peptide", "polypeptide", "protein" and variations of these terms refer to a peptide, oligopeptide, polypeptide, or protein that comprises at least two amino acids linked together, preferably by a normal peptide bond, or alternatively, in the case of isoteric peptides, by a modified peptide bond. In particular, the terms "peptide", "polypeptide", and "protein" refer to a continuous chain of amino acids of any length linked together via peptide bonds (-NHCO-). Peptides, polypeptides, and proteins can perform structural and / or functional roles in cells in vitro and / or in vivo. The terms "peptide", "polypeptide", and "protein" preferably encompass amino acid chains ranging in size from 2 to at least about 1000 amino acid residues. The term "peptide" as used herein preferably encompasses amino acid chains less than about 30 amino acids in size, while the terms "polypeptide" and "protein" preferably encompass amino acid chains at least 30 amino acids in size. The terms "polypeptide" and "protein" are used interchangeably herein. In some embodiments, the terms "peptide", "polypeptide" and "protein" also include "peptidomimetics", which are defined as peptide analogs containing non-peptide structural elements that enable the peptide to mimic or antagonize the biological action of the natural parent peptide. Peptidomimetics lack classical peptide characteristics such as peptide bonds that are susceptible to enzymatic cleavage. In particular, peptides, polypeptides or proteins can contain, in addition to these amino acids, or consist of amino acids other than the 20 amino acids defined by the genetic code. In particular, peptides, polypeptides or proteins in the context of the present invention can also consist of amino acids that have been modified by natural processes, such as post-translational maturation processes, or by chemical processes well known to those skilled in the art. Such modifications are fully detailed in the literature.These modifications can occur anywhere in a polypeptide: in the peptide backbone, in the amino acid chain, or even at the carboxy- or amino-terminus. In particular, a peptide or polypeptide may be branched after ubiquitination or may be cyclic, with or without branching. Modifications of this type can be the result of natural or synthetic post-translational processes that are well known to those skilled in the art. The terms "peptide", "polypeptide", and "protein", particularly in the context of the present invention, also include modified peptides, polypeptides, and proteins. For example, peptide, polypeptide, or protein modifications can include acetylation, acylation, ADP-ribosylation, amidation, covalent immobilization of a nucleotide or nucleotide derivative, covalent immobilization of a lipid or lipid derivative, covalent immobilization of phosphatidylinositol, covalent or non-covalent cross-linking, cyclization, disulfide bond formation, demethylation, glycosylation including pegylation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, seneloylation, sulfation, amino acid addition such as arginylation, or ubiquitination. Such modifications are well documented in the literature (Proteins Structure and Molecular Properties (1993) 2nd ed., T. E. Creighton, New York; Post-translational Covalent Modifications of Proteins (1983) ed. B. C. Johnson, Academic Press, New York; Seifter et al. (1990) Analysis for protein modifications and nonprotein cofactors, Meth. Enzymol. 182: 626-646, and Rattan et al. (1992) Protein Synthesis: Post-translational Modifications and Aging, Ann NY Acad Sci, 663: 48-62).Thus, the terms "peptide", "polypeptide" and "protein" preferably also include, for example, lipopeptides, lipoproteins, glycopeptides, glycoproteins, and the like.

[0019] Preferably, the (poly)peptide or protein is a "classical" (poly)peptide or protein. A "classical" (poly)peptide or protein typically consists of amino acids selected from the 20 amino acids defined by the genetic code, linked together by conventional peptide bonds.

[0020] In general, a protein or (poly)peptide may be of any length. In some embodiments, the length of a protein may be assessed on the "mature" protein (in its functional state). That is, pre-protein sequences such as "additional" signal peptides, which are removed in the mature / functional protein, may not be considered in the length of the protein. Preferably, the length of a polypeptide of the invention does not exceed 500 amino acids. For example, the maximum length of a polypeptide according to the invention may be 120 amino acids. In some embodiments, the maximum length of a polypeptide according to the invention does not exceed 100 amino acids (e.g., 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20 amino acids or less).

[0021] As used herein, the term "microbiota protein" refers to a protein of microbiota origin. As used herein, the term "microbiota" refers to commensal, symbiotic, and pathogenic microorganisms found in every multicellular organism studied so far, from plants to animals. In particular, microbiota have been found to be crucial for the immunological, hormonal, and metabolic homeostasis of their hosts. In particular, microbiota are non-pathogenic. In other words, microbiota usually do not (cannot) cause disease in the host and / or microbiota are preferably not harmful to the host. Microbiota include bacteria, archaea, protists, fungi, viruses, and phages. Thus, microbiota proteins may be bacterial proteins, archaea proteins, protist proteins, fungal proteins, viral proteins, and / or phage proteins.

[0022] As used herein, the term "recombinant" is intended to refer to compounds, e.g., proteins, that are prepared, expressed, produced, or isolated by recombinant means, e.g., proteins isolated from a heterologous host cell (that does not naturally express said protein) or proteins expressed using a recombinant expression vector transfected into a host cell. Thus, recombinant proteins are proteins that are prepared, expressed, produced, or isolated by recombinant means, e.g., proteins isolated from a host cell transfected to express the protein, proteins isolated from a recombinant protein library, and proteins prepared, expressed, produced, or isolated by any other means, including splicing the respective gene sequence encoding the protein to other DNA sequences (different from the DNA sequences that naturally flank said gene). In particular, the term "recombinant" is intended to refer to compounds, e.g., proteins, that do not occur in nature. In some cases, recombinant proteins may have a glycosylation pattern that does not occur in nature.

[0023] As is well known in the art, peptides, polypeptides and proteins can be encoded by nucleic acids. The terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "polynucleotide", "nucleotide sequence" are used interchangeably herein and refer to an exact sequence of natural nucleotides (e.g., A, T, G, C and U) or synthetic nucleotides, i.e., a linkage of at least two nucleotides. In particular, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "polynucleotide", "nucleotide sequence" refer to DNA or RNA. Nucleic acids preferably include single-stranded, double-stranded or partially double-stranded DNA or RNA, preferably selected from genomic DNA, cDNA, ribosomal DNA and transcription products of said DNA, e.g. RNA. Preferred examples of nucleic acids include rRNA, mRNA; antisense DNA, antisense RNA; complementary RNA and / or DNA sequences, ribozymes, (complementary) RNA / DNA sequences (with or without expression elements); vectors; minigenes, gene fragments, regulatory elements, promoters and combinations thereof. Further preferred examples of nucleic acids (molecules) and / or polynucleotides include, for example, recombinant polynucleotides, vectors, oligonucleotides, RNA molecules, such as rRNA, mRNA, or tRNA, or DNA molecules as described above. Thus, the nucleic acids (molecules) are preferably DNA or RNA molecules, preferably selected from genomic DNA; cDNA; rRNA; mRNA; antisense DNA; antisense RNA; complementary RNA and / or DNA sequences; RNA and / or DNA sequences with or without expression elements, regulatory elements, and / or promoters; vectors; and combinations thereof. It is within the skill of the person skilled in the art to determine a nucleotide sequence capable of encoding a particular amino acid sequence.

[0024] The polypeptides and / or nucleic acids according to the present invention can be prepared by any method known in the art, including but not limited to any synthetic method, any recombinant method, any ex vivo production method, etc., and any combination thereof. Such techniques are well known in the art.

[0025] In general, the term "sequence variant" as used herein, i.e. throughout the application, refers to a sequence that is similar (in particular, means at least 50% sequence identity, see below) but not (100%) identical to a reference sequence (such as any one of the specific sequences listed in the sequence listing). Thus, a sequence variant contains at least one change compared to a reference sequence. For example, in a sequence variant, one or more of the amino acids or nucleotides of the reference sequence are deleted or substituted, or one or more amino acids or nucleotides are inserted or added to the sequence of the reference sequence. Thus, a "sequence variant" is similar but contains at least one change compared to its reference sequence. Preferably, a sequence variant shares at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, particularly preferably at least 95%, and most preferably at least 98% or 99% sequence identity with a reference sequence, especially over the entire length of the sequence. A sequence variant can preserve certain functions of a reference sequence. In the context of the present invention, this function may be the functionality to induce and / or enhance IL-10 secretion (from human cells).

[0026] The term "sequence variant" includes nucleotide sequence variants and amino acid sequence variants. For example, an amino acid sequence variant has a sequence change in which one or more amino acids are deleted or substituted compared to a reference sequence, or one or more amino acids are inserted or added compared to a reference amino acid sequence. As a result of the change, an amino acid sequence variant has an amino acid sequence that is at least 50%, for example at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, particularly preferably at least 95%, and most preferably at least 98% or 99% identical to a reference sequence. For example, a variant sequence that is at least 90% identical has no more than 10 changes (i.e., any combination of deletions, insertions, or substitutions) per 100 amino acids of the reference sequence.

[0027] In the context of the present invention, an amino acid sequence "sharing sequence identity" of at least, for example, 70% with a query (reference) amino acid sequence of the present invention is intended to mean that the sequence of the subject amino acid sequence is identical to the query sequence, except that the subject amino acid sequence may contain up to 3 amino acid changes for each 10 amino acids of the query amino acid sequence. In other words, up to 30% (3 out of 10) of the amino acid residues in the subject sequence may be inserted, replaced with another amino acid, or deleted, preferably within the above definition of a variant or fragment, to obtain an amino acid sequence having a sequence of at least 70% identity to the query amino acid sequence. Of course, the same applies to nucleic acid sequences as well.

[0028] In the context of the present invention, any amino acid substitution is preferably a conservative amino acid substitution. Examples of conservative substitutions include the substitution of one aliphatic residue for another (e.g., Ile, VaI, Leu, or Ala for each other); or the substitution of one polar residue for another (e.g., Lys for Arg; Glu for Asp; or Gln for Asn). Other such conservative substitutions, such as the substitution of entire regions with similar hydrophobic properties, are well known (Kyte and Doolittle, 1982, J. Mol. Biol. 157(1):105-132). Examples of conservative amino acid substitutions are presented in Table 1 below:

[0029] [Table 1]

[0030] For sequences (amino acid or nucleic acid) without exact correspondence, the "% identity" of a first sequence (e.g., a sequence variant) can be determined against a second sequence (e.g., a reference sequence). In general, the two sequences being compared can be aligned to show maximum correlation between the sequences. This can include inserting "gaps" in either or both sequences to improve the degree of alignment. The % identity can then be determined over the entire length of each sequence being compared (so-called "global alignment"), which is particularly suitable for sequences of the same or similar length, or over a shorter, defined length of the sequence (so-called "local alignment"), which is more suitable for sequences of non-identical length. Methods for comparing the identity (sometimes also referred to as "similarity" or "homology") of two or more sequences are well known in the art. The percentage that two (or more) sequences are identical can be determined, for example, using a mathematical algorithm. A preferred, but non-limiting example of a mathematical algorithm that can be used is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such algorithms are incorporated into the BLAST family of programs available from the NCBI homepage at the worldwide website ncbi.nlm.nih.gov, e.g., the BLAST or NBLAST programs (see also Altschul et al., 1990, J. Mol. Biol. 215, 403-410, or Altschul et al. (1997), Nucleic Acids, 25:3389-3402), and FASTA (Pearson (1990), Methods Enzymol. 183, 63-98; Pearson and Lipman (1988), Proc. Natl. Acad. Sci. USA 85, 2444-2448). Sequences that are identical to a particular degree to other sequences can be identified by these programs. Additionally, programs available in the Wisconsin Sequence Analysis Package, version 9.1 (Devereux et al., 1984, Nucleic Acids Res., pp. 387-395), such as the programs BESTFIT and GAP, can be used to determine the percent identity between two polynucleotide and the percent identity and homology or identity between two polypeptide sequences. BESTFIT uses the "local homology" algorithm of (Smith and Waterman (1981), J. Mol. Biol. 147, pp. 195-197) to find the best single region of similarity between two sequences.

[0031] By "pharmaceutical acceptable excipient" herein is meant a pharmaceutical grade compound that improves the delivery, stability or bioavailability of an active agent, can be metabolized by the subject to which it is administered, and is non-toxic to the subject to which it is administered. Preferred excipients according to the present invention include any excipients commonly used in pharmaceutical products, such as, for example, water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In many cases, it will be preferable to include an isotonic agent, such as a sugar, a polyhydric alcohol, such as mannitol, sorbitol, or sodium chloride, in the composition. Pharmaceutically acceptable excipients may further include minor amounts of auxiliary substances, such as wetting or emulsifying agents, or preservatives.

[0032] According to various aspects and embodiments of the invention described herein, a "subject" or "host" refers preferably to a mammal, and most preferably to a human.

[0033] As used herein, the phrase "treatment of a disease" generally refers to improving, reducing, preventing, and / or treating a disease or condition, or reducing or preventing the occurrence of a disease or condition, or the risk of developing a disease or condition. Thus, the phrase "treatment of a disease" refers to preventive and therapeutic settings. A preventive setting generally means avoiding or minimizing the onset, occurrence, or recurrence of a disease or condition before it develops or after it has been "cured", whereas a therapeutic setting usually encompasses reducing, improving, or curing a disease or condition (or a symptom of a disease or condition) after it develops. In particular, the term "preventing" encompasses "reducing the likelihood of occurrence" or "reducing the likelihood of recurrence".

[0034] An "effective amount" or "effective dose" as used herein is an amount that produces a desired effect. For therapeutic purposes, an effective amount is an amount sufficient to produce a beneficial or desired clinical result. The preferred effective amount for a given application can be readily determined by one of skill in the art, taking into account, for example, the subject's size, age, weight, the type of disease / disorder being prevented or treated, and the time since the onset of the disease / disorder. In the context of the present invention, for treatment, an effective amount of the composition is typically an amount sufficient to enhance and / or induce IL-10 secretion from human cells.

[0035] Throughout this specification and the claims that follow, unless the context otherwise requires, the term "comprise", as well as variations such as "comprises" and "comprising", will be understood to imply the inclusion of the stated members, integers, or steps, but not the exclusion of any other unstated members, integers, or steps. The term "consist of" is a specific embodiment of the term "comprise", in which any other unstated members, integers, or steps are excluded. In the context of the present invention, the term "comprising" encompasses the term "consisting". The term "comprising" thus encompasses "including" and "consisting", e.g., a composition "comprising" X may consist exclusively of X, or may include something additional, e.g., X+Y.

[0036] The terms "a" and "an" and "the" and similar references used in the context of describing the present invention (particularly in the context of the claims) should be construed to include both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated herein as if it were individually recited herein. No language herein should be construed as indicating any non-claimed element essential to the practice of the invention.

[0037] The term "substantially" does not exclude "completely". For example, a composition that is "substantially free" of Y may be completely free of Y. If desired, the term "substantially" may be omitted from the definition of the invention.

[0038] The term "about" in relation to a numerical value x means x±10%.

[0039] Additional definitions are provided throughout the specification.

[0040] The present invention may be understood more readily by reference to the following detailed description, including preferred embodiments of the invention, and the examples included therein.

[0041] In the following, a brief description of the attached drawings is given, which are intended to illustrate the invention in more detail, but which in no way limit the subject matter of the invention. [Brief description of the drawings]

[0042] [Figure 1] FIG. 1 shows AlphaLISA results of IL-10 secretion from human (CD14 neg.) PBMCs upon stimulation with 10 exemplary microbiota proteins in a second round of cell-free synthesis, relating to Example 1. [Diagram 2]FIG. 1 shows AlphaLISA results of IL-10 secretion from human PBMCs upon stimulation with five selected microbiota proteins at doses of 0.5, 0.25, 0.1 and 0.025 μM (final concentrations), relating to Example 2. [Diagram 3] Figure 1 shows NAT_29 dose response in monocyte-derived dendritic cells (MoDCs; A) and monocytes (Monocytes; B) for Example 3. Cells were co-stimulated with NAT_29 (SEQ ID NO: 1; at concentrations of 1000-100-10-1-0.1 nM as indicated) and LPS (100 ng / mL) for 24 hours. [Figure 4] FIG. 1 shows kinetics of IL-10 (A), TNF (B), and IL-6 (C) secretion from monocytes co-stimulated with NAT_29 (SEQ ID NO: 1; 1 μM) and LPS (10 ng / mL) for 5-10-24-48-72 hours (as indicated) for Example 4. Results are shown as fold (NAT_29 vs LPS) and are the average of 6 different monocyte donors. [Diagram 5] Figure 1 shows the effect of different mutations in SEQ ID NO:1 / NAT_29 (mutated version: NAT_38 / SEQ ID NO:9) for example 5. NAT polypeptide was used at 1 μM and LPS at 100 ng / mL. [Figure 6] Measurement of transepithelial electrical resistance (TER) (A), histology (HE staining, B), and IL-8 quantification by ELISA (C) in human ileal resections, for Example 6. Explants were pretreated with either 1000 nM or 10 nM NAT_29 (SEQ ID NO: 1) for 1 h in the apical compartment, then E. coli LF82 was added at 1×109 UFC / mL and incubation was extended for 4 h. The control condition corresponds to explants in medium alone. The two top photographs in (B) show the control without E. coli LF82 (T=0 and T=4 h), whereas the two bottom photographs in (B) show the LF82 only and LF82+NAT_29 groups at T=4 h. [Figure 7]FIG. 13 shows the in vivo anti-inflammatory properties of intrarectally administered NAT29 peptide in a model of acute colitis induced by TNBS in rats, as measured using the Wallace score, referring to Example 7. Results are expressed as mean±SEM scores. [Figure 8] FIG. 1 shows the in vivo anti-inflammatory properties of intrarectally administered NAT29 peptide in a model of acute colitis induced by TNBS in rats, as measured by Lipocalin quantification, relating to Example 7. Results are expressed as mean±SEM. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0043] The present invention is described in detail below, but it should be understood that the present invention is not limited to the specific methodology, protocols, and reagents described herein, as these may vary. It should also be understood that the terms used herein do not limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0044] In the following, elements of the present invention are described. Although these elements are listed with specific embodiments, it should be understood that they can be combined in any manner and in any number to create additional embodiments. The various described examples and preferred embodiments should not be construed as limiting the present invention only to the embodiments explicitly described. This description should be understood to support and encompass embodiments that combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutation and combination of all described elements in this application should be considered to be disclosed by the description of this application, unless the context indicates otherwise.

[0045] Polypeptides that induce IL-10 secretion from human cells

[0046] In a first aspect, the present invention provides a compound of general formula (I): SCX1X2X3YLX4(I) (In the formula, X1 may be any amino acid; X2 may be any amino acid; X3 may be any amino acid or may be deleted; X4 is P or D) The present invention provides a polypeptide comprising or consisting of an amino acid sequence according to the present invention.

[0047] Preferably, X1 is selected from the group consisting of F, A, C, G, I, L, M, P, H, W, Y and V, more preferably X1 is selected from the group consisting of F, H, W and Y, and particularly preferably X1 is F.

[0048] Preferably, X2 is selected from the group consisting of F, A, C, G, I, L, M, P, H, W, Y and V, more preferably X2 is selected from the group consisting of F, H, W and Y, and particularly preferably X2 is F.

[0049] Preferably, X3 is deleted or selected from the group consisting of I, A, C, G, L, M, F, P, W and V, Y and V, more preferably X3 is deleted or selected from the group consisting of I, A, G or L, particularly preferably X3 is deleted or I.

[0050] The inventors have identified various polypeptides capable of inducing and / or enhancing IL-10 secretion from human cells, e.g. having an amino acid sequence according to SEQ ID NO: 1 or 9. Based thereon, the inventors have identified the sequence motifs described herein for inducing and / or enhancing IL-10 secretion from human cells.

[0051] Preferably, the polypeptide has the general formula (Ia): KGSRSCX1X2X3YLX4(Ia) (wherein X1 to X4 are defined as above). The amino acid sequence of the present invention is

[0052] In some embodiments of general formula (I) or (Ia), X3 may be deleted and X4 may be P. Thus, the polypeptide has the amino acid sequence according to SEQ ID NO:3: SCX1X2YLP (SEQ ID NO:3) (wherein X1 and X2 are as defined above). It may comprise or consist of.

[0053] Preferably, the polypeptide comprises or consists of the amino acid sequence according to SEQ ID NO:5 (SCFFYLP) or the amino acid sequence according to SEQ ID NO:6 (KKGSRSCFFYLP).

[0054] In some embodiments of general formula (I) or (Ia), X3 may be an amino acid as defined above and X4 may be D. Thus, the polypeptide has the amino acid sequence according to SEQ ID NO:4: SCX1X2X3YLD (SEQ ID NO: 4) (wherein X1 to X3 are as defined above). It may comprise or consist of.

[0055] Preferably, the polypeptide comprises or consists of the amino acid sequence according to SEQ ID NO: 7 (SCFFIYLD) or the amino acid sequence according to SEQ ID NO: 8 (KGSRSCFFIYLD).

[0056] Preferably, the polypeptide comprises two cysteine ​​residues. Without being bound by any theory, the inventors believe that the two cysteine ​​residues may form a disulfide bond, thereby making the polypeptide loop-like, similar to certain human hormones. Thus, the two cysteine ​​residues may advantageously stabilize the structure of the polypeptide. In some embodiments, no additional cysteines are introduced into the polypeptide. Thus, it is preferred that the polypeptide comprises a (single) disulfide bond and / or forms a loop (also called a "cyclic" polypeptide). Thus, it is preferred that the polypeptide comprises two cysteine ​​residues that form a disulfide bond.

[0057] In some embodiments, 10 to 20 amino acids (i.e. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids), preferably 11 to 19 amino acids, more preferably 12 to 18 amino acids, even more preferably 13 to 17 amino acids, even more preferably 14 to 16 amino acids, and most preferably (exactly) 15 amino acids, may be located between the two cysteine ​​residues (and thus form a loop between the disulfide bonds).

[0058] In some embodiments, the polypeptide may comprise two amino acid sequences according to the above described (e.g. according to general formula (I) and / or (Ia) (or one or more embodiments thereof as described above), thereby resulting in the polypeptide comprising two cysteine ​​residues. The two amino acid sequences may be the same or different. For example, the polypeptide may comprise an amino acid sequence according to SEQ ID NO:5 and an amino acid sequence according to SEQ ID NO:7, preferably an amino acid sequence according to SEQ ID NO:6 and an amino acid sequence according to SEQ ID NO:8.

[0059] The present invention also relates to a compound of general formula (II): CX1X2X3YLX4X5X6X7X8X9KGSRX 10 C (II) (In the formula, X1 may be any amino acid; X2 may be any amino acid; X3 may be any amino acid or may be deleted; X4 is P or D; X5 may be any amino acid; X6 may be any amino acid or may be deleted, X7 may be any amino acid; X8 may be any amino acid; X9 is K or Q; X 10 may be any amino acid) Also provided is a polypeptide comprising or consisting of an amino acid sequence according to the invention.

[0060] In particular, X1 to X4 in general formula (II) are defined as described above for general formulas (I) and (Ia), and therefore X1 to X4 in general formula (II) correspond to X1 to X4 in general formula (I).

[0061] Preferably, X5 is selected from the group consisting of R, N, D, Q, E, H, K, S, T and Y, more preferably X5 is selected from the group consisting of R, K, Q and H, and particularly preferably X5 is R.

[0062] Preferably, X6 is deleted or selected from the group consisting of R, N, D, Q, E, H, K, S, T and Y, more preferably X6 is deleted or selected from the group consisting of R, K, Q and H, and particularly preferably X6 is deleted or Q.

[0063] Preferably, X7 is selected from the group consisting of G, A, C, I, L, M, S, F, P, W or V, more preferably X7 is selected from the group consisting of G, A and S, and particularly preferably X7 is G.

[0064] Preferably, X8 is selected from the group consisting of Y, R, N, D, Q, E, K, H, S and T, more preferably X8 is selected from the group consisting of Y, T and S, and particularly preferably X8 is T or Y.

[0065] Preferably, X9 is deleted or selected from the group consisting of R, N, D, Q, E, H, K, S, T and Y, more preferably X9 is deleted or selected from the group consisting of R, K, Q and H, particularly preferably X9 is deleted or K or Q.

[0066] Preferably, X 10 is selected from the group consisting of G, A, C, I, L, M, S, F, P, W or V, more preferably X 10 is selected from the group consisting of G, A and S, and particularly preferably X 10 is S or G.

[0067] It is also preferred that the polypeptide comprises an amino acid sequence according to general formula (I), e.g. (Ia), and an amino acid sequence according to general formula (II), whereby general formulas (I) and (II) may overlap, in particular at (the same) X1 to X4.

[0068] More preferably, the polypeptide has the general formula (IIa): SCFFX3YLX4RX6GX8X9KGSRX 10 C (IIa) (In the formula, X3 is I or deleted, X4 is P or D; X6 is Q or deleted, X8 is T or Y; X9 is K or Q; X 10 is S or G) The amino acid sequence of the present invention is

[0069] In the amino acid sequences of general formula (II) and (IIa), each of X3 and X6 may be independently present or absent. For example, X3 or X6 may both be present. Alternatively, X3 or X6 may both be deleted. However, it is preferred that either X3 or X6 (but not both, X3 and X6) is deleted. Thereby, in general formula (II) and (IIa), 15 amino acid residues are located between the two cysteine ​​residues.

[0070] In some embodiments, the above-described polypeptides of the invention have a length of at least 17 amino acids, such as at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 amino acids. Preferably, the above-described polypeptides of the invention have a length of at least 20 amino acids. More preferably, the above-described polypeptides of the invention have a length of at least 25 amino acids, such as 28 amino acids.

[0071] In a further aspect, the present invention provides a polypeptide comprising or consisting of an amino acid sequence according to SEQ ID NO: 1, optionally in which 0, 1, 2, 3, 4, 5, 6, 7 or 8 amino acids (of SEQ ID NO: 1) may be substituted, added and / or deleted, provided that the serine residue at position 6 of SEQ ID NO: 1 is maintained. Shown below is the amino acid sequence of SEQ ID NO:1 with the serine residue at position 6 of SEQ ID NO:1 underlined.

[0072] [ka]

[0073] The polypeptide having the amino acid sequence of SEQ ID NO:1 is also referred to herein as "NAT_29."

[0074] The inventors have surprisingly found various microbiota proteins that are capable of inducing and / or enhancing IL-10 secretion from human cells as shown in Example 1. As shown in Example 1 (Figure 1), IL-10 secretion from human cells stimulated with exemplary microbiota proteins is higher than that from the same type of human cells stimulated with E. coli lysate. In particular, the microbiota protein "ID3166" (SEQ ID NO: 2) showed extremely high efficacy in inducing and / or enhancing IL-10 secretion even at low doses, as described in Examples 1 and 2. In the following, the amino acid sequence of SEQ ID NO: 2 is shown.

[0075] [ka]

[0076] The inventors focused on the microbiota protein "ID3166" (SEQ ID NO: 2) and its identified fragment of SEQ ID NO: 1 (NAT_29; underlined in the amino acid sequence of SEQ ID NO: 2 shown above). "ID3166" is able to induce and / or enhance IL-10 secretion from human cells as shown in the examples, but does not stimulate pro-inflammatory cytokines such as TNF and IL-6. As shown in the examples, deletion of up to 8 amino acids did not suppress IL-10 secretion. Hence, a polypeptide comprising or consisting of SEQ ID NO: 1, optionally with 0, 1, 2, 3, 4, 5, 6, 7 or 8 amino acids substituted, added and / or deleted, but maintaining the serine residue at position 6 of SEQ ID NO: 1, appears as a candidate drug with anti-inflammatory properties.

[0077] As described above, the amino acid sequence of SEQ ID NO:1 ("NAT_29") is a fragment of the microbiota protein according to SEQ ID NO:2 ("ID3166"). However, the polypeptide of the invention described herein preferably does not comprise or consist of the amino acid sequence according to SEQ ID NO:2 ("ID3166"). In some embodiments, the polypeptide of the invention is a recombinant polypeptide (not naturally occurring), e.g. a (recombinant) fusion protein, which may contain the IL-10 secreting polypeptide of the invention in combination with various domains / functionalities (not naturally occurring in the same protein) that target or stabilize moieties, e.g. a label. Preferably, the polypeptide of the invention does not comprise a (full-length) microbiota protein, e.g. a bacterial or viral protein. In some embodiments, the polypeptide of the invention does not comprise a sequence variant or fragment of a (full-length) microbiota protein, e.g. a bacterial or viral protein, having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% sequence identity to said (full-length) microbiota protein, e.g. SEQ ID NO:2.

[0078] As noted above, the polypeptide may have a (minimum) length of 20 amino acids. In other embodiments, the polypeptide has a (minimum) length of 21 amino acids. In other embodiments, the polypeptide has a (minimum) length of 22 amino acids. In other embodiments, the polypeptide has a (minimum) length of 23 amino acids. In other embodiments, the polypeptide has a (minimum) length of 24 amino acids. In other embodiments, the polypeptide has a (minimum) length of 25 amino acids. In other embodiments, the polypeptide has a (minimum) length of 26 amino acids. In other embodiments, the polypeptide has a (minimum) length of 27 amino acids. Preferably, the polypeptide has a (minimum) length of 28 amino acids.

[0079] In some embodiments, the polypeptide has a (maximum) length of 120 amino acids. In other embodiments, the polypeptide has a (maximum) length of 100 amino acids. In other embodiments, the polypeptide has a (maximum) length of 80 amino acids. In other embodiments, the polypeptide has a (maximum) length of 60 amino acids. In other embodiments, the polypeptide has a (maximum) length of 50 amino acids. Preferably, the polypeptide has a (maximum) length of 40 amino acids, such as a (maximum) length of 35 amino acids.

[0080] Thus, the polypeptide may have a length of 20 to 120 amino acids, preferably 22 to 100 amino acids, more preferably 23 to 80 amino acids, even more preferably 24 to 60 amino acids, even more preferably 25 to 50 amino acids, particularly preferably 26 to 40 amino acids, for example, 27 to 35 amino acids.

[0081] In some embodiments, the polypeptide comprises or consists of an amino acid sequence according to SEQ ID NO: 1, with (exactly) 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, additions and / or deletions, provided that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. Thus, the polypeptide may comprise (exactly) 1, 2, 3, 4, 5, 6, 7 or 8 amino acid mutations (i.e. amino acid substitutions, additions or deletions) compared to SEQ ID NO: 1, provided that the serine at position 6 of SEQ ID NO: 1 (S6) is maintained. Such sequence variants usually preserve the specific functions of the reference sequence, in particular the functionality of inducing and / or enhancing IL-10 secretion (from human cells) as described above.

[0082] Preferably, the polypeptide comprises or consists of an amino acid sequence according to SEQ ID NO: 1, with (precisely) 1, 2, 3, 4, 5, 6 or 7 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. More preferably, the polypeptide comprises or consists of an amino acid sequence according to SEQ ID NO: 1, with (precisely) 1, 2, 3, 4, 5 or 6 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. Even more preferably, the polypeptide comprises or consists of an amino acid sequence according to SEQ ID NO: 1, with (precisely) 1, 2, 3, 4 or 5 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. Even more preferably, the polypeptide comprises or consists of the amino acid sequence according to SEQ ID NO: 1, with (precisely) 1, 2, 3 or 4 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. Particularly preferably, the polypeptide comprises or consists of the amino acid sequence according to SEQ ID NO: 1, with (precisely) 1, 2 or 3 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained. Most preferably, the polypeptide comprises or consists of the amino acid sequence according to SEQ ID NO: 1, with (precisely) 1 or 2 amino acids being substituted, added and / or deleted, with the proviso that the serine residue at position 6 of SEQ ID NO: 1 (S6) is maintained.

[0083] In some embodiments, the lysine residue (K1) at position 1 of SEQ ID NO:1 is maintained. In other embodiments, the lysine residue (K1) at position 1 of SEQ ID NO:1 may be deleted or substituted. The lysine residue (K1) at position 1 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, K1 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, H, S, T and Y. Preferably, K1 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, K1 of SEQ ID NO:1 may be substituted with R or H (arginine or histidine).

[0084] In some embodiments, the lysine residue (K2) at position 2 of SEQ ID NO:1 is maintained. In other embodiments, the lysine residue (K2) at position 2 of SEQ ID NO:1 may be deleted or substituted. The lysine residue (K2) at position 2 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, K2 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, H, S, T and Y. Preferably, K2 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, K2 of SEQ ID NO:1 may be substituted with R or H (arginine or histidine).

[0085] In some embodiments, the glycine residue (G3) at position 3 of SEQ ID NO:1 is maintained. In other embodiments, the glycine residue (G3) at position 3 of SEQ ID NO:1 may be deleted or substituted. The glycine residue (G3) at position 3 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, G3 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, I, L, M, F, P, W or V. Preferably, G3 of SEQ ID NO:1 may be substituted with another aliphatic amino acid. For example, G3 of SEQ ID NO:1 may be substituted with A, I or L. It is also preferred that G3 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, G3 of SEQ ID NO:1 may be substituted with A or S (alanine or serine).

[0086] In some embodiments, the serine residue (S4) at position 4 of SEQ ID NO:1 is maintained. In other embodiments, the serine residue (S4) at position 4 of SEQ ID NO:1 may be deleted or substituted. The serine residue (S4) at position 4 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, S4 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, T and Y. Preferably, S4 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, S4 of SEQ ID NO:1 may be substituted with A or G (alanine or glycine). It is also preferred that S4 of SEQ ID NO:1 may be substituted with another hydroxy amino acid, for example T (threonine).

[0087] In some embodiments, the arginine residue (R5) at position 5 of SEQ ID NO:1 is maintained. In other embodiments, the arginine residue (R5) at position 5 of SEQ ID NO:1 may be deleted or substituted. The arginine residue (R5) at position 5 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, R5 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of N, D, Q, E, H, K, S, T and Y. Preferably, R5 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, R5 of SEQ ID NO:1 may be substituted with K or H (lysine or histidine).

[0088] In some embodiments, the cysteine ​​residue at position 7 (C7) of SEQ ID NO:1 is maintained. In other embodiments, the cysteine ​​residue at position 7 (C7) of SEQ ID NO:1 may be deleted or substituted. The cysteine ​​residue at position 7 (C7) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, C7 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, G, I, L, M, F, P, W or V. Preferably, C7 of SEQ ID NO:1 may be substituted with another small amino acid. For example, C7 of SEQ ID NO:1 may be substituted with A, G or S, preferably A or G (alanine or glycine).

[0089] In some embodiments, the phenylalanine residue (F8) at position 8 of SEQ ID NO:1 is maintained. In other embodiments, the phenylalanine residue (F8) at position 8 of SEQ ID NO:1 may be deleted or substituted. The phenylalanine residue (F8) at position 8 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, F8 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, L, M, P, W or V. Preferably, F8 of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, F8 of SEQ ID NO:1 may be substituted with H, W or Y (histidine, tryptophan or tyrosine).

[0090] In some embodiments, the phenylalanine residue (F9) at position 9 of SEQ ID NO:1 is maintained. In other embodiments, the phenylalanine residue (F9) at position 9 of SEQ ID NO:1 may be deleted or substituted. The phenylalanine residue (F9) at position 9 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, F9 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, L, M, P, W or V. Preferably, F9 of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, F9 of SEQ ID NO:1 may be substituted with H, W or Y (histidine, tryptophan or tyrosine).

[0091] In some embodiments, the isoleucine residue (I10) at position 10 of SEQ ID NO:1 is maintained. In other embodiments, the isoleucine residue (I10) at position 10 of SEQ ID NO:1 can be deleted or substituted. The isoleucine residue (I10) at position 10 of SEQ ID NO:1 can be substituted with any amino acid, but conservative substitutions are preferred. For example, I10 of SEQ ID NO:1 can be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, L, M, F, P, W or V. Preferably, I10 of SEQ ID NO:1 can be substituted with another aliphatic amino acid. For example, I10 of SEQ ID NO:1 can be substituted with A, G or L (alanine, glycine or leucine).

[0092] In some embodiments, the tyrosine residue at position 11 (Y11) of SEQ ID NO:1 is maintained. In other embodiments, the tyrosine residue at position 11 (Y11) of SEQ ID NO:1 may be deleted or substituted. The tyrosine residue at position 11 (Y11) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, the tyrosine residue at position 11 (Y11) of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, S and T. Preferably, the tyrosine residue at position 11 (Y11) of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, the tyrosine residue at position 11 (Y11) of SEQ ID NO:1 may be substituted with H, W or F (histidine, tryptophan or phenylalanine).

[0093] In some embodiments, the leucine residue (L12) at position 12 of SEQ ID NO:1 is maintained. In other embodiments, the leucine residue (L12) at position 12 of SEQ ID NO:1 may be deleted or substituted. The leucine residue (L12) at position 12 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, L12 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, M, F, P, W or V. Preferably, L12 of SEQ ID NO:1 may be substituted with another aliphatic amino acid. For example, L12 of SEQ ID NO:1 may be substituted with A, G or I (alanine, glycine or isoleucine).

[0094] In some embodiments, the aspartic acid residue at position 13 (D13) of SEQ ID NO:1 is maintained. In other embodiments, the aspartic acid residue at position 13 (D13) of SEQ ID NO:1 may be deleted or substituted. The aspartic acid residue at position 13 (D13) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, D13 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, Q, E, K, H, S, T and Y. Preferably, D13 of SEQ ID NO:1 may be substituted with another negatively charged or acidic amino acid, for example E (glutamic acid). It is also preferred that D13 is substituted with P (proline).

[0095] In some embodiments, the arginine residue at position 14 (R14) of SEQ ID NO:1 is maintained. In other embodiments, the arginine residue at position 14 (R14) of SEQ ID NO:1 may be deleted or substituted. The arginine residue at position 14 (R14) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, R14 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of N, D, Q, E, H, K, S, T and Y. Preferably, R14 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, R14 of SEQ ID NO:1 may be substituted with K or H (lysine or histidine).

[0096] In some embodiments, the glycine residue at position 15 (G15) of SEQ ID NO:1 is maintained. In other embodiments, the glycine residue at position 15 (G15) of SEQ ID NO:1 may be deleted or substituted. The glycine residue at position 15 (G15) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, G15 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, I, L, M, F, P, W or V. Preferably, G15 of SEQ ID NO:1 may be substituted with another aliphatic amino acid. For example, G15 of SEQ ID NO:1 may be substituted with A, I or L. It is also preferred that G15 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, G15 of SEQ ID NO:1 may be substituted with A or S (alanine or serine).

[0097] In some embodiments, the threonine residue at position 16 (T16) of SEQ ID NO: 1 is maintained. In other embodiments, the threonine residue at position 16 (T16) of SEQ ID NO: 1 may be deleted or substituted. The threonine residue at position 16 (T16) of SEQ ID NO: 1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, T16 of SEQ ID NO: 1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, S and Y. Preferably, T16 of SEQ ID NO: 1 may be substituted with A, S, Y or G (alanine, serine, tyrosine or glycine), in particular S or Y (serine or tyrosine).

[0098] In some embodiments, the lysine residue at position 17 (K17) of SEQ ID NO:1 is maintained. In other embodiments, the lysine residue at position 17 (K17) of SEQ ID NO:1 may be deleted or substituted. The lysine residue at position 17 (K17) of SEQ ID NO:1 may be substituted with any amino acid, although conservative substitutions are preferred. For example, K17 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, H, S, T and Y. Preferably, K17 of SEQ ID NO:1 may be substituted with Q, R or H (glutamine, arginine or histidine).

[0099] In some embodiments, the lysine residue at position 18 (K18) of SEQ ID NO:1 is maintained. In other embodiments, the lysine residue at position 18 (K18) of SEQ ID NO:1 may be deleted or substituted. The lysine residue at position 18 (K18) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, K18 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, H, S, T and Y. Preferably, K18 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, K18 of SEQ ID NO:1 may be substituted with R or H (arginine or histidine).

[0100] In some embodiments, the glycine residue (G19) at position 19 of SEQ ID NO:1 is maintained. In other embodiments, the glycine residue (G19) at position 19 of SEQ ID NO:1 may be deleted or substituted. The glycine residue (G19) at position 19 of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, G19 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, I, L, M, F, P, W, or V. Preferably, G19 of SEQ ID NO:1 may be substituted with another aliphatic amino acid. For example, G19 of SEQ ID NO:1 may be substituted with A, I, or L. It is also preferred that G19 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, G19 of SEQ ID NO:1 may be substituted with A or S (alanine or serine).

[0101] In some embodiments, the serine residue at position 20 (S20) of SEQ ID NO:1 is maintained. In other embodiments, the serine residue at position 20 (S20) of SEQ ID NO:1 may be deleted or substituted. The serine residue at position 20 (S20) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, S20 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, T and Y. Preferably, S20 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, S20 of SEQ ID NO:1 may be substituted with A or G (alanine or glycine). It is also preferred that S20 of SEQ ID NO:1 may be substituted with another hydroxy amino acid, for example T (threonine).

[0102] In some embodiments, the arginine residue at position 21 (R21) of SEQ ID NO:1 is maintained. In other embodiments, the arginine residue at position 21 (R21) of SEQ ID NO:1 may be deleted or substituted. The arginine residue at position 21 (R21) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, R21 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of N, D, Q, E, H, K, S, T and Y. Preferably, R21 of SEQ ID NO:1 may be substituted with another basic or positively charged amino acid. For example, R21 of SEQ ID NO:1 may be substituted with K or H (lysine or histidine).

[0103] In some embodiments, the serine residue at position 22 (S22) of SEQ ID NO:1 is maintained. In other embodiments, the serine residue at position 22 (S22) of SEQ ID NO:1 may be deleted or substituted. The serine residue at position 22 (S22) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, S22 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, T and Y. Preferably, S22 of SEQ ID NO:1 may be substituted with another very small amino acid. For example, S22 of SEQ ID NO:1 may be substituted with A or G (alanine or glycine). S22 of SEQ ID NO:1 may be substituted with another hydroxy amino acid, for example T (threonine). Also preferred.

[0104] In some embodiments, the cysteine ​​residue at position 23 (C23) of SEQ ID NO:1 is maintained. In other embodiments, the cysteine ​​residue at position 23 (C23) of SEQ ID NO:1 may be deleted or substituted. The cysteine ​​residue at position 23 (C23) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, C23 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, G, I, L, M, F, P, W or V. Preferably, C23 of SEQ ID NO:1 may be substituted with another small amino acid. For example, C23 of SEQ ID NO:1 may be substituted with A, G or S, preferably A or G (alanine or glycine).

[0105] In some embodiments, the phenylalanine residue at position 24 (F24) of SEQ ID NO:1 is maintained. In other embodiments, the phenylalanine residue at position 24 (F24) of SEQ ID NO:1 may be deleted or substituted. The phenylalanine residue at position 24 (F24) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, F24 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, L, M, P, W or V. Preferably, F24 of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, F24 of SEQ ID NO:1 may be substituted with H, W or Y (histidine, tryptophan or tyrosine).

[0106] In some embodiments, the phenylalanine residue at position 25 (F25) of SEQ ID NO:1 is maintained. In other embodiments, the phenylalanine residue at position 25 (F25) of SEQ ID NO:1 may be deleted or substituted. The phenylalanine residue at position 25 (F25) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, F25 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, L, M, P, W or V. Preferably, F25 of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, F25 of SEQ ID NO:1 may be substituted with H, W or Y (histidine, tryptophan or tyrosine).

[0107] In some embodiments, the tyrosine residue at position 26 (Y26) of SEQ ID NO:1 is maintained. In other embodiments, the tyrosine residue at position 26 (Y26) of SEQ ID NO:1 may be deleted or substituted. The tyrosine residue at position 26 (Y26) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, Y26 of SEQ ID NO:1 may be substituted with another polar amino acid, for example selected from the group consisting of R, N, D, Q, E, K, H, S and T. Preferably, Y26 of SEQ ID NO:1 may be substituted with another aromatic amino acid. For example, Y26 of SEQ ID NO:1 may be substituted with H, W or F (histidine, tryptophan or phenylalanine).

[0108] In some embodiments, the leucine residue at position 27 (L27) of SEQ ID NO:1 is maintained. In other embodiments, the leucine residue at position 27 (L27) of SEQ ID NO:1 may be deleted or substituted. The leucine residue at position 27 (L27) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, L27 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, M, F, P, W or V. Preferably, L27 of SEQ ID NO:1 may be substituted with another aliphatic amino acid. For example, L27 of SEQ ID NO:1 may be substituted with A, G or I (alanine, glycine or isoleucine).

[0109] In some embodiments, the proline residue at position 28 (P28) of SEQ ID NO:1 is maintained. In other embodiments, the proline residue at position 28 (P28) of SEQ ID NO:1 may be deleted or substituted. The proline residue at position 28 (P28) of SEQ ID NO:1 may be substituted with any amino acid, but conservative substitutions are preferred. For example, P28 of SEQ ID NO:1 may be substituted with another non-polar amino acid, for example selected from the group consisting of A, C, G, I, L, M, F, W or V. Preferably, P28 of SEQ ID NO:1 may be substituted with another small amino acid. For example, P28 of SEQ ID NO:1 may be substituted with A, G, S or T (alanine, glycine, serine or threonine).

[0110] Preferably, the cysteine ​​residues at positions 7 and / or 23 (C7 and / or C23) of SEQ ID NO:1 are maintained in the polypeptides of the invention (in addition to the serine residue at position 6 (S6) of SEQ ID NO:1). As mentioned above, without being bound by any theory, the inventors believe that the cysteine ​​residues at positions 7 and 23 may form a disulfide bond, thereby making the polypeptide looped similar to certain human hormones. Thus, the cysteines at positions 7 and 23 of SEQ ID NO:1 may advantageously stabilize the structure of the polypeptide. In some embodiments, no additional cysteines (in addition to C7 and C23) are introduced into SEQ ID NO:1. Thus, it is preferred that the polypeptide comprises a (single) disulfide bond and / or forms a loop (also called a "cyclic" polypeptide). In some embodiments, 10 to 20 amino acids (i.e. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids), preferably 11 to 19 amino acids, more preferably 12 to 18 amino acids, even more preferably 13 to 17 amino acids, even more preferably 14 to 16 amino acids, and most preferably (exactly) 15 amino acids, may be located between the two cysteine ​​residues (and thus form a loop between the disulfide bonds).

[0111] It is also preferred that the serine residue at position 22 (S22) of SEQ ID NO: 1 is maintained, in addition to the serine residue at position 6 (S6) of SEQ ID NO: 1. More preferably, the serine residues at positions 6 (S6) and 22 (S22) and the cysteine ​​residues at positions 7 (C7) and 23 (C23) of SEQ ID NO: 1 are maintained, but 0, 1, 2, 3, 4 or 5 of the remaining amino acids of SEQ ID NO: 1 (i.e., amino acids other than S6, C7, S22 and C23) may be substituted, added and / or deleted.

[0112] In some embodiments, the polypeptide comprises the sequence motif YLP and / or YLD (e.g. corresponding to positions 11-13 and / or 26-28 of SEQ ID NO: 1). For example, Y11, L12 and D13 of SEQ ID NO: 1 may be maintained. Alternatively or additionally, Y26, L27 and P28 of SEQ ID NO: 1 may be maintained. Preferably, the sequence motif YLP or YLD is located downstream (C-terminal side) of the cysteine ​​residue, for example at a position corresponding to C7 and / or C23 of SEQ ID NO: 1. Thereby, two or three amino acids may be located between the cysteine ​​residue and the YLP or YLD motif, for example as shown in SEQ ID NOs: 3 and 4 below (X may be any amino acid): SCXXYLP (SEQ ID NO:3) SCXXXYLD (SEQ ID NO:4)

[0113] Preferably, the amino acid located between the cysteine ​​residue and the YLP or YLD motif is a phenylalanine or isoleucine residue, for example as shown in SEQ ID NOs: 5 and 7 below (wherein X can be any amino acid): SCFFYLP (SEQ ID NO:5) SCFFIYLD (SEQ ID NO:7)

[0114] Preferably, the amino acid sequences according to SEQ ID NO: 6 and / or 8 may be maintained in SEQ ID NO: 1: KKGSRCFFYLP (SEQ ID NO:6) KKGSRSCFFIYLD (SEQ ID NO:8)

[0115] In some embodiments, a polypeptide of the invention may comprise or consist of an amino acid sequence according to SEQ ID NO:1 (NAT_29).

[0116] In some embodiments, a polypeptide of the invention may comprise or consist of an amino acid sequence according to SEQ ID NO: 9 (NAT_38).

[0117] In particular, the polypeptides of the present invention can induce and / or enhance IL-10 secretion from human cells. In light of the functionality of inducing and / or enhancing IL-10 secretion from human cells, the polypeptides of the present invention can also be referred to as "secretagogues." In general, the term "secretagogue" refers to a substance that causes the secretion of other substances. A variety of human cells, including immune cells and non-immune cells (e.g., epithelial and neuronal cells), have been described to secrete IL-10. Preferably, the polypeptide induces and / or enhances IL-10 secretion from human immune cells, such as peripheral blood mononuclear cells (PBMCs). For example, a variety of blood cell types, including lymphocytes, monocytes, dendritic cells, and granulocytes, have been reported to produce IL-10. In some embodiments, the polypeptide induces and / or enhances IL-10 secretion from monocytes. In some embodiments, the polypeptide induces and / or enhances IL-10 secretion from lymphocytes, such as T lymphocytes.

[0118] Those skilled in the art are aware of various methods to identify whether a polypeptide can induce and / or enhance IL-10 secretion from human cells. For example, human cells capable of secreting IL-10 (e.g., PBMCs, lymphocytes, monocytes, dendritic cells, or granulocytes, as outlined above) can be cultured in the presence and absence of a polypeptide, and IL-10 secretion in both cases (with / without the polypeptide) can be compared. For such comparison purposes, it is understood that the human cells and other experimental conditions (other than the presence / absence of the polypeptide) used are usually identical. In some embodiments, to assess induction of IL-10 secretion, the culture medium may lack IL-10-inducing compounds (other than the polypeptide, for each experimental group). In other embodiments, to assess enhancement of IL-10 secretion, IL-10-inducing compounds (other than the polypeptide) may be added to observe whether IL-10 secretion can be increased. Examples of IL-10 inducing compounds useful in such experiments include lipopolysaccharide (LPS), bacterial lysates, phytohemagglutinin (PHA), and other compounds known to induce inflammatory responses or directly induce IL-10 (e.g., in humans / human cells). Control compounds may be used in comparison cells cultured in the absence of the polypeptide of the invention. For example, such cells may be cultured in the presence of a negative control (not IL-10 inducing / enhancing) or a positive control (known to be IL-10 inducing / enhancing). Kits for determining IL-10 secretion are commercially available. For example, human IL-10 AlphaLisa (registered trademark) kit (Perkin), "IL-10 Human ELISA Kit" (Invitrogen); "Human IL-10 Quantikine ELISA Kit D1000B" (R&D Systems); "Simoa (registered trademark) IL-10 Advantage Kit" (Quanterix); "IL-10 Secretion Assay" (Miltenyi Biotec); "Human IL10 Kit" (Cisbio); "Human IL-10 ELISA Kit" (Abcam), and the like.Specific examples for determining whether a polypeptide is capable of inducing and / or enhancing IL-10 secretion from human cells are provided in the Examples section herein. In general, a polypeptide is considered to be capable of inducing and / or enhancing IL-10 secretion from human cells if the human cells produce more IL-10 when cultured in the presence of the polypeptide compared to the same human cell type cultured under the same conditions but in the absence of the polypeptide.

[0119] In some embodiments, secretion of IL-10 from human cells cultured in the presence of a polypeptide of the invention is at least 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold higher than the IL-10 levels produced by the same type of human cells cultured in the absence of a polypeptide of the invention and / or cultured with a control compound.

[0120] In some embodiments, IL-10 secretion from human cells stimulated with a polypeptide of the invention is the same as or higher than IL-10 secretion from human cells of the same type stimulated with LPS, e.g., 10-100 ng / ml, e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 ng / ml LPS (but under otherwise the same conditions). In some embodiments, IL-10 secretion from human cells stimulated with the polypeptide is the same as or higher than IL-10 secretion stimulated with 10 or 100 ng / ml lipopolysaccharide (LPS).

[0121] In some embodiments, IL-10 secretion from human cells stimulated with the polypeptide of the present invention is higher than IL-10 secretion from the same type of human cells stimulated with E. coli lysate. (Cell-free) E. coli lysate is commercially available or can be prepared by methods known in the art, such as sonication, homogenization, enzymatic lysis (e.g., using lysozyme), or freezing and crushing. Preferably, E. coli lysate can be prepared by the method described in Zubay G. In vitro synthesis of protein in microbial systems. Annu Rev Genet. 1973;7:267-87, which is incorporated herein by reference. Further suitable methods for preparing high yield E. coli lysates are described in Kim, DM., Swartz, JR Oxalate improves protein synthesis by enhancing ATP supply in a cell-free system derived from Escherichia coli. Biotechnology Letters 22, 1537-1542 (2000). https: / / doi.org / 10.1023 / A:1005624811710; and Kim DM, Swartz JR. Regeneration of adenosine triphosphate from glycolytic intermediates for cell-free protein synthesis. Biotechnol Bioeng. 20 Aug. 2001; 74(4):309-16, which are incorporated herein by reference. E. coli strains with low exonuclease activity may be used and growth conditions may be optimized to allow optimal protein expression from linear and plasmid templates.

[0122] In some embodiments, IL-10 secretion from human cells stimulated with the polypeptide of the present invention is higher than IL-10 secretion from the same type of human cells stimulated with phytohemagglutinin (PHA). Phytohemagglutinin (PHA) is an extract from red kidney bean (Phaseolus vulgaris) that contains strong cell agglutinating and mitogenic properties. PHA is known to induce IL-10 secretion from human cells and is therefore often used as a positive control. In certain embodiments, IL-10 secretion from human cells stimulated with 0.1 μM of the polypeptide of the present invention is higher than IL-10 secretion from the same type of human cells stimulated with 10 μg / ml PHA. In certain examples, IL-10 secretion from human cells stimulated with a concentration as low as 0.025 μM of the polypeptide of the present invention is still higher than IL-10 secretion from the same type of human cells stimulated with 10 μg / ml PHA.

[0123] Preparation of Polypeptides The polypeptides of the invention can be prepared by artificial recombinant or synthetic means (i.e., the polypeptides can be prepared by either recombinant protein synthesis or chemical peptide synthesis). For example, the polypeptides can be prepared by chemical synthesis in vitro or expressed by another organism (other than the organism from which the sequence was obtained; "heterologous expression"). Thus, the polypeptides of the invention are specifically recombinant polypeptides. In some embodiments, the polypeptides of the invention are prepared by chemical synthesis. In some embodiments, the polypeptides of the invention are prepared by in vitro synthesis (cell-free expression) or recombinant overexpression (e.g., in bacterial cells). Preferably, the polypeptides are purified.

[0124] A person skilled in the art knows various methods of preparing a polypeptide based on an amino acid or nucleic acid sequence. For example, a polypeptide can be prepared by chemical synthesis, in vitro synthesis (cell-free expression) or (in vivo) recombinant (over)expression.

[0125] For example, the polypeptides of the invention may be (heterologously) expressed by bacteria, such as E. coli, transformed with an expression vector comprising a nucleic acid sequence encoding a polypeptide known in the art. In vitro protein synthesis (also called "in vitro protein expression", "cell-free protein expression" and "cell-free protein synthesis") is the production of recombinant proteins in solution using biomolecular translation machinery extracted from cells. In vitro protein synthesis occurs in cell lysates or cocktails of recombinant proteins rather than in cultured cells, and is therefore accomplished without the use of living cells. The in vitro protein synthesis environment is not constrained by cell walls or homeostatic conditions necessary to maintain cell viability. In vitro protein synthesis therefore allows for direct access and control of the translation environment. Furthermore, this approach allows for rapid expression and production of functional proteins. In vitro protein synthesis is useful for a variety of applications including optimization of protein production, optimization of protein complexes for studying protein synthesis, incorporation of unnatural amino acids, high throughput screening, functional analysis, molecular interaction detection, molecular structure and localization analysis, and molecular diagnostics.

[0126] Common components of cell-free reactions include proteins, e.g., a cocktail of recombinant proteins or cell extracts, necessary to achieve in vitro transcription and transduction. Additionally, an energy source, a supply of amino acids, a nucleic acid encoding the polypeptide to be expressed, and optionally cofactors such as magnesium, may be added. In vitro protein synthesis can be achieved using cell extracts of several types and species, or a cocktail of recombinant proteins. Cell extracts can be obtained, for example, by lysing the cells of interest so that the necessary cellular machinery (including ribosomes, aminoacyl t-RNA synthetases, translation initiation and elongation factors, nucleases, etc.) remains, and centrifuging off the cell walls, DNA genomes, and other debris. Examples include cell extracts made from Escherichia coli (ECE), rabbit reticulocytes (RRL), wheat germ (WGE), insect cells (ICE, e.g., SF9 or SF21), and human cells, all of which are commercially available. Examples of commercially available in vitro protein synthesis systems include, but are not limited to, RTS (5 PRIME); Expressway™ (Life Technologies); S30 T7 high yield (Promega); One-step human IVT (Thermo Scientific); WEPRO® (CellFree Sciences); TNT® coupled (Promega); RTS CECF (5 PRIME); TNT® Coupled (Promega); Retic lysate IVT™ (Life Technologies); TNT® T7 (Promega); EasyXpress Insect kit (Qiagen / RiN A); PURExpress® (New England Biolabs); and PURESYSTEM® (BioComber). In some embodiments, PURExpress® (New England Biolabs), a cocktail of recombinant proteins necessary to achieve in vitro transcription and transduction, may be used.In other embodiments, bacterial extracts or lysates (e.g. from E. coli), especially ECE (E. coli extracts) can be used, since they provide a bacterial machinery (ideal for the expression of bacterial proteins) and typically achieve high yields. A more detailed description of in vitro protein synthesis in bacterial extracts can be obtained from Hani S. Zaher, Rachel Green: Chapter One - In Vitro Synthesis of Proteins in Bacterial Extracts, edited by Jon Lorsch, Methods in Enzymology, Academic Press, Vol. 539, 2014, pp. 3-15, ISSN 0076-6879, ISBN 9780124201200. Kits for cell-free heterologous expression are commercially available, for example the E. coli cell-free kit (RTS 100 E. coli Disulfide Kit; Biotechrabbit, Hennigsdorf, Germany).

[0127] The nucleic acid used in in vitro protein synthesis is preferably RNA or DNA. For example, isolated RNA (particularly mRNA) synthesized in vivo or in vitro can be used as a translation template. It is also preferred to use DNA, particularly a translation / transcription coupled system, in which circular or linear DNA, e.g. genes / ORFs (cDNA) cloned into a plasmid vector, or linear DNA templates, e.g. PCR-generated templates, are used. The nucleic acid may be codon-optimized. In some embodiments, direct synthesis of DNA is used, preferably by codon optimization.

[0128] Nucleic acids, e.g. synthetic DNA molecules, can be subcloned into vectors or plasmids, e.g. for (over)expression or heterologous expression of the encoded protein. The vector may be an expression vector, which can be used for the production of an expression product, such as a polypeptide. For example, an expression vector or an expression plasmid may contain sequences required for the transcription of the sequence stretch of the vector, e.g. a promoter sequence (e.g. a T7 promoter). Thus, the vector may contain a (T7) promoter. A "promoter" is usually a DNA sequence that drives the transcription of a polynucleotide encoding a polypeptide (of the invention). A promoter is usually located in the 5' region of a gene, in particular proximal to the transcription start site of the polynucleotide encoding the polypeptide (of the invention). A promoter may be inducible. Furthermore, the vector may contain specific tags, if necessary. In some embodiments, the vector or plasmid contains regulatory or control elements for the heterologous expression of a polypeptide of the invention in bacterial cells.

[0129] In vitro / cell-free protein synthesis is preferably applied to proteins / polypeptides having a minimum length of 20 amino acids, preferably having a minimum length of 30 amino acids, more preferably having a minimum length of 40 amino acids, even more preferably having a minimum length of 45 amino acids, even more preferably having a minimum length of 50 amino acids. For example, polypeptides having a length of 50-350 amino acids or 50-500 amino acids (preferably without a signal peptide) are synthesized by in vitro / cell-free protein synthesis as described above.

[0130] Alternatively, the polypeptides of the invention can be prepared by chemical synthesis as known in the art and as described, for example, by Fields GB. Introduction to peptide synthesis. Curr Protoc Protein Sci. 2002; Chapter 18:Unit-18.1. doi:10.1002 / 0471140864.ps1801s26. For example, solid-phase techniques known in the art (Solid Phase Peptide Synthesis (SPPS)) may be used, for example applying Fmoc-based chemistry. SPPS allows the rapid assembly of peptide chains by sequential reactions of amino acid derivatives on an insoluble porous support. Alternatively, liquid phase peptide synthesis (LPPS) may be used. A variety of commercial suppliers of chemical protein and peptide synthesis are available, e.g., Pepscan (Lelystad, The Netherlands), GenScript (Piscataway, NJ, USA), LifeTein (Somerset, NJ, USA), JPT (Berlin, Germany), and SB-Peptide (Saint-Egreve, France).

[0131] Chemical synthesis, e.g. SPPS, can be applied to polypeptides having a maximum length of 100 amino acids, preferably having a maximum length of 90 amino acids, more preferably having a maximum length of 80 amino acids, even more preferably having a maximum length of 70 or 60 amino acids, even more preferably having a maximum length of 50 amino acids. For example, polypeptides having a length of 15 to 50 amino acids or 20 to 50 amino acids are synthesized by chemical synthesis, e.g. SPPS.

[0132] In some embodiments, longer polypeptides, e.g., having lengths as described above (e.g., 50-350 amino acids), may be synthesized by in vitro / cell-free protein synthesis or recombinant overexpression, and shorter proteins, e.g., having lengths as described above (e.g., 20-50 amino acids), may be synthesized by chemical synthesis, e.g., SPPS.

[0133] Nucleic acids and vectors encoding polypeptides In a further aspect, the present invention also provides a nucleic acid comprising a polynucleotide encoding a polypeptide according to the invention as described above.

[0134] A nucleic acid (molecule) is a molecule that contains a nucleic acid component. The term nucleic acid (molecule) usually refers to DNA or RNA (molecule). The term may be used synonymously with the term "polynucleotide". That is, a nucleic acid molecule may consist of a polynucleotide that encodes a polypeptide of the invention. Alternatively, a nucleic acid molecule may contain additional elements in addition to a polynucleotide that encodes a polypeptide. Typically, a nucleic acid molecule is a polymer that comprises or consists of nucleotide monomers covalently linked to each other by sugar / phosphate backbone phosphodiester bonds. The term "nucleic acid (molecule)" also encompasses modified nucleic acids (molecules), such as DNA or RNA molecules that are base-, sugar-, or backbone-modified.

[0135] The nucleic acid preferably comprises a single-stranded, double-stranded or partially double-stranded nucleic acid, preferably selected from genomic DNA, cDNA, RNA, siRNA, antisense DNA, antisense RNA, ribozyme, complementary RNA / DNA sequence (with or without expression elements), minigene, gene fragment, regulatory element, promoter, and combinations thereof. Further preferred examples of nucleic acid (molecule) include, for example, recombinant polynucleotide, vector, oligonucleotide, RNA molecule, such as rRNA, mRNA or tRNA, or DNA molecule as described above. Thus, the nucleic acid (molecule) is preferably a DNA molecule or an RNA molecule, preferably selected from genomic DNA; cDNA; rRNA; mRNA; antisense DNA; antisense RNA; complementary RNA and / or DNA sequence; RNA and / or DNA sequence with or without expression elements, regulatory elements, and / or promoter; vector; and combinations thereof.

[0136] The nucleic acid encoding the polypeptide according to the invention may be in the form of naked nucleic acid or nucleic acid cloned into a plasmid or viral vector (Tregoning and Kinnear, Using Plasmids as DNA Vaccines for Infectious Diseases. Microbiol Spectr. 2014 Dec;2(6). doi: 10.1128 / microbiolspec.PLAS-0028-2014), the latter being preferred. Examples of suitable viral vectors according to the invention include, but are not limited to, retrovirus, adenovirus, adeno-associated virus (AAV), herpes virus, and poxvirus vectors. It is within the skill of the art to clone a nucleic acid into a plasmid or viral vector using standard recombinant methods in the art.

[0137] In general, nucleic acids (molecules) can be engineered to insert, delete, or change certain nucleic acid sequences. Changes from such engineering include, but are not limited to, changes to introduce restriction sites, modify codon usage, add or optimize transcriptional and / or translational regulatory sequences, etc. Nucleic acids can also be altered to change the encoded amino acids. For example, it can be useful to introduce one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid substitutions, deletions, and / or insertions into the amino acid sequence of a polypeptide. Such point mutations can modify effector functions, post-translational modifications, immunogenicity, etc., can introduce amino acids for attachment of covalent groups (e.g., labels) or can introduce tags (e.g., for purification purposes). Alternatively, mutations in the nucleic acid sequence can be "silent", i.e., not reflected in the amino acid sequence due to redundancy in the genetic code. In general, mutations can be introduced at specific sites or can be introduced randomly and then selected for (e.g., molecular evolution). For example, one or more nucleic acids encoding the polypeptides of the invention can be randomly or directedly mutated to introduce different properties into the encoded amino acids. Such changes can be the result of an iterative process in which the original changes are retained and new changes at other nucleotide positions are introduced. Moreover, changes achieved in independent steps can be combined.

[0138] In some embodiments, a polynucleotide (or a (complete) nucleic acid molecule) encoding a polypeptide may be codon optimized. The skilled artisan knows various tools for codon optimization, such as those described in Ju Xin Chin, Bevan Kai-Sheng Chung, Dong-Yup Lee, Codon Optimization OnLine (COOL): a web-based multi-objective optimization platform for synthetic gene design, Bioinformatics, Vol. 30, No. 15, 1 August 2014, pp. 2210-2212; or Grote A, Hiller K, Scheer M, Munch R, Nortemann B, Hempel DC, Jahn D, JCat: a novel tool to adapt codon usage of a target gene to its potential expression host. Nucleic Acids Res. 1 July 2005; 33 (Web Server Issue): W526-31; or US 2011 / 0081708 A1; or tools offered by commercial suppliers, such as the codon optimization algorithm offered by Twist Bioscience (San Francisco, USA). In some embodiments, the polynucleotide (or (complete) nucleic acid molecule) encoding the polypeptide is codon-optimized for expression by a prokaryotic cell, preferably for expression in a bacterium such as E. coli.

[0139] In particular, the preferred embodiments of the polypeptides according to the invention described above also apply to such nucleic acids according to the invention. For example, a nucleic acid may code for a polypeptide comprising or consisting of the amino acid sequence set out in SEQ ID NO: 1, optionally with 0, 1, 2, 3, 4, 5, 6, 7 or 8 amino acids substituted, added and / or deleted, provided that the serine residue at position 6 of SEQ ID NO: 1 is maintained.

[0140] Nucleotide sequence of SEQ ID NO:10: AAAAAAGGCAGCAGAAGCTGCTTTTTTATTTACCTCGACAGGGGTACCAAAAAAGGCAGCAGAAGCTGCTTTTTTTATTTACCT is a specific example of a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO:1.

[0141] Thus, it is preferred that the polynucleotide encoding the polypeptide of the present invention comprises or consists of the nucleic acid sequence set forth in SEQ ID NO: 10, or a sequence variant thereof as described above. For example, the nucleic acid sequence of said polynucleotide may share at least 80% sequence identity with SEQ ID NO: 10. It is understood that for any sequence variant, the nucleotide sequence encoding serine at position 6 (S6) of SEQ ID NO: 1 is maintained. More preferably, the polynucleotide encoding the polypeptide has a nucleic acid sequence according to SEQ ID NO: 10. However, it is understood that due to redundancy in the genetic code, different nucleic acid sequences may encode the same amino acid sequence. Thus, the polypeptide of SEQ ID NO: 1 may also be encoded by a nucleic acid different from the exemplified nucleic acids mentioned above.

[0142] Due to the redundancy of the genetic code, the present invention also includes sequence variants of nucleic acid sequences that code for the same amino acid sequence. A polynucleotide encoding a polypeptide can be optimized for expression of the polypeptide. For example, codon optimization of a nucleotide sequence can be used to improve the efficiency of translation in an expression system that produces the polypeptide. Furthermore, a nucleic acid molecule can include heterologous elements (i.e., elements that are not naturally present in the same nucleic acid molecule as the coding sequence of the polypeptide). For example, a nucleic acid molecule can include a heterologous promoter, a heterologous enhancer, a heterologous UTR (e.g., for optimal translation / expression), a heterologous polyA tail, etc.

[0143] In some embodiments, the nucleic acid may further comprise (in addition to a polynucleotide encoding a polypeptide according to the present invention) a polynucleotide encoding a signal peptide (secretory or export peptide) or a secretion tag.

[0144] A signal peptide or secretion tag typically indicates that a protein is designed for the secretory pathway. Thus, a protein that includes a signal peptide or secretion tag is typically secreted from a cell, for example, from a bacterium that expresses the protein. A signal peptide is usually located at the N-terminus (i.e., N-terminal) of a protein. A signal peptide is typically recognized by the secretory machinery of a cell. Non-limiting examples of signal peptides suitable for protein secretion are described in Degering et al. (Degering C et al., Optimization of protease secretion in Bacillus subtilis and Bacillus licheniformis by screening of homologous and heterologous signal peptides. Appl Environ Microbiol. 2010 October;76(19):6370-6. doi: 10.1128 / AEM.01146-10) and Watanabe et al. (Watanabe K et al., Scanning the Corynebacterium glutamicum R genome for high-efficiency secretion signal sequences. Microbiology (Reading). 2009 March;155(Pt 3):741-750. doi: 10.1099 / mic.0.024075-0.), which are incorporated by reference in their entireties.

[0145] As described in Freudl R. Signal peptides for recombinant protein secretion in bacterial expression systems. Microb Cell Fact. 2018 May 29;17(1):52, there are two major export pathways in bacteria for transporting proteins across the cytoplasmic membrane, the common secretion pathway or Sec pathway, and the twin-arginine transport pathway or Tat pathway. In some embodiments, the polynucleotide encodes a secretion tag that is a prototypic N-terminal Sec-dependent secretion signal or a Tat-dependent secretion signal.

[0146] The polynucleotide encoding the signal peptide and the polynucleotide encoding the polypeptide according to the invention may be comprised in the same open reading frame (ORF). Thus, after expression, the polypeptide of the invention may be operably linked to the signal peptide. In other words, the protein expression may produce a fusion protein comprising (i) the signal peptide and (ii) the polypeptide according to the invention. Thereby, the signal peptide is preferably located at the N-terminus of the polypeptide according to the invention, more preferably the signal peptide is located at the N-terminus (of the fusion protein). Thus, the polynucleotide encoding the signal peptide and the polynucleotide encoding the polypeptide according to the invention may be arranged such that the polynucleotide encoding the signal peptide is located at the 5'-terminus of the sequence encoding the fusion protein.

[0147] In some embodiments, the signal peptide or secretion tag may be removed (e.g. by cleavage) e.g. before, during or after secretion, such that the (mature) protein does not contain the signal peptide. In particular, the signal peptide or secretion tag may be cleaved upon secretion into the periplasmic space. For example, the secretion apparatus may be able to remove the signal peptide before secreting the protein from the host cell, e.g. an engineered bacterium. For example, in type V autocrine mediated secretion, the N-terminal signal peptide is removed upon translocation of the "passenger" peptide from the cytoplasm to the periplasmic compartment by the native secretion apparatus. Furthermore, upon translocation of the autocrine form across the outer membrane, the C-terminal secretion tag may be removed by either autocatalytic or protease-catalyzed (e.g. OmpT) cleavage, thereby releasing the polypeptide of the invention into the extracellular environment.

[0148] A fusion protein comprising a signal peptide and a polypeptide according to the invention may be a recombinant fusion protein. Thus, the signal peptide and the polypeptide according to the invention may not occur (together) in nature. For example, the signal peptide and / or the polypeptide according to the invention may be recombinant (non-naturally occurring) or - if both occur in nature - they may occur naturally in different organisms, resulting in "heterologous" secretion of the protein. Thus, the nucleic acid may be a recombinant nucleic acid, comprising for example a polynucleotide encoding a recombinant fusion protein (non-naturally occurring), and / or a codon-optimized nucleic acid.

[0149] In a further aspect, the present invention also provides an expression cassette comprising a polynucleotide encoding a polypeptide of the invention or a nucleic acid (molecule) of the invention as described above. Furthermore, the expression cassette typically comprises regulatory elements for expressing the polypeptide of the invention, operably linked to said polynucleotide or nucleic acid encoding the polypeptide. In some embodiments, the expression cassette comprises regulatory elements for recombinant expression, e.g. heterologous expression and / or overexpression, of the encoded polypeptide.

[0150] As described above, "heterologous expression" means that an encoded polypeptide is expressed by another organism (other than the organism that naturally encodes and / or expresses the polypeptide). In other words, "heterologous expression" refers to the expression of an encoded protein in a (host) organism that does not naturally encode (or express) said protein. Recombinant "overexpression" means that more copies of a protein are produced compared to native expression. For example, if a bacterium normally expresses a protein, the bacterium can be transformed with, for example, a plasmid or vector for overexpression (e.g., using a specific promoter that increases expression) so that the transformed (genetically modified) bacterium then expresses more copies of the protein.

[0151] The regulatory element may be a (heterologous) promoter. A heterologous promoter is not naturally present in combination with the respective coding sequence (i.e. the coding sequence is naturally under the control of a different promoter). The promoter initiates transcription and is therefore a control point for the expression of the encoded protein. The promoter may be inducible, by introduction of an inducer such as IPTG, so that protein synthesis is initiated only when required. However, gene expression may be constitutive (i.e. the protein may be expressed at all times). Examples of promoters include the promoter of the lac operon or the T7 promoter. They may be regulated by the lac operator. The promoter may also be a hybrid of different promoters, for example the Tac-promoter, which is a hybrid of the trp promoter and the lac promoter.

[0152] For example, an expression cassette may comprise (operably linked to each other) a (heterologous) promoter, an open reading frame (ORF) comprising or consisting of a polynucleotide encoding a polypeptide of the invention, and a 3' untranslated region (3'UTR). In some embodiments, an expression cassette may comprise (operably linked to each other) a (heterologous) promoter, a ribosome binding site, a polynucleotide encoding a polypeptide of the invention, and a transcription terminator (for terminating DNA transcription). In some embodiments, an expression cassette may comprise (operably linked to each other) a (heterologous) promoter and an open reading frame (ORF) comprising or consisting of a polynucleotide encoding a signal peptide or secretion tag as described above, and a polynucleotide encoding a polypeptide of the invention. In some embodiments, an expression cassette comprises (operably linked to each other) a (heterologous) promoter; a ribosome binding site; an ORF comprising or consisting of a polynucleotide encoding a signal peptide or secretion tag as described above, and a polynucleotide encoding a polypeptide of the invention; and a transcription terminator (for terminating DNA transcription).

[0153] An expression cassette typically comprises the gene to be expressed (in this case a polynucleotide / nucleic acid encoding a polypeptide of the invention), and regulatory elements for expression. The expression cassette may be a component of a vector, in particular an expression vector, so that the encoded protein may be expressed by a cell containing the vector, e.g. a cell transfected with the vector. The expression cassette usually drives the cellular machinery to produce RNA and protein. In some embodiments, expression cassettes may be designed for modular cloning of protein coding sequences, so that the same cassette can be easily modified to make different proteins. The regulatory elements of an expression cassette are usually heterologous compared to the encoded protein (expressed), i.e. the specific combination of regulatory element and polynucleotide sequence encoding a protein of interest typically does not occur in nature. The regulatory elements usually control the expression of the encoded protein.

[0154] The expression cassette can further comprise a nucleic acid sequence encoding a tag (e.g., immediately downstream of the polynucleotide encoding the polypeptide according to the invention) so that the expressed polypeptide contains the tag. The tag can be useful, for example, for purification of the polypeptide after expression or as a reporter (label). Examples of tags include histidine (His) tags, other marker peptides, or fusion partners such as glutathione S-transferase or maltose binding protein.

[0155] The expression cassette may be optimized for expression in eukaryotic or prokaryotic cells. For example, an expression cassette for a prokaryotic expression vector may contain a Shine-Dalgarno sequence for ribosome binding at its translation initiation site, while an expression cassette for eukaryotic expression may contain a Kozak consensus sequence. Preferably, the expression cassette is optimized for expression in prokaryotic cells, such as bacteria.

[0156] Further included within the scope of the present invention is a vector, such as an expression vector, comprising the above-described nucleic acid according to the present invention or the above-described expression cassette according to the present invention. For example, the above-described nucleic acid molecule may be a vector. Thus, the present invention also provides a vector comprising the above-described nucleic acid according to the present invention or the above-described expression cassette according to the present invention.

[0157] A vector is usually a non-naturally occurring (recombinant) nucleic acid molecule. Thus, a vector may contain heterologous elements (i.e. sequence elements of a different origin in nature). For example, a vector may contain a multiple cloning site, a heterologous promoter, a heterologous enhancer, a heterologous selection marker (identifying cells containing the vector compared to cells not containing the vector), or a combination thereof. A vector in the context of the present invention is suitable to incorporate or carry a desired nucleic acid sequence. Such vectors may be storage vectors, expression vectors, cloning vectors, transfer vectors, etc. A storage vector is a vector in which a nucleic acid molecule can be conveniently stored. Thus, a vector may for example comprise a sequence corresponding to (or encoding) a polypeptide according to the present invention. An expression vector can be used for the production of an expression product, such as an RNA, e.g. an mRNA, or a peptide, polypeptide or protein. For example, an expression vector may comprise sequences required for the transcription of a sequence of the vector, such as a (heterologous) promoter sequence, e.g. as described above. A cloning vector is typically a vector that contains a cloning site that can be used to incorporate a nucleic acid sequence into the vector. The cloning vector may be, for example, a plasmid vector or a bacteriophage vector. The transfer vector may be a vector suitable for introducing a nucleic acid molecule into a cell or organism, for example a viral vector.

[0158] A vector in the context of the present invention may for example be an RNA vector or a DNA vector. Preferably, the vector is a DNA molecule. For example, a vector in the sense of the present application comprises a cloning site, a selection marker, e.g. an antibiotic resistance factor, and sequences suitable for the propagation of the vector, e.g. an origin of replication. Preferably, a vector in the context of the present invention is a plasmid vector. Preferably, a vector in the context of the present invention is an expression vector. An expression vector may further comprise a nucleic acid sequence encoding a tag (e.g. immediately downstream of the polynucleotide encoding the polypeptide according to the present invention) such that the expressed polypeptide contains the tag. The tag may be useful for example for purification of the polypeptide after expression or as a reporter (label). Examples of tags include histidine (His) tags, other marker peptides, or fusion partners such as glutathione S-transferase or maltose binding protein. Furthermore, the expression vector may comprise a polynucleotide encoding a signal peptide or a secretion tag as described above (e.g. for the expression of a fusion protein comprising a signal peptide and a polypeptide of the present invention as described above).

[0159] Preferred vectors are those for expression in bacterial cells such as E. coli. Many expression vectors are commercially available for the expression of a polypeptide / protein of interest in bacterial cells such as E. coli.

[0160] Vectors may be useful for expression in so-called "live vectors", whereby live bacterial cells (bacteria or bacterial spores, such as endospores, exospores or microbial cysts) may be administered, preferred examples of which are described in Palffy R, Gardlik R, Hodosy J, Behuliak M, Resko P, Radvansky J, Celec P. Bacteria in gene therapy: bactofection versus alternative gene therapy. Gene Ther. 2006 January;13(2):101-5.

[0161] Cells and culture media In a further aspect, the present invention also provides a (host) cell expressing a polypeptide according to the invention or comprising a nucleic acid, expression cassette or vector according to the invention. The (host) cell may be an isolated cell.

[0162] Examples of such cells include, but are not limited to, eukaryotic cells, such as yeast cells, animal or plant cells, or prokaryotic cells, including E. coli. In some embodiments, the cells are mammalian cells, such as mammalian cell lines. Examples include human cells, CHO cells, HEK293T cells, PER.C6 cells, NS0 cells, human kidney cells, myeloma cells, or hybridoma cells.

[0163] Preferably, the (host) cell is a bacterial cell, such as an E. coli cell. Such cells are preferably used for the production of a polypeptide according to the invention. Furthermore, such (host) cells can also be an active ingredient in a pharmaceutical composition.

[0164] Preferably, the (host) cell is a bacterial cell, more preferably an enterobacteria cell. Such bacterial cells may function as "live vectors" in which live bacterial cells (bacteria or bacterial spores, such as endospores, exospores, or microbial cysts) may function as vectors for providing the polypeptides of the invention or nucleic acids encoding same. Preferred examples thereof are described in Palffy R, Gardlik R, Hodosy J, Behuliak M, Resko P, Radvansky J, Celec P. Bacteria in gene therapy: bactofection versus alternative gene therapy. Gene Ther. 2006 January;13(2):101-5. Bacterial cells (bacteria or bacterial spores, such as endospores, exospores, or microbial cysts), especially (whole) enterobacteria species, may be advantageous as they have the potential to trigger a greater immune response than the proteins or nucleic acids they contain.

[0165] Furthermore, the bacterial cells, in particular the Enterobacteriaceae, according to the invention can be provided in the form of probiotics, i.e. live Enterobacteriaceae, and therefore can be used as a food additive due to the health benefits they may bring. They can be, for example, freeze-dried into granules, pills or capsules, or directly mixed with edible dairy products.

[0166] Therefore, the present invention also provides a genetically modified bacterium (or recombinant bacterium) capable of inducing and / or enhancing IL-10 secretion from human cells, said bacterium comprising a nucleic acid according to the invention, an expression cassette according to the invention or a vector according to the invention as described above. Furthermore, the present invention also provides a genetically modified bacterium (or recombinant bacterium) which (over)expresses a polypeptide according to the invention. In particular, the genetically modified bacterium (or recombinant bacterium) is capable of secreting a polypeptide according to the invention. Thus, the present invention also provides a genetically modified bacterium (or recombinant bacterium) which is capable of secreting a polypeptide according to the invention. To this end, the genetically modified bacterium (or recombinant bacterium) may comprise an expression cassette as described above. In some embodiments, the bacterium comprises an expression vector (or plasmid) as described above. In some embodiments, the expression cassette may be integrated into the genome of the bacterium, in particular for recombinant expression (e.g. heterologous expression or overexpression).

[0167] Preferably, the bacterial (host) cell / bacteria is a modified bacterium (or recombinant bacterium). Generally, the modified bacterium (or recombinant bacterium) is a bacterium that does not occur in nature. In particular, the genetically modified bacterium (or recombinant bacterium) is capable of expressing a polypeptide recombinantly, e.g. by heterologous expression or overexpression. For this purpose, the (host) bacterium may for example be modified (e.g. by transformation) by introducing into the (host) bacterium a vector (or plasmid) encoding the polypeptide. Said vector, or a part thereof comprising the polynucleotide encoding the polypeptide, may optionally be integrated into the genome of the (host) bacterium.

[0168] In some embodiments, bacterial (host) cells may be genetically modified to facilitate permeabilization of the cell membrane; facilitate release of delivered plasmids or expressed polypeptides; or minimize the risk of clinically symptomatic infection. Modified bacteria are described, for example, in Palffy R, Gardlik R, Hodosy J, Behuliak M, Resko P, Radvansky J, Celec P. Bacteria in gene therapy: bactofection versus alternative gene therapy. Gene Ther. 2006 January;13(2):101-5. Modified bacteria that secrete a protein of interest are described, for example, in WO 2016 / 164636, WO 2018 / 045184, or WO 2020 / 206221 A1, which are incorporated herein by reference.

[0169] In some embodiments, the genetically modified bacteria (or recombinant bacteria) may comprise a polynucleotide encoding a signal peptide or secretion tag as described above. Thus, the genetically modified bacteria (or recombinant bacteria) may comprise a secretion apparatus (particularly for secreting a polypeptide of the invention). As used herein, the term "secretion apparatus" refers to a natural or non-natural secretion mechanism capable of secreting or exporting a polypeptide of the invention from the bacterial cytoplasm. The secretion apparatus may comprise a single protein or may comprise two or more proteins assembled into a complex, as known in the art. Non-limiting examples of secretion apparatus of Gram-negative bacteria include modified type III flagellar secretion apparatus, type I (e.g., hemolysin secretion apparatus), type II, type IV, type V, type VI, and type VII secretion apparatus, resistance-nodulation-division (RND) multidrug efflux pump, various single membrane secretion apparatus. Non-limiting examples of secretion apparatus of Gram-positive bacteria include the Sec and TAT secretion apparatus.

[0170] In general, the (modified) bacterium is preferably a non-pathogenic bacterium. The term "non-pathogenic bacterium" as used herein refers to a bacterium that is essentially unable to cause disease or a harmful response in a host. In some embodiments, the non-pathogenic bacterium is a commensal bacterium.Examples of non-pathogenic bacteria include Bacillus, Bacteroides, Bifidobacteria, Brevibacterium, Clostridium, Enterococcus, Escherichia coli (E. coli), Lactobacillus, Lactococcus, Saccharomyces, and Staphylococcus, such as Bacillus coagulans, Bacillus subtilis, Bacteroides fragilis, Bacteroides subtilis, Bacteroides thetaiotaomicron, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium cepa ... infantis, Bifidobacterium lactis, Bifidobacterium longum, Clostridium butyricum, Enterococcus faecium, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus johnsonii, Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus Examples of suitable bacteria include, but are not limited to, Lactococcus rhamnosus, Lactococcus lactis, and Saccharomyces boulardii. Of these, the bacterium (modified) Escherichia coli is particularly preferred.

[0171] In a further aspect, the present invention also provides a culture medium comprising a polypeptide according to the invention, a (host) cell according to the invention, or a bacterium according to the invention.

[0172] The culture medium is preferably a culture medium for human cells, in particular human immune cells. Various culture media for human immune cells such as PBMCs are known in the art and commercially available. Examples include RPMI-1640 medium, Iscove's Modified Dulbecco's Medium (IMDM), TexMACS medium, and AIM V medium (ThermoFisher). The culture medium can be supplemented with, for example, antibiotics, glutamine, and / or (inactivated) fetal bovine serum (FBS). In some embodiments, the culture medium is serum-free. Preferably, the culture medium does not contain IL-10 and / or compounds that induce IL-10 secretion from human cells other than the polypeptide according to the invention, the (host) cell according to the invention, or the bacterium according to the invention.

[0173] In some embodiments, the culture medium further comprises an antigen, e.g., an autoantigen. For example, in allergy and autoimmunity, patient-derived immune cells (such as dendritic cells) pulsed with a specific antigen (Ag) can be used to induce differentiation of self-Ag-specific type 1 regulatory T (Tr1) cell products and thus promote / restore Ag-specific tolerance.

[0174] In a further aspect, the present invention also provides isolated human cells cultured in a culture medium comprising the polypeptide according to the invention, the (host) cell according to the invention, or the bacterium according to the invention as described above. The polypeptide according to the invention (or a cell expressing such a polypeptide) is typically capable of inducing and / or enhancing IL-10 secretion from human cells as described above. Preferably, the human cells cultured with the polypeptide (or a cell expressing such a polypeptide) are human immune cells, such as peripheral blood mononuclear cells (PBMCs). For example, various blood cell types have been reported to produce IL-10, including lymphocytes, monocytes, dendritic cells, and granulocytes. In some embodiments, the human cells cultured with the polypeptide of the invention (or a cell expressing such a polypeptide) are lymphocytes, such as T lymphocytes.

[0175] As described above, culturing human cells (as described above) in the presence of a polypeptide of the invention (or cells expressing such a polypeptide) typically induces and / or enhances IL-10 release from the human cells. Further details regarding IL-10 secretion by human cells in the presence of a polypeptide of the invention are given above and apply mutatis mutandis here.

[0176] Pharmaceutical Compositions and Medical Treatments and Uses In a further aspect, the present invention provides a method for producing a composition comprising the steps of: - a polypeptide of the invention as defined above; - a nucleic acid as defined above; - a vector as described above; - a (host) cell as described above; - a bacterium as described above; or - a human cell as described above The present invention provides a pharmaceutical composition comprising:

[0177] Preferably, the pharmaceutical composition further comprises a pharma- ceutically acceptable excipient, diluent or carrier. The carrier or excipient may facilitate administration but should not induce the production of antibodies harmful to the individual receiving the composition. It should also not be toxic. Suitable carriers may be large, slowly metabolized macromolecules, such as proteins, polypeptides, liposomes, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. In some embodiments, the pharma-ceutically acceptable carrier, diluent and / or excipient in the pharmaceutical composition according to the present invention is not an active ingredient with respect to inducing and / or enhancing IL-10 secretion from human cells.

[0178] Pharmaceutically acceptable salts may be used, for example mineral acid salts such as hydrochloride, hydrobromide, phosphate, and sulfate salts, or organic acid salts such as acetates, propionates, malonates, and benzoate salts.

[0179] Pharmaceutically acceptable carriers in pharmaceutical compositions can further contain liquids such as water, saline, glycerol, and ethanol. In addition, auxiliary substances such as wetting or emulsifying agents or pH buffering substances may be present in such compositions. Such carriers allow the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, and suspensions for ingestion by a subject. A thorough discussion of pharma-ceutically acceptable carriers is available in Gennaro (2000) Remington: The Science and Practice of Pharmacy, 20th Edition, ISBN: 0683306472.

[0180] The pharmaceutical composition of the invention may have a pH of 5.5 to 8.5, and in some embodiments, it may be 6 to 8, for example about 7. The pH may be maintained by the use of a buffer. The composition may be sterile and / or pyrogen-free. The composition may be isotonic to humans. In some embodiments, the pharmaceutical composition of the invention is supplied in a sealed container.

[0181] In some embodiments, the (only) active ingredient in the composition is a polypeptide, a nucleic acid, a vector, a (host) cell, a bacterium, or a human cell according to the present invention as described above. Therefore, the active ingredient may be susceptible to degradation in the gastrointestinal tract. Therefore, when the composition is administered by a route that uses the gastrointestinal tract, the composition may contain an agent that protects the active ingredient from degradation.

[0182] In some embodiments, the polypeptides of the invention can be administered in the form of microorganisms, such as (intestinal) bacterial cells. Furthermore, the (intestinal) bacteria according to the invention can be in the form of probiotics, i.e. live bacteria, and therefore can be used as food additives for the health benefits they may bring. They can be, for example, freeze-dried into granules, pills or capsules, or directly mixed with edible dairy products.

[0183] The polypeptides of the invention, the nucleic acids (or vectors) and the compositions according to the invention can further be encapsulated to facilitate their administration to a subject in need thereof. For example, they can be encapsulated in lipid-based carrier systems such as peptide nanocarriers, virosomes, or liposome-polycation-DNA complexes (Trovato M, De Berardinis P. Novel antigen delivery systems. World J Viral. 2015 Aug. 12; 4(3): 156-68; Saade F, Petrovsky N. Technologies for enhanced efficacy of DNA vaccines. Expert Rev Vaccines. 2012 Feb; 11(2): 189-209; Li et al., Peptide Vaccine: Progress and Challenges. Vaccines (Basel). 2014 Jul. 2; 2(3): 515-36).

[0184] The composition according to the invention may further comprise other active agents, for example active agents capable of enhancing the effect of the polypeptide of the invention, or the composition may not comprise any other active agents (i.e. other than the polypeptide according to the invention, the cell according to the invention, the nucleic acid according to the invention, or the host cell according to the invention).

[0185] In view of the IL-10 secretion induced and / or enhanced by the polypeptide according to the present invention, the present invention also provides a method for inducing and / or enhancing IL-10 secretion in a subject, comprising the step of administering to the subject a polypeptide according to the present invention, a nucleic acid according to the present invention, a vector according to the present invention, a (host) cell according to the present invention or a bacterium according to the present invention.

[0186] Preferably, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention or the human immune cell according to the invention may be used as a medicament.

[0187] In other words, the present invention also provides a polypeptide according to the invention, a nucleic acid according to the invention, a vector according to the invention, a (host) cell according to the invention, a bacterium according to the invention, a human immune cell according to the invention or a pharmaceutical composition according to the invention for use in medicine.

[0188] IL-10 is often considered the "prototype anti-inflammatory cytokine" and its inhibitory action is mainly exerted on the most typical inflammatory markers such as IL-1, IL-6, TNF-α, GM-CSF and IFN-γ. Three major pro-inflammatory cytokines, IL-1β, IL-6 and TNF-α, are involved in the development and maintenance of inflammatory conditions in many diseases. Furthermore, TH1 immune responses are known to be a hallmark of autoimmune and inflammatory diseases. Although IL-10 can suppress both Th1 and Th2 type responses, its effect on the Th1 subpopulation is more pronounced, and IL-10 is considered a promoter of Th2 responses (pleiotropic effects). Therefore, suppression / reduction of pro-inflammatory cytokines and Th1 immune responses by inducing or enhancing secretion of IL-10 from human cells is useful for various inflammatory and autoimmune diseases.

[0189] In some embodiments, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention or the human immune cell according to the invention are therefore useful for increasing the secretion of anti-inflammatory cytokines, such as IL-10.

[0190] Furthermore, the examples of the present application show an increase in intestinal epithelial cell barrier function when the polypeptide of the invention is applied in an assay evaluating transepithelial electrical resistance. Thus, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention, or the human immune cell according to the invention may be useful for increasing intestinal epithelial cell barrier function or integrity (in a subject). They may therefore be used in vivo to increase intestinal epithelial cell wound healing in a subject in need thereof, for example a subject having intestinal tissue damage due to treatment with a chemical, or to reduce intestinal tissue pathology, in particular gastrointestinal mucosal inflammation. The structural and functional integrity of the epithelial cell layer may be assessed, for example, by a TER assay. The TER assay is well known in the art and is described, for example, in Srinivasan et al., 2015, J Lab Autom, 20: 107-126 and in Example 6 below.

[0191] Thus, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention, the human immune cell according to the invention, or the pharmaceutical composition according to the invention may be useful in various medical applications, including the treatment of inflammatory diseases, autoimmune disorders, and diseases of the gastrointestinal tract (GIT), such as inflammatory bowel disease (IBD). Inflammatory bowel disease (IBD) includes, for example, Crohn's disease (CD) and ulcerative colitis (UC). Thus, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention, the human immune cell according to the invention, or the pharmaceutical composition according to the invention may be used for the treatment of inflammatory bowel disease (IBD).

[0192] In general, inflammatory diseases include a myriad of disorders and conditions characterized by inflammation.Inflammatory diseases can be acute or chronic.Examples of inflammatory diseases include allergies such as food allergies, asthma such as allergic asthma, chronic obstructive pulmonary disease (COPD), inflammatory bowel disease (IBD) such as Crohn's disease (CD) and ulcerative colitis (UC), psoriasis, atopic dermatitis (AD), rheumatoid arthritis (RA), lupus such as systemic lupus erythematosus (SLE), multiple sclerosis, and type 1 diabetes (T1D).

[0193] In some embodiments, the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention, the human immune cell according to the invention, or the pharmaceutical composition according to the invention may be used for the treatment of allergies, such as food allergies.

[0194] Furthermore, a polypeptide according to the invention, a nucleic acid according to the invention, a vector according to the invention, a (host) cell according to the invention, a bacterium according to the invention, a human immune cell according to the invention or a pharmaceutical composition according to the invention may - Reduction of gastroenteritis in patients who need it, - Reduction of intestinal mucosal inflammation in patients in need thereof, - Increased gastrointestinal wound healing in patients who need it, - Increased intestinal epithelial cell proliferation in a patient in need thereof, and / or - Treating or preventing epithelial barrier dysfunction in a patient in need thereof may be used in any one (or combination).

[0195] The epithelial barrier dysfunction may, for example, be selected in the group consisting of inflammatory bowel disease (IBD), ulcerative colitis (UC), pediatric UC, Crohn's disease (CD), pediatric Crohn's disease, short bowel syndrome, GI mucositis, oral mucositis, mucositis of the esophagus, stomach, small intestine (duodenum, jejunum, ileum), large intestine (colon), and / or rectum, chemotherapy-induced mucositis, radiation-induced mucositis, necrotizing enterocolitis, pouchitis, metabolic disease, celiac disease, irritable bowel syndrome (IBS), or chemotherapy-associated steatohepatitis (CASH).

[0196] Preferably, said epithelial barrier dysfunction is an IBD, such as Crohn's disease (CD). Another preferred disorder to be treated is ulcerative colitis (UC).

[0197] Accordingly, the present invention provides a method of reducing, treating, alleviating the symptoms of, or ameliorating an inflammatory disease or autoimmune disorder in a subject, comprising the step of administering to the subject a polypeptide according to the present invention, a nucleic acid according to the present invention, a vector according to the present invention, a (host) cell according to the present invention, a bacterium according to the present invention, a human immune cell according to the present invention, or a pharmaceutical composition according to the present invention.

[0198] Furthermore, the present invention provides a method for reducing, treating, alleviating the symptoms of or ameliorating allergy in a subject, comprising the step of administering to the subject a polypeptide according to the present invention, a nucleic acid according to the present invention, a vector according to the present invention, a (host) cell according to the present invention, a bacterium according to the present invention, a human immune cell according to the present invention, or a pharmaceutical composition according to the present invention.

[0199] The present invention also provides a method of inducing tolerance in a subject comprising the step of administering to the subject a polypeptide according to the present invention, a nucleic acid according to the present invention, a vector according to the present invention, a (host) cell according to the present invention, a bacterium according to the present invention, or a human immune cell according to the present invention.

[0200] Methods of administration of the polypeptide according to the invention, the nucleic acid according to the invention, the vector according to the invention, the (host) cell according to the invention, the bacterium according to the invention, or the human immune cell according to the invention are well known to those skilled in the art. For example, it may be administered directly to the subject, to the affected organ (i.e., topically), or administered systemically (i.e., enterally or parenterally). Enteral administration includes oral and rectal administration, as well as administration via a gastric feeding tube, a duodenal feeding tube, or a gastrostomy. Parenteral administration includes, among others, subcutaneous, intravenous, intramuscular, intraarterial, intradermal, intraosseous, intracerebral, and intrathecal injection. The method of administration will often depend on the type of disease to be treated and the type of active compound. For example, administration is preferably via the enteric route, especially for the treatment of diseases of the gastrointestinal tract (GIT), such as inflammatory bowel disease (IBD). In some embodiments, administration is preferably oral, for example when the polypeptide is delivered in the form of (enteric) bacteria as defined above, for example when the enteric bacteria is in the form of a probiotic. EXAMPLES

[0201] In the following, specific examples are presented to illustrate various embodiments and aspects of the present invention. However, the present invention is not limited in scope by the specific embodiments described herein. The following preparations and examples are presented to enable those skilled in the art to clearly understand and practice the present invention. However, the present invention is not limited in scope by the exemplified embodiments, which are intended only as illustrations of a single aspect of the present invention, and methods that are functionally equivalent are within the scope of the present invention. Indeed, various modifications of the present invention in addition to those described herein will be readily apparent to those skilled in the art from the foregoing description, the accompanying drawings, and the following examples. All such modifications are within the scope of the appended claims.

[0202] Example 1 Identification of human microbiota-derived proteins that induce IL-10 release from human cells The goal of this study was to identify proteins expressed by the human microbiota that can induce the secretion of IL-10 from human immune cells. To this end, a library of proteins expressed by the human microbiota was screened to identify proteins that induce IL-10 release from human immune cells.

[0203] Testing Procedure: Library: In silico methods A compound library of secreted proteins from gut commensal bacteria was generated by an in silico-based approach. The library contained over 12,000 predicted proteins from the human gut microbiome catalog and bacterial species with known roles in immune regulation. To obtain the library, bacterial proteins with lengths between 50 and 350 amino acids were screened for the presence of secretory signal peptides using the bioinformatics tool Phobius and annotated using the HMMSCAN and PFAM databases. A cutoff of 75% was applied to reduce sequence redundancy.

[0204] Considering the relevance of small cysteine-rich proteins in immune regulation, an additional selection criterion was applied to identify cysteine-rich proteins: at least two cysteines must be present to form disulfide bonds. To ensure correct synthesis and folding in vitro, the amino acid sequence corresponding to the signal peptide was removed.

[0205] Libraries: Cell-free protein synthesis and quantification The protein library was generated using an E. coli cell-free kit suitable for the generation of disulfide bonds according to the supplier's protocol (RTS 100 E. coli disulfide kit; Biotechrabbit GmbH, Hennigsdorf, Germany). The cell-free system is based on continuous exchange through a semipermeable membrane between a reaction compartment containing components for transcription and translation and a feeding chamber containing amino acids and other energy components.

[0206] Heterologous protein expression using the E. coli transcription machinery was improved by a codon optimization algorithm (Twist Bioscience, San Francisco, USA) applied to all selected sequences. All synthetic ORFs were subcloned into the pIVEX 2.4 vector (Biotechrabbit, Hennigsdorf, Germany), specifically designed for high-yield cell-free expression of His-tagged proteins.

[0207] For detection of His-tagged proteins, the 6His Check kit Gold (Cisbio, Codre, France) using HTRF® technology was used according to the supplier's protocol. Proteins pre-diluted 1:20 in 1× PBS were quantified in 384-well plates against a standard curve of 0.1 μg / mL 6×His GFP (ThermoFisher, Waltham, USA) diluted in serial dilutions of the lysate used for cell-free synthesis (lysate was also diluted 1:20 in 1× PBS).

[0208] E. coli production of recombinant proteins DNA from positive hits was subcloned into pET-28a vector (Twist Bioscience, San Francisco, USA) with an N-terminal 6xHis-Tag and then transformed into E. coli BL21(DE3) or Nico21(DE3) (as for 3166 protein) thermocompetent cells (New England Biolabs, Ipswich, MA, USA). For expression of recombinant proteins, precultures of BL21(DE3) or Nico21(DE3) clones were performed in LB medium at 30°C under shaking (180 rpm). Cultures were made under the same conditions in LB or 2YT medium and induction was started at an OD600 of 0.4-0.8 using 0.1 or 0.5 mM IPTG depending on the protein characteristics. Induction times were also adapted to each protein and ranged from 2 h to overnight.

[0209] The culture was centrifuged at 4500 rpm for 15 min at 4°C. The supernatant was removed and the pellet was frozen at -80°C to disrupt the cells. The pellet was then thawed and resuspended in 1x BugBuster® (Novagen®, Merck KGaA, Darmstadt, Germany) supplemented with Benzonase® nuclease (Sigma-Aldrich, St. Louis, USA) and lysozyme (Sigma-Aldrich, St. Louis, USA). The sample was incubated at room temperature with gentle shaking and centrifuged at 15,000 g for 30 min at 4°C. Soluble proteins were purified from the supernatant on a nickel-loaded column (Protino®, Macherey-Nagel, Düren, Germany) according to the supplier's protocol. For the 3166 protein a unique protocol was developed. Soluble proteins were purified from the supernatant into HisTrap (Cytivia, Marlborough, USA) using the Akta system (Cytivia, Marlborough, USA) following this protocol: 50 mM imidazole in binding buffer, sample application flow rate 0.5 mL / min, and elution with a mixed mode step: first a gradient of elution buffer 0 to 25% in 5 CV, then a step of 75% elution buffer in 10 CV, then 100% elution buffer in 10 CV. Imidazole used for protein elution was removed by dialysis using a 3 kDa Slide-A-Lyzer dialysis cassette (ThermoFisher, Waltham, USA). Proteins were visualized on 12% Bis-Tris acrylamide gels (ThermoFisher, Waltham, USA) stained with Coomassie blue (Imperial protein stain; ThermoFisher, Waltham, USA) and detected by Western blot using 6X-His tag monoclonal antibody HRP (Miltenyi Biotec, Bergisch Gladbach, Germany) diluted 1:5000 and developed using DAB (Sigma-Aldrich, St. Louis, USA).The purified proteins were quantified by the Bradford protein assay (Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254).

[0210] IL10 screening IL-10 screening of the microbiota protein library was performed on CD14-depleted human peripheral blood mononuclear cells (PBMCs). This cell model was chosen to reduce background in the synthesized (but not purified) proteins from cell wall components and other bacterial contaminants that may be present in the lysates of cell-free synthesis kits.

[0211] CD14-depleted PBMCs: PBMCs were isolated from the buffy coat as follows: 80 ml PBS was added to 50 ml blood; four SepMate™-50 IVD tubes (Stemcell Technologies, Vancouver, Canada) were filled with 15 ml Ficoll® (Ficoll® Paque Plus; Sigma-Aldrich, St. Louis, USA) per donor and then 30 ml PBS-diluted blood was gently added. Samples were centrifuged at 1200 g for 20 min at room temperature and washed three times with PBS. To lyse red blood cells, the pellet was resuspended in red blood cell lysis buffer 1× (Miltenyi Biotec, Bergisch Gladbach, Germany) and incubated for 10 min at room temperature. Cells were then washed with MACS buffer and counted.

[0212] PBMC depletion was performed using a CD14 microbead kit (Miltenyi Biotec, Bergisch Gladbach, Germany) according to the supplier's protocol. Depleted monocytes were resuspended in Iscove's modified Dulbecco's medium (IMDM; GIBCO™, Life Technologies, Carlsbad, USA) supplemented with 1% L-glutamine (Sigma-Aldrich, St. Louis, USA), 1% penicillin-streptomycin (Sigma-Aldrich, St. Louis, USA), and 10% heat-inactivated FBS (Sigma-Aldrich, St. Louis, USA).

[0213] IL-10 Screening: Screening was performed in 384-well plates in a final volume of 60 μl. PBMCs were seeded at 72,000 cells / well by multidrop and stimulated for 72 h with 10% (vol / vol) library (protein) previously diluted 1:10 in PBS at 37°C in a humidified 5% CO2 atmosphere (Hamilton Robotics, Martinsried, Germany). E. coli lysate included in the cell-free kit was used as a negative control (at the same dilution as the library). Phytohemagglutinin (PHA) at 10 μg / ml (0.087 μM) was used as a positive control. To ensure technical robustness, screening was performed on CD14-depleted PBMCs from at least two different donors.

[0214] IL-10 secretion was measured in undiluted supernatants by AlphaLISA® (IL10 (human) AlphaLISA Detection Kit; PerkinElmer, Waltham MA, USA) according to the supplier's protocol. Results were expressed as AlphaLISA® signals (numbers). Results were considered positive hits when at least a single raw data signal (out of two signals from two PBMC donors) was higher than the corresponding plate mean + 3SD (standard deviation) or both raw data signals (out of two signals from two PBMC donors) were higher than the corresponding plate mean + 2SD (standard deviation). To avoid false positives, the concentrations of potential hits obtained by primary screening were compared with the corresponding plate means.

[0215] Potential hits were then validated by a new round of cell-free synthesis and tested on CD14-depleted PBMCs from several donors (described above). Further characterization was performed on recombinant proteins produced in E. coli BL21 (DE3) strain transformed with pET-28a vector containing the target sequence (described above, see paragraph "E. coli production of recombinant proteins"). Alternatively, cell-free production of some proteins was performed by a commercial supplier (Synthelis, La Tronche, France). Peptides were obtained by custom synthesis by commercial suppliers (SB-Peptide or Pepscan).

[0216] result screening A total of 11904 proteins from the library were screened with CD14-depleted PBMCs to identify proteins capable of stimulating IL-10 secretion from human PBMCs. From the various potential hits obtained in the primary screen, 10 proteins have been confirmed so far in a second round of cell-free synthesis. These microbiota proteins capable of stimulating IL-10 secretion from human PBMCs include ID3166 (SEQ ID NO: 2) and further microbiota proteins labeled as ID6359; ID1888; ID1889; ID2661; ID5682; ID5138; ID6077; ID6274; and ID6298.

[0217] The results of AlphaLISA for IL-10 secretion from human PBMCs in the second round of cell-free synthesis are shown in Figure 1. The data show that 10 IL-10 secretagogue proteins, including protein "3166", were identified by screening the human microbiome metasecretome protein library upon stimulation of IL-10 release from human PBMCs. These microbiota proteins induce IL-10 release from human immune cells.

[0218] Example 2 Dose-response of selected IL-10-inducing microbiota proteins Microbiota proteins ID3166 (SEQ ID NO:2); ID2661; ID5682; and ID5138 were selected, containing 121 (ID3166), 144 (ID2661), 58 (ID5682), and 44 (ID5138) amino acids, respectively, corresponding to sizes of 14, 15.5, 6, and 4 kDa, respectively.

[0219] Prior to testing, the protein was purified. Considering that, CD14 depletion of PBMCs was not necessary, since the background induced by residual contaminants present in the purified protein was extremely low. Therefore, the cell assay of Example 2 to characterize the purified protein was performed on whole PBMCs.

[0220] Selected proteins were tested on PBMCs at concentrations of 0.5, 0.25, 0.1 and 0.025 μM (final concentration). Cells were seeded in 384-well plates at 72,000 cells / well in a final volume of 60 μl and stimulated for 24 h at 37° C. in a humidified 5% CO2 atmosphere with either purified proteins (10% vol / vol) or relative controls (positive and negative). Samples were tested in duplicate on at least two different PBMC donors. All dilutions were made in PBS.

[0221] IL-10 secretion was measured by AlphaLISA essentially as described above and compared to that of PBS (negative control) and 10 μg / ml PHA (positive control).

[0222] AlphaLISA results for IL-10 secretion from human PBMCs at different doses of selected microbiota proteins are shown in Figure 2. The data show that all tested proteins are as effective (ID5138) or more effective (ID3166; ID2661; and ID5682) than PHA (positive control) in inducing IL-10 secretion from PBMCs. Moreover, microbiota protein ID3166 shows extremely high efficacy even at the lowest dose tested.

[0223] Example 3 In vitro characterization of an IL-10-inducing fragment of the microbiota protein ID3166 A 28 amino acid fragment of microbiota protein ID3166 (referred to as "NAT_29"; SEQ ID NO:1) was examined for its IL-10 inducing / enhancing ability. The NAT_29 sequence (SEQ ID NO:1) features two cysteines (C7 and C23) which, without being bound by any theory, the inventors believe that the NAT_29 sequence forms a loop that may be similar to a class of human hormones.

[0224] To investigate the IL-10 induction / enhancement ability of NAT_29, in vitro IL-10 secretion of human immune cells in the presence of different doses of NAT_29 was tested. Briefly, human CD14+ monocytes were isolated from peripheral blood mononuclear cells (PBMCs) from healthy human volunteers by density gradient centrifugation using SepMate™-50 IVD tubes (Stemcell, ref. 85460). The obtained PBMCs were washed three times with Dulbecco's phosphate buffered saline (PBS, Sigma, D88537) and lysed in red blood cell lysis buffer 1× (Miltenyi Biotec, 130-094-183) for 10 min at room temperature. Cells were washed with MACS buffer (Miltenyi Biotec, 130-091-221) and counted using trypan blue exclusion method. CD14+ monocytes were stored using anti-human CD14 microbeads (Miltenyi Biotec, 130-050-201) according to the manufacturer's protocol. The positive CD14+ fraction was collected and plated at 2 × 10 6 cells per well of a 384-well plate in IMDM medium (Gibco, 12440-046) supplemented with 10% FBS and 1 × antibiotic solution. 4 Cells were seeded.

[0225] Monocyte-derived dendritic cells (MoDCs) were derived from differentiation of CD14+ cells and obtained after selective sorting. CD14+ cells were cultured at 1.5 × 10 in complete IMDM medium supplemented with 20 ng / mL human IL4 (Miltenyi Biotec, 130-093-921) and 20 ng / mL human GM-CSF (Miltenyi Biotec, 130-093-865). 6MoDCs were cultured at a density of 1.2 × 10 cells / mL per well of a 384-well plate in IMDM medium for 7 days. 4 Cells were seeded.

[0226] Monocytes or MoDCs were stimulated with various concentrations of NAT_29 (1-1000 nM) and co-stimulated with 100 ng / mL LPS from E. coli O111:B4 (InvivoGen, tlrl-eblps) and placed in a humidified CO2 incubator for 24 h at 5% CO2 / 37°C. IL-10 secretion was measured in cell supernatants at 24 h by AlphaLISA® according to the supplier's protocol and read on an Envision plate reader (Perkin Elmer).

[0227] The results are shown in Figure 3 (A: MoDC; B: monocytes). The results demonstrate the IL-10 secretagogue activity of NAT_29 (SEQ ID NO: 1). NAT_29 was tested in a dose range of 0.1-1000 nM, and the highest IL-10 levels were measured in both cell types at the highest concentration of NAT_29 tested, although IL-10 secretagogue activity can still be observed even at much lower concentrations of NAT_29. In this assay, monocytes appeared to be more sensitive to the action of NAT_29 than MoDC. For this reason, further in vitro characterization of NAT_29 was performed on monocytes.

[0228] Example 4 NAT_29 has anti-inflammatory properties in vitro To confirm the anti-inflammatory potential of NAT_29 (SEQ ID NO: 1), a kinetic study was performed to test the simultaneous secretion of IL-10 and the main pro-inflammatory cytokines TNF-α and IL-6. For this purpose, monocytes were obtained as described in Example 3, stimulated with 1 μM NAT_29 polypeptide (SEQ ID NO: 1), co-stimulated with 10 ng / mL LPS from E. coli O111:B4 (InvivoGen, tlrl-eblps) and placed in a humidified CO2 incubator at 5% CO2 / 37°C for 72 hours. IL-10, TNF-α and IL-6 secretion were measured at 5, 10, 24, 48 and 72 hours in cell supernatants by AlphaLISA® (Perkin, ref. AL218F, AL208F, AL223F) according to the supplier's protocol and read on an Envision plate reader (Perkin Elmer).

[0229] The results are shown in Figure 4 (A: IL-10; B: TNF-α; C: IL-6). This kinetic study confirmed the IL-10 secretagogue activity of NAT_29 (SEQ ID NO: 1), showing a peak in IL-10 secretion at 24 hours, reaching a 2-fold increase relative to LPS (Figure 4A). IL-10 secretion remained constant (1.5-fold) until the end of the experiment (72 hours).

[0230] In contrast, no significant secretion of the main pro-inflammatory cytokines TNF-α and IL-6 was measured throughout the experiment (Figure 4B-C). Overall, these data demonstrate a positive balance of IL-10 secretion vs. pro-inflammatory cytokine secretion induced by the NAT_29 polypeptide.

[0231] Example 5 Various mutations in NAT_29 do not abolish IL-10 secretion To investigate the effect of different sequence mutations of NAT_29, monocytes from six donors were obtained as described in Example 3, stimulated with 1 μM NAT_29 polypeptide (SEQ ID NO: 1) or its sequence variant containing 8 mutations (NAT_38; SEQ ID NO: 9), co-stimulated with 100 ng / mL LPS (NAT_38 control) from E. coli O111:B4 (InvivoGen, tlrl-eblps) and placed in a humidified CO2 incubator at 5% CO2 / 37°C for 24 hours. IL-10 secretion was measured at 24 hours in cell supernatants by AlphaLISA® according to the supplier's protocol and read on an Envision plate reader (Perkin Elmer).

[0232] For comparison with NAT_29 (SEQ ID NO:1), a polypeptide was selected (NAT_38; SEQ ID NO:9) that differs from the NAT_29 sequence at eight amino acid positions. (i) I10 of SEQ ID NO:1 is deleted, (ii) D13 of SEQ ID NO:1 is replaced with P (D13P); (iii) Q is added between R14 and G15 of SEQ ID NO:1; (iv) T16 of SEQ ID NO:1 is replaced with Y (T16Y); (v) K17 of SEQ ID NO:1 is replaced with Q (K17Q); (vi) S22 of SEQ ID NO:1 is replaced with G (S22G), (vii) I is added between F25 and Y26 of SEQ ID NO:1; and (viii) P28 of SEQ ID NO:1 is deleted.

[0233] These differences are illustrated in the sequence comparison below:

[0234] [ka]

[0235] The results are shown in FIG. 5 (A: various mutations (NAT_38); B: C-terminal truncations (NAT_31.1, NAT_31.2 and NAT_31.3)). These data show that despite the various mutations introduced into the sequence of NAT_29 (SEQ ID NO: 1), the polypeptide NAT_38 (SEQ ID NO: 9) maintained its IL-10 secretagogue activity. Thus, the IL-10 secretagogue activity is not strictly dependent on the exact sequence of NAT_29 (SEQ ID NO: 1) but tolerates various mutations.

[0236] Example 6 NAT_29 has anti-inflammatory properties ex vivo and enhances epithelial cell integrity following inflammation Next, the role of NAT_29 was evaluated in the context of inflammatory disease using ex vivo experiments performed on human ileal resections. To this end, explants were mounted in Ussing chambers to separate the apical from the basolateral side as they naturally occur in the intestine. The tissue was pre-incubated with NAT_29 (SEQ ID NO:1) for 1 h, after which inflammation was triggered with live E. coli LF82 for 4 h.

[0237] Preparation of bacteria: The day before the assay, LB broth (Sigma Aldrich, L3522) was inoculated with bacteria (E. coli LF82-gfp) from a glycerol stock maintained at -80°C using a sterile loop. The tubes were incubated overnight at 37°C without shaking. The following day, the optical density of the bacterial suspension was read at 600 nM using a spectrophotometer (Amersham Ultrospec 10) that allows estimation of the bacterial cell density, and the bacteria were added to the human explants as described below.

[0238] Preparation of human ileal explants: Human tissue samples were obtained with patient consent from patients undergoing surgery. Samples were taken from macroscopically unaffected areas identified by the surgeon. After resection, specimens were placed in ice-cold oxygenated DMEM medium (Gibco, 61965-026) containing 1% streptomycin / penicillin solution (Gibco, 15140-122) and 50 μg / mL gentamicin (Thermofisher, Gentamicin Hyclone, SV30080-03). Intestinal resections were extensively washed and cleared from blood vessels and connective tissue using forceps under a binocular microscope. Muscle and nerve plexuses were removed, keeping only the epithelial layer. Then, the specimens were cut into pieces using a surgical punch (1 cm diameter) 2 Intestinal explants were isolated from clean resections using a 30-mL PBS. Intestinal explants were washed three times with a large volume of antibiotic-free DMEM medium and then mounted in an Ussing chamber (Harward apparatus, 66-0015) allowing access to either the apical / luminal or basolateral / serosal side of the explant. Both compartments of the Ussing chamber were filled with 1 mL of antibiotic-free DMEM medium prior to exposure to NAT_29 and bacteria.

[0239] Exposure of human ileal explants to fractions and bacteria: Human ileal explants were left untreated or pretreated with 10 nM or 1 μM NAT_29 for 1 h at 37° C. (apical / mucosal compartment of Ussing chamber). After a preincubation period of 1 h at 37° C. in a CO2 incubator (Panasonic, model MCO-19AICUV-PE), 1 × 10 LF82-gfp bacteria were inoculated into the apical compartment of the Ussing chamber. 9 Bacteria / mL were added together with 10 nM or 1 μM NAT_29.

[0240] The anti-inflammatory potential of NAT_29 was evaluated in an ex vivo model by assessing three parameters: 1) Transepithelial electrical resistance (TER), a measure of the integrity / firmness of human explants; 2) Histology; 3) IL-8 secretion (quantified by Elisa).

[0241] Transepithelial electrical resistance (TER) assay The TER assay is a well-known method for measuring the effect on the structural and functional integrity of epithelial cell layers, and is described, for example, in Srinivasan et al., 2015, J Lab Autom, 20: 107-126. Thus, the integrity / firmness of human explants during incubation was assessed by transepithelial electrical resistance (TER) measurements using a Millicell-ERS (Electrical Resistance System) Voltohmmeter (Millipore, MERS00002). For IL-8 measurements, aliquots of supernatant from the basolateral side were collected at T0 and T4 hours.

[0242] IL-8 analysis: IL-8 levels were measured by ELISA (BD Biosciences, 555244). ELISA was visualized using the HRP substrate Sigma Fast OPD (Sigma-Aldrich, P9187-50SET). Absorbance was measured at 490 nm using a microplate reader (BioTek, Synergy MX, model SMATLD).

[0243] Microscopic examination (H&E staining) At the end of the experiment, the human explants were removed from the Ussing chamber, washed six times with 2 mL of PBS (Gibco, 14040-091) and fixed for 24 h at 4 °C using PBS PFA 4% solution (Merck, ZC906196547). The next day, all punches were washed twice with 1 ml of PBS. The punches were then cut in two and included in mounting medium (TFM-EMS, 72592) in a transverse position to allow cutting at the crypt-villus axis. Four sections of 5 μm thickness were obtained per explant (cryostat Leica CM3050), each section 100 μm away from the next, to include all the tissue. The explants were then stained using a hematoxylin and eosin (H&E) staining protocol.

[0244] The procedure was as follows: - Incubation with hematoxylin (Sigma-Aldrich, HS16-500mL) for 8 min - 2 min incubation in tap water (to allow the stain to develop) - Incubation with Eosin (Sigma-Aldrich, 318906-500) for 1 min - 1 min incubation in tap water - Incubation in 70% ethanol for 2 min - Incubation in 95% ethanol for 2 min - Incubation in 100% ethanol for 2 min - Incubation in xylene for 15 minutes (performed twice) - Mount with coverslip slides using Eukitt (tissue mounting medium) - Leave to dry overnight.

[0245] The results are shown in Figure 6 (A: TER assay; B: histology; C: IL-8 secretion). As seen in Figure 6A, explants incubated with E. coli LF82 alone for 4 hours showed a significant decrease in TER (52% decrease). Pre-incubation of tissue with either 1000 nM or 10 nM NAT_29 (SEQ ID NO: 1) similarly prevented the tissue degradation observed by TER values ​​(32% decrease). This was similar to the control condition without inflammation triggered by E. coli LF82 (24% decrease).

[0246] The TER results were then confirmed by histological analysis, as shown in Figure 6B. Observation of H&E staining (Figure 6B) showed that at T=0 the intestinal mucosa was completely homogenous and there was no desquamation. The thickness of the mucosa was normal, reflecting the non-inflammatory baseline state of the tissue. In the T=4h control without bacterial infection, a thinner mucosa was observed, especially in the crypts, indicating a pre-inflammatory stage of the tissue, possibly due to the stress experienced by the tissue during the chamber construction and the 4h incubation at 37°C. Incubation for 4h in the presence of LF82 bacteria induced the development of an inflammatory state, with the mucosa being completely desquamated even at the level of its apical pole and the villi. Pre-incubation of the explants with 1000nM NAT_29 induced a protective effect against LF82-induced degradation. Under these conditions, both the mucosa and the submucosa remained similar to the controls at the same time point (T=4h).

[0247] Quantification of the proinflammatory cytokine IL-8 from media collected from the basolateral side of Ussing chambers confirmed the overall anti-inflammatory potential of NAT_29. As shown in Figure 6C, IL-8 showed a 4-fold increase after incubation with LF82. Treatment with either 1000 or 10 nM NAT-29 completely abolished IL-8 secretion.

[0248] In summary, these data demonstrate the anti-inflammatory potential and beneficial effects of NAT_29 on the structural and functional integrity of epithelial cell layers in an ex vivo model of inflammatory disease.

[0249] Example 7 NAT_29 Polypeptides Have Anti-inflammatory Properties in Vivo Next, the anti-inflammatory properties of the NAT_29 polypeptide (SEQ ID NO: 1) were evaluated in a 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis model. The model of colitis induced by TNBS in rats is a validated animal model for evaluating the anti-inflammatory properties of drugs in inflammatory bowel disease (IBD). TNBS induces profound inflammation, leading to colonic necrosis (full-thickness destruction of the intestinal wall). This model is well characterized, reliable, reproducible, and approved by regulatory authorities in IBD (e.g., as described in Antoniou, E. et al. (2016). The TNBS-induced colitis animal model: An overview. Annals of medicine and surgery, Vol. 11, pp. 9-15, incorporated herein in its entirety).

[0250] For this purpose, the NAT_29 polypeptide (SEQ ID NO: 1) was administered by intrarectal instillation at two different concentrations (1 and 0.1 μM) in a model of acute colitis induced by TNBS (80 mg / kg intrarectally) in Sprague-Dawley rats. The anti-inflammatory effect was assessed at the macroscopic level using Wallace's validated score and compared with the anti-inflammatory effect induced by a positive control (5-ASA) also administered by intrarectal instillation.

[0251] Resolution of inflammation was also assessed using colonic lipocalin-2 (Lcn-2) quantification. Lipocalin-2, also known as neutrophil gelatinase-associated lipocalin (NGAL), is considered a clinically meaningful biomarker for IBD. Lipocalin-2 is expressed in normal tissues and is significantly increased upon inflammation, such as in colonic epithelial tissue from IBD patients. Rodent models of colitis have shown a strong association between elevated levels of Lcn-2 and colitis severity.

[0252] A. Materials and Methods Male Sprague-Dawley rats (body weight: approximately 100-150 g) were randomly and blindly assigned 4 per cage and allowed to acclimate for 1 week. Rats were obtained from Janvier Laboratoires, Le Genest Saint-Isle, France.

[0253] The test products were administered once daily by intrarectal instillation (500 μl) in prophylactic and therapeutic mode starting on day −5, i.e. 5 days before colitis induction (D0), until euthanasia on D4, corresponding to a total of 9 treatment days.

[0254] For colitis induction, Sprague Dawley rats were anesthetized for 2 hours using a subcutaneous injection of 12.5 mg / kg xylazine / 25 mg / kg ketamine. Colitis was induced by intrarectal injection of 250 μL TNBS (80 mg / kg in 40% EtOH) 8 cm from the anus using a catheter. The 80 mg / kg TNBS solution was prepared based on the average body weight of the rats, which was recorded before preparation of the TNBS solution.

[0255] Five animal groups, as shown in Table 2 below, were used in this study.

[0256] [Table 2]

[0257] NAT_29 was solubilized in PBS and the active concentration for animal treatment was calculated assuming a maximum volume of 3.5 ml for the rat colon-rectum content. To achieve a final concentration of 0.1 μM in the rat colon, 500 μl of a 0.7 μM solution of NAT_29 was administered intrarectally. To achieve a final concentration of 1 μM in the rat colon, 500 μl of a 7 μM solution of NAT_29 was administered intrarectally.

[0258] Pentasa® was used as a positive control anti-inflammatory compound at a final concentration of 30 mM. Assessment of the intensity of colitis was performed after 4 days.

[0259] To assess the intensity of colitis, animals were sacrificed 4 days (D4) after TNBS administration (D0). Samples were collected from the distal colon and used for macroscopic evaluation and lipocalin quantification.

[0260] Macroscopic and histological assessment of colitis was performed independently by two operators to validate the scores. The colon of each rat was examined and assessed for macroscopic lesions according to the Wallace criteria. The Wallace score grades macroscopic lesions on a scale of 0 to 10. The score is based on features reflecting inflammation such as hyperemia, intestinal thickening, and the extent of ulceration, as shown in Table 3 below.

[0261] [Table 3]

[0262] Levels of lipocalin-2 (Lcn-2), an enzyme contained in primary polymorphonuclear neutrophil granules, a marker of neutrophil infiltration, were quantified by ELISA (Clinisciences, rat neutrophil gelatinase-associated lipocalin NGAL, ref. DLR-NGAL-Ra-96T) in distal colonic pieces removed at the time of euthanasia. Colonic pieces were homogenized in Tris-HCl buffer (Sigma-Aldrich) containing protease inhibitors (50 mg / ml) in a Precellys homogenizer using ceramic beads (1.4 and 2.8 mm) (Bertin, France).

[0263] All comparisons were analyzed using permutation tests for two independent samples using StatXact software. Comparisons were performed against the TNBS control group. Differences were considered statistically significant if the p-value was <0.05.

[0264] B. Results The anti-inflammatory effect of the test product was evaluated 4 days after the induction of colitis by TNBS. This step corresponds to the end of the peak of inflammation. No deaths were recorded related to the administration of the test product or the induction of colitis, thereby demonstrating the safety and harmlessness of daily rectal administration of the active product for 8 consecutive days, even under inflammatory conditions.

[0265] Chronic inflammation and lesion intensity were assessed at the macroscopic level according to the validated Wallace criteria described in Table 3. The results are shown in Figure 7. The results show that intrarectal administration of NAT_29 at a final concentration of 1 μM induces a statistically protective effect on inflammatory parameters as measured by the Wallace score. The level of protection is similar to that observed with the reference compound 5-ASA (Pentasa). Treatment with NAT_29 at a final concentration of 0.1 μM also induced a protective effect (albeit not significantly).

[0266] The intensity of chronic inflammation was evaluated using lipocalin quantification (ELISA) per ml of colonic tissue. Lipocalin levels are considered a biomarker of disease severity, mainly secreted by neutrophils, and are regulated in serum, fecal and colonic samples from animal models of colitis as well as in humans suffering from IBD. The results are shown in Figure 8. The results show that intrarectal administration of NAT_29 at a final concentration of 1 μM is associated with a significant reduction in lipocalin levels in the colon. The level of protection is similar to that observed with the reference compound 5-ASA (Pentasa). Treatment with NAT_29 at a final concentration of 0.1 μM is associated with a slight (albeit not significant) reduction in lipocalin-2 levels. Table of Sequences and SEQ ID NOs:

[0267] [Table 4]

Claims

1. General formula (IIa): SCFFX 3 YLX 4 RX 6 GX 8 X 9 KGSRX 10 C (IIa) (In the formula, X 3 is I or deleted, X 4 is P or D, X 6 is Q or deleted, X 8 is T or Y, X 9 is K or Q, X 10 is S or G) 2, excluding the amino acid sequence of SEQ ID NO: 2, and having a length of 20 to 120 amino acids.

2. The polypeptide described in claim 1, having a length of 25 to 50 amino acids.

3. X 3 and X 6 Instead of X 3 or X 6 The polypeptide of claim 1, wherein either of the above is deleted.

4. The polypeptide according to claim 1, which is capable of inducing and / or enhancing IL-10 secretion from human cells.

5. 2. The polypeptide of claim 1, comprising or consisting of the amino acid sequence according to SEQ ID NO: 1, but not comprising the amino acid sequence according to SEQ ID NO:

2.

6. 2. The polypeptide of claim 1, comprising or consisting solely of the amino acid sequence according to SEQ ID NO:

9.

7. A nucleic acid comprising a polynucleotide encoding the polypeptide of claim 1.

8. An expression cassette comprising a polynucleotide encoding a polypeptide as defined in claim 7 and regulatory elements operably linked thereto, preferably for expression in a prokaryotic cell such as a bacterium.

9. A vector comprising the nucleic acid of claim 7.

10. A vector comprising the expression cassette of claim 8.

11. 10. A host cell that expresses a polypeptide according to any one of claims 1 to 6; or that comprises a nucleic acid according to claim 7, an expression cassette according to claim 8, or a vector according to claim 9.

12. 12. A pharmaceutical composition comprising a polypeptide according to any one of claims 1 to 6, a nucleic acid according to claim 7, a vector according to claim 9 or 10, or a host cell according to claim 11, and optionally a pharmaceutically acceptable excipient or carrier.

13. 13. The pharmaceutical composition of claim 12 for use in the treatment of an inflammatory disease or an autoimmune disorder.

14. 13. The pharmaceutical composition of claim 12 for use in the treatment of inflammatory bowel disease (IBD).

15. 13. The pharmaceutical composition of claim 12 for use in the treatment of allergies.

16. The pharmaceutical composition of claim 12 for inducing and / or enhancing IL-10 secretion in a subject.

17. The pharmaceutical composition of claim 12 for inducing tolerance in a subject.