Recombinant rotavirus expressing an exogenous protein and uses thereof

JP2024540894A5Pending Publication Date: 2025-10-23ザトラスティーズオブインディアナユニバーシティー
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024523176
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-18
Filing Date
2022-10-18
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

There is a lack of effective vaccines and treatments for norovirus (NoV) due to the absence of suitable cell lines for virus culture and animal models, making it difficult to induce immunity against this highly contagious and environmentally stable pathogen, particularly in young children and the elderly.

Method used

Development of recombinant rotavirus (RV) expressing exogenous proteins, such as Norovirus VP1 and SARS-CoV-2 proteins, using a reverse genetics system to create a vaccine vector that induces immune responses by fusing RV NSP3 with heterologous polynucleotides and promoters like T7 or T3, enabling expression of antigenic peptides.

Benefits of technology

The recombinant RV vectors generate functional proteins capable of inducing immune responses against both RV and NoV, providing potential protection against these pathogens through immunization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Disclosed herein are polynucleotides encoding recombinant rotaviruses (RVs), methods of using same, and systems for producing recombinant RVs.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 256,960, filed October 18, 2021, and U.S. Provisional Patent Application No. 63 / 256,875, filed October 18, 2021, each of which is incorporated by reference in its entirety herein.

[0002] Statement of Government Rights This invention was made with government support under TR002529 and AI44881 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Sequence Listing A Sequence Listing accompanies this application and has been submitted in an ST26 format Sequence Listing xml file named "144578_00351.xml", which is 120,469 bytes in size and was created on October 18, 2022. The Sequence Listing was submitted electronically via EFS-Web with the application and is hereby incorporated by reference in its entirety. [Background technology]

[0004] Rotavirus (RV) and norovirus (NoV) are the leading causes of acute gastroenteritis (AGE) and acute diarrheal episodes in young children and the elderly (1, 2). The development and introduction of effective RV vaccines—Rotarix (GSK Biologicals), a monovalent vaccine (RV1), and RotaTeq (Merck and Company), a pentavalent vaccine (RV5)—in childhood immunization programs in the United States and many other countries has led to a reduction in the incidence of RV hospitalizations and deaths, and these vaccines are quite successful in generating neutralizing antibodies in vaccinated children (3, 4). In countries where RV vaccines are widely used, an increase in NoV-mediated diarrheal disease and hospitalizations during the first 5 years of children's lives has become more evident (5, 6). The incidence of NoV disease is high in young children, elderly populations, and subjects with low immune protection, who urgently need effective preventive measures (7). NoV disease is highly contagious, requiring as few as 10 infectious particles to cause AGE, and has high environmental stability, with shedding continuing for several weeks after infection. (8) However, it has been extremely difficult for many years to develop effective anti-NoV drugs or vaccines due to the lack of suitable cell lines for virus culture and the lack of successful animal models for drug and vaccine evaluation. (9,10) Summary of the Invention [Problem to be solved by the invention]

[0005] Thus, there is a need in the art for novel compositions and methods for eliciting immunity against NoV. [Means for solving the problem]

[0006] (Summary) In one aspect of the disclosure, a polynucleotide is provided. In some embodiments, the polynucleotide comprises a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding the RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site.In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is a porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to the sequence encoding the RV protein. In some embodiments, a polynucleotide that encodes a protein selected from SEQ ID NOs: 2-11, or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22, or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22.

[0007] In another aspect of the disclosure, an infectious particle is provided. In some embodiments, the infectious particle comprises a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding the RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site.In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is a porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to the sequence encoding the RV protein. In some embodiments, a polynucleotide that encodes a protein selected from SEQ ID NOs: 2-11, or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22, or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22.

[0008] In some embodiments, the infectious particle is produced by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide into a cell. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site.In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is a porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to the sequence encoding the RV protein. In some embodiments, a polynucleotide that encodes a protein selected from SEQ ID NOs: 2-11, or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22, or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22.

[0009] In another aspect of the disclosure, a pharmaceutical composition includes an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide, and optionally further comprising a pharma- ceutically acceptable carrier or excipient. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site.In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is a porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to the sequence encoding the RV protein. In some embodiments, a polynucleotide that encodes a protein selected from SEQ ID NOs: 2-11, or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22, or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22.

[0010] In some embodiments, the pharmaceutical composition comprises an infectious particle produced by introducing into a cell a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site.In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is a porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to the sequence encoding the RV protein. In some embodiments, a polynucleotide encoding a protein selected from SEQ ID NOs: 2-11, or encoding a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22, or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22. In some embodiments, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier.

[0011] In another aspect of the disclosure, a method of eliciting an immune response against one or more microorganisms in a subject is provided. In some embodiments, the method comprises administering to a subject an effective amount of a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide, and optionally further comprising a pharma- ceutically acceptable carrier or excipient, to elicit an immune response against one or more microorganisms. In some embodiments, the pharmaceutical composition comprises an infectious particle made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide into a cell. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide.In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site. In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is the porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to a sequence encoding a RV protein. In some embodiments, the polynucleotide encodes a protein selected from SEQ ID NOs: 2-11 or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22 or comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22. In some embodiments, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier. In some embodiments, the one or more pathogens comprises NoV. In some embodiments, the one or more pathogens comprises RV and NoV.In some embodiments, the one or more pathogens include SARS-CoV-2. In some embodiments, the one or more pathogens include RV and SARS-CoV-2.

[0012] In another aspect of the disclosure, a method of vaccinating a subject against one or more pathogens is provided. In some embodiments, the method comprises administering to the subject an effective amount of a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide, and optionally further comprising a pharma- ceutically acceptable carrier or excipient, to vaccinate the subject against one or more pathogens. In some embodiments, the pharmaceutical composition comprises an infectious particle made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide into a cell. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide.In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site. In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is the porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to a sequence encoding a RV protein. In some embodiments, the polynucleotide encodes a protein selected from SEQ ID NOs: 2-11 or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22 or comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22. In some embodiments, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier. In some embodiments, the one or more pathogens comprises NoV. In some embodiments, the one or more pathogens comprises RV and NoV.In some embodiments, the one or more pathogens include SARS-CoV-2. In some embodiments, the one or more pathogens include RV and SARS-CoV-2. In some embodiments, the one or more pathogens include NoV. In some embodiments, the one or more pathogens include RV and NoV. In some embodiments, the one or more pathogens include SARS-CoV-2. In some embodiments, the one or more pathogens include RV and SARS-CoV-2.

[0013] In another aspect of the disclosure, a method for producing a recombinant rotavirus (RV) in vitro is provided. In some embodiments, the method includes introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide into a cell, allowing the cell to express the polynucleotide, incubating the cell for a sufficient time to produce the RV, and harvesting the virus produced by the cell to produce the RV in vitro. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, the promoter is a T7 promoter or a T3 promoter. In some embodiments, the promoter is a T7 promoter. In some embodiments, the polynucleotide encodes a positive-sense viral transcript. In some embodiments, the sequence encoding the RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:1. In some embodiments, the heterologous polynucleotide encodes a peptide or protein. In some embodiments, the heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3. In some embodiments, the peptide or protein comprises an antigenic peptide or protein. In some embodiments, the peptide or protein comprises a microbial peptide or protein. In some embodiments, the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a Norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises a NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide.In some embodiments, the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein. In some embodiments, the SARS-CoV-2 protein is the S1 protein or a fragment thereof. In some embodiments, the peptide or protein comprises a cleavage site. In some embodiments, the cleavage site is a protease cleavage site. In some embodiments, the cleavage site is a thrombin cleavage site (SEQ ID NO: 28). In some embodiments, the cleavage site is a self-cleaving peptide sequence. In some embodiments, the self-cleaving peptide sequence is the porcine teschovirus 2A element (SEQ ID NO: 29). In some embodiments, the peptide or protein comprises a linker. In some embodiments, the linker is a GAG flexible linker or a GSG flexible linker. In some embodiments, the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length. In some embodiments, the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation sites. In some embodiments, the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in frame 3' to a sequence encoding the RV protein. In some embodiments, the polynucleotide encodes a protein selected from SEQ ID NOs: 2-11 or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2-11. In some embodiments, the polynucleotide comprises any one of SEQ ID NOs: 13-22 or a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-22.In some embodiments, the method further comprises introducing one or more additional polynucleotides into the cell prior to the enabling step, the one or more additional polynucleotides comprising a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4, and NSP5, each sequence encoding an RV protein being operably linked to a promoter. In some embodiments, the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5. In some embodiments, the one or more additional polynucleotides comprise a sequence encoding a capping enzyme operably linked to a promoter. In some embodiments, the capping enzyme is African Swine Fever Virus capping enzyme. In some embodiments, the cell is selected from MA-104 cells, Vero cells, and BHK-1 cells. In some embodiments, the cell expresses a heterologous RNA polymerase. In some embodiments, the heterologous RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase. In some embodiments, the cell is a BHK-1 cell that contains T7 RNA polymerase. In some embodiments, the method produces an RV protein that is fused to a glycoprotein when expressed in the cell.

[0014] In another aspect of the disclosure, a cell is provided. In some embodiments, the cell comprises a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the cell comprises an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the cell comprises an infectious particle produced by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide into the cell. In some embodiments, the cell is an MA-104 cell, a Vero cell, or a BHK-1 cell. In some embodiments, the cell expresses a heterologous RNA polymerase. In some embodiments, the heterologous RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase.

[0015] In another aspect of the disclosure, a system, platform or kit for generating a recombinant rotavirus (RV) is provided. In some embodiments, the system, platform or kit comprises (a) a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide, and (b) a cell capable of expressing the polynucleotide of (a). In some embodiments, the system, platform or kit further comprises one or more additional polynucleotides comprising a sequence encoding a RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4 and NSP5, each sequence encoding a RV protein being operably linked to a promoter. In some embodiments, the one or more additional polynucleotides comprise at least one sequence encoding a RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4 and NSP5. In some embodiments, the cell comprises a heterologous RNA polymerase and optionally an African swine fever virus capping enzyme. In some embodiments, the cells comprise cells from a cell line selected from MA-104 cells, Vero cells, and BHK-1 cells. In some embodiments, the cells comprise BHK-1 cells that contain T7 RNA polymerase. In some embodiments, the cells comprise BHK-1 cells, Vero cells, and MA-104 cells that contain T7 RNA polymerase. [Brief description of the drawings]

[0016] [Figure 1A] Domains of human NoV VP1 capsid protein. VP1 can be subdivided into shell (S) and protruding (P) domains. The P domain is further broken down into P1 and P2 subdomains. [Figure 1B] Surface display of NoV capsid with the S domain of VP1 (green) and the P1 (cyan) and P2 (blue) subdomains identified by color. [Figure 1C]Ribbon representation of NoV VP1 dimers: S (green), P1 (cyan), and P2 (blue). [Diagram 2] Plasmids carrying modified segment 7 (NSP3) cDNA were used to generate recombinant (r)SA11 viruses expressing portions of the human NoV VP1 protein. Schematic showing nucleotide positions in the coding sequence of NSP3 (nonstructural protein 3), porcine teschovirus 2A element (2A), 3xFLAG (3FL), 1xFLAG (1FL) or 6xHistidine (6xHis) tags, and / or thrombin cleavage site (Th), as well as complete VP1, or P2 and P subdomains. Red arrows indicate the position of the 2A translation stop restart site, and stars indicate the end of the ORE (open reading frame). Sizes of the encoded NSP3 and VP1 products (in number of encoded amino acids (aa)) are presented in brackets. T7 (T7 RNA polymerase promoter sequence), Rz (Hepatitis D virus ribozyme), UTR (untranslated region). [Figure 3A] Characterization of rSA11 virus expressing a FLAG-tagged region of NoV VP1 protein. Double-stranded RNA was harvested from rSA11-infected MA104 cells, separated by gel electrophoresis, and detected by ethidium bromide staining. Genomic segments 1 to 11 of rSA11 / wt (wt, wild type) are labeled. The size (in kilobase pairs, kbp) of the modified segment 7 RNA (black arrow) is indicated. [Figure 3B] Plaque assays were performed using MA104 cells and detected by crystal violet staining. [Figure 3C] The mean diameter values ​​of rSA11 plaques are shown with 95% confidence intervals (black lines). [Figure 3D] The titers achieved by the rSA11 isolates were determined by plaque assay (plaque forming units, PFU). [Figure 3E]Whole cell lysates (WCLs) were prepared from MA104 cells infected with rSA11 virus and examined by immunoblot assay using FLAG antibodies to detect VP1 protein products (P2, P, VP1), the 2A read-through product [red asterisk], and antibodies specific for RV NSP3, VP6, the porcine teschovirus 2A element, and b-actin. Protein molecular weight marker (MWM) sizes (in kDa) are indicated. [Figure 4A] Characterization of rSA11 viruses expressing His-tagged NoV capsid proteins. dsRNA was recovered from MA104 cells infected with plaque-purified rSA11 isolates expressing His-tagged proteins, separated by gel electrophoresis, and detected by ethidium bromide staining. RNA segments of rSA11 / wt are labeled 1-11. The size (kbp) of modified segment 7 RNA (black arrow) of rSA11 isolates is indicated. [Figure 4B] Plaque assays were performed using MA104 cells and detected by crystal violet staining. [Figure 4C] Note the mean plaque diameter values ​​with 95% confidence intervals (black lines). [Figure 4D] The titers achieved by the rSA11 isolates were determined by plaque assay. [Figure 4E] Whole cell lysates (WCLs) were prepared from MA104 cells infected with rSA11 virus and examined by immunoblot assay using anti-6xHis antibodies to detect the VP1 protein products (P and VP1), as well as antibodies specific for RV NSP3, VP6, porcine teschovirus 2A element (2A), and cellular beta-actin. Sizes (in kilodaltons) of protein markers (MWM) are indicated. [Figure 5A]Characterization of rSA11 / RIX NSP3 viruses expressing NoV P protein dsRNA was performed by recovering from MA104 cells infected with plaque-purified rSA11 and rSA11 / RIX NSP3-2A-P His isolates (plaques 1-3), separating by gel electrophoresis, and detecting by ethidium bromide staining. RNA segments of rSA11 / wt are labeled 1-11. The size (kbp) of modified segment 7 RNA (black arrow) of rSA11 isolates is indicated. [Figure 5B] Plaque assays were performed using MA104 cells and detected by crystal violet staining. [Figure 5C] The titers achieved by the rSA11 isolates were determined by plaque assay. [Figure 5D] Whole cell lysates (WCLs) were prepared from MA104 cells infected with rSA11 and rSA11 / RIX NSP3-2A-P His isolates and examined by immunoblot assay using anti-6xHis antibodies to detect the P protein, the 2A read-through product, and antibodies specific for RV SA11 NSP3, VP6, the porcine teschovirus 2A element (2A), and cellular beta-actin. [Figure 6A]Dimerization of NoV capsid proteins expressed by rSA11. (A) MA104 cells were mock infected or infected with rSA11 / wt or rSA11 / NSP3-2A-fP2, rSA11 / NSP3-2A-fP, rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1f and incubated until 9 h pi when cells were harvested. Cell lysates were mixed with sample buffer containing sodium dodecyl sulfate and β-mercaptoethanol, incubated for 10 min at either 25°C or 95°C, resolved by Biorad electrophoresis on 4-20% polyacrylamide gels and blotted onto nitrocellulose membranes. Blots were probed with M2 FLAG antibody, guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies, or rabbit anti-B-actin monoclonal antibody. Primary antibodies were detected using HRP-conjugated secondary antibodies. The sizes (in kilodaltons, kDa or kD) of protein molecular weight markers (MWM) are indicated. [Figure 6B] MA104 cells were mock infected or infected with rSA11 / wt or rSA11 / NSP3-2A-PHis, rSA11 / NSP3-2A-VP1His, rSA11 / NSP3-2A-VP1ThHis at 9 h.pi and cells were harvested. Cell lysates were prepared as above, resolved by Biorad electrophoresis on 4-20% polyacrylamide gels and blotted onto nitrocellulose membranes. Blots were probed with mouse anti-6xHis antibody, guinea pig polyclonal anti-NSP3 or anti-VP6 antibody, or rabbit anti-B-actin monoclonal antibody. Primary antibodies were detected using HRP-conjugated secondary antibodies. Sizes (kilodaltons) of protein markers (MWM) are indicated. [Figure 7A]Properly folded NoV VP1 capsid protein expressed from rSA11 strain. (A) Lysates prepared from MA104 cells infected with rSA11 / wt, rSA11 / NSP3-2A-fVP1, rSA11 / NSP3-2A-VP1f, and rSA11 / NSP3-2A-VP1His viruses were analyzed by immunoprecipitation (IP) assay using a NoV VP1-specific monoclonal antibody (anti-NoV GII.4 NVB43.9, absolute antibody) that recognizes a conformation-dependent epitope on the folded VP1 protein. Antigen-antibody complexes were retrieved by use of magnetic IgA / G beads, separated by gel electrophoresis, and blotted onto nitrocellulose membranes. Blots were probed with anti-FLAG and anti-6xHis antibodies to detect immunoprecipitated VP1 protein, and with guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies, or rabbit anti-B-actin monoclonal antibody. Blue arrows indicate immunoprecipitated VP1 protein. Ig light chain (Ig / L) and Ig heavy chain (IgH). [Figure 7B] Lysates were similarly analyzed with an NSP2-specific mouse monoclonal antibody (#171), and blots were probed with mouse anti-NSP2 antibody (#516) to detect immunoprecipitated NSP2 protein, guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies, or rabbit anti-B-actin monoclonal antibody. The positions of molecular weight markers (MWM) in kDa are indicated. [Figure 8A] Genetic stability of the rSA11 strain expressing NoV proteins. The rSA11 strain was serially passaged five times (P1–P5) in MA104 cells. (A) Genomic RNA was recovered from infected cell lysates and analyzed by gel electrophoresis. The positions of the viral genome segments are labeled. The position of the modified segment 7 (NSP3) dsRNA introduced into the rSA11 strain is indicated by a black arrow. [Figure 8B]Genomic RNA was harvested from cells infected with lysates at three dilutions (1:10, 1:100, and 1:1000) and analyzed by gel electrophoresis. Genetic stability of modified segment 7 (NSP3) dsRNA of rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1His resulted in rearranged RNA upon serial passaging (indicated by red arrows). [Figure 8C] Genomic RNA was harvested from cells infected with lysates at three dilutions (1:10, 1:100, and 1:1000) and analyzed by gel electrophoresis. Genetic stability of modified segment 7 (NSP3) dsRNA of rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1His resulted in rearranged RNA upon serial passaging (indicated by red arrows). [Figure 8D] Genomic RNA prepared from large (L) and small (S) plaques isolated from P5 lysates of rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1His viruses. Rearranged segment 7 RNAs are indicated as fVP1 / R1, fVP1 / R2, and VP1 His / R (red arrows). [Figure 8E] Genomic RNA prepared from large (L) and small (S) plaques isolated from P5 lysates of rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1His viruses. Rearranged segment 7 RNAs are indicated as fVP1 / R1, fVP1 / R2, and VP1 His / R (red arrows). [Figure 8F] The organization of the rearranged segment 7 RNA(R) sequence determined by sequencing cDNA prepared from the rearranged RNA. Sequence deletions are indicated by dashed lines. [Figure 9A]Characterization of rSA11 variants generated from rSA11 viruses modified to express NoV VP1. Genomic RNA was recovered from rSA11 / NSP3-2A-fVP1 and rSA11 / NSP3-2A-VP1His infected cell lysates and analyzed by gel electrophoresis. The positions of viral genome segments are labeled. The position of the modified segment 7 (NSP3) dsRNA introduced into the rSA11 strain is indicated by a black arrow, and the generation of random variants is indicated by a red arrow. [Figure 9B] Whole cell lysates (WCLs) were prepared from MA104 cells infected with mutant rSA11 viruses and examined by immunoblot assay using antibodies specific for RV NSP3, VP6, and cellular beta-actin. Probing with NSP3 antiserum reveals numerous NSP3 protein bands. [Figure 9C] Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9D] Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9E] Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9F] Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9G]Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9H] Genomic RNA was recovered from cells infected with large (L) and small (S) plaques isolated from the fVP1 variant pools (V1–V4) and the VP1His variant pools (V5–V6) and analyzed by gel electrophoresis (V: variants). [Figure 9I] The organization of the rearranged segment 7 RNA (designated R) sequence as determined by sequencing cDNA made from the mutated segment 7 RNA. The sequence deletion is indicated by a dashed line. The size of the rearranged mutant segment is indicated in brackets. [Figure 10A] Effect of genome size on RV particle density. (A-B). MA104 cells were infected with rSA11 / wt, rSA11 / NSP3-fP2, rSA11 / NSP3-fP, rSA11 / NSP3-fVP1, rSA11 / NSP3-PHis, and rSA11 / NSP3-VP1His viruses at an MOI of 5. At 12 hours pi (post-infection), cells were harvested, lysed by treatment with non-ionic detergent, and treated with EDTA to convert RV virions into DLPs. DLPs were banded by centrifugation on a CsCl gradient, and their density (g / cm3) was determined by use of a refractometer. Particle densities are shown in the tables embedded in Figures 10A and 10B. [Figure 10B]Effect of genome size on RV particle density. (A-B). MA104 cells were infected with rSA11 / wt, rSA11 / NSP3-fP2, rSA11 / NSP3-fP, rSA11 / NSP3-fVP1, rSA11 / NSP3-PHis, and rSA11 / NSP3-VP1His viruses at an MOI of 5. At 12 hours pi (post-infection), cells were harvested, lysed by treatment with non-ionic detergent, and treated with EDTA to convert RV virions into DLPs. DLPs were banded by centrifugation on a CsCl gradient, and their density (g / cm3) was determined by use of a refractometer. Particle densities are shown in the tables embedded in Figures 10A and 10B. [Figure 10C] Electrophoretic profiles of dsRNA genomes of DLPs recovered from the CsCl gradient. RNA in panel C is from the DLP in panel A (Figure 10A), and RNA in panel D (Figure 10C) is from the DLP in panel B. RNA segments of rSA11 / wt are labeled 1-11. The position of modified segment 7 RNA is indicated by a black arrow, and red arrows indicate the variants generated in the samples. [Figure 10D] Electrophoretic profiles of dsRNA genomes of DLPs recovered from the CsCl gradient. RNA in panel C is from the DLP in panel A (Figure 10A), and RNA in panel D (Figure 10C) is from the DLP in panel B. RNA segments of rSA11 / wt are labeled 1-11. The position of modified segment 7 RNA is indicated by a black arrow, and red arrows indicate the variants generated in the samples. [Figure 11]Plasmid carrying modified segment 7 (NSP3) cDNA used to generate rSA11 encoding the SARS-CoV-2 S1 protein. Schematic showing nucleotide positions of coding sequences for NSP3, porcine teschovirus 2A element, 3x or 1xFLAg (GL), 6xHis (His) and complete S1. Red arrow indicates position of 2A translation stop-restart site and asterisk indicates end of ORE. Sizes of encoded NSP3 and S1 proteins (in terms of number of amino acids (aa) encoded sequences) are shown in brackets. T7 (T7 RNA polymerase promoter sequence), Rz (Hepatitis D virus ribozyme), UTR (untranslated region). [Figure 12A] Characterization of rSA11 virus expressing SARS CoV-2 S1 protein. dsRNA was recovered from MA104 cells infected with plaque-purified rSA11 isolates, separated by gel electrophoresis, and detected by ethidium bromide staining. RNA segments of rSA11 / weight (wt) are labeled 1-11. The size (Kbp) of segment 7 RNA (black arrow) of the rSA11 isolate is indicated. [Figure 12B] Cell lysates were prepared from cells infected with rSA11 virus 9 at 9 hours post-infection (hpi) and examined by immunoblot assay using anti-FLAG and anti-6xHis antibodies to detect S protein, and the same blots were reprobed with antibodies specific for SARS CoV-2 S1 protein, RV NSP3, VP6 and cellular beta-actin. [Figure 12C] Plaque assays were performed using MA104 cells and detected by crystal violet staining. [Figure 12D] The titers achieved by the rSA11 isolates were determined by plaque assay. [Figure 13]The SARS CoV-2 S1 protein expressed from the rSA11 virus is glycosylated. Whole cell lysates were prepared from cells infected with rSA11 virus at 9 h.pi, treated with or without Endo H reagent, and examined by immunoblot assay using anti-FLAG and anti-6xHis antibodies to detect S1 protein, and the same blot was reprobed with an antibody specific for SARS CoV-2 S1. The immunoblot was also probed with antibodies specific for RV NSP3 and VP6, and the same blot was reprobed with an antibody specific for cellular beta-actin. [Figure 14A] The SARS CoV-2 S1 protein expressed from the rSA11 virus can bind to the human ACE-2 receptor. Lysates prepared from MA104 cells infected with rSA11 / wt and rSA11 / NSP3-2A-S1 viruses were examined by co-immunoprecipitation assay using recombinant ACE-2 human IgG protein. Protein-antibody complexes were collected using protein IgA / G beads, separated by gel electrophoresis, blotted onto nitrocellulose membranes and probed with anti-FLAG and anti-6xHis antibodies, SARS CoV-2 S1 antibodies, RV, NSP3, VP6 and antibodies specific for cellular beta-actin. [Figure 14B] The SARS CoV-2 S1 protein expressed from the rSA11 virus can bind to the human ACE-2 receptor. Lysates prepared from MA104 cells infected with rSA11 / wt and rSA11 / NSP3-2A-S1 viruses were examined by co-immunoprecipitation assay using recombinant ACE-2 human IgG protein. Protein-antibody complexes were collected using protein IgA / G beads, separated by gel electrophoresis, blotted onto nitrocellulose membranes and probed with anti-FLAG and anti-6xHis antibodies, SARS CoV-2 S1 antibodies, RV, NSP3, VP6 and antibodies specific for cellular beta-actin. [Figure 15]Localization of SARS CoV-2 S1 protein in RV-infected cells. MA104 cells were mock infected or infected with recombinant SA11 viruses: wt, NSP3-2A-S1f. At 9 h.pi, cells were fixed in 3.7% formaldehyde. Then, all cells were incubated with rabbit S1 antibody, mouse NSP2 antibody, followed by Alexa488 anti-rabbit iIgG (green) and TRITC anti-mouse IgG (red) to detect the location of S1 and NSP2 proteins in infected cells. Nuclei were detected by staining with DAPI. Cells were analyzed by Echo Revolve fluorescence microscope (20x objective) using fluorescein isothiocyanate and tetramethylrhodium isothiocyanate windows. [Figure 16A] Genetic stability of the rSA11 strain expressing the SARS CoV-2 S1f protein. The rSA11 strain expressing the S1 protein was serially passaged five times (P1-P5) in MA104 cells. Genomic RNA was recovered from infected cell lysates and analyzed by gel electrophoresis. The positions of the viral genome segments are labeled. The position of the modified segment 7 (NSP3) dsRNA introduced into the rSA11 strain is indicated by a black arrow. [Figure 16B] Lysates prepared from MA104 cells infected with rSA11 / wt and serially passaged SA11 / NSP3-2A-S1f viruses (P1 to P5) were examined by immunoblot assay and probed with FLAG antibody, SARS CoV-2 S1 antibody, and antibodies specific for RV, NSP3, VP6, and cellular beta-actin. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] Genetic analyses of the entire genome or individual viral genes have led to the identification of seven NoV genogroups, and sequence studies of the capsid protein VP1 and the RNA-dependent RNA polymerase have identified more than 30 genotypes (7). Human NoV disease is mostly caused by strains in genogroups I (GI), II (GII), and IV (GIV) (11). However, GII is the main genogroup causing human disease worldwide. The GII.4 genotype has predominated since the 1990s and accounts for 55–85% of all human NoV disease (12–14). There is a high degree of genetic diversity within genogroups, and infections caused by strains in one genogroup generally do not confer protection against other genogroups, making it difficult to develop an effective universal vaccine (15).

[0018] The NoV genome is approximately 7.6 kbp and contains three open reading frames (ORF1-3), with ORF-3 encoding the major structural protein, VP1. The viral capsid is composed of 90 VP1 dimers, which are composed of the shell (S) domain and the protruding (P) domain (16). The S domain is the most highly conserved VP1 domain, while the P domain is more variable and contains the P1 and P2 subdomains, which are discontinuous in primary amino acid sequence. The highly variable P2 subdomain represents the immunodominant region of the protein, is the target of neutralizing antibodies, and contains the defined receptor binding site of NoV (17,18). The immune response following NoV infection can be confirmed by measuring serum human histo-blood group antigens (19,20).

[0019] Three types of NoV vaccines have been developed: non-replicating virus-like particles (VLPs), P particles, and recombinant adenovirus-vectored vaccines (21-23). ​​Most vaccine studies have been conducted in adults (24-26), while phase II trials of a GI.1 and GII.4 bivalent vaccine performed in children and infants to test immunogenicity and safety showed that the preparation induced robust immune responses (27). In an attempt to simultaneously prevent both RV and NoV disease, a trivalent vaccine containing two NoV VLPs (GII.4 and GI.3) and an oligomeric RV VP6 was tested in animal models (28,29). RV VP6 is a highly conserved protein that can induce significant immune responses that protect against RV infection and can act as an adjuvant to increase immune responses to NoV antigens (30).

[0020] Recent development of RV reverse genetics systems has led to the generation of recombinant RVs as expression vectors for foreign proteins (31-36). The RV genome consists of 11 segments of dsRNA with a total size of 18.5 kbp. All segments contain a single ORE, except for segment 11. These encode six structural (VP) or six nonstructural (NSP) viral proteins (37). Genome segment 7 of group A RVs (RVA) encodes a 36 kDa protein, NSP3, an RNA-binding protein that acts as a translation enhancer of viral (+) mRNA in infected cells (38,39).

[0021] To use RV as a vaccine expression vector, we explored the possibility of generating an RV-SARS-CoV-2 vaccine by modifying the NSP3 ORF with the use of the 2A translation element to express a region of the SARS CoV-2 spike protein (31). Well-grown, genetically stable recombinant RVs expressing domains of the SARS CoV-2 S protein have been generated, and the NSP3 products of these viruses are functional, capable of dimerizing, and capable of inducing nuclear localization of cellular poly(A) binding protein (31,32,40). Thus, we developed RV as an effective vector system to generate a mixed RV-Nov vaccine that can induce immune protection against both RV and NoV infection.

[0022] Polynucleotides In one aspect of the present disclosure, a polynucleotide is provided, comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. The inventors herein disclose that in some embodiments, the polynucleotide encodes a positive-sense viral transcript and can be expressed in a cell to produce a functional gene product. Thus, in some embodiments, the polynucleotide is operably linked to a promoter, for example, a T3 promoter (SEQ ID NO: 31) or a T7 promoter (SEQ ID NO: 30).

[0023] As used herein, "operably linked" refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship between a transcriptional regulatory element (promoter) and a transcribed sequence. For example, a promoter is operably linked to a coding sequence if it stimulates or regulates the transcription of the coding sequence in an appropriate cell. Generally, a promoter transcriptional regulatory element operably linked to a sequence is physically adjacent to the transcribed sequence, i.e., cis-acting. However, some transcriptional regulatory elements, such as enhancers, do not need to be physically adjacent or located in close proximity to the coding sequence whose transcription is enhanced. Exemplary promoters include the T7 bacteriophage promoter (SEQ ID NO: 14) and the T3 bacteriophage promoter (SEQ ID NO: 15). Suitable promoters can be selected from promoters known in the art. In some embodiments, the cell is a mammalian cell and is selected from MA-104 cells, Vero cells, and BHK-1 cells.

[0024] In some embodiments, the RV NSP3 protein is SEQ ID NO:1 or a sequence having at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to SEQ ID NO:1.

[0025] In some embodiments, a sequence encoding NSP3, e.g., SEQ ID NO: 9, further comprises a heterologous polynucleotide fused to the 3' end of the sequence, such that the heterologous polynucleotide encodes a protein or peptide in-frame with the NSP3 sequence, thereby allowing transcription of a single mRNA encoding both NSP3 and the heterologous polynucleotide. In some embodiments, a polynucleotide comprising a sequence encoding NSP3 and a heterologous polynucleotide comprises a sequence encoding a cleavage site. In some embodiments, the cleavage site is a self-cleaving peptide, e.g., the porcine teschovirus 2A element (SEQ ID NO: 13). Thus, in some embodiments, the disclosed compositions comprise a polynucleotide 5' to 3' encoding NSP3 fused in-frame to a sequence encoding a self-cleaving peptide, which is fused in-frame to a heterologous polynucleotide sequence encoding a peptide or protein. Thus, transcription and translation of such compositions results in the production in the cell of a fusion protein comprising a self-cleaving peptide fused to a peptide or protein encoded by a heterologous polynucleotide, e.g., the N- to C-terminus of the RV NSP3 protein fused to SEQ ID NO: 13, and post-translationally, self-cleavage of the fusion protein results in two separate proteins: (1) a functional RV NSP3 protein and (2) the protein or peptide encoded by the heterologous polynucleotide. In some embodiments, the compositions further comprise a sequence encoding a linker, e.g., a sequence encoding a flexible linker, located 3' and in frame with the sequence encoding the NSP3 protein and located 5' to the cleavage site. Without being limited to any theory or mechanism, the inventors believe that adding a flexible linker between the NSP3 protein and the cleavage site improves cleavage. In some embodiments, the linker is a (GAG) n linker (also called GAG linker), where n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, or (GSG) n linker (also called a GSG linker), where n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0026] In some embodiments, the sequence encoding the cleavage site encodes a protease cleavage site, such as a thrombin cleavage site, e.g., SEQ ID NO:12.

[0027] In some embodiments, the heterologous polynucleotide comprises a sequence encoding at least one carrier moiety, which in some embodiments is a secreted peptide, such as an interleukin 2 secreted protein, a SARS CoV-2 S1 secreted protein, or a ligand of a cell surface receptor, such as immunoglobulin IgG, a fetal receptor FcRn.

[0028] The inventors further contemplate that the heterologous polynucleotide sequences described above include sequences encoding proteins or peptides derived from an infectious organism, e.g., NoV or SARS-CoV-2. Thus, in some embodiments, the disclosed compositions include sequences encoding RV NSP3 fused in-frame to a heterologous polynucleotide encoding a NoV protein or peptide, e.g., NoV.

[0029] In some embodiments, the NoV VP1 protein has an amino acid sequence selected from SEQ ID NO: 24 or 26. In some embodiments, the heterologous polynucleotide encodes NoV VP1 and comprises SEQ ID NO: 25. In some embodiments, the Norovirus protein is selected from SEQ ID NO: 24 or 26 and 80-84.

[0030] The inventors further disclose herein an exemplary rotavirus NSP3 norovirus fusion protein. Accordingly, in another aspect of the disclosure, further polynucleotides are provided. In some embodiments, the polynucleotides encode a protein selected from SEQ ID NOs: 2-11, or encode a sequence having at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to a sequence selected from SEQ ID NOs: 2-11.

[0031] In some embodiments, the polynucleotide comprises SEQ ID NOs: 13-22, or a sequence having at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to any one of SEQ ID NOs: 13-22.

[0032] infectious particles In another aspect of the present disclosure, an infectious particle is provided. In some embodiments, the infectious particle comprises a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the infectious particle is produced by introducing a polynucleotide comprising a sequence encoding a RV NSP3 protein and a heterologous polynucleotide into a cell.

[0033] As used herein, "infectious particle" refers to any particle capable of causing an infection in an organism or cell. Exemplary infectious particles include, but are not limited to, virus particles, virions, and the like. The terms "virus," "virus particle," and "virion" may be used interchangeably herein.

[0034] In some embodiments, the infectious particle is RV, for example, RV strain SA11.

[0035] Without wishing to be limited, the present disclosure provides a composition comprising a polynucleotide encoding a RV protein operably linked to a promoter, e.g., the T7 promoter (SEQ ID NO: 30). In some embodiments, the composition can be used in reverse genetic techniques to generate a recombinant RV, e.g., recombinant RV strain RIX4414. Thus, in some embodiments, a recombinant RV may comprise a composition of the present disclosure.

[0036] In some embodiments, the cell is selected from a BHK-1 cell, an MA104 cell, and a Vero cell, hi some embodiments, the cell is a BHK-1 cell that expresses T7 polymerase, also known as a BHK-T7 cell.

[0037] Pharmaceutical Compositions The inventors herein disclose compositions, methods and systems useful for producing recombinant rotaviruses (RVs) that may be suitable for administration to a subject. Thus, in another aspect of the disclosure, a pharmaceutical composition is provided. In some embodiments, the pharmaceutical composition comprises an infectious particle comprising a polynucleotide comprising a sequence encoding a RV NSP3 protein and a heterologous polynucleotide. In some embodiments, the pharmaceutical composition comprises an infectious particle produced by transfecting a cell with a polynucleotide comprising a sequence encoding a recombinant RV NSP3 protein and a heterologous polynucleotide.

[0038] The compositions and methods disclosed herein may be administered as pharmaceutical compositions, and thus pharmaceutical compositions incorporating the compounds are considered to be embodiments of the compositions disclosed herein. Such compositions may take any pharmaceutically acceptable physical form, and illustratively, they may be pharmaceutical compositions for oral administration. Such pharmaceutical compositions contain an effective amount of the disclosed compositions, where the effective amount refers to the daily dose of the composition administered. Each dosage unit may contain a daily dose of a given composition, or each dosage unit may contain a fraction of the daily dose, for example, a half or a third of the dose. The amount of each composition contained in each dosage unit may depend in part on the identity of the particular composition selected for therapy and other factors, such as the indication for which it is given. The pharmaceutical compositions disclosed herein may be formulated to provide a rapid, sustained or delayed release of the active ingredient after administration to a patient using well-known procedures.

[0039] The pharmaceutical composition may be utilized in a method of inducing an immune response or vaccinating against a pathogen, e.g., RV, NoV, SARS-CoV-2. As disclosed herein, the term "treatment" or "treating" means, for the referenced disease or disorder, alleviating symptoms, temporarily or permanently eliminating the cause of the resulting symptoms, and / or preventing or slowing the appearance of the resulting symptoms, or reversing the progression or severity, respectively. Thus, the methods disclosed herein encompass both therapeutic and prophylactic administration. By way of example, a subject may be at risk of infection with a pathogen, e.g., RV, NoV, and administration of a pharmaceutical composition of the present disclosure induces a protective immune response or vaccinates against the pathogen.

[0040] As used herein, the term "effective amount" refers to an amount or dose of a composition that, upon administration to a subject in a single or multiple doses, provides a desired effect in a subject undergoing diagnosis or treatment. The disclosed methods may include administering an effective amount of a composition of the present disclosure (e.g., present in a pharmaceutical composition) to induce an immune response against a pathogen, e.g., RV, NoV, SARS-CoV-2, or to vaccinate against a pathogen.

[0041] The effective amount can be easily determined by the attending diagnostician, as one skilled in the art, by using known techniques and by observing results obtained under similar circumstances. In determining the effective amount or dose of the composition to be administered, numerous factors may be considered by the attending diagnostician, such as the species of the subject; the size, age and general health of the subject; the degree of involvement or severity of the disease or disorder involved; the response of the individual subject; the particular composition to be administered; the mode of administration; the bioavailability characteristics of the administered formulation; the dose regimen selected; the use of concomitant medications; and other relevant circumstances.

[0042] Oral administration is an exemplary route of administration for the compositions and methods disclosed herein. Other exemplary routes of administration include transdermal, percutaneous, intravenous, intramuscular, intranasal, buccal, intrathecal, intracerebral, or intrarectal routes. The route of administration may vary and may be limited by the physical properties of the compound used, as well as the convenience of the subject and the caregiver.

[0043] As those skilled in the art will appreciate, suitable formulations include those suitable for more than one route of administration. For example, a formulation may be suitable for both intrathecal and intracerebral administration. Alternatively, suitable formulations include those suitable for only one route of administration, as well as those suitable for one or more routes of administration but not suitable for one or more other routes of administration. For example, a formulation may be suitable for oral, transdermal, percutaneous, intravenous, intramuscular, intranasal, buccal and / or intrathecal administration, but not suitable for intracerebral route.

[0044] The internal components of the pharmaceutical compositions and the methods of formulation are conventional. Conventional methods of formulation used in pharmacy may be used herein. All conventional types of compositions may be used, including tablets, chewable tablets, capsules, liquids, parenteral solutions, nasal sprays or powders, troches, suppositories, transdermal patches, and suspensions. In general, the compositions contain from about 0.5% to about 50% of the compound in total, depending on the desired dose and the type of composition used. However, the amount of the compound is best defined as an "effective amount", i.e., the amount of compound that provides the desired dose to a patient in need of such treatment. The activity of the compounds used in the compositions and methods disclosed herein is not believed to be highly dependent on the nature of the composition, and thus the compositions may be selected and formulated primarily or solely for convenience and economy.

[0045] Capsules are prepared by mixing the compound with a suitable diluent and filling the appropriate amount of the mixture into capsules. Conventional diluents include inert powdered substances (e.g., starch), powdered cellulose (especially crystalline cellulose and microcrystalline cellulose), sugars (e.g., fructose, mannitol, and sucrose), grain flours, and similar edible powders.

[0046] Tablets are prepared by direct compression, wet granulation or dry granulation. These preparations usually incorporate (besides the compound) diluents, binders, lubricants and disintegrants. Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphate or sulfate, inorganic salts (e.g., sodium chloride) and powdered sugar. Powdered cellulose derivatives may also be used. Typical tablet binders include substances such as starch, gelatin, and sugars (e.g., lactose, fructose, glucose, etc.). Natural and synthetic gums may also be used, including acacia, alginates, methylcellulose, polyvinylpyrrolidone, etc. Polyethylene glycol, ethylcellulose and waxes may also function as binders.

[0047] Tablets can be coated with sugar, for example, as a flavor enhancer and sealant.The compound can also be formulated as a chewable tablet by using large amounts of palatable substances, such as mannitol, in the formulation.Fast-dissolving tablet-like formulations can also be used, for example, to ensure that patients consume the dosage form and to avoid the difficulties some patients experience when swallowing solid foods.

[0048] Lubricants can be used in tablet formulations to prevent the tablet and punches from sticking to the die. The lubricant may be selected from slippery solids such as talc, magnesium and calcium stearates, stearic acid, and hydrogenated vegetable oils.

[0049] Tablets can also contain disintegrants. Disintegrants are substances that expand when wet, disintegrating the tablet and releasing the compound. These include starch, clay, cellulose, algin and gum. As further examples, corn starch and potato starch, methylcellulose, agar, bentonite, wood cellulose, powdered natural sponge, cation exchange resin, alginic acid, guar gum, citrus pulp, sodium lauryl sulfate and carboxymethylcellulose can be used.

[0050] The composition may be formulated as an enteric formulation, for example, to protect the active ingredient from the strong acidity of the stomach. Such a formulation may be created by coating the solid dosage form with a film or polymer that is insoluble in an acidic environment and soluble in a basic environment. Illustrative films include cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate.

[0051] Transdermal patches can also be used to deliver the compounds. Transdermal patches can include a resinous composition in which the compound is dissolved or partially dissolved, and a film that protects the composition and keeps the resinous composition in contact with the skin. Other more complex patch compositions can also be used, such as those with a membrane that is perforated with multiple holes through which the drug is pushed out by osmotic action.

[0052] As one of skill in the art will also appreciate, formulations may be prepared with materials (e.g., active excipients, carriers (e.g., cyclodextrins), diluents, etc.) that have properties (e.g., purity) that make the formulation suitable for administration to humans. Alternatively, formulations may be prepared with materials that have purity and / or other properties that make the formulation suitable for administration to non-human subjects, but not suitable for administration to humans.

[0053] Methods for generating recombinant rotavirus (RV) The inventors have generated recombinant RVs using a reverse genetics system in a SA11 background by introducing a polynucleotide encoding an additional heterologous protein, e.g., NSP3 fused to a NoV protein. Thus, in another aspect of the disclosure, a method of generating an RV in vitro is provided. In some embodiments, the method includes introducing a polynucleotide comprising a sequence encoding an RV NSP3 protein and a heterologous polynucleotide into a cell, allowing the cell to express the polynucleotide, incubating the cell for a sufficient time to produce an RV, and harvesting the virus produced by the cell to generate the RV in vitro. To successfully generate a competent RV, each of the eleven RV genome segments must be expressed in the cell. Thus, in some embodiments, the method further comprises, prior to the enabling step, introducing one or more additional polynucleotides into the cell, the one or more additional polynucleotides comprising a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4 and NSP5, each sequence encoding an RV protein being operably linked to a promoter. In some embodiments, the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4 and NSP5. In some embodiments, the one or more additional polynucleotides are 10 separate polynucleotides comprising a sequence encoding an RV protein each selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4 and NSP5. Thus, in some embodiments, the method comprises introducing a polynucleotide comprising a sequence encoding each of the eleven rotavirus proteins, each encoded in a separate polynucleotide in some embodiments. In some embodiments, the one or more additional polynucleotides comprise a sequence encoding a capping enzyme operably linked to a promoter.In some embodiments, the capping enzyme is African swine fever virus capping enzyme (encoded by SEQ ID NO:27).

[0054] cell The inventors herein disclose cells that contain the disclosed polynucleotides and can also be used in the disclosed methods and systems. Thus, in another aspect of the disclosure, a cell is provided. In some embodiments, the cell comprises a polynucleotide that comprises a sequence encoding a recombinant RV NSP3 protein and a heterologous polynucleotide. In some embodiments, the cell is selected from MA104 cells, Vero cells, and BHK-1 cells.

[0055] RV vaccine strains are traditionally grown using Vero cells. This method of producing RV has been found to be suitable for producing RV for administration to subjects. Thus, in some embodiments, the cells are Vero cells.

[0056] In some embodiments, the cells disclosed herein further comprise a heterologous RNA polymerase, which binds to a promoter in the disclosed compositions and catalyzes sequence-dependent RNA polymerization based on a polynucleotide when the polynucleotide is introduced into the cell. As used herein, "heterologous RNA polymerase" refers to an RNA polymerase that is introduced into a cell via molecular biology techniques, such as transduction, transfection, lipofection, etc. In some embodiments, the heterologous RNA polymerase comprises T7 bacteriophage RNA polymerase or T3 bacteriophage RNA polymerase, more commonly known simply as T7 polymerase and T3 polymerase, respectively.

[0057] Thus, in some embodiments, the cells further comprise T7 RNA polymerase or T3 RNA polymerase. In some embodiments, such cells are referred to as, for example, BHK-T7 cells, because they are derived from BHK-1 cells, but express a heterologous RNA polymerase, T7 bacteriophage RNA polymerase. Thus, as used herein, a "BHK-T7 cell" is a BHK-1 cell that expresses a heterologous RNA polymerase, T7 bacteriophage RNA polymerase.

[0058] Methods for Inducing an Immune Response The present disclosure provides pharmaceutical compositions comprising infectious particles that may contain heterologous antigens that, when administered to a subject, may be protective against natural infection by the pathogen from which the antigen is derived. Thus, in another aspect of the present disclosure, a method of eliciting an immune response against one or more pathogens is provided. In some embodiments, the method comprises administering to a subject a pharmaceutical composition comprising an infectious particle that includes a polynucleotide that includes a sequence encoding an RV NSP3 protein and a heterologous polynucleotide to elicit an immune response against one or more pathogens.

[0059] In some embodiments, the methods include administering to a subject a pharmaceutical composition comprising infectious particles generated by transfecting a cell with a polynucleotide comprising a sequence encoding an RV NSP3 protein and a heterologous polynucleotide to elicit an immune response against one or more pathogens.

[0060] As used herein, "inducing an immune response" refers to the generation of an inflammatory response, which is an increase in the activity level or number of innate or adaptive immune cells in response to administration. Inducing an immune response can also be measured as an increase in hormonal immunity to the administered antigen in a subject. Suitable assays for measuring both the activation and increase in the number of innate / adaptive cells and / or the increase in hormonal immunity to an antigen are known in the art. For example, cellular immunity can be measured by an increase in the number of activated T cells in a subject, for example, by flow cytometry. Inducing a hormonal immune response can be measured by an antibody that binds to the antigen administered to the subject, and many methods are known in the art.

[0061] How to vaccinate a subject In another aspect of the present disclosure, a method of vaccinating a subject against one or more pathogens is provided. In some embodiments, the method comprises administering a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein and a heterologous polynucleotide. In some embodiments, the method comprises administering a pharmaceutical composition comprising an infectious particle produced by transfecting a cell with a polynucleotide comprising a sequence encoding a RV NSP3 protein and a heterologous polynucleotide.

[0062] As used herein, "vaccinate" or "vaccination" includes administering to a subject an antigen derived from a pathogen to stimulate an immune response in the subject to the antigen, thereby providing some level of immunity to the pathogen such that the subject becomes infected with the pathogen. Thus, vaccination may reduce signs or symptoms of infection by the pathogen in the vaccinated subject, or may provide neutralizing immunity and prevent infection of the pathogen in the subject.

[0063] Systems, platforms and kits for producing recombinant rotaviruses (RVs) In another aspect of the disclosure, systems, platforms and kits for producing recombinant RVs are provided. In some embodiments, the systems, platforms or kits comprise a polynucleotide comprising a sequence encoding the RV NSP3 protein and a heterologous polynucleotide, and a cell capable of expressing the polynucleotide.

[0064] In some embodiments, the kits of the present disclosure include a polynucleotide comprising a sequence encoding an RV NSP3 protein and a heterologous polynucleotide, and a cell capable of expressing the polynucleotide. The inventors contemplate that the kits of the present disclosure may, in some embodiments, contain additional reagents necessary for introducing the polynucleotides of the present disclosure into cells, e.g., reagents for transfection, lipofection, electroporation, transduction, etc. Thus, in some embodiments, the kits of the present disclosure include reagents for in vitro production of recombinant rotavirus, e.g., according to the methods of the present disclosure.

[0065] Illustrative Embodiments 1. A recombinant RV comprising an RV and an insertion of up to 1.3 kbp of a foreign sequence, wherein the RV carrying the 1.3 bp insertion is genetically stable.

[0066] 2. The recombinant RV according to embodiment 1, wherein the RV is RIX4414.

[0067] 3. The recombinant RV of embodiment 1 or 2, wherein the insertion encodes at least one antigen of a non-RV virus selected from the group consisting of NoV, SARS-CoV-2, Astrovirus, Enterovirus and Hepatitis E.

[0068] 4. A recombinant RV according to any of embodiments 1 to 3, wherein the insertion further encodes at least one carrier moiety.

[0069] 5. The recombinant RV according to embodiment 4, wherein at least one carrier moiety is a secreted peptide (e.g., interleukin 2 secreted protein, SARS CoV-2 S1 secreted protein), or a ligand for a cell surface receptor, immunoglobulin IgG, fetal receptor FcRn).

[0070] 6. A recombinant RV according to any one of embodiments 1 to 5, wherein the insertion encodes the SARS-CoV-2 S1 protein.

[0071] 7. A recombinant RV according to any of embodiments 1 to 6, wherein the insertion encodes a NoV capsid protein.

[0072] 8. A vaccine comprising a recombinant RV according to any one of embodiments 1 to 7.

[0073] 9. The vaccine of embodiment 8, wherein the vaccine is for use in children.

[0074] 10. The vaccine of any of embodiments 8-9, wherein the vaccine further comprises at least one compound that stabilizes the recombinant RV.

[0075] 11. A recombinant RV comprising a sequence encoding an RV and a glycosylated exogenous capsid protein, the sequence being inserted into segment 7 RNA.

[0076] 12. The recombinant RV according to embodiment 11, wherein the RV is rSA11.

[0077] 13. The recombinant RV according to embodiments 11-12, wherein the exogenously encoded glycosylated protein is SARS-CoV-2 S1.

[0078] 14. A recombinant RV according to embodiments 11 to 13, wherein the exogenously encoded protein sequence comprises a C-terminal 1x-FLAG tag.

[0079] 15. The recombinant RV according to embodiments 11 to 14, further comprising at least one of the following: a pharma- ceutically acceptable excipient, stabilizer and / or carrier.

[0080] 16. A composition comprising a recombinant RV according to embodiment 15, further comprising an adjuvant.

[0081] 17. The composition of embodiment 16, wherein the adjuvant is an immunostimulatory oligonucleotide such as CpG, a polyacrylic acid polymer, dimethyldioctadecylammonium bromide, a sterol, a saponin, monophosphoryl lipid A or an analogue thereof, a quaternary amine, an aluminum hydroxide composition such as aluminum hydroxide gel, or a combination thereof.

[0082] 18. The composition according to any one of embodiments 15 to 17, wherein the composition comprises at least one compound that stabilizes recombinant RV.

[0083] 19. A method for treating a subject, comprising administering any of the compositions described in embodiments 15 to 19.

[0084] 20. The method of embodiment 19, wherein the subject is administered at least two doses of the composition of any one of embodiments 15 to 18, with an interval of at least 4 weeks between each dose.

[0085] 21. A cell comprising a recombinant RV according to any one of embodiments 1 to 14.

[0086] 22. The cell of embodiment 21, wherein the host cell expresses a glycosylated protein encoded by a recombinant RV. EXAMPLES

[0087] Example 1 - Recombinant Rotavirus Expressing Norovirus Proteins Materials and Methods cell culture Monkey embryonic kidney (MA104) cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (41). Baby hamster kidney cells (BHK-T7) constitutively expressing T7 RNA polymerase were provided by Dr. Ulla Buchholz, Laboratory of Infectious Diseases, NIAID, NIH, and propagated in Glasgow minimal essential medium (GMEM) containing 5% heat-inactivated FBS, 10% tryptone-peptide broth, 1% penicillin-streptomycin, 2% nonessential amino acids, and 1% glutamine (42). BHK-T7 cells were grown in medium supplemented with 2% Geneticin (Invitrogen) every other passage.

[0088] Plasmid construction Recombinant rSA11 was prepared using the plasmids pT7 / VP1SA11, pT7 / VP2SA11, pT7 / VP3SA11, pT7 / VP4SA11, pT7 / VP6SA11, pT7 / VP7SA11, pT7 / NSP1SA11, pT7 / NSP2SA11, pT7 / NSP3SA11, pT7 / NSP4SA11, and pT7 / NSP5SA11 [https: / / www.addgene.org / Takeshi_Kobayashi / ] (36) and pCMV / NP868R (33). Plasmid pT7 / NSP3-P2A-fUnaG was generated by fusing a DNA fragment containing the ORF of P2A-3xFL-UnaG to the 3′ end of the NSP3 ORF of pT7 / NSP3SA11 using the Takara In-Fusion cloning kit ( 32 ). A plasmid (pUC57 / MDA145_VP1) containing the full-length cDNA of the VP1 genome segment of NoV GII.4 strain MD145-12 (GenBank: AY032605.1) was purchased from Genewiz. Plasmids pT7 / NSP3-P2A-fP2, pT7 / NSP3-P2A-fP, and pT7 / NSP3-P2A-fVP1 were generated by replacing the UnaG ORF of pT7 / NSP3-P2A-fUnaG with the ORFs of the P2, P, and VP1 regions of the NoV VP1 capsid protein, respectively, by In-Fusion cloning. The plasmid backbone was generated by PCR amplification of pT7 / NSP3-P2A-fUnaG using the primer pair: Vector_For and Vector_Rev (Table 1). DNA fragments containing the P2, P, and VP1 coding sequences were amplified from pUC57 / MDA145_VP1 using primer pairs fP2_For and fP2_Rev, fP_For and fP_Rev, and fVP1_For and fVP1_Rev, respectively (Table 1). Plasma pT7 / NSP3-P2A-VP1f, pT7 / NSP3-P2A-P-His, pT7 / NSP3-P2A-VP1-His, and pT7 / NSP3-P2A-VP1-Th-His were prepared in the same manner.The plasmid backbone was generated by amplifying pT7 / NSP3-P2A-fUnaG with the primer pair: Vector P2A_For and Vector P2A_Rev (Table 1). DNA fragments containing VP1 with a C-terminal FLAG, or P, or VP1 with a C-terminal His tag were generated by PCR amplification of pUC57 / MDA145_VP1 with the primer pairs VP1-fFor and VP1-fRev, P-His_For and P-His_Rev, VP1-ThHis_For and VP1-ThHis_Rev, VP1-His_For and VP1-His_Rev, respectively (Table 1). The puc19 plasmid containing the RIX / NSP3-P2A-P-His insert under the control of the T7 transcription promoter (puc19 / T7 / RIX / NSP3-P2A-P-His) was purchased from Bio Basic Canada Inc. Transfection-quality plasmids were either commercially prepared (www.plasmid.com) or prepared using Qiagen plasmid purification kits. Primers were provided and sequenced by EuroFins Scientific.

[0089] Recombinant viruses The reverse genetic protocol used to generate recombinant RVs was described in detail above. Briefly, BHK-T7 cell monolayers in 12-well plates were transfected with SA11 pT7 plasmid and pCMV-NP868R using Mirus TransIT-LT1 transfection reagent. The transfection mixture contained 0.8ug of each of the 11 pT7 plasmids, except for pT7 / NSP2SA11 and pT7 / NSP5SA11, which were used at 3-fold higher levels. Two days after transfection, the BHK-T7 cells were overseeded with MA104 cells and the trypsin in the medium was adjusted to a final concentration of 0.5ug / ml. After 3 days, the BHK-T7 / MA104 cell mixture was freeze-thawed three times and the lysate was clarified by low speed centrifugation (800×g, 5 min). Recombinant viruses in clarified lysates were amplified by one passage on MA104 monolayers and recovered by plaque purification. Viral dsRNA was recovered from infected cell lysates by TRIzol extraction, resolved by electrophoresis on 10% polyacrylamide gels in Tris-glycine buffer, detected by staining with ethidium bromide, and visualized using a BioRad ChemiDoc MP Imaging System.

[0090] Plaque assay RV plaque assays were performed as previously described. To visualize plaques, cell monolayers with agarose overlays were incubated overnight with phosphate-buffered saline (PBS) containing 3.7% formaldehyde. The agarose overlay was then removed and the monolayers were stained with a solution of 1% crystal violet in 5% ethanol for 3 hours. The monolayers were then rinsed with water and air-dried. Plaque images were captured using a Bio-Rad ChemiDoc Imaging System, diameters were measured using ImageJ software, and results were analyzed by GraphPad Prism version 8. Statistical significance of differences in plaque size was determined using an unpaired Student's t-test and included 95% confidence intervals.

[0091] Immunoblot analysis MA104 cells were mock infected or infected with recombinant RV at 5 plaque-forming units (PFU) per cell and harvested 9 h.pi. Cells were washed with cold PBS, pelleted by centrifugation (5000×g, 10 min), and lysed by incubation on ice for 30 min in native lysis buffer (300 mM NaCl, 100 mM Tris-HCl, pH 7.4, 2% Triton X-100, and 1× EDTA-free protease inhibitor cocktail [Roche Complete]). For immunoblot assays, lysates were resolved by electrophoresis on 10% polyacrylamide gels and transferred to nitrocellulose membranes. After blocking with PBS containing 5% nonfat dry milk, the blots were probed with mouse monoclonal FLAG M2 (F1804, Sigma, 1:2000), mouse monoclonal anti-6xHis antibody (MCA1396GA, Bio-Rad, 1:1000), mouse 2A antibody (NBP2-59627, Novus, 1:1000), guinea pig polyclonal NSP3 (Lot 55068, 1:2000), VP6 (Lot 53963, 1:2000) antisera or rabbit monoclonal B-actin (8457S, Cell Signaling Technology (CST), 1:1000) antibody. Primary antibodies were detected using a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated secondary antibody (goat anti-mouse IgG (CST), goat anti-guinea pig IgG (KPL) or goat anti-rabbit IgG (CST)) or Alexa Fluor-conjugated antibody (goat anti-mouse Alexa647 antibody (CST)) in 2.5% nonfat dry milk. HRP signals were developed using Clarity Western ECL Substrate (Bio-Rad) and detected using a Bio-Rad ChemiDoc Imaging System, while Alexa Fluor signals were directly visualized using a Bio-Rad ChemiDoc Imaging System.

[0092] To evaluate the dimerization ability of NoV proteins expressed by rSA11 virus, cell lysates were adjusted to final concentrations of 1.5% sodium dodecyl sulfate and 3% β-mercaptoethanol and incubated for 10 min at 25° C. or 95° C. Proteins in the samples were then separated by electrophoresis on a 10% polyacrylamide gel and detected by immunoblot assay.

[0093] Immunoprecipitation assay Whole cell lysates (WCLs) were prepared from MA1 monolayers 9 h pi that were mock infected or infected with rSA11 virus as described above. Rabbit anti-NoV GII.4 monoclonal antibody [NVB43.9] (Ab00269-23.0, Absolute Antibody, final dilution 1:150) or NSP2 mouse polyclonal antibody (Lot 171, final dilution 1:200) were added to the cell lysates. After 18 h incubation at 4°C with gentle rocking, antigen-antibody complexes were collected using Pierce magnetic IgA / IgG beads (ThermoScientific), separated by gel electrophoresis, and blotted onto nitrocellulose membranes. Blots were probed with anti-FLAG antibody (1:2000) or anti-6xHis antibody (1:1000) to detect FLAG-tagged or His-tagged VP1 protein, and with NSP2 antibody (Lot#516, 1:2000) to detect NSP2 protein.

[0094] Genetic stability of rSA11 virus Viruses were serially passaged five times in MA104 cell monolayers using 1:1000, 1:100 or 1:10 dilutions of infected cell lysates prepared in serum-free DMEM medium. Cells were freeze-thawed three times in medium when the cytopathic effect reached completion (4-5 days) and lysates were clarified by low-speed centrifugation. Double-stranded RNA (dsRNA) was recovered from the clarified lysates by TRIzol extraction. Purified dsRNA was separated by electrophoresis on a 10% polyacrylamide gel and dsRNA bands were detected by ethidium bromide staining.

[0095] Isolation and sequencing of unstable variants Individual rSA11 variants were recovered from pools of serially passaged virus by plaque isolation.(41) The variants were amplified through a single passage in MA104 cells, and their genomic dsRNA was recovered by Trizol extraction. Full-length genomic segment 7 RNA in the samples was amplified with the segment-specific primer pair NSP3_5'UTR 5'GGCATTTAATGCTTTTCAGTG3' (sequence number 1) and NSP3_3'UTR 5'GGCCACATAACGCCCCTATAG3' (sequence number 2), and a short fragment from the C-terminus of the NSP3 ORF to the 3'UTR region was amplified with the primer pair NSP3 C-term F 5'CATTGCACGCTTTTGATGACTTAG3' (sequence number 3) and NSP3_3'UTR 5'GGCCACATAACGCCCCTATAG3' (sequence number 4), also using the Superscript III One-Step RT-PCR System (Invitrogen) with Platinum Taq DNA polymerase. Amplified PCR products were separated by electrophoresis on a 0.8% agarose gel in Tris acetate EDTA buffer, products were gel purified using Nucleospin gel and PCR Clean-up (Takara), and sequences were determined by EuroFins Scientific.

[0096] CsCl (cesium chloride) gradient centrifugation The density of double-layer particles (DLPs) was determined as described above. Briefly, MA104 cells in 10 cm cell culture plates were infected with 5 PFU of rSA11 virus per cell and harvested 12 h.pi. Cells were lysed by scraping into 1 ml of PBS (phosphate buffered saline) and adjusting the solution to a final concentration of 0.5% Triton X-100 and incubated on ice for 5 min. After low-speed centrifugation to remove cell debris, the lysate was adjusted to 10 mM EDTA (ethylenediaminetetraacetic acid) and incubated at 37°C for 1 h with intermittent mixing to convert RV virus to DLPs. CsCl was added to the samples to obtain a concentration of 1.367 g / cm 3The resulting mixture was centrifuged at 110,000×g for 22 h at 8° C. in a Beckmann SW55Ti rotor. The viral band was detected in the gradient using an inverted light source. Fractions containing the viral band were collected with a micropipette and their CsCl density was determined using a refractometer.

[0097] GenBank Accession Number The segment 7 sequences of rSA11 viruses have been deposited in GenBank: wt. (LC178572), NSP3-P2A-NoVfP2 (MN190002), NSP3-P2A-NoVfP (MN190003), NSP3-P2A-NoVfVP1 (MN190004), NSP3-P2A-NoV VP1f (MN201548), NSP3-P2A-NoV P-His (MN201549), NSP3-P2A-NoV VP1-ThHis (MN201547), NSP3-P2A-NoV VP1-His (MZ562305), RIX / NSP3-P2A-NoV P-His (MZ643978). See also Table 2.

[0098] result Modified genome segment 7 expressing the NoV capsid protein To generate RV as an expression vector for the region of the NoV capsid protein (Figure 1), genome segment 7 of the pT7 / SA11 vector was modified by replacing the wt.NSP3 ORF with a cassette containing the NSP3 ORF fused to a GAG flexible linker together with the porcine teschovirus 2A element (P2A) and coding sequence for the NoV capsid protein (Figure 2). The modified ORF also contained either a 3xFLAG tag (f) at the N-terminus or a 1xFLAG tag (f) at the C-terminus of the NoV protein (Figure 2). The NoV sequence was inserted into the pT7 / NSP3 plasmid at the same site used to generate rSA11 strains expressing fluorescent proteins and the SARS CoV-2 spike protein. Similarly, pT7 SA11 NSP3 vectors expressing 6xHis-tagged NoV proteins were generated by replacing the FLAG-tagged NoV sequence with a 6xHis-tagged NoV sequence with or without the insertion of a Th cleavage site (Figure 2). This procedure led to the generation of a set of pT7 / SA11NSP3-2A-NoV vectors, P2 (pT7 NSP3-2A-fP2), P (pT7 NSP3-2A-fP or pT7 NSP3-2A-PHis), VP1 (pT7 NSP3-2A-fVP1, pT7 NSP3-2A-VP1f, pT7 NSP3-2A-VP1-ThHis and pT7 NSP3-2A-VP1 His), that contained FLAG- or 6xHis-tagged coding sequences of NoV proteins (Figure 2). Next, to test the feasibility of generating human strain genome segment 7 as an expression platform, we modified genome segment 7 of the current neonatal RV vaccine strain Rotarix (RIX NSP3) to express NoV PHis protein downstream of the 2A peptide, synthesizing pUC 19 / RIX NSP3-2A-P His.

[0099] Recovery and characterization of rSA11 virus expressing FLAG-tagged NoV capsid protein Recombinant SA11 viruses expressing NoV capsid proteins were generated by transfecting BHK-T7 cells with a complete set of 11 pT7 plasmids encoding +mRNAs of RV genome segments and a CMV expression vector encoding African swine fever virus capping enzyme (NP8688R), replacing pT7 / NSP3SA11 with the pT7 / NSP3-2A-NoV vector as described above. Transfected BHK-T7 cells were over-seeded with MA104 cells 2 days after transfection, the cell mixture was frozen-thawed 3 days later, and recombinant RVs were recovered by growing in MA104 cells. rSA11 isolates were plaque purified and amplified in large quantities before characterization. The characteristics of the rSA11 viruses are summarized in Table 2.

[0100] rSA11 viruses generated by modified pT7 NSP3-2A-NoV vectors expressing FLAG-tagged NoV proteins contained larger segment 7 dsRNA than wild-type viruses (rSA11 / wt) based on RNA gel electrophoresis (Figure 3A). Sequence analysis showed that segment 7 of rSA11 viruses matched the pT7 NSP3-2A-NoV vector. Introducing FLAG-tagged NoV P2 and P into genome segment 7 increased its size to 1.7 kbp and 2.1 kbp, respectively, and migrated between RV genome segments 4 (2.4 kbp) and 5 (1.6 kbp) in RNA gels, as expected from the size (Table 2, Figure 3A). Similarly, reengineered segment 7 of virus isolates (NSP3-2A-fVP1 and NSP3-2A-VP1f) containing the 1.7 kbp NoV VP1 protein sequence had a length of 2.9 kbp and resulted in a slow migrating position near RV genome segment 1. Thus, inserting the 2A-fVP1 and VP1-f sequences into the segment 7 genome increased the total genome size to 20.3 kbp, which exceeds the packaging capacity of the wt virus by 9.5%. The longest foreign sequence previously introduced into the segment 7 RNA of rSA11 was the 3.3 kbp segment 7 dsRNA of rSA11 / NSP3-fS1 expressing the SARS CoV-2 S1 protein.

[0101] Plaque analysis showed that the plaques formed by rSA11 / wt virus were larger than those formed by rSA11 / NSP3-2A-fP2, -fP, -fVP1, and -VP1f viruses (Figure 3B and C), consistent with data reported in previous studies. Quantification of viral peak titers showed that rSA11 / NSP3-2A-fP2, -fP, -fVP1, and -VP1f viruses grew to similar titers in MA104 cells, reaching 0.5 × 10 7 ~2.6×10 7 We demonstrated that the small plaque phenotype and low titers ranged from 0.1 to 1.0 (Figure 3D). The exact reasons for the small plaque phenotype and low titers are unclear, but could possibly be due to the viral RNA polymerase that transcribes the modified segment 7 dsRNA during viral replication requiring a longer elongation time, or it could require a longer time to translate the segment 7 mRNA containing the foreign protein sequence. Alternatively, it could reflect the complications associated with packaging the large modified dsRNA containing the foreign sequence and assembly of viral particles.

[0102] To determine the expression of NoV protein products, MA104 cells were infected with the rSA11 strain and whole cell lysates (WCLs) were examined by immunoblot assay using FLAG antibody (Fig. 3E). Immunoblots probed with FLAG antibody showed that rSA11 / NSP3-2A-fP2, -fP, -fVP1, and -VP1f viruses produced NoV proteins as major products with the predicted protein sizes of the functional 2A element of the modified NSP3 ORF: -fP2 (18.6 kDa), -fP (37.7 kDa), -fVP1 (61.9 kDa), and -VP1f (60.1 kDa) (Table 2 and Fig. 3E). Assays with anti-NSP3 and 2A element antibodies confirmed a 38 kDa protein, corresponding to NSP3 (36 kDa) linked to remnant residues of the P2A element (2 kDa). However, immunoblot assays performed with anti-FLAG antibodies detected small amounts of large fusion proteins representing the read-through products of the NSP3-2A-NoV proteinization cassette; NSP3-2A-fP2, NSP3-2A-fP, and NSP3-2A-fVP1 (Fig. 3E, red asterisks). However, no read-through products were detected in the rSA11 / NSP3-2A-VP1f virus, suggesting that direct fusion of the downstream ORF to the 2A peptide results in efficient stop-start activity of the 2A element (Fig. 3E).

[0103] Recovery and characterization of rSA11 virus modified to express NoV capsid protein containing a C-terminal 6xHis tag Modification of genome segment 7 of the virus expressing 6xHis-tagged NoV P and VP1 sequences increased their length to 2.1 kbp and 2.8 kbp (Fig. 4A). As described above, the plaque sizes of rSA11 / NSP3-2A-PHis, -VP1 His, and -VP1 Th His were significantly smaller than those of rSA11 / wt virus (Fig. 4B, C). Analysis of peak viral titers of rSA11 / NSP3-2A-PHis, -VP1His, and -fVP1 Th His viruses showed that they produced maximum titers that were 0.5 to 1 log lower than rSA11 / wt (Fig. 4D).

[0104] Immunoblot assays performed with anti-6xHis antibodies showed that rSA11 / NSP3-2A-P His, -VP1 His, -fVP1 Th His viruses produced P (35.8 kDa) and VP1 (60 kDa) products with the size predicted for a functional 2A element (Fig. 4E and Table 2). On the other hand, probing with anti-6xHis antibodies failed to detect the presence of a large fusion read-through product in these viruses, presumably because the NoV ORF was inserted immediately after the 2A element. Mirroring the results described above for viruses expressing FLAG-tagged NoV protein products, assays of rSA11 / NSP3-2A-PHis, -VP1 His, -fVP1 Th His viruses with anti-NSP3 and 2A element antibodies confirmed the 38 kD size of the NSP3-2A protein (Fig. 4E).

[0105] Generation of rSA11 virus containing Rotarix genome segment 7 expressing NoV P protein To test the feasibility of generating a human vaccine vector platform, recombinant SA11 monoreassortant viruses containing human vaccine strain Rotarix genome segment 7 (RIX 4414) modified to express NoV P protein were generated using the reverse genetic approach described above. rSA11 viruses containing RIX NSP3-2A-PHis were recovered by growth in MA104 cells (African green monkey kidney cells), and isolates were plaque purified and characterized as summarized in Table 2.

[0106] rSA11 / RIXNSP3-2A-PHis contained a larger segment 7 dsRNA (2.1 kbp) than rSA11 / wt (1.1 kbp) because the introduction of 1 kb of 2A NoV PHis sequence and additional sequences increased the total genome size to 19.6 kbp based on RNA gel electrophoresis (Fig. 5A) (Table 2). Plaque analysis showed that rSA11 / RIXNSP3-2A-PHis formed smaller plaques than rSA11 / wt virus (Fig. 5B) and produced peak titers 1 log lower than rSA11 / wt (Fig. 5C).

[0107] To determine the expression of NoV P protein from the modified RIX NSP3 segment, MA104 cells were infected with three isolated plaques of rSA11 / RIX NSP3-2A-PHis virus, and whole cell lysates were examined by immunoblot assay using anti-6xHis antibody (Fig. 5D). Immunoblot results showed that rSA11 / RIX NSP3-2A-PHis virus expressed the 35.8 kDa NoV P protein as the major product and a 74.2 kDa read-through product (red star) as a minor product from the modified RIX NSP3 ORF (Fig. 5D and Table 2). Assay with anti-(SA11)NSP3 antibody confirmed only the SA11 NSP3 protein of rSA11 / wt (Fig. 5D), and the antibody did not react with the NSP3 product of the RIX NSP3 ORF (Fig. 5D). As we did not have specific antibodies against the RIX NSP3 protein, to test for deliberate expression of the RIX NSP3 protein, we reprobed the same blot with the 2A antibody and confirmed robust expression of the 38 kDa RIX NSP3 protein fused to the 2 kDa 2A peptide (Fig. 5D). Overall, these results indicate that it is possible to generate SA11 / RIX RV reassortant strains modified to express immunogenic proteins of another enteric virus, such as NoV.

[0108] Self-assembly of VP1 protein expressed from rSA11 virus to form dimers To determine whether the NoV protein products expressed from rSA11 virus could form dimers in infected cells, lysates of rSA11 / NSP3-2A-fP2, -fP, -fVP1, and -VP1f-infected cells were treated with native sample buffer at 25° C. Immunoblot assays with FLAG antibody showed that NoV P2 and P proteins did not form dimers, whereas both N- and C-terminally FLAG-tagged VP1 proteins (fVP1 and VP1f) from rSA11 / NSP3-2A-fVP1 and -VP1f lysates migrated as VP1 dimers (Fig. 6A, lanes 10 and 12), suggesting that VP1 dimer formation regulated by intradimer interactions through the P domain was maintained in the expressed VP1 proteins. Under the same electrophoretic conditions, both the NSP3 and VP6 proteins of rSA11 / wt and rSA11 / NSP3-2A-fP2, -fP, -fVP1, and -VP1f viruses formed stable dimers and trimers at 25°C (Fig. 6A), consistent with previous reports. Similar results for VP1 dimerization were observed with His-tagged VP1 proteins (VP1His and VP1Th His) when lysates of rSA11 / NSP3-VP1 His and -VP1 Th His infected cells were probed with anti-6xHis antibody (Fig. 6B). Mirroring the results shown above, the NSP3 and VP6 proteins formed stable dimers and trimers under the same electrophoretic conditions (Fig. 6B).

[0109] Folding of NoV VP1 capsid protein into its native structure To gain insight into whether the VP1 product expressed from rSA11 / NSP3-2A-VP1 virus folds into a native conformation, lysates prepared from MA104 cells infected with rSA11 / NSP3-2A-fVP1 and -VP1f, -VP1His viruses were probed by pull-down assays using an anti-NoV VP1 conformation-dependent neutralizing monoclonal antibody (NVB43.9, Absolute Antibody). As shown in Fig. 7A (blue arrows), the anti-NoV GII.4 NVB43.9 antibody immunoprecipitated both FLAG- and His-tagged NoV VP1 proteins (fVP1 and VP1His), indicating that at least a portion of the VP1 protein expressed from rSA11 virus folds into a correct conformation and contains a corroborating neutralizing epitope found in the NoV VP1 protein that can induce a protective immune response. Unlike the successful pull-down of fVP1 and VP1His by anti-NoV GII.4 antibody, it was not clear whether this antibody would similarly immunoprecipitate the VP1f product of rSA11 / NSP3-2A-VP1f. These results could be related to the low signal intensity of 1xFAG of VP1-f or the Ig / H heavy chain of the anti-Nov GII.4 antibody obscuring the closely migrating 60 kDa VP1f (Fig. 7A). Lysates were similarly analyzed using an NSP2-specific monoclonal antibody (Fig. 7B). A further question was whether the low yield of immunoprecipitated VP1 protein was due to either the low affinity of the anti-NoV GII.4 NVB43.9 antibody or the elution conditions. To answer this question, the presence of VP1, NSP3 and VP6 proteins in the WCL and flow-through was analyzed by probing with FLAG, NSP3 and VP6 antibodies. The results showed that the main fraction of VP1 protein remained in the flow-through and only a small amount of VP1 protein was immunoprecipitated (Fig. 7A, lower panel). This was further verified by examining the amounts of NSP2, NSP3, and VP6 proteins in the WCL and flow-through of the NSP2 immunoprecipitation sample, showing that the major portion of NSP2 protein was successfully immunoprecipitated and recovered from the beads (Fig. 7B, lower panel).Taken together, these results suggest that at least some of the VP1 proteins expressed from rSA11 viruses were folded in the correct three-dimensional structure and that the low yield of VP1 immunoprecipitates may be due to the poor binding affinity of the anti-NoV GII.4 antibody.

[0110] Genetic stability of rSA11 strains expressing NoV proteins To analyze the genetic stability of rSA11 viruses expressing NoV capsid proteins, rSA11 viruses expressing both FLAG- and His-tagged proteins (rSA11 / NSP3-2A-fP2, -fP, -PHis, -fVP1, and VP1-His) were subjected to five serial passages at three dilutions (1:10, 1:100, or 1:1000). Gel electrophoresis of dsRNA recovered from cells infected with SA11 / NSP3-2A-fP2, -fP, and fHis showed no change in the size of any of the genome segments, including modified genome segment 7, over five serial passages (P1–P5), indicating that viruses carrying foreign sequences up to 1.1 kbp were genetically stable (Figure 8A), consistent with previous studies. In contrast, serial passage of rSA11 / NSP3-2A-fVP1 and -VP1His showed evidence of genetic instability at all three dilutions (Figures 8B and 8C). A new genome segment appeared at the third passage, which was smaller than the 2.9 kbp size of the original modified g7 segment, NSP3-2A-fVP1 and -VP1His. Subsequent passages resulted in a prominent variant segment 1.2 kbp in size that had shifted down genome segment 6, while the 2.9 kbp segment 7 was not detected by P5 generation, suggesting that the high-passage virus pool was dominated by variants derived from the 2.9 kbp segment 7 RNA via sequence deletion. To test for possible internal sequence deletion, five variants were recovered from the P5 virus pool by plaque isolation, four with a large (L) plaque phenotype and one with a small (S) plaque phenotype. Gel electrophoresis performed on dsRNA extracted from isolated plaques showed that none contained the original 2.9 kbp genome segment 7 RNA (Figure 8D, Figure 8E). Instead, the L1-L4 variants of the NSP3-2A-fVP1 P5 pool contained the rearranged (indicated by the letter R) fVP1 / R2 segment, while the S1 variant contained both the -fVP1 / R1 and -fVP1 / R2 segments (Figure 8D).Similarly, RNA gel electrophoresis of dsRNA isolated from the rSA11 / NSP3-2A-VP1His P5 pool showed that the large (L1, L3–5) and small (S1) plaque lysates contained only a single type of small variant segment, VP1 His / R (Figure 8E).

[0111] Sequence analysis of the variant segments revealed that -fVP1 / R1 and -fVP1 / R2 originated from the 2.9 kbp segment 7 RNA, NSP3-2A-fVP1, and -VP1 His / R was contributed by the large NSP3-2A-VP1 His segment (Figure 8F). The -fVP1 / R1 (1550 bp) and -fVP1 / R2 (1,263 bp) variant segments retained the complete 5'-UTR and NSP3 ORF of segment 7, but had 1.6 kbp of NoV VP1 coding sequence and a primordial 7 bp sequence deletion in the 3'-UTR. Sequence alignment of -fVP1 / R1 and -fVP1 / R2 demonstrated that R1 had a 287-base overlap from the C-terminus of the NSP3 ORF and the 2A peptide sequence, and that -fVP1 / R2 could originate from the -fVP1 / R1 variant sequence (Figure 8F, Table 3). Similarly, sequencing of -VP1 His / R showed that the dsRNA retained the complete 5'-UTR, NSP3 ORF and 3'-UTR of segment 7, but had a 1.6 kbp sequence deletion of the NoV VP1 coding sequence (Fig. 8F). The fact that all five variants isolated from the P5 pools of NSP3-2A-fVP1 and NSP3-2A-VP1His by plaque assay contained the small variant segments -fVP1 / R2 and -VP1 His / R, respectively, suggested that variants with small RNAs may have a growth advantage over variants with full-length or large genome segments (Fig. 8D, Fig. 8E), consistent with previous reports. Although all three variants had deletions of the NoV coding sequence, these variants contained the complete ORF of NSP3, suggesting that the NSP3 protein may be essential for viral replication. Further analysis of the entire population of viral RNA at every passage by direct RNA sequencing may provide better insight into the mechanism and diversity of the deletions introduced into the modified genome segment 7 (NSP3-2A-VP1), which carries the long foreign sequence.

[0112] Sequence deletions due to genetic instability are not limited to insertions of foreign sequences To gain a better understanding of the potential hotspot regions and the nature of genetic instability, rSA11 / NSP3-2A-fVP1 and -VP1His viruses were amplified in large quantities at low MOI (multiplicity of infection). Gel electrophoresis analysis of extracted dsRNA confirmed diverse variant pools (denoted V) that contained different types of rearranged genome segments 7 at various sizes in rSA11 / NSP3-2A-fVP1 viruses (fVP1 / V1-V4) and rSA11 / NSP3-2A-VP1 His viruses (VP1 His / V5-V7) (Figure 9A, red and blue arrows). Immunoblot assays performed on lysates prepared from MA104 cells infected with variant pool viruses (fVP1 / V1-V4 and VP1 His / V5-V7) detected more than one form of NSP3 protein when probed with NSP3 antibodies. This suggests that, as expected, the variant genome segments expressed small NSP3 proteins similar to the wt.NSP3 protein, while the original genome segment 7 containing the NSP3-2A-VP1 cassette expressed the NSP3-2A protein (Figure 9B). Occasionally, there were some modified NSP3 proteins that were even larger than the predicted NSP3-2A protein size, likely caused by the fusion of some VP1 residues to the NSP3-2A peptide after sequence deletion (Figure 9B).

[0113] Four to five rSA11 isolates were recovered from each of the variant pools described above and characterized for further evaluation. Sequencing of segment 7 dsRNA of each plaque-purified isolate (V1-V7) from the variant pools revealed the appearance of rearranged genomic segments (R) derived from the 2.9 kbp segment 7 RNA of rSA11 / NSP3-2A-fVP1 and -VP1 His viruses (Figure 9C-H). R1, R2, and R3 RNAs generated from the fVP1 / V1 pool retained the 5'-UTR and NSP3 ORF but contained 1.3 (R1), 1.6 (R2 and R3) kbp sequence deletions of the VP1 coding sequence, and either a 7 bp deletion or a 9 b duplication in the 3'-UTR (Figure 9I). Interestingly, the R2 isolate from the fVP1 / V1 pool showed a 154-bp overlap, identical to the last few amino acids present in the NSP3 ORF and some residues of the 2A element inserted in the middle of the 2A peptide (Figure 9C, Figure 9I and Table 3). Plaque isolates from the variant 2 pool showed only one rearranged genome segment 7 (fVP1 / V3 / R) (Figure 9D). The fVP1 / V3 / R segment contained the complete 5'- and 3'-UTRs and the NSP3 ORF of segment 7 and lacked the entire 3xFLAG sequence. A portion of the 2A sequence was also missing, all but the last 40 bases along the VP1 sequence (Figure 9I). In contrast, RNA gel electrophoresis of dsRNA from plaques isolated from the fVP1 / V4 and VP1 His / V5 pools confirmed various R segments, one of which (VP1 His / V5 / R3) had a smaller genome segment 7 (1038 bp) than rSA11 / wt (1104 bp) (Figure 9F, lane 2). The small size of VP1 His / V5 / R3 was caused by a large deletion of 1.8 kbp of inserted foreign sequence, including 23 bp of the NSP3 ORF and 41 bp of the 3'-UTR region (Figure 9I and Table 3). Similarly, the VP1 His / V6 / R isolate contained a small genome segment 7 (1087 bp) due to a deletion of 9 bp from the NSP3 ORF and 6 bp from the 3'-UTR (Figure 9I), accompanied by the deletion of the entire 2A-VP1-His foreign sequence (Figure 9G, lanes 2-5).Furthermore, a variant plaque (VP1 His / V7 / R) isolated from the VP1 His / V7 pool confirmed a rearranged genome segment 7 that contains the complete 5'- and 3'-UTRs of segment 7, as well as the NSP3 ORF, but with a 14-bp duplication of the NSP3 sequence and a 1.7-kb deletion of the VP1-His coding sequence (Figure 9H, Figure 9I). Taken together, these sequencing results suggest that RV strains can still replicate efficiently even when they lose some nucleotides at the 3' end of the NSP3 ORF and the first few located in the 3'UTR region (Figure 9F, lanes 2 and 9; Figure 9G, lanes 2-5). Thus, rSA11 strains modified to express large foreign sequences such as NoV VP1 become genetically unstable in subsequent passages, and this instability is explained by the deletion of the inserted foreign sequence or the NSP3 sequence.

[0114] Density of rSA11 viral particles containing NoV capsid sequences rSA11 viruses re-engineered to express NoV capsid protein from modified segment 7 contained large viral genomes, 0.5-2.1 kbp larger in size than SA11 / wt. RNA gel electrophoresis showed that rSA11 / NSP3-2A modified viruses were efficiently packaged and contained the complete arrangement of all 11 genome segments (Figures 3A, 4A, and 5A), indicating that packaging of additional sequences within the core should alter the density of viral particles. To explore this possibility, rSA11 / wt (genome size: 18.6 kbp), rSA11 / NSP3-2A-fP2 (19.1 kbp), rSA11 / NSP3-2A-fP (19.6 kbp), rSA11 / NSP3-2A-fVP1 (20.3 kbp), rSA11 / NSP3-2A-PHis (19.6 kbp) and rSA11 / NSP3-2A-VP1 His (20.2 kbp) were amplified in MA104 cell monolayers. Double-layered particles (DLPs) were prepared from infected cell lysates by converting RV triple-layered particles after treatment with EDTA. DLPs were centrifuged to equilibrium in a CsCl gradient and the density of the DLP bands was determined by using a refractometer (Figure 10A, Figure 10B). This analysis was performed using rSA11 / NSP3-2A-fP2 DLP (1.3831 g / cm 3 ), rSA11 / NSP3-2A-fP DLP(1.3863g / cm 3 ) and rSA11 / NSP3-2A-fVP1 DLP (1.3885 g / cm 3 ) density is SA11 / wt DLP (1.382g / cm 3 ) (Figure 10A). Similarly, rSA11 / NSP3-2A-PHis (1.3852 g / cm 3 ) and rSA11 / NSP3-2A-VP1His (1.3885 g / cm 3 The density of SA11 / wt DLP (1.38 g / cm 3) (Fig. 10B). Analysis of dsRNA extracted from banded DLPs by gel electrophoresis verified that they contained the expected arrangement of 11 genomic segments (Fig. 10C, D). However, DLPs banded from rSA11 / NSP3-2A-fVP1 showed two bands in CsCl, likely due to the fact that banded DLPs contain diverse viral isolates, including several variants (Fig. 10A). This was further corroborated by gel electrophoresis of dsRNA extracted from banded-fVP1 DLPs, which confirmed three types of genomic segment 7, with sizes of 2.9 kbp (black arrows), 1.55 kbp, and 1.3 kbp (red arrows) (Fig. 10C, lane 4), matching exactly with that shown in lane 6 of Fig. 8D. These data showed that rSA11 / NSP3-2A-NoV viruses carrying the extra 1.8 kbp of heterologous sequences retained the complete genome arrangement even though the size of these genome segment 7 was significantly larger than that of wild-type SA11 viruses. In fact, the 20.2 kbp rSA11 / NSP3-2A-fVP1 and VP1-His genomes are 9.1% larger in size than the 18.6 kbp rSA11 / wt genome (Table 1). These results indicate that the RV core has the space to accommodate a large amount of additional foreign (heterologous) nucleic acid sequences that could code for various proteins, for example, consistent with previous reports. The largest foreign sequence inserted into rSA11 / genome segment 7 to date is 2.6 kbp (data not shown), but the maximum packaging capacity of the core remains to be determined. These findings are consistent with earlier studies showing that the density of RV variants with naturally occurring sequence duplications or inserted foreign sequences is greater than that of wild-type RV.

[0115] Consideration As demonstrated herein, it is possible to generate rRVs that express a portion of the NoV capsid protein as a separate protein through modification of genome segment 7. These results indicate that RVs can be used as potential vaccine expression vectors. These results provide a method for generating a mixed oral live attenuated RV-NoV vaccine that can prevent both RV and NoV-mediated AGE in children, for example. Recently, some NoV vaccine formulations have been tested in adult trials, but there is a strong need to explore vaccine candidates for use in infants and young children. In this study, we generated a panel of rRVs expressing NoV capsid domains and tested them for protein expression and genetic stability. All recombinant RVs grew to high titers in cell culture and NoV proteins were highly expressed, making them excellent expression platforms for use in children with no pre-existing immunity to RV or NoV. Furthermore, RVs have extremely high levels of antigen expression and can generate strong immune responses during their use as vaccines, and therefore can act as adjuvants to increase immune responses to NoV antigens. Furthermore, the RV genome can accommodate up to 1.3 kpb of additional sequence without genetic instability, allowing the accommodation of multiple foreign genes and can be developed as a multivalent vaccine vector. This raises the possibility that RV can be re-engineered to express immunodominant regions of other viruses, such as SARS (severe acute respiratory syndrome caused by SARS-associated coronavirus), including the CoV-2 (also known as COVID-19) RBD (receptor binding domain) and NoV P2, to generate a multivalent vaccine for infants and children (RV-SARS-CoV-2 -NoV vaccine), e.g., to replace the current RV vaccine.

[0116] This analysis demonstrated that recombinant RV expressing the NoV capsid protein was able to produce high titers (0.5 × 10 7 ~2.6×10 7PFU / ml), consistent with previous reports, this high titer makes vaccine production more economically feasible. The stop-restart activity of the 2A element was shown for some variants of rSA11 viruses. Viruses modified to express N-terminal FLAG-tagged NoV proteins and RIX segment 7 modified to express NoV P-His protein produced small amounts of NSP3-2A-readthrough products (Fig. 3E and 5D, red asterisks). The exact reason for this is unclear in the practice of the present invention, but it is likely because they all contained a flexible Ala-Ser linker before the start codon of the downstream NoV protein. Such fusion readthrough products were not found in the case of the viruses depicted in Fig. 4E, and sequence analysis showed that these viruses did not have an Ala-Ser linker but contained a direct fusion of the NSP3-2A sequence to the start codon of the downstream NoV protein (Fig. 3E, lane 6 and Fig. 4E).

[0117] This data suggests that the VP1 protein expressed from modified genome segment 7 is capable of dimerizing and folding into the correct conformation, and the NSP3 protein of recombinant RV expressing NoV proteins is functional, retains the ability to dimerize, and is capable of expressing the full complement of all viral proteins.

[0118] Although the upper limit of the amount of heterologous sequence that can be accommodated in the RV genome is currently not determined, naturally occurring RV strains with natural sequence overlaps contained an additional 0.9 kbp of segment 7 sequence, increasing the size to 2.0 kbp (56). In this study, the generation of rSA11 / NSP3-2A-fVP1 virus resulted in the accommodation of 1.8 kbp of foreign sequence, sufficient to code for the NoV VP1 protein, increasing the total genome size to 20.3 kbp. However, this is not the largest recombinant RV produced to date, and dsRNA capable of accommodating 2.2 kbp of foreign sequence encoding the SARS-CoV-2 S1 protein has been produced previously. This data demonstrates that RVs carrying large heterologous sequences, e.g., carrying 1.8 kbp of NoV VP1, have a small plaque phenotype and are genetically unstable, leading to the generation of new variants upon subsequent amplification. The exact reasons for the small plaque phenotype and genetic instability are unknown but are under investigation (data not shown). Hypotheses proposed for sequence rearrangements suggested that viral RNA polymerase may interrupt RNA synthesis during either transcription or replication and revert to its own template to restart RNA synthesis (57,58). However, RVs carrying up to 1.3 kbp have been found to be genetically stable for more than five serial passages (43) and thus can be developed into vaccine platforms. The coding capacity provided by the 1.3 kbp foreign sequence is sufficient to allow RVs to express the NoV P protein (1.1 kbp) with some further modifications such as fusion of secondary signals or Fc-binding proteins. This type of protein modification, e.g., Fc immunoglobulin G1 (Fc-IgG1) or ligands of cell surface receptors, can specifically target the expressed protein to a particular cell type (antigen-presenting cells or T cells). Further modification of the NoV P protein with carrier moieties, e.g., cell-penetrating peptides or secretory peptides (e.g., interleukin-2 secretory peptide), can achieve efficient transport of the expressed protein across the cell membrane.

[0119] This result shows that it is possible to re-engineer the human vaccine strain genome segment 7 (RIX 4414) to express NoV proteins, providing a method to develop human RV-NoV vaccine strains for use in children. Furthermore, there is a need to develop modified RV reverse genetic systems that can generate recombinant human RV strains present in current RV vaccines. Such human rRV vaccine strains expressing NoV proteins can be tested to gain insight into the production of neutralizing antibodies in immunized animals. The described RV system can be used as an effective vector system to develop combination vaccines that can protect against multiple diseases or against the same disease caused by two or more variants of the same pathogen, for example, against two or more diseases caused by two or more viruses or two or more variants of the same virus.

[0120] Example 2 - Recombinant rotavirus (RV) expressing functional glycoproteins Initial studies have investigated the possibility of generating recombinant RV expressing a portion of the spike (S) protein of SARS-CoV-2 ( Philip and Patton, 2021 ). In this study, rSA11 viruses with segment 7 modifications were recovered that expressed the N-terminal domain (NTD), receptor binding domain (RBD) and core domain (CR) of the S protein ( Duan et al., 2020 ; Huang et al., 2020 ). Similar segment 7 modifications were used to generate a recombinant virus (rSA11 / NSP3-2A-fS1) that contains the complete coding sequence of the SARS-CoV-2 S1 protein, a truncated fragment of the S protein that includes both the NTD and RBD and is the primary target of neutralizing antibodies produced during SARS-CoV-2 infection (Brouwer et al., 2020; Liu et al., 2020; Rogers et al., 2020; Zost et al., 2020; Xin et al., 2021). The open reading frame (ORF) in the modified segment 7 RNA of the rSA11 / NSP3-2A-fS1 virus contained the coding cassette NSP3-2A-3xFLAG-S1. Through the action of the 2A translation element, the viral segment 7 RNA was expected to generate two products: NSP3 fused to the 2A peptide (NSP3-2A) and 3xFLAG-tagged S1 (fS1). In the NSP3-2A-3xFLAG-S1 cassette, the 3xFLAG tag was located immediately upstream of the S1 signal peptide, an important element for the synthesis of glycosylated S products (Casalino et al., 2020). Immunoblot analysis of products made by rSA11 / NSP3-2A-fS1 showed that the virus made NSP3-2A efficiently but not sufficiently to generate the predicted fS1 product, possibly due to instability or decay of the S1 product or the effect of the FLAG tag on the function of the signal peptide (Philip and Patton, 2021). The studies described herein compare the S1 products made by the rSA11 / NSP3-2A-fS1 virus to those made by newly designed rSA11 viruses that encode S1 proteins that differ in the nature of the terminal peptide tag.The results showed that the newly designed rSA11 virus efficiently expressed the S1 protein, as measured by affinity for the extracellular domain of the ACE2 receptor, and that the S1 protein was glycosylated and biofunctional (Medina-Enriquez, 2020), demonstrating that the recombinant RV can be used as an expression vector for glycosylated foreign proteins.

[0121] Materials and Methods cell culture Monkey embryonic kidney cells (MA104) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g / L glucose (Lonza 12-640F or Corning 15-107-CV), 1% penicillin-streptomycin [Corning], and 5% fetal bovine serum (FBS, Gibco) (Arnold et al., 2009). Baby hamster kidney cells constitutively expressing T7 RNA polymerase (BHK-T7 cells) were a gift from Drs. Ulla Buchholz and Peter Collins, Laboratory of Infectious Diseases, NIAID, NIH. BHK-T7 cells were grown in Glasgow complete medium (GMEM, Lonza) supplemented with 10% tryptone-peptide broth (Gibco), 1% penicillin-streptomycin, 2% non-essential amino acids (Gibco), 1% glutamine and 5% heat-inactivated FBS ( Philip et al., 2020 ). The medium used to culture BHK-T7 cells was supplemented with 2% G418 (Geneticin, ThermoFisher) every other passage.

[0122] Plasmids Plasmids used to generate rSA11 virus were obtained from Addgene [https: / / www.addgene.org / Takeshi_Kobayashi / ] and included pT7 / VP1SA11, pT7 / VP2SA11, pT7 / VP3SA11, pT7 / VP4SA11, pT7 / VP6SA11, pT7 / VP7SA11, pT7 / NSP1SA11, pT7 / NSP2SA11, pT7 / NSP3SA11, pT7 / NSP4SA11, and pT7 / NSP5SA11. Plasmids pCMV-NP868R, pT7 / NSP3-P2A-fUnaG, and pTWIST / COVID19Spike were derived as previously described (Philip et al., 2019; Philip and Patton, 2020, 2021). Plasmid pT7 / NSP3-2A-3fS1 was generated as described in Philip and Patton (2021) and contains the full-length cDNA of the SARS-CoV-2 spike S1 open reading frame (ORF) (GenBank MN908947.3). Plasmids pT7 / NSP3-2A-S1F and pT7 / NSP3-2A-3fS1-His are identical to pT7 / NSP3-2A-3fS1 and contain the same S1 ORF, but differ in the sequence of the peptide tag surrounding the S1 ORF.

[0123] The pT7 / NSP3-2A-S1f plasmid was constructed using the Takara In Fusion cloning kit, which combines the vector backbone (pT7 / NSP3-P2A region) of pT7 / NSP3-P2A-fUnaG (primer pair for amplification: SEQ ID NO: 72 TGACCATTTTGATACATGTTGAACAATCAAATACAG and SEQ ID NO: 73 AGGACCGGGGTTTTCTTCCAC) with the insertion of the S1 ORF of pTWIST / COVID19Spike (primer pair: SEQ ID NO: 74. GAAAACCCCGGTCCTGTGTTTGTTTTTCTTGTTTTATTGCCACTAGTCT and SEQ ID NO: 75. GTATCAAAATGGTCACTTGTCATCGTCATCCTTGTAATCACGTGCCCGCCG). Primers were designed to introduce a 1xFLAG tag as the C-terminus of the encoded S1 protein. The pT7 / NSP3-2A-3fS1-His plasmid was generated by inserting a sequence encoding a 6xHis tag into the 3' end of the S1 ORF of pT7 / NSP3-2A-3fS using the In Fusion cloning kit. This was achieved by amplifying pT7 / NSP3-2A-3fS with the primer pair: SEQ ID NO: 76. ACCACCACCACCACCACTGACCATTTTGATACATGTTGAACA and SEQ ID NO: 77. GGTGGTGGTGGTGGTGACGTGCCCGCCGAGGAGA. Transfection quality plasmid was prepared using the Qiagen plasmid purification kit. Primers were obtained from Eurofins Scentific and the plasmid sequence was verified by Eurofins Genomics.

[0124] Recombinant viruses Detailed procedures for generating and recovering recombinant rSA11 have been published previously (Philip et al., 2020; Philip and Patton, 2021). Briefly, BHK-T7 cells were transfected with SA11 pT7 plasmid and pCMV-NP868R using Mirus TransIT-LT1 transfection reagent. pT7 / NSP2SA11 and pT7 / NSP5SA11 were included in the transfection mixture at levels three-fold higher than the other plasmids. Where necessary, the pT7 / NSP3SA11 plasmid was replaced with pT7 / NSP3-2A-3fS, pT7 / NSP3-2A-S1F, or pT7 / NSP3-2A-3fS1-His. Transfected BHK-T7 cells were overseeded with MA104 cells 2 days after infection, and the growth medium was adjusted to a final concentration of 0.5 mg / ml tyrosine (Porcine Type IX Pancreatic Trypsin, Sigma Aldrich). Once complete cytopathic effect (CPE) was observed, the cells in the medium overlay were subjected to three rounds of free thawing, and the lysate was clarified by low-speed centrifugation. Virus in the lysate was recovered by plaque isolation and amplified by one round of growth in MA104 cells (Philip et al., 2020). Viral dsRNA was recovered by Trizol (Thermo Fischer) extraction (Philip et al., 2020), separated by polyacrylamide gel electrophoresis, and detected by staining with ethidium bromide. cDNA was generated from dsRNA using the Superscript III One-Step RT-PCR Platinum Taq kit (Thermo Fisher) and appropriate segment 7 (NSP3) primers and sequenced by Eurofins Genomics.

[0125] Immunoblot analysis Proteins present in MA104 cell lysates were detected by immunoblot assay according to the procedure described above (Philip et al., 2020; Philip and Patton, 2021). Cells were mock infected or infected with 5 plaque forming units (PFU) of recombinant virus, harvested at 9 h.pi, and lysed by resuspension in immunoprecipitation (IP) lysis buffer (300 mM NaCl, 100 mM Tris-HCl, pH 7.4, 2% Triton X-100) (Roche cOmplete, Sigma Aldrich) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail). Proteins were separated by electrophoresis on a 10% polyacrylamide (SDS) gel and transferred to a nitrocellulose membrane using a Bio-Rad Trans-Blot Turbo Transfer System. Membranes were blocked with phosphate-buffered saline containing 5% nonfat dry milk and probed with rabbit polyclonal SARS-CoV-2 S1 antibody (A20136, ABclonal, 1:1000 dilution), guinea pig polyclonal NSP3 (NIH Lot 55068, 1:2000 dilution) or VP6 (NIH Lot 53963, 1:2000) antisera, mouse monoclonal FLAG M2 (F1804, Sigma-Aldrich, 1:2000) or anti-6xHis antibody (MCA1396, Bio-Rad, 1:1000), or rabbit monoclonal b-actin antibody (D6A8, Cell Signaling Technology, 1:1000). In some cases, blots were reprobed with different antibodies after treatment with WesternSure ECI stripping buffer (LI-COR Biosciences). Primary antibodies were detected using a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated secondary antibody: horse anti-mouse IgG (Cell Signal Technology), goat anti-guinea pig IgG [Kirkegaard & Perry Laboratories (KPL)], or goat anti-rabbit IgG (Cell Signaling Technology).Signals were developed using Clarity Western ECL Substrate (Bio-Rad) and detected using a Bio-Rad ChemiDoc Imaging System.

[0126] Endoglycosidase H (Endo H) Assay MA104 cell monolayers in 6-well plates were mock infected or infected with rSA11 virus (5 PFU per cell, PFU = plaque forming units). At 9 h.pi, cell monolayers were washed, scraped into phosphate-buffered saline (PBS), pelleted by low-speed centrifugation, and resuspended in 250 ml per well of IP lysis buffer. The presence of glycosylated proteins in the cell lysates was determined using the Promega Endoglycosidase H Assay System (V4871). Briefly, a 27 ml sample of cell lysate was combined with 3 ml of 10X Denaturing Solution, heated to 95°C for 5 minutes, and cooled to room temperature. The heat-treated lysate was mixed with 3 ml of nuclease-free water, 4 ml of 10X Endo H Reaction Buffer, and 3 ml of Endo H enzyme, then incubated at 37°C for 16 hours. Proteins in the treated samples were detected by immunoblot assay as described above.

[0127] S1-ACE2 interaction assay The affinity of SARS-CoV-2 S1 expressed by rSA11 virus for ACE2 was assessed using Takara Capturem IP and Co-IP kit (Cat No: 635721). Protein A spin column and all necessary buffers were included in the Capturem kit. MA104 cell monolayers were mock infected or infected with rSA11 virus (5 PFU / cell). At 9 h.pi, cells were washed, scraped into PBS, pelleted by low speed centrifugation, and resuspended in Lysis / Equilibration Buffer containing a protease inhibitor cocktail. After incubation on ice for 15 min, the lysate was clarified by centrifugation at 17,000 g for 10 min. Soluble hACE2-Fc (fchace2, InvivoGen), a recombinant protein consisting of the extracellular domain of human ACE2 fused to the human IgG1 Fc region, was added to the clarified lysate to a final concentration of 20 mg per ml, and the mixture was incubated overnight at 4°C. To recover the complex formed by hACE2-Fc and S1 protein, the lysate sample was loaded onto a pre-equilibrated Protein A spin column and then centrifuged at 1000g at room temperature for 1 minute. After rinsing the column with Wash Buffer, the protein was eluted from the column by adding Elution Buffer and centrifuged at 1000×g at room temperature for 1 minute. The eluted sample was immediately neutralized by adding Neutralization Buffer. Proteins in the eluted sample were detected by immunoblot assay as described above.

[0128] Immunofluorescence assay Genetic stability Genetic stability of recombinant RV was assessed by serial passage in MA104 cell monolayers using a 1:10 dilution of infected cell lysates prepared in serum-free DMEM and 0.5 μg / ml trypsin (Philip and Patton, 2021). Viral dsRNA was recovered by Trizol extraction from clarified cell lysates treated with RNase T1 to remove single-stranded RNA (Philip et al., 2019). Viral dsRNA was analyzed by electrophoresis on 8% polyacrylamide gels and detected by staining with ethidium bromide.

[0129] GenBank Accession Number Modified segment 7 of rSA11 virus deposited in GenBank: rSA11 / wt. (LC178572), rSA11 / NSP3-2A-3f-S1 (MW059026), rSA11 / NSP3-2A-S1-1f (MZ511690) and rSA11 / NSP3-2A-3f-S1-His (MZ511689). Other accession numbers include the SARS-CoV-2 S sequence in pTWIST / COVID19spike (GenBank MN908947), the sequence of African swine fever virus capping enzyme in pCMV-NP868R, and modified segment 7 RNA of rSA11-NSP3-P2A-3fUnaG (MK851042).

[0130] result Generation of recombinant viruses encoding S1 protein In a previous study, rSA11 virus (rSA11 / NSP3-2A-fS1) was generated with a modified segment 7 RNA encoding a SARS-CoV-2 S1 protein with a fused N-terminal 3xFLAG tag (3xFLAG-S1). To understand the basis of the poor S1 expression by this virus, we generated two similar rSA11 viruses that differed only in the nature of the peptide tags encoded upstream and downstream of the S1 ORF of segment 7 RNA. One of the viruses, rSA11 / NSP3-2A-fS1-His, was identical to rSA11 / NSP3-2A-fS1, except that the ORF of segment 7 RNA had been engineered to place a 6xHis tag at the end of the S1 product, thus encoding 3xFLAG-S1-6xHis. The rSA11 / NSP3-2A-fS1-His virus was generated to address the possibility that cleavage of the signal peptide from the S1 product would result in loss of the N-terminal 3xFLG tag, preventing accurate assessment of fS1 synthesis by the rSA11 / NSP3-2A-fS1 virus via immunoblot assays using anti-FLAG antibodies. Instead, production of the S1 product can be assessed with anti-6xHis antibodies. The second recombinant virus generated, rSA11 / NSP3-2A-fS1, contained segment 7 RNA designed to express S1 with a C-terminal 1xFLAG tag but without any N-terminal tag (S1-1xFLAG). The utility of this virus was examined for the possibility that a tag located upstream of the S1 signal peptide could interfere with synthesis and glycosylation of the S1 protein by the endoplasmic reticulum.

[0131] The recombinant viruses rSA11 / NSP3-2A-S1f and rSA11 / NSP3-2A-fS1-His were produced following the same reverse genetic procedure previously used to generate rSA11 / NSP3-2A-fS1-His and the wild-type virus rSA11 / wt. This procedure involved transfection of BHK-T7 cells with a set of T7 transcription vectors (pT7) expressing SA11 positive-sense (+)RNA and a CMV expression plasmid (pCMV-NP868R) encoding the capping enzyme of African swine fever virus. In the transfection mixture, the T7 transcription vectors for NSP2 and NSP5 +RNA (pT7 / SA11NSP2 and pT7 / SA11NSP5, respectively) were used at levels three-fold greater than the other pT7 vectors. The modified segment 7 transcription vector used to generate rSA11 encoding the S1 product (Figure 11) was added to the transfection mixture in place of pT7 / NSP3SA11. Recombinant viruses formed in transfected BHK-T7 cells were amplified by overplating MA104 cells and then isolated by plaque purification.

[0132] Genomic and developmental characteristics of rSA11 The dsRNA genomic segments of the recombinant viruses were separated by gel electrophoresis to verify the presence of modified segment 7 RNA (Figure 12). This analysis showed that rSA11 / NSP3-2A-fS1, rSA11 / NSP3-2A-S1f, and rSA11 / NSP3-2A-fS1-His all lacked the 1.1 Kbp segment 7 dsRNA typical of rSA11 / wt. Instead, as expected, all S1-encoding rSA11 viruses contained a segment 7 dsRNA that migrated in polyacrylamide gels near the location of the segment 1 dsRNA and had a size of 3.3 Kbp. Sequencing verified that the segment 7 RNA of the recombinant viruses was identical to that of the pT7 transcription vector used for recovery. The total size of the genome segments of rSA11 / NSP3-2A-fS1, rSA11 / NSP3-2A-S1f, and rSA11 / NSP3-2A-fS1-His was 20.7 to 20.8 Kbp, which is 2.1 to 2.2 Kbp (or approximately 11%) larger than that of the wild-type virus.

[0133] rSA11 virus expressing glycosylated S1 protein of SARS-CoV-2 This was followed by a second round of amplification in MA104 cells. Recombinant viruses were plaque purified from the virus pool and the translation of S1 RNA with an N-terminal 3xFLAG tag was fused to fS1. In this design, the 3xFLAG tag was positioned immediately upstream of the S1 signal sequence (SS), an important element for the synthesis of glycosylated S1. In previous studies, the nature of the S1 product expressed by rSA11 / NSP3-2A-fS1 in infected cells was uncertain, possibly due to instability or cleavage of the S1 product or the effect of the FLAG tag on the functionality of the SS sequence. This study re-examined the S1 product made by the rSA11 / NSP3-2A-fS1 virus and compared this product to the product generated by a newly designed rSA11 virus that encoded an S1 protein lacking the N-terminal tag sequence. This analysis shows that the newly designed rSA11 virus efficiently expressed a glycosylated S1 protein with the ability to bind to the extracellular domain of ACE2. These results demonstrate that the RV segment 7 expression platform can be used to direct expression of glycosylated capsid protein.

[0134] While the disclosed subject matter is susceptible to various modifications and alternative forms, specific embodiments have been described in detail herein. The intention, however, is not to limit the disclosure to the specific embodiments described. The disclosure is intended to cover all modifications, equivalents, and alternatives falling within the scope of the disclosure as defined in the appended claims.

[0135] Similarly, although an illustrative method may be described herein, the description of the method should not be construed to imply any requirement or particular order of the various steps disclosed herein. However, certain embodiments may require certain steps and / or a certain order among certain steps (e.g., performance of some steps may depend on the results of previous steps), as may be expressly described herein and / or understood by the nature of the steps themselves. In addition, a "set," "subset," or "group" of items (e.g., inputs, algorithms, data values, etc.) may include one or more items, and similarly, a subset or subgroup of items may include one or more items. "Plurality" means two or more.

[0136] As terms used herein in relation to ranges, "about" and "approximately" are used interchangeably and can refer to measurements, including those measurements that are stated, and also include any measurements that are fairly close to the stated measurements, but may differ by a fairly small amount, such as would be understood and easily ascertained by an individual of ordinary skill in the relevant art, due to measurement errors, differences in measurement and / or manufacturing equipment calibration, human errors in reading and / or measurement setups, adjustments made to optimize performance and / or structural parameters in view of differences in measurements associated with other components, particularly realization scenarios, imprecise adjustments and / or manipulation of objects by humans or machines, etc.

[0137] [Table 1]

[0138] [Table 2]

[0139] [Table 3] TIFF2024540894000005.tif164161

Claims

1. a sequence encoding the rotavirus (RV) NSP3 protein, and heterologous polynucleotides, A polynucleotide comprising: The heterologous polynucleotide encodes a peptide or protein and is in frame with NSP3, wherein the peptide or protein comprises a viral peptide or protein.

2. The polynucleotide of claim 1 , wherein the polynucleotide is operably linked to a promoter.

3. 2. The polynucleotide of claim 1, wherein the sequence encoding RV NSP3 is a sequence encoding SEQ ID NO:1 or a sequence having at least about 90% identity to SEQ ID NO:

1.

4. The polynucleotide of claim 1, wherein the viral peptide or protein comprises (a) a norovirus (NoV) peptide or protein including NoV VP1 protein, or (b) a SARS-CoV-2 protein or peptide, and the SARS-CoV-2 protein or peptide is selected from the N protein, the S protein, or a fragment of either the N protein or the S protein.

5. The polynucleotide of claim 1 , wherein the peptide or protein comprises a cleavage site.

6. The polynucleotide of claim 5 , wherein the cleavage site is a protease cleavage site.

7. The polynucleotide of claim 1, wherein the heterologous polynucleotide is less than or equal to about 2.6 kb in length.

8. 2. The polynucleotide of claim 1, wherein the peptide or protein (a) is a glycoprotein or (b) contains one or more glycosylation sites.

9. A polynucleotide according to claim 1, which (a) encodes a protein selected from SEQ ID NOs: 2 to 11 or encodes a sequence having at least about 90% identity to a sequence selected from SEQ ID NOs: 2 to 11, or (b) comprises any one of SEQ ID NOs: 13 to 22 or comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 13 to 22.

10. An infectious particle comprising a polynucleotide according to any one of claims 1 to 9.

11. A pharmaceutical composition comprising the infectious particles of claim 10.

12. 12. The pharmaceutical composition of claim 11 for use in a method of inducing an immune response in a subject against one or more microorganisms or a method of vaccinating a subject against one or more pathogens, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 11 to induce an immune response against one or more microorganisms or vaccinate the subject against one or more pathogens.

13. 1. A method for producing recombinant rotavirus (RV) in vitro, comprising:

10. A method comprising introducing a polynucleotide according to any one of claims 1 to 9 into a cell, allowing the cell to express the polynucleotide, incubating the cell for a sufficient time to produce a RV, and harvesting the virus produced by the cell to produce a RV in vitro.

14. 14. The method of claim 13, wherein the method further comprises introducing one or more additional polynucleotides into the cell before the enabling step, wherein the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4 and NSP5, and each sequence encoding an RV protein is operably linked to a promoter.

15. 1. A system, platform or kit for producing a recombinant rotavirus (RV), comprising: (a) a polynucleotide according to any one of claims 1 to 9, and (b) a cell capable of expressing the polynucleotide of (a); A system, platform or kit comprising:

16. The polynucleotide described in claim 4, wherein the viral peptide or protein comprises a norovirus (NoV) peptide or protein selected from SEQ ID NOs: 24, 26 or 80-84.

17. A polynucleotide described in claim 5, wherein the cleavage site is a self-cleaving peptide sequence.

18. A polynucleotide described in claim 5, wherein the cleavage site is a self-cleaving peptide sequence of the porcine teschovirus 2A element (sequence number 29).