Compositions containing polynucleotide amphiphiles and methods of use thereof

Abstract

Disclosed herein are polyadenosine, polythymidine, polyguanosine, and / or polycytosine nucleic acid sequences, as well as interferon stimulating DNA and immunostimulating herpes simplex virus sequences, and pharma- ceutically acceptable salts thereof, that may be conjugated to an albumin binding domain.Further disclosed herein are methods of inducing an immune response in a subject, as well as methods of administering polyadenosine, polythymidine, polyguanosine, and / or polycytosine nucleic acid sequences and antigens conjugated to an albumin binding domain to induce an immune response in a subject.

Description

[Background technology]

[0001] Vaccines are used to stimulate an immune response in an individual to provide protection against and / or treatment of a particular disease. Some vaccines contain an antigen to induce an immune response. The immune response as a result of vaccination has contributed greatly to both human and animal health. Since the invention of the first vaccine in 1796, vaccines have come to be regarded as the most successful method of preventing many infectious diseases by inducing an immune response in subjects. According to the World Health Organization, immunization currently prevents 2-3 million deaths annually across all age groups. The goal of vaccination is to generate a strong and sustained immune response that provides long-term protection against infection. However, many vaccines currently do not induce optimal immunity.

[0002] There remains a need to develop new and improved compositions and methods for inducing an immune response in a subject. Summary of the Invention [Means for solving the problem]

[0003] The present disclosure provides compounds comprising poly-deoxyadenosine (poly-dA) and / or poly-deoxythymidine (poly-dT) nucleic acid sequences conjugated with an albumin binding domain, and poly-deoxyguanosine (poly-dG) and / or poly-deoxycytosine (poly-dC) nucleic acid sequences conjugated with an albumin binding domain, and pharma- ceutically acceptable salts thereof, pharmaceutical compositions, and kits. The present disclosure further provides methods of inducing an immune response in a subject by administering the compounds and salts thereof described herein together with an antigen.

[0004] In one aspect, the disclosure provides a compound comprising a poly-deoxyadenosine (poly-dA) nucleic acid sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof.

[0005] In another aspect, the disclosure provides a compound comprising a poly-dT nucleic acid sequence and an albumin binding moiety, or a pharma- ceutically acceptable salt thereof.

[0006] In some embodiments, the compound or a pharma- ceutically acceptable salt thereof comprises a poly-dA nucleic acid sequence and a poly-dT nucleic acid sequence, hi some embodiments, the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence hybridize to form a double-stranded DNA sequence.

[0007] In some embodiments, the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises between 30 and 150 nucleotides (e.g., between 30 and 140, between 20 and 130, between 30 and 120, between 30 and 110, between 30 and 100, between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 150, between 50 and 150, between 60 and 150, between 70 and 150, between 80 and 150, between 90 and 150, between 100 and 150, between 110 and 150, between 120 and 150, between 130 and 150, and between 140 and 150 nucleotides). In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences comprise between 30 and 100 nucleotides (e.g., between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 100, between 50 and 100, between 60 and 100, between 70 and 100, between 80 and 100, and between 90 and 100 nucleotides). In certain embodiments, the poly-dA and / or poly-dT nucleic acid sequences comprise between 50 and 100 nucleotides (e.g., between 50 and 90, between 50 and 80, between 50 and 70, between 50 and 80, between 50 and 70, between 50 and 60, between 60 and 100, between 70 and 100, between 80 and 100, and between 90 and 100 nucleotides). In certain embodiments, the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30-50 nucleotides (e.g., 30-48, 30-46, 30-44, 30-42, 30-40, 30-38, 30-36, 30-34, 30-32, 32-50, 34-50, 36-50, 38-50, 40-50, 42-50, 44-50, 46-50, and 48-50 nucleotides). In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences comprise 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences comprise 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides.

[0008] In some embodiments, the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence contain the same number of nucleotides.

[0009] In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences comprise a mixture of dA and dT nucleic acid residues. In some embodiments, the poly-dA nucleic acid sequence comprises 100%-51% (e.g., 100%-60%, 100%-70%, 100%-80%, 100%-90%, 100%-95%, 95%-51%, 90%-51%, 80%-51%, 70%-51%, and 60%-51%) of dA nucleic acid residues and 0%-49% (e.g., 0%-45%, 0%-40%, 0%-30%, 0%-20%, 0%-10%, and 0%-5%, 5%-49%, 10%-49%, 20%-49%, 30%-49%, and 40%-49%) of dT nucleic acid residues. In some embodiments, the poly-dT nucleic acid sequence comprises between 100% and 51% (e.g., between 100% and 60%, between 100% and 70%, between 100% and 80%, between 100% and 90%, between 100% and 95%, between 95% and 51%, between 90% and 51%, between 80% and 51%, between 70% and 51%, and between 60% and 51%) dT nucleic acid residues and between 0% and 49% (e.g., between 0% and 45%, between 0% and 40%, between 0% and 30%, between 0% and 20%, between 0% and 10%, and between 0% and 5%, between 5% and 49%, between 10% and 49%, between 20% and 49%, between 30% and 49%, and between 40% and 49%) dA nucleic acid residues.

[0010] In some embodiments, all internucleotide groups connecting the nucleotides in the poly-dA and poly-dT nucleic acid sequences are phosphodiester or phosphorothioate. In some embodiments, between 50% and 100% (e.g., between 50% and 90%, between 50% and 80%, between 50% and 70%, between 50% and 60%, between 60% and 100%, between 70% and 100%, between 80% and 100%, and between 90% and 100%) of the internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphorothioate bonds. In some embodiments, between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphodiester linkages and the remaining internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphorothioate linkages. In some embodiments, all of the internucleotide groups connecting the nucleotides in the poly-dA and poly-dT nucleic acid sequences are phosphorothioate.

[0011] In some embodiments, the albumin binding domain is attached to the 5' end of a poly-dA nucleic acid sequence. In some embodiments, the albumin binding domain is attached to the 5' end of a poly-dT nucleic acid sequence.

[0012] In another aspect, the present disclosure provides a compound comprising an interferon-stimulated DNA (ISD) sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof. In some embodiments, the albumin binding domain is linked to the 5' end of the ISD sequence.

[0013] In a further aspect, the present disclosure provides a compound comprising an immunostimulatory herpes simplex virus (HSV) sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof. In some embodiments, the albumin binding domain is attached to the 5' end of the immunostimulatory HSV sequence. In some embodiments, the albumin binding domain is attached to the 5' end of the sense strand of the immunostimulatory HSV-60 sequence.

[0014] In some embodiments, the albumin binding domain is a lipid. In some embodiments, the lipid is a diacyl lipid. In certain embodiments, the diacyl lipid comprises an acyl chain comprising 12-30 hydrocarbon units (e.g., 12-25, 12-20, 12-15, 15-30, 20-30, and 25-30 hydrocarbon units), 14-25 hydrocarbon units (e.g., 14-22, 14-20, 14-18, 14-16, 16-25, 18-25, 20-25, and 22-25 hydrocarbon units), 16-20 hydrocarbon units (e.g., 16-19, 16-18, 16-17, 17-20, 18-20, and 19-20 hydrocarbon units), or 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hydrocarbon units. In some embodiments, the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE). In some embodiments, the poly-dA nucleic acid sequence, the poly-dT nucleic acid sequence, or the ISD sequence is selected from the group consisting of the following lipids: [ka] or a salt thereof, or is linked by a linker, wherein X is O or S.

[0015] In some embodiments, the linker is selected from the group consisting of a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof. In some embodiments, the linker comprises "N" polyethylene glycol units, where N is 24-50 (e.g., 24-45, 24-40, 24-35, 24-30, 24-26, 26-50, 30-50, 35-50, 40-50, and 45-50 glycol units). In some embodiments, the linker comprises PEG24-amide-PEG24.

[0016] In another aspect, the disclosure provides poly-dA and poly-dT double-stranded DNA sequences comprising 30-100 pairs of paired nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 pairs), or pharma- ceutically acceptable salts thereof. In some embodiments, poly-dA and poly-dT comprise the same number of nucleotides.

[0017] In another aspect, the disclosure provides poly-dA or poly-dT single stranded DNA sequences comprising 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100), or a pharma- ceutically acceptable salt thereof.

[0018] In one aspect, the disclosure provides a compound comprising a poly-dG nucleic acid sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof.

[0019] In another aspect, the disclosure provides a compound comprising a poly-dC nucleic acid sequence and an albumin binding moiety, or a pharma- ceutically acceptable salt thereof.

[0020] In some embodiments, the compound or a pharma- ceutically acceptable salt thereof comprises a poly-dG nucleic acid sequence and a poly-dC nucleic acid sequence. In some embodiments, the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence hybridize to form a double-stranded DNA sequence.

[0021] In some embodiments, the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises between 30 and 150 nucleotides (e.g., between 30 and 140, between 20 and 130, between 30 and 120, between 30 and 110, between 30 and 100, between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 150, between 50 and 150, between 60 and 150, between 70 and 150, between 80 and 150, between 90 and 150, between 100 and 150, between 110 and 150, between 120 and 150, between 130 and 150, and between 140 and 150 nucleotides). In some embodiments, the poly-dG and / or poly-dC nucleic acid sequences comprise between 30 and 100 nucleotides (e.g., between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 100, between 50 and 100, between 60 and 100, between 70 and 100, between 80 and 100, and between 90 and 100 nucleotides). In certain embodiments, the poly-dG and / or poly-dC nucleic acid sequences comprise between 50 and 100 nucleotides (e.g., between 50 and 90, between 50 and 80, between 50 and 70, between 50 and 80, between 50 and 70, between 50 and 60, between 60 and 100, between 70 and 100, between 80 and 100, and between 90 and 100 nucleotides). In certain embodiments, the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30-50 nucleotides (e.g., 30-48, 30-46, 30-44, 30-42, 30-40, 30-38, 30-36, 30-34, 30-32, 32-50, 34-50, 36-50, 38-50, 40-50, 42-50, 44-50, 46-50, and 48-50 nucleotides). In some embodiments, the poly-dG and / or poly-dC nucleic acid sequences comprise 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the poly-dG and / or poly-dC nucleic acid sequences comprise 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides.

[0022] In some embodiments, the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence contain the same number of nucleotides.

[0023] In some embodiments, the poly-dG and / or poly-dC nucleic acid sequences comprise a mixture of dG and dC nucleic acid residues. In some embodiments, the poly-dG nucleic acid sequence comprises 100%-51% (e.g., 100%-60%, 100%-70%, 100%-80%, 100%-90%, 100%-95%, 95%-51%, 90%-51%, 80%-51%, 70%-51%, and 60%-51%) of dG nucleic acid residues and 0%-49% (e.g., 0%-45%, 0%-40%, 0%-30%, 0%-20%, 0%-10%, and 0%-5%, 5%-49%, 10%-49%, 20%-49%, 30%-49%, and 40%-49%) of dC nucleic acid residues. In some embodiments, the poly-dC nucleic acid sequence comprises between 100% and 51% (e.g., between 100% and 60%, between 100% and 70%, between 100% and 80%, between 100% and 90%, between 100% and 95%, between 95% and 51%, between 90% and 51%, between 80% and 51%, between 70% and 51%, and between 60% and 51%) dC nucleic acid residues and between 0% and 49% (e.g., between 0% and 45%, between 0% and 40%, between 0% and 30%, between 0% and 20%, between 0% and 10%, and between 0% and 5%, between 5% and 49%, between 10% and 49%, between 20% and 49%, between 30% and 49%, and between 40% and 49%) dG nucleic acid residues.

[0024] In some embodiments, all internucleotide groups connecting nucleotides in poly-dG and poly-dC nucleic acid sequences are phosphodiester or phosphorothioate. In some embodiments, 50%-100% (e.g., 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 70%-100%, 80%-100%, and 90%-100%) of the internucleotide groups connecting nucleotides in poly-dG and / or poly-dC nucleic acid sequences are phosphorothioate bonds. In some embodiments, between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the poly-dG and / or poly-dC nucleic acid sequences are phosphodiester bonds and the remaining internucleotide groups connecting the nucleotides in the poly-dG and / or poly-dC nucleic acid sequences are phosphorothioate bonds. In some embodiments, all of the internucleotide groups connecting the nucleotides in the poly-dG and poly-dC nucleic acid sequences are phosphorothioate.

[0025] In some embodiments, the albumin binding domain is attached to the 5' end of a poly-dG nucleic acid sequence. In some embodiments, the albumin binding domain is attached to the 5' end of a poly-dC nucleic acid sequence.

[0026] In some embodiments, the albumin binding domain is a lipid. In some embodiments, the lipid is a diacyl lipid. In certain embodiments, the diacyl lipid comprises an acyl chain comprising 12-30 hydrocarbon units (e.g., 12-25, 12-20, 12-15, 15-30, 20-30, and 25-30 hydrocarbon units), 14-25 hydrocarbon units (e.g., 14-22, 14-20, 14-18, 14-16, 16-25, 18-25, 20-25, and 22-25 hydrocarbon units), 16-20 hydrocarbon units (e.g., 16-19, 16-18, 16-17, 17-20, 18-20, and 19-20 hydrocarbon units), or 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hydrocarbon units. In some embodiments, the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE). In some embodiments, the poly-dG nucleic acid sequence, the poly-dC nucleic acid sequence, or the ISD sequence is selected from the group consisting of the following lipids: [ka] or a salt thereof, or is linked by a linker, wherein X is O or S.

[0027] In some embodiments, the linker is selected from the group consisting of a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof. In some embodiments, the linker comprises "N" polyethylene glycol units, where N is 24-50 (e.g., 24-45, 24-40, 24-35, 24-30, 24-26, 26-50, 30-50, 35-50, 40-50, and 45-50 glycol units). In some embodiments, the linker comprises PEG24-amide-PEG24.

[0028] In another aspect, the present disclosure provides poly-dG and poly-dC double-stranded DNA sequences comprising 30-100 pairs of paired nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 pairs), or pharma- ceutically acceptable salts thereof. In some embodiments, the poly-dG and poly-dC comprise the same number of nucleotides.

[0029] In another aspect, the present disclosure provides poly-dG or poly-dC single-stranded DNA sequences comprising 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100), or a pharma- ceutically acceptable salt thereof.

[0030] In another aspect, the disclosure provides a method of inducing an immune response to an antigen in a subject by administering to the subject any one of the compounds described herein or a pharma- ceutically acceptable salt thereof and the antigen. In some embodiments, the method further comprises administering to the subject an adjuvant. In some embodiments, the antigen is an influenza antigen, or a fragment thereof. In some embodiments, the antigen is an influenza nucleoprotein, or a fragment thereof. For example, the influenza nucleoprotein may comprise a polypeptide sequence having at least 85% (e.g., at least 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22, or a fragment thereof. In particular, the influenza nucleoprotein may have at least 95% (e.g., at least 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22, or a fragment thereof. In a specific embodiment, the influenza nucleoprotein comprises the polypeptide sequence of SEQ ID NO: 22, or a fragment thereof.

[0031] In some embodiments, the antigen is a coronavirus antigen, or a fragment thereof. In some embodiments, the antigen is a coronavirus spike protein, or a fragment thereof. In some embodiments, the antigen is a coronavirus nucleocapsid protein, or a fragment thereof.

[0032] In some embodiments, the antigen is administered intramuscularly, subcutaneously, intravenously, intraperitoneally, topically, or orally. In certain embodiments, the compound or any one of its pharma- ceutically acceptable salts is administered subcutaneously.

[0033] In some embodiments, the subject is a mammal, hi some embodiments, the subject is a human.

[0034] In another aspect, the present disclosure provides a pharmaceutical composition comprising any one of the compounds described herein or a pharma- ceutically acceptable salt thereof, an antigen or a nucleic acid sequence encoding the antigen, and a pharma- ceutically acceptable carrier. In some embodiments, the antigen is an influenza antigen or a fragment thereof. In some embodiments, the antigen is an influenza nucleoprotein or a fragment thereof. In some embodiments, the antigen is a coronavirus antigen or a fragment thereof.

[0035] In another aspect, the disclosure provides a kit comprising any one of the compounds described herein or pharma- ceutically acceptable salts thereof and an antigen or a nucleic acid sequence encoding the antigen. In some embodiments, the antigen is an influenza antigen, or a fragment thereof. In some embodiments, the antigen is an influenza nucleoprotein, or a fragment thereof. In some embodiments, the influenza nucleoprotein comprises a polypeptide sequence having at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22. In some embodiments, the influenza nucleoprotein comprises a polypeptide sequence having at least 95% (e.g., at least 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22. In some embodiments, the influenza nucleoprotein comprises a polypeptide sequence of SEQ ID NO:22.

[0036] In some embodiments, the antigen is a coronavirus antigen, or a fragment thereof.

[0037] In each embodiment, including the claims, where a pharma- ceutically acceptable salt is referred to, the embodiment may optionally be a pharma- ceutically acceptable salt thereof. [Brief description of the drawings]

[0038] [Figure 1] FIG. 1 is a diagram of a double-stranded amphipathic (AMP) poly-deoxyadenosine (dA) nucleic acid sequence (AMP-dAdT) hybridized to a poly-deoxythymidine (dT) nucleic acid sequence, a double-stranded AMP-poly-deoxythymidine (dT) nucleic acid sequence (AMP-dTdA) hybridized to a poly-deoxyadenosine (dA) nucleic acid sequence, a single-stranded AMP-poly-deoxyadenosine (dA), and a single-stranded AMP-poly-deoxythymidine (dT). [Figure 2A-2B]2A and 2B are graphs showing splenocyte IFNγ co-culture ELISpot responses of C57B16 mice administered a vaccine containing 5 μg of coronavirus spike RBD antigen and single-stranded soluble or amphipathic (AMP) dA or single-stranded soluble or AMP dT (FIG. 2A) and C57B16 mice administered a vaccine containing 5 μg of coronavirus spike RBD antigen and double-stranded soluble hybridizing dA and dT (dA:dT), double-stranded AMP dA:dT in which an amphipathic is conjugated to dA, or double-stranded AMP dT:dA in which an amphipathic is conjugated to dT (FIG. 2B). dA and dT are all 50 nucleotides in length and contain only phosphorothioates (PS). [Figure 3A-3B] 3A and 3B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone (from top to bottom of each row) found in harvested peripheral blood cells of C57BL / 6J mice (n=5 per group) administered single-stranded soluble or amphipathic (AMP) dA or single-stranded soluble or AMP dT (FIG. 3A) and C57B16 mice administered a vaccine containing 5 μg of coronavirus spike RBD antigen and double-stranded soluble hybridizing dA and dT (dA:dT), double-stranded AMP dA:dT with an amphipathic conjugated to dA, or double-stranded AMP dT:dA with an amphipathic conjugated to dT (FIG. 3B). dA and dT are all 50 nucleotides in length and contain only phosphorothioates (PS). [Figure 3C-3D] Figures 3C and 3D are graphs showing the amount of CD8 cells specific for SARS-CoV-2 RBD antigen isolated from peripheral blood collected from C57BL / 6J mice (n=5 per group) administered 5 μg of coronavirus spike RBD antigen and soluble or amphipathic single-stranded dA or dT (Figure 3C), or double-stranded soluble hybridized dA and dT (dA:dT) or double-stranded amphipathic hybridized dA and dT (dA:dT) or amphipathic dT:dA (Figure 3D). All dA and dT are 50 nucleotides in length and contain only phosphorothioates (PS). [Figure 4] 4 is a graph showing the frequency of cytokines in CD4+ T cells including (from top to bottom of each row) IFNγ and TNFα, TNFα alone, and IFNγ alone found in harvested peripheral blood cells from C57BL / 6J mice (n=5 per group) administered 5 μg of coronavirus spike RBD antigen and single-stranded soluble or amphipathic (AMP) dA or single-stranded soluble or AMP, and C57B16 mice administered a vaccine containing 5 μg of coronavirus spike RBD antigen and double-stranded soluble hybridizing dA and dT (dA:dT), double-stranded AMP dA:dT in which an amphipathic is conjugated to dA, or double-stranded AMP dT:dA in which an amphipathic is conjugated to dT. All dA and dT are 50 nucleotides in length and contain only phosphorothioates (PS). [Figure 5A-5B] 5A and 5B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) that received a vaccine containing 5 μg of coronavirus spike RBD antigen and single-chain soluble or amphipathic (AMP) dA or single-chain soluble or AMP dT (FIG. 5A), and in C57B16 mice that received a vaccine containing 5 μg of coronavirus spike RBD antigen and double-stranded soluble hybridizing dA and dT (dA:dT), double-stranded AMP dA:dT in which an amphipathic is conjugated to dA, or double-stranded AMP dT:dA in which an amphipathic is conjugated to dT (FIG. 5B). The dAs and dTs are all 50 nucleotides in length and contain only phosphorothioates (PS). [Figures 6A-6C]Figures 6A-C are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells isolated from perfused lung tissue restimulated with coronavirus spike peptides from the Wuhan variant (Figure 6A), alpha variant (Figure 6B), or beta variant (Figure 6C) in C57BL / 6J mice (n=5 per group) vaccinated with 5 μg of coronavirus spike RBD in combination with AMP-dA, AMP-dT, AMP-dA:dT, or AMP-dT:dA. dA and dT are all 50 nucleotides in length and contain only phosphorothioate (PS) linkages. [Fig. 6D-6G] Figures 6D-6G are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue restimulated with coronavirus spike peptides from the South African variant pool (Figure 6D), UK variant pool (Figure 6E), custom wild-type pool (Figure 6F), or wild-type spike pool (Figure 6G) in C57BL / 6J mice (n=5 per group) vaccinated with 5 μg coronavirus spike RBD in combination with soluble or AMP-dA, soluble or AMP-dT, soluble or AMP-dA:dT, or AMP-dT:dA. dA and dT are all 50 nucleotides in length and contain only phosphorothioate (PS) linkages. [Fig. 6H-6J]Figures 6H-J are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue restimulated with coronavirus spike peptides from the Wuhan variant (Figure 6H), alpha variant pool (Figure 6I), or beta variant pool (Figure 6J) in C57BL / 6J mice (n=5 per group) vaccinated with 5 μg coronavirus spike RBD in combination with soluble or AMP-dA, soluble or AMP-dT, soluble or AMP-dA:dT, or AMP-dT:dA. dA and dT are all 50 nucleotides in length and contain only phosphorothioate (PS) linkages. [Figure 7A-7B] Figures 7A and 7B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of coronavirus spike RBD antigen and single-stranded soluble or AMP-dA or single-stranded soluble or AMP-dT (Figure 7A), and in C57B16 mice administered a vaccine containing 5 μg of coronavirus spike RBD antigen and double-stranded soluble hybridized dA and dT (dA:dT), double-stranded AMP dA:dT with an amphiphile conjugated to dA, or double-stranded AMP dT:dA with an amphiphile conjugated to dT (Figure 7B). All dA and dT are 50 nucleotides in length and contain only phosphorothioates (PS). [Figure 8A-8B]Figures 8A and 8B are graphs showing total radiative efficiency measured in lymph nodes harvested from C57BL / 6J mice (n=20 per group) administered vaccines containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of AMP-dT and FAM-dA, 50 nucleotides each, 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of dT and FAM-dA, 50 nucleotides each, or 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of AMP-dT and dA, 50 nucleotides each, either 24 hours (Figure 8A) or 48 hours (Figure 8B) post-dose. [Figure 9] FIG. 9 is a graph showing the frequency of 6-fluorescein amidite (FAM) fluorophore among T cells, macrophages, and dendritic cells 24 or 48 hours after injection in lymph nodes of C57BL / 6J mice (n=20 per group) administered vaccines containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of AMP-dT and FAM-dA, 50 nt each (right side of each panel), 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of soluble dA and FAM-dT, 50 nt each (center of each panel), or no FAM (left side of each panel). [Figure 10A-10B] Figures 10A and 10B are graphs showing splenocyte IFNγ co-culture ELISpot responses from C57B16 mice administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and soluble dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 10A) or 5 μg of SARS-CoV-2 RBD antigen and AMP-dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 10B). [Figure 11A-11B]Figures 11A and 11B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells from perfused lung tissue in C57BL / 6J mice (n=20 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and soluble dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 11A) or 5 μg of SARS-CoV-2 RBD antigen and AMP-dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 11B). [Figure 12A-12B] Figures 12A and 12B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells from perfused lung tissue in C57BL / 6J mice (n=20 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and soluble dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 12A) or 5 μg of SARS-CoV-2 RBD antigen and AMP-dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 12B). [Figure 13A-13B] Figures 13A and 13B are graphs showing the amount of IgG isolated from the serum of C57B16 mice administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and soluble dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 13A) or a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and AMP-dA:dT that is 30, 40, 50, 75, or 100 nucleotides in length (Figure 13B). [Figure 14A-14B]Figures 14A and 14B are graphs showing splenocyte IFNγ co-culture ELISpot responses of C57B16 mice administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-dA:dT, 50 nucleotides in length, with either a PS or PO backbone (Figure 14A), or 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-ISD (interferon-stimulating DNA), 45 nucleotides in length, with either a PS or PO backbone (Figure 14B). [Figure 15A-15B] Figures 15A and 15B are graphs showing the frequency of cytokines in CD8+ T cells including (from top to bottom of each row) IFNγ and TNFα, TNFα alone, and IFNγ alone found in peripheral blood cells collected from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-dA:dT, 50 nucleotides in length, with either PS or PO backbone (Figure 15A), or 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-interferon-stimulating DNA (ISD), 45 nucleotides in length, with either PS or PO backbone (Figure 15B). [Figure 16A-16B] Figures 16A and 16B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-dA:dT, 50 nucleotides in length, with either PS or PO backbone (Figure 16A), or 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-ISD (interferon stimulating DNA), 45 nucleotides in length, with either PS or PO backbone (Figure 16B). [Figure 17A-17B]Figures 17A and 17B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-dA:dT, 50 nucleotides in length, with either PS or PO backbone (Figure 17A), or 5 μg of SARS-CoV-2 RBD antigen and either soluble or AMP-ISD (interferon stimulating DNA), 45 nucleotides in length, with either PS or PO backbone (Figure 17B). [Figure 18] FIG. 18 is a graph showing the amount of influenza NP antigen-specific CD8 cells isolated from peripheral blood collected from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg influenza nucleoprotein antigen and 5 nmol of soluble or AMP-CpG or 5 nmol of soluble or AMP-dT that is 50 nucleotides in length. [Figure 19] FIG. 19 is a graph showing the frequency of cytokines in CD8+ T cells including (from top to bottom of each row) IFNγ and TNFα, TNFα alone, and IFNγ alone found in peripheral blood cells harvested from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg influenza nucleoprotein antigen and 5 nmol of soluble or AMP-CpG or 5 nmol of soluble or AMP-dT that is 50 nucleotides in length. [Figure 20]Figure 20 is a graph showing splenocyte IFNγ co-culture ELISpot responses of C57Bl6 mice administered vaccines containing 5 nmol per injection of double-stranded soluble hybridized dA and dT (dA:dT), double-stranded AMP dA:dT with amphiphile conjugated to dA, soluble dT, AMP dT, naked double-stranded dA:dT, or 1 nmol of AMP-CpG7090 dT:dA. dA and dT are all 50 nucleotides in length and contain only phosphorothioates (PS). Naked double-stranded dA:dT contains poly(deoxyadenylate-deoxythymidylic acid sodium salt, which contains a repeating synthetic double-stranded DNA sequence of poly(dA-dT):poly(dT-dA), a synthetic analog of B-DNA. [Figure 21] FIG. 21 is a graph showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD8+ T cells isolated from perfused lung tissue in C57BL / 6J mice that received a vaccine containing 5 nmol per injection of double-stranded soluble hybridized dA and dT (dA:dT), double-stranded AMP dA:dT with an amphiphile conjugated to dA, soluble dT, AMP dT naked double-stranded dA:dT, or 1 nmol of AMP-CpG7909, where naked dA:dT is poly(deoxyadenylic-deoxythymidylic) acid sodium salt containing a repeating synthetic double-stranded DNA sequence of poly(dA-dT):poly(dT-dA), a synthetic analog of B-DNA. [Figures 22A-22C] Figures 22A-C are graphs showing splenocyte IFNy coculture ELISpot responses from C57BI6 mice administered a vaccine containing 5 μg influenza nucleoprotein (Puerto Rico) and 50 μg alum, 5 nmol soluble CpG, 5 nmol amphipathic CpG, 5 nmol soluble single-stranded dT, or 5 nmol amphipathic single-stranded dT and restimulated with CDS epitopes from Puerto Rico nucleoprotein (Figure 22A), Ann Arbor nucleoprotein (Figure 22B), and Kitakyushu nucleoprotein (Figure 22C). [Figure 23]Figure 23 is a graph showing the frequency of intracellular cytokine production, from top to bottom of each row, including IFNy and TNFa, TNFa alone, and IFNy alone, in CDS+ T cells isolated from perfused lung tissue in C57BL / 6J mice administered a vaccine containing 5 μg influenza nucleoprotein (Puerto Rico) and 50 μg alum, 5 nmol soluble CpG, 5 nmol amphipathic CpG, 5 nmol soluble single-stranded dT, or 5 nmol amphipathic single-stranded dT, and restimulated with CDS epitopes from Puerto Rico nucleoprotein. The administered CpG was 22 nucleotides in length, the dT was nucleotides in length, and both contained only PS linkages. [Fig. 24A-24B] Figures 24A and 24B are graphs showing the frequency of intracellular cytokine production, including IFNy and TNFa, TNFa alone, and IFNy alone, from top to bottom of each row, in CDS+ T cells isolated from perfused lung tissue in C57BL / 6J mice administered a vaccine containing 5 μg influenza nucleoprotein (Puerto Rico) and 50 μg alum, 5 nmol soluble CpG, 5 nmol amphipathic CpG, 5 nmol soluble single-stranded dT, or 5 nmol amphipathic single-stranded dT, and restimulated with CDS epitopes from Ann Arbor nucleoprotein (Figure 24A) and Kitakyushu nucleoprotein (Figure 24B). The administered CpG was 22 nucleotides in length, the dT was nucleotides in length, and both contained only PS linkages. [Fig. 25A-25B]Figures 25A and 25B are graphs showing the frequency of intracellular cytokine production, including IFNy and TNFa, TNFa alone, and IFNy alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice administered a vaccine containing 5 μg influenza nucleoprotein (Puerto Rico) and 50 μg alum, 5 nmol soluble CpG, 5 nmol amphipathic CpG, 5 nmol soluble single-stranded dT, or 5 nmol amphipathic single-stranded dT, and restimulated with epitopes from Ann Arbor nucleoprotein (Figure 25A) and Kitakyushu nucleoprotein (Figure 25B). The administered CpG was 22 nucleotides in length, the dT was nucleotides in length, and both contained only PS linkages. [Figure 26A-26B] Figures 26A and 26B are graphs showing the amount of CD8 cells specific for ovalbumin antigen isolated from peripheral blood collected from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of ovalbumin nucleoprotein antigen and 5 nmol of AMP-CpG, 5 nmol of soluble or AMP-dA:dT (Figure 26A); or 5 nmol of soluble or AMP-dT (Figure 26B), which are 50 nucleotides in length. [Figure 27A-27B] Figures 27A and 27B are graphs showing the frequency of cytokines in CD8+ T cells including (from top to bottom of each row) IFNγ and TNFα, TNFα alone, and IFNγ alone found in peripheral blood cells collected from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of ovalbumin nucleoprotein antigen and 5 nmol of AMP-CpG, 5 nmol of soluble or AMP-dA:dT, which are 50 nucleotides in length (Figure 27A); or 5 nmol of soluble or AMP-dT (Figure 27B). [Fig. 28A-28B]Figures 28A and 28B are graphs showing the frequency of cytokines in CD8+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of ovalbumin nucleoprotein antigen and 5 nmol of AMP-CpG, 5 nmol of soluble or AMP-dA:dT, which are 50 nucleotides in length (Figure 28A); or 5 nmol of soluble or AMP-dT (Figure 28B). [Figure 29A-29B] Figures 29A and 29B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol of AMP-CpG, 5 nmol of soluble or AMP-dA:dT, which are 50 nucleotides in length (Figure 29A); or 5 nmol of soluble or AMP-dT (Figure 29B). [Fig. 30A-30B] Figures 30A and 30B are graphs showing splenocyte IFNγ co-culture ELISpot responses from C57B16 mice administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol of AMP-CpG, 5 nmol of soluble or AMP-dA:dT, which are 50 nucleotides long (Figure 30A); or 5 nmol of soluble or AMP-dT (Figure 30B). [Fig. 31A-31B] Figures 31A and 31B are graphs showing splenocyte IFNγ coculture ELISpot responses from C57B16 mice administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of single-stranded soluble dT (Figure 31A) or 5 nmol of single-stranded AMP-dT (Figure 31B) that are 10, 20, 30, 40, 50, 75, or 100 nucleotides in length and contain only phosphorothioate linkages. [Fig. 32A-32B]Figures 32A and 32B are graphs showing the frequency of cytokines in CD8+ T cells, including, from top to bottom of each row, IFNγ and TNFα, TNFα alone, and IFNγ alone, found in peripheral blood cells collected from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of single-stranded soluble dT (Figure 32A) or 5 nmol of single-stranded AMP-dT (Figure 32B) that are 10, 20, 30, 40, 50, 75, or 100 nucleotides long and contain only phosphorothioate linkages. [Fig. 33A-33B] Figures 33A and 33B are graphs showing the frequency of cytokines in CD8+ T cells isolated from perfused lung tissue harvested from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of single-stranded soluble dT (Figure 33A) or 5 nmol of single-stranded AMP-dT (Figure 33B) that are 10, 20, 30, 40, 50, 75, or 100 nucleotides long and contain only phosphorothioate linkages, from top to bottom of each row, including IFNγ and TNFα, TNFα alone, and IFNγ alone. [Fig. 34A-34B] Figures 34A and 34B are graphs showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) that received a vaccine containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of single-stranded soluble dT (Figure 34A) or 5 nmol of single-stranded AMP-dT (Figure 34B) that was 10, 20, 30, 40, 50, 75, or 100 nucleotides long and contained only phosphorothioate linkages. [Diagram 35]FIG. 35 is a graph showing the amount of CD8 cells specific for ovalbumin antigen isolated from peripheral blood harvested from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg of ovalbumin nucleoprotein antigen and 5 nmol of alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Diagram 36] FIG. 36 is a graph showing splenocyte IFNγ co-culture ELISpot responses from C57B16 mice administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Figure 37] FIG. 37 is a graph showing the frequency of cytokines in CD8+ T cells isolated from peripheral blood cells harvested from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG, including, from top to bottom of each row, IFNγ and TNFα, TNFα alone, and IFNγ alone. [Figure 38] FIG. 38 is a graph showing the frequency of intracellular cytokine production, including IFNγ and TNFα, TNFα alone, and IFNγ alone, from top to bottom of each row, in CD4+ T cells isolated from peripheral blood cells in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Figure 39] FIG. 39 is a graph showing the frequency of cytokines in CD8+ T cells isolated from perfused lung tissue harvested from C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG, from top to bottom of each row, including IFNγ and TNFα, TNFα alone, and IFNγ alone. [Diagram 40] FIG. 40 is a graph showing the frequency of intracellular cytokine production, from top to bottom of each row, including IFNγ and TNFα, TNFα alone, and IFNγ alone, in CD4+ T cells isolated from perfused lung tissue in C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Diagram 41] FIG. 41 is a graph showing the amount of anti-ovalbumin IgG isolated from the serum of C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol of alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Fig. 42A-42B] Figures 42A and 42B are graphs showing the amount of anti-ovalbumin IgG1 (Figure 42A) and IgG2c (Figure 42B) isolated from the serum of C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol of alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Figure 42C] FIG. 42C is a graph showing the ratio of anti-ovalbumin IgG2c to IgG1 isolated from serum of C57BL / 6J mice (n=5 per group) administered a vaccine containing 5 μg ovalbumin antigen and 5 nmol of alum, IFA, MF59, AS03, AS04, AMP-dA:dT, AMP-dT, or AMP-CpG. [Diagram 43] FIG. 43 is a schematic diagram showing the timeline of vaccination with adjuvant and SARS-CoV-2 spike antigen in Rhesus macaques as well as the sample collection timeline. [Figure 44A]FIG. 44A is a graph showing the amount of IgG isolated from serum of Rhesus macaque monkeys administered a vaccine containing 3000 μg of AMP-CpG and the SARS-CoV-2 spike RBD. [Figure 44B] FIG. 44B is a graph showing pseudovirus neutralization titers50 for serum from Rhesus macaque monkeys administered a vaccine containing 3000 μg AMP-CpG and the SARS-CoV-2 spike RBD compared to convalescent human serum. [Diagram 45] FIG. 45 is a series of graphs showing the quantity of CD8 cells specific for RBD antigen isolated from peripheral blood collected from Rhesus macaques administered a vaccine containing an amphipathic CpG7909 or amphipathic poly-dT50 nucleotide length adjuvant and an antigen containing the SARS-CoV-2 spike RBD, a variant of concern (VOC) spike RBD, or the SARS-CoV-2 spike. [Diagram 46] FIG. 46 is a graph showing (from left to right; baseline to week 8) the amount of IgG isolated from serum of Rhesus macaque monkeys administered a vaccine containing 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the Wuhan variant. [Figure 47]FIG. 47 is a graph showing (from left to right; baseline to week 8) the amount of IgG isolated from serum of Rhesus macaque monkeys administered a vaccine containing 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the delta variant. [Figure 48] FIG. 48 is a graph showing (from left to right; baseline to week 8) the amount of IgG isolated from serum of Rhesus macaque monkeys administered a vaccine containing 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the beta variant. [Figure 49] FIG. 49 is a graph showing the amount of IgG isolated from serum of Rhesus macaque monkeys administered a vaccine containing 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen after 6 weeks for each of the SARS-CoV-2 spike antigens tested. [Fig. 50A-50D]50A-50D are graphs showing (from left to right at each time point) the concentration of intracellular cytokine production of IFNγ (FIG. 50A), IL-6 (FIG. 50B), IL-1RA (FIG. 50C), and IL-18 (FIG. 50D) from Rhesus macaque monkeys administered a vaccine containing 5000 μg AMP-CpG and SARS-CoV-2 spiked RBD, 10000 μg AMP-CpG and SARS-CoV-2 spiked RBD, 5000 μg AMP CpG and VOC spiked RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen. [Figure 51] FIG. 51 is a series of graphs showing splenocyte IFNγ co-culture ELISpot responses from Rhesus macaque monkeys administered a vaccine containing (from left to right) 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the Wuhan variant. [Figure 52] FIG. 52 is a series of graphs showing splenocyte IFNγ co-culture ELISpot responses from Rhesus macaque monkeys administered a vaccine containing (from left to right) 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the delta variant. [Diagram 53]FIG. 53 is a series of graphs showing splenocyte IFNγ co-culture ELISpot responses from Rhesus macaque monkeys administered a vaccine containing (from left to right) 5000 μg AMP-CpG and SARS-CoV-2 spike RBD, 10000 μg AMP-CpG and SARS-CoV-2 spike RBD, 5000 μg AMP CpG and VOC spike RBD, 5000 μg AMP-CpG, or 5000 μg AMP-CpG SARS-CoV-2 spike antigen, where the SARS-CoV-2 spike antigen is from the beta variant. [Figure 54] FIG. 54 is a diagram of a double-stranded amphipathic poly-deoxyadenosine (AMP-dA) nucleic acid sequence hybridized to a poly-deoxythymidine nucleic acid sequence (dT), a double-stranded amphipathic alternating poly-deoxyadenosine and poly-deoxythymidine (AMP-dAdT) nucleic acid sequence hybridized to a complementary alternating poly-deoxyadenosine and poly-deoxythymidine (dAdT) nucleic acid sequence, and a double-stranded amphipathic ISD nucleic acid sequence with phosphorothioate bonds (AMP-ISD-PS) hybridized to a complementary ISD nucleic acid sequence with phosphorothioate bonds. [Figure 55] Figure 55 is a graph showing splenocyte IFNγ co-culture ELISpot responses of C57B16 mice 21 days after administration of two doses of vaccine containing 5 nmol of double-stranded soluble hybridizing dA:dT, double-stranded hybridizing amphipathic dA:dT, double-stranded soluble alternating dAdT:dAdT, double-stranded amphipathic alternating dAdT:dAdT, double-stranded soluble ISD, and double-stranded amphipathic ISD, and 5 μg of spike RBD on days 0 and 14. [Fig. 56A-56B]Figures 56A and 56B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found (from top to bottom of each row) in CD8+ T cells (Figure 56A) or CD4+ T cells (Figure 56B) isolated from peripheral blood cells collected from C57BL / 6J mice 21 days after administration of two doses of vaccine containing 5 nmol of double-stranded soluble hybridizing dA:dT, double-stranded hybridizing amphipathic dA:dT, double-stranded soluble alternating dAdT:dAdT, double-stranded amphipathic alternating dAdT:dAdT, double-stranded soluble ISD, and double-stranded amphipathic ISD, and 5 μg of spike RBD on days 0 and 14. [Fig. 57A-57B] Figures 57A and 57B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found (from top to bottom of each row) in CD8+ T cells (Figure 57A) or CD4+ T cells (Figure 57B) isolated from lung tissue harvested from C57BL / 6J mice 21 days after administration of two doses of vaccine containing 5 nmol of double-stranded soluble hybridizing dA:dT, double-stranded hybridizing amphipathic dA:dT, double-stranded soluble alternating dAdT:dAdT, double-stranded amphipathic alternating dAdT:dAdT, double-stranded soluble ISD, and double-stranded amphipathic ISD, and 5 μg of spike RBD on days 0 and 14. [Figure 58] FIG. 58 shows transcriptome data of various genes from tissue extracted from lymph nodes of mice 2 hours after administration of double-stranded amphipathic dAdT, double-stranded soluble dAdT, single-stranded amphipathic dT, single-stranded soluble dT, amphipathic CpG, and soluble CpG and 5 μg of spiked RBD. [Figure 59] FIG. 59 shows transcriptome data of various genes from tissue extracted from lymph nodes of mice 6 hours after administration of double-stranded amphipathic dAdT, double-stranded soluble dAdT, single-stranded amphipathic dT, single-stranded soluble dT, amphipathic CpG, and soluble CpG and 5 μg of spiked RBD. [Figure 60]FIG. 60 shows transcriptome data of various genes from tissue extracted from lymph nodes of mice 24 hours after administration of double-stranded amphipathic dAdT, double-stranded soluble dAdT, single-stranded amphipathic dT, single-stranded soluble dT, amphipathic CpG, and soluble CpG and 5 μg of spiked RBD. [Figure 61] FIG. 61 shows transcriptome data of various genes from tissue extracted from lymph nodes of mice 72 hours after administration of double-stranded amphipathic dAdT, double-stranded soluble dAdT, single-stranded amphipathic dT, single-stranded soluble dT, amphipathic CpG, and soluble CpG and 5 μg of spiked RBD. [Figure 62] FIG. 62 is a diagram of a double-stranded amphipathic herpes simplex virus (AMP-HSV60) nucleic acid sequence hybridized to a complementary HSV60 nucleic acid sequence and a single-stranded amphipathic HSV60 (AMP-HSV60-sense). [Figure 63] Figure 63 is a graph showing splenocyte IFNγ co-culture ELISpot responses in C57B16 mice 21 days after administration of two doses of a vaccine containing 5 nmol of double-stranded soluble hybridizing HSV60, double-stranded hybridizing amphipathic HSV60, single-stranded soluble HSV60, and 5 μg of spike RBD on days 0 and 14. [Fig. 64A-64B] Figures 64A and 64B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found in CD8+ T cells (Figure 64A) or CD4+ T cells (Figure 64B) isolated from peripheral blood cells collected from C57BL / 6J mice 21 days after administration of two doses of a vaccine containing 5 nmol of double-stranded soluble hybridizing HSV60, double-stranded hybridizing amphipathic HSV60, single-stranded soluble HSV60, and 5 μg of spike RBD on days 0 and 14. [Fig. 65A-65B]Figures 65A and 65B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found in CD8+ T cells (Figure 65A) or CD4+ T cells (Figure 65B) isolated from lung tissue harvested from C57BL / 6J mice 21 days after administration of two doses of a vaccine containing 5 nmol of double-stranded soluble hybridizing HSV60, double-stranded hybridizing amphipathic HSV60, single-stranded soluble HSV60, and 5 μg of spike RBD on days 0 and 14. [Figure 66] Figure 66 is a graph showing the amount of CD8+ cells specific for SARS-CoV-2 RBD antigen isolated from peripheral blood collected from C57BL / 6J 21 days after administration of two doses of vaccine containing 5 nmol of double-stranded soluble hybridizing HSV60, double-stranded hybridizing amphipathic HSV60, single-stranded soluble HSV60, and 5 μg of spike RBD on days 0 and 14. [Figure 67] FIG. 67 is a diagram of a double-stranded amphipathic ISD (AMP-ISD) nucleic acid sequence hybridized to a complementary ISD nucleic acid sequence of a single-stranded amphipathic ISD (AMP-ISD-sense or AMP-ISD-antisense). [Figure 68] Figure 68 is a graph showing splenocyte IFNγ co-culture ELISpot responses of C57B16 mice 21 days after administration of two doses of vaccine containing 5 nmol of double-stranded soluble hybridizing ISD, double-stranded hybridizing amphipathic ISD, single-stranded soluble sense ISD, single-stranded amphipathic sense ISD, single-stranded soluble antisense ISD, single-stranded amphipathic antisense ISD, and 5 μg of spike RBD on days 0 and 14. [Fig. 69A-69B]Figures 69A and 69B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found in CD8+ T cells (Figure 69A) or CD4+ T cells (Figure 69B) isolated from peripheral blood cells collected from C57BL / 6J mice 21 days after administration of two doses of a vaccine containing 5 nmol of double-stranded soluble hybridizing ISD, double-stranded hybridizing amphipathic ISD, single-stranded soluble sense ISD, single-stranded amphipathic sense ISD, single-stranded soluble antisense ISD, single-stranded amphipathic antisense ISD, and 5 μg of spike RBD on days 0 and 14. [Fig. 70A-70B] Figures 70A and 70B are graphs showing the percentage of cytokines including IFNγ and TNFα, TNFα alone, and IFNγ alone found (from top to bottom of each row) in CD8+ T cells (Figure 70A) or CD4+ T cells (Figure 70B) isolated from lung tissue harvested from C57BL / 6J mice 21 days after administration of two doses of a vaccine containing 5 nmol of double-stranded soluble hybridizing ISD, double-stranded hybridizing amphipathic ISD, single-stranded soluble sense ISD, single-stranded amphipathic sense ISD, single-stranded soluble antisense ISD, single-stranded amphipathic antisense ISD, and 5 μg of spike RBD on days 0 and 14. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] definition Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0040] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0041] As used herein, "about" will be understood by those of ordinary skill in the art and will vary to some extent depending on the context in which it is used. If there are uses of the term that are not clear to persons of ordinary skill in the art given the context in which the term is used, "about" will mean up to plus or minus 10% of the particular value.

[0042] As used herein, the term "adjuvant" refers to a compound that enhances or otherwise changes or modifies the immune response obtained with a particular immunogen or antigen. Modification of the immune response includes enhancing or broadening the specificity of either or both antibody and cellular immune responses. Modification of the immune response can also mean decreasing or suppressing a particular antigen-specific immune response. In certain embodiments, the adjuvant is a cyclic dinucleotide. In some embodiments, the adjuvant is an immunostimulatory oligonucleotide as described herein.

[0043] "Amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to a naturally occurring amino acid. Naturally occurring amino acids are those encoded by the genetic code, as well as those that are later modified, such as hydroxyproline, gamma-carboxyglutamate, and phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon attached to a hydrogen, a carboxyl group, an amino group, and an R group, such as homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that differs from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. Amino acids may be referred to herein by either their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their commonly accepted single-letter codes.

[0044] An "amino acid substitution" refers to the replacement of at least one existing amino acid residue in a given amino acid sequence (the amino acid sequence of the starting polypeptide) with a second, different, "substitution" amino acid residue. An "amino acid insertion" refers to the incorporation of at least one additional amino acid into a given amino acid sequence. An insertion usually consists of the insertion of one or two amino acid residues, although present larger "peptide insertions" can be made, for example, by the insertion of about 3 to about 5, or even up to about 10, 15, or 20 amino acid residues. The inserted residues may be naturally occurring or non-naturally occurring, as disclosed above. An "amino acid deletion" refers to the removal of at least one amino acid residue from a given amino acid sequence.

[0045] As used herein, "amphiphile" or "amphiphilic" refers to a conjugate that includes a hydrophilic head group and a hydrophobic tail, thereby forming an amphiphilic conjugate. In some embodiments, the amphiphile conjugate includes poly-dA and / or poly-dT sequences and one or more hydrophobic lipid tails.

[0046] The term "amelioration" refers to any therapeutically beneficial outcome in the treatment of a disease state, e.g., influenza and SARS-CoV-2, including prevention, reduction in severity or progression, remission or cure.

[0047] As used herein, "cancer antigen" refers to (i) a tumor-specific antigen, (ii) a tumor-associated antigen, (iii) a cell expressing a tumor-specific antigen, (iv) a cell expressing a tumor-associated antigen, (v) an embryonic antigen on a tumor, (vi) an autologous tumor cell, (vii) a tumor-specific membrane antigen, (viii) a tumor-associated membrane antigen, (ix) a growth factor receptor, (x) a growth factor ligand, and (xi) any other type of antigen or antigen-presenting cell or substance associated with cancer.

[0048] A polypeptide or amino acid sequence that is "derived from" a specified polypeptide or protein or a "polypeptide fragment" refers to the origin of the polypeptide. Preferably, a polypeptide or amino acid sequence that is derived from or is a fragment of a particular sequence having an amino acid sequence that is essentially identical to that sequence or a portion thereof, the portion of which consists of at least 10-20 amino acids, preferably at least 20-30 amino acids, more preferably at least 30-50 amino acids, or is otherwise identifiable by the skilled artisan as having that origin in the sequence. A polypeptide that is derived from or is a fragment of another peptide may have one or more mutations relative to the starting polypeptide, e.g., one or more amino acid residues that are replaced with another amino acid residue or have an insertion or deletion of one or more amino acid residues.

[0049] Polypeptides can include non-naturally occurring amino acid sequences. Such variants necessarily have less than 100% sequence identity or similarity with the starting molecule. In preferred embodiments, variants have less than about 75%-100% amino acid sequence identity or similarity, more preferably less than about 80%-100%, more preferably less than about 85%-100%, more preferably less than about 90%-100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and most preferably less than about 95%-100% amino acid sequence identity or similarity with the amino acid sequence of the starting polypeptide, for example over the length of the variant molecule.

[0050] In one embodiment, there is one amino acid difference between the starting polypeptide sequence and the sequence derived therefrom. Identity or similarity with respect to this sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical (i.e., the same residue) to the starting amino acid residues, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.

[0051] As used herein, the term "cytotoxic T lymphocyte (CTL) response" refers to an immune response induced by cytotoxic T cells. CTL responses are primarily mediated by CD8+ T cells.

[0052] As used herein, the term "effective dose" or "effective dosage" is defined as an amount sufficient to achieve, or at least partially achieve, a desired effect.

[0053] The term "therapeutically effective dose" is defined as an amount sufficient to cure or at least partially halt the disease and its complications in a patient already suffering from the disease. Amounts effective for this use will depend on the severity of the disorder being treated and the general state of the patient's own immune system.

[0054] As used herein, an "immune cell" is a cell of hematopoietic origin that plays a role in the immune response. Immune cells include lymphocytes (e.g., B cells and T cells), natural killer cells, and myeloid cells (e.g., monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes). In certain embodiments, the immune cell is a T cell.

[0055] As used herein, "immune response" refers to a response made by an organism's immune system to a substance, including but not limited to a foreign body or a self-protein. Three general types of "immune response" include mucosal immune response, humoral immune response, and cellular immune response. For example, an immune response may include increased activation, expansion, and / or proliferation of immune cells. An immune response may also include at least one of cytokine production, T cell activation and / or proliferation, granzyme or perforin production, activation of antigen-presenting cells or dendritic cells, antibody production, inflammation, immune development, development of hypersensitivity to an antigen, antigen-specific lymphocyte response to an antigen, clearance of an infectious agent, and transplant or graft rejection.

[0056] As used herein, an "immunostimulatory oligonucleotide" is an oligonucleotide that is capable of stimulating (eg, inducing or enhancing) an immune response.

[0057] The terms "inducing an immune response" and "enhancing an immune response" are used interchangeably and refer to the stimulation of an immune response (ie, either passive or adaptive) to a particular antigen.

[0058] The term "induction" as used with respect to the induction of complement dependent cytotoxicity (CDC) or antibody dependent cellular cytotoxicity (ADCC) refers to the stimulation of a specific direct cell killing mechanism.

[0059] As used herein, a subject "in need of prevention," "in need of treatment," or "in need of" refers to one who, as determined by an appropriate medical practitioner (e.g., in the case of humans, a physician, nurse, or nursing practitioner; in the case of non-human mammals, a veterinarian), would reasonably benefit from a given treatment (such as treatment with a composition comprising an amphipathic ligand conjugate).

[0060] The term "in vivo" refers to a process that takes place in a living organism.

[0061] The term "in vitro" refers to a process that takes place outside of a living organism, such as in a test tube, flask, or culture plate.

[0062] As used herein, the terms "linked," "operably linked," "fused," or "fusion" are used interchangeably. These terms refer to the joining of two or more elements or components or domains by suitable means, including chemical conjugation or recombinant DNA technology. Methods of chemical conjugation (e.g., the use of heterobifunctional crosslinkers) are known in the art, as are methods of recombinant DNA technology.

[0063] The term "lipid" refers to a biomolecule that is soluble in non-polar solvents and insoluble in water. Lipids are often described as hydrophobic or amphipathic molecules, which allow them to form structures such as vesicles or membranes in an aqueous environment. Lipids include fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids (including cholesterol), prenol lipids, saccharolipids, and polyketides. In some embodiments, lipids suitable for the amphipathic ligand conjugates of the present disclosure bind to human serum albumin under physiological conditions. In some embodiments, lipids suitable for the amphipathic ligand conjugates of the present disclosure insert into cell membranes under physiological conditions. In some embodiments, the lipids bind to albumin and insert into cell membranes under physiological conditions. In some embodiments, the lipid is a diacyl lipid. In some embodiments, the diacyl lipid comprises at least 12 carbons. In some embodiments, the diacyl lipid comprises 12-30 hydrocarbon units, 14-25 hydrocarbon units, or 16-20 hydrocarbon units. In some embodiments, the diacyl lipid contains 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 carbons.

[0064] "Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., J. Biol. Chem. 260:2605-2608, 1985); and Cassol et al., 1992; Rossolini et al., Mal. Cell. Probes 8:91-98, 1994). In the case of arginine and leucine, the modification at the second base can also be conservative. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.

[0065] The polynucleotides of the invention may be composed of any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA. For example, the polynucleotides may be composed of single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA that is a mixture of single-stranded and double-stranded regions, hybrid molecules that include DNA and RNA that may be single-stranded or more typically double-stranded, or a mixture of single-stranded and double-stranded regions. Furthermore, the polynucleotides may be composed of triple-stranded regions that include RNA or DNA or both RNA and DNA. The polynucleotides may also contain one or more modified bases or DNA or RNA backbones that have been modified for stability or other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" encompasses chemically, enzymatically, or metabolically modified forms. In some embodiments, the peptides of the invention are encoded by nucleotide sequences. The nucleotide sequences of the present invention may be useful for many applications including cloning, gene therapy, protein expression and purification, mutagenesis, DNA vaccination of a host in need thereof, antibody production for e.g. passive immunization, PCR, primer and probe generation, etc.

[0066] As used herein, "parenteral administration," "administered parenterally," and other grammatically equivalent phrases refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intranasal, intraocular, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, epidural, intracerebral, intracranial, intracarotid, and intrasternal injection and infusion.

[0067] As generally used herein, "pharmacologically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues, organs, and / or body fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio.

[0068] The term "pharmaceutically acceptable salt" as used herein means any pharmaceutically acceptable salt of the conjugate, oligonucleotide, or peptide disclosed herein. Pharmaceutically acceptable salts of any of the compounds and nucleic acid sequences described herein may include those that are within the scope of sound medical judgment, suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCH, 2008. Salts can be prepared in situ during the final isolation and purification of the compounds described herein, or separately by reacting the free base group with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, and 2-hydroxy-ethanesulfonate. Examples of the salts include phosphate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate.Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc., as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc. References to compounds, nucleic acids, conjugates, oligonucleotides, or peptides in the claims and elsewhere in this specification include any pharma- ceutically acceptable salts thereof, unless otherwise indicated or applicable.

[0069] As used herein, the term "physiological conditions" refers to the in vivo conditions of a subject. In some embodiments, physiological conditions refer to a neutral pH (e.g., a pH of 6 to 8).

[0070] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and to non-naturally occurring amino acid polymers.

[0071] As used herein, the term "subject" or "mammal" or "patient" includes any human or non-human animal. For example, the methods and compositions of the invention can be used to treat a subject having a disease or condition. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, e.g., non-human primates, sheep, dogs, cats, mice, horses, pigs, cows, chickens, amphibians, reptiles, etc.

[0072] The term "sufficient amount" or "an amount sufficient to" refers to an amount sufficient to produce a desired effect, for example an amount sufficient to reduce the diameter of a tumor.

[0073] The term "T cell" refers to a type of white blood cell that can be distinguished from other white blood cells by the presence of a T cell receptor on the cell surface. There are several subsets of T cells, including, but not limited to, T helper cells (T H Cells or CD4 + (also known as T cells) and e.g. H , T H 2. T H 3. T H 17, T H 9 and T FH Subtypes include cytotoxic T cells (i.e., Tc cells, CD8 + T cells, cytotoxic T lymphocytes, T killer cells, killer T cells), memory T cells and, for example, central memory T cells (T CM cells), effector memory T cells (T EM and T EMRA cells) and resident memory T cells (T RM subtypes include regulatory T cells (also known as Treg cells or suppressor T cells) and CD4 + FOXP3 + T reg cells, CD4 + FOXP3 - T reg cells, Tr1 cells, Th3 cells and T reg Subtypes including T cells, including IL-17 cells, natural killer T cells (also known as NKT cells), mucosal-associated invariant T cells (MAIT) and gamma delta T cells (γδ T cells), such as Vγ9 / Vδ2 T cells. Any one or more of the above or unmentioned T cells may be a target cell type for the methods of use of the present invention.

[0074] The terms "treat", "treating" and "treatment" as used herein refer to therapeutic or prophylactic measures as described herein. The method of "treatment" employs administration of poly-dA and / or poly-dT nucleic acid sequences and albumin binding domains of the present disclosure to a subject in need of such treatment. In some embodiments, poly-dA, poly-dT, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain are administered to a subject in need of an enhanced immune response to a particular antigen or who may ultimately acquire such a disorder to prevent, cure, delay, reduce the severity or ameliorate one or more symptoms of the disorder or a recurrent disorder, or to extend the survival of the subject beyond that expected in the absence of such treatment.

[0075] The term "tumor-associated antigen" refers to an antigen produced in a tumor that can be detected by the immune system and elicit an immune response. Tumor-associated antigens have been identified in many human cancers, including lung, skin, blood, brain, liver, breast, rectal, bladder, and stomach cancers.

[0076] As used herein, a "vaccine" refers to a formulation comprising an amphipathic polyadenine and / or polythymidine nucleic acid sequence and an antigen as described herein, optionally combined with an adjuvant, in a form capable of being administered to a vertebrate and inducing a protective immune response sufficient to induce immunity to prevent and / or ameliorate a disease or condition (e.g., influenza or SARS-CoV-2) and / or reduce at least one symptom of a disease or condition (e.g., influenza or SARS-CoV-2). Typically, a vaccine comprises a conventional saline or buffered aqueous medium in which a composition as described herein is suspended or dissolved. In this form, the compositions as described herein are used to prevent, ameliorate, or treat an infection or disease. Upon introduction into a host, the vaccine elicits an immune response, including, but not limited to, induction of a protective immune response to induce immunity to prevent and / or ameliorate a disease or condition (e.g., influenza or SARS-CoV-2) and / or reduce at least one symptom of a disease or condition.

[0077] The present disclosure provides compounds comprising poly-deoxyadenosine (poly-dA) and / or poly-deoxythymidine (poly-dT) nucleic acid sequences or poly-deoxyguanosine (poly-dG) and / or poly-deoxycytosine (poly-dC) nucleic acid sequences, as well as poly-dA and / or poly-dT and poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, the present disclosure provides poly-deoxyguanosine (poly-dG) and / or poly-deoxycytosine (poly-dC) nucleic acid sequences, as well as poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, e.g., lipid. Pharmaceutically acceptable salts thereof are also provided. Additionally, the present disclosure provides pharmaceutical compositions and kits comprising poly-dA and / or poly-dT nucleic acid sequences (e.g., albumin binding domains, e.g., poly-dA and / or poly-dT nucleic acid sequences conjugated to lipids) and poly-dG and / or poly-dC nucleic acid sequences (e.g., albumin binding domains, e.g., poly-dG and / or poly-dC nucleic acid sequences conjugated to lipids) and antigens, and pharma- ceutically acceptable salts thereof. The present disclosure further provides methods of inducing an immune response in a subject by administering a compound described herein or a pharma- ceutically acceptable salt thereof together with an antigen, and a compound comprising a poly-dA and / or poly-dT nucleic acid sequence and a poly-dG and / or poly-dC nucleic acid sequence, or an albumin binding domain, e.g., poly-dA and / or poly-dT nucleic acid sequence and a poly-dG and / or poly-dC nucleic acid sequence conjugated to lipids.

[0078] Polyadenosine and polythymidine nucleic acid sequences Poly-deoxyribonucleic acid includes nucleic acid strands that can be single-stranded or double-stranded. Poly-deoxyribonucleic acid can include only one type of nucleic acid in a single strand of nucleic acid (e.g., polyadenosine (poly-dA) and polythymidine (poly-dT)). Poly-dA nucleic acid sequences can include only adenosine nucleic acid bases. In some embodiments, poly-dA nucleic acid sequences include a mixture of adenosine and thymidine nucleic acid residues. For example, in some embodiments, poly-dA nucleic acid sequences can be composed of 100%-51% adenosine nucleic acid residues and 0%-49% thymidine nucleic acid residues. In some embodiments, nucleic acid sequences can include alternating dA and dT residues. Poly-dT sequences can include only thymidine nucleic acid bases. In some embodiments, poly-dT nucleic acid sequences include a mixture of thymidine and adenosine nucleic acid residues. For example, in some embodiments, a poly-dT nucleic acid sequence can be composed of 100%-51% thymidine nucleic acid residues and 0%-49% adenosine nucleic acid residues.

[0079] The poly-dA single single-stranded DNA sequence may comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dA single single-stranded DNA sequence comprises 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, the poly-dA single stranded DNA sequence comprises 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, the poly-dA comprises 50 nucleotides (dA50).

[0080] The poly-dT single single-stranded DNA sequence may comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dT single single-stranded DNA sequence comprises 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, the poly-dT single stranded DNA sequence comprises 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, the poly-dT comprises 50 nucleotides (dT50).

[0081] The poly-dA and poly-dT double stranded DNA sequences can comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dA and poly-dT nucleic acid sequences comprise 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, poly-dA and poly-dT contain the same number of nucleotides. In some embodiments, the poly-dA and poly-dA single stranded DNA sequence of the double stranded DNA sequence each contain 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, poly-dA and poly-dT each contain 50 nucleotides (dA50:dT50).

[0082] References to the poly-deoxyribonucleic acids described herein should be understood to include the pharma- ceutically acceptable salts thereof.

[0083] Polyguanosine and polycytosine nucleic acid sequences Poly-deoxyribonucleic acid includes a nucleic acid strand that can be single-stranded or double-stranded. Poly-deoxyribonucleic acid can include only one type of nucleic acid in a single strand of nucleic acid (e.g., polyguanosine (poly-dG) and polycytosine (poly-dC)). Poly-dG nucleic acid sequences can include only guanosine nucleic acid bases. In some embodiments, poly-dG nucleic acid sequences include a mixture of guanosine and cytosine nucleic acid residues. For example, in some embodiments, poly-dG nucleic acid sequences can be composed of 100%-51% guanosine nucleic acid residues and 0%-49% cytosine nucleic acid residues. Poly-dC sequences can include only cytosine nucleic acid bases. In some embodiments, poly-dC nucleic acid sequences include a mixture of cytosine and guanosine nucleic acid residues. For example, in some embodiments, poly-dC nucleic acid sequences can be composed of 100%-51% cytosine nucleic acid residues and 0%-49% guanosine nucleic acid residues.

[0084] The poly-dG single-stranded DNA sequence may comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dG single-stranded DNA sequence comprises 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, the poly-dG single stranded DNA sequence comprises 75, 80, 85, 90, 95, or 100 nucleotides.

[0085] The poly-dC single stranded DNA sequence may comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dC single stranded DNA sequence comprises 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, the poly-dC single stranded DNA sequence comprises 75, 80, 85, 90, 95, or 100 nucleotides.

[0086] The poly-dG and poly-dC double stranded DNA sequences can comprise 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides. In some embodiments, the poly-dG and poly-dC nucleic acid sequences comprise 75-150 (e.g., 75-140, 75-130, 75-120, 75-110, 75-100, 75-95, 75-90, 75-85, 75-80, 80-150, 85-150, 90-150, 95-150, 100-150, 110-150, 120-150, 130-150, and 140-150) nucleotides. In some embodiments, the poly-dG and poly-dC comprise the same number of nucleotides. In some embodiments, the poly-dG and poly-dC single stranded DNA sequences of the double stranded DNA sequence each comprise 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, the poly-dG and poly-dC strands of the nucleic acid are complementary to each other.

[0087] References to the poly-deoxyribonucleic acids described herein should be understood to include the pharma- ceutically acceptable salts thereof.

[0088] Adjuvants Interferon-stimulating DNA sequences Interferon-stimulating DNA (ISD) is a DNA strand that enhances the expression of interferon in a cell. The ISD can be derived from a genome separate from the genome of the host cell. For example, the ISD can be derived from a bacterial genome (e.g., Listeria monocytogenes). An amphipathic ISD contains an albumin-binding domain, e.g., a nucleic acid strand conjugated to a lipid.

[0089] The present disclosure provides an ISD sequence conjugated to an albumin binding domain, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the amphipathic ISD is a single strand of nucleic acid conjugated to an albumin binding domain, e.g., a lipid. In some embodiments, the amphipathic ISD is a double-stranded nucleic acid. In some embodiments, the albumin binding domain is conjugated to the 5' end of the ISD sequence. In other embodiments, the albumin binding domain is conjugated to the 3' end of the ISD sequence.

[0090] The length of the ISD sequence may comprise 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the ISD sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the ISD sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the ISD sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the ISD sequence may be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides in length. In some embodiments, the ISD sequence may be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length.

[0091] In some embodiments, 50%-100% (e.g., 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 70%-100%, 80%-100%, or 90%-100%) of the internucleotide groups connecting the nucleotides in the ISD sequence are phosphorothioate linkages. In some embodiments, 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the ISD sequence are phosphodiester linkages and the remaining internucleotide groups connecting the nucleotides of the ISD sequence are phosphorothioate linkages. For example, 1-5 linkages (e.g., 1, 2, 3, 4, or 5) at the 5' and / or 3' end of the ISD sequence are phosphodiester linkages and all remaining linkages are phosphorothioate linkages.

[0092] An ISD can be either double-stranded or single-stranded. A double-stranded nucleic acid can include a sense strand and an antisense strand. For example, an ISD can include a sense strand having a nucleic acid sequence of TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 23) and an antisense strand having a nucleic acid sequence of ATGTCTAGATGATCACTAGATACTGACTAGACATGTACTAGATGT (SEQ ID NO: 24), as shown in Figure 54 and Figure 67.

[0093] References to the adjuvants described herein should be understood to include the pharma- ceutically acceptable salts thereof.

[0094] Herpes simplex virus The present disclosure provides a herpes simplex virus (HSV) sequence conjugated to an albumin binding domain, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the amphipathic HSV is a single strand of nucleic acid conjugated to the albumin binding domain, e.g., a lipid. In some embodiments, the amphipathic HSV is a double stranded nucleic acid. In some embodiments, the albumin binding domain is conjugated to the 5' end of the HSV sequence. In other embodiments, the albumin binding domain is conjugated to the 3' end of the HSV sequence.

[0095] The length of the HSV sequence may comprise 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the HSV sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the HSV sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the HSV sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of the HSV sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the HSV sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, the length of the HSV sequence is about 60 nucleotides.

[0096] In some embodiments, between 50% and 100% (e.g., between 50% and 90%, between 50% and 80%, between 50% and 70%, between 50% and 60%, between 60% and 100%, between 70% and 100%, between 80% and 100%, or between 90% and 100%) of the internucleotide groups connecting the nucleotides in the HSV sequence are phosphorothioate linkages. In some embodiments, between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the HSV sequence are phosphodiester linkages and the remaining internucleotide groups connecting the nucleotides of the HSV sequence are phosphorothioate linkages. For example, between 1 and 5 (e.g., 1, 2, 3, 4, or 5) linkages at the 5' and / or 3' end of the HSV sequence are phosphodiester linkages and all remaining linkages are phosphorothioate linkages.

[0097] HSV can be either double stranded or single stranded. The double stranded nucleic acid can include a sense strand and an antisense strand. For example, HSV can include a sense strand and an antisense strand, such as the HSV sequence shown in Figure 62. In some embodiments, the HSV sequence can be an HSV-60 sequence. In some embodiments, the HSV-60 sequence sense strand has the following sequence (5' to 3') TAAGACACGATGCGATAAAATCTGTTTGTAAAATTTATTAAGGGTACAAATTGCCCTAGC (SEQ ID NO: 34). In some embodiments, the HSV-60 sequence antisense strand has the following sequence (5' to 3') GCTAGGGCAATTTGTACCCTTAATAAATTTTACAAACAGATTTTATCGCATCGTGTCTTA (SEQ ID NO: 35), as shown in Figure 62, with the 5' end of the sense strand conjugated to a diacyl lipid.

[0098] Amphiphilic poly-deoxyribonucleic acid The amphipathic poly-deoxyribonucleic acid comprises an albumin binding domain, for example, a nucleic acid chain conjugated to a lipid. In certain embodiments, the amphipathic poly-deoxyribonucleic acid is an albumin binding domain, for example, a poly-deoxyadenosine (AMP-dA) chain of a nucleic acid conjugated to a lipid. In certain embodiments, the amphipathic poly-deoxyribonucleic acid is an albumin binding domain, for example, a poly-deoxythymidine (AMP-dT) chain of a nucleic acid conjugated to a lipid. In certain embodiments, the amphipathic poly-deoxyribonucleic acid is an albumin binding domain, for example, a poly-deoxyguanosine (AMP-dG) chain of a nucleic acid conjugated to a lipid. In certain embodiments, the amphipathic poly-deoxyribonucleic acid is an albumin binding domain, for example, a poly-deoxycytosine (AMP-dC) chain of a nucleic acid conjugated to a lipid.

[0099] In some embodiments, the compounds described herein include both dA and dT nucleic acid sequences, or dG and dC, and an albumin binding domain (e.g., AMP-dA:dT, AMP-dT:dA, AMP-dG:dC, and AMP-dC:dG). dA and dT nucleic acid sequences can hybridize to form double-stranded DNA sequences (e.g., dA:dT and dT:dA). Similarly, dG and dC nucleic acid sequences can hybridize to form double-stranded DNA sequences (e.g., dG:dC and dC:dG). Examples of poly-dA and / or poly-dT compounds of the present disclosure are shown in Figure 1 and Figure 54. In some embodiments, the compounds described herein include a mixture of both dA and dT nucleic acid residues, or a mixture of dG and dC nucleic acid residues. For example, the compounds can include alternating dA and dT nucleic acid residues.

[0100] The length of the poly-dA nucleic acid sequence can comprise 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the poly-dA nucleic acid sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dA nucleic acid sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dA nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of the poly-dA nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the poly-dA nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Additionally, the present disclosure provides poly-dA single stranded DNA sequences comprising 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides.

[0101] The length of the poly-dT nucleic acid sequence can include 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the poly-dT nucleic acid sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dT nucleic acid sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dT nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of the poly-dT nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the poly-dT nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Additionally, the present disclosure provides poly-dT single stranded DNA sequences comprising 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides.

[0102] The length of both the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence can both comprise between 30 and 150 nucleotides (e.g., between 30 and 140, between 30 and 130, between 30 and 120, between 30 and 110, between 30 and 100, between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 150, between 50 and 150, between 60 and 150, between 70 and 150, between 80 and 150, between 90 and 150, between 100 and 150, between 110 and 150, between 120 and 150, between 130 and 150, and between 140 and 150 nucleotides). For example, the length of both the poly-dA and poly-dT nucleic acid sequences can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of both the poly-dA and poly-dT nucleic acid sequences can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of both the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of both the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence can be 30, 40, 50, 75, or 100 nucleotides. In some embodiments, the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence have the same number of nucleotides. Additionally, the present disclosure provides poly-dA and poly-dT double-stranded DNA sequences that comprise 30-100 (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100) nucleotides. In some embodiments, the poly-dA and poly-dT contain the same number of nucleotides.

[0103] The length of the poly-dG nucleic acid sequence may comprise 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the poly-dG nucleic acid sequence can be 30 to 100 nucleotides (e.g., 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, and 90 to 100 nucleotides). In some embodiments, the length of the poly-dG nucleic acid sequence can be 50 to 100 nucleotides (e.g., 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 70 to 100, 80 to 100, and 90 to 100 nucleotides). In some embodiments, the length of the poly-dG nucleic acid sequence can be 30 to 50 nucleotides (e.g., 30 to 45, 30 to 40, 30 to 35, 35 to 50, 40 to 50, and 45 to 50 nucleotides). In some embodiments, the length of the poly-dG nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the poly-dG nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Additionally, the present disclosure provides poly-dG single stranded DNA sequences comprising 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides.

[0104] The length of the poly-dC nucleic acid sequence can include 30-150 nucleotides (e.g., 30-140, 30-130, 30-120, 30-110, 30-100, 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-150, 50-150, 60-150, 70-150, 80-150, 90-150, 100-150, 110-150, 120-150, 130-150, and 140-150 nucleotides). For example, the length of the poly-dC nucleic acid sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dC nucleic acid sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dC nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of the poly-dC nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the poly-dC nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Additionally, the present disclosure provides poly-dC single stranded DNA sequences comprising 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides.

[0105] The length of both the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence can both comprise between 30 and 150 nucleotides (e.g., between 30 and 140, between 30 and 130, between 30 and 120, between 30 and 110, between 30 and 100, between 30 and 90, between 30 and 80, between 30 and 70, between 30 and 60, between 30 and 50, between 30 and 40, between 40 and 150, between 50 and 150, between 60 and 150, between 70 and 150, between 80 and 150, between 90 and 150, between 100 and 150, between 110 and 150, between 120 and 150, between 130 and 150, and between 140 and 150 nucleotides). For example, the length of both the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of both the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of both the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of both the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence can be 30, 40, 50, 75, or 100 nucleotides. In some embodiments, the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence have the same number of nucleotides. Additionally, the present disclosure provides poly-dG and poly-dC double-stranded DNA sequences that include 30-100 (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100) nucleotides. In some embodiments, the poly-dG and poly-dC contain the same number of nucleotides.

[0106] The length of the alternating poly-dA and poly-dT nucleic acid sequence can comprise 30 to 150 nucleotides (e.g., 30 to 140, 30 to 130, 30 to 120, 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, and 140 to 150 nucleotides). For example, the length of the poly-dA nucleic acid sequence can be 30-100 nucleotides (e.g., 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 50-100, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the alternating poly-dA and poly-dT nucleic acid sequence can be 50-100 nucleotides (e.g., 50-90, 50-80, 50-70, 50-60, 60-100, 70-100, 80-100, and 90-100 nucleotides). In some embodiments, the length of the poly-dA nucleic acid sequence can be 30-50 nucleotides (e.g., 30-45, 30-40, 30-35, 35-50, 40-50, and 45-50 nucleotides). In some embodiments, the length of the poly-dA nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides. In some embodiments, the length of the alternating poly-dA and poly-dT nucleic acid sequence can be 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Additionally, the present disclosure provides alternating poly-dA and poly-dT single stranded DNA sequences comprising 75-100 (e.g., 75-95, 75-90, 75-85, 75-80, 80-100, 85-100, 90-100, and 95-100) nucleotides.

[0107] In some embodiments, between 50% and 100% (e.g., between 50% and 90%, between 50% and 80%, between 50% and 70%, between 50% and 60%, between 60% and 100%, between 70% and 100%, between 80% and 100%, or between 90% and 100%) of the internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphorothioate linkages. In some embodiments, between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphodiester linkages and the remaining internucleotide groups connecting the nucleotides in the poly-dA and / or poly-dT nucleic acid sequences are phosphorothioate linkages. For example, one to five (e.g., one, two, three, four, or five) bonds at the 5' and / or 3' ends of a poly-dA and / or poly-dT nucleic acid sequence are phosphodiester bonds and all remaining bonds are phosphorothioate bonds, hi some embodiments, all of the internucleotide groups connecting the nucleotides in a poly-dA and / or poly-dT nucleic acid sequence are phosphorothioate bonds.

[0108] In some embodiments, between 50% and 100% (e.g., between 50% and 90%, between 50% and 80%, between 50% and 70%, between 50% and 60%, between 60% and 100%, between 70% and 100%, between 80% and 100%, or between 90% and 100%) of the internucleotide groups connecting the nucleotides in the poly-dG and / or poly-dC nucleic acid sequences are phosphorothioate linkages. In some embodiments, between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the internucleotide groups connecting the nucleotides in the poly-dG and / or poly-dC nucleic acid sequences are phosphodiester linkages, and the remaining internucleotide groups connecting the nucleotides in the poly-dG and / or poly-dC nucleic acid sequences are phosphorothioate linkages. For example, one to five (e.g., one, two, three, four, or five) bonds at the 5' and / or 3' ends of a poly-dG and / or poly-dC nucleic acid sequence are phosphodiester bonds and all remaining bonds are phosphorothioate bonds. In some embodiments, all of the internucleotide groups connecting the nucleotides in a poly-dG and / or poly-dC nucleic acid sequence are phosphorothioate bonds.

[0109] References herein to poly-deoxyribonucleic acid, and amphiphiles comprising poly-deoxyribonucleic acid, should be understood to include the pharma- ceutically acceptable salts thereof.

[0110] Lipids The compounds described herein include a poly-deoxyribonucleotide sequence, including poly-dA, poly-dT, poly-dG, and poly-dC, an ISD, or an immunostimulatory HSV sequence, and a lipid. In some embodiments, the lipid is attached to the 5' end of the poly-dA nucleic acid sequence. In some embodiments, the lipid is attached to the 5' end of the poly-dT nucleic acid sequence. In some embodiments, the lipid is attached to the 5' end of the poly-dG nucleic acid sequence. In some embodiments, the lipid is attached to the 5' end of the poly-dC nucleic acid sequence. In some embodiments, the lipid is attached to the 5' end of the ISD sequence. In some embodiments, the lipid is attached to the 5' end of the immunostimulatory HSV sequence. The lipid can be linear, branched, or cyclic.

[0111] Examples of preferred lipids include fatty acids having an aliphatic tail of 3 to 30 carbons, including, but not limited to, straight chain unsaturated and saturated fatty acids, branched saturated and unsaturated fatty acids, and fatty acid derivatives such as fatty acid esters, fatty acid amides, and fatty acid thioesters, diacyl lipids, cholesterol, cholesterol derivatives, and steroid acids such as bile acids, lipid A, or combinations thereof.

[0112] In certain embodiments, the lipid is a diacyl lipid or a two-tail lipid. In some embodiments, the tail of the diacyl lipid comprises about 12 to about 30 (e.g., 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) carbons. In some embodiments, the tail of the diacyl lipid comprises about 14 to about 25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24) carbons. In some embodiments, the tail of the diacyl lipid comprises about 16 to about 20 (e.g., 17, 18, or 19) carbons. In some embodiments, the diacyl lipid contains 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 carbons.

[0113] The carbon tail of the diacyl lipid can be saturated, unsaturated, or a combination thereof. The tail can be attached to the head group via an ester bond, an amide bond, a thioester bond, or a combination thereof. In certain embodiments, the diacyl lipid is a phospholipid, a glycolipid, a sphingolipid, or a combination thereof.

[0114] In some embodiments, the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE).

[0115] In some embodiments, the poly-dA nucleic acid sequence, poly-dT nucleic acid sequence, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequence is selected from the group consisting of the following lipids: [ka] or a salt thereof, or linked by a linker, where X is O or S. The poly-dA, poly-dT, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequence may be directly linked to the lipid. Alternatively, the poly-dA, poly-dT, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequence may be linked to the lipid via a linker.

[0116] References herein to lipids, and lipid-containing amphiphiles, should be understood to include pharma- ceutically acceptable salts thereof.

[0117] Linker In some embodiments, the compound comprises an albumin binding domain, e.g., poly-dA, poly-dT, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequence, linked by a linker to a lipid. The linker can be a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof. The linker can reduce or prevent the ability of the albumin binding domain to insert into the plasma membrane of a cell, e.g., a cell in a tissue adjacent to the injection site. The linker can also reduce or prevent the ability of the amphipathic poly-dA, amphipathic poly-dT, amphipathic poly-dG, or amphipathic poly-dC to nonspecifically associate with extracellular matrix proteins at the administration site. In order for the amphipathic poly-dA, amphipathic poly-dT, amphipathic poly-dG, or amphipathic poly-dC to be efficiently transported to lymph nodes, it should remain soluble. To enhance the solubility of amphipathic poly-dA, amphipathic poly-dT, amphipathic poly-dG, or amphipathic poly-dC, a polar block linker can be included between the poly-dA, poly-dT, poly-dG, or poly-dC and the albumin binding domain to which it is conjugated.

[0118] The length and composition of the linker can be adjusted based on the selected albumin binding domain and poly-dA, poly-dT, poly-dG, poly-dC, ISD, or HSV sequence. For example, in certain embodiments, the polynucleotide itself may be sufficiently polar to ensure solubility; for example, a polynucleotide that is 10, 15, 20 or more nucleotides long. Thus, in some embodiments, an additional linker is not required. However, in certain cases, it may be desirable to include a linker that mimics the effect of polar oligonucleotides. Linkers can be used as part of any of the albumin binding domain conjugates described herein, such as lipid-oligonucleotide conjugates and lipid-peptide conjugates that reduce cell membrane insertion / preferential partitioning onto albumin.

[0119] Suitable linkers include, but are not limited to, oligonucleotides comprising a series of nucleic acids, such as the oligonucleotides described above, hydrophilic polymers, such as, but not limited to, poly(ethylene glycol) (MW: 500 Da to 20,000 Da), polyacrylamide (MW: 500 Da to 20,000 Da), polyacrylic acid; a series of hydrophilic amino acids, such as serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine, histidine, or combinations thereof, polysaccharides, including, but not limited to, dextran (MW: 1,000 Da to 2 million Da), or combinations thereof. The hydrophobic albumin binding domain and the linker / CpG ODN are covalently linked. The covalent bond can be a non-cleavable bond or a cleavable bond. The non-cleavable bond can include an amide bond or a phosphate bond, and the cleavable bond can include a disulfide bond, an acid-cleavable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-cleavable bond.

[0120] In some embodiments, the linker is one or more ethylene glycol (EG) units, more preferably two or more EG units (i.e., polyethylene glycol (PEG)). For example, in some embodiments, the compound comprises poly-dA, poly-dT, poly-dG, or poly-dC and a hydrophobic albumin binding domain linked by a polyethylene glycol (PEG) molecule or a derivative or analog thereof.

[0121] In some embodiments, the compounds described herein comprise a poly-dA, poly-dT, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequence linked to a PEG which in turn is linked to a hydrophobic albumin binding domain, e.g., a lipid. The exact number of PEG units will depend on the albumin binding domain and cargo, but typically the linker can have about 1 to about 100, about 20 to about 80, about 30 to about 70, or about 40 to about 60 PEG units. In some embodiments, the number of PEG units is 24 to 50 units (e.g., 24 to 45, 24 to 40, 24 to 35, 24 to 30, 30 to 50, 35 to 50, 40 to 50, and 45 to 50 units). In some embodiments, the linker has about 45 to 55 PEG units. For example, in some embodiments, the linker has 48 PEG units. In some embodiments, the linker comprises a PEG24-amide-PEG24 linker.

[0122] As mentioned above, in some embodiments, the linker is an oligonucleotide comprising a series of nucleic acids. In some embodiments, the compounds described herein comprise poly-dA, poly-dT, poly-dG, poly-dC, ISD, or immunostimulatory HSV sequences linked to a series of nucleic acids that are in turn linked to a hydrophobic albumin binding domain, e.g., lipid. The linker can be any sequence, e.g., the sequence of the oligonucleotide can be a random sequence or a sequence specifically selected for its molecular or biochemical properties (e.g., highly polar). In some embodiments, the linker comprises a series of one or more of 20 consecutive adenines (A), cytosine (C), guanine (G), thymine (T), uracil (U), or analogs thereof. In some embodiments, the linker consists of a series of consecutive adenines (A), cytosine (C), guanine (G), thymine (T), uracil (U), or analogs thereof.

[0123] In some embodiments, the stretch of nucleic acid comprises 1 to 50 nucleic acid residues. In some embodiments, the stretch of nucleic acid comprises 5 to 30 nucleic acid residues. In some embodiments, the linker comprises one or more guanines, for example, 1 to 10 guanines.

[0124] In some embodiments, the linker is an oligonucleotide comprising a series of nucleic acids. In some embodiments, an amphipathic poly-dA, an amphipathic poly-dT, an amphipathic poly-dG, or an amphipathic poly-dC comprises poly-dA, poly-dT, poly-dG, or poly-dC linked to a series of amino acids that are in turn linked to a hydrophobic albumin binding domain, e.g., a lipid. The linker can have any amino acid sequence, e.g., the sequence of the oligonucleotide can be a random sequence or a sequence selected for its molecular or biochemical properties (e.g., high flexibility). In some embodiments, the linker comprises a series of glycine residues to form a polyglycine linker. In some embodiments, the linker comprises (Gly) nwhere n can be from 2 to 20 residues. Examples of polyglycine linkers include, but are not limited to, GGG, GGGA (SEQ ID NO: 1), GGGG (SEQ ID NO: 2), GGGAG (SEQ ID NO: 3), GGGAGG (SEQ ID NO: 4), GGGAGGG (SEQ ID NO: 5), GGAG (SEQ ID NO: 6), GGSG (SEQ ID NO: 7), AGGG (SEQ ID NO: 8), SGGG (SEQ ID NO: 9), GGAGGA (SEQ ID NO: 10), GGSGGS (SEQ ID NO: 11), GGAGGAGGA (SEQ ID NO: 12), GGSGGSGGS (SEQ ID NO: 13), GGAGGAGGAGGA (SEQ ID NO: 14), GGSGGSGGSGGS (SEQ ID NO: 15), GGAGGGAG (SEQ ID NO: 16), GGSGGGSG (SEQ ID NO: 17), GGAGGGAGGGAG (SEQ ID NO: 18), GGSGGGSGGGSG (SEQ ID NO: 19), GGGGAGGGGAGGGGA (SEQ ID NO: 20), and GGGGSGGGGSGGGGGS (SEQ ID NO: 21).

[0125] antigen In some embodiments, poly-dA and / or poly-dT conjugated to an albumin binding domain, poly-dG and / or poly-dC conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain are administered with an antigen. The antigen can be an antigenic protein or polypeptide, or a fragment thereof (e.g., an epitope), or a nucleotide encoding the antigen or a fragment thereof.

[0126] The antigen can be, for example, 2 to 100 amino acids (e.g., 2 to 90, 2 to 80, 2 to 70, 2 to 60, 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, or 90 to 100 amino acids), including 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, or 50 amino acids. In some embodiments, the peptide can be more than 50 amino acids. In some embodiments, the peptide can be more than 100 amino acids.

[0127] The protein or polypeptide can be any protein or peptide that is capable of inducing or increasing the ability of the immune system to generate antibody and T cell responses against the protein or peptide.

[0128] The antigen may be a peptide, protein, polysaccharide, sugar, lipid, nucleic acid, or combinations thereof. The antigen may be derived from a virus, bacteria, parasite, plant, protozoan, fungus, tissue, or transformed cell, e.g., cancer or leukemia cell, and may be the cell itself or its immunogenic components, e.g., cell wall components or its molecular components. Suitable antigens are known in the art and are available from commercial, governmental, and scientific sources. In one embodiment, the antigen is an inactivated or attenuated organism itself. These organisms may be infectious organisms, such as viruses, parasites, and bacteria. These organisms may also be tumor cells. The antigen may be a purified or partially purified polypeptide from a tumor or a viral or bacterial source. The antigen may be a recombinant polypeptide produced by expressing DNA encoding the polypeptide antigen in a heterologous expression system. The antigen may be DNA encoding all or part of the antigenic protein. The DNA may be in the form of a vector DNA, such as plasmid DNA.

[0129] Antigens may be provided as single antigens or in combination. Antigens may also be provided as complex mixtures of polypeptides or nucleic acids. Exemplary antigens are provided below.

[0130] Viral antigens Viral antigens may be isolated from any virus, including, but not limited to, viruses from any of the following viral families: Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Badnavirus, Barnaviridae, Birnaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Capillovirus, Carravirus, Cauliniovirus (CAVV), Cauliviridae, ... auliniovirus, Circoviridae, Closterovirus, Comoviridae, Coronaviridae (e.g., coronaviruses, e.g., Severe Acute Respiratory Syndrome (SARS) virus; e.g., SARS-CoV-2), Corticoviridae, Cystoviridae, Deltavirus, Dianthovirus, Enamovirus, Filoviridae (e.g., Marburg virus and Ebola virus (e.g., Zaire, Reston, IvoryViruses that are not identified include, but are not limited to, Hepatitis C virus, dengue virus type 1, dengue virus type 2, dengue virus type 3, and dengue virus type 4, Flaviviridae (e.g., Hepatitis C virus, dengue virus type 1, dengue virus type 2, dengue virus type 3, and dengue virus type 4), Hepadnaviridae, Herpesviridae (e.g., human herpesvirus types 1, 3, 4, 5, and 6, and cytomegalovirus), Hypoviridae, Iridoviridae, Leviviridae, Lipothrixviridae, Microviridae, Orthomyxoviridae ( For example, influenza viruses types A, B, and C), Papovaviridae, Paramyxoviridae (e.g., measles virus, mumps virus, and human respiratory syncytial virus), Parvoviridae, Picornaviridae (e.g., poliovirus, rhinovirus, hepatovirus, and aphthovirus), Poxviridae (e.g., vaccinia and smallpox virus), Reoviridae (e.g., rotavirus), Retroviridae (e.g., lentiviruses, e.g., human immunodeficiency virus (HIV) 1 and HIV 2), Rhabdoviridae (e.g., rabies virus, measles virus, respiratory syncytial virus, etc.), Togaviridae (e.g., rubella virus, dengue virus, etc.), and Totiviridae. Suitable viral antigens also include all or part of dengue protein M or protein E, dengue D1NS1, dengue D1NS2, and dengue D1NS3.

[0131] Viral antigens may be derived from specific strains, such as Papillomavirus, Herpesvirus, e.g., Herpes Simplex Types 1 and 2; Hepatitis viruses, such as Hepatitis A Virus (HAV), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Hepatitis Delta D Virus (HDV), Hepatitis E Virus (HEV), and Hepatitis G Virus (HGV), Tick-borne encephalitis virus; Parainfluenza, Varicella Zoster, Cytomegalovirus, Epstein-Barr, Rotavirus, Rhinovirus, Adenovirus, Coxsackievirus, Equine encephalitis, Japanese encephalitis, Yellow Fever, Rift Valley Fever, and Lymphocytic Choriomeningitis.

[0132] bacterial antigen Bacterial antigens include, but are not limited to, those of the genera Actinomyces, Anabaena, Bacillus, Bacteroides, Bdellovibrio, Bordetella, Borrelia, Campylobacter, Caulobacter, Chlamydia, Chlorobium, Chromatium, and the like. atium, Clostridium, Corynebacterium, Cytophaga, Deinococcus, Escherichia, Francisella, Halobacterium, Heliobacter, Haemophilus, Haemophilus influenzae type B (HIB), Hypomicrobium homicrobium, Legionella, Leptspirosis, Listeria, Meningococcus A, B and C, Methanobacterium, Micrococcus, Myobacterium, Mycoplasma, Myxococcus, Neisseria, Nitrobacter, Oscillobacterium, Oscillatoria, Prochloron, Proteus, Pseudomonas, Phodospirillum, Rickettsia, Salmonella, Shigella, Spirillum, Spirochaeta, Staphylococcus, Streptococcus,The bacteria may be from any bacteria, including Streptomyces, Sulfolobus, Thermoplasma, Thiobacillus, Treponema, Vibrio, and Yersinia.

[0133] Parasitic antigens Parasite antigens include parasites such as, but not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, Candida tropicalis, Nocardia asteroides, Rickettsia ricketsii, Rickettsia typhi, Mycoplasma pneumoniae, Chlamydial psittaci, Chlamydial trachomatis, Plasmodium falciparum, Trypanosoma brucei, and the like. Antigens may be derived from antigens derived from Entamoeba histolytica, Toxoplasma gondii, Trichomonas vaginalis and Schistosoma mansoni. These include sporozoan antigens, plasmodian antigens such as circumsporozoite proteins, sporozoite surface proteins, liver stage antigens, apical membrane associated proteins, or all or part of merozoite surface proteins.

[0134] Allergens and Environmental Antigens The antigen may be an allergen or environmental antigen, for example an antigen derived from a naturally occurring allergen such as, but not limited to, pollen allergens (tree, herb, weed, and grass pollen allergens), insect allergens (inhalant, saliva, and venom allergens), animal hair and dander allergens, and food allergens. Important pollen allergens from trees, herbs and herbs are from the taxonomic orders Fagales, Oleales, Pinales and Platanaceae, including birch (Betula), alder (Alnus), hazel (Corylus), hornbeam (Carpinus) and olive (Olea), cedars (Cryptomeria and Juniperus), sycamore (Platanus), among others. For example, from the order Poales, which includes the herbs of the genera Lolium, Phleum, Poa, Cynodon, Dactylis, Holcus, Phalaris, Secale, and Sorghum, from the orders Asterales and Urticales, which include especially the herbs of the genera Ambrosia, Artemisia, and Parietaria.Other allergen antigens that may be used include house dust mites of the genera Dermatophagoides and Euroglyphus, storage mites such as allergens from the genera Lepidoglyphys, Glycyphagus and Tyrophagus, cockroaches, small insects and fleas such as Blatella, Periplaneta, Midges, and other insects. These include allergens from the genera Chironomus and Ctenocepphalides, mammals such as cats, dogs and horses, allergens from birds, venom allergens including allergens from stinging insects such as those from the taxonomic order Hymenoptera, which includes bees (superfamily Apidae), hornets (superfamily Vespidae), and ants (superfamily Formicoidae). Still other allergen antigens that may be used may include inhalant allergens from fungi such as those of the genera Alternaria and Cladosporium.

[0135] Cancer antigens Cancer antigens are antigens that are typically preferentially expressed by cancer cells (i.e., expressed at higher levels in cancer cells than on non-cancerous cells), and in some cases, only by cancer cells. Cancer antigens can be expressed within or on the surface of cancer cells. Cancer antigens can be tumor-associated antigens. Cancer antigens can be MART-1 / Melan-A, gp100, adenosine deaminase binding protein (ADAbp), FAP, cyclophilin b, colorectal associated antigen (CRC)-0017-1A / GA733, carcinoembryonic antigen (CEA), CAP-1, CAP-2, etv6, AML1, prostate-specific antigen (PSA), PSA-1, PSA-2, PSA-3, prostate-specific membrane antigen (PSMA), T-cell receptor / CD3-zeta chain, and CD20.Cancer antigens are MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE -A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C 1, MAGE-C2, MAGE-C3, MAGE-C4, MAGE-05), GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9, BAGE, RAGE, LAGE-1, NAG, GnT-V, MUM-1, CDK4, tyrosinase, p53, MUC family, HER2 / neu, p The antigen may be selected from the group consisting of 21ras, RCAS1, alpha-fetoprotein, E-cadherin, alpha-catenin, beta-catenin, gamma-catenin, p120ctn, gp100Pmel117, PRAME, NY-ESO-1, cdc27, adenomatous polyposis coli protein (APC), fodrin, connexin 37, Ig-idiotype, p15, gp75, GM2 ganglioside, GD2 ganglioside, human papillomavirus protein, Smad family of tumor antigens, Imp-1, P1A, EBV-encoded nuclear antigen (EBNA)-1, brain-type glycogen phosphorylase, SSX-1, SSX-2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1 and CT-7, CD20, or c-erbB-2.

[0136] Adjuvants In some embodiments, the pharmaceutical compositions described herein can be administered with one or more adjuvants. An adjuvant refers to a substance that causes stimulation of the immune system. In this context, an adjuvant is used to enhance the immune response to one or more antigens. The adjuvant can be administered to the subject before, in combination with, or after administration of the antigen. In some embodiments, an additional adjuvant is administered to the subject in combination with poly-dA and / or poly-dT conjugated to an albumin binding domain, poly-dG and / or poly-dC conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain and an antigen, or a nucleic acid sequence encoding the same, as described herein. In some embodiments, the adjuvant can be conjugated to an albumin binding domain, e.g., a lipid.Adjuvants include, but are not limited to, lipids (e.g., monophosphoryl lipid A (MPLA)), alum (e.g., aluminum hydroxide, aluminum phosphate); Freund's adjuvant; saponins purified from the bark of the Q. saponaria tree, e.g., QS21 (a glycolipid eluting in the 21st peak by HPLC fractionation; Antigenics, Inc., Worcester, Mass.); poly[di(carboxylatophenoxy)phosphazene] (PCPP polymer; Virus Research Institute, USA), Flt3 ligand, Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.), ISCOMS (immunostimulating complexes containing mixed saponins, lipids, forming virus-sized particles with pores capable of retaining antigens; CSL, Melbourne, Australia), Pam3Cys, SB-AS4 (a SmithKline adjuvant containing alum and MPL), Adjuvant systems may include, but are not limited to, micelle-forming non-ionic block copolymers such as Beecham adjuvant system #4; SBB, Belgium), CRL1005 (which contain linear chains of hydrophobic polyoxypropylene flanked by chains of polyoxyethylene) (Vaxcel, Inc., Norcross, Ga), and Montanide IMS (e.g., IMS 1312, an aqueous nanoparticle combined with the soluble immunostimulant Seppic), and CDNs (cyclic di-nucleotides).

[0137] The adjuvant may be a toll-like receptor (TLR) ligand. Adjuvants acting through TLR3 include, but are not limited to, double-stranded RNA. Adjuvants acting through TLR4 include, but are not limited to, derivatives of lipopolysaccharide, such as monophosphoryl lipid A (MPLA; Ribi ImmunoChem Research, Inc. Hamilton, Mont.) and muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland). Adjuvants acting through TLR5 include, but are not limited to, flagellin. Adjuvants acting through TLR7 and / or TLR8 include synthetic low molecular weight compounds such as single-stranded RNA, oligoribonucleotides (ORNs), imidazoquinoline amines (e.g., imiquimod (R-837), resiquimod (R-848)). Adjuvants 5 acting through TLR9 include DNA of viral or bacterial origin, or synthetic oligodeoxynucleotides (ODNs), such as CpG ODNs. Another class of adjuvants are phosphorothioate-containing molecules, such as phosphorothioate nucleotide analogs and nucleic acids containing phosphorothioate backbone linkages.

[0138] Pharmaceutical Compositions Described herein are pharmaceutical compositions of the disclosure comprising any one of the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain described herein, and an antigen, or a nucleic acid sequence encoding an antigen. In addition to a therapeutic amount of the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain and antigens, or nucleic acid sequences encoding antigens, as described herein, the pharmaceutical composition may contain a pharma- ceutically acceptable carrier or excipient, which may be formulated by methods known to those of skill in the art. Pharmaceutically acceptable salts of the components, as described herein, are also included. In other embodiments, the pharmaceutical composition of the invention may contain a nucleic acid molecule encoding one or more antigens described herein (e.g., in a vector, such as a viral vector). The nucleic acid molecule encoding the antigen described herein may be cloned into a suitable expression vector that can be delivered via methods well known in gene therapy. The antigen may be an influenza antigen, or a fragment thereof. For example, the antigen may be an influenza nucleoprotein, or a fragment thereof. In particular, the influenza nucleoprotein may be [ka] The polypeptide may comprise a polypeptide sequence having at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to

[0139] The influenza nucleoprotein can comprise a polypeptide sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO: 22. In some embodiments, the influenza nucleoprotein has the polypeptide sequence of SEQ ID NO: 22, or a fragment thereof. The antigen can be a coronavirus antigen, or a fragment thereof. For example, the antigen can be a coronavirus spike protein, or a fragment thereof.

[0140] Acceptable carriers and excipients in pharmaceutical compositions of poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and antigens, or nucleic acid sequences encoding antigens, described herein, are non-toxic to recipients at the dosages and concentrations used. In certain embodiments, the formulation material is for subcutaneous (sc) and / or intravenous (iv) administration. In some embodiments, administration is by inhalation or intranasal administration. In some embodiments, the formulation material is administered intraperitoneally, topically, or orally. In some embodiments, the pharmaceutical composition can include formulation materials to modify, maintain, or preserve, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, adsorption or penetration of the composition.In some embodiments, suitable formulation materials include, but are not limited to, amino acids (e.g., glycine, glutamine, asparagine, arginine, or lysine); antimicrobial agents; antioxidants (e.g., ascorbic acid, methionine, sodium sulfite, or sodium bisulfite); buffers (e.g., borate, bicarbonate, Tris-HCl, citrate, HEPES, TAE, phosphate, or other organic acids); bulking agents (mannitol, glycine, etc.); chelating agents (such as ethylenediaminetetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, or hydroxypropyl-β-cyclodextrin); bulking agents; monosaccharides; disaccharides; and other carbohydrates (such as glucose, sucrose mannose, or dextrin); proteins (e.g., human serum albumin, gelatin, dextran, and immunoglobulins); colorants, flavoring agents, and diluents; emulsifiers; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions ( sodium and the like); preservatives (e.g., hexamethonium chloride, octadecyldimethylbenzylammonium chloride, resorcinol, and benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (e.g., glycerin, propylene glycol or polyethylene glycol); sugar alcohols (e.g., mannitol or sorbitol); suspending agents; surfactants or wetting agents (e.g., pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapear); stability enhancing agents (e.g., sucrose or sorbitol); isotonicity agents (e.g., alkali metal halides, preferably sodium chloride or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants (Remington's Pharmaceutical Sciences, 18th Edition, A. R. Gennaro, ed., Mack Publishing Company (1995).In some embodiments, optimal pharmaceutical compositions are determined by one of skill in the art depending, for example, on the intended route of administration, delivery mode, and desired dosage. See, e.g., Remington's Pharmaceutical Sciences, supra. In some embodiments, such compositions can affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the amphiphilic conjugate.

[0141] In some embodiments, the primary vehicle or carrier in a pharmaceutical composition comprising a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, as described herein, and an antigen or a nucleic acid sequence encoding an antigen, may be either aqueous or non-aqueous in nature. For example, in some embodiments, a suitable vehicle or carrier may be water for injection, saline, or artificial cerebrospinal fluid, but may be supplemented with other materials common in compositions for parenteral administration. In some embodiments, the saline comprises isotonic phosphate buffered saline. In certain embodiments, neutral buffered saline or saline mixed with serum albumin is further exemplary vehicle. In some embodiments, the pharmaceutical composition comprises a Tris buffer of about pH 7.0-8.5 or an acetate buffer of about pH 4.0-5.5, and thus may further comprise sorbitol or a suitable substitute. In some embodiments, compositions comprising poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, as described herein, and an antigen, or a nucleic acid sequence encoding an antigen, can be prepared for storage by mixing a selected composition having the desired purity with any compounding agent in the form of a lyophilized cake or aqueous solution (Remington's Pharmaceutical Sciences, supra).Furthermore, in some embodiments, the compositions described herein poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain and antigens, or nucleic acid sequences encoding antigens, can be formulated as a lyophilizate using appropriate excipients, such as sucrose.

[0142] In some embodiments, the pharmaceutical compositions may be selected for parenteral delivery. The preparation of such pharma- ceutically acceptable compositions is within the capabilities of those skilled in the art.

[0143] In some embodiments, the formulation components are present in concentrations that are acceptable to the site of administration. In some embodiments, a buffering agent is used to maintain the composition at physiological pH or a slightly lower pH, typically within a pH range of about 5 to about 8.

[0144] In some embodiments, where parenteral administration is contemplated, the therapeutic composition may be in the form of a pyrogen-free, parenterally acceptable aqueous solution comprising a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and an antigen, or a nucleic acid sequence encoding an antigen, in a pharma- ceutically acceptable vehicle. In some embodiments, the vehicle for parenteral injection is sterile distilled water in which the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and the antigen or nucleic acid sequence encoding the antigen are formulated as a sterile, isotonic solution, appropriately preserved. In some embodiments, the preparation can include formulating the desired molecule with agents such as injectable microspheres, bioerodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads, or liposomes, which can provide controlled or sustained release of the product, and can then be delivered via depot injection. In some embodiments, hyaluronic acid can also be used, which can have the effect of promoting duration in the circulation. In some embodiments, an implantable drug delivery device can be used to introduce the desired molecule.

[0145] The pharmaceutical composition can be administered in a therapeutically effective amount, for example, to induce an immune response. The therapeutically effective amount of the poly-dA and / or poly-dT nucleic acid sequence, poly-dG and / or poly-dC nucleic acid sequence, poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain and antigen, or nucleic acid sequence encoding an antigen, contained in the pharmaceutical preparation can be determined by one skilled in the art such that the dosage (e.g., a dose in the range of 0.01 to 100 mg / kg body weight) induces an immune response in the subject.

[0146] Vectors can be used in in vivo nucleic acid delivery vehicles, including, but not limited to, retroviral vectors, adenoviral vectors, poxvirus vectors (e.g., vaccinia virus vectors, e.g., Modified Vaccinia Ankara (MVA)), adeno-associated virus vectors, and alphavirus vectors. In some embodiments, the vectors can contain an internal ribosome entry site (IRES) that allows for expression of multiple coronavirus antigens described herein (e.g., coronavirus spike proteins, peptides thereof, or nucleic acid sequences encoding same). Other vehicles and methods for nucleic acid delivery are described in U.S. Patent Nos. 5,972,707, 5,697,901, and 6,261,554, each of which is incorporated herein by reference in its entirety. Other methods of preparing pharmaceutical compositions are described, for example, in U.S. Pat. Nos. 5,478,925, 8,603,778, 7,662,367, and 7,892,558, all of which are incorporated by reference herein in their entireties.

[0147] In some embodiments, the pharmaceutical compositions described herein can be administered with one or more adjuvants.

[0148] Route, dosage, and timing of administration The pharmaceutical compositions of the present disclosure containing the poly-dA and / or poly-dT, poly-dG and / or poly-dC, poly-dA and / or poly-dT conjugated to an albumin binding domain, poly-dG and / or poly-dC, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain as described herein and an antigen or a nucleic acid sequence encoding an antigen as a therapeutic agent can be formulated for parenteral, subcutaneous, intravenous, intramuscular, intranasal, or inhalation administration. Methods of administering therapeutic proteins are known in the art. See, e.g., U.S. Pat. Nos. 6,174,529, 6,613,332, 8,518,869, 7,402,155, and 6,591,129, as well as U.S. Patent Application Publication No. 20140051634, WO 1993000077, and U.S. Patent Application Publication No. 20110184145, the disclosures of which are incorporated by reference in their entireties.

[0149] One or more of these methods can be used to administer the pharmaceutical compositions of the present invention containing poly-dA and / or poly-dT-amphiphiles, poly-dG and / or poly-dC amphiphiles, poly-dA and / or poly-dT sequences, poly-dG and / or poly-dC sequences, or ISDs or immunostimulatory sequences conjugated to albumin binding domains, and antigens (e.g., coronavirus antigens, e.g., coronavirus spike proteins, peptides thereof, or nucleic acid sequences encoding same, or influenza virus antigens). For injectable formulations, a variety of effective pharmaceutical carriers are known in the art. See, for example, Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, Pa., Banker and Chalmers, eds., pp. 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pp. 622-630 (1986). The dosage of the pharmaceutical composition of the present invention depends on factors including the route of administration and the physical characteristics of the subject, such as age, weight, and general health. Typically, the amount of poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain and antigens, or nucleic acid sequences encoding antigens, contained within a single dose may be an amount that effectively induces an immune response in the subject without inducing significant toxicity.The pharmaceutical composition of the present invention may comprise a dosage ranging from 0.001 to 500 mg (e.g., 0.01, 0.05, 0.1, 0.2, 0.3, 0.5, 0.7, 0.8, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 50 mg, 100 mg, 250 mg, or 500 mg), and in more specific embodiments, from about 0.1 to about 100 mg of the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and antigens, or nucleic acid sequences encoding antigens, as described herein. The dosage can be adjusted by the clinician according to different parameters of the subject.

[0150] Pharmaceutical compositions of the invention containing poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain as described herein, and an antigen, or a nucleic acid sequence encoding an antigen, can be administered to a subject in need thereof, for example, daily, weekly, monthly, semi-annually, yearly or more than once (e.g., 1 to 10 times or more), or as medically necessary.

[0151] In some embodiments, influenza nucleoprotein is administered to the subject. In some embodiments, mRNA encoding a coronavirus antigen (e.g., a coronavirus spike protein, a peptide thereof, or a nucleic acid sequence encoding same) is administered to the subject. In some embodiments, the antigen and poly-dA and / or poly-dT nucleic acid sequence, poly-dG and / or poly-dC nucleic acid sequence, poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain are administered to the subject simultaneously or essentially simultaneously. The poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and the antigen can be co-formulated, or they can be administered as two separate formulations. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and the antigen, or nucleic acid sequences encoding the antigens, described herein, are administered sequentially.For example, a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain can be administered first and the antigen, or a nucleic acid sequence encoding it, can be administered second, or in some embodiments, the antigen, or a nucleic acid sequence encoding it can be administered first and a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain can be administered second. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, poly-dG and / or poly-dC nucleic acid sequence, poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain and an antigen, or a nucleic acid sequence encoding an antigen, is administered with a second adjuvant.

[0152] Methods for inducing an immune response The present disclosure provides a method of inducing an immune response to an antigen in a subject, the method comprising administering to the subject any one of the compounds described herein and the antigen.

[0153] In some embodiments, the present disclosure provides a method of inducing an immune response in a subject against an antigen by administering to the subject any one of the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain described herein and an antigen, and further administering an adjuvant to the subject. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain can be administered without one or more additional adjuvants.

[0154] In some embodiments, the method comprises administering to the subject 1) a therapeutically effective amount of a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, as described herein, and 2) an antigen or a nucleic acid sequence encoding same. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the antigen are administered substantially simultaneously. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, poly-dG and / or poly-dC nucleic acid sequence, poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the antigen are administered separately. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, poly-dG and / or poly-dC nucleic acid sequence, poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, is administered first, followed by the antigen.In some embodiments, the antigen is administered first, followed by the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain.

[0155] In some embodiments, the antigen is an influenza antigen, or a fragment thereof. In some embodiments, the antigen is an influenza nucleoprotein, or a fragment thereof. In some embodiments, the influenza nucleoprotein comprises a polypeptide sequence having at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22. In some embodiments, the influenza nucleoprotein comprises a polypeptide sequence having at least 95% (e.g., at least 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO:22. In some embodiments, the influenza nucleoprotein comprises the polypeptide sequence of SEQ ID NO:22. In some embodiments, the antigen is a coronavirus antigen, or a fragment thereof. For example, the antigen is a coronavirus spike protein, or a fragment thereof, or a coronavirus nucleocapsid protein, or a fragment thereof.

[0156] In some embodiments, one or more of the administered components is a pharma- ceutically acceptable salt of the indicated component as described herein.

[0157] In some embodiments, the immune response is protective against infection. For example, the immune response can be protective against influenza infection or SARS-CoV-2 infection.

[0158] In some embodiments, the immune response is protective against Covid-19 disease.

[0159] In some embodiments, the disclosure provides a method of inducing an immune response to an antigen in a subject by subcutaneously administering to the subject any one of the compounds or pharma- ceutically acceptable salts described herein. In some embodiments, the disclosure provides a method of inducing an immune response to an antigen in a subject by intramuscularly, subcutaneously, intravenously, intraperitoneally, topically, or orally administering to the subject the antigen.

[0160] In some embodiments, the subject is a mammal, for example, the subject can be a human.

[0161] kit The kit may include a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, or a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain as disclosed herein, an antigen or a nucleic acid encoding an antigen, and instructions for use. The kit may also include an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain as disclosed herein, an antigen or a nucleic acid encoding an antigen, and instructions for use. The kits may include, in suitable containers, poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, an antigen or a nucleic acid encoding an antigen, one or more controls, as well as various buffers, reagents, enzymes and other standard components known in the art. In some embodiments, the kits further include an adjuvant. Thus, in some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the antigen, or the nucleic acid encoding the antigen, are in the same vial. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the antigen, or the nucleic acid encoding the antigen, are in separate vials.Further, in some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the adjuvant are in the same vial. In some embodiments, the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, and the adjuvant are in separate vials. In some embodiments, the antigen, or the nucleic acid encoding the antigen, and the adjuvant are in the same vial. In some embodiments, the antigen, or nucleic acid encoding the antigen, and the adjuvant are in separate vials.

[0162] The container may comprise at least one vial, well, test tube, flask, bottle, syringe or other container means into which may be placed, optionally appropriately aliquoted, a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain. Where additional components are provided, the kit may comprise additional containers into which the compounds may be placed. The kit may also include a means for containing the poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, antigens or nucleic acids encoding antigens, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained. The containers and / or kits may include labels with instructions and / or warnings.

[0163] In some embodiments, the disclosure provides a medicament comprising a composition comprising a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, an antigen or a nucleic acid encoding an antigen, and optionally a pharma- ceutical acceptable carrier, the medicament alone or in combination with a composition comprising an adjuvant and optionally a pharma- ceutical acceptable carrier. and a package insert containing instructions for administration to treat, delay the progression of, or prevent a disease or condition (e.g., influenza or SARS-CoV-2), comprising poly-dA and / or poly-dT nucleic acid sequences, poly-dG and / or poly-dC nucleic acid sequences, poly-dA and / or poly-dT nucleic acid sequences conjugated to an albumin binding domain, poly-dG and / or poly-dC nucleic acid sequences conjugated to an albumin binding domain, or ISD or immunostimulatory HSV sequences conjugated to an albumin binding domain, and an optional linker. In some embodiments, the antigen may be an influenza antigen, or a fragment thereof. In some embodiments, the antigen may be an influenza nucleoprotein, or a fragment thereof. In some embodiments, the antigen may be a coronavirus antigen, or a fragment thereof.

[0164] In some embodiments, the disclosure provides a kit comprising a container containing a composition comprising a poly-dA and / or poly-dT nucleic acid sequence, a poly-dG and / or poly-dC nucleic acid sequence, a poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, a poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or an ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain, an antigen or a nucleic acid encoding an antigen, and optionally a pharma- ceutically acceptable carrier, and a package insert comprising instructions for administration of the composition vaccine in a subject, wherein the poly-dA and / or poly-dT nucleic acid sequence, the poly-dG and / or poly-dC nucleic acid sequence, the poly-dA and / or poly-dT nucleic acid sequence conjugated to an albumin binding domain, the poly-dG and / or poly-dC nucleic acid sequence conjugated to an albumin binding domain, or the ISD or immunostimulatory HSV sequence conjugated to an albumin binding domain optionally comprises a linker. In some embodiments, the kit further comprises an adjuvant and instructions for administration of the adjuvant.

[0165] In some embodiments of the kit, one or more of the components of the kit is a pharma- ceutically acceptable salt of the components described herein. EXAMPLES

[0166] The following examples are intended to be illustrative rather than limiting, and the disclosure is presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated. The examples are intended to be purely illustrative of the disclosure, and are not intended to limit the scope of what the inventors regard as their invention.

[0167] Example 1. Evaluation of the activity of single-stranded versus double-stranded amphipathic DNA The effect of single-stranded versus double-stranded DNA dAdT constructs on immune responses was determined.

[0168] Eleven groups of five C57BL-6J mice each were administered a vaccine having the components listed in Table 1.

[0169] [Table 1]

[0170] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The amphipathic and soluble dAdT was resuspended in 0 and the final injection was diluted with 1x phosphate buffered saline (PBS) so that the amphipathic and soluble dAdT had a concentration of 5 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was dissolved in PBS at a concentration of 0.88 mg / ml and the final injection was diluted with 1x PBS to a concentration of 5 μg / 100 μL injection. Solutions were prepared with the vaccine components listed in Table 2.

[0171] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides, with booster doses given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage, and biweekly injections were determined to be optimal for immune response.

[0172] [Table 2]

[0173] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dose 2 (Figures 3A-3B and 4). ICS was also performed on lung samples 7 days after dose 2 (Figures 5A, 5B, 6A-6J, 7A, and 7B). Cells were surface stained for CD4, CD8, and CD3. Antibodies listed in Table 3 were used for the ICS assays. ICS samples were activated overnight with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 4) (in the presence of brefeldin A and monensin).

[0174] [Table 3]

[0175] [Table 4]

[0176] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2. Splenocytes (0.1 × 10 6 Cells / well) were activated with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix (Table 4) and IFNy plate stimulated overnight (Figures 2A and 2B). In separate experiments, cells were restimulated with four different peptide pools: 1) those listed in Table 4 (restimulation), 2) a custom-made peptide pool made by GenScript identical to those above, 3) a custom-made peptide pool made by GenScript with the corresponding mutations of the UK variant B.1.1.7, and 4) a custom-made peptide pool made by GenScript with the corresponding mutations of the South Africa variant B.1.351.

[0177] We evaluated a new restimulation peptide pool for the SARS-CoV2 spike RBD that was custom made for the purpose of being able to substitute single 15-mer peptides to match different CoV2 strains. The custom pool for the WT strain produced the same results as the commercial pool from GenScript. Furthermore, there was no difference in T cell responses between the different peptide pools. This indicated that the T cell responses were not affected by the various mutations between the tested strains.

[0178] Tetramer analysis was performed 7 days after administration using H-2Kb CoV2 RBD tetramer-VNFNFNGL-PE (NIH 53309; SEQ ID NO: 25) (Figures 3C and 3D).

[0179] Compared to other adjuvants, AMP-dT appeared to be the most immunogenic. CD8 responses measured by tetramer were already detectable after administration of dose 1 of the vaccine. ICS data after dose 2 from peripheral blood also showed that AMP-dT induced a robust T cell response with 85% of CD8 cells and 5% of CD4 cells positive for TNFα and IFNy cytokines. This also exceeded the immune response of AMP-dAdT, which resulted in 65% of CD8 cells and 1.2% of CD4 cells positive for TNFα and IFNy cytokines. The same trend was seen in ICS data from lung lymphocytes and ELISpot data from splenocytes. Serum antibody ELISA data showed that AMP-dT, followed by AMP-dAdT, generated the greatest antibody response.

[0180] Example 2. Evaluation of lymph node accumulation of double-stranded amphipathic DNA The biodistribution of AMP-dAdT, its efficiency in entering lymph nodes, and its retention in lymph nodes were determined.

[0181] Four groups of 10 C57BL-6J mice each were administered vaccines containing 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of AMP-dT and FAM-dA, 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of dT and FAM-dA, 5 μg of SARS-CoV-2 RBD antigen and 5 nmol of AMP-dT and dA, or PBS, as described in Table 5. Lymph nodes and spleens of five mice were imaged 1 and 2 days later, respectively.

[0182] [Table 5]

[0183] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2The SARS-CoV2 spike S1 RBD protein stock solution was dissolved in PBS at a concentration of 0.88 mg / ml, and the final injection was diluted with 1× PBS to a concentration of 5 μg / 100 μL injection. Solutions were prepared with the vaccine components listed in Table 6.

[0184] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. SC injection ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage.

[0185] [Table 6]

[0186] IVIS imaging was performed 24 and 48 hours after injection. Inguinal and accessory lymph nodes were harvested and imaged from 5 animals per time point. Lymph nodes were kept moist with PBS while imaging. Total radiative efficiency in lymph nodes was measured (Figures 8A and 8B).

[0187] Flow cytometry analysis was performed on lymph nodes after IVIS imaging. Lymph nodes were processed and analyzed for T cells: CD3 + CD19 - CD11b - , B cells: CD3 - CD19 + CD11c - CD11b low&+ , and Pan mDC:CD3 - CD19 - CD11c + CD11b + MHCII +We stained for cell surface markers that distinguish DC, MΦ, and B cells, including FAM, which is seen across cell lineages for T cells, macrophages, and dendritic cells at 24 and 48 hours. + The percentages are summarized in FIG.

[0188] [Table 7]

[0189] This experiment shows that amphipathic and soluble adjuvants of such size (approximately 32 kDa) are delivered to and retained in lymph nodes to a similar extent. Despite this, historically, we have shown that amphipathic adjuvants have achieved significantly greater immune responses than soluble adjuvants, indicating an additional pathway by which AMP modification promotes the generation of an immune response.

[0190] Example 3. Evaluation of the contribution of length to the activity of double-stranded amphipathic DNA The effect of construct length of the dAdT complex on the immune response was determined.

[0191] Eleven groups of five C57BL-6J mice each were administered vaccines containing the components listed in Table 8.

[0192] [Table 8]

[0193] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was resuspended in 0 and the final injections were diluted with 1x phosphate buffered saline (PBS) such that the various lengths of AMP-dAdTs and soluble dAdTs had a concentration of 5 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was dissolved in PBS at a concentration of 0.88 mg / ml. The final injections were diluted with 1x PBS to a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 9.

[0194] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage, and biweekly injections were determined to be optimal for immune response.

[0195] [Table 9]

[0196] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing. ICS was also performed on lung samples 7 days after dose 2 (Figures 11A, 11B, 12A, and 12B). Cells were also surface stained for CD4, CD8, and CD3 using the antibodies listed in Table 10. ICS samples were activated overnight with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 11) (in the presence of brefeldin A and monensin).

[0197] [Table 10]

[0198] [Table 11]

[0199] ELISpot analysis for IFNγ was performed on splenocytes after dose 2 administration (Figures 10A and 10B). Splenocytes (0.25 x 10 6 Cells / well) were activated with 1 μg / well of peptide pool mix (Table 11). IFNy plates were stimulated overnight.

[0200] A SARS-CoV2 specific serum ELISA (enzyme-linked immunosorbent assay) was performed on mouse serum 7 days after each dose to detect any RBD-specific antibody response (Figures 13A and 13B). Whole blood was collected and then centrifuged using Ser-gel tubes (NC9436363, Fisher Scientific). Serum was used fresh or stored at -80°C until use. 96-well plates were coated with 200ng / 100μL (2μg / ml) CoV2 RBD protein (Z03483, GenScript) and left overnight at 4°C. Plates were then preblocked with 2% BSA for 2 hours at room temperature. Mouse serum was then diluted up to 1:20 and then serially diluted (1:5→8 concentrations) in dummy plates. ELISA plates were washed once with ELISA wash buffer (BioLegend 4211601). Samples were transferred to the ELISA plates and incubated at room temperature for 2 hours. The plates were washed 4 times with wash buffer. For serum antibody detection, the secondary HRP-conjugated antibodies in Table 12 were used at 1:2000 in PBS+, incubated for 1 hour at room temperature, and the plates were washed 4 times with wash buffer. The reaction was visualized by addition of the substrate 3,3',5,5'-tetramethylbenzidine (TMB) for 10 minutes at room temperature and stopped with H2SO4 (1N). The absorbance at 450 nm was measured by an ELISA plate reader.

[0201] [Table 12]

[0202] For amphipathic adjuvants, T cells showed the highest response when the adjuvant was either 100 or 75 nucleotides long, followed by the adjuvant with 50 nucleotides, then the adjuvant with 40 nucleotides, then the adjuvant with 30 nucleotides. For soluble adjuvants, T cells showed the highest response when the adjuvant was 100 or 75 nucleotides long, followed by the adjuvant with 50, 40, or 30 nucleotides long. At shorter lengths, including 30, 40, and 50 nucleotides, the amphipathic adjuvants generated greater T cell responses compared to their soluble counterparts. At longer lengths, including 75 and 100 nucleotides, the amphipathic adjuvants and the soluble adjuvants generated similar T cell responses.

[0203] Amphipathic adjuvants of all lengths induced similar antibody responses. Soluble adjuvants with lengths of 40, 50, 75, or 100 nucleotides induced similar antibody responses, while the 30 nucleotide soluble adjuvant was inactive. In summary, the amphipathic adjuvants induced greater antibody responses than their soluble counterparts.

[0204] Based on the ICS and ELISpot results, AMP modification of the dAdT construct was beneficial in eliciting immune responses. In particular, when probing responses in the lung, the AMP tail allowed smaller constructs to robustly elicit immune responses. Furthermore, AMP increased the responses elicited by dAdT compared to soluble dAdT.

[0205] Example 4. Evaluation of the activity of phosphorothioate versus phosphodiester double-stranded DNA The effect of phosphodiester (PO) versus phosphorothioate (PS) in double-stranded DNA constructs on immune responses was determined.

[0206] Nine groups of five C57BL-6J mice each were administered vaccines containing the components listed in Table 13.

[0207] [Table 13]

[0208] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was resuspended in 0 and the final injection diluted in 1× phosphate buffered saline (PBS) such that the AMP-dAdT and soluble dAdT of the PO and PS variations had a concentration of 5 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was dissolved in PBS at a concentration of 0.88 mg / ml. The final injection was diluted in 1× PBS to a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 14.

[0209] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage, and biweekly injections were determined to be optimal for immune response.

[0210] [Table 14]

[0211] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing (Figures 15A and 15B). ICS was also performed on lung samples 7 days after dose 2 (Figures 16A, 16B, 17A, and 17B). Cells were surface stained for CD4, CD8, and CD3 using antibodies from Table 15. ICS samples were activated overnight with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 16) (in the presence of brefeldin A and monensin).

[0212] [Table 15]

[0213] [Table 16]

[0214] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Figures 14A and 14B). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / well of peptide pool mix (Table 16). IFNy plates were stimulated overnight. For serum antibody detection, secondary HRP-conjugated antibodies from Table 17 were used.

[0215] [Table 17]

[0216] When generating DNA-based adjuvants, it was important to use a phosphorothioate (PS) backbone, since the naturally occurring linkage between nucleic acids, phosphodiester (PO), has a fairly low adjuvanticity. This may be because naturally occurring DNA can be more easily degraded by endogenous endonucleases. Maximal T cell responses were measured for AMP-dAdT and AMP-ISD adjuvants, as measured by ELISpot on splenocytes and ICS on lung lymphocytes and peripheral blood cells. Both CD8 and CD4 responses were detected.

[0217] Example 5. Induction of influenza-specific T cell proliferation Amphipathic adjuvants, including amphipathic CpG7909 and amphipathic poly-dT, were administered in combination with influenza A nucleoprotein antigen to elicit an immune response. The immune responses elicited as a result of administration of AMP-CpG and AMP-dT were compared to their soluble counterparts and benchmarked against administration of alum.

[0218] Six groups of five C57BL-6J mice each were administered vaccines on day 0 containing 10 μg influenza NP antigen and 5 nmol AMP-CpG, 10 μg influenza NP antigen and 5 nmol soluble CpG, 10 μg influenza NP antigen and 100 μg alhydrogel, 10 μg influenza NP antigen and 5 nmol AMP-dT50 nucleotide length, 10 μg influenza NP antigen and 5 nmol dT50 nucleotide length, or AMP-CpG alone, as described in Table 18. Immune agents were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side, bilaterally. Booster doses were given approximately two weeks apart on days 14 and 28. SC injection ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage, and biweekly injections were determined to be optimal in generating an immune response.

[0219] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The final injections were diluted with 1× phosphate buffered saline (PBS) so that AMP-CpG and soluble CpG had a concentration of 5 nmol / 100 μL injection, AMP-dT and soluble dT had a concentration of 5 nmol / 100 μL injection, and alum had a concentration of 100 μg / 100 μL injection. Influenza A H1N1 (A / Puerto Rico / 8 / 34 / Mount Sinai) nucleoprotein (I116M) stock solution was added to the LAL H 2 The vaccine was dissolved in 0.5% PBS at a concentration of 0.25 mg / ml. The final injection was diluted with 1×PBS to give a concentration of 10 μg / 100 μL injection. The components used in the vaccine are listed in Table 19.

[0220] [Table 18]

[0221] [Table 19]

[0222] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing. ICS was also performed on lung samples 7 days after dose 3. Cells were also surface stained for CD4, CD8 and CD3 using the antibodies listed in Table 20. ICS samples were activated overnight with 2 μg / ml of restimulation peptides PepMix H3N2 (PM-INFA_NP), PepMix H2N2 (BP21433), or peptide SP-MHCI-0100 (Table 21) (in the presence of brefeldin A and monensin). The results of the ICS assays are summarized in Figure 19.

[0223] [Table 20]

[0224] [Table 21]

[0225] ELISpot analysis for IFNγ was performed on splenocytes after dose 3. Splenocytes (0.125 × 10 6 Cells / well) were activated with 2 μg / ml PepMix (Table 21). IFNy plates were stimulated overnight (Figures 22A, 22B, and 22C).

[0226] Tetramer analysis was performed 7 days post-administration using H-2Db Influenza NP tetramer-ASNENMETM-PE 9 (SEQ ID NO: 27) (Figure 18).

[0227] ICS, tetramer and ELISpot data all showed strong immune responses to AMP-conjugated CpG and AMP-dT, which were significantly higher than their soluble counterparts or alum. Responses measured by ELISpot and ICS also demonstrated that heterosubtypic immunity can be detected by immunization with specific nucleoprotein variants and AMP-adjuvant, and subsequent restimulation with nucleoproteins from different influenza serotypes.

[0228] In ICS and ELISpot assays, splenocytes restimulated with a CD8 epitope 9-mer matching the sequence of the nucleoprotein used to immunize mice elicited strong CD8 T cell responses (Figures 22A-22C and 23). When these samples were restimulated with PepMix spanning nucleoprotein sequences from two different serotypes of influenza virus, the Ann Arbor nucleoprotein and the Kitakyushu nucleoprotein, strong CD4 and CD8 responses were observed despite the presence of point mutations in the known CD8 epitopes (Figures 24A, 24B, 25A, and 25B). The known CD4 epitopes did not mutate in any of the stimulations. This indicates that T cell responses can be maintained across different serotypes of influenza virus despite a single point mutation.

[0229] Example 6. Evaluation of amphipathic DNA versus naked DNA activity The effect of amphipathic DNA versus naked DNA on immune responses was determined. C57BL-6J mice were administered vaccines with components including 5 nmol of double-stranded soluble hybridizing dA and dT (dA:dT), double-stranded AMP dA:dT, soluble dT, or AMP dT per injection, 165 μg (which is the mass equivalent of 5 nmol of dA:dT) naked double-stranded dA:dT (Invivogen), or 1 nmol of AMP-CpG7909, where naked dA:dT is poly(deoxyadenylate-deoxythymidylic acid sodium salt) (InvivoGen) that contains a repeating synthetic double-stranded DNA sequence of poly(dA-dT):poly(dT-dA), a synthetic analog of B-DNA, as described in Table 22.

[0230] Mice were administered subcutaneously (SC) into the base of the tail at 50 μL per side on both sides. SC injection ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage, and biweekly injections were determined to be optimal for immune response.

[0231] [Table 22]

[0232] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was resuspended in 1× PBS and the final injections were diluted with 1× phosphate buffered saline (PBS) such that the (AMP-)dAdT and dT solutions had a concentration of 5 nmol / 100 μL injection, the AMP-CpG7909 had a concentration of 1 nmol / 100 μL injection, and the naked dAdT had a concentration of 165 μg / 100 μL injection. An ovalbumin protein stock solution was made by dissolving ovalbumin in PBS to obtain a concentration of 2 mg / mL. The final injections of ovalbumin were diluted with 1× PBS to yield a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 23.

[0233] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice bilaterally in a volume of 50 μL per side. Booster doses were given approximately two weeks apart. Subcutaneous injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. In preliminary mouse studies, biweekly injections were determined to be optimal in generating an immune response.

[0234] [Table 23]

[0235] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dose 2. ICS was also performed on lung samples 7 days after dose 2 (Figures 21, 27A and 27B). ICS was also performed on lung samples 7 days after dose 2 (Figures 28A and 28B and Figures 29A and 29B). Cells were surface stained for CD4, CD8, and CD3. Antibodies listed in Table 24 were used in the ICS assays.

[0236] [Table 24]

[0237] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Spleen cells (0.1 × 10 6 cells / well) were activated with 1 μg / ml of PepTivator ovalbumin peptide pool (Table 25) and stimulated with IFNy plates overnight (FIG. 20 and FIGS. 30A and 30B).

[0238] Tetramer analysis was performed 7 days post-treatment using T-Select I-Ab OVA 323-339 tetramer-APC (ISQAVHAAHAEINEAGR) (SEQ ID NO: 28) and iTAg tetramer / PE-H-2Kb OVA (SIINFEKL) (SEQ ID NO: 29) (Figures 26A and 26B).

[0239] The results showed that AMP-dAdT, AMP-dT and AMP-CpG all inhibited the IFNγ ELISpot assay in splenocytes and peripheral blood CD8 + Tetramer (MHCI specific) staining of cells, peripheral blood CD8 + and CD4 + Intracellular staining of IFNy and TNFa cytokines in T cells and lung CD8 + and CD4 + They were shown to elicit stronger T cell immune responses than their soluble comparator adjuvants, as measured by intracellular staining of IFNy and TNFa cytokines in T cells, and further demonstrated that the immune responses induced by AMP-dT were greater than or equal to AMP-dAdT.

[0240] [Table 25]

[0241] Example 7. Evaluation of the contribution of single-stranded amphipathic DNA length to activity This experiment was performed to determine how the length of the single-stranded poly-dT construct affects immunogenicity.

[0242] Fifteen groups of five C57BL-6J mice were administered a vaccine with a component containing 5 nmol of SARS-CoV-2 antigen and 5 nmol of single-stranded soluble or amphipathic poly-dT. As shown in Table 26, on day 0, the poly-dT had a length of 10, 20, 30, 40, 50, 75, or 100 nucleotides, all containing only phosphorothioate backbones.

[0243] [Table 26]

[0244] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was resuspended in 0 and the final injection was diluted with 1× phosphate buffered saline (PBS) to have a concentration of 5 nmol (AMP-)dT / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was made by dissolving in PBS at a concentration of 0.88 mg / mL and the final injection was diluted with 1× PBS to have a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 27.

[0245] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice bilaterally in a volume of 50 μL per side. Booster doses were given approximately two weeks apart. Subcutaneous injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. In preliminary mouse studies, biweekly injections were determined to be optimal in generating an immune response.

[0246] [Table 27]

[0247] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing (Figures 32A and 32B). ICS was also performed on lung samples 7 days after dose 2 (Figures 33A and 33B and Figures 34A and 34B). Cells were surface stained for CD4, CD8, and CD3. Antibodies listed in Table 28 were used for the ICS assay. ICS samples were activated overnight with 1 μg / mL of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 29) (in the presence of brefeldin A and monensin).

[0248] [Table 28]

[0249] [Table 29]

[0250] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Figures 31A and 31B). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / ml of SARS-CoV-2 spike glycoprotein peptide pool mix (Table 29). IFNy plates were stimulated overnight.

[0251] Tetramer analysis was performed 7 days after administration using H-2Kb CoV2 RBD tetramer-VNFNFNGL-PE (SEQ ID NO: 25) (NIH 53309).

[0252] A SARS-CoV2-specific serum ELISA (enzyme-linked immunosorbent assay) was performed on mouse serum 7 days after each dose to detect any RBD-specific antibody responses. Samples were collected by centrifugation of whole blood using Ser-gel tubes (NC9436363, Fisher Scientific). Serum was used fresh or stored at -80°C until use. 96-well plates were coated with 200ng / 100μL (2μg / mL) CoV2 RBD protein (Z03483, GenScript) overnight at 4°C. Plates were then preblocked with 2% BSA for 2 hours at room temperature. Mouse serum was diluted up to 1:20 and then serially diluted (1:5→8 concentrations) in dummy plates. ELISA plates were washed once with ELISA wash buffer (BioLegend 4211601). Samples were transferred to the ELISA plates and incubated for 2 hours at room temperature. Plates were washed 4 times with wash buffer. For serum antibody detection, secondary HRP-conjugated antibodies from Table 30 were used at 1:2000 in PBS+ and incubated for 1 hour at room temperature. Plates were washed 4 times with wash buffer. Reactions were visualized by addition of substrate 3,3',5,5'-tetramethylbenzidine (TMB) for 10 minutes at room temperature and stopped with H2SO4 (1N). Absorbance at 450 nm was measured by an ELISA plate reader.

[0253] [Table 30]

[0254] The results from this experiment showed that AMP conjugation of dT DNA improved its immunogenicity. AMP-conjugated dT length variants could induce strong immune responses up to 30 nucleic acid base lengths. 10 and 20 bases in the AMP-dT-construct did not induce immune responses. When unconjugated soluble dT-DNA was used, responses were not observable up to 40 base lengths. Immune responses increased with increasing soluble dT length. However, dT100 elicited an immune response that was below that of AMP-dT30. These data may indicate a length cutoff in recognition by pattern recognition receptors (PRRs) that do not interact with DNA shorter than 30 bases.

[0255] Example 8. Evaluation of amphiphilic DNA as an adjuvant versus other adjuvants This experiment was performed to compare the AMP version of the DNA-adjuvant against five standard adjuvants commonly used in commercial vaccines. The antigen ovalbumin (OVA) was used to allow broad comparison with other results in the literature.

[0256] Nine groups of five C57BL-6J mice were administered a vaccine on day 0 containing 5 nmol of ovalbumin antigen and components including amphipathic duplex dA hybridized to dT (dA:dT), amphipathic poly-dT, amphipathic CpG, alum, IFA, MF59, AS03, or AS04, as described in Table 31.

[0257] [Table 31]

[0258] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2The adjuvant solutions were resuspended in 0 and the final injections were diluted in 1× phosphate buffered saline (PBS) such that AMP-dAdT and AMP-dT had a concentration of 5 nmol / 100 μL injection, AMP-CpG7909 had a concentration of 1 nmol / 100 μL injection, alum had a concentration of 10 μg / 100 μL injection, and AS04 had a concentration of 10 μg / 100 μL injection. Monophosphoryl lipid A (MPLA) was derived from Salmonella enterica LPS. The other adjuvant solutions were supplied as 2× stock solutions and their concentrations were diluted 1:2 in PBS at the final volume. IFA was a water-in-oil emulsion of 15% mannide monooleate and 85% paraffin oil. AS03 contained DL-α-tocopherol (5% v / v) in squalene oil 5% (v / v) and Tween 80® (1.8% v / v) in phosphate buffered saline (pH 6.8). MF56 contained sorbitan trioleate (0.5% w / v) in squalene oil (5% v / v) and Tween 80® (0.5% v / v) in sodium citrate buffer (10 mM, pH 6.5). Ovalbumin protein stock solution was dissolved in PBS at a concentration of 2 mg / mL and the final injection was diluted with 1×PBS to a concentration of 5 μg / 100 μL injection. The vaccine components administered are listed in Table 32.

[0259] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice bilaterally in a volume of 50 μL per side. Booster doses were given approximately two weeks apart. Subcutaneous injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. In preliminary mouse studies, biweekly injections were determined to be optimal in generating an immune response.

[0260] [Table 32]

[0261] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days post-dose (Figures 37 and 38). ICS was also performed on lung samples 7 days post-dose 2 (Figures 39 and 40). Cells were surface stained for CD4, CD8, and CD3. Antibodies listed in Table 33 were used for the ICS assays. ICS samples were activated overnight with 1 μg / mL PepTivator ovalbumin peptide pool mix (Table 34) (in the presence of brefeldin A and monensin).

[0262] [Table 33]

[0263] [Table 34]

[0264] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Figure 36). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / ml PepTivator Ovalbumin Mix (Table 34). IFNy plates were stimulated overnight.

[0265] Tetramer analysis was performed 7 days post-treatment using T-Select I-Ab OVA 323-339 tetramer-APC (ISQAVHAAHAEINEAGR) (SEQ ID NO: 28) and iTAg tetramer / PE-H-2Kb OVA (SIINFEKL) (SEQ ID NO: 29) (Figure 35).

[0266] Ovalbumin-specific serum ELISA (enzyme-linked immunosorbent assay) was performed on mouse serum 7 days after each dose to detect any ovalbumin-specific antibody response. Samples were collected by centrifugation of whole blood using Ser-gel tubes (NC9436363, Fisher Scientific). Serum was used fresh or stored at -80°C until use. 96-well plates were coated with 200ng / 100μL (2μg / mL) ovalbumin overnight at 4°C. Plates were then preblocked with 2% BSA for 2 hours at room temperature. Mouse serum was diluted up to 1:20 and then serially diluted (1:5→8 concentrations) in dummy plates. ELISA plates were washed once with ELISA wash buffer (BioLegend 4211601). Samples were transferred to the ELISA plates and incubated for 2 hours at room temperature. Plates were washed 4 times with wash buffer. For serum antibody detection, secondary HRP-conjugated antibodies from Table 35 were used at 1:2000 in PBS+ and incubated for 1 hour at room temperature. Plates were washed 4 times with wash buffer. Reactions were visualized by addition of the substrate 3,3',5,5'-tetramethylbenzidine (TMB) for 10 minutes at room temperature and stopped with H2SO4 (1N). Absorbance at 450 nm was measured by an ELISA plate reader. The results of these studies are summarized in Figures 41 and 42A-42C.

[0267] [Table 35]

[0268] The results of this experiment demonstrated that the T cell immune responses generated by the AMP-adjuvant were robust. In comparison, all industry standard control drugs failed to induce T cell responses. These assays included ELISpot analysis of splenocytes, peripheral blood and lung CD4 + and CD8 +Intracellular staining and flow cytometry of T cells and tetramer analysis were included. IgG antibody titers in all groups were robust and comparable in scale. However, when IgG isotype responses were analyzed, the comparator drug adjuvants were observed to have a biased response towards Th2-associated antibodies (IgG1) with low or no response to Th1-associated antibodies (IgG2c). In contrast, the AMP conjugate adjuvant showed a strong bias towards Th1 responses.

[0269] Example 9. Induction of SARS-CoV-2-specific T cell proliferation in non-human primates This study was conducted to test SARS-CoV2 amphipathic vaccines in non-human primates (NHPs). The adjuvants, amphipathic CpG7909 (AMP-CpG7909) and amphipathic poly-dT with 50 nucleotides length (AMP-dT50), were tested in combination with spike RBD and spike protein antigens as described below. The purpose of the study was to determine the toxicity and tolerability of the AMP-vaccine in primates, as well as to determine the optimal vaccine composition and concentration.

[0270] Nine groups of 2-6 Rhesus Macaque monkeys were administered adjuvant and SARS-CoV-2 RBD or spike antigen. Each group received an adjuvant of amphipathic CpG7909 or amphipathic poly-dT with 50 nucleotides and SARS-CoV-2 spike antigen including SARS-CoV-2 RBD, delta variant RBD, beta variant RBD, or SARS-CoV-2 spike protein antigen as described in Table 36, with vaccine components described in Table 37. Groups 3-5 were designed to test escalating doses of CpG. Group 6 was designed to test AMP-CpG and variants of concern of SARS-CoV2. Group 7 was designed to test AMP-dT. Group 8 was designed to test AMP-CpG and spike protein. Vaccines were administered and samples were collected as described in Figure 43.

[0271] [Table 36]

[0272] The adjuvant stock solutions of AMP-CpG7909 and AMP-dT50 were mixed with Limulus amebocyte extract (LAL) H. 2 The SARS-CoV2 spike S1 RBD and spike protein stock solutions were dissolved in PBS. The final injections were diluted in 1x PBS. Immunizations were administered subcutaneously (SC) into each limb of the NHPs. A booster dose was given 4 weeks after the first injection.

[0273] [Table 37]

[0274] Upon receipt of collected serum, it was stored at -80°C until use. After thawing, serum was heat inactivated at 56°C for 30 minutes, aliquoted, and either refrozen or used immediately. Working aliquots were stored at 4°C for up to one week for further use.

[0275] 96-well flat-bottom Maxisorp plates were coated with 100 ng / well (1 μg / ml) of antigen, which was RBD WT (GenScript Z03483), RBD beta (GenScript Z03537), or RBD delta (GenScript Z03613). Sera were serially diluted in fresh untreated 96-well flat-bottom plates by initial dilution of 1:20 in PBS followed by serial dilutions of 1:4 in PBS. Coated ELISA plates were washed once with PBS and preblocked with casein blocking solution (Thermo Fisher 37582) for 1-2 hours at room temperature. Serially diluted serum samples were transferred to the coated ELISA plates and incubated for 2 hours at room temperature. Plates were washed three times with wash buffer (BioLegend 4211601). For serum antibody detection, HRP-conjugated secondary antibodies were used at a dilution of 1:2000 in PBS+ (Thermo Fisher (cat #PA184631)) and incubated for 1 h at room temperature. Plates were washed 3 times with wash buffer. Reactions were visualized by addition of the substrate 3,3',5,5'-tetramethylbenzidine (TMB) for 15 min at room temperature and stopped with H2SO4 (1N). Absorbance was measured at 450 nm by an ELISA plate reader. The results of the ELISA assays are summarized in Figure 44A and Figures 46-49.

[0276] Collected PBMCs were received frozen. Cells were thawed using thawing medium (RPMI + 50 IU / mL Benzonase [Millipore Sigma, Cat #71206-3]). Cells were then resuspended in R10 medium (RPMI + 10% FBS, 1% Penn / Strep, 1% L-glutamine) and left to rest overnight. The rested cells were stimulated with the respective peptide pools (Table 38) for 8 hours. Each peptide pool contained 15-mer peptides overlapping by 11 amino acids spanning the length of the relevant antigen. For stimulation, a concentration of 2 μg / ml of each peptide was used. Additionally, cells were treated with GolgiStop and GolgiPlug and co-stimulated with anti-CD49d and anti-CD28 antibodies during stimulation. Stimulated cells were stained and fixed as outlined in Table 39 and analyzed on a BD Symphony flow cytometer.

[0277] [Table 38]

[0278] [Table 39]

[0279] PBMCs were handled and rested as above. MabTech Monkey IFN-γ ELISpot PLUS Kit HRP (3421M-4HPT-10) was used as described by the manufacturer. 0.1×10 per well 6 cells were used. Cells were activated with 0.1 μg / well (1 μg / ml) of the RBD peptide pool (Table 38). IFNy plates were stimulated overnight (20 hours) and developed according to the manufacturer's instructions. The results of these studies are shown in Figures 51-53.

[0280] Tetramers (fluorescently labeled RBD) prepared were RBD-BV605, which contains biotinylated RBD + streptavidin-BV605 at a 1:2 ratio, and RBD-APC, which contains biotinylated RBD + streptavidin-APC at a 1:2 ratio. Tetramers were made by incubating biotinylated RBD with each SA-fluorochrome (separate reactions for each fluorochrome) for 20 minutes at room temperature. Lymph node cells were stained in the following order: Fc Block and Live / Dead staining, fluorescently labeled RBD, surface staining with subsequent fixation and permeabilization, and intracellular staining. Cells were analyzed on a BD Symphony flow cytometer. Antibodies used in this assay are listed in Table 40. The results of the tetramer assay are shown in Figure 45.

[0281] [Table 40]

[0282] Pseudovirus neutralization assays were performed by sending serum samples to GenScript for analysis. The results of this study are shown in Figure 44B.

[0283] Serum cytokine luminex assay was performed by heat inactivating serum. Luminex assay was performed using kit PCYTMG-40K-PX23 used as indicated by the manufacturer. The amount of IFNγ (Figure 50A), IL-6 (Figure 50B), IL-1RA (Figure 50C), and IL-18 (Figure 50D) were measured for each sample.

[0284] No sites of reactogenicity (redness, swelling, itching) were observed. There were no changes in body temperature (measured daily for 1 week after each dose). There were no significant changes in body weight (measured biweekly). There were no significant changes in % neutrophils, lymphocytes, monocytes, eosinophils or basophils, platelets, RBCs for 2 days after each dose. There were no significant changes in chemistry panel (glucose, BUN, creatinine, Na, K, chloride, Ca, albumin, ALT, LDH, etc.) for 2 days after each dose.

[0285] The AMP-vaccine was extremely well tolerated by NHPs. There were no signs of toxicity with higher concentrations of AMP-CpG or AMP-dT. Antibody responses were robust after one dose and increased further after a second dose. Animals receiving two doses of the AMP-vaccine demonstrated responses greater than those reported in the literature for other CoV-2 vaccines tested on NHPs. Animals vaccinated with 3000 μg of AMP-CpG7909 and WT spike RBD demonstrated neutralizing antibody titers higher than those measured in convalescent patients. Furthermore, robust B cell populations and circulating T cells specific for the CoV2 spike RBD were detected in the lymph nodes and blood of immunized NHPs, respectively.

[0286] Example 9. Evaluation of the effect of nucleotide sequence on DNA sensing This experiment was designed to determine whether nucleotide sequence is important in DNA sensing. Groups of 5 C57BL / 6J mice were administered a vaccine containing the components described in Table 41 and shown in Figure 54.

[0287] [Table 41]

[0288] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was prepared by resuspending in 1× phosphate buffered saline (PBS) for AMP-dAdT and AMP-ISD nucleic acid sequences at a concentration of 5 nmol / 100 μL injection. The final injection was diluted with 1× phosphate buffered saline (PBS) so that the AMP-dAdT and AMP-ISD nucleic acid sequences had a concentration of 5 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was prepared by dissolving the protein in PBS at a concentration of 0.88 mg / ml, and the final injection was diluted with 1× PBS to a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 42.

[0289] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. It was determined in preliminary mouse studies that biweekly injections were optimal in generating an immune response.

[0290] [Table 42]

[0291] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing. ICS was also performed on lung samples 7 days after dose 2 (Figures 56A, 56B, 57A, and 57B). Cells were also surface stained for CD4, CD8, and CD3 using the antibodies listed in Table 43. ICS samples were activated overnight with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 44) (in the presence of brefeldin A and monensin).

[0292] [Table 43]

[0293] [Table 44]

[0294] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Figure 55). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / ml of SARS-CoV-2 spike glycoprotein peptide pool mix (Table 44). IFNy plates were stimulated overnight.

[0295] The immunogenicity of all three DNA sequences was significantly increased when conjugated to amphiphiles. Furthermore, the numbers of CD8+ T cells were significantly increased in both the circulation and the lungs, whereas CD4 T cells appeared to accumulate primarily in peripheral tissues such as the lungs.

[0296] Example 10. Assessment of changes in the lymph node transcriptome upon vaccination This experiment was designed to analyze changes in the transcriptome of lymph node cells early upon vaccination with amphiphilic adjuvants.

[0297] Seven groups of eight C57BL / 6J mice were administered vaccines containing the components listed in Table 45.

[0298] [Table 45]

[0299] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 The vaccine was prepared by resuspending in 1× phosphate buffered saline (PBS) and the final injection was diluted with 1× phosphate buffered saline (PBS) such that AMP-dAdT and AMP-dT had a final concentration of 5 nmol / 100 μL injection and amphipathic AMP-CpG had a final concentration of 1 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was prepared by dissolving the protein in PBS at a concentration of 0.89 mg / ml and the final injection was diluted with 1× PBS to a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 46.

[0300] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. It was determined in preliminary mouse studies that biweekly injections were optimal in generating an immune response.

[0301] [Table 46]

[0302] For lymph node extraction, mice were sacrificed at the corresponding time points and lymph nodes were extracted in medium-containing microcentrifuge tubes. Lymph nodes were transferred onto a wet (1 ml of growth medium (RPMI) was added to the strainer to wet the surface) 70 μm nylon strainer and crushed through the filter into a 50 mL tube using a syringe plunger. The filter was washed with 10 mL of RPMI.

[0303] The cell suspension was then transferred into a 15 mL tube and spun at 1750 revolutions per minute (RPM) for 5 minutes at a temperature of 4° C. The supernatant was carefully aspirated and the cell pellet was resuspended in 1 mL of RPMI. The cells were then counted and spun down again. The supernatant was aspirated thoroughly and Qiagen RLT buffer (stored at room temperature, kept sterile) was added to obtain a 2×10 6 A concentration of 0.2 × 10 cells / mL was achieved. Cells were first resuspended by pipetting up and down and then vortexed for at least 10 seconds. 6 Cells (100 μl) were transferred to NanoString. The remainder was aliquoted and stored at -80°C.

[0304] The results showed that for AMP-dT, the chemokine was upregulated as early as 2 hours after immunization (Figure 58), which could indicate the induction of a strong inflammatory environment in the lymph nodes leading to the recruitment of additional leukocytes.

[0305] From 6 to 24 hours, many more immunologically related genes were upregulated. These include pattern recognition receptors, antigen processing and presentation genes, and antigen presenting cell (APC) activation markers, indicating that the innate immune system is activated. At the same time, chemokines, cytokines, interferons, antivirals, and inflammatory proteins were highly upregulated, which could be the result of innate immune system activation (Figures 59 and 60). Conversely, genes related to the adaptive immune system were mostly downregulated at this early time point, as expected.

[0306] 72 hours after immunization, the initial inflammatory response appeared to have subsided (Figure 61). APC markers were still elevated. Increased expression of genes associated with NK cells may suggest an influx of these cells into the lymph nodes at that time.

[0307] On the other hand, for soluble dT, not many genes were upregulated in the first 24 hours (Figures 58, 59, and 60). At 72 hours, a gene signature can be observed that may suggest a predominantly B cell-rich environment (Figure 61).

[0308] Example 11. Evaluation of nucleic acid sequences derived from herpes simplex virus as adjuvants This experiment was designed to determine whether an AMP-DNA adjuvant consisting of a 60 nucleic acid residue sequence from herpes simplex virus (HSV-60) would be a good adjuvant and whether that sequence was required to exist in its double-stranded conformation or whether the sense strand was sufficient to elicit an immune response.

[0309] Five groups of five C57BL / 6J mice were administered vaccines containing the components described in Table 47 and shown in FIG.

[0310] [Table 47]

[0311] The HSV-60 sequence sense strand has the following sequence (5' to 3') TAAGACACGATGCGATAAAATCTGTTTGTAAAATTTATTAAGGGTACAAATTGCCCTAGC (SEQ ID NO: 34). The HSV-60 sequence antisense strand has the following sequence (5' to 3') GCTAGGGCAATTTGTACCCTTAATAAATTTTACAAACAGATTTTATCGCATCGTGTCTTA (SEQ ID NO: 35), as shown in Figure 62, with the 5' end of the sense strand being conjugated to a diacyl lipid.

[0312] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2 AMP-HSV60 was prepared by resuspending in 1× phosphate buffered saline (PBS) and the final injection was diluted with 1× phosphate buffered saline (PBS) to a concentration of 5 nmol / 100 μL injection. SARS-CoV2 spike S1 RBD protein stock solution was prepared by dissolving the protein in PBS at a concentration of 1.14 mg / mL and the final injection was diluted with 1× PBS to a final concentration of 5 μg / 100 μL injection. Vaccine components are listed in Table 48.

[0313] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. It was determined in preliminary mouse studies that biweekly injections were optimal in generating an immune response.

[0314] [Table 48]

[0315] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing. ICS was also performed on lung samples 7 days after dose 2 (Figures 64A, 64B, 65A, and 65B). Cells were also surface stained for CD4, CD8, and CD3 using the antibodies listed in Table 49. ICS samples were activated overnight with 1 μg / well SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 50) in the presence of brefeldin A and monensin.

[0316] [Table 49]

[0317] [Table 50]

[0318] ELISpot analysis for IFNγ was performed on splenocytes after administration of dose 2 (Figure 63). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / well of PepMix (Table 50). IFNy plates were stimulated overnight.

[0319] Tetramer analysis was performed 7 days after administration using H-2Kb CoV2 RBD tetramer-VNFNFNGL-PE (SEQ ID NO: 25) (NIH 53309) (Figure 66).

[0320] AMP modification of HSV-60 adjuvant increased immunogenicity. Both single-chain and double-chain HSV-60 benefited from AMP conjugation. There was no significant difference in the immune response induced by single-chain and double-chain variants of HSV-60 adjuvant. However, double-chain variants tended to perform better. This could be due to the equimolar amounts used, which resulted in twice as much DNA in double-chain variants.

[0321] Example 12. Assessment of whether both chains of the ISD are required for immune responses This experiment was designed to determine whether both chains of the ISD sequence are necessary to elicit a strong immune response, or, if only one chain is required, which chain is more immunogenic.

[0322] Seven groups of five C57BL / 6J mice were administered a vaccine containing the components described in Table 51 and shown in FIG.

[0323] [Table 51]

[0324] The adjuvant stock solution was Limulus amebocyte extract (LAL) H 2The vaccine was prepared by resuspension in 0 and the final injection diluted in 1x phosphate buffered saline (PBS) to give a concentration of 5 nmol / 100 μL injection for AMP-ISD and 5 nmol / 100 μL injection for AMP-RNA (equivalent to 33 μg of RNA). SARS-CoV2 spike S1 RBD protein stock solution was dissolved in PBS at a concentration of 0.89 mg / ml and the final injection diluted in 1x PBS to give a concentration of 5 μg / 100 μL injection. The vaccine components are listed in Table 52.

[0325] Immunizers were administered subcutaneously (SC) into the base of the tail of female B6 mice, 50 μL per side on both sides. Booster doses were given approximately 2 weeks apart. SC injections ensured optimal delivery of the vaccine into the lymph nodes via natural lymphatic drainage. It was determined in preliminary mouse studies that biweekly injections were optimal in generating an immune response.

[0326] [Table 52]

[0327] ICS (intracellular staining) assays for TNFα and IFNγ were performed on PBMCs 7 days after dosing. ICS was also performed on lung samples 7 days after dose 2 (Figures 69A, 69B, 70A, and 70B). Cells were also surface stained for CD4, CD8, and CD3 using the antibodies listed in Table 53. ICS samples were activated overnight with 1 μg / well of SARS-CoV-2 spike glycoprotein peptide pool mix [315 peptides each at 1 μg / well] (Table 54) (in the presence of brefeldin A and monensin).

[0328] [Table 53]

[0329] [Table 54]

[0330] ELISpot analysis for IFNγ was performed on splenocytes after dose 2 (Figure 68). Splenocytes (0.1 x 10 6 Cells / well) were activated with 1 μg / well of PepMix (Table 54). IFNy plates were stimulated overnight.

[0331] The results of the experiment show that AMP conjugation of any of the ISD variants improved their immunogenicity. The immune response for each of the single-chain variants was approximately half as strong as that of the double-chain ISD variant. This is most likely due to the fact that molar equivalents were used for each variant, and the double-chain version had twice the mass of the single-chain version. There was no significant difference in the immune response elicited between the single-chain versions.

[0332] Numbered embodiments 1. A compound comprising a poly-deoxyadenosine (poly-dA) nucleic acid sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof. 2. A compound comprising a poly-deoxythymidine (poly-dT) nucleic acid sequence and an albumin binding moiety, or a pharma- ceutically acceptable salt thereof. 3. The compound according to embodiment 1 or 2, or a pharma- ceutically acceptable salt thereof, comprising a poly-dA nucleic acid sequence and a poly-dT nucleic acid sequence. 4. The compound of embodiment 3, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence hybridize to form a double-stranded DNA sequence. 5. The compound according to any one of embodiments 1 to 4, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30 to 100 nucleotides. 6. The compound according to embodiment 5, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 50-100 nucleotides. 7. The compound according to embodiment 5, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30-50 nucleotides. 8. The compound of embodiment 5, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30, 40, 50, 75, or 100 nucleotides. 9. The compound according to any one of embodiments 3 to 8, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence comprise the same number of nucleotides. 10. The compound according to any one of embodiments 1 to 9, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises a mixture of dA and dT nucleic acid residues. 11. The compound according to embodiment 10, or a pharma- ceutically acceptable salt thereof, wherein the poly-dA nucleic acid sequence comprises 100% to 51% dA nucleic acid residues and 0% to 49% dT nucleic acid residues. 12. The compound according to embodiment 10, or a pharma- ceutically acceptable salt thereof, wherein the poly-dT nucleic acid sequence comprises 100% to 51% dT nucleic acid residues and 0% to 49% dA nucleic acid residues. 13. The compound according to any one of embodiments 1 to 12, or a pharma- ceutically acceptable salt thereof, wherein at least one internucleotide group connecting the nucleotides in the poly-dA and poly-dT nucleic acid sequences is phosphodiester. 14. The compound according to any one of embodiments 1 to 12, or a pharma- ceutically acceptable salt thereof, wherein all internucleotide groups connecting the nucleotides in the poly-dA and poly-dT nucleic acid sequences are phosphorothioates. 15. The compound according to any one of embodiments 1 to 14, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5' end of the poly-dA nucleic acid sequence. 16. The compound according to any one of embodiments 1 to 14, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5' end of a poly-dT nucleic acid sequence. 17. A compound comprising an interferon stimulating DNA (ISD) sequence and an albumin binding domain or an immunostimulatory herpes simplex virus (HSV) sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof. 18. The compound according to embodiment 17, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5'-end of the ISD sequence or the immunostimulatory HSV sequence. 19. The compound according to any one of embodiments 1-18, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding is a lipid. 20. The compound according to embodiment 19, or a pharma- ceutically acceptable salt thereof, wherein the lipid is a diacyl lipid. 21. The compound of embodiment 20, or a pharma- ceutically acceptable salt thereof, wherein the diacyl lipid comprises an acyl chain comprising 12 to 30 hydrocarbon units, 14 to 25 hydrocarbon units, 16 to 20 hydrocarbon units, or 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hydrocarbon units. 22. The compound according to embodiment 20 or 21, or a pharma- ceutically acceptable salt thereof, wherein the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE). 23. The poly-dA nucleic acid sequence, the poly-dT nucleic acid sequence, or the ISD sequence is selected from the group consisting of the following lipids: [ka] Or its salt or linked by a linker, 23. The compound according to any one of embodiments 20-22, wherein X is O or S; or a pharma- ceutically acceptable salt thereof. 24. The compound according to embodiment 23, or a pharma- ceutically acceptable salt thereof, wherein the linker is selected from the group consisting of a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof. 25. The compound according to embodiment 23, or a pharma- ceutically acceptable salt thereof, wherein the linker comprises "N" polyethylene glycol units, wherein N is 24 to 50. 26. The compound according to embodiment 25, or a pharma- ceutically acceptable salt thereof, wherein the linker comprises PEG24-amide-PEG24. 27. A poly-dA and poly-dT double-stranded DNA sequence containing 30 to 100 pairs of paired nucleotides. 28. The poly-dA and poly-dT double-stranded DNA sequence according to embodiment 27, or a pharma- ceutically acceptable salt thereof, wherein poly-dA and poly-dT contain the same number of nucleotides. 29. A poly-dA or poly-dT single-stranded DNA sequence comprising 30 to 100 nucleotides, or a pharma- ceutically acceptable salt thereof. 30. Poly-deoxyguanosine (poly-dG) nucleic acid sequence A compound comprising a nucleic acid sequence and an albumin binding domain, or a pharma- ceutically acceptable salt thereof. 31. A compound comprising a poly-deoxycytosine (poly-dC) nucleic acid sequence and an albumin binding moiety, or a pharma- ceutically acceptable salt thereof. 32. The compound according to embodiment 30 or 31, or a pharma- ceutically acceptable salt thereof, comprising a poly-dG nucleic acid sequence and a poly-dC nucleic acid sequence. 33. The compound according to embodiment 32, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence hybridize to form a double-stranded DNA sequence. 34. The compound according to any one of embodiments 30 to 33, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30 to 100 nucleotides. 35. The compound according to embodiment 34 or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 50 to 100 nucleotides. 36. The compound according to embodiment 34, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30 to 50 nucleotides. 37. The compound according to embodiment 34, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30, 40, 50, 75, or 100 nucleotides. 38. The compound according to any one of embodiments 32 to 37, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence contain the same number of nucleotides. 39. The compound according to any one of embodiments 30 to 38, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises a mixture of dG and dC nucleic acid residues. 40. The compound according to embodiment 39, or a pharma- ceutically acceptable salt thereof, wherein the poly-dG nucleic acid sequence comprises 100% to 51% dG nucleic acid residues and 0% to 49% dC nucleic acid residues. 41. The compound according to embodiment 39, or a pharma- ceutically acceptable salt thereof, wherein the poly-dC nucleic acid sequence comprises 100% to 51% dC nucleic acid residues and 0% to 49% dG nucleic acid residues. 42. The compound according to any one of embodiments 30 to 41, or a pharma- ceutically acceptable salt thereof, wherein at least one internucleotide group connecting the nucleotides in the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence is phosphodiester. 43. The compound according to any one of embodiments 30 to 41, or a pharma- ceutically acceptable salt thereof, wherein all internucleotide groups connecting the nucleotides in the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence are phosphorothioate. 44. The compound according to any one of embodiments 30-43, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5' end of the poly-dG nucleic acid sequence. 45. The compound according to any one of embodiments 30-43, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5' end of the poly-dC nucleic acid sequence. 46. ​​The compound according to any one of embodiments 30-45, or a pharma- ceutically acceptable salt thereof, wherein the albumin binding is a lipid. 47. The compound according to embodiment 46, or a pharma- ceutically acceptable salt thereof, wherein the lipid is a diacyl lipid. 48. The compound according to embodiment 47, or a pharma- ceutically acceptable salt thereof, wherein the diacyl lipid comprises an acyl chain comprising 12 to 30 hydrocarbon units, 14 to 25 hydrocarbon units, 16 to 20 hydrocarbon units, or 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hydrocarbon units. 49. The compound according to embodiment 47 or 48, or a pharma- ceutically acceptable salt thereof, wherein the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE). 50. The poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence is selected from the group consisting of the following lipids: [ka] Or its salt or linked by a linker, 50. The compound according to any one of embodiments 47-49, wherein X is O or S; or a pharma- ceutically acceptable salt thereof. 51. The compound according to embodiment 50, or a pharma- ceutically acceptable salt thereof, wherein the linker is selected from the group consisting of a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof. 52. The compound according to embodiment 51, or a pharma- ceutically acceptable salt thereof, wherein the linker comprises "N" polyethylene glycol units, wherein N is 24 to 50. 53. The compound according to embodiment 52, or a pharma- ceutically acceptable salt thereof, wherein the linker comprises PEG24-amide-PEG24. 54. Poly-dG and poly-dC double-stranded DNA sequences containing 30 to 100 pairs of paired nucleotides. 55. The poly-dG and poly-dC double-stranded DNA sequence according to embodiment 54, or a pharma- ceutically acceptable salt thereof, wherein poly-dG and poly-dC contain the same number of nucleotides. 56. A poly-dG or poly-dC single-stranded DNA sequence containing 30 to 100 nucleotides, or a pharma- ceutically acceptable salt thereof. 57. A method for inducing an immune response to an antigen in a subject, comprising administering to the subject a compound according to any one of embodiments 1 to 56, a poly-dA and poly-dT double-stranded DNA sequence, a poly-dA or poly-dT single-stranded DNA sequence, a poly-dG and poly-dC double-stranded DNA sequence, a poly-dG or poly-dC single-stranded DNA sequence, or a pharma-ceutically acceptable salt thereof, and the antigen. 58. The method of embodiment 57, further comprising administering an adjuvant to the subject. 59. The method of embodiment 57 or 58, wherein the antigen is an influenza antigen, or a fragment thereof. 60. The method of embodiment 59, wherein the antigen is influenza nucleoprotein, or a fragment thereof. 61. The method of embodiment 60, wherein the influenza nucleoprotein comprises a polypeptide sequence having at least 85% sequence identity to SEQ ID NO:22. 62. The method of embodiment 61, wherein the influenza nucleoprotein comprises a polypeptide sequence having at least 95% sequence identity to SEQ ID NO:22. 63. The method of embodiment 62, wherein the influenza nucleoprotein comprises the polypeptide sequence of SEQ ID NO: 22. 64. The method of embodiment 57 or 58, wherein the antigen is a coronavirus antigen, or a fragment thereof. 65. The method of embodiment 64, wherein the antigen is a coronavirus spike protein, or a fragment thereof. 66. The method of embodiment 64, wherein the antigen is a coronavirus nucleocapsid protein, or a fragment thereof. 67. The method according to any one of embodiments 57-66, wherein the compound according to any one of embodiments 1-56 or a pharma- ceutically acceptable salt thereof is administered subcutaneously. 68. The method of any one of embodiments 57-67, wherein the antigen is administered intramuscularly, subcutaneously, intravenously, intraperitoneally, topically, or orally. 69. The method of any one of embodiments 57-68, wherein the subject is a mammal. 70. The method of embodiment 67, wherein the subject is a human. 71. A pharmaceutical composition comprising a compound according to any one of embodiments 1 to 56, a poly-dA and poly-dT double-stranded DNA sequence, a poly-dA or poly-dT single-stranded DNA sequence, a poly-dG and poly-dC double-stranded DNA sequence, a poly-dG or poly-dC single-stranded DNA sequence, or a pharma- ceutically acceptable salt thereof, an antigen, or a nucleic acid sequence encoding an antigen, and a pharma- ceutically acceptable carrier. 72. The pharmaceutical composition according to embodiment 71, wherein the antigen is an influenza antigen or a fragment thereof. 73. The pharmaceutical composition according to embodiment 72, wherein the antigen is influenza nucleoprotein or a fragment thereof. 74. The pharmaceutical composition according to embodiment 71, wherein the antigen is a coronavirus antigen, or a fragment thereof. 75. A kit comprising a compound according to any one of embodiments 1 to 56, a poly-dA and poly-dT double-stranded DNA sequence, a poly-dA or poly-dT single-stranded DNA sequence, a poly-dG and poly-dC double-stranded DNA sequence, a poly-dG or poly-dC single-stranded DNA sequence, or a pharma-ceutically acceptable salt thereof, and an antigen or a nucleic acid sequence encoding an antigen. 76. The kit of embodiment 75, wherein the antigen is an influenza antigen, or a fragment thereof. 77. The kit of embodiment 76, wherein the antigen is influenza nucleoprotein, or a fragment thereof. 78. The kit of embodiment 77, wherein the antigen is a coronavirus antigen, or a fragment thereof.

[0333] Other embodiments Various modifications and variations of the described compositions, methods, and uses of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described with reference to specific embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the present invention that are apparent to those skilled in the art are intended to be within the scope of the present invention.

Claims

1. (a) a poly-deoxyadenosine (poly-dA) and / or poly-deoxythymidine (poly-dT) nucleic acid sequence, and an albumin binding domain; or (b) a poly-deoxyguanosine (poly-dG) and / or poly-deoxycytosine (poly-dC) nucleic acid sequence, and an albumin binding domain; or a pharmaceutically acceptable salt thereof.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, (a) the compound, or a pharmaceutically acceptable salt thereof, comprises a poly-dA nucleic acid sequence and a poly-dT nucleic acid sequence; and optionally, wherein: (i) the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence hybridize to form a double-stranded DNA sequence; and / or (ii) the poly-dA nucleic acid sequence and the poly-dT nucleic acid sequence contain the same number of nucleotides; (b) the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30 to 100 nucleotides; optionally, wherein: (i) the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 50 to 100 nucleotides; (ii) the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30 to 50 nucleotides; or (iii) the poly-dA nucleic acid sequence and / or the poly-dT nucleic acid sequence comprises 30, 40, 50, 75, or 100 nucleotides; (c) the poly-dA and / or poly-dT nucleic acid sequences comprise a mixture of dA and dT nucleic acid residues; and optionally, wherein: (i) the poly-dA nucleic acid sequence comprises between 100% and 51% dA nucleic acid residues and between 0% and 49% dT nucleic acid residues; or (ii) the poly-dT nucleic acid sequence comprises between 100% and 51% dT nucleic acid residues and between 0% and 49% dA nucleic acid residues; (d) at least one internucleotide group connecting the nucleotides in said poly-dA nucleic acid sequence and said poly-dT nucleic acid sequence is phosphodiester; (e) all internucleotide groups connecting nucleotides in said poly-dA nucleic acid sequences and poly-dT nucleic acid sequences are phosphorothioate; and / or (f) the albumin binding domain is attached to the 5' end of the poly-dA nucleic acid sequence or the 5' end of the poly-dT nucleic acid sequence; The compound or a pharmaceutically acceptable salt thereof.

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, (a) the compound, or a pharmaceutically acceptable salt thereof, comprises a poly-dG nucleic acid sequence and a poly-dC nucleic acid sequence; and optionally, wherein: (i) the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence hybridize to form a double-stranded DNA sequence; and / or (ii) the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence contain the same number of nucleotides; (b) the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30 to 100 nucleotides; optionally, wherein: (i) the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 50 to 100 nucleotides; (ii) the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30 to 50 nucleotides; or (iii) the poly-dG nucleic acid sequence and / or the poly-dC nucleic acid sequence comprises 30, 40, 50, 75, or 100 nucleotides; (c) the poly-dG and / or poly-dC nucleic acid sequences comprise a mixture of dG and dC nucleic acid residues; and optionally, wherein: (i) the poly-dG nucleic acid sequence comprises between 100% and 51% dG nucleic acid residues and between 0% and 49% dC nucleic acid residues; or (ii) the poly-dC nucleic acid sequence comprises between 100% and 51% dC nucleic acid residues and between 0% and 49% dG nucleic acid residues; (d) at least one internucleotide group connecting the nucleotides in the poly-dG nucleic acid sequence and the poly-dC nucleic acid sequence is phosphodiester; (e) all internucleotide groups connecting nucleotides in the poly-dG and poly-dC nucleic acid sequences are phosphorothioate; and / or (f) the albumin binding domain is attached to the 5' end of the poly-dG nucleic acid sequence or the 5' end of the poly-dC nucleic acid sequence; The compound or a pharmaceutically acceptable salt thereof.

4. A compound comprising an interferon-stimulating DNA (ISD) sequence and an albumin binding domain or an immunostimulatory herpes simplex virus (HSV) sequence and an albumin binding domain, or a pharmaceutically acceptable salt thereof.

5. 5. The compound of claim 4, or a pharmaceutically acceptable salt thereof, wherein the albumin binding domain is attached to the 5' end of the ISD sequence or the immunostimulatory HSV sequence.

6. 2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the albumin binding domain is a lipid.

7. 7. The compound of claim 6, or a pharmaceutically acceptable salt thereof, wherein the lipid is a diacyl lipid.

8. The compound of claim 7 or a pharmaceutically acceptable salt thereof, (a) the diacyl lipid comprises an acyl chain containing 12 to 30 hydrocarbon units, 14 to 25 hydrocarbon units, 16 to 20 hydrocarbon units, or 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hydrocarbon units; (b) the lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE); or (c) the poly-dA nucleic acid sequence, the poly-dT nucleic acid sequence, the poly-dG nucleic acid sequence, the poly-dC nucleic acid sequence, or the ISD sequence is a lipid: 【Chemical 1】 or its salt or linked by a linker, wherein X is O or S; optionally, wherein (i) the linker is selected from the group consisting of a hydrophilic polymer, a series of hydrophilic amino acids, a polysaccharide, and an oligonucleotide, or a combination thereof; or (ii) the linker comprises "N" polyethylene glycol units, where N is 24-50; optionally, wherein the linker comprises PEG24-amide-PEG24; The compound or a pharmaceutically acceptable salt thereof.

9. A DNA sequence of poly-dA and poly-dT, or poly-dG and poly-dC, (a) the sequence is double-stranded and comprises 30 to 100 pairs of paired nucleotides; optionally, wherein the poly-dA and poly-dT, or poly-dG and poly-dC, comprise the same number of nucleotides, or a pharmaceutically acceptable salt thereof; or (b) a sequence, or a pharmaceutically acceptable salt thereof, wherein said sequence is single-stranded and comprises 30 to 100 nucleotides.

10. A composition for use in inducing an immune response to an antigen in a subject, comprising a compound described in any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, or a DNA sequence described in claim 9 or a pharmaceutically acceptable salt thereof, and an antigen.

11. The composition of claim 10, (a) inducing the immune response further comprises administering to the subject an adjuvant; (b) the antigen is an influenza antigen, or a fragment thereof; (c) the influenza antigen is an influenza nucleoprotein, or a fragment thereof; (d) the influenza nucleoprotein comprises a polypeptide sequence having at least 85% sequence identity to SEQ ID NO:22; (e) the influenza nucleoprotein comprises a polypeptide sequence having at least 95% sequence identity to SEQ ID NO:22; (f) the influenza nucleoprotein comprises the polypeptide sequence of SEQ ID NO:22; (g) the antigen is a coronavirus antigen, or a fragment thereof; optionally, wherein: (i) the antigen is a coronavirus spike protein, or a fragment thereof; or (ii) the antigen is a coronavirus nucleocapsid protein, or a fragment thereof; (h) inducing the immune response comprises subcutaneously administering the compound or a pharmaceutically acceptable salt thereof; (i) inducing the immune response comprises administering the antigen intramuscularly, subcutaneously, intravenously, intraperitoneally, topically, or orally; (j) the subject is a mammal; and / or (k) the subject is a human. composition.

12. A pharmaceutical composition comprising a compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, or a DNA sequence according to claim 9 or a pharmaceutically acceptable salt thereof, an antigen or a nucleic acid sequence encoding the antigen, and a pharmaceutically acceptable carrier.

13. The pharmaceutical composition of claim 12, (a) the antigen is an influenza antigen or a fragment thereof; (b) the antigen is influenza nucleoprotein or a fragment thereof; and / or (c) the antigen is a coronavirus antigen, or a fragment thereof; Pharmaceutical compositions.

14. A kit comprising a compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, or a DNA sequence according to claim 9 or a pharmaceutically acceptable salt thereof, and an antigen or a nucleic acid sequence encoding the antigen.

15. The kit of claim 14, (a) the antigen is an influenza antigen, or a fragment thereof; (b) the antigen is influenza nucleoprotein, or a fragment thereof; and / or (c) the antigen is a coronavirus antigen, or a fragment thereof; kit.

Images