Engineered Guide RNAs and Polynucleotides

Abstract

Disclosed herein are engineered guide RNAs and compositions comprising the same for treating a disease or condition in a subject. Also disclosed herein are methods for treating a disease or condition in a subject by administering the engineered guide RNA or pharmaceutical composition described herein.

Description

[Technical Field]

[0001] cross reference This application claims priority under 35 U.S.C. § 119 to U.S. Provisional Patent Application No. 63 / 216,178, filed June 29, 2021, U.S. Provisional Patent Application No. 63 / 277,701, filed November 10, 2021, U.S. Provisional Patent Application No. 63 / 303,680, filed January 27, 2022, and U.S. Provisional Patent Application No. 63 / 345,059, filed May 24, 2022, the disclosures of which are incorporated herein by reference in their entireties. [Background technology]

[0002] Compositions that mediate RNA editing can be effective treatments for genetic diseases. However, there is a need for highly effective compositions that can maximize on-target RNA editing while simultaneously minimizing off-target RNA editing. Furthermore, there is a need for compositions that can promote RNA editing. Summary of the Invention

[0003] Disclosed herein is an engineered guide RNA and a composition comprising the engineered guide RNA, wherein (a) upon hybridization of the engineered guide RNA to a sequence of a target SNCA RNA, the engineered guide RNA forms a guide-target RNA scaffold with the sequence of the target SNCA RNA, (b) the formation of the guide-target RNA scaffold substantially forms one or more structural features selected from the group consisting of a bulge, an internal loop, and a hairpin, (c) the structural feature is not present in the engineered guide RNA prior to hybridization of the engineered guide RNA to the target SNCA RNA, and (d) upon hybridization of the engineered guide RNA to the sequence of the target SNCA RNA, the engineered guide RNA promotes RNA editing of one or more target adenosines in the sequence of the target SNCA RNA by an RNA editor. In some embodiments, the sequence of the target SNCA RNA is present in a 3' untranslated region (UTR). In some embodiments, the sequence of the target SNCA RNA is present in the 5' untranslated region (UTR). In some embodiments, the sequence of the target SNCA RNA in the 5' UTR is a Kozak sequence. In some embodiments, the sequence of the target SNCA RNA in the 5' UTR is an internal ribosome entry site (IRES). In some embodiments, the sequence of the target SNCA RNA in the 5' UTR is an iron response element (IRE). In some embodiments, the sequence of the target SNCA RNA comprises a translation start site. In some embodiments, the translation start site is the SNCA codon 1 translation start site in exon 2. In some embodiments, the translation start site is the SNCA codon 1 translation start site in exon 2, which corresponds to position 226 of SNCA transcript variant 1 of Accession Number NM_000345.4. In some embodiments, the one or more structural features include a first 6 / 6 symmetric internal loop at a position selected from the group consisting of: 32, 30, 28, 26, and 24 relative to the target adenosine at position 0.In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 13 relative to position 0, an A / C mismatch at position 15 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 13 relative to position 0, and an A / C mismatch at position 15 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 350. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 350. In some embodiments, the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −18 relative to position 0, a 3 / 3 symmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position −18 relative to position 0, a 3 / 3 symmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, and a U / C mismatch at position 10 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 303. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 303. In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -8 relative to position 0, an A / C mismatch at position 0, a G / U wobble at position 2 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position -8 relative to position 0, an A / C mismatch at position 0, and a G / U wobble at position 2 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 318. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 318. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -10 relative to position 0, a 2 / 2 symmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position -10 relative to position 0, a 2 / 2 symmetric bulge at position -6 relative to position 0, and an A / C mismatch at position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 353. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 353. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 0 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 0 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, and an A / A mismatch at position 4 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:361.In some embodiments, the engineered guide RNA comprises SEQ ID NO: 361. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -10 relative to position 0, a 2 / 0 asymmetric bulge at position -4 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position -10 relative to position 0, a 2 / 0 asymmetric bulge at position -4 relative to position 0, and an A / C mismatch at position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 365. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 365. In some embodiments, the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and a 2 / 2 symmetric bulge at position 5 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 356. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 356. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 3 / 3 symmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 3 / 3 symmetric bulge at position −4 relative to position 0, and an A / C mismatch at position 0.In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 367. In some embodiments, the engineered guide RNA comprises SEQ ID NO: 367. In some embodiments, a first 6 / 6 symmetric internal loop is present at position 24 relative to the target adenosine at position 0. In some embodiments, the one or more structural features comprise at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair. In some embodiments, the one or more structural features comprise a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, upon hybridization of the engineered guide RNA to the sequence of the target SNCA RNA, the engineered guide RNA promotes RNA editing of one or more adenosines in the sequence of the target SNCA RNA by an RNA editor. In some embodiments, the RNA editor comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to any of SEQ ID NOs: 2-11. In some embodiments, the engineered guide RNA is encoded by an engineered polynucleotide. In some embodiments, the engineered polynucleotide is contained in or present on a vector.In some embodiments, the vector is a viral vector, and the engineered polynucleotide is encapsidated in the viral vector. In some embodiments, the viral vector is an adeno-associated viral (AAV) vector or a derivative thereof. In some embodiments, the viral vector is an adeno-associated viral (AAV) vector, wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or a derivative, chimera, or variant of any of them. In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof. In some embodiments, In some embodiments, the engineered guide RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any of SEQ ID NOs: 12 through 384. In some embodiments, the engineered guide RNA has the sequence of any of SEQ ID NOs: 12 through 384.

[0004] Also disclosed herein is a pharmaceutical composition comprising (a) an engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein, and (b) a pharmaceutically acceptable excipient, carrier, or diluent.

[0005] Also disclosed herein are methods of treating a disease or condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an engineered guide RNA as described herein, a composition comprising an engineered guide RNA as described herein, or a pharmaceutical composition comprising an engineered guide RNA as described herein. In some embodiments, the disease or condition comprises a synucleinopathy. In some embodiments, the synucleinopathy comprises Parkinson's disease. In some embodiments, the subject is a human or non-human animal. In some embodiments, the pharmaceutical composition or composition is in unit dosage form. In some embodiments, administration is sufficient to treat one or more symptoms of the disease or condition. In some embodiments, the disease or condition is a synucleinopathy. In some embodiments, the one or more symptoms treated comprise rigidity, bradykinesia, resting tremor, or any combination thereof. In some embodiments, the administration is sufficient to reduce aggregation of alpha-synuclein protein compared to (a) the level of aggregation before administration, (b) the level of aggregation that accumulates in the subject in the absence of administration, or (c) both.

[0006] Also disclosed herein are methods for treating Parkinson's disease in a subject in need thereof, comprising administering to the subject an engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein in an amount sufficient to treat the subject's Parkinson's disease. In some embodiments, the administration is sufficient to treat one or more symptoms of Parkinson's disease in the subject compared to before administration. In some embodiments, the one or more symptoms treated include rigidity of muscles, bradykinesia, resting tremor, or any combination thereof. In some embodiments, the subject after administration exhibits an increased Unified Parkinson's Disease Rating Scale (UPDRS) score compared to the UPDRS score before administration.

[0007] Also disclosed herein are methods of editing SNCA RNA, the methods comprising contacting the SNCA RNA with an engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein and an RNA editing agent, thereby editing the SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines in the 3' untranslated region (UTR) of the SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines in the 5' untranslated region (UTR) of the SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines in the transcription start site (TIS) of the SNCA RNA. In some embodiments, the translation start site is the SNCA codon 1 translation start site of exon 2, the codon 5 translation start site of exon 2, or both. In some embodiments, the SNCA RNA comprises a pre-mRNA transcript of SNCA. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of SNCA pre-mRNA transcripts have at least one edit. In some embodiments, editing of SNCA RNA promotes protein knockdown. In some embodiments, protein knockdown comprises at least a 10% reduction compared to the amount of protein present prior to contact. In some embodiments, protein knockdown comprises an about 10% to about 25% reduction compared to the amount of protein present prior to contact. In some embodiments, protein knockdown comprises at least a 50% reduction compared to the amount of protein present prior to contact. In some embodiments, protein knockdown comprises knockdown of alpha-synuclein. In some embodiments, knockdown is measured in an in vitro assay. In some embodiments, knockdown is measured in an in vivo assay. In some embodiments, knockdown is measured in a human subject.

[0008] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0009] The novel features of the present disclosure are set forth with particularity in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which exemplary principles of the present disclosure are utilized, and the accompanying drawings, in which: [Brief explanation of the drawings]

[0010] [Figure 1] 1 shows a graph of SNCA expression as a percentage of wild type after cells were introduced with A to G mutations engineered into the gene at codon 1 TIS and codon 5 TIS. [Figure 2]

[0023] Figure 1 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base-paired with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). [Figure 3]1 is a plot showing the sequence similarity of the disclosed engineered guide RNAs targeting SNCA TIS to standard guide RNA designs on the x-axis and the percentage edited by ADAR2 enzyme on the y-axis. These data highlight the diverse sequence regions exhibited by the disclosed engineered guide RNAs targeting SNCA TIS, which have a variety of different structural features that result in sequence diversity and exhibit high on-target editing efficiency. [Figure 4] Figure 1 shows a schematic diagram of the transcription start sites (TIS) in SNCA. The top schematic shows a comprehensive view of the 5' region + TIS, while the bottom schematic shows a more detailed view of the different TISs. [Figure 5] ELISA evaluation of α-synuclein protein levels in SH-SY5Y cell lines with an integrated A>G mutation. *p<0.05, ***p<0.001, n=3-4 biological replicates, except for primary neurons (n=1). Data are presented as mean ± SD. Statistical tests: one-way ANOVA and Tukey's multiple comparison test. [Figure 6] A-B show immunoblot assessment of α-synuclein protein levels in SH-SY5Y cell lines with an integrated A>G mutation. A shows a representative immunoblot using an α-synuclein-specific antibody and a β-actin antibody as a protein loading control. B shows quantitative densitometry analysis of α-synuclein protein levels normalized to the protein loading control on the immunoblot. **p<0.01, ***p<0.001, n=3-4 biological replicates. Data are presented as mean ± SD. Statistical tests: one-way ANOVA and Tukey's multiple comparison test. [Figure 7]A-B show quantitative PCR assessment of SNCA mRNA transcript levels in SH-SY5Y cell lines with an integrated A>G mutation. SNCA mRNA transcript levels were measured by quantitative PCR using TaqMan Assays specific for either the SNCA exon 2-3 junction (A) or the SNCA exon 3-4 junction (B). **p<0.01, n=2-6 biological replicates. Data are shown as mean ± SD. Statistical tests: one-way analysis of variance and Tukey's multiple comparison test. [Figure 8-1] Biological replicates of in-cell experiments of 48 gRNAs selected by high-throughput screening are shown. [Figure 8-2] Biological replicates of in-cell experiments of 48 gRNAs selected by high-throughput screening are shown. [Figure 9] 1 shows intracellular editing by ADAR1 (left) or ADAR1+ADAR2 (right) of the targeted SNCA exon 1 TIS by a control guide (top) and a guide RNA of the disclosure (SEQ ID NO: 382 (bottom)). [Figure 10] 1 shows intracellular editing of SNCA exon 1 TIS targeted by guide RNAs of the disclosure (SEQ ID NO: 338 (top); SEQ ID NO: 329 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 11] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 336 (top); SEQ ID NO: 380 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 12] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 309 (top); SEQ ID NO: 359 (middle); SEQ ID NO: 357 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 13] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 320 (top); SEQ ID NO: 373 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 14] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 315 (top); SEQ ID NO: 321 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 15] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (sequence number 378 (top); sequence number 320 (middle); sequence number 351 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 16] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 312 (top); SEQ ID NO: 393 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 17] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 323 (top); SEQ ID NO: 332 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 18] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 374 (top); SEQ ID NO: 363 (middle); SEQ ID NO: 366 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 19] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 369 (top); SEQ ID NO: 355 (middle); SEQ ID NO: 349 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 20] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 295 (top); SEQ ID NO: 371 (middle); SEQ ID NO: 319 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 21] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 325 (top); SEQ ID NO: 219 (middle); SEQ ID NO: 330 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 22] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 340 (top); SEQ ID NO: 384 (middle); SEQ ID NO: 343 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 23] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 376 (top); SEQ ID NO: 242 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 24] 1 shows intracellular editing of targeting SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 345 (top); SEQ ID NO: 306 (middle); SEQ ID NO: 334 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 25] 1 shows intracellular editing of targeted SNCA exon 1 TIS by guide RNAs of the present disclosure (SEQ ID NO: 347 (top); SEQ ID NO: 327 (bottom)) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 26] 1 shows intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the present disclosure (SEQ ID NO: 341) with ADAR1 (left) or ADAR1+ADAR2 (right). [Figure 27] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 365) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 28] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 303) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 29] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 318) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 30]Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 350) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 31] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 361) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 32] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 367) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 33] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 356) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. [Figure 34] Two biological replicates of intracellular editing of targeted SNCA exon 1 TIS by a guide RNA of the disclosure (SEQ ID NO: 353) with ADAR1 (left) or ADAR1+ADAR2 (right) are shown. DETAILED DESCRIPTION OF THE INVENTION

[0011] RNA editing RNA editing can refer to the process in which RNA is modified with specific nucleosides by enzymes after synthesis. RNA editing can involve either the insertion, deletion, or substitution of nucleotide(s). Examples of RNA editing include chemical modifications, such as pseudouridylation (isomerization of uridine residues) and deamination (removal of an amine group from cytidine to produce uridine, or C→U editing; or removal of an amine group from adenosine to produce inosine, or A→I editing). RNA editing can be used to correct mutations (e.g., correct missense mutations) to restore protein expression, as well as introduce mutations or edit the coding or non-coding regions of RNA to inhibit RNA translation and achieve protein knockdown.

[0012] Described herein are engineered guide RNAs that promote RNA editing by RNA editing substances (e.g., RNA adenosine deaminase (ADAR)) or biologically active fragments thereof. For example, the engineered guide RNAs of the present disclosure can promote editing of the transcription start site (e.g., codon 1 transcription start site) of a target SNCA mRNA (e.g., an engineered guide RNA of any of SEQ ID NOS: 12-384). In some examples, ADARs can be enzymes that catalyze the chemical conversion of adenosine in RNA to inosine. Because the properties of inosine are similar to those of guanosine (e.g., inosine forms two hydrogen bonds with cytosine), inosine can be recognized as guanosine by the cellular translation machinery. "Adenosine-to-inosine (A→I) RNA editing" thus effectively alters the primary sequence of the RNA target. Typically, ADAR enzymes share a common domain structure that includes a variable number of amino-terminal dsRNA-binding domains (dsRBDs) and a single carboxy-terminal deaminase catalytic domain. Human ADARs have two or three dsRBDs. Evidence suggests that ADARs can form homodimers and heterodimers with other ADARs when bound to double-stranded RNA, although it is currently uncertain whether dimerization is required for editing to occur. The engineered guide RNAs disclosed herein can promote RNA editing by any of the three identified human ADAR genes (ADAR1-3) or any combination thereof. ADARs have a typical modular domain structure, containing at least two copies of a dsRNA-binding domain (dsRBD; ADAR1 has three dsRBDs, and ADAR2 and ADAR3 each have two dsRBDs) in their N-terminal region, followed by a C-terminal deaminase domain.

[0013] The engineered guide RNAs of the present disclosure (e.g., engineered guide RNAs of any of SEQ ID NOS: 12-384 listed in Table 2) promote RNA editing by endogenous ADAR enzymes (e.g., RNA editing of the SNCA codon 1 transcription start site). In some embodiments, an exogenous ADAR can be delivered together with the engineered guide RNAs disclosed herein to promote RNA editing. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human ADAR1, human ADAR2, human ADAR2, or any combination thereof.

[0014] In some embodiments, the present disclosure provides engineered guide RNAs that promote editing of specific regions of target RNAs (e.g., mRNAs or pre-mRNAs). For example, the engineered guide RNAs disclosed herein can target the coding or non-coding sequences of RNA. For example, the target region of the coding sequence of RNA can be the translation initiation site (TIS). In some embodiments, the target region of the non-coding sequence of RNA can be a polyadenylation (polyA) signal sequence.

[0015] TIS In some embodiments, the engineered guide RNAs of the present disclosure target an adenosine at the translation start site (TIS). In some embodiments, the engineered guide RNAs of the present disclosure (e.g., any of the engineered guide RNAs of SEQ ID NOS: 12-384 listed in Table 2) may target the TIS at codon 1 in exon 2, which corresponds to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4). The engineered guide RNA promotes ADAR-mediated RNA editing of the TIS (AUG) to GUG. This results in inhibition of RNA translation, thereby resulting in protein knockdown. Protein knockdown can also be referred to as a reduction in wild-type protein expression. In some embodiments, an engineered guide RNA of the present disclosure targeting the canonical TIS in codon 1 of exon 2 of SNCA (nucleotide position 226 of NCBI Reference Sequence: NM_000345.4) can be multiplexed with one or more additional engineered guide RNAs that target a different TIS of SNCA, for example, the codon 5 translation start site of exon 2. Alternatively or additionally, one or more engineered guide RNAs of the present disclosure targeting the canonical TIS in codon 1 of exon 2 of SNCA (nucleotide position 226 of NCBI Reference Sequence: NM_000345.4) can be multiplexed with one or more engineered guide RNAs that target a different sequence of SNCA, for example, the 5'UTR region of SNCA (e.g., the Kozak sequence of the 5'UTR, an internal ribosome entry site (IRES), or an iron response element (IRE)). In each of these cases, the multiplexed engineered guide RNAs can be delivered together in the same viral vector, or each of the different engineered guide RNAs can be delivered together but in a separate vector.

[0016] 3'UTR In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the 3' untranslated region (3'UTR). In some embodiments, the engineered guide RNA promotes ADAR-mediated RNA editing of one or more adenosines in the 3'UTR, thereby reducing mRNA export from the nucleus and inhibiting translation, resulting in protein knockdown.

[0017] 5'UTR In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the 5' untranslated region (5'UTR). Figure 4 displays a schematic diagram of a 5'UTR along with structures within the 5'UTR that can be targeted by a guide RNA of the present disclosure. In some embodiments, the engineered guide RNAs of the present disclosure may target a Kozak sequence in the 5'UTR. In some embodiments, the engineered guide RNAs of the present disclosure may target an internal ribosome entry site (IRES) in the 5'UTR. In some embodiments, the engineered guide RNAs of the present disclosure may target an iron response element (IRE) in the 5'UTR. In some embodiments, the engineered guide RNAs promote ADAR-mediated RNA editing of one or more adenosines in the 5'UTR (including one or more adenosines present in one or more structures in the 5'UTR). In some instances, extensive or excessive editing of multiple adenosines can be promoted by the engineered guide RNAs of the present disclosure, which can result in ribosomal stalling of mRNA transcripts, thereby resulting in protein knockdown.

[0018] PolyA Signal Sequences In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines of a polyA signal sequence. In some embodiments, the engineered guide RNA promotes ADAR-mediated RNA editing of one or more adenosines of the polyA signal sequence, thereby disrupting RNA processing and degrading the target mRNA, resulting in protein knockdown. In some embodiments, the target may have one or more polyA signal sequences. In these cases, one or more engineered guide RNAs of the present disclosure, each with a different sequence, may be multiplexed to target one or more adenosines of the polyA signal sequence. In both cases, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of the adenosines of the polyA signal sequence to inosines (which are read as guanosines by the cellular machinery), resulting in protein knockdown.

[0019] Engineered guide RNA Disclosed herein are engineered guide RNAs (e.g., engineered guide RNAs of any of SEQ ID NOS: 12-384 listed in Table 2) for site-specific selective editing of a target RNA (e.g., the SNCA codon 1 TIS in exon 2 corresponding to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)) by an RNA editing agent or a biologically active fragment thereof, and engineered polynucleotides encoding the same. The engineered guide RNAs of the present disclosure may comprise potential structures such that, when the engineered guide RNA hybridizes with a target RNA to form a guide-target RNA scaffold, at least a portion of the potential structure appears as at least a portion of the structural features described herein.

[0020] The engineered guide RNA as described herein comprises a targeting domain that is complementary to the target RNA described herein. Thus, the guide RNA can be engineered to site-specifically / selectively target a specific target RNA, hybridize thereto, and thereby promote the editing of a specific nucleotide of the target RNA by an RNA editor or a biologically active fragment thereof. The targeting domain can include a nucleotide that, when the guide RNA hybridizes to the target RNA, faces the base edited by the RNA editor or a biologically active fragment thereof, and is positioned so that it does not base-pair with the edited base or does not completely base-pair with the edited base. This mismatch can help the RNA editor to confine editing to the desired base of the target RNA. However, in some instances, some off-target editing may occur, and in some cases, significant off-target editing may occur.

[0021] Hybridization of the target RNA and the targeting domain of the guide RNA results in specific secondary structures in the guide-target RNA scaffold that emerge upon hybridization, referred to herein as "cryptic structures." When these structures emerge, they represent structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of the structural features described herein that form upon hybridization of the guide RNA with the target RNA configures the guide RNA to promote specific or selective targeted editing of the target RNA by an RNA editor or a biologically active fragment thereof. Furthermore, structural features combined with the mismatches described above typically promote increased amounts of target adenosine editing, less off-target editing, or both, compared to constructs containing only mismatches or constructs with perfect complementarity to the target RNA. Thus, rational design of cryptographic structures in engineered guide RNAs of the present disclosure to generate specific structural features in the guide-target RNA scaffold can be a powerful tool for promoting target RNA editing with high specificity, selectivity, and potent activity.

[0022] Provided herein are engineered guides and polynucleotides encoding them, as well as compositions comprising the engineered guide RNA or the polynucleotide. As used herein, the term "engineered," with respect to a guide RNA or a polynucleotide encoding it, refers to a non-natural guide RNA or a polynucleotide encoding it. For example, the present disclosure provides an engineered polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0023] In some examples, the engineered guides provided herein include engineered guides that can be configured, upon hybridization to a target RNA molecule, to at least partially form a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature that recruits an RNA editor and facilitates chemical modification of nucleotide bases of the target RNA molecule by the RNA editor.

[0024] In some examples, the target RNA of the engineered guide RNA of the present disclosure can be a pre-mRNA or an mRNA. In some embodiments, the engineered guide RNA of the present disclosure hybridizes to the sequence of the target RNA. In some embodiments, a portion of the engineered guide RNA (e.g., the targeting domain) hybridizes to the sequence of the target RNA. The portion of the engineered guide RNA that hybridizes to the target RNA is sufficiently complementary to the sequence of the target RNA for hybridization to occur.

[0025] A. Targeting Domains The engineered guide RNAs disclosed herein can be engineered in any manner suitable for RNA editing. In some embodiments, the engineered guide RNA typically comprises at least a targeting sequence that allows it to hybridize to a region of a target RNA molecule (e.g., the SNCA codon 1 TIS in exon 2, which corresponds to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)). The targeting sequence can also be referred to as a "targeting domain" or "targeting region."

[0026] In some examples, the targeting domain of the engineered guide enables the engineered guide to target an RNA sequence by base pairing, e.g., Watson-Crick base pairing. In some examples, the targeting sequence can be present at either the N-terminus or C-terminus of the engineered guide. In some examples, the targeting sequence can be present at both termini. The targeting sequence can be any length. In some examples, the targeting sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 10 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155 7, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 nucleotides in length, or up to about 200 nucleotides in length.In some examples, the targeting sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 The length of the guide RNA may be up to 3, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides. In some embodiments, the engineered guide RNA comprises a targeting sequence that may be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some embodiments, the engineered guide RNA comprises a targeting sequence that may be about 100 nucleotides in length.

[0027] In some examples, the targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target RNA. In some examples, the targeting sequence comprises less than 100% complementarity to the target RNA sequence. For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0028] The targeting sequence may have sufficient complementarity to the target RNA to allow hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to a non-contiguous stretch of sequence. In some embodiments, antisense complementarity refers to a continuous sequence section.

[0029] In some examples, an engineered guide RNA targeting SNCA may contain multiple targeting sequences. In some examples, one or more target sequence domains of the engineered guide RNA may bind to one or more regions of the target SNCA RNA. For example, a first targeting sequence may be configured to be at least partially complementary to a first region of the target RNA (e.g., the first exon of the pre-mRNA), while a second targeting sequence may be configured to be at least partially complementary to a second region of the target RNA (e.g., the second exon of the pre-mRNA). In some examples, multiple targeting sequences may be operably linked to provide continuous hybridization of multiple regions of the target RNA. In some examples, multiple targeting sequences may provide non-contiguous hybridization of multiple regions of the target RNA. "Discontinuous" overlap or hybridization refers to hybridization of a first region of a target SNCA RNA with a second targeting sequence simultaneously with hybridization of a second region of a target SNCA RNA with a first targeting sequence, where the first and second regions of the target SNCA RNA are non-contiguous (e.g., there is an intervening sequence between the first and second regions of the target RNA). For example, a targeting sequence may be configured to bind to a portion of a first exon and may include an asymmetric internal loop (e.g., an oligotether) configured to bind to a portion of a second exon, while the intervening sequence between the portion of exon 1 and the portion of exon 2 is not hybridized by the targeting sequence or the oligotether. The use of engineered guide RNAs as described herein configured for discontinuous hybridization may provide numerous advantages. For example, such guides could potentially target pre-mRNAs during (or shortly after) transcription, which could then facilitate chemical modification using deaminases (e.g., ADARs) concomitantly with transcription, thereby increasing the overall efficiency of chemical modification. Furthermore, the use of oligo-tethers could result in non-contiguous hybridization, while skipping intervening sequences could result in shorter, more specific guide RNAs with less off-target editing.

[0030] In some instances, an engineered guide RNA configured for non-contiguous hybridization to a target SNCA RNA (e.g., an engineered guide RNA comprising a targeting sequence with an oligo-tether) can be configured to bind to distinct regions of the target SNCA RNA separated by intervening sequences. In some examples, the intervening sequence is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 1 9, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940 , 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800,4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 76 The length of the targeting sequence may be 00, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10,000 nucleotides. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of the same intron or exon. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of adjacent exons or introns. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of distal exons or introns.

[0031] B. Engineered guide RNAs with recruitment domains In some examples, the engineered guide RNA of the present invention comprises a recruitment domain that recruits an RNA editor (e.g., an ADAR), where in some cases the recruitment domain is formed and present in the absence of binding to the target RNA. A "recruitment domain" may also be referred to herein as a "recruitment sequence" or "recruitment region." In some examples, the engineered guide of the present invention can promote editing of nucleotide bases in a target sequence of a target RNA, thereby modulating the expression of a polypeptide encoded by the target RNA. The modulation may be an increase in polypeptide expression or a decrease in polypeptide expression. In some examples, the engineered guide can be configured to promote editing of nucleotides or polynucleotide bases in an RNA region by an RNA editor (e.g., an ADAR). To promote editing, the engineered guide RNA of the present disclosure can recruit an RNA editor (e.g., an ADAR). A variety of RNA editor recruitment domains may be utilized. In some embodiments, the recruitment domain includes: ionotropic glutamate receptor AMPA-type subunit 2 (GluR2), an Alu sequence, or, if recruiting an APOBEC, an APOBEC recruitment domain.

[0032] In some examples, two or more recruitment domains may be included in the engineered guide of the present disclosure. In examples where a recruitment domain may be present, the recruitment domain may be used to position the RNA editor to effectively react with the target RNA of interest after the targeting sequence hybridizes to the target sequence of the target RNA. In some examples, the recruitment domain may enable transient binding of the RNA editor to the engineered guide. In some examples, the recruitment domain may enable persistent binding of the RNA editor to the engineered guide. The recruitment domain may be of any length. In some examples, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 nucleotides in length, up to about 80 nucleotides in length. In some examples, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length or less. In some examples, the recruitment domain can be about 45 nucleotides in length. In some examples, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some examples, at least a portion of the recruitment domain comprises about 45 nucleotides to about 60 nucleotides.

[0033] In some embodiments, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some instances, the GluR2 sequence can be recognized by an RNA editing agent, such as an ADAR, or a biologically active fragment thereof. In some embodiments, the GluR2 sequence can be a non-naturally occurring sequence. In some instances, the GluR2 sequence can be modified, for example, to enhance recruitment. In some embodiments, the GluR2 sequence can include portions of naturally occurring GluR2 sequences and synthetic sequences.

[0034] In some examples, the recruitment domain comprises a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and / or length to the GluR2 sequence, or GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 1). In some examples, the recruitment domain may comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1. In some examples, the recruitment domain may comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and / or length to SEQ ID NO: 1.

[0035] Additional RNA editor recruitment domains are also contemplated. In one embodiment, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme catalytic polypeptide-like (APOBEC) domain. In some instances, the APOBEC domain may comprise a non-native sequence or a naturally occurring sequence. In some embodiments, the sequence encoding the APOBEC domain may comprise a modified portion. In some instances, the sequence encoding the APOBEC domain may comprise a portion of the sequence encoding a naturally occurring APOBEC domain. In another embodiment, the recruitment domain may be derived from an Alu domain.

[0036] Any number of recruitment domains may be found in the engineered guides of the present disclosure. In some instances, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains may be included in the engineered guide. The recruitment domain may be located anywhere in the engineered guide RNA. In some instances, the recruitment domain may be located at the N-terminus, middle, or C-terminus of the engineered guide RNA. The recruitment domain may be located upstream or downstream of the targeting sequence. In some instances, the recruitment domain is adjacent to the targeting sequence of the guides of the present disclosure. The recruitment sequence may contain all ribonucleotides or deoxyribonucleotides, although in some cases, recruitment domains containing both ribonucleotides and deoxyribonucleotides may not be excluded.

[0037] C. Engineered guide RNAs with potential structures In some examples, the engineered guide disclosed herein useful for promoting target RNA editing by an RNA editing substance can be an engineered potential guide RNA. "Engineered potential guide RNA" refers to an engineered guide RNA that includes a potential structure. "Potential structure" refers to a structural feature that is substantially formed upon hybridization of the guide RNA to the target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are substantially formed only upon hybridization to the target RNA, and therefore, the one or more potential structural features appear as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural features are formed, thus exposing the potential structure provided by the guide RNA.

[0038] Upon hybridization of the engineered guide RNA of the present disclosure to a target RNA (e.g., SNCA codon 1 TIS), a double-stranded RNA (dsRNA) substrate is formed. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA scaffold."

[0039] Figure 2 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24-bp region (24 nucleotides on the target RNA side base-paired with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise noted, the number of nucleotides involved in a given structural feature is shown as the number of nucleotides on the guide RNA side versus the number of nucleotides on the target RNA side. This legend also provides clues for positional annotations in each figure. For example, the edited target nucleotide is designated as position 0. Each nucleotide downstream (3') of the edited target nucleotide is counted by +1. Each nucleotide upstream (5') of the edited target nucleotide is counted by -1. Thus, an exemplary 2 / 2 symmetric bulge in this legend occurs at positions +12 to +13 of the guide-target RNA scaffold. Similarly, a 2 / 3 asymmetric bulge in this legend occurs at positions -36 to -37 of the guide-target RNA scaffold. As used herein, positional annotations are provided relative to the edited target nucleotide and on the target RNA side of the guide-target RNA scaffold. As used herein, when a single position is annotated, the structural feature extends from that position away from position 0 (the edited target nucleotide). For example, if a potential guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, the 2 / 3 asymmetric bulge forms at positions -36 to -37 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold.As another example, if a potential guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, the 2 / 2 symmetric bulge is formed at positions +12 to +13 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold.

[0040] In some instances, the engineered guides disclosed herein lack a recruitment region, and recruitment of RNA editors can be achieved by structural features of the guide-target RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some instances, the engineered guides, when present in aqueous solution and not bound to a target RNA molecule, do not contain structural features that recruit RNA editors (e.g., ADARs). Upon hybridization to the target RNA, the engineered guide RNA forms one or more structural features with the target RNA molecule that recruit RNA editors (e.g., ADARs).

[0041] In the absence of a recruitment sequence, the engineered guide RNA may still be able to associate with a target RNA editing substance (e.g., an ADAR) to promote editing of the target RNA and / or regulate the expression of a polypeptide encoded by the target RNA. This may be achieved by structural features formed in the guide-target RNA scaffold that is formed upon hybridization of the engineered guide RNA and the target RNA. The structural features may include a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, or any combination thereof.

[0042] Structural features that may be present in the guide-target RNA scaffolds of the present disclosure are described herein. Examples of features include mismatches, bulges (symmetric or asymmetric), internal loops (symmetric or asymmetric internal loops), or hairpins (mobilizing or non-mobilizing hairpins). The engineered guide RNAs of the present disclosure may have 1 to 50 features. The engineered guide RNAs of the present disclosure may have 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 5 to 20, 1 to 3, 4 to 5, 2 to 10, 20 to 40, 10 to 40, 20 to 50, 30 to 50, 4 to 7, or 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from potential structures of the engineered potential guide RNA upon hybridization of the engineered potential guide RNA to the target RNA, thus forming a guide-target RNA scaffold. In some embodiments, the structural feature is not formed from a potential structure, but instead is a preformed structure (e.g., a GluR2 recruitment hairpin or a hairpin derived from U7 snRNA).

[0043] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in the guide RNA that is not paired with an opposing single nucleotide in the target RNA within the guide-target RNA scaffold. A mismatch can include any two single nucleotides that do not form a base pair. If the number of involved nucleotides on the guide RNA and target RNA sides exceeds one, the resulting structure is no longer considered a mismatch, but rather a "bulge" or "internal loop," depending on the size of the structural feature. In some embodiments, the mismatch is an A / C mismatch. An A / C mismatch can include a C of an engineered guide RNA of the present disclosure opposite an A of the target RNA. An A / C mismatch can include an A of an engineered guide RNA of the present disclosure opposite a C of the target RNA. A G / G mismatch can include a G of an engineered guide RNA of the present disclosure opposite a G of the target RNA.

[0044] In some embodiments, a mismatch located 5' of the editing site can facilitate base flipping of the edited target A. Mismatches can also serve to confer sequence specificity. Thus, mismatches can be structural features formed from potential structures provided by engineered potential guide RNAs.

[0045] In another embodiment, the structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly pair. For example, a wobble base pair in the present disclosure may refer to a G paired with a U. Thus, a wobble base pair may be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0046] In some instances, the structural feature may be a hairpin. As disclosed herein, a hairpin comprises an RNA duplex in which portions of a single-stranded RNA fold back on themselves to form an RNA duplex. The portions of the single-stranded RNA fold back due to nucleotide sequences that base-pair with each other, separated by an intervening sequence that does not base-pair with itself, thereby forming a base-paired portion and an intervening loop portion that does not base-pair. The hairpin may have an overall duplex length of 10 to 500 nucleotides. The loop portion of the hairpin may be 3 to 15 nucleotides long. A hairpin may be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein may have 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have one hairpin. In some embodiments, the engineered guide RNAs disclosed herein have two hairpins. As disclosed herein, hairpins can be recruitment hairpins or non-recruitment hairpins.Hairpins can be present anywhere within the engineered guide RNA of the present disclosure.In some embodiments, one or more hairpins can be located at or near the 3' end of the engineered guide RNA of the present disclosure, at or near the 5' end of the engineered guide RNA of the present disclosure, near or within the targeting domain of the engineered guide RNA of the present disclosure, or any combination thereof.

[0047] In some aspects, the structural feature comprises a non-recruiting hairpin. As disclosed herein, the non-recruiting hairpin does not have the primary function of recruiting an RNA editor. In some examples, the non-recruiting hairpin does not recruit an RNA editor. In some examples, the non-recruiting hairpin has a binding dissociation constant for an RNA editor that is insufficient for binding under physiological conditions. For example, the non-recruiting hairpin has a binding dissociation constant for an RNA editor at 25°C greater than about 1 mM, 10 mM, 100 mM, or 1 M, as measured in an in vitro assay. The non-recruiting hairpin may exhibit the function of improving the localization of an engineered guide RNA to a target RNA. In some embodiments, the non-recruiting hairpin improves intranuclear retention. In some embodiments, the non-recruiting hairpin comprises a hairpin derived from U7 snRNA. Thus, non-recruiting hairpins, such as those derived from U7 snRNA, are preformed structural features that may be present in constructs containing engineered guide RNA constructs, rather than structural features formed by potential structures introduced into engineered potential guide RNAs.

[0048] Hairpins of the present disclosure can be of any length, hi some embodiments, hairpins can be from about 10 to 500 nucleotides or more. In some examples, the hairpin has a length of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127 3, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188 46, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 24, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384 , 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486 45, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, or more nucleotides. In other cases, hairpins are 10-20, 10-30, 10-40,10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 10~110, 10~120, 10~130, 10~140, 10~150, 10~160, 10~170, 10~180, 10~190, 10~200, 10~210, 10~220, 10~230, 10~240, 10~250, 10~260, 10~270, 10~280, 10~ It may contain 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0049] A guide-target RNA scaffold is formed upon hybridization of the disclosed engineered guide RNA to a target RNA. As disclosed herein, a bulge refers to a structure that is substantially formed only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposing strand. A bulge can alter the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, respectively, or a bulge can have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold, respectively. However, as used herein, a bulge does not refer to a structure in which a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA do not base-pair; a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA that do not base-pair is referred to herein as a "mismatch." Furthermore, if the number of involved nucleotides on either the guide RNA or the target RNA exceeds four, the resulting structure is no longer considered a bulge, but rather an internal loop. In some embodiments, a guide-target RNA scaffold of the present disclosure has two bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has three bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has four bulges. Thus, a bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0050] In some embodiments, the presence of a bulge in the guide-target RNA scaffold can position or help position ADARs to selectively edit target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA scaffold can recruit or help recruit additional amounts of ADARs. The bulge in the guide-target RNA scaffold disclosed herein can recruit other proteins, such as other RNA editing substances. In some embodiments, a bulge located 5' of the editing site can promote base flipping of the target A to be edited. The bulge can also help impart sequence specificity to the A of the target RNA to be edited compared to other A(s) present in the target RNA. For example, the bulge can help direct ADAR editing by constraining it to a direction that results in selective editing of target A.

[0051] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be symmetric or asymmetric. A symmetric bulge is formed when the same number of nucleotides are present in both bulges. For example, a symmetric bulge of a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and two nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and three nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and four nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, the symmetrical bulge may be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0052] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. An asymmetric bulge is formed when a different number of nucleotides are present on either side of the bulge. For example, an asymmetric bulge of a guide-target RNA scaffold of the present disclosure can have a different number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and two nucleotides on the target RNA side of the guide-target RNA scaffold.The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by three nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.Therefore, the asymmetric bulge may be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0053] In some embodiments, the asymmetric bulge can be a 1 / 0 asymmetric bulge. In some embodiments, the 1 / 0 asymmetric bulge can be a U deletion. A "U deletion" refers to a 1 / 0 asymmetric bulge in which a U nucleotide in an engineered guide RNA that would be present opposite a non-targeting A in a target RNA of a guide-targeting RNA scaffold has been removed from the engineered guide RNA. In some instances, a 1 / 0 asymmetric bulge containing a U deletion can reduce editing of a non-targeting A compared to a comparable guide RNA lacking the U deletion.

[0054] In some instances, the structural feature may be an internal loop. As disclosed herein, an internal loop refers to a structure that is substantially formed only upon the formation of a guide-target RNA scaffold, in which the nucleotides of either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposite strand, and one side of the internal loop, either the target RNA side of the guide-target RNA scaffold or the engineered guide RNA side, has 5 or more nucleotides. If the number of nucleotides involved on both the guide RNA side and the target RNA side is reduced to less than 5, the resulting structure is no longer considered an internal loop, but rather a bulge or mismatch, depending on the size of the structural feature. The internal loop may be a symmetric internal loop or an asymmetric internal loop. An internal loop present near the editing site may be useful for base flipping of target A of the target RNA to be edited.

[0055] The internal loop side, the target RNA side or engineered guide RNA side of the guide-target RNA scaffold, can be formed by 5 to 150 nucleotides. The internal loop side can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop may be formed by 5 nucleotides. One side of the internal loop may be formed by 10 nucleotides. One side of the internal loop may be formed by 15 nucleotides. One side of the internal loop may be formed by 20 nucleotides. One side of the internal loop may be formed by 25 nucleotides. One side of the internal loop may be formed by 30 nucleotides. One side of the internal loop may be formed by 35 nucleotides. One side of the internal loop may be formed by 40 nucleotides. One side of the internal loop may be formed by 45 nucleotides. One side of the internal loop may be formed by 50 nucleotides. One side of the internal loop may be formed by 55 nucleotides. One side of the internal loop may be formed by 60 nucleotides. One side of the internal loop may be formed by 65 nucleotides. One side of the internal loop may be formed by 70 nucleotides. One side of the internal loop may be formed by 75 nucleotides. One side of the internal loop may be formed by 80 nucleotides. One side of the internal loop may be formed by 85 nucleotides. One side of the internal loop may be formed by 90 nucleotides. One side of the internal loop may be formed by 95 nucleotides. One side of the internal loop may be formed by 100 nucleotides. One side of the internal loop may be formed by 110 nucleotides. One side of the internal loop may be formed by 120 nucleotides. One side of the internal loop may be formed by 130 nucleotides. One side of the internal loop may be formed by 140 nucleotides.One side of the internal loop may be formed by 150 nucleotides. One side of the internal loop may be formed by 200 nucleotides. One side of the internal loop may be formed by 250 nucleotides. One side of the internal loop may be formed by 300 nucleotides. One side of the internal loop may be formed by 350 nucleotides. One side of the internal loop may be formed by 400 nucleotides. One side of the internal loop may be formed by 450 nucleotides. One side of the internal loop may be formed by 500 nucleotides. One side of the internal loop may be formed by 600 nucleotides. One side of the internal loop may be formed by 700 nucleotides. One side of the internal loop may be formed by 800 nucleotides. One side of the internal loop may be formed by 900 nucleotides. One side of the internal loop may be formed by 1000 nucleotides. Thus, an internal loop may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0056] The internal loop may be a symmetric internal loop or an asymmetric internal loop. A symmetric internal loop is formed when the same number of nucleotides are present on both sides of the internal loop. For example, a symmetric internal loop of a guide-target RNA scaffold of the present disclosure may have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 15 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 20 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 30 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 40 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 50 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 60 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 70 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 80 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 90 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 100 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 110 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 120 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 130 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 140 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 200 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 250 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 300 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 350 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 400 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 450 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 500 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0057] An asymmetric internal loop is formed when there are different numbers of nucleotides on either side of the internal loop. For example, the asymmetric internal loop of a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0058] The asymmetric internal loop of the present disclosure can be formed by 5 to 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different compared to the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 to 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different compared to the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by a 5-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 5-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 50-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 5-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 100-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 5-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 150-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0059] As disclosed herein, a "base-paired (bp) region" refers to a region of a guide-target RNA scaffold in which a base of the guide RNA pairs with an opposing base of the target RNA. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near the other end of the guide-target RNA scaffold. A base-paired region can extend between two structural features. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near a structural feature. A base-paired region can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base-paired region is from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp , at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

[0060] The present disclosure provides engineered guide RNAs (e.g., any of SEQ ID NOS: 12-384 listed in Table 2) that target a target SNCA RNA sequence (e.g., the codon 1 TIS of exon 2 corresponding to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)).

[0061] In some instances, the engineered guide RNA comprises one or more structural features that manifest as potential structures that result in editing of a target adenosine (defined as position 0) of a target sequence (e.g., codon 1 TIS) of an SNCA RNA. In some embodiments, the one or more structural features comprise a first 6 / 6 symmetric internal loop and a second 6 / 6 symmetric internal loop. In some embodiments, the one or more structural features comprise a first 6 / 6 symmetric internal loop at a position selected from the group consisting of 32, 30, 28, 26, and 24 relative to the target adenosine at position 0.

[0062] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 32 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, and any combination thereof.

[0063] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0064] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 336, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0065] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 336, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0066] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 32 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 13 relative to position 0, an A / C mismatch at position 15 relative to position 0, and any combination thereof.

[0067] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 15 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0068] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 350, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 15 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0069] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 350, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 15 relative to position 0, and a 6-nucleotide symmetric internal loop at position 32 relative to position 0.

[0070] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, and any combination thereof.

[0071] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0072] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 293, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0073] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 293, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0074] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −18 relative to position 0, a 3 / 3 symmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof.

[0075] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position −18 relative to position 0, a 3-nucleotide symmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0076] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 303, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −18 relative to position 0, a 3-nucleotide symmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0077] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 303, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −18 relative to position 0, a 3-nucleotide symmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0078] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 4 relative to position 0, a C / C mismatch at position 11 relative to position 0, and any combination thereof.

[0079] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0080] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 306, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0081] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 306, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0082] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 4 / 4 symmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof.

[0083] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 4-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0084] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 309, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −14 relative to position 0, a 4-nucleotide symmetric bulge at position −5 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0085] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 309, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 4-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0086] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof.

[0087] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0088] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 315, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0089] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 315, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at positions 0 to 30.

[0090] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a C / U mismatch at position 11 relative to position 0, a G / A mismatch at position 19 relative to position 0, and any combination thereof.

[0091] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0092] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 320, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0093] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 320, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0094] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −16 relative to position 0, a 1 / 0 asymmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, a U / G wobble at position 7 relative to position 0, and any combination thereof.

[0095] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 1 / 0 nucleotide asymmetric bulge at position −4 relative to position 0, a 1 nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0096] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 321, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 1 / 0 nucleotide asymmetric bulge at position −4 relative to position 0, a 1 nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0097] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 321, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 1 / 0 nucleotide asymmetric bulge at position −4 relative to position 0, a 1 nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0098] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 2 / 0 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 5 relative to position 0, an A / G mismatch at position 12 relative to position 0, and any combination thereof.

[0099] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 2-nucleotide asymmetric bulge at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 5 relative to position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0100] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 325, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 2-nucleotide asymmetric bulge at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 5 relative to position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0101] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 325, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 2-nucleotide asymmetric bulge at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 5 relative to position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0102] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 2 / 0 asymmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0103] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -5 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0104] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 338, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -5 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0105] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 338, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −14 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position −5 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0106] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a U / G wobble at position −6 relative to position 0, a 2 / 0 asymmetric bulge at position −3 relative to position 0, an A / C mismatch at position 0, a G / A mismatch at position 19 relative to position 0, and any combination thereof.

[0107] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a wobble base pair at position -6 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -3 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0108] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 349, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a wobble base pair at position -6 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -3 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0109] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 349, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a wobble base pair at position -6 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -3 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 19 relative to position 0, and a 6-nucleotide symmetric internal loop at position 30 relative to position 0.

[0110] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a G / U wobble at position 2 relative to position 0, and any combination thereof.

[0111] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 2 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0112] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 318, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 2 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0113] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 318, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 2 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0114] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −16 relative to position 0, a 4 / 1 asymmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, a G / U wobble at position 6 relative to position 0, and any combination thereof.

[0115] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 4 / 1 asymmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0116] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 319, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 4 / 1 asymmetric bulge at position −5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0117] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 319, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 4 / 1 asymmetric bulge at position −5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0118] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, a C / U mismatch at position 11 relative to position 0, and any combination thereof.

[0119] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0120] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 329, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0121] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 329, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0122] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −16 relative to position 0, a 2 / 0 asymmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 7 relative to position 0, and any combination thereof.

[0123] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -4 relative to position 0, a 1 nucleotide mismatch at position 0, a 1 nucleotide mismatch at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0124] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 334, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0125] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 334, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position −4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0126] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof.

[0127] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0128] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 347, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0129] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 347, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0130] In some instances, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some instances, the one or more structural features further include at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, and any combination thereof.

[0131] In some instances, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 1 nucleotide mismatch at position 0, a 1 nucleotide mismatch at position 6 relative to position 0, and a 6 nucleotide symmetric internal loop at position 28 relative to position 0.

[0132] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 351, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0133] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 351, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0134] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 2 / 2 symmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0135] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2-nucleotide symmetric bulge at position 6 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0136] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 353, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2-nucleotide symmetric bulge at position 6 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0137] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 353, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2-nucleotide symmetric bulge at position 6 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0138] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −18 relative to position 0, a 2 / 0 asymmetric bulge at position −3 relative to position 0, an A / C mismatch at position 0, a 0 / 2 asymmetric bulge at position 18 relative to position 0, and any combination thereof.

[0139] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -18 relative to position 0, a 2 / 0 asymmetric bulge at position -3 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 2 nucleotide asymmetric bulge at position 18 relative to position 0, and a 6-nucleotide symmetric internal bulge at position 28 relative to position 0.

[0140] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 355, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −18 relative to position 0, a 2 / 0 asymmetric bulge at position −3 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 2 nucleotide asymmetric bulge at position 18 relative to position 0, and a 6-nucleotide symmetric internal bulge at position 28 relative to position 0.

[0141] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 355, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −18 relative to position 0, a 2 / 0 asymmetric bulge at position −3 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 2 nucleotide asymmetric bulge at position 18 relative to position 0, and a 6-nucleotide symmetric internal bulge at position 28 relative to position 0.

[0142] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, a 2 / 1 asymmetric bulge at position −2 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0143] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position -2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0144] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 357, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position -2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0145] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 357, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −8 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position −2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0146] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 2 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a U / C mismatch at position 13 relative to position 0, and any combination thereof.

[0147] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position -6 relative to position 0, a 1 nucleotide mismatch at position 0, a 1 nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0148] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 359, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0149] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 359, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0150] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 0 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof.

[0151] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6 nucleotide symmetric internal loop at position −10 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position −6 relative to position 0, a 1 nucleotide mismatch at position 0, a 1 nucleotide mismatch at position 4 relative to position 0, and a 28 nucleotide symmetric internal loop at position 28 relative to position 0.

[0152] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 361, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 28-nucleotide symmetric internal loop at position 28 relative to position 0.

[0153] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 361, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position −6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 28-nucleotide symmetric internal loop at position 28 relative to position 0.

[0154] In some instances, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some instances, the one or more structural features further include at least one structural feature selected from the group consisting of a G / G mismatch at position −3 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0155] In some instances, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 1 nucleotide mismatch at position -3 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6 nucleotide symmetric internal loop at position 28 relative to position 0.

[0156] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 363, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 1 nucleotide mismatch at position -3 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6 nucleotide symmetric internal loop at position 28 relative to position 0.

[0157] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 363, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 1 nucleotide mismatch at position -3 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6 nucleotide symmetric internal loop at position 28 relative to position 0.

[0158] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 2 / 0 asymmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0159] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -4 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0160] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 365, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position -4 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0161] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 365, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 2 / 0 nucleotide asymmetric bulge at position −4 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0162] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −16 relative to position 0, a 4 / 3 asymmetric bulge at position −3 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0163] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 4 / 3 nucleotide asymmetric bulge at position -3 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0164] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 366, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 4 / 3 nucleotide asymmetric bulge at position −3 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0165] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 366, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 4 / 3 nucleotide asymmetric bulge at position −3 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0166] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −4 relative to position 0, an A / C mismatch at position 0, a 2 / 1 asymmetric bulge at position 4 relative to position 0, and any combination thereof.

[0167] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 2 / 1-nucleotide asymmetric bulge at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0168] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 369, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 2 / 1-nucleotide asymmetric bulge at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0169] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 369, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 2 / 1-nucleotide asymmetric bulge at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0170] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −4 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 12 relative to position 0, and any combination thereof.

[0171] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0172] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 374, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0173] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 374, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 12 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0174] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −4 relative to position 0, an A / C mismatch at position 0, a C / C mismatch at position 11 relative to position 0, and any combination thereof.

[0175] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0176] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 376, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0177] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 376, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0178] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a G / U wobble at position 3 relative to position 0, a U / C mismatch at position 13 relative to position 0, and any combination thereof.

[0179] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 3 relative to position 0, a 1-nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0180] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 378, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 3 relative to position 0, a 1-nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0181] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 378, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 3 relative to position 0, a 1-nucleotide mismatch at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0182] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a C / U mismatch at position 11 relative to position 0, and any combination thereof.

[0183] In some instances, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0184] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 380, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0185] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 380, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0186] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 3 / 3 symmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0187] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 nucleotides downstream of target A.

[0188] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 382, ​​and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 downstream of the target A.

[0189] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 382, ​​and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 28 downstream of target A.

[0190] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −10 relative to position 0, a 3 / 3 symmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, a U / G wobble at position 10 relative to position 0, and any combination thereof.

[0191] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0192] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 384, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0193] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 384, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 3-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 10 relative to position 0, and a 6-nucleotide symmetric internal loop at position 28 relative to position 0.

[0194] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −12 relative to position 0, a 3 / 2 asymmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, a U / G wobble at position 13 relative to position 0, and any combination thereof.

[0195] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -12 relative to position 0, a 3 / 2 nucleotide asymmetric bulge at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0196] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 299, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -12 relative to position 0, a 3 / 2 nucleotide asymmetric bulge at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0197] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 299, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -12 relative to position 0, a 3 / 2 nucleotide asymmetric bulge at position -4 relative to position 0, a 1-nucleotide mismatch at position 0, a wobble base pair at position 13 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0198] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, an A / A mismatch at position −7 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0199] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -7 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0200] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 312, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -7 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0201] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 312, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -7 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0202] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −12 relative to position 0, a 2 / 1 asymmetric bulge at position −2 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0203] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -12 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position -2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0204] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 323, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -12 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position -2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0205] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 323, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −12 relative to position 0, a 2 / 1 nucleotide asymmetric bulge at position −2 relative to position 0, a 1 nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0206] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, a U / G wobble at position −6 relative to position 0, an A / C mismatch at position 0, a U / U mismatch at position 9 relative to position 0, and any combination thereof.

[0207] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a wobble base pair at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 9 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0208] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 327, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a wobble base pair at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 9 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0209] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 327, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a wobble base pair at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 9 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0210] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -16 relative to position 0, a 0 / 1 asymmetric bulge at position -7 relative to position 0, an A / C mismatch at position 0, a C / U mismatch at position 11 relative to position 0, and any combination thereof.

[0211] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position -7 relative to position 0, a 1 nucleotide mismatch at position 0, a 1 nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0212] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 341, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -16 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position -7 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0213] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 341, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −16 relative to position 0, a 0 / 1 nucleotide asymmetric bulge at position −7 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 11 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0214] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -10 relative to position 0, a U / C mismatch at position -5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0215] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0216] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 343, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0217] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 343, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0218] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof.

[0219] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0220] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 356, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0221] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 356, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 2-nucleotide symmetric bulge at position 5 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0222] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −14 relative to position 0, a 3 / 3 symmetric bulge at position −4 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0223] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0224] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 367, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0225] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 367, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 3-nucleotide symmetric bulge at position 4 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0226] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -10 relative to position 0, a 2 / 2 symmetric bulge at position -5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0227] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -10 relative to position 0, a 2-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0228] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 371, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 2-nucleotide symmetric bulge at position −5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0229] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 371, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position −10 relative to position 0, a 2-nucleotide symmetric bulge at position −5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0230] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −20 relative to position 0, a 4 / 4 symmetric bulge at position −5 relative to position 0, an A / C mismatch at position 0, a 0 / 1 asymmetric bulge at position 5 relative to position 0, an A / C mismatch at position 17 relative to position 0, and any combination thereof.

[0231] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -20 relative to position 0, a 4-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 1-nucleotide asymmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 17 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0232] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 373, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -20 relative to position 0, a 4-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 1-nucleotide asymmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 17 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0233] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 373, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -20 relative to position 0, a 4-nucleotide symmetric bulge at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, a 0 / 1-nucleotide asymmetric bulge at position 5 relative to position 0, a 1-nucleotide mismatch at position 17 relative to position 0, and a 6-nucleotide symmetric internal loop at position 26 relative to position 0.

[0234] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 24 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, and any combination thereof.

[0235] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0236] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 295, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0237] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 295, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0238] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 24 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -18 relative to position 0, a U / C mismatch at position -5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0239] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -18 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0240] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 330, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -18 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0241] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 330, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -18 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0242] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 24 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position -14 relative to position 0, a U / C mismatch at position -5 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

[0243] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0244] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 332, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0245] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 332, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -14 relative to position 0, a 1-nucleotide mismatch at position -5 relative to position 0, a 1-nucleotide mismatch at position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0246] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 24 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of a 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, an A / C mismatch at position 4 relative to position 0, and any combination thereof.

[0247] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0248] In some instances, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 340, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0249] In some examples, an engineered guide RNA of the present disclosure directed against a target SNCA RNA has the sequence of SEQ ID NO: 340, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a 6-nucleotide symmetric internal loop at position -8 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 4 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0250] In some examples, the one or more structural features include a first 6 / 6 symmetric internal loop at position 24 relative to the target adenosine at position 0. In some examples, the one or more structural features further include at least one structural feature selected from the group consisting of an 8 / 8 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / A mismatch at position 6 relative to position 0, a U / G wobble at position 7 relative to position 1, and any combination thereof.

[0251] In some examples, structural features formed upon hybridization of an engineered guide RNA of the present disclosure to a target SNCA RNA include an 8-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0252] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 345, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises an 8-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0253] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has the sequence of SEQ ID NO: 345, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises an 8-nucleotide symmetric internal loop at position -6 relative to position 0, a 1-nucleotide mismatch at position 0, a 1-nucleotide mismatch at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a 6-nucleotide symmetric internal loop at position 24 relative to position 0.

[0254] In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 365, or the engineered guide RNA comprises the sequence of SEQ ID NO: 365. In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 303, or the engineered guide RNA comprises the sequence of SEQ ID NO: 303. In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 318, or the engineered guide RNA comprises the sequence of SEQ ID NO: 318. In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 350, or the engineered guide RNA comprises the sequence of SEQ ID NO: 350. In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 361, or the engineered guide RNA comprises the sequence of SEQ ID NO: 361. In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 367, or the engineered guide RNA comprises the sequence of SEQ ID NO: 367.In some examples, an engineered guide RNA of the present disclosure for a target SNCA RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 353, or the engineered guide RNA comprises the sequence of SEQ ID NO: 353.

[0255] Additional components of engineered RNA The present disclosure provides engineered guide RNAs with additional structural features and components.For example, the engineered guide RNAs described herein can be circular.In another example, the engineered guide RNAs described herein can include a U7 sequence, a SmOPT sequence, or a combination of both sequences.

[0256] In some examples, the engineered guide RNA may be circularized. In some examples, the engineered guide RNAs provided herein may be circularized or may have a circular structure. In some aspects, the circular guide RNA at least partially lacks a 5' hydroxyl or a 3' hydroxyl. In some embodiments, the engineered circular guide RNA may include any of the guide RNAs listed in SEQ ID NOs: 12-384 in Table 2, which target the SNCA codon 1 TIS in exon 2.

[0257] In some instances, the engineered guide RNA may comprise a backbone comprising multiple sugar and phosphate moieties covalently linked to one another, hi some instances, the backbone of the engineered guide RNA may comprise a phosphodiester bond linkage between the first hydroxyl group of the phosphate group on the 5' carbon of the deoxyribose of DNA or the ribose of RNA and the second hydroxyl group on the 3' carbon of the deoxyribose of DNA or the ribose of RNA.

[0258] In some embodiments, the backbone of the engineered guide RNA may lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to solvent. In some embodiments, the backbone of the engineered guide may lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to nucleases. In some embodiments, the backbone of the engineered guide may lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to hydrolases. In some examples, the backbone of the engineered guide may be represented as a polynucleotide sequence in a circular two-dimensional format, with the nucleotides presented in sequential order. In some examples, the backbone of the engineered guide may be represented as a polynucleotide sequence in a looped two-dimensional format, with the nucleotides presented in sequential order. In some examples, the 5' hydroxyl, the 3' hydroxyl, or both may be linked by a phosphorus-oxygen bond. In some examples, the 5' hydroxyl, the 3' hydroxyl, or both may be modified to a phosphoester having a phosphorus-containing moiety.

[0259] As described herein, the engineered guide may comprise a circular structure. The engineered polynucleotide may be circularized from an engineered precursor polynucleotide. Such an engineered precursor polynucleotide may be an engineered linear precursor polynucleotide. In some examples, the engineered linear precursor polynucleotide may be a precursor of an engineered circular guide RNA. For example, the engineered linear precursor polynucleotide may be a linear mRNA transcribed from a plasmid, which may be configured to circularize in a cell using the techniques described herein. The engineered linear precursor polynucleotide may be constructed with domains such as a ribozyme domain and a ligation domain that enable circularization when inserted into a cell. The ribozyme domain may include a domain that can cleave the linear precursor RNA at a specific site (e.g., adjacent to the ligation domain). The engineered linear precursor polynucleotide may comprise, from 5' to 3', a 5' ribozyme domain, a 5' ligation domain, a region to be circularized, a 3' ligation domain, and a 3' ribozyme domain. In some examples, the region to be circularized can include a guide RNA described herein. In some examples, a precursor polynucleotide can be specifically processed at both sites by 5' and 3' ribozymes, respectively, to expose free ends of 5' and 3' ligation domains. The exposed free ends can be ligatable, such that the ends can be ligated to form a circularized mature structure. For example, the free ends can include a 5'-OH and a 2',3'-cyclic phosphate that can be ligated by RNA ligation in a cell. A linear polynucleotide having a ligation domain and a ribozyme domain can be transfected into a cell where it can be circularized by endogenous intracellular enzymes. In some examples, the polynucleotide can encode an engineered guide RNA containing a ribozyme domain and a ligation domain described herein that can be circularized in a cell.Circular guide RNAs are described in PCT / US2021 / 034301, which is incorporated by reference in its entirety.

[0260] An engineered polynucleotide (e.g., a circularized guide RNA) as described herein may contain a spacer domain. As used herein, a spacer domain may refer to a domain that provides spacing between other domains. A spacer domain may be used between the circularized region and the adjacent ligation sequence to increase the overall size of the mature circularized guide RNA. When the circularized region includes a targeting domain as described herein that is configured to bind to a target sequence, the addition of a spacer may provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) to the target polynucleotide of the engineered polynucleotide compared to an equivalent engineered polynucleotide lacking the spacer domain. In some examples, the spacer domain is configured so as not to hybridize with the target RNA. In some embodiments, the engineered precursor polynucleotide or engineered circular guide may comprise, in 5' to 3' order, a first ribozyme domain, a first ligation domain, a first spacer domain, a targeting domain that may be at least partially complementary to a target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some examples, when the targeting domain binds to the target RNA, the first spacer domain, the second spacer domain, or both are configured not to bind to the target RNA.

[0261] The disclosed compositions and methods provide engineered polynucleotides encoding guide RNAs operably linked to portions of small nuclear ribonucleic acid (snRNA) sequences. The engineered polynucleotides may include at least a portion of the small nuclear ribonucleic acid (snRNA) sequence. U7 and U1 small nuclear RNAs, whose original role is in spliceosomal processing of pre-mRNAs, have been redesigned for decades to alter splicing at desired disease targets. Replacing the first 18 nt of U7 snRNA (which naturally hybridizes to the spacer element of histone pre-mRNAs) with a short targeting (or antisense) sequence for a disease gene redirects the splicing machinery to alter splicing around its target site. Furthermore, converting the Sm domain-binding site of wild-type U7 to an optimized Sm-binding consensus sequence (SmOPT) can increase the expression level, activity, and subcellular localization of engineered artificial antisense U7 snRNAs. Subsequent groups have applied this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit spliceosome components and alter RNA splicing of additional disease targets.

[0262] snRNAs are a type of small RNA molecule found in the nucleus of eukaryotic cells. They are involved in various important processes, such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintenance of telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are called small ribonucleoproteins (snRNPs), or sometimes snurps. There are numerous snRNAs, designated U1, U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0263] U7-type snRNAs are typically involved in the maturation of histone mRNAs. These snRNAs have been identified in numerous eukaryotic species (56 so far), and the U7 snRNAs of each of these species should be considered equally advantageous for the present disclosure.

[0264] The wild-type U7 snRNA contains a stem-loop structure, a U7-specific Sm sequence, and an antisense sequence to the 3' end of the histone pre-mRNA.

[0265] In addition to the SmOPT domain, U7 contains an antisense sequence to the 3' end of histone pre-mRNA. When this sequence is replaced with an antisense sequence to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Thus, stable expression of a modified U7 snRNA containing the SmOPT domain and a targeted antisense sequence resulted in specific changes in mRNA splicing. An AAV-2 / 1-based vector expressing an appropriately modified mouse U7 gene with its native promoter and 3' elements enabled highly efficient gene transfer into skeletal muscle and complete dystrophin rescue by covering and skipping exon 23 of mouse Dmd. The engineered polynucleotides described herein (whether administered directly or, for example, via an AAV vector) can promote editing of target RNA by deaminase.

[0266] The engineered polynucleotide can comprise, at least in part, a snRNA sequence. The snRNA sequence can be a U1, U2, U3, U4, U5, U6, U7, U8, U9, or U10 snRNA sequence.

[0267] In some instances, engineered polynucleotides comprising at least a portion of an snRNA sequence (e.g., an snRNA promoter, an snRNA hairpin, etc.) may have superior properties for treating or preventing a disease or condition compared to equivalent polynucleotides lacking such characteristics. For example, as described herein, engineered polynucleotides comprising at least a portion of an snRNA sequence may promote exon skipping of an exon more efficiently than equivalent polynucleotides lacking such characteristics. Furthermore, as described herein, engineered polynucleotides comprising at least a portion of an snRNA sequence may promote editing of nucleotide bases of a target RNA (e.g., a pre-mRNA or a mature RNA) more efficiently than equivalent polynucleotides lacking such characteristics. Promoter and snRNA components are described in PCT / US2021 / 028618, which is incorporated by reference in its entirety.

[0268] Disclosed herein is an engineered RNA comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, an SmOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 hairpin sequence or a mouse U7 hairpin sequence. In some examples, the human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 385 or RNA: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 386)). In some examples, the mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 387 or RNA: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 1593)). In some embodiments, the SmOPT sequence has the sequence AATTTTTGGAG (SEQ ID NO: 388) or RNA:AAUUUUUGGAG (SEQ ID NO: 389). In some embodiments, a guide RNA of any of SEQ ID NOs: 12-384 listed in Table 2 that targets SNCA codon 1 TIS in exon 2 can include a guide RNA that includes a U7 hairpin sequence (e.g., a human or mouse U7 hairpin sequence), an SmOPT sequence, or a combination thereof. In some examples, the combination of a U7 hairpin sequence and an SmOPT sequence can include an SmOPT U7 hairpin sequence, in which the SmOPT sequence is linked to the U7 sequence. In some examples, a U7 hairpin sequence, an SmOPT sequence, or a combination thereof is downstream (e.g., 3') of an engineered guide RNA disclosed herein.

[0269] Also disclosed herein is a promoter for driving the expression of the guide RNA disclosed herein.In some examples, the promoter for driving expression can be located 5' to the guide RNA sequence disclosed herein.In some examples, the promoter can include a U1 promoter, a U7 promoter, a U6 promoter, or any combination thereof.In some examples, the promoter can include a CMV promoter.In some examples, the U7 promoter or the U6 promoter can be a mouse U7 promoter or a mouse U6 promoter.In some examples, the U1 promoter, the U7 promoter, or the U6 promoter can be a human U1 promoter, a human U7 promoter, or a human U6 promoter. In some examples, the human U6 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 390).In some examples, the mouse U6 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to GTACTGAGTCGCCCAGTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTG (SEQ ID NO: 391). In some examples, the human U7 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to TTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA (SEQ ID NO: 392).In some examples, the mouse U7 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to TTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC (SEQ ID NO: 393). In some examples, the human U1 promoter is TAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCTCTTGGCGACTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTT CGCCACGAAGGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGCCCGAAGATCTC (SEQ ID NO: 394).In some examples, the CMV promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to (SEQ ID NO: 395).

[0270] Targets and Treatment Methods The present disclosure provides compositions of engineered guide RNAs or engineered polynucleotides encoding guide RNAs, and methods of using them, such as treatment methods. In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target a coding sequence of an RNA (e.g., a TIS). In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target a non-coding sequence of an RNA (e.g., a polyA sequence). In some embodiments, the present disclosure provides compositions of one or more engineered polynucleotides encoding two or more engineered guide RNAs that target a TIS, a polyA sequence, or any other part of a coding or non-coding sequence. The engineered guide RNAs disclosed herein promote ADAR-mediated RNA editing of adenosines in a TIS, a polyA sequence, any part of a coding sequence of an RNA, any part of a non-coding sequence of an RNA, or any combination thereof.

[0271] The present disclosure provides engineered guide RNAs that, upon contact with SNCA RNA, promote editing of SNCA RNA, thereby knocking down expression of alpha-synuclein protein. Knockdown by the engineered guide RNAs of the present disclosure results in a reduction of alpha-synuclein protein by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to the amount before contacting the engineered guide RNA with SNCA RNA. Alpha-synucleinopathies are characterized by alpha-synuclein dysfunction, overexpression, and / or aggregation, and are associated with neurodegenerative disorders based on genetic and neuropathological evidence. The gene encoding alpha-synuclein protein is referred to as SNCA. In Parkinson's disease (PD), gene duplications and variants (e.g., A53T) in SNCA that promote alpha-synuclein aggregation result in early-onset and severe forms of the disease. Thus, the engineered guide RNAs of the present disclosure can target SNCA for RNA editing, thereby causing a reduction in alpha-synuclein synthesis and promoting the removal of aggregation. In some embodiments, the present disclosure provides engineered guide RNA compositions that target SNCA and promote ADAR-mediated RNA editing of SNCA by targeting a critical adenosine present in the translation start site (TIS) or 3'UTR for deamination, thereby reducing pathogenic levels of alpha-synuclein. In some embodiments, the engineered guide RNAs of the present disclosure target the coding sequence of SNCA. For example, the coding sequence can be the translation start site (TIS) (AUG) of SNCA, and the engineered guide RNA can promote ADAR-mediated RNA editing of AUG to GUG.For example, as shown in FIG. 1 , an A to G mutation engineered into the gene for the TIS at codon 1 results in an approximately 90% reduction in alpha-synuclein protein levels, while an A to G mutation (ATG to GTG) engineered into the gene for the TIS at codon 1 and codon 5 results in almost complete suppression of translation. Thus, engineered guide RNAs of the present disclosure that target these sites in SNCA can promote editing that inhibits translation and reduces alpha-synuclein protein expression. In some embodiments, the TIS targeted by an engineered guide RNA of the present disclosure is in codon 1 of SNCA. In some embodiments, the TIS targeted by an engineered guide RNA of the present disclosure is in codon 5 of SNCA. In some embodiments, one or more engineered guide RNAs may target the TIS at codon 1 and codon 5. In some embodiments, engineered guide RNAs of the present disclosure target any critical adenosine of the native SNCA TIS. For example, in some embodiments, an engineered guide RNA targets AUG at position 265 in SNCA exon 2 to promote ADAR-mediated editing to GUG, thereby disrupting translation and reducing alpha-synuclein expression. In some embodiments, an engineered guide RNA targets a critical adenosine in the 3'UTR of SNCA to promote ADAR-mediated A to G editing, thereby disrupting translation and reducing alpha-synuclein expression. An engineered guide RNA that targets the 3'UTR of SNCA for A to G editing can result in inhibition of mRNA export from the nucleus, thereby preventing availability for protein translation and reducing alpha-synuclein expression. In some embodiments, an engineered guide RNA targets the 3'UTR to promote ADAR-mediated RNA editing of the 3'UTR, resulting in mRNA knockdown and reduced alpha-synuclein expression. Assays to confirm successful RNA editing may include NGS, Sanger sequencing, qPCR, ddPCR, fluorescent Western blot, and alpha-synuclein-specific sandwich ELISA.In some embodiments, any of the engineered guide RNAs disclosed herein are packaged into an AAV vector and delivered virally.

[0272] As disclosed herein, ADAR-mediated editing of the target sequence of SNCA RNA by engineered guide RNA can be used to reduce the expression of alpha-synuclein protein. Reduction of alpha-synuclein can be used to treat diseases or conditions associated with alpha-synuclein. In some embodiments, the disease or condition is a synucleinopathy. Editing of target SNCA RNA as described herein, accompanied by reduction of alpha-synuclein levels, can be used to reduce or prevent the aggregation of alpha-synuclein protein. Thus, one or more symptoms associated with the aggregation of alpha-synuclein (e.g., synucleinopathy) can be treated by administering the engineered guide RNA described herein.

[0273] As disclosed herein, administration of an engineered guide RNA described herein targeting SNCA RNA to a subject can be used to treat a disease or condition associated with alpha-synuclein, e.g., to treat one or more symptoms associated with the disease or condition. In some embodiments, the disease or condition can be Parkinson's disease. In some embodiments, one or more symptoms of Parkinson's disease can be treated by administering an engineered guide RNA targeting SNCA RNA as described herein. For example, administration of the engineered guide RNA can be sufficient to reduce resting tremor, muscle rigidity, difficulty standing, difficulty walking, difficulty moving, involuntary movements, muscle stiffness, loss of coordination, rhythmic muscle contractions, slow movements, bradykinesia, slow shuffling gait, or any combination thereof. In some embodiments, treatment of Parkinson's disease includes improving cognitive function. For example, a subject administered an engineered guide RNA targeting SNCA of the present disclosure can show improvement in cognitive or motor skill tests compared to their performance prior to administration. In some embodiments, the subject may show improvement in a Unified Parkinson's Disease Rating Scale (UPDRS) test, such as the MDS-UPDRS test. In some embodiments, the subject may be evaluated by imaging techniques, such as MRI or CAT scan, to monitor the progression of the disease or condition. For example, MRI imaging may be used to visualize the subject's neurons over the treatment period and monitor the progress of treatment. In some embodiments, destruction of neurons in the substantia nigra may be monitored throughout the treatment period.

[0274] As disclosed herein, administration of the engineered guide RNAs of the present disclosure can be used to reduce alpha-synuclein protein levels by knockdown to treat diseases or conditions associated with alpha-synuclein. Although reduction is achieved by administration, residual alpha-synuclein may still be present after administration. In some instances, the presence of reduced alpha-synuclein protein levels treats a disease or condition without reducing the level of alpha-synuclein protein levels to zero. Such levels can be determined by in vitro assays using samples obtained from a subject. In some instances, levels can be determined in vivo using imaging techniques such as MRI, as described above. Treatment can result in the improvement of certain biomarkers in a subject. For example, treatment can result in a reduction of SNCA in the CSF, a reduction in SNCA in the blood, a reduction in neurofilament A levels in the CSF, or any combination thereof.

[0275] In some embodiments, the engineered guide RNA targets a non-coding sequence of SNCA. The non-coding sequence may be a polyA signal sequence, and the engineered guide RNA may promote ADAR-mediated RNA editing of one or more adenosines of the polyA signal sequence of SNCA. In some embodiments, the engineered guide RNA of the present disclosure may be multiplexed to target two or more polyA signal sequences of SNCA. In some embodiments, the engineered guide RNA of the present disclosure may be multiplexed to target a TIS and one or more polyA signal sequences of SNCA. In some embodiments, an engineered guide RNA of the present disclosure targeting the canonical TIS of codon 1 of exon 2 of SNCA (nucleotide position 226 of NCBI Reference Sequence: NM_000345.4) may be multiplexed with one or more additional engineered guide RNAs targeting a different TIS of SNCA, for example, the translation start site at codon 5 of exon 2. Alternatively or additionally, one or more engineered guide RNAs of the present disclosure targeting the canonical TIS of codon 1 of exon 2 of SNCA (nucleotide position 226 of NCBI Reference Sequence: NM_000345.4) can be multiplexed with one or more engineered guide RNAs targeting a different sequence of SNCA, such as the 5'UTR region of SNCA (e.g., the Kozak sequence of the 5'UTR, an internal ribosome entry site (IRES), or an iron response element (IRE)). In some embodiments, engineered guide RNAs can be multiplexed to target non-coding and coding sequences of SNCA. Engineered guide RNAs of the present disclosure promoted ADAR-mediated RNA editing of SNCA, thereby achieving protein knockdown. In each of these cases, the multiplexed engineered guide RNAs can be delivered together in the same viral vector, or each of the different engineered guide RNAs can be delivered together but in separate vectors.

[0276] In some embodiments, the present disclosure provides engineered guide RNAs that promote editing at multiple adenosines. The hydrolytic deamination of multiple adenosines in RNA can be referred to as hyper-editing. In some instances, hyper-editing can occur in cis (e.g., at an Alu element) or trans (e.g., in a target RNA by an engineered guide RNA). In some instances, hyper-editing can include editing at the polyA signal sequence of a target SNCA RNA. In some instances, hyper-editing can introduce editing into at least two or more nucleotides of a target RNA of interest. In some examples, hyper-editing may introduce at least or up to 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 edits, or at least or up to about 100 edits into a region of the target RNA. In one embodiment, hyper-editing may occur in an untranslated region, a translated region, a 3'UTR, a 5'UTR, or any combination thereof.

[0277] In some embodiments, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of 1-100% of target adenosines. The engineered guide RNAs of the present disclosure may promote editing of 40-90% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 5% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 10% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of 15% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 20% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 25% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 30% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 35% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 40% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 45% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 50% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 55% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 60% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 65% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 70% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 75% of the targeted adenosines.In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of at least 80% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of at least 85% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of at least 90% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of at least 95% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 100% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 5-20% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 20-40% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 40-60% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 60-80% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 80-100% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 60-80% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate editing of 70-90% of target adenosines.

[0278] In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% or more of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 80% or more of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of up to 90% or more of target adenosines. Optionally, engineered guide RNAs of the present disclosure may further promote these levels of on-target RNA editing while maintaining editing of less than 10% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 30% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 25% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 20% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 15% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 10% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 9% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 8% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 7% of off-target adenosines.In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 6% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 5% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 4% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 3% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 2% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 1% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can promote these levels of on-target RNA editing while maintaining 0% editing of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of less than 30% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of less than 29% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of less than 28% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of less than 27% of off-target adenosines.In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 26% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 25% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 24% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 23% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 22% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 21% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 20% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 19% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 18% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 17% of off-target adenosines.In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 16% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 15% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 14% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 13% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 12% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 11% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 10% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 9% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 8% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 7% of off-target adenosines.In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 6% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 5% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 4% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 3% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 2% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of less than 1% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines while maintaining editing of 0% of off-target adenosines.

[0279] In some embodiments, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of SNCA, resulting in protein level knockdown. Protein level knockdown is quantified as a reduction in alpha-synuclein protein expression. The engineered guide RNAs of the present disclosure can promote 1% to 100% alpha-synuclein knockdown. The engineered guide RNAs of the present disclosure may promote alpha-synuclein knockdown of 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%. In some embodiments, the engineered guide RNAs of the present disclosure promote 30% to 60% alpha-synuclein knockdown, which can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0280] The engineered guide RNAs of the present disclosure may be used in methods for treating a disorder in a subject in need thereof. The disorder may be any condition associated with a disease, condition, genotype, phenotype, or adverse effect. In some embodiments, treating a disorder may include preventing the disorder, slowing its progression, reversing it, or alleviating its symptoms. The method for treating a disorder may include delivering an engineered polynucleotide encoding the engineered guide RNA to cells of a subject in need thereof and expressing the engineered guide RNA in the cells. In some embodiments, the engineered guide RNAs of the present disclosure may be used to treat a genetic disorder (e.g., a synucleinopathic disease such as Parkinson's disease). In some embodiments, the engineered guide RNAs of the present disclosure may be used to treat a condition associated with one or more mutations.

[0281] Pharmaceutical Composition The compositions described herein (e.g., compositions comprising engineered guide RNAs or engineered polynucleotides) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or non-human animal). Pharmaceutically acceptable carriers can include, but are not limited to, phosphate-buffered saline, water, emulsions (e.g., oil / water emulsions or water / oil emulsions), glycerol, liquid polyethylene glycol, aprotic solvents (e.g., dimethyl sulfoxide, N-methylpyrrolidone, or mixtures thereof), and various types of wetting agents, solubilizers, antioxidants, bulking agents, protein carriers such as albumin, any solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions can also include stabilizers and preservatives. Additional examples of carriers, stabilizers, and adjuvants compatible with the compositions of the present disclosure can be found, for example, in Remington's Pharmaceutical Sciences, 21st Ed., Mack Publ. Co., Easton, Pa. (2005), which is incorporated herein by reference in its entirety.

[0282] In some examples, pharmaceutical compositions may be formulated in unit-dosage or multi-dosage forms. In some examples, unit-dosage forms may be physically discrete units suitable for administration to humans or non-human subjects (e.g., animals). In some examples, unit-dosage forms may be individually packaged. In some examples, each unit dose contains a predetermined amount of active ingredient(s), which may be sufficient to produce a desired therapeutic effect in association with a pharmaceutical carrier, diluent, excipient, or any combination thereof. In some examples, unit-dosage forms include ampoules, syringes, or individually packaged tablets and capsules, or any combination thereof. In some examples, unit-dosage forms may be contained in a disposable syringe. In some examples, unit-dosage forms are administered individually or in multiples thereof. In some examples, multiple-dosage forms may include multiple identical unit-dosage forms packaged in a single container, which may be administered separately as unit-dosage forms. Examples of multiple-dosage forms include, but are not limited to, vials, bottles of tablets or capsules, or pint or gallon bottles. In some instances, the multiple dosage forms contain the same pharmaceutically active agent. In some instances, the multiple dosage forms contain different pharmaceutically active agents.

[0283] In some examples, the pharmaceutical composition comprises a pharmaceutically acceptable excipient, hi some examples, the excipient comprises a buffering agent, a cryopreservative, a preservative, a stabilizer, a binder, a compression agent, a lubricant, a chelating agent, a dispersion enhancer, a disintegrant, a flavoring agent, a sweetening agent, or a coloring agent, or any combination thereof.

[0284] In some examples, the excipient comprises a buffering agent. In some examples, the buffering agent comprises sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof. In some examples, the buffering agent comprises sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium gluconate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium monohydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, or calcium hydroxide and other calcium salts, or any combination thereof.

[0285] In some examples, the excipient comprises a cryopreservative. In some examples, the cryopreservative comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the cryopreservative comprises sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof. In some examples, the excipient comprises a pH agent (to minimize oxidation or degradation of the components of the composition), a stabilizer (to prevent denaturation or degradation of the components of the composition), a buffer (to increase temperature stability), a solubilizer (to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a nonionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient comprises sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HCl, disodium edetate, lecithin, glycerin, xanthan gum, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient can be an excipient described in Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986).

[0286] In some examples, the excipient includes a preservative. In some examples, the preservative includes an antioxidant such as α-tocopherol and ascorbate, an antibacterial agent such as paraben, chlorobutanol, and phenol, or any combination thereof. In some examples, the antioxidant includes EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), sodium sulfite, p-aminobenzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol, or N-acetylcysteine, or any combination thereof. In some examples, the preservative comprises validamycin A, TL-3, sodium orthovanadate, sodium fluoride, Na-tosyl-Phe-chloromethylketone, Na-tosyl-Lys-chloromethylketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitors, phosphatase inhibitors, caspase inhibitors, granzyme inhibitors, cell adhesion inhibitors, cell division inhibitors, cell cycle inhibitors, lipid signaling inhibitors, protease inhibitors, reducing agents, alkylating agents, antimicrobial agents, oxidase inhibitors, or other inhibitors, or any combination thereof.

[0287] In some examples, the excipient comprises a binder, ie, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyloxoazolidone, polyvinyl alcohol, C12-C18 fatty acid alcohol, polyethylene glycol, polyol, sugar, oligosaccharide, or any combination thereof.

[0288] In some examples, the binder may be a starch, such as potato starch, corn starch, or wheat starch; a sugar, such as sucrose, glucose, dextrose, lactose, or maltodextrin; a natural and / or synthetic gum; gelatin; a cellulose derivative, such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropylmethyl cellulose, carboxymethyl cellulose, methyl cellulose, or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; calcium phosphate; an alcohol, such as sorbitol, xylitol, mannitol, or water, or any combination thereof.

[0289] In some examples, the excipient comprises a lubricant. In some examples, the lubricant comprises magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oil, Sterotex, polyoxyethylene monostearate, talc, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof. In some examples, the lubricant comprises a metal stearate (e.g., magnesium stearate, calcium stearate, aluminum stearate), a fatty acid ester (e.g., sodium stearyl fumarate), a fatty acid (e.g., stearic acid), a fatty alcohol, glyceryl behenate, mineral oil, paraffin, hydrogenated vegetable oil, leucine, polyethylene glycol (PEG), a metal lauryl sulfate (e.g., sodium lauryl sulfate, magnesium lauryl sulfate), sodium chloride, sodium benzoate, sodium acetate, or talc, or a combination thereof.

[0290] In some instances, the excipient comprises a dispersion enhancer, which in some instances comprises starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicates, or microcrystalline cellulose, or any combination thereof as a high HLB emulsifier surfactant.

[0291] In some examples, the excipient comprises a disintegrant. In some examples, the disintegrant comprises a non-effervescent disintegrant. In some examples, the non-effervescent disintegrant comprises starch, such as corn starch, potato starch, pregelatinized starch and modified starches thereof, sweeteners, clays, such as bentonite, microcrystalline cellulose, alginate, sodium starch glycolate, or gums, such as agar, guar gum, carob gum, karaya gum, pectin, and tragacanth, or any combination thereof. In some examples, the disintegrant comprises an effervescent disintegrant. In some examples, suitable effervescent disintegrants include bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.

[0292] In some examples, the excipient comprises a sweetener, a flavoring agent, or both. In some examples, sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts, such as sodium salt; dipeptide sweeteners, such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (stevioside); chloro derivatives of sucrose, such as sucralose; and sugar alcohols, such as sorbitol, mannitol, xylitol, etc., or any combination thereof. In some examples, the flavoring agent incorporated into the composition comprises synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; or any combination thereof. In some embodiments, flavoring agents include cinnamon oil; oil of wintergreen; peppermint oil; clover oil; hay oil; anise oil; eucalyptus oil; vanilla; citrus oils, such as lemon oil, orange oil, grape oil, and grapefruit oil; and fruit essences, including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot, or any combination thereof.

[0293] In some examples, the excipient comprises a pH agent (e.g., to minimize oxidation or degradation of components of the composition), a stabilizer (e.g., to prevent denaturation or degradation of components of the composition), a buffer (e.g., to increase temperature stability), a solubilizer (e.g., to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient includes sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HCl, disodium edetate, lecithin, glycerin, xanthan gum, soy isoflavone, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient includes a cryopreservation agent. In some examples, the excipient includes DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the excipient comprises sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof.

[0294] In some examples, the pharmaceutical composition includes a diluent. In some examples, the diluent includes water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof. In some examples, the diluent includes an aqueous acid, such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof. In some examples, the diluent includes an alkali metal carbonate, such as calcium carbonate; an alkali metal phosphate, such as calcium phosphate; an alkali metal sulfate, such as calcium sulfate; a cellulose derivative, such as cellulose, microcrystalline cellulose, or cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitostearate, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol, and / or an anhydride, hydrate, and / or a pharmaceutically acceptable derivative thereof, or a combination thereof.

[0295] In some instances, the pharmaceutical composition includes a carrier. In some instances, the carrier includes a liquid or solid filler, solvent, or encapsulating material. In some instances, the carrier includes additives such as proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-, and oligosaccharides; derivatized sugars, e.g., alditols, aldol acids, esterified sugars, and the like; and polysaccharides or sugar polymers), alone or in combination.

[0296] delivery An engineered guide RNA of the present disclosure (e.g., an engineered guide RNA targeting SNCA codon 1 TIS and having a polynucleotide sequence of any of SEQ ID NOS: 12-384 listed in Table 2) or an engineered polynucleotide of the present disclosure (e.g., an engineered polynucleotide encoding an engineered guide RNA) can be delivered by a delivery vehicle. In some embodiments, the delivery vehicle is a vector. The vector can facilitate delivery of the engineered guide RNA to a cell to genetically modify the cell. In some examples, the vector comprises DNA, e.g., double-stranded or single-stranded DNA. In some examples, the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or a plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, the viral vector comprises a viral capsid, an inverted terminal repeat, and an engineered polynucleotide can be used to deliver the engineered guide RNA to a cell.

[0297] In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentiviral vector (e.g., human or porcine), a herpesvirus vector, an Epstein-Barr virus vector, an SV40 viral vector, a poxvirus vector, or a combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0298] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a specific serotype. In some embodiments, the viral vector is selected from the group consisting of AAV1 serotype, AAV2 serotype, AAV3 serotype, AAV4 serotype, AAV5 serotype, AAV6 serotype, AAV7 serotype, AAV8 serotype, AAV9 serotype, AAV10 serotype, AAV11 serotype, AAV12 serotype, AAV13 serotype, AAV14 serotype, AAV15 serotype, AAV16 serotype, AAV.rh8 serotype, AAV.rh10 serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh74 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 serotype, AAV.7m8 serotype, AAV.PHP.B serotype , AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AAV.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype, AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, and AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.

[0299] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.

[0300] In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods for producing recombinant AAV vectors may be known in the art and, in some instances, typically involve introducing into a producer cell line a plasmid construct containing (1) DNA necessary for AAV replication and AAV capsid synthesis, (b) one or more helper constructs containing viral functions missing from the AAV vector, (c) a helper virus, and (d) the genome of the AAV vector, such as ITRs, a promoter, and an engineered guide RNA sequence. In some instances, the viral vectors described herein may be engineered by synthetic or other suitable means with reference to published sequences, such as those available in the literature. For example, the genome and protein sequences of various AAV serotypes, as well as sequences of natural terminal repeats (TRs), Rep proteins, and capsid subunits, may be known in the art and may be found in the literature or public databases, such as GenBank or the Protein Data Bank (PDB).

[0301] In some examples, a method for producing a delivery vector described herein includes packaging an engineered polynucleotide (e.g., an engineered polynucleotide encoding an engineered guide RNA) of the present disclosure into an AAV vector. In some examples, a method for producing a delivery vector described herein includes (a) introducing into a cell (i) a polynucleotide comprising a promoter and an engineered guide RNA disclosed herein, and (ii) a viral genome comprising a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified form thereof; (b) expressing the wild-type AAV capsid protein or a modified form thereof in the cell; (c) assembling AAV particles; and (d) packaging the engineered guide RNA disclosed herein into the AAV particles, thereby producing an AAV delivery vector. In some examples, the recombinant vector includes one or more inverted terminal repeat sequences, including 5' inverted terminal repeat sequences, 3' inverted terminal repeat sequences, and mutant inverted terminal repeat sequences. In some instances, the variant terminal repeat sequences lack terminal dissociation sites, thereby allowing the formation of self-complementary AAV.

[0302] In some examples, hybrid AAV vectors can be produced by capsid conversion, e.g., packaging inverted terminal repeats (ITRs) from a first serotype into a capsid of a second serotype, where the first and second serotypes may not be the same. In some examples, the Rep gene and ITRs from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), where the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising AAV2 ITRs and AAV9 capsid proteins can be designated AAV2 / 9. In some examples, hybrid AAV delivery vectors include AAV2 / 1, AAV2 / 2, AAV2 / 4, AAV2 / 5, AAV2 / 6, AAV2 / 8, or AAV2 / 9 vectors.

[0303] In some examples, the AAV vector can be a chimeric AAV vector. In some examples, the chimeric AAV vector contains foreign amino acids or amino acid substitutions, or capsid proteins from two or more serotypes. In some examples, the chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0304] In some instances, the AAV vector comprises a self-complementary AAV genome, which may be generally known in the art and may contain both DNA strands that can anneal to each other to form double-stranded DNA.

[0305] In some examples, the delivery vector can be a retroviral vector. In some examples, the retroviral vector can be a Moloney murine leukemia virus vector, a spleen necrosis virus vector, or a vector derived from Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof. In some examples, the retroviral vector can be transfected so that most of the sequences encoding the viral structural genes (e.g., gag, pol, and env) can be removed and replaced with a gene(s) of interest.

[0306] In some examples, the delivery vehicle may be a non-viral vector. In some examples, the delivery vehicle may be a plasmid. In some embodiments, the plasmid comprises DNA. In some examples, the plasmid comprises circular double-stranded DNA. In some examples, the plasmid may be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone including an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid may be a minicircle plasmid. In some examples, the plasmid contains one or more genes that provide a selectable marker for transducing target cells and maintaining the plasmid. In some examples, the plasmid may be formulated for delivery by injection with a syringe equipped with a needle. In some examples, the plasmid may be formulated for delivery by electroporation. In some examples, the plasmid may be genetically engineered by synthesis or other suitable means known in the art. For example, in some instances, genetic elements can be assembled by restriction digestion of a desired gene sequence from a donor plasmid or organism to generate DNA ends that can then be easily ligated to another gene sequence.

[0307] In some embodiments, the vector containing the engineered guide RNA or engineered polynucleotide is a non-viral vector system. In some embodiments, the non-viral vector system comprises a cationic lipid or polymer. For example, the non-viral vector system may be a liposome or a polymer nanoparticle. In some embodiments, the engineered polynucleotide or the non-viral vector containing the engineered polynucleotide is delivered to cells by hydrodynamic injection or ultrasound.

[0308] Administration Administration may refer to methods that can be used to enable delivery of the compositions described herein (e.g., containing an engineered guide RNA or an engineered polynucleotide encoding the same) to a desired biological site of action. For example, an engineered guide RNA (e.g., an engineered guide RNA targeting SNCA codon 1 TIS and having a polynucleotide sequence of any of SEQ ID NOS: 12-384 listed in Table 2) can be contained in a DNA construct, a viral vector, or both, and administered intravenously. Administration as disclosed herein to an area in need of treatment or therapy can be achieved by, for example and not by limitation, oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments, delivery includes inhalation, ear drops, oral, conjunctival, dental, intracervical, intrasinus, intratracheal, intestinal, epidural, extra-amniotic, extracorporeal, hemodialysis, osmotic, intrainterstitial, intraabdominal, intra-amniotic, intra-arterial, intra-articular, intrabiliary, intra-bronchial, intra-vesical, intracardiac, intracartilaginous, intrasacral, intracavernous, intracavity, intraventricular, intracisternal, intracorneal, intracoronary, intracoronary, intracavernous, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intrathecal, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intranasal asinal, intrathecal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumoral, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, intraocular, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, ​​vaginal, suborbital, intraparenchymal, intrathecal, intraventricular, stereotactic delivery, or any combination thereof. Delivery may include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, or a combination thereof. Delivery may include direct application to the affected tissue or area of ​​the body.In some examples, local administration may include administering lotions, solutions, emulsions, creams, balms, oils, pastes, sticks, aerosols, foams, jelly, foams, masks, pads, powders, solids, tinctures, butters, patches, gels, sprays, drops, liquid formulations, or ointments to the external surface of a surface such as the skin. Delivery may include injection into the parenchyma, intraspinal injection, intraventricular injection, or intracisternal injection. The compositions provided herein may be administered by any method. Administration may be by intraarterial injection, intracisternal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intrathecal injection, intraspinal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural injection, or any combination thereof. Delivery may include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion administration). In some embodiments, delivery may include nanoparticles, liposomes, exosomes, extracellular vesicles, implants, or combinations thereof. In some examples, delivery may be from a device. In some examples, delivery may be performed by a pump, an infusion pump, or a combination thereof. In some embodiments, delivery may be by enema, eye drops, nasal spray, or any combination thereof. In some examples, a subject may administer the composition without supervision. In some examples, a subject may administer the composition under the supervision of a medical professional (e.g., a doctor, nurse, medical assistant, janitor, hospice worker, etc.). In some embodiments, a medical professional may administer the composition.

[0309] In some examples, the pharmaceutical compositions disclosed herein may be administered at a dose of from about 0.0001 mg / kg to about 100 mg / kg of subject's body weight, from about 0.001 mg / kg to about 0.05 mg / kg of subject's body weight, from about 0.005 mg / kg to about 0.05 mg / kg of subject's body weight, from about 0.001 mg / kg to about 0.005 mg / kg of subject's body weight, from about 0.05 mg / kg to about 0.5 mg / kg of subject's body weight, or from about 0.001 mg / kg to about 0.005 mg / kg of subject's body weight, or from about 0.05 mg / kg to about 0.5 mg / kg of subject's body weight per day to achieve the desired therapeutic, diagnostic, or prophylactic effect. The compound may be administered one or more times daily at a dosage level sufficient to deliver about 0.01 mg / kg to about 50 mg / kg of subject's body weight, about 0.1 mg / kg to about 40 mg / kg of subject's body weight, about 0.5 mg / kg to about 30 mg / kg of subject's body weight, about 0.01 mg / kg to about 10 mg / kg of subject's body weight, about 0.1 mg / kg to about 10 mg / kg of subject's body weight, or about 1 mg / kg to about 25 mg / kg of subject's body weight.

[0310] Suitable dosages and treatment regimens for the treatment methods described herein vary depending on the particular disease being treated, the gRNA and / or ADAR (or vector encoding the gRNA and / or ADAR) being delivered, and the particular condition of the subject. In some examples, administration can be for a period of time until a desired effect (e.g., reduction of symptoms) can be achieved. In some examples, administration can be 1, 2, 3, 4, 5, 6, or 7 times per week. In some examples, administration or application of the compositions disclosed herein can be carried out for a treatment period of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or longer. In some examples, administration can be for a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In some instances, administration can be for 2, 3, 4, 5, 6 months or longer. In some instances, administration can be repeated throughout the subject's life, for example, once a month or once a year throughout the subject's life. In some instances, administration can be repeated throughout a significant portion of the subject's life, for example, once a month or once a year for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years or more. In some instances, treatment can be resumed after a period of remission.

[0311] In some examples, administration may be oral ingestion. In some examples, delivery may be capsule or tablet. Oral ingestion delivery may include tea, elixir, food, beverage, drink, syrup, liquid, gel, capsule, tablet, oil, tincture, or any combination thereof. In some embodiments, the food may be a medical food. In some examples, the capsule may include hydroxymethylcellulose. In some embodiments, the capsule may include gelatin, hydroxypropylmethylcellulose, pullulan, or any combination thereof. In some examples, the capsule may include a coating, for example, an enteric coating. In some embodiments, the capsule may include a vegetarian or vegan product, such as a hypromellose capsule. In some embodiments, delivery may include inhalation via an inhaler, diffuser, nebulizer, vaporizer, or combination thereof.

[0312] In some embodiments, methods are disclosed herein that include administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some examples, the methods can treat (including prevent) a disease in the subject.

[0313] definition Unless otherwise defined, all technical terms, notations, and other scientific or technical terms used herein are generally intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some instances, for clarity and / or ready reference, terms having a commonly understood meaning are defined herein, but the inclusion of such definitions herein should not necessarily be construed as indicating a substantial departure from what is commonly understood in the art.

[0314] Throughout this application, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all possible subranges and individual numerical values ​​within that range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0315] As used herein, the term "about" a value may refer to that value plus or minus 10% of that value.

[0316] As disclosed herein, a "bulge" refers to a structure that is substantially formed only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposing strand. A bulge may have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, respectively, or a bulge may have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold, respectively. However, as used herein, a bulge does not refer to a structure in which a single nucleotide involved in the engineered guide RNA and a single nucleotide involved in the target RNA are not base-paired; a single nucleotide involved in the engineered guide RNA and a single nucleotide involved in the target RNA that are not base-paired is referred to herein as a "mismatch." Furthermore, if the number of nucleotides involved on either the guide RNA side or the target RNA side exceeds four, the resulting structure is no longer considered a bulge, but rather an "internal loop." A "symmetric bulge" refers to a bulge where there are the same number of nucleotides on each side of the bulge. An "asymmetric bulge" refers to a bulge where there are different numbers of nucleotides on each side of the bulge.

[0317] The terms "complementary" or "complementarity" refer to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence, for example, by hydrogen bonding (e.g., conventional Watson-Crick), covalent bonding, or other similar methods. In Watson-Crick base pairing, a double hydrogen bond forms between nucleobases T and A, while a triple hydrogen bond forms between nucleobases C and G. For example, the sequence AGT may be complementary to the sequence TCA. Percent complementarity indicates t...

Claims

【Claim 1】 The invention described in the specification.

Images