Compositions and methods for the treatment of primary ciliary dyskinesia
Patent Information
- Application Number
- JP2024527340
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-10
- Filing Date
- 2022-11-10
- Publication Date
- 2025-11-17
AI Technical Summary
Current treatments for primary ciliary dysfunction (PCD), a genetic disorder affecting cilia function, are inadequate, and traditional gene therapy methods struggle to effectively deliver therapeutic agents to cilia.
Administration of mRNA encoding DNAI1 protein at specific doses and intervals to restore ciliary function by increasing ciliary motor frequency and DNAI1-positive transfection in ciliated cells, using liposome-encapsulated mRNA delivery.
The method enhances ciliary function by increasing ciliary motor frequency and DNAI1 protein expression in the airway epithelium, providing a therapeutic effect for PCD symptoms.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 278,007, filed November 10, 2021, the contents of each of which are incorporated by reference in their entirety herein.
[0002] Incorporation by reference of sequence listing This specification makes reference to the Sequence Listing, which was submitted electronically on November 10, 2022 as an .xml with the file name MRT-2260WO1_SL. The .xml file was created on October 29, 2022 and is 3.71 MB in size. The entire contents of the Sequence Listing are incorporated herein by reference. [Background technology]
[0003] Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder characterized by abnormal cilia and flagella found in the lining of the airways, reproductive system, and other organs and tissues. PCD occurs in approximately 1 in 16,000 people. Symptoms appear as early as birth with breathing problems, and affected individuals develop frequent airway infections beginning in early childhood. In patients with PCD, the cilia in the respiratory system have a functional defect that prevents the drainage of mucus from the lungs, sinuses, and middle ear. People with PCD also have nasal congestion and chronic coughing throughout the year. Chronic airway infections can result in a condition called bronchiectasis, which damages the airways called bronchi, causing life-threatening breathing problems. Some individuals with PCD also have infertility, recurrent ear infections, and abnormally placed organs in their chest and abdomen.
[0004] Among the several genes identified as directly involved in PCD pathogenesis, strikingly frequent mutations are found in two genes: DNAI1 and DNAH5, which code for the intermediate and heavy chains of axonemal dynein, respectively. Mutations in other genes encoding proteins involved in axonemal ultrastructure (DNAH11, DNAI2, TXNDC3, RSPH9, RSPH4A) or axonemal assembly (KTU, CRRC50), as well as mutations in the RPGR gene in certain cases of PCD, have also been reported. Mutations in DNAI1 and DNAH5, both of which are associated with a pilus outer dynein arm (ODA)-deficient phenotype, are estimated to together account for nearly 40% of PCD cases.
[0005] Currently, there is no cure for PCD. Existing standard treatments include aggressive measures to promote mucus clearance and antibiotic therapy for bacterial infections of the airways. Routine immunization is administered to prevent respiratory infections and other secondary complications. For some patients, lobectomy, lung transplantation, and sinus surgery are considered. Gene therapy is being investigated to address the urgent need for new, more effective treatments for PCD. However, traditional gene therapy methods for delivering therapeutic agents to the lungs, particularly the cilia, remain problematic. Summary of the Invention [Means for solving the problem]
[0006] The present invention provides, inter alia, methods and compositions for use in the treatment of primary ciliary dysfunction (PCD). The invention is based in part on the surprising discovery that administration of mRNA encoding DNAI1 protein at doses ranging from 1 mg to 36 mg per day for 5 consecutive days resulted in restoration of ciliary function in PCD. Furthermore, the methods of the invention resulted in expression of DNAI1 protein in airway epithelium at levels at least 10% of wild-type levels, increased ciliary beat frequency (CBF), and greater than 5% DNAI1 positive transfection in ciliated cells.
[0007] In one aspect, the invention provides, inter alia, a treatment for primary ciliary dyskinesia (PCD), comprising administering to a subject in need of treatment mRNA encoding dynein axonemal intermediate chain 1 (DNAI1) protein, wherein the mRNA is administered at a dose ranging from 1 mg to 36 mg daily for five consecutive days.
[0008] In some embodiments, the mRNA is administered at a dose ranging from 0.01 mg to 100 mg. In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg. In some embodiments, the mRNA is administered at a dose of 0.5 mg. In some embodiments, the mRNA is administered at a dose of 1 mg. In some embodiments, the mRNA is administered at a dose of 1.5 mg. In some embodiments, the mRNA is administered at a dose of 2 mg. In some embodiments, the mRNA is administered in a dose of 2.5 mg. In some embodiments, the mRNA is administered in a dose of 3 mg. In some embodiments, the mRNA is administered in a dose of 4 mg. In some embodiments, the mRNA is administered in a dose of 5 mg. In some embodiments, the mRNA is administered in a dose of 6 mg. In some embodiments, the mRNA is administered in a dose of 7 mg. In some embodiments, the mRNA is administered in a dose of 8 mg. In some embodiments, the mRNA is administered in a dose of 9 mg. In some embodiments, the mRNA is administered in a dose of 10 mg. In some embodiments, the mRNA is administered in a dose of 11 mg. In some embodiments, the mRNA is administered in a dose of 12 mg. In some embodiments, the mRNA is administered in a dose of 13 mg. In some embodiments, the mRNA is administered in a dose of 14 mg. In some embodiments, the mRNA is administered in a dose of 15 mg. In some embodiments, the mRNA is administered in a dose of 16 mg. In some embodiments, the mRNA is administered in a dose of 17 mg. In some embodiments, the mRNA is administered in a dose of 18 mg.In some embodiments, the mRNA is administered in a dose of 20 mg. In some embodiments, the mRNA is administered in a dose of 21 mg. In some embodiments, the mRNA is administered in a dose of 22 mg. In some embodiments, the mRNA is administered in a dose of 23 mg. In some embodiments, the mRNA is administered in a dose of 24 mg. In some embodiments, the mRNA is administered in a dose of 25 mg. In some embodiments, the mRNA is administered in a dose of 26 mg. In some embodiments, the mRNA is administered in a dose of 27 mg. In some embodiments, the mRNA is administered in a dose of 28 mg. In some embodiments, the mRNA is administered in a dose of 29 mg. In some embodiments, the mRNA is administered in a dose of 30 mg. In some embodiments, the mRNA is administered in a dose of 31 mg. In some embodiments, the mRNA is administered in a dose of 32 mg. In some embodiments, the mRNA is administered in a dose of 33 mg. In some embodiments, the mRNA is administered in a dose of 34 mg. In some embodiments, the mRNA is administered in a dose of 35 mg. In some embodiments, the mRNA is administered in a dose of 36 mg. In some embodiments, the mRNA is administered in a dose of 37 mg. In some embodiments, the mRNA is administered in a dose of 38 mg. In some embodiments, the mRNA is administered in a dose of 39 mg. In some embodiments, the mRNA is administered in a dose of 40 mg.
[0009] In some embodiments, the mRNA is administered for 1 day. In some embodiments, the mRNA is administered for 2 consecutive days. In some embodiments, the mRNA is administered for 3 consecutive days. In some embodiments, the mRNA is administered for 4 consecutive days. In some embodiments, the mRNA is administered for at least 1 day. In some embodiments, the mRNA is administered for at least 2 days. In some embodiments, the mRNA is administered for at least 3 days. In some embodiments, the mRNA is administered for at least 4 days. In some embodiments, the administration is for at least 5 consecutive days. In some embodiments, the mRNA is administered for 5 days. In some embodiments, the mRNA is administered for 6 days. In some embodiments, the mRNA is administered for 7 days. In some embodiments, the mRNA is administered for 8 days. In some embodiments, the mRNA is administered for 9 days. In some embodiments, the mRNA is administered for 10 days. In some embodiments, the mRNA is administered for 12 days. In some embodiments, the mRNA is administered for 14 days. In some embodiments, the mRNA is administered for 15 days. In some embodiments, the mRNA is administered for 16 days. In some embodiments, the mRNA is administered for 17 days. In some embodiments, the mRNA is administered for 18 days. In some embodiments, the mRNA is administered for 20 days. In some embodiments, the mRNA is administered for 1 week. In some embodiments, the mRNA is administered for 2 weeks. In some embodiments, the mRNA is administered for 3 weeks. In some embodiments, the mRNA is administered for 4 weeks. In some embodiments, the mRNA is administered for 5 weeks. In some embodiments, the mRNA is administered for 6 weeks. In some embodiments, the mRNA is administered for 7 weeks. In some embodiments, the mRNA is administered for 8 weeks. In some embodiments, the mRNA is administered for 10 weeks. In some embodiments, the mRNA is administered for 1 month. In some embodiments, the mRNA is administered for 2 months. In some embodiments, the mRNA is administered for 3 months. In some embodiments, the mRNA is administered for 4 months.In some embodiments, the mRNA is administered for 5 months. In some embodiments, the mRNA is administered for 6 months. In some embodiments, the mRNA is administered for 7 months. In some embodiments, the mRNA is administered for 8 months. In some embodiments, the mRNA is administered for 9 months. In some embodiments, the mRNA is administered for 10 months. In some embodiments, the mRNA is administered for 11 months. In some embodiments, the mRNA is administered for 12 months. In some embodiments, the mRNA is administered for 1 year.
[0010] In some embodiments, the 5 consecutive days of administration is at least 5 consecutive days. In some embodiments, the mRNA is administered for 5 days. In some embodiments, the mRNA is administered for 6 days. In some embodiments, the mRNA is administered for 7 days. In some embodiments, the mRNA is administered for 8 days. In some embodiments, the mRNA is administered for 9 days. In some embodiments, the mRNA is administered for 10 days. In some embodiments, the mRNA is administered for 12 days. In some embodiments, the mRNA is administered for 14 days. In some embodiments, the mRNA is administered for 15 days. In some embodiments, the mRNA is administered for 16 days. In some embodiments, the mRNA is administered for 17 days. In some embodiments, the mRNA is administered for 18 days. In some embodiments, the mRNA is administered for 20 days. In some embodiments, the mRNA is administered for 1 week. In some embodiments, the mRNA is administered for 2 weeks. In some embodiments, the mRNA is administered for 3 weeks. In some embodiments, the mRNA is administered for 4 weeks. In some embodiments, the mRNA is administered for 5 weeks. In some embodiments, the mRNA is administered for 6 weeks. In some embodiments, the mRNA is administered for 7 weeks. In some embodiments, the mRNA is administered for 8 weeks. In some embodiments, the mRNA is administered for 10 weeks. In some embodiments, the mRNA is administered for 1 month. In some embodiments, the mRNA is administered for 2 months. In some embodiments, the mRNA is administered for 3 months. In some embodiments, the mRNA is administered for 4 months. In some embodiments, the mRNA is administered for 5 months. In some embodiments, the mRNA is administered for 6 months. In some embodiments, the mRNA is administered for 7 months. In some embodiments, the mRNA is administered for 8 months. In some embodiments, the mRNA is administered for 9 months. In some embodiments, the mRNA is administered for 10 months. In some embodiments, the mRNA is administered for 11 months. In some embodiments, the mRNA is administered for 12 months.In some embodiments, the mRNA is administered for one year.
[0011] In one aspect, the invention provides, inter alia, a method for treating primary ciliary dyskinesia (PCD), comprising administering to a subject in need of treatment mRNA encoding dynein axoneme intermediate chain 1 (DNAI1) protein, wherein the mRNA is administered at a therapeutically effective dose and interval such that the subject achieves an increase in ciliary beating frequency (CBF) compared to a control.
[0012] In one aspect, the present invention provides, inter alia, a method for treating primary ciliary dysfunction (PCD), comprising administering to a subject in need of treatment mRNA encoding dynein axoneme intermediate chain 1 (DNAI1) protein, wherein the mRNA is administered at a therapeutically effective dose and at an interval such that the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 10% of the wild-type level.
[0013] In some embodiments, the airway epithelium comprises pulmonary epithelium. In some embodiments, the airway epithelium comprises basal cells. In some embodiments, the airway epithelium comprises club cells. In some embodiments, the airway epithelium comprises ciliated cells. In some embodiments, the airway epithelium comprises goblet cells. In some embodiments, the airway epithelium comprises tuft cells. In some embodiments, the airway epithelium comprises pulmonary neuroendocrine cells (PNECs). In some embodiments, the airway epithelium comprises lung salt cells. In some embodiments, the airway epithelium comprises fold cells. In some embodiments, the airway epithelium comprises caruncle. In some embodiments, the airway epithelium comprises ciliated cells.
[0014] In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 12% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 15% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 18% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 20% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 22% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 25% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 28% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 30% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 35% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 38% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 40% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 42% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 45% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 50% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 60% of the wild-type level.In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 70% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 80% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 90% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 95% of the wild-type level. In some embodiments, the subject maintains expression of DNAI1 protein in the airway epithelium at a level of at least 99% of the wild-type level.
[0015] In some embodiments, CBF is increased by at least 3% compared to the control. In some embodiments, CBF is increased by at least 4% compared to the control. In some embodiments, CBF is increased by at least 5% compared to the control. In some embodiments, CBF is increased by at least 6% compared to the control. In some embodiments, CBF is increased by at least 7% compared to the control. In some embodiments, CBF is increased by at least 8% compared to the control. In some embodiments, CBF is increased by at least 9% compared to the control. In some embodiments, CBF is increased by at least 10% compared to the control. In some embodiments, CBF is increased by at least 11% compared to the control. In some embodiments, CBF is increased by at least 12% compared to the control. In some embodiments, CBF is increased by at least 13% compared to the control. In some embodiments, CBF is increased by at least 14% compared to the control. In some embodiments, CBF is increased by at least 15% compared to the control. In some embodiments, CBF is increased by at least 16% compared to the control. In some embodiments, CBF is increased by at least 17% compared to the control. In some embodiments, CBF is increased by at least 18% compared to the control. In some embodiments, CBF is increased by at least 19% compared to the control. In some embodiments, CBF is increased by at least 20% compared to the control. In some embodiments, CBF is increased by at least 22% compared to the control. In some embodiments, CBF is increased by at least 25% compared to the control. In some embodiments, CBF is increased by at least 28% compared to the control. In some embodiments, CBF is increased by at least 30% compared to the control. In some embodiments, CBF is increased by at least 35% compared to the control. In some embodiments, CBF is increased by at least 40% compared to the control. In some embodiments, CBF is increased by at least 45% compared to the control. In some embodiments, CBF is increased by at least 50% compared to the control.In some embodiments, CBF is increased by at least 55% compared to a control. In some embodiments, CBF is increased by at least 60% compared to a control. In some embodiments, CBF is increased by at least 65% compared to a control. In some embodiments, CBF is increased by at least 70% compared to a control. In some embodiments, CBF is increased by at least 75% compared to a control. In some embodiments, CBF is increased by at least 80% compared to a control. In some embodiments, CBF is increased by at least 85% compared to a control. In some embodiments, CBF is increased by at least 90% compared to a control. In some embodiments, CBF is increased by at least 95% compared to a control. In some embodiments, CBF is increased by at least 97% compared to a control. In some embodiments, CBF is increased by at least 98% compared to a control. In some embodiments, CBF is increased by at least 99% compared to a control. In some embodiments, CBF is increased by at least 100% compared to a control. In some embodiments, administration of the mRNA restores CBF levels compared to a control.
[0016] In some embodiments, the control is the CBF in the subject before administration of the mRNA encoding DNAI1 protein.In some embodiments, the control is untreated CBF.In some embodiments, the control is the CBF in the subject administered with placebo.
[0017] In some embodiments, administration of the mRNA rescues CBF in the subject to normal CBF levels.
[0018] In some embodiments, a normal CBF level is between 6-16 Hz. In some embodiments, a normal CBF level is between 6-10 Hz. In some embodiments, a normal CBF level is between 6-9 Hz. In some embodiments, a normal CBF level is 6 Hz. In some embodiments, a normal CBF level is 7 Hz. In some embodiments, a normal CBF level is 8 Hz. In some embodiments, a normal CBF level is 9 Hz. In some embodiments, a normal CBF level is 10 Hz. In some embodiments, a normal CBF level is 11 Hz. In some embodiments, a normal CBF level is 12 Hz. In some embodiments, a normal CBF level is a level sufficient for proper ciliary function. In some embodiments, a normal CBF level is a level sufficient for mucus clearance.
[0019] In some embodiments, CBF is measured by high speed video microscopy (HSVM). In some embodiments, CBF is measured by a high speed digital video camera.
[0020] In some embodiments, CBF is measured at a temperature of 25° C. In some embodiments, CBF is measured at a temperature of 32° C. In some embodiments, CBF is measured at a temperature of 37° C.
[0021] In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 3% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 5% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 7% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 10% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 12% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 15% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 18% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 20% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 22% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 25% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 28% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 30% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 35% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 40% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 45% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 50% in ciliated cells.In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 55% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 60% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 65% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 70% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 75% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 80% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 85% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 90% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 95% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 98% in ciliated cells. In some embodiments, administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 99% in ciliated cells.
[0022] In some embodiments, the DNAI1 mRNA is encapsulated in a liposome.
[0023] In some embodiments, the liposomes comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the liposomes comprise three or fewer distinct lipid components. In some embodiments, the liposomes comprise four or fewer distinct lipid components.
[0024] In some embodiments, the one or more cationic lipids are selected from the group consisting of TL1-01D-DMA, TL1-10D-DMA, GL-TES-SA-DMP-E18-2, HEP-E4-E10, HEP-E3-E10, TL1-04D-DMA, GL-TES-SA-DME-E18-2, Guan-SS-Chol, SY-3-E14-DMAPr, RL3-07D-DMA, cKK-E12, OF-02, ICE (imidazole-based esters), and combinations thereof.
[0025] In some embodiments, the cationic lipid is TL1-01D-DMA. In some embodiments, the cationic lipid is TL1-10D-DMA. In some embodiments, the cationic lipid is GL-TES-SA-DME-E18-2. In some embodiments, the cationic lipid is HEP-E4-E10. In some embodiments, the cationic lipid is HEP-E3-E10. In some embodiments, the cationic lipid is TL1-04D-DMA. In some embodiments, the cationic lipid is GL-TES-SA-DME-E18-2. In some embodiments, the cationic lipid is Guan-SS-Chol. In some embodiments, the cationic lipid is SY-3-E14-DMAPr. In some embodiments, the cationic lipid is RL3-07D-DMA. In some embodiments, the cationic lipid is ICE.
[0026] In some embodiments, the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)) or combinations thereof. In some embodiments, the non-cationic lipid is DOPE.
[0027] In some embodiments, the one or more PEG-modified lipids comprise a poly(ethylene)glycol chain up to 5 kDa in length covalently attached to the lipid by an alkyl chain of C6-C20 in length, hi some embodiments, the PEG-modified lipid is DMG-PEG2K.
[0028] In some embodiments, the cationic lipid comprises about 30-60% of the liposome by molar ratio.
[0029] In some embodiments, the cationic lipid comprises about 30%, 40%, 50%, or 60% of the liposome by molar ratio.
[0030] In some embodiments, the liposomes comprise four distinct lipid components: cationic lipid, non-cationic lipid, cholesterol, and PEG-modified lipid. In some embodiments, the molar ratio of cationic lipid to non-cationic lipid to cholesterol to PEG-modified lipid is between about 30-60:25-35:20-30:1-15, respectively.
[0031] In some embodiments, the liposomes comprise three distinct lipid components: a cationic lipid (typically a sterol-based cationic lipid), a non-cationic lipid, and a PEG-modified lipid. In some embodiments, the molar ratio of cationic lipid to non-cationic lipid to PEG-modified lipid is approximately 60:35:5, respectively.
[0032] In some embodiments, the liposomes have a diameter of about 30 nm to 200 nm, optionally the liposomes have a diameter of about 100 nm or less. In some embodiments, the liposomes have a size less than 200 nm. In some embodiments, the liposomes have a size less than 180 nm. In some embodiments, the liposomes have a size less than 150 nm. In some embodiments, the liposomes have a size less than 125 nm. In some embodiments, the liposomes have a size less than 110 nm. In some embodiments, the liposomes have a size less than 200 nm. In some embodiments, the liposomes have a size less than 100 nm. In some embodiments, the liposomes have a size less than 90 nm. In some embodiments, the liposomes have a size less than 80 nm. In some embodiments, the liposomes have a size less than 75 nm. In some embodiments, the liposomes have a size less than 70 nm. In some embodiments, the liposomes have a size less than 65 nm. In some embodiments, the liposomes have a size less than 60 nm. In some embodiments, the liposomes have a size of 30 nm to 180 nm. In some embodiments, the liposomes have a size of 50 nm to 160 nm. In some embodiments, the liposomes have a size of 60 nm to 120 nm. In some embodiments, the liposomes have a size of 80 nm to 100 nm. In some embodiments, the liposomes have a size of 60 nm to 100 nm. In some embodiments, the liposomes have a size of 60 nm to 80 nm.
[0033] In some embodiments, the DNAI1 mRNA is codon-optimized. In some embodiments, the codon-optimized mRNA produces at least 10% more, 15% more, 20% more, 25% more, or at least 30% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 10% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 15% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 20% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 25% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 30% more DNAI1 protein than a non-codon-optimized mRNA sequence. In some embodiments, the codon-optimized mRNA produces at least 30% more DNAI1 protein than a non-codon-optimized mRNA sequence.
[0034] In some embodiments, the DNAI1 mRNA is codon-optimized to include a high-yield codon-optimized mRNA sequence that results in at least 10% more, 15% more, 20% more, 25% more, or at least 30% more DNAI1 protein than a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence results in at least 10% more DNAI1 protein than a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence results in at least 15% more DNAI1 protein than a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence provides at least 20% more DNAI1 protein compared to a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence provides at least 25% more DNAI1 protein compared to a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence provides at least 30% more DNAI1 protein compared to a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose. In some embodiments, the high-yield codon-optimized mRNA sequence provides at least 30% more DNAI1 protein compared to a second DNAI1 mRNA sequence that is codon-optimized with a different reference codon-optimized sequence and delivered at the same dose.
[0035] In some embodiments, the DNAI1 mRNA comprises one or more modified nucleotides.
[0036] In some embodiments, the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.
[0037] In some embodiments, the one or more modified nucleotides include pseudouridine. In some embodiments, the one or more modified nucleotides include N-1-methyl-pseudouridine. In some embodiments, the one or more modified nucleotides include 2-aminoadenosine. In some embodiments, the one or more modified nucleotides include 2-thiothymidine. In some embodiments, the one or more modified nucleotides include inosine. In some embodiments, the one or more modified nucleotides include pyrrolo-pyrimidine. In some embodiments, the one or more modified nucleotides include 3-methyladenosine. In some embodiments, the one or more modified nucleotides include 5-methylcytidine. In some embodiments, the one or more modified nucleotides include C-5 propynyl-cytidine. In some embodiments, the one or more modified nucleotides include C-5 propynyllo-uridine. In some embodiments, the one or more modified nucleotides include 2-aminoadenosine. In some embodiments, the one or more modified nucleotides include C5-bromouridine. In some embodiments, the one or more modified nucleotides comprise C5-fluorouridine. In some embodiments, the one or more modified nucleotides comprise C5-iodouridine. In some embodiments, the one or more modified nucleotides comprise C5-propynyllo-uridine. In some embodiments, the one or more modified nucleotides comprise C5-propynyl-cytidine. In some embodiments, the one or more modified nucleotides comprise C5-methylcytidine. In some embodiments, the one or more modified nucleotides comprise 2-aminoadenosine. In some embodiments, the one or more modified nucleotides comprise 7-deazaadenosine. In some embodiments, the one or more modified nucleotides comprise 7-deazaguanosine. In some embodiments, the one or more modified nucleotides comprise 8-oxoadenosine. In some embodiments, the one or more modified nucleotides comprise 8-oxoguanosine.In some embodiments, the one or more modified nucleotides comprises O(6)-methylguanine.In some embodiments, the one or more modified nucleotides comprises 2-thiocytidine.
[0038] In some embodiments, the mRNA is unmodified.
[0039] In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO:2 or SEQ ID NO:3.
[0040] In some embodiments, the mRNA comprises a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO:4 or SEQ ID NO:5.
[0041] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NO:6-SEQ ID NO:10. In some embodiments, the mRNA comprises a coding sequence set forth in SEQ ID NO:6-SEQ ID NO:10.
[0042] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:6.
[0043] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence set forth in SEQ ID NO:7.
[0044] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence set forth in SEQ ID NO:8.
[0045] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:9.
[0046] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence set forth in SEQ ID NO: 10.
[0047] In some embodiments, administration of mRNA to a subject is performed by intratracheal, intranasal, intravenous, intramuscular, or subcutaneous delivery.
[0048] In some embodiments, the mRNA is administered to the subject by intratracheal delivery. In some embodiments, the mRNA is administered to the subject by intranasal delivery. In some embodiments, the mRNA is administered to the subject by aerosol delivery. In some embodiments, the mRNA is administered to the subject by nebulized delivery. In some embodiments, the mRNA is administered to the subject by dry powder inhalation.
[0049] In some embodiments, the composition is administered once a week.
[0050] In some embodiments, the composition is administered once every two weeks.
[0051] In some embodiments, the composition is administered twice a month.
[0052] In some embodiments, the composition is administered once a month.
[0053] In some embodiments, the composition is administered at repeat intervals. In some embodiments, the repeat interval occurs daily, every 3 days, every week, every 2 weeks, every 3 weeks, or every 4 weeks. Thus, in some embodiments, the repeat interval occurs daily. In some embodiments, the repeat interval occurs every 3 days. In some embodiments, the repeat interval occurs every week. In some embodiments, the repeat interval occurs every 2 weeks. In some embodiments, the repeat interval occurs every 3 weeks. In some embodiments, the repeat interval occurs every 4 weeks. In some embodiments, the repeat interval occurs every 5 weeks. In some embodiments, the repeat interval occurs every 6 weeks. In some embodiments, the repeat interval occurs every 7 weeks. In some embodiments, the repeat interval occurs every 8 weeks. In some embodiments, the repeat interval occurs every 9 weeks. In some embodiments, the repeat interval occurs every 10 weeks. In some embodiments, the repeat interval occurs every 11 weeks. In some embodiments, the repeat interval occurs every 12 weeks.
[0054] In some embodiments, the composition is administered daily for five consecutive days. In some embodiments, daily administration for five consecutive days is at least five consecutive days. Thus, in some embodiments, the composition is administered for six consecutive days, one week, one month, or one year.
[0055] In some embodiments, the composition is administered daily for 6 consecutive days. In some embodiments, the composition is administered daily for 7 consecutive days. In some embodiments, the composition is administered daily for 8 consecutive days. In some embodiments, the composition is administered daily for 9 consecutive days. In some embodiments, the composition is administered daily for 10 consecutive days. In some embodiments, the composition is administered daily for 11 consecutive days. In some embodiments, the composition is administered daily for 12 consecutive days. In some embodiments, the composition is administered daily for 13 consecutive days. In some embodiments, the composition is administered daily for 14 consecutive days. In some embodiments, the composition is administered daily for 15 consecutive days. In some embodiments, the composition is administered daily for 1 week. In some embodiments, the composition is administered daily for 2 weeks. In some embodiments, the composition is administered daily for 2 weeks. In some embodiments, the composition is administered daily for 3 weeks. In some embodiments, the composition is administered daily for 4 weeks. In some embodiments, the composition is administered daily for 5 weeks. In some embodiments, the composition is administered daily for 6 weeks. In some embodiments, the composition is administered daily for 7 weeks. In some embodiments, the composition is administered daily for 8 weeks. In some embodiments, the composition is administered daily for 10 weeks. In some embodiments, the composition is administered daily for 12 weeks. In some embodiments, the composition is administered daily for 15 weeks. In some embodiments, the composition is administered daily for 1 month. In some embodiments, the composition is administered daily for 2 months. In some embodiments, the composition is administered daily for 3 months. In some embodiments, the composition is administered daily for 4 months. In some embodiments, the composition is administered daily for 5 months. In some embodiments, the composition is administered daily for 6 months. In some embodiments, the composition is administered daily for 7 months. In some embodiments, the composition is administered daily for 8 months. In some embodiments, the composition is administered daily for 9 months. In some embodiments, the composition is administered daily for 10 months. In some embodiments, the composition is administered daily for 12 months.In some embodiments, the composition is administered daily for 15 months. In some embodiments, the composition is administered daily for 20 months. In some embodiments, the composition is administered daily for 1 year. In some embodiments, the composition is administered daily for 2 years. In some embodiments, the composition is administered daily for 3 years. In some embodiments, the composition is administered daily for 5 years.
[0056] In some embodiments, the composition is administered weekly for 5 consecutive weeks. In some embodiments, the weekly administration for 5 consecutive weeks is at least 5 consecutive weeks. Thus, in some embodiments, the composition is administered for 6 consecutive weeks, 10 consecutive weeks, a month, a year, or for 10 years or more.
[0057] In some embodiments, the composition is administered weekly for two weeks. In some embodiments, the composition is administered weekly for three weeks. In some embodiments, the composition is administered weekly for four weeks. In some embodiments, the composition is administered weekly for five weeks. In some embodiments, the composition is administered weekly for six weeks. In some embodiments, the composition is administered weekly for seven weeks. In some embodiments, the composition is administered weekly for eight weeks. In some embodiments, the composition is administered weekly for ten weeks. In some embodiments, the composition is administered weekly for twelve weeks. In some embodiments, the composition is administered weekly for fifteen weeks. In some embodiments, the composition is administered weekly for one month. In some embodiments, the composition is administered weekly for two months. In some embodiments, the composition is administered weekly for three months. In some embodiments, the composition is administered weekly for four months. In some embodiments, the composition is administered weekly for five months. In some embodiments, the composition is administered weekly for six months. In some embodiments, the composition is administered weekly for seven months. In some embodiments, the composition is administered weekly for eight months. In some embodiments, the composition is administered weekly for nine months. In some embodiments, the composition is administered weekly for ten months. In some embodiments, the composition is administered weekly for 12 months. In some embodiments, the composition is administered weekly for 15 months. In some embodiments, the composition is administered weekly for 20 months. In some embodiments, the composition is administered weekly for 1 year. In some embodiments, the composition is administered weekly for 2 years. In some embodiments, the composition is administered weekly for 3 years. In some embodiments, the composition is administered weekly for 5 years. In some embodiments, the composition is administered weekly for 10 years or more.
[0058] In some embodiments, administration of the mRNA results in detectable DNAI1 protein expression in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis.
[0059] In some embodiments, administration of mRNA results in detectable DNAI1 protein expression in the lung.
[0060] In some embodiments, administration of the mRNA results in detectable DNAI1 protein expression in the lung epithelium.
[0061] In some embodiments, DNAI1 protein expression is detectable throughout the length of the pilus. In some embodiments, DNAI1 mRNA is detectable throughout the length of the pilus.
[0062] In some aspects, the present invention provides a composition for use in the treatment of primary ciliary dysfunction (PCD), wherein the liposome comprises a therapeutically effective amount of mRNA encoding human axonemal dynein intermediate chain 1 (DNAI1) encapsulated in a liposome comprising one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.
[0063] In some embodiments, the mRNA comprises a DNAI1 coding sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NO:6-SEQ ID NO:10.
[0064] In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 6. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 7. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 8. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 9. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 10.
[0065] In some embodiments, the mRNA has a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO:2 or SEQ ID NO:3, and a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO:4 or SEQ ID NO:5.
[0066] In some embodiments, the mRNA comprises one or more modified nucleotides.
[0067] In some embodiments, the present invention provides a pharmaceutical composition comprising the above composition and a suitable excipient.
[0068] In some aspects, the invention provides a method of delivery of an mRNA encoding a protein or peptide in vivo, comprising administering to a subject in need thereof an mRNA encoding the protein or peptide and having a 5'-untranslated region (5'-UTR) having a sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 70% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 75% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 80% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 85% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 90% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 95% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) that is at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:2 and is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) set forth in SEQ ID NO:2.
[0069] Other features, objects, and advantages of the present invention will be apparent in the following detailed description, drawings, and claims. It should be understood, however, that the detailed description, drawings, and claims, while indicating embodiments of the present invention, are given by way of illustration only, not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art.
[0070] The drawings are for illustrative purposes only, and not for limitation. [Brief description of the drawings]
[0071] [Figure 1] FIG. 1 is an exemplary schematic diagram of a directed differentiation schedule for airway basal cells to generate pseudostratified epithelium. [Figure 2A] 13 is an exemplary immunofluorescence imaging of differentiated cells of pseudostratified epithelium showing that iso-wt cultures contain ciliated cells (ACT staining). [Figure 2B] FIG. 13. Exemplary immunofluorescence imaging of differentiated cells of pseudostratified epithelium showing that iso-wt cultures contain a distinct goblet cell population and MUC5AC. [Figure 3A] Exemplary imaging of differentiated epithelium in Iso-WT, disease model, and HBEC-ALI model cultures after staining with hematoxylin and eosin (H&E). Both Iso-WT and HBEC cultures contained proper cilia, while the disease model had reduced amounts of cilia and short cilia. [Figure 3B] 1 is an exemplary bar graph showing pili length in ALI cultures of disease strains, iso-wt models, or HBECs. Pili in the disease models are statistically shorter than pili in the iso-wt or HBEC models. [Figure 4A] 1 is an exemplary bar graph showing ciliary beat frequency (CBF) in ALI cultures of untreated diseased strains, treated diseased strains, iso-wt model, or HBEC model. CBF in diseased strains is rescued to normal levels by administration of mRNA of the invention. [Figure 5A]1 shows exemplary graphs and tables showing the amount of transfected mRNA over time and the dose-dependent response. The mRNA was administered by LNPs containing either SY-3-E14-DMAPr or TL1-01D-DMA as the cationic lipid. [Figure 5B] 1 is an exemplary bar graph showing the % of ciliated cells that are DNAI1 positive upon a single administration of DNAI1 mRNA encapsulated in LNPs containing TL1-01D-DMA. [Figure 5C] 1 shows exemplary immunohistochemical (IHC) staining of airway epithelium following administration of DNAI1 mRNA. Arrows indicate exemplary staining sites showing DNAI1 protein expression. [Figure 6A] 1 is an exemplary density plot of TUBA+DNAI1+ lung epithelial cells from Cd-1 mice. Flow cytometry results are from the lungs of mice that were not treated or treated via nebulization with test article MRT-DNAI1-LNP1 for 6 hours (Group 2, N=4). Lungs were harvested 48 hours after exposure, enzymatically digested for single cells, and stained before flow cytometry analysis. The TUBA+ / DNAI1+ gate was based on the untreated sample. Results are representative of group results for 6 hours of nebulization treatment. [Figure 6B] 1 is an exemplary bar graph showing the exposure-expression relationship in multiciliated cells for DNAI1 in CD1 mice with MRT-DNAI1-LNP. Flow cytometry results of DNAI1 positive multiciliated (TUBA+) cells from animals exposed to nebulized test article MRT-DNAI1 / LNP. Lungs were harvested 48 hours after exposure, enzymatically digested for single cells, and stained prior to flow cytometry analysis. TUBA+ / DNAI1+ gate was based on untreated samples. [Figure 6C] 1 is an exemplary bar graph showing exposure-expression relationships assessing mRNA levels immediately after exposure. Right lungs from animals (all groups, N=4 per group) immediately after exposure were analyzed for the presence of mRNA levels by RTqPCR. A standard curve was used to assess mRNA copies per mg of lung tissue. [Figure 7] 1 is a series of exemplary bar graphs showing the duration of expression for DNAI1 after a single 6-hour exposure. Flow cytometry results of DNAI1 positive multiciliated (TUBA+) cells from animals exposed to aerosolized test articles MRT-DNAI1-LNP1 or LNP2. Lungs were harvested 4, 8, and 15 days after exposure, enzymatically digested for single cells, and stained prior to flow cytometry analysis. TUBA+ / DNAI1 gate was based on paired untreated samples. One-way ANOVA *p<0.05, analyzed by Fisher's LSD test compared to untreated. [Figure 8A] 1A-1C are exemplary flow cytometry density plots showing a population of cells that are both fimbriae and DNAI1 positive. The population of cells that are both fimbriae and DNAI1 positive is located in the upper right corner of each panel. Representative flow cytometry density plots are from lungs of CD-1 mice that were untreated or treated with either MRT-DNAI1-LNP1 (n=4 per time point) or MRT-DNAI1-LNP2 (n=4 per time point). Animals evaluated on day 4 had a single exposure. Animals evaluated on day 8 had 5 daily exposures on days 1-5 (groups 2 and 3) and were evaluated 3 days after the last exposure. Animals evaluated on day 12 had 5 daily exposures on days 1-5 (groups 2 and 3) and were evaluated 7 days after the last exposure. [Figure 8B] 1 is an exemplary bar graph showing the % of ciliated cells that are DNAI1 positive with repeated administration of DNAI1 mRNA encapsulated in LNPs containing TL1-01D-DMA or SY-3-E14-DMAPr. Flow cytometry results of multiciliated (TUBA+) cells that were DNAI1 positive from animals exposed to nebulized test article after a single dose (day 4) or five consecutive daily doses (days 8 and 12). Lungs were harvested, enzymatically digested for single cells, and stained prior to flow cytometry analysis. TUBA+ / DNAI1+ gate was based on untreated samples. *p<0.05 compared to untreated, Fisher's LSD test, one-way ANOVA. [Figure 8C]1 is an exemplary histogram representation of the geometric mean fluorescence intensity of DNAI1 expression. Flow cytometry data measuring the geometric mean fluorescence intensity (gMFI) of DNAI1 from TUBA-positive / DNAI1-positive multiciliated epithelial cells. The blue plot represents the gMFI of untreated cells, the red plot represents day 4 (72 hours after a single exposure), the orange plot represents day 8 (3 days after a 5-day exposure), and the green plot represents day 12 (7 days after a 5-day exposure). [Figure 8D] 1 is an exemplary bar graph showing the expression level of DNAI1 from multiciliated airway epithelium after repeated administration of DNAI1 mRNA encapsulated in LNPs containing TL1-01D-DMA or SY-3-E14-DMAPr. In this experiment, mice were nebulized with mRNA-LNPs daily for 5 consecutive days. One-way ANOVA *p<0.05, analyzed by Fisher's LSD test compared to untreated. [Figure 8E] 1 is an exemplary bar graph showing ciliary beat frequency (CBF) in untreated WT, untreated heterozygote, and treated knockout mice, in which CBF was rescued to normal levels by administration of an mRNA of the invention. [Figure 9A] 1 is an exemplary bar graph showing the % of ciliated cells that are DNAI1 positive upon administration of DNAI1 mRNA encapsulated in LNPs containing TL1-01D-DMA or SY-3-E14-DMAPr for 15 days. Protein expression peaks on day 8 and is still present on day 15. The approximate half-life of DNAI1 protein is 15 days. [Figure 9B] 1 is an exemplary graph showing the % of ciliated cells and DNAI1 positive cells over time based on data modeling of weekly dosing assuming a 2 week half-life of DNAI1 protein. Predicted levels of eMax are achieved by at least 40% by week 5, regardless of the cationic lipid used. [Figure 10A]10A-C are exemplary Western blot analysis of DNAI1 protein from lung homogenates after weekly intratracheal instillation of MRT-DNA1-LNP. Western blot results of DNAI1 expression detected in lung homogenates of treated CD-1 mice. Mice were dosed weekly for up to 6 weeks with either saline or MRT-DNAI1-LNP at 15 μg per animal. Cohorts of animals from all groups were scored 7 days after dosing (dosing 1-5) and left lungs were analyzed for expression. Western blot antibodies detected both human DNAI1 (exogenous) and mouse Dnaic1 (endogenous), with human DNAI1 protein migrating slightly higher in SDS-PAGE gels (green band). DNAI1 band intensity is graphed as DNAI1 RFU representing the day mice were scored 7 days after the last dose. Triangles below the x-axis represent the days animals were dosed. (A-C) corresponds to the representative IHC results shown in FIG. 10B. [Figure 10B] A series of representative images of DNAI1 IHC performed on lungs of either saline-treated or MRT-DNAI1-LNP-treated animals via intratracheal instillation. Test article-treated animals were dosed at 15 μg per animal per week (group 2). Animals were scored weekly (n=4 per time point) 7 days after their last dose. The images demonstrate staining of airway pseudostratified columnar epithelial cells on the mucosal surface facing the airway in test article-treated animals. Increasing doses increase signal intensity and cell number. [Figure 11] 1 is an exemplary bar graph showing ciliary beat frequency from mice that were untreated or treated with MRT-DNAI1-LNP. Tracheas from mice were washed in situ to prevent damage from washing in vitro. Tracheas were accessed by making a longitudinal incision, and fimbriae were imaged using a 40x water immersion objective by acquiring a 5-second video at 500 frames per second. Statistical analysis was performed using one-way ANOVA / Tukey's multiple comparison test. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0072] definition In order that the present invention may be more readily understood, certain terms are first defined below. Further definitions of these terms and other terms are set forth throughout the specification. Publications and other reference materials mentioned herein to describe the background of the invention and to provide additional details regarding its practice are hereby incorporated by reference.
[0073] Alkyl: As used herein, "alkyl" refers to a group of linear or branched saturated hydrocarbon groups having 1-15 carbon atoms ("C1-15 alkyl"). In some embodiments, the alkyl group has 1-3 carbon atoms ("C1-3 alkyl"). Examples of C1-3 alkyl groups include methyl (C1), ethyl (C2), n-propyl (C3), and isopropyl (C3). In some embodiments, the alkyl group has 8-12 carbon atoms ("C8-12 alkyl"). Examples of C8-12 alkyl groups include, but are not limited to, n-octyl (C8), n-nonyl (C9), n-decyl (C10), n-undecyl (C11), n-dodecyl (C12), and the like. The prefix "n-" (linear) refers to an unbranched alkyl group. For example, n-C8 alkyl refers to (CH2)7CH3, n-C10 alkyl refers to (CH2)9CH3, and the like.
[0074] Amino acid: As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure H2N-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a d-amino acid; in some embodiments, an amino acid is an l-amino acid. "Standard amino acid" refers to any of the 20 standard l-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than the standard amino acids, whether it is synthetically prepared or obtained from a natural source. As used herein, "synthetic amino acid" encompasses chemically modified amino acids, including, but not limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including carboxy- and / or amino-terminal amino acids in peptides, can be modified by methylation, amidation, acetylation, protecting groups, and / or substitutions with other chemical groups that can alter the circulating half-life of the peptides without adversely affecting their activity. The amino acids may participate in disulfide bonds. The amino acids may include one or post-translational modifications, such as association with one or more chemical entities (e.g., methyl groups, acetate groups, acetyl groups, phosphate groups, formyl moieties, isoprenoid groups, sulfate groups, polyethylene glycol moieties, lipid moieties, carbohydrate moieties, biotin moieties, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and may refer to free amino acids and / or amino acid residues of peptides. Whether the term refers to a free amino acid or a residue of a peptide will be clear from the context in which it is used.
[0075] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.
[0076] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a value that falls within a range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise specified or clear from the context (except where such number exceeds 100% of the possible value). Typically, the term "approximately" or "about" refers to a value that falls within a range of 10%, or more typically within 1%, of the stated reference value.
[0077] Biologically active: As used herein, the phrase "biologically active" refers to a characteristic of any agent that has activity in a biological system, and in particular in an organism. For example, an agent is considered to be biologically active if, when administered to an organism, it has a biological effect on that organism.
[0078] Codon-optimized: As used herein, this term describes a nucleic acid in which one or more of the nucleotides present in a naturally occurring nucleic acid sequence (also referred to as a "wild-type" sequence) are replaced with alternative nucleotides that optimize protein expression without changing the amino acid sequence of the polypeptide encoded by the naturally occurring nucleic acid sequence. For example, the codon AAA can be modified to become AAG without changing the identity of the encoded amino acid (lysine). In some embodiments, the nucleic acids of the present invention are codon-optimized to increase protein expression of the protein encoded by the nucleic acid. For purposes of this application, the nucleobases thymidine (T) and uracil (U) are used interchangeably in describing mRNA sequences.
[0079] Delivery: As used herein, the term "delivery" encompasses both local and systemic delivery. For example, delivery of mRNA encompasses the situation where mRNA is delivered to a target tissue, the encoded protein is expressed, and retained within the target tissue (also referred to as "local distribution" or "local delivery"), and the situation where mRNA is delivered to a target tissue, the encoded protein is expressed, secreted into the patient's circulatory system (e.g., serum), distributed systemically, and absorbed by other tissues (also referred to as "systemic distribution" or "systemic delivery").
[0080] Dosing interval: As used herein, the dosing interval in the context of a method for treating a disease is the frequency with which a therapeutic composition, such as an mRNA composition, is administered in an effective dose of mRNA in a subject (mammal) in need thereof, so that one or more symptoms associated with the disease are reduced; or one or more biomarkers associated with the disease are decreased, at least during the duration of the dosing interval. Dosing frequency and dosing interval may be used interchangeably in this disclosure.
[0081] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or fully assembled protein (e.g., an enzyme). As used herein, the terms "expression" and "production," and grammatical equivalents, are used interchangeably.
[0082] Effective dose: As used herein, an effective dose is a dose of mRNA in a pharmaceutical composition that, when administered to a subject in need thereof, herein a mammalian subject, according to the methods of the present invention, is effective to bring about an expected result in the subject, e.g., effective to reduce symptoms associated with a disease.
[0083] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity by which it is characterized.
[0084] Half-life: As used herein, the term "half-life" is the time required for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of its value measured at the beginning of a period of time.
[0085] Improve, increase, or reduce: As used herein, the terms "improve," "increase" or "reduce," or grammatical equivalents, refer to a relative value relative to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject who is about the same age as the subject being treated and who is afflicted with the same form of the disease as the subject being treated.
[0086] In vitro: As used herein, the term "in vitro" refers to events that take place not inside a multicellular organism, but in an artificial environment, such as in a test tube or reaction vessel, in cell culture, etc.
[0087] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as humans and non-human animals. In the context of cell-based systems, the term can be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).
[0088] Isolated: As used herein, the term "isolated" refers to substances and / or entities that (1) have been separated from at least some of the components with which they are associated when originally produced (whether in nature and / or in an experimental setting) and / or (2) have been produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% of the other components with which they are originally associated. In some embodiments, an isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of the percent purity of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).
[0089] Local distribution or delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires a protein (e.g., an enzyme) that is encoded by an mRNA that is translated and expressed intracellularly or that has limited secretion that avoids entry into the circulatory system of a patient.
[0090] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polyribonucleotide that codes for at least one polypeptide. An mRNA may contain one or more coding and non-coding regions. An mRNA may be purified from a natural source, produced using a recombinant expression system, optionally purified, transcribed in vitro, or chemically synthesized. An mRNA sequence is presented in a 5' to 3' direction unless otherwise indicated. Typically, the mRNA of the present invention is synthesized from adenosine, guanosine, cytidine, and uridine nucleotides that do not have modifications. Such an mRNA is referred to herein as an mRNA with unmodified nucleotides or, for short, "unmodified mRNA." Typically, this means that the mRNA of the invention does not contain any of the following nucleotide analogues: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine. mRNAs suitable for practicing the claimed invention generally do not contain nucleosides that contain chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).
[0091] N / P ratio: as used herein, the term "N / P ratio" refers to the molar ratio of the positively charged molecular units in the cationic lipid in lipid nanoparticles to the negatively charged molecular units in the mRNA encapsulated in lipid nanoparticles.Therefore, N / P ratio is usually calculated as the molar ratio of the amine groups in the cationic lipid in lipid nanoparticles to the molar ratio of the phosphate groups in the mRNA encapsulated in lipid nanoparticles.
[0092] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain that comprises individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA as well as single-stranded and / or double-stranded DNA and / or cDNA.
[0093] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Exemplary patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Human includes pre- and post-natal forms.
[0094] Pharmaceutically acceptable: The term "pharmacologically acceptable," as used herein, refers to a material that is suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable risk / benefit ratio.
[0095] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in J.Pharmaceutical Sciences (1977) 66:1-19. The pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are the salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N+(C1-4 alkyl) salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.Further pharma- ceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations, where appropriate, formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates, etc. Further pharma-ceutically acceptable salts include salts formed from the quaternization of amines using appropriate electrophiles, e.g., alkyl halides, to form quaternized alkylated amino salts.
[0096] Systemic distribution or delivery: As used herein, the term "systemic distribution," "systemic delivery," or grammatical equivalents, refers to a mechanism or method of delivery or distribution that affects the entire body or organ. Typically, systemic distribution or delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery."
[0097] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. A subject may be a patient, which refers to a human presenting to a health care provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be afflicted with or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.
[0098] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the entire or nearly full extent or degree of a characteristic or property of interest. Those skilled in the art of biology will understand that biological and chemical events rarely, if ever, proceed to completion and / or perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical events.
[0099] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by a disease to be treated. In some embodiments, a target tissue includes a tissue that exhibits a pathology, symptom, or characteristic associated with a disease.
[0100] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent symptoms, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. It will be understood by those skilled in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.
[0101] Treat: As used herein, the terms "treat", "treatment", or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not show signs of the disease and / or who show only early signs of the disease in order to reduce the risk of developing pathologies associated with the disease.
[0102] Various aspects of the invention are detailed in the following clauses. The use of clauses is not intended to limit the invention. Each clause may apply to any aspect of the invention. In this specification, the use of "or" means "and / or" unless otherwise stated.
[0103] Detailed Description Primary ciliary dyskinesia (PCD) Primary ciliary dysfunction (PCD) is an autosomal recessive disorder characterized by abnormal cilia and flagella found in the lining of the airways, reproductive system, and other organs and tissues. The primary ciliary defect found in PCD is the absence of dynein arms, affecting nearly all cilia. Ciliary dysfunction prevents the clearance of mucus from the lungs, sinuses, and middle ear. Bacteria and other irritants in the mucous membranes cause frequent respiratory infections.
[0104] Dyneins consist of a large family of proteins involved in many types of microtubule-dependent cell motility in both lower and higher eukaryotes. Two major classes of dyneins have been described: cytoplasmic dyneins and axonemal dyneins. Cytoplasmic dyneins are involved in a wide range of cytoplasmic functions, including chromosome movement on the mitotic spindle and transport of membranous organelles towards the minus ends of microtubules. Axonemal dyneins are found in the axonemes of fimbriae and flagella. Two dynein arms, outer and inner, are attached to each peripheral microtubule doublet; these dynein arms, which are essential for fimbria and flagellar motility, are generated through an ATP-dependent cycle of attachment / detachment to adjacent microtubule doublets.
[0105] Among the few genes identified to be directly involved in PCD pathogenesis, strikingly frequent mutations have been found in two genes: DNAI1 and DNAH5, which code for the intermediate and heavy chains of axonemal dynein, respectively. Mutations in other genes encoding proteins involved in axonemal ultrastructure (DNAH11, DNAI2, TXNDC3, RSPH9, RSPH4A) or axonemal assembly (KTU, CRRC50), as well as mutations in the RPGR gene in some cases of PCD, have also been reported. Mutations in DNAI1 and DNAH5, both of which are associated with a pilus outer dynein arm (ODA)-deficient phenotype, are estimated to together account for nearly 40% of PCD cases.
[0106] Mutations in the DNAI1 gene result in a lack of or abnormal dynein axonemal intermediate chain 1, which is required for cilia to function properly. If DNAI1 is not of the normal type, the defective cilia cannot generate the force and movement needed to clear fluids, bacteria, and particles from the lungs, establish the left-right axis during embryonic development, and propel sperm cells. PCD can cause chronic airway infections, bronchiectasis, year-round nasal congestion, abnormally placed organs in their chest and abdomen, and infertility.
[0107] The polyribonucleotides of the present disclosure may be used, for example, to treat subjects who have or are at risk of having primary cilium dyskinesia or have any other condition associated with a deficiency or dysfunction of a gene whose function is linked to cilium maintenance and function. Non-limiting examples of genes associated with primary ciliary dysfunction include armadillo repeat containing 4 (ARMC4), chromosome 21 open reading frame 59 (C21orf59), coiled-coil domain containing 103 (CCDC103), coiled-coil domain containing 114 (CCDC114), coiled-coil domain containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40), coiled-coil domain containing 65 (CCDC65), cyclin O (CCNO), dynein assembly factor 1 (DNAAF1), dynein assembly factor 2 (DNAAF2), dynein assembly factor 3 (DNAAF3), dynein assembly factor 5 (DNAAF5), dynein axonemal heavy chain 11 (DNAHl), and dynein axonemal assembly factor 2 (DNAAF3). l), dynein axonemal heavy chain 5 (DNAH5), dynein axonemal heavy chain 6 (DNAH6), dynein axonemal heavy chain 8 (DNAH8), dynein axonemal intermediate chain 1 (DNAI1), dynein axonemal intermediate chain 2 (DNAI2), dynein axonemal light chain 1 (DNALl), dynein regulatory complex subunit 1 (DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), growth arrest specific 8 (GAS8), axonemal central paired apparatus protein (HYDIN), leucine-rich repeat containing 6 (LRRC6), ME / M23 family member These include NME8, orofacial-digital syndrome 1 (OFD1), retinitis pigmentosa GTPase regulator (RPGR), radial spokehead 1 homolog (Chlamydomonas) (RSPH1), radial spokehead 4 homolog A (Chlamydomonas) (RSPH4A), radial spokehead 9 homolog (Chlamydomonas) (RSPH9), sperm-associated antigen l (SPAGl), and zinc finger MY D-type containing 10 (ZMYND10).
[0108] Treatment of PCD According to the present invention, DNAI1 mRNA is delivered to a PCD patient in need of treatment at a therapeutically effective dose and administration interval for a treatment period sufficient to improve, stabilize or reduce one or more symptoms of PCD relative to a control. The term "treat" or "treatment", as used in the context of PCD herein, refers to the amelioration of one or more symptoms associated with PCD, the prevention or delay of the onset of one or more symptoms of PCD, and / or the reduction of the severity or frequency of one or more symptoms of PCD. In particular, administration of the composition of the present invention by repeated administration to a PCD patient results in an improvement of ciliary function as measured by ciliary beating frequency (CBF). Furthermore, the method of the present invention resulted in expression of DNAI1 protein in airway epithelium at a level of at least 10% of wild-type level, an increase in ciliary beating frequency (CBF), and more than 5% DNAI1 positive transfection in ciliated cells.
[0109] In some embodiments, the suitable administration interval of the treatment is daily, twice a week, weekly, once every two weeks, once every three weeks, once every four weeks, monthly, once every two months, once every three months, once every six months, annually, once every two years, or once every five years. Typically, daily or weekly administration of a therapeutically effective dose of DNAI1 mRNA according to the present invention is sufficient to effectively reduce the severity of one or more symptoms in a PCD patient. For example, a nominal dose of 1-36 mg of DNAI1 mRNA (e.g., a nominal dose of 6-30 mg, e.g., 8 mg, 16 mg, 20 mg, or 24 mg) administered daily or weekly by nebulization is effective to provide a subject with at least 3% DNAI1 positive transfection efficiency in ciliated cells, expression of DNAI1 protein in airway epithelium at a level of at least 10% of wild-type level, or an increase in CBF from control or baseline CBF.
[0110] In some embodiments, the duration of nebulization is at least 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, at least 65 minutes, at least 70 minutes, at least 75 minutes, at least 80 minutes, at least 85 minutes, at least 90 minutes, at least 95 minutes, at least 100 minutes, at least 105 minutes, at least 110 minutes, at least 115 minutes, or at least 120 minutes. For example, the duration of nebulization can be between 45 and 135 minutes, between 65 and 115 minutes, or between 70 and 90 minutes.
[0111] In some embodiments, the present invention provides a method of treating primary ciliary dyskinesia (PCD), comprising administering to a subject in need of treatment mRNA encoding dynein axonemal intermediate chain 1 (DNAI1) protein, wherein the mRNA is administered at a dose ranging from 1 mg to 36 mg for 5 consecutive days. In some embodiments, the mRNA is administered weekly. In a preferred composition, the DNAI1 mRNA is encapsulated in a liposome.
[0112] In some embodiments, the treatment period or the length of time that a patient is administered a therapeutically effective dose of DNAI1 mRNA is for the patient's lifetime. In some embodiments, a suitable treatment period is at least 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 20 years, 30 years, or 50 years.
[0113] Typically, the therapeutic effect of administration of DNAI1 mRNA to a PCD patient is measured relative to a control. In some embodiments, the control is the severity of one or more symptoms in the same patient prior to treatment. In some embodiments, the control represents a baseline level of the background of one or more symptoms in a PCD patient. In some embodiments, the control represents the ability to respond to one or more symptoms, physical condition, or normal levels of biomarkers being measured. In some embodiments, the control is ciliary beat frequency (CBF). In some embodiments, the control is transfection efficiency of cells that are both ciliated and DNAI1 positive.
[0114] In some embodiments, the therapeutic effect of administering to a subject by nebulization an effective dose of a composition comprising the mRNA encoding DNAI1 protein is measured by the increase in CBF.Therefore, the suitable dose for use in the method of the present invention is selected based on that it causes an increase in CBF of at least 3% from baseline CBF on the second day after administration to a human subject.In some embodiments, the dose is selected to cause an increase in CBF of at least 10% from baseline CBF on the second day after administration to a human subject.
[0115] An additional or alternative consideration in selecting a dose for use in the methods of the invention is whether it results in an increase in CBF from baseline CBF at 1 week after administration. In some embodiments, a dose is selected to result in at least a 2% increase in CBF from baseline CBF at 1 week after administration to a human subject. For example, a dose may be selected to result in at least a 7% increase in CBF from baseline CBF by 1 week after administration to a human subject. In some embodiments, a dose is selected to result in at least an 8% increase in CBF from baseline CBF by 1 week after administration to a human subject. In certain embodiments, a dose is selected to result in at least a 12% increase in CBF from baseline CBF by 1 week after administration to a human subject.
[0116] In some embodiments, the mRNA is administered at a dose ranging from 0.01 mg to 100 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.1 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 100 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.05 mg to 0.1 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.5 mg to 1 mg. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 10 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.05 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.5 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 0.01 mg to 50 mg. In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg. In some embodiments, the mRNA is administered in a dose ranging from 1.5 mg to 40 mg. In some embodiments, the mRNA is administered in a dose ranging from 2 mg to 36 mg. In some embodiments, the mRNA is administered in a dose ranging from 5 mg to 30 mg. In some embodiments, the mRNA is administered in a dose ranging from 10 mg to 20 mg. In some embodiments, the mRNA is administered in a dose ranging from 6 mg to 24 mg. In some embodiments, the mRNA is administered in a dose ranging from 8 mg to 16 mg. In some embodiments, the mRNA is administered in a dose of 0.5 mg. In some embodiments, the mRNA is administered in a dose of 0.01 mg. In some embodiments, the mRNA is administered in a dose of 1 mg. In some embodiments, the mRNA is administered in a dose of 0.1 mg. In some embodiments, the mRNA is administered in a dose of 0.5 mg. In some embodiments, the mRNA is administered in a dose of 1 mg. In some embodiments, the mRNA is administered in a dose of 0.05 mg. In some embodiments, the mRNA is administered in a dose of 1 mg. In some embodiments, the mRNA is administered in a dose of 1.5 mg.In some embodiments, the mRNA is administered in a dose of 2 mg. In some embodiments, the mRNA is administered in a dose of 2.5 mg. In some embodiments, the mRNA is administered in a dose of 3 mg. In some embodiments, the mRNA is administered in a dose of 4 mg. In some embodiments, the mRNA is administered in a dose of 5 mg. In some embodiments, the mRNA is administered in a dose of 6 mg. In some embodiments, the mRNA is administered in a dose of 7 mg. In some embodiments, the mRNA is administered in a dose of 8 mg. In some embodiments, the mRNA is administered in a dose of 9 mg. In some embodiments, the mRNA is administered in a dose of 10 mg. In some embodiments, the mRNA is administered in a dose of 11 mg. In some embodiments, the mRNA is administered in a dose of 12 mg. In some embodiments, the mRNA is administered in a dose of 13 mg. In some embodiments, the mRNA is administered in a dose of 14 mg. In some embodiments, the mRNA is administered in a dose of 15 mg. In some embodiments, the mRNA is administered in a dose of 16 mg. In some embodiments, the mRNA is administered in a dose of 17 mg. In some embodiments, the mRNA is administered in a dose of 18 mg. In some embodiments, the mRNA is administered in a dose of 20 mg. In some embodiments, the mRNA is administered in a dose of 21 mg. In some embodiments, the mRNA is administered in a dose of 22 mg. In some embodiments, the mRNA is administered in a dose of 23 mg. In some embodiments, the mRNA is administered in a dose of 24 mg. In some embodiments, the mRNA is administered in a dose of 25 mg. In some embodiments, the mRNA is administered in a dose of 26 mg. In some embodiments, the mRNA is administered in a dose of 27 mg. In some embodiments, the mRNA is administered in a dose of 28 mg. In some embodiments, the mRNA is administered in a dose of 29 mg. In some embodiments, the mRNA is administered in a dose of 30 mg. In some embodiments, the mRNA is administered in a dose of 31 mg. In some embodiments, the mRNA is administered in a dose of 32 mg.In some embodiments, the mRNA is administered in a dose of 33 mg. In some embodiments, the mRNA is administered in a dose of 34 mg. In some embodiments, the mRNA is administered in a dose of 35 mg. In some embodiments, the mRNA is administered in a dose of 36 mg. In some embodiments, the mRNA is administered in a dose of 37 mg. In some embodiments, the mRNA is administered in a dose of 38 mg. In some embodiments, the mRNA is administered in a dose of 39 mg. In some embodiments, the mRNA is administered in a dose of 40 mg.
[0117] In some embodiments, the mRNA is administered for 1 day. In some embodiments, the mRNA is administered for 2 days. In some embodiments, the mRNA is administered for 3 days. In some embodiments, the mRNA is administered for 4 days. In some embodiments, the mRNA is administered for more than 1 day. In some embodiments, the mRNA is administered for more than 2 days. In some embodiments, the mRNA is administered for more than 3 days. In some embodiments, the mRNA is administered for more than 4 days. In some embodiments, the 5 consecutive days of administration is at least 5 consecutive days. In some embodiments, the mRNA is administered for 5 days. In some embodiments, the mRNA is administered for 6 days. In some embodiments, the mRNA is administered for 7 days. In some embodiments, the mRNA is administered for 8 days. In some embodiments, the mRNA is administered for 9 days. In some embodiments, the mRNA is administered for 10 days. In some embodiments, the mRNA is administered for 12 days. In some embodiments, the mRNA is administered for 14 days. In some embodiments, the mRNA is administered for 15 days. In some embodiments, the mRNA is administered for 16 days. In some embodiments, the mRNA is administered for 17 days. In some embodiments, the mRNA is administered for 18 days. In some embodiments, the mRNA is administered for 20 days. In some embodiments, the mRNA is administered for 1 week. In some embodiments, the mRNA is administered for 2 weeks. In some embodiments, the mRNA is administered for 3 weeks. In some embodiments, the mRNA is administered for 4 weeks. In some embodiments, the mRNA is administered for 5 weeks. In some embodiments, the mRNA is administered for 6 weeks. In some embodiments, the mRNA is administered for 7 weeks. In some embodiments, the mRNA is administered for 8 weeks. In some embodiments, the mRNA is administered for 10 weeks. In some embodiments, the mRNA is administered for 1 month. In some embodiments, the mRNA is administered for 2 months. In some embodiments, the mRNA is administered for 3 months. In some embodiments, the mRNA is administered for 4 months.In some embodiments, the mRNA is administered for 5 months. In some embodiments, the mRNA is administered for 6 months. In some embodiments, the mRNA is administered for 7 months. In some embodiments, the mRNA is administered for 8 months. In some embodiments, the mRNA is administered for 9 months. In some embodiments, the mRNA is administered for 10 months. In some embodiments, the mRNA is administered for 11 months. In some embodiments, the mRNA is administered for 12 months. In some embodiments, the mRNA is administered for 1 year.
[0118] In some embodiments, the mRNA is administered for 1 day. In some embodiments, the mRNA is administered for 2 days. In some embodiments, the mRNA is administered for 3 days. In some embodiments, the mRNA is administered for 4 days. In some embodiments, the mRNA is administered for more than 1 day. In some embodiments, the mRNA is administered for more than 2 days. In some embodiments, the mRNA is administered for more than 3 days. In some embodiments, the mRNA is administered for more than 4 days. In some embodiments, the 5 consecutive days of administration is at least 5 consecutive days. In some embodiments, the mRNA is administered for 5 days. In some embodiments, the mRNA is administered for 6 days. In some embodiments, the mRNA is administered for 7 days. In some embodiments, the mRNA is administered for 8 days. In some embodiments, the mRNA is administered for 9 days. In some embodiments, the mRNA is administered for 10 days. In some embodiments, the mRNA is administered for 12 days. In some embodiments, the mRNA is administered for 14 days. In some embodiments, the mRNA is administered for 15 days. In some embodiments, the mRNA is administered for 16 days. In some embodiments, the mRNA is administered for 17 days. In some embodiments, the mRNA is administered for 18 days. In some embodiments, the mRNA is administered for 20 days. In some embodiments, the mRNA is administered for 1 week. In some embodiments, the mRNA is administered for 2 weeks. In some embodiments, the mRNA is administered for 3 weeks. In some embodiments, the mRNA is administered for 4 weeks. In some embodiments, the mRNA is administered for 5 weeks. In some embodiments, the mRNA is administered for 6 weeks. In some embodiments, the mRNA is administered for 7 weeks. In some embodiments, the mRNA is administered for 8 weeks. In some embodiments, the mRNA is administered for 10 weeks. In some embodiments, the mRNA is administered for 1 month. In some embodiments, the mRNA is administered for 2 months. In some embodiments, the mRNA is administered for 3 months. In some embodiments, the mRNA is administered for 4 months.In some embodiments, the mRNA is administered for 5 months. In some embodiments, the mRNA is administered for 6 months. In some embodiments, the mRNA is administered for 7 months. In some embodiments, the mRNA is administered for 8 months. In some embodiments, the mRNA is administered for 9 months. In some embodiments, the mRNA is administered for 10 months. In some embodiments, the mRNA is administered for 11 months. In some embodiments, the mRNA is administered for 12 months. In some embodiments, the mRNA is administered for one year or more.
[0119] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least two days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least two days.
[0120] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least three days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least three days.
[0121] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least 4 days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least 4 days.
[0122] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least 5 days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least 5 days.
[0123] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least 7 days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least 7 days.
[0124] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least 10 days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least 10 days.
[0125] In some embodiments, the mRNA is administered at a dose ranging from 1 mg to 50 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 1.5 mg to 40 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 2 mg to 36 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 5 mg to 30 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 10 mg to 20 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 6 mg to 24 mg for at least 14 days. In some embodiments, the mRNA is administered at a dose ranging from 8 mg to 16 mg for at least 14 days.
[0126] Dynein axonemal intermediate chain 1(DNAI1) gene and protein sequence. In some embodiments, the present invention provides methods and compositions for delivering mRNA encoding to a subject for the treatment of PCD. Suitable DNAI1 mRNA encodes either full length, fragments or portions of DNAI1 protein that can replace naturally occurring DNAI1 mRNA protein activity and / or reduce the intensity, severity and / or frequency of one or more symptoms associated with PCD.
[0127] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding the human DNAI1 protein. The naturally occurring human DNAI1 mRNA coding sequence and the corresponding amino acid sequence are shown in Table 1.
[0128] [Table 1]
[0129] Various mRNA sequences used in the Examples section or useful in the present invention are shown in Table 2.
[0130] [Table 2]
[0131] [Table 3]
[0132] [Table 4]
[0133] [Table 5]
[0134] [Table 6]
[0135] [Table 7]
[0136] [Table 8]
[0137] In some embodiments, a suitable mRNA is the sequence of wild-type human DNAI1 mRNA. In some embodiments, a suitable therapeutic candidate mRNA is the DNAI1 amino acid sequence shown in Table 1 as SEQ ID NO: 1 or a codon-optimized DNAI1 sequence that can encode an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In some embodiments, an mRNA according to the invention encodes a DNAI1 protein having an amino acid sequence identical to SEQ ID NO: 1.
[0138] Codon optimization According to a growing body of research, mRNA contains multiple layers of information that overlap with the amino acid code. Traditionally, codon optimization has been used to remove rare codons that were thought to be rate-limiting for protein expression. Both fast-growing bacteria and yeasts show strong codon bias in highly expressed genes, but higher eukaryotes have much less codon bias, making it more difficult to identify potentially rate-limiting codons. In addition, it has been found that codon bias itself does not necessarily result in high expression, but requires other features.
[0139] For example, rare codons have been implicated in slowing translation and forming stop sites, which may be required for correct protein folding. Thus, variation in codon usage may provide a mechanism for fine-tuning the temporal pattern of elongation, thus increasing the time available for a protein to adopt its correct structure. Codon optimization disrupts this mechanism of fine-tuning, resulting in less efficient protein translation or an increased amount of incorrectly folded protein. Similarly, codon optimization may disrupt the normal pattern of cognate and wobble tRNA usage, thereby affecting protein structure and function, as the slowing of wobble-dependent elongation may have been selected as a mechanism for achieving correct protein folding as well.
[0140] Various methods of performing codon optimization are known in the art, but each has significant drawbacks and limitations from a computational and / or therapeutic standpoint. In particular, known methods of codon optimization often involve, for each amino acid, replacing all codons with the codon that has the highest usage for that amino acid, such that the "optimized" sequence contains only one codon that codes for each amino acid (and thus may be referred to as a one-to-one sequence).
[0141] Despite these obstacles, the inventors arrived at a codon-optimized hDNAI1 sequence that improves the expression of the DNAI1 protein by at least three-fold over the coding sequence of the wild-type gene. The increase in expression was not limited to cell cultures of mammalian cells, but was also observed in vivo in a mouse model. The observed improved expression of the codon-optimized DNAI1 coding sequence is expected to lead to improved and more cost-effective mRNA replacement therapy for patients suffering from PCD, since it eliminates the need to use modified nucleotides in the preparation of mRNA, allowing treatment with reduced doses and / or extended administration intervals.
[0142] In some embodiments, the codon-optimized mRNA sequences according to the present invention are further codon-optimized by a novel process: this process first generates a list of codon-optimized sequences, and then passes this list through three filters. Specifically, it passes through a motif selection filter, a guanine-cytosine (GC) content analysis filter, and a codon adaptation index (CAI) analysis filter, resulting in an update of the list of optimized nucleotide sequences. The updated list no longer includes nucleotide sequences containing features that are expected to interfere with efficient transcription and / or translation of the encoded protein antigen.
[0143] Exemplary codon-optimized DNAI1 mRNA sequences The sequences listed below are a selection of exemplary codon-optimized DNAI1 mRNA sequences.
[0144] In some embodiments, a suitable mRNA may be a codon-optimized sequence as set forth in SEQ ID NOs:6-10.
[0145] In some embodiments, a suitable mRNA sequence may be an mRNA sequence that is a homolog or analog of human DNAI1 protein. For example, a homolog or analog of human DNAI1 protein may be a modified human DNAI1 protein that contains one or more amino acid substitutions, deletions, and / or insertions compared to wild-type or naturally occurring human DNAI1 protein, but retains substantial DNAI1 protein activity. In some embodiments, a suitable mRNA for the present invention encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 1. In some embodiments, a suitable mRNA for the present invention encodes a protein that is substantially identical to human DNAI1 protein. In some embodiments, an mRNA suitable for the present invention encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1. Typically, an mRNA according to the present invention encodes a DNAI1 protein having an amino acid sequence identical to SEQ ID NO: 1.
[0146] In some embodiments, the mRNA suitable for the present invention encodes a fragment or a portion of the human DNAI1 protein. In some embodiments, the mRNA suitable for the present invention encodes a fragment or a portion of the human DNAI1 protein, and the fragment or portion of the protein still maintains a DNAI1 activity similar to that of the wild-type protein.
[0147] In some embodiments, a suitable mRNA encodes a fusion protein comprising a full-length, fragment or portion of the DNAI1 protein fused to another protein (e.g., N- or C-terminal fusion). In some embodiments, the protein fused to the mRNA encoding the full-length, fragment or portion of the DNAI1 protein encodes a signal sequence or a cell targeting sequence.
[0148] In some embodiments, an mRNA suitable for the invention comprises a nucleotide sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO:6. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 99% identical to SEQ ID NO:6. For example, an mRNA according to the invention comprises the nucleotide sequence of SEQ ID NO:6. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO:7. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 99% identical to SEQ ID NO:7. For example, an mRNA according to the invention comprises the nucleotide sequence of SEQ ID NO:7. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO:8. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 99% identical to SEQ ID NO:8. For example, an mRNA according to the invention comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO: 9. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 99% identical to SEQ ID NO: 9. For example, an mRNA according to the invention comprises the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO: 10. In some embodiments, an mRNA according to the invention comprises a nucleotide sequence that is at least 99% identical to SEQ ID NO: 10. For example, an mRNA according to the invention comprises the nucleotide sequence of SEQ ID NO: 10. Exemplary codon-optimized DNAI1 mRNA sequences are shown in Table 3.
[0149] [Table 9]
[0150] [Table 10]
[0151] [Table 11]
[0152] [Table 12]
[0153] [Table 13]
[0154] [Table 14]
[0155] mRNA synthesis The mRNA according to the present invention can be synthesized according to any of a variety of known methods. A variety of methods are described in published US Patent Application Publication No. 2018 / 0258423, all of which are incorporated herein by reference, and can be used to practice the present invention. For example, the mRNA according to the present disclosure can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary according to the specific application.
[0156] 5' and 3' untranslated regions In some embodiments, the mRNA comprises a 5' untranslated region (UTR). In some embodiments, the mRNA comprises a 3' untranslated region. In some embodiments, the mRNA comprises both a 5' untranslated region and a 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, e.g., an iron-responsive element. In some embodiments, the 5' untranslated region can be between about 50 and 500 nucleotides in length.
[0157] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the mRNA in the cell, or one or more binding sites for an miRNA, hi some embodiments, the 3' untranslated region can be between 50 and 500 nucleotides in length or more.
[0158] Exemplary 3' and 5' untranslated region sequences may be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5'UTR sequence may include a subsequence of the CMV immediate early 1 (IE1) gene, or a fragment thereof, to improve nuclease resistance and / or improve the half-life of the polynucleotide. Inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof, in the 3' end or untranslated region of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide is also contemplated. In general, these modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, e.g., to improve the resistance of such polynucleotides to nuclease digestion in vivo.
[0159] In certain embodiments, the codon-optimized DNAI1 mRNA comprises a coding region having a codon-optimized coding region flanked by 5' and 3' untranslated regions, as represented as X and Y, respectively (see below), X-Code-Region-Y the coding region sequence is SEQ ID NO:6, or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:6; SEQ ID NO:7; SEQ ID NO:8; SEQ ID NO:9; or SEQ ID NO:10, or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:10; and X (5'UTR sequence) is [ka] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:2; or [ka] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:3; and Y (the 3'UTR sequence) is CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 4) or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 4, or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO:5) or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:5.
[0160] The present invention can be used to deliver mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb or more in length. In some embodiments, the present invention may be used to deliver in vitro synthesized mRNA ranging in length from about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-50 kb.
[0161] In some embodiments, for the preparation of mRNA according to the invention, a DNA template is transcribed in vitro. A suitable DNA template will usually have a promoter for in vitro transcription, such as a T3, T7 or SP6 promoter, followed by the desired nucleotide sequence for the desired mRNA and a termination signal.
[0162] nucleotide A variety of naturally occurring or modified nucleotides may be used to generate the mRNA according to the present invention. In some embodiments, the mRNA may be modified with any of the following nucleotides: naturally occurring nucleosides (or unmodified nucleotides; e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deoxyuridine, C5-methyl ... The base may be or contain zaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).
[0163] In some embodiments, suitable mRNAs may contain backbone, sugar and / or base modifications, such as modified nucleotides, such as modified purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, N6-isopenten ... l-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethionine These may include, but are not limited to, N-uracil-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, beta-D-mannosyl-queosine, wybutoxocine, as well as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine and inosine.The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642, the disclosures of which are incorporated by reference in their entirety.
[0164] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. The non-standard nucleotide residues may include, for example, 5-methyl-cytidine ("5mC"), pseudouridine ("ψU"), and / or 2-thio-uridine ("2sU"). For example, see U.S. Pat. No. 8,278,036 or WO 2011 / 012316 for a discussion of such residues and their incorporation into mRNA. The mRNA may be RNA, defined as RNA in which 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings for the use of RNA are disclosed in U.S. Pat. Appl. Pub. No. 2012 / 0195936 and WO 2011 / 012316, both of which are incorporated herein by reference in their entirety. The presence of non-standard nucleotide residues may render the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, the mRNA may contain one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine and 2-chloro-6-aminopurine cytosine, and combinations of these and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of 2'-O-alkyl modifications, locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications can include, but are not limited to, a 2'-deoxy-2'-fluoro modification, a 2'-O-methyl modification, a 2'-O-methoxyethyl modification, and a 2'-deoxy modification.In some embodiments, any of these modifications may be present in 0-100% of the nucleotides, for example, individually or in combination, greater than 0%, greater than 1%, greater than 10%, greater than 25%, greater than 50%, greater than 75%, greater than 85%, greater than 90%, greater than 95%, or greater than 100% of the component nucleotides.
[0165] In some embodiments, mRNA may contain RNA backbone modification.Backbone modification is generally a modification that chemically modifies the backbone phosphate of nucleotide contained in RNA.Exemplary backbone modifications generally include, but are not limited to, modifications from the group consisting of methylphosphonate, methylphosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means that phosphodiester bond is replaced by other anionic group, cationic group or neutral group.
[0166] In some embodiments, the mRNA may contain sugar modifications. Exemplary sugar modifications are chemical modifications of the sugar of the nucleotide, such as 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C 2'-C-alkyl oligoribonucleotides and their isomers (2'-aracytidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azido triphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).
[0167] Post-synthesis processing Usually, a 5' cap and / or a 3' tail can be added post-synthetically. The presence of a cap is important to provide resistance to nucleases found in most eukaryotic cells. The presence of a "tail" helps protect the mRNA from exonuclease degradation.
[0168] A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate by a guanylyltransferase, generating a 5'5'5 triphosphate linkage; and then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5'(A,G(5')ppp(5')A and G(5')ppp(5')G. Additional cap structures are described in published U.S. Patent Application Publication Nos. 2016 / 0032356 and 2018 / 0125989, which are incorporated herein by reference.
[0169] Typically, the tail structure comprises a poly(A) and / or poly(C) tail. A poly-A or poly-C tail on the 3' end of an mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 1000 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 1000 adenosine or cytosine nucleotides, at least 1000 adenos at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides.In some embodiments, the polyA or polyC tail comprises between about 10 and 800 adenosine or cytosine nucleotides, respectively (e.g., between about 10 and 200 adenosine or cytosine nucleotides, between about 10 and 300 adenosine or cytosine nucleotides, between about 10 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 20 and 300 adenosine or cytosine nucleotides, between about 20 and 300 adenosine or cytosine nucleotides, between about 30 and 4 ... The tail structure may be about 0-600 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides). In some embodiments, the tail structure comprises a combination of poly(A) and poly(C) tails of various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides, in some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.
[0170] As described herein, the addition of a 5' cap and / or 3' tail facilitates the detection of aborted transcripts generated during in vitro synthesis, since in the absence of capping and / or tailing, the size of these aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, a 5' cap and / or 3' tail is added to an mRNA synthesized before the mRNA is tested for purity (e.g., the level of aborted transcript present in the mRNA). In some embodiments, a 5' cap and / or 3' tail is added to an mRNA synthesized before the mRNA is purified as described herein. In other embodiments, a 5' cap and / or 3' tail is added to an mRNA synthesized after the mRNA is purified as described herein.
[0171] The mRNA synthesized according to the present invention may be used without further purification. In particular, the mRNA synthesized according to the present invention may be used without a step of removing shortmers. In some embodiments, the mRNA synthesized according to the present invention may be further purified. Various methods may be used to purify the mRNA synthesized according to the present invention. For example, purification of the mRNA may be performed using centrifugation, filtration and / or chromatography methods. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted in a standard phenol:chloroform:isoamyl alcohol solution well known to those skilled in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include those described in U.S. Patent Application Publication No. 2016 / 0040154, U.S. Patent Application Publication No. 2015 / 0376220, U.S. Patent Application Publication No. 2018 / 0251755, U.S. Patent Application Publication No. 2018 / 0251754, U.S. Provisional Patent Application No. 62 / 757,612, filed November 8, 2018, and U.S. Provisional Patent Application No. 62 / 891,781, filed August 26, 2019, all of which are incorporated herein by reference and may be used to practice the present invention.
[0172] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing.
[0173] In some embodiments, the mRNA is purified by centrifugation either before, after, or both before and after capping and tailing.
[0174] In some embodiments, the mRNA is purified by filtration either before, after, or both before and after capping and tailing.
[0175] In some embodiments, the mRNA is purified by tangential flow filtration (TFF) either before, after, or both before and after capping and tailing.
[0176] In some embodiments, the mRNA is purified by chromatography either before, after, or both before and after capping and tailing.
[0177] Characterization of purified mRNA The mRNA compositions described herein are substantially free of contaminants, including short interrupted RNA species, long interrupted RNA species, double-stranded RNA (dsRNA), residual plasmid DNA, residual in vitro transcriptase enzymes, residual solvents and / or residual salts.
[0178] The mRNA compositions described herein have a purity between about 60% and about 100%. Thus, in some embodiments, the purified mRNA has a purity of about 60%. In some embodiments, the purified mRNA has a purity of about 65%. In some embodiments, the purified mRNA has a purity of about 70%. In some embodiments, the purified mRNA has a purity of about 75%. In some embodiments, the purified mRNA has a purity of about 80%. In some embodiments, the purified mRNA has a purity of about 85%. In some embodiments, the purified mRNA has a purity of about 90%. In some embodiments, the purified mRNA has a purity of about 91%. In some embodiments, the purified mRNA has a purity of about 92%. In some embodiments, the purified mRNA has a purity of about 93%. In some embodiments, the purified mRNA has a purity of about 94%. In some embodiments, the purified mRNA has a purity of about 95%. In some embodiments, the purified mRNA has a purity of about 96%. In some embodiments, the purified mRNA has a purity of about 97%. In some embodiments, the purified mRNA has a purity of about 98%. In some embodiments, the purified mRNA has a purity of about 99%. In some embodiments, the purified mRNA has a purity of about 100%.
[0179] In some embodiments, the mRNA compositions described herein have less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, and / or less than 0.1% impurities other than full-length mRNA. Impurities include IVT contaminants such as proteins, enzymes, DNA templates, free nucleotides, residual solvents, residual salts, double-stranded RNA (dsRNA), interrupted RNA sequences ("shortmers" or "short interrupted RNA species"), and / or long interrupted RNA species. In some embodiments, the purified mRNA is substantially free of processing enzymes.
[0180] In some embodiments, the residual plasmid DNA in the purified mRNA of the present invention is less than about 1 pg / mg, less than about 2 pg / mg, less than about 3 pg / mg, less than about 4 pg / mg, less than about 5 pg / mg, less than about 6 pg / mg, less than about 7 pg / mg, less than about 8 pg / mg, less than about 9 pg / mg, less than about 10 pg / mg, less than about 11 pg / mg, or less than about 12 pg / mg. Thus, the residual plasmid DNA in the purified mRNA is less than about 1 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 2 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 3 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 4 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 5 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 6 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 7 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 8 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 9 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 10 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 11 pg / mg. In some embodiments, the residual plasmid DNA in the purified mRNA is less than about 12 pg / mg.
[0181] In some embodiments, the methods according to the invention remove more than about 90%, more than about 95%, more than about 96%, more than about 97%, more than about 98%, more than about 99%, or substantially all of the interrupted RNA sequences (also known as "shortmers"). In some embodiments, the mRNA composition is substantially free of interrupted RNA sequences. In some embodiments, the mRNA composition contains less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, or less than about 1%) of the interrupted RNA sequences. In some embodiments, the mRNA composition contains less than about 1% (e.g., less than about 0.9%, less than about 0.8%, less than about 0.7%, less than about 0.6%, less than about 0.5%, less than about 0.4%, less than about 0.3%, less than about 0.2%, or less than about 0.1%) of the interrupted RNA sequences. In some embodiments, the mRNA composition contains undetectable interrupted RNA sequences as determined, for example, by high performance liquid chromatography (HPLC) (e.g., shoulder peaks or discrete peaks), ethidium bromide, Coomassie staining, capillary electrophoresis, or glyoxal gel electrophoresis (e.g., presence of a separate lower band). As used herein, the term "shortmer", "short interrupted RNA species", "interrupted RNA sequence" or "long interrupted RNA species" refers to any transcript that is less than full length. In some embodiments, the "shortmer", "short interrupted RNA species", or "interrupted RNA sequence" is less than 100 nucleotides, less than 90 nucleotides, less than 80 nucleotides, less than 70 nucleotides, less than 60 nucleotides, less than 50 nucleotides, less than 40 nucleotides, less than 30 nucleotides, less than 20 nucleotides, or less than 10 nucleotides in length. In some embodiments, the shortmers are detected or quantified after adding a 5'-cap and / or a 3'-polyA tail. In some embodiments, the interrupted RNA transcript comprises fewer than 15 bases (e.g., fewer than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 bases). In some embodiments, the interrupted RNA transcript contains about 8-15, 8-14, 8-13, 8-12, 8-11, or 8-10 bases.
[0182] In some embodiments, the purified mRNA of the present invention is substantially free of enzyme reagents used in in vitro synthesis, including but not limited to T7 RNA polymerase, DNAse I, pyrophosphatase, and / or RNAse inhibitors. In some embodiments, the purified mRNA according to the present invention contains less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, or less than about 1%) of the enzyme reagents used in in vitro synthesis. In some embodiments, the purified mRNA contains less than about 1% (e.g., less than about 0.9%, less than about 0.8%, less than about 0.7%, less than about 0.6%, less than about 0.5%, less than about 0.4%, less than about 0.3%, less than about 0.2%, or less than about 0.1%) of the enzyme reagents used in in vitro synthesis. In some embodiments, the purified mRNA contains undetectable enzyme reagents used in in vitro synthesis, including as determined by, for example, silver staining, gel electrophoresis, high performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC), and / or capillary electrophoresis, ethidium bromide and / or Coomassie staining.
[0183] In various embodiments, the purified mRNA of the present invention maintains a high degree of integrity. As used herein, the term "mRNA integrity" generally refers to the quality of the mRNA after purification. The integrity of the mRNA can be determined using methods well known in the art, for example, by RNA agarose gel electrophoresis. In some embodiments, the integrity of the mRNA can be determined by the banding pattern of RNA agarose gel electrophoresis. In some embodiments, the purified mRNA of the present invention shows little or no banding compared to the reference band of RNA agarose gel electrophoresis. In some embodiments, the purified mRNA of the present invention has an integrity of more than about 95% (e.g., more than about 96%, more than about 97%, more than about 98%, more than about 99% or more). In some embodiments, the purified mRNA of the present invention has an integrity of more than 98%. In some embodiments, the purified mRNA of the present invention has an integrity of more than 99%. In some embodiments, the purified mRNA of the present invention has an integrity of approximately 100%.
[0184] In some embodiments, the purified mRNA is evaluated for one or more of the following characteristics: appearance, identity, quantity, concentration, presence of impurities, microbiological evaluation, pH level, and activity. In some embodiments, acceptable appearance includes a clear, colorless solution essentially free of visible particulates. In some embodiments, the identity of the mRNA is evaluated by sequencing. In some embodiments, the concentration is evaluated by a suitable method, such as UV spectrophotometry. In some embodiments, a suitable concentration is nominally between about 90% and 110% (0.9-1.1 mg / mL).
[0185] In some embodiments, assessing mRNA purity includes assessing mRNA integrity, residual plasmid DNA, and residual solvent. In some embodiments, an acceptable level of mRNA integrity is assessed by agarose gel electrophoresis. The gel is analyzed to determine whether the banding pattern and apparent nucleotide length match analytical standards. Additional methods for assessing RNA integrity include, for example, evaluating purified mRNA using capillary gel electrophoresis (CGE). In some embodiments, an acceptable purity of purified mRNA as determined by CGE is that the purified mRNA composition has interrupted / degraded species of about 55% or less in length. In some embodiments, residual plasmid DNA is assessed by methods in the art, for example, by using qPCR. In some embodiments, less than 10 pg / mg (e.g., less than 10 pg / mg, less than 9 pg / mg, less than 8 pg / mg, less than 7 pg / mg, less than 6 pg / mg, less than 5 pg / mg, less than 4 pg / mg, less than 3 pg / mg, less than 2 pg / mg, or less than 1 pg / mg) is an acceptable level of residual plasmid DNA. In some embodiments, acceptable residual solvent levels are 10,000 ppm or less, 9,000 ppm or less, 8,000 ppm or less, 7,000 ppm or less, 6,000 ppm or less, 5,000 ppm or less, 4,000 ppm or less, 3,000 ppm or less, 2,000 ppm or less, 1,000 ppm or less. Thus, in some embodiments, acceptable residual solvent levels are 10,000 ppm or less. In some embodiments, acceptable residual solvent levels are 9,000 ppm or less. In some embodiments, the acceptable residual solvent level is 8,000 ppm or less. In some embodiments, the acceptable residual solvent level is 7,000 ppm or less. In some embodiments, the acceptable residual solvent level is 6,000 ppm or less. In some embodiments, the acceptable residual solvent level is 5,000 ppm or less.In some embodiments, the acceptable residual solvent level is 4,000 ppm or less. In some embodiments, the acceptable residual solvent level is 3,000 ppm or less. In some embodiments, the acceptable residual solvent level is 2,000 ppm or less. In some embodiments, the acceptable residual solvent level is 1,000 ppm or less.
[0186] In some embodiments, microbiological testing is performed on the purified mRNA, including, for example, evaluation of endotoxins. In some embodiments, the endotoxins are <0.5EU / mL, <0.4EU / mL, <0.3EU / mL, <0.2EU / mL, or <0.1EU / mL. Thus, in some embodiments, the endotoxins in the purified mRNA are <0.5EU / mL. In some embodiments, the endotoxins in the purified mRNA are <0.4EU / mL. In some embodiments, the endotoxins in the purified mRNA are <0.3EU / mL. In some embodiments, the endotoxins in the purified mRNA are <0.2EU / mL. In some embodiments, the endotoxins in the purified mRNA are <0.2EU / mL. In some embodiments, the endotoxins in the purified mRNA are <0.1EU / mL. In some embodiments, the purified mRNA has 1 CFU / 10 mL or less, 1 CFU / 25 mL or less, 1 CFU / 50 mL or less, 1 CFU / 75 mL or less, or 1 CFU / 100 mL or less. Thus, in some embodiments, the purified mRNA has 1 CFU / 10 mL or less. In some embodiments, the purified mRNA has 1 CFU / 25 mL or less. In some embodiments, the purified mRNA has 1 CFU / 50 mL or less. In some embodiments, the purified mRNA has 1 CFU / 75 mL or less. In some embodiments, the purified mRNA has 1 CFU / 100 mL or less.
[0187] In some embodiments, the pH of the purified mRNA is evaluated. In some embodiments, an acceptable pH for the purified mRNA is between 5 and 8. Thus, in some embodiments, the purified mRNA has a pH of about 5. In some embodiments, the purified mRNA has a pH of about 6. In some embodiments, the purified mRNA has a pH of about 7. In some embodiments, the purified mRNA has a pH of about 7. In some embodiments, the purified mRNA has a pH of about 8.
[0188] In some embodiments, the translation fidelity of the purified mRNA is assessed. Translation fidelity can be assessed by a variety of methods, including, for example, transfection and Western blot analysis. Acceptable characteristics of purified mRNA include a banding pattern on a Western blot that migrates at a similar molecular weight as a standard.
[0189] In some embodiments, the purified mRNA is assessed for permeability. In some embodiments, acceptable characteristics of the purified mRNA include a permeability of between about 50% and 150% of the standard.
[0190] The purified mRNA is also assessed for cap percentage and polyA tail length. In some embodiments, acceptable cap percentages include Cap1, % Area:NLT90. In some embodiments, acceptable polyA tail lengths are between about 100 and 1500 nucleotides (e.g., 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, and 1000, 1100, 1200, 1300, 1400, or 1500 nucleotides).
[0191] In some embodiments, the purified mRNA is also assessed for any remaining PEG. In some embodiments, the purified mRNA is between 10 ng PEG / mg of purified mRNA and 1000 ng PEG / mg of mRNA. Thus, in some embodiments, the purified mRNA has less than about 10 ng PEG / mg of purified mRNA. In some embodiments, the purified mRNA has less than about 100 ng PEG / mg of purified mRNA. In some embodiments, the purified mRNA has less than about 250 ng PEG / mg of purified mRNA. In some embodiments, the purified mRNA has less than about 500 ng PEG / mg of purified mRNA. In some embodiments, the purified mRNA has less than about 750 ng PEG / mg of purified mRNA. In some embodiments, the purified mRNA has less than about 1000 ng PEG / mg of purified mRNA.
[0192] Various methods of detecting and quantifying mRNA purity are known in the art. For example, such methods include blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV), or UPLC, or a combination thereof. In some embodiments, the mRNA is first denatured with glyoxal dye before gel electrophoresis ("glyoxal gel electrophoresis"). In some embodiments, the synthesized mRNA is characterized before capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.
[0193] delivery vehicle According to the present invention, mRNA or MCNA encoding a protein or peptide (e.g., full length, fragment, or portion of a protein or peptide) as described herein can be delivered as naked RNA (unencapsulated) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "transport vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.
[0194] The delivery vehicle may be formulated in a pharmacological composition in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizing reagents, or in which it is mixed with a suitable excipient. Techniques for drug formulation and administration may be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa. A particular delivery vehicle is selected based on its ability to facilitate transfection of the nucleic acid into the target cell.
[0195] In some embodiments, the mRNA or MCNA encoding at least one protein or peptide can be delivered via a single delivery vehicle. In some embodiments, the mRNA or MCNA encoding at least one protein or peptide can be delivered via one or more delivery vehicles, each of which has a different composition. In some embodiments, one or more mRNAs and / or MCNAs are encapsulated in the same lipid nanoparticle. In some embodiments, one or more mRNAs are encapsulated in separate lipid nanoparticles.
[0196] According to various embodiments, suitable delivery vehicles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural, synthetic and semi-synthetic lamellar bodies, nanoparticles, calcium phosphosilicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides and other vector tags. The use of bio-nanocapsules and other viral capsid protein assemblies as suitable transport vehicles is also contemplated. (Hum. Gene Ther. 2008 September; 19(9): 887-95).
[0197] Liposomal Delivery Vehicles In some embodiments, the suitable delivery vehicle is a liposomal delivery vehicle, e.g., lipid nanoparticles. As used herein, liposomal delivery vehicles, e.g., lipid nanoparticles, are generally characterized as microscopic vesicles with an internal aqueous space separated from an external medium by one or more bilayer membranes. The bilayer membrane of a liposome is generally formed by amphiphilic molecules, such as lipids of synthetic or natural origin, which contain hydrophilic and hydrophobic domains spaced apart (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome may also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, liposomal delivery vehicles are generally useful for transporting desired nucleic acids (e.g., mRNA or MCNA) to target cells or tissues. In some embodiments, the nanoparticle delivery vehicle is a liposome. In some embodiments, the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids. In some embodiments, the liposome comprises three or fewer distinct lipid components, hi some embodiments, one distinct lipid component is a sterol-based cationic lipid.
[0198] Cationic lipids As used herein, the phrase "cationic lipid" refers to any of several lipid species that carry a net positive charge at a selected pH, such as physiological pH.
[0199] Suitable cationic lipids for use in the compositions and methods of the invention include those as described in WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise: [ka] The cationic lipid having the compound structure: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, and pharma- ceutically acceptable salts thereof.
[0200] Other suitable cationic lipids for use in the compositions and methods of the invention include ionizable cationic lipids as described in WO 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the following formula: [ka] or a pharma- ceutically acceptable salt thereof, wherein R1 and R2 are each independently hydrogen, an optionally substituted, undefined saturated or unsaturated C1-C 20 Alkyl and optionally substituted, unspecified, saturated or unsaturated C6-C 20 acyl; L1 and L2 are each independently selected from the group consisting of hydrogen, optionally substituted C1-C 30 Alkyl, optionally substituted, unsaturated C1-C 30 Alkenyl, and optionally substituted C1-C 30 alkynyl; m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3); and n is 0 or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid comprising one of: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid having a compound structure of: (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), and pharmaceutically acceptable salts thereof. [ka] A cationic lipid having the compound structure: (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001"); and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002"), and pharma- ceutically acceptable salts thereof.
[0201] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids described as amino alcohol lipidoids in WO 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0202] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2016 / 118725, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0203] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0204] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharma- ceutically acceptable salts thereof.
[0205] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2013 / 063468 and WO 2016 / 205691, each of which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the following formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof (wherein, R L Each example of is independently an optionally substituted C-C 40 In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0206] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the following formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; A are independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl, or halogen; and each R Bare independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl, or halogen. In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid having the compound structure, "Target 23" and pharma- ceutically acceptable salts thereof.
[0207] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise: [ka] A cationic lipid having the compound structure or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise: [ka] A cationic lipid having the compound structure or a pharma- ceutically acceptable salt thereof.
[0208] Other suitable cationic lipids for use in the compositions and methods of the invention include cationic lipids as described in U.S. Provisional Patent Application No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the following formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof (wherein each R 1 and R 2 is independently H or a C1-C6 aliphatic; each m is independently an integer having a value of 1 to 4; each A is independently a covalent bond or arylene; each L 1 is independently an ester, a thioester, a disulfide, or an anhydride group; 2 are independent, C2~C 10 is aliphatic; each X 1 is independently H or OH; and each R 3 are independent, C6~C 20 In some embodiments, the compositions and methods of the present invention include a cyclic alkyl group having the following formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a compound of the formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a compound of the formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof.
[0209] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in J. McClellan, MCKing, Cell 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277, which are incorporated herein by reference. In certain embodiments, the cationic lipids of the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure and pharma-ceutically acceptable salts thereof.
[0210] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the compound structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof.
[0211] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the compound structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof.
[0212] Other suitable cationic lipids for use in the compositions and methods of the invention include cationic lipids as described in WO 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the following formula: [ka] Cationic lipids or a pharma- ceutically acceptable salt thereof (wherein, L 1 Or L 2 One of the following is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O-; and L 1 Or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O- or a direct bond; G 1 and G 2 are each independently unsubstituted C1 to C 12 Alkylene or C1-C 12 Alkenylene; G 3 is C1~C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 R is alkyl; 1 and R 2are each independently C6 to C 24 Alkyl or C6-C 24 alkenyl; R 3 H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 ;R 4 is C1~C 12 R is alkyl; 5 is H or C1-C6 alkyl; and x is 0, 1, or 2.
[0213] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid having the compound structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a compound having the structure: [ka] A cationic lipid having and pharma- ceutically acceptable salts thereof.
[0214] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipids of the compositions and methods of the invention include those having the following formula: [ka] One of the compounds and pharma- ceutically acceptable salts thereof. For any one of these four formulas, R4 is independently -(CH2) n Q and -(CH2) n CHQR; Q is selected from -OR, -OH, -O(CH2) n and n is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle; and n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention further comprise: [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0215] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids as described in WO 2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include: [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] A cationic lipid having the compound structure and pharma- ceutically acceptable salts thereof.
[0216] Other suitable cationic lipids for use in the compositions and methods of the invention include cleavable cationic lipids as described in WO 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cleavable cationic lipid having the following formula: [ka] Cationic lipids wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; R2 is selected from the group consisting of the following two formulae: [ka] is selected from the group consisting of one of and R and R are each independently an optionally substituted saturated or unsaturated C-C 20 Alkyl and optionally substituted, unspecified, saturated or unsaturated C6-C 20 acyl; and n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid "HGT4001" with the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid "HGT4002" (also referred to herein as "Guan-SS-Chol") having the compound structure: and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid "HGT4003" with the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid "HGT4004" with the compound structure and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include [ka] Cationic lipid "HGT4005" with the compound structure and pharma- ceutically acceptable salts thereof.
[0217] Other suitable cationic lipids for use in the compositions and methods of the invention include cleavable cationic lipids as described in International Application Publication No. PCT / US2019 / 032522, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having any of the general formulas or structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in International Application Publication No. PCT / US2019 / 032522. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having the formula (I') [ka] (In the formula, R X are independently -H, -L 1 -R 1 , or -L 5A -L 5B -B'; L 1 , L 2 , and L 3each is independently a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NR L - and; Each L 4A and L 5A are independently -C(O)-, -C(O)O-, or -C(O)NR L - and; Each L 4B and L 5B are independent, C1~C 20 Alkylene; C2~C 20 Alkenylene; or C2-C 20 alkynylene; Each B and B' is NR 4 R 5 or a 5-10 membered nitrogen-containing heteroaryl; Each R 1 , R 2 , and R 3 are independent, C6~C 30 Alkyl, C6-C 30 Alkenyl, or C6-C 30 is alkynyl; Each R 4 and R 5 are independently hydrogen, C1 to C 10 Alkyl; C2-C 10 Alkenyl; or C2-C 10 alkynyl; and Each R L are independently hydrogen, C1 to C 20 Alkyl, C2-C 20 Alkenyl, or C2-C 20 The cationic lipids include those having a structure according to the invention, where R is an aryl group and R is an alkynyl group.
[0218] In certain embodiments, the compositions and methods of the present invention comprise: [ka] The cationic lipid is compound (139) of International Application No. PCT / US2019 / 032522, which has the compound structure:
[0219] In some embodiments, the compositions and methods of the present invention include: [ka] The compound includes a cationic lipid, TL1-04D-DMA, having the compound structure:
[0220] In some embodiments, the compositions and methods of the present invention include: [ka] The cationic lipid is GL-TES-SA-DME-E18-2 having the compound structure:
[0221] In some embodiments, the compositions and methods of the present invention include: [ka] The cationic lipid is Guan-SS-Chol having the compound structure:
[0222] In some embodiments, the compositions and methods of the present invention include: [ka] The compound includes a cationic lipid, SY-3-E14-DMAPr, having the compound structure:
[0223] In some embodiments, the compositions and methods of the present invention include: [ka] The compound includes a cationic lipid, which is RL3-07D-DMA, having the compound structure:
[0224] In some embodiments, the compositions and methods of the present invention include: [ka] The compound includes a cationic lipid, TL1-01D-DMA, having the compound structure:
[0225] In some embodiments, the compositions and methods of the present invention comprise the cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride ("DOTMA"). (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355), which are incorporated herein by reference. Other cationic lipids suitable for the compositions and methods of the invention include, for example, 5-carboxyspermylglycine dioctadecylamide ("DOGS"); 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium ("DOSPA") (Behr et al. Proc. Nat. 'l Acad. Sci. 86, 6982 (1989); U.S. Pat. No. 5,171,678; U.S. Pat. No. 5,334,761); 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"); 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").
[0226] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"); N-dioleyl-N,N-dimethylammonium chloride ("N-DMCA"); n-(1,2-dimyristyloxyprop-3-yl)-n-dimethyl-n-hydroxyethylammonium bromide ("DMRIE"); 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutane-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane ("CLinDMA"); 2-[5'-(cholest-5-en-3-beta-o N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); l,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); l,2-Dilinoleoylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA");(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,fsl-dimethylh3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1 -amine ("Octyl-CLinDMA(2S)"); 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("DLin-K-XTC2-DMA"); and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (see WO 2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010), which are incorporated herein by reference). (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole, dialkylamino, or guanidinium moiety;
[0227] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").
[0228] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is TL1-04D-DMA having the compound structure:
[0229] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of the cationic lipid is GL-TES-SA-DME-E18-2 having the compound structure:
[0230] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is SY-3-E14-DMAPr having the compound structure:
[0231] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is TL1-01D-DMA having the compound structure:
[0232] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is TL1-10D-DMA having the compound structure:
[0233] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of the cationic lipid is GL-TES-SA-DMP-E18-2 having the compound structure:
[0234] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is HEP-E4-E10 having the compound structure:
[0235] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include: [ka] An example of a cationic lipid is HEP-E3-E10 having the compound structure:
[0236] In some embodiments, the compositions of the present invention comprise one or more cationic lipids that account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by mol% of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that comprise about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35%-40%) of the total lipid content in the composition, e.g., measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that comprise about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35%-40%) of the total lipid content in the composition, e.g., measured as mol% of the lipid nanoparticles.
[0237] Non-cationic / helper lipids In some embodiments, the liposome contains one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of several lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimide ... The lipids include, but are not limited to, 16-O-monomethyl-2-oleoyl-phosphatidylethanolamine (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof.
[0238] In some embodiments, the non-cationic lipids are neutral lipids, ie, lipids that have no net charge in the conditions in which the composition is formulated and / or administered.
[0239] In some embodiments, such cationic lipids can be used alone, but are preferably used in combination with other lipids, e.g., cationic lipids.
[0240] In some embodiments, the non-cationic lipids may be present in a molar ratio (mol%) of about 5% to about 90%, about 5% to about 70%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 10% to about 70%, about 10% to about 50%, or about 10% to about 40% of the total lipids present in the composition. In some embodiments, the total non-cationic lipids may be present in a molar ratio (mol%) of about 5% to about 90%, about 5% to about 70%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 10% to about 70%, about 10% to about 50%, or about 10% to about 40% of the total lipids present in the composition. In some embodiments, the percentage of non-cationic lipids in the liposomes can be greater than about 5 mol%, greater than about 10 mol%, greater than about 20 mol%, greater than about 30 mol%, or greater than about 40 mol%. In some embodiments, the percentage of total non-cationic lipids in the liposomes can be greater than about 5 mol%, greater than about 10 mol%, greater than about 20 mol%, greater than about 30 mol%, or greater than about 40 mol%. In some embodiments, the percentage of total non-cationic lipids in the liposomes can be less than about 5 mol%, less than about 10 mol%, less than about 20 mol%, less than about 30 mol%, or less than about 40 mol%. In some embodiments, the percentage of total non-cationic lipids in the liposomes can be less than about 5 mol%, less than about 10 mol%, less than about 20 mol%, less than about 30 mol%, or less than about 40 mol%.
[0241] In some embodiments, the non-cationic lipids may be present in a weight ratio (wt%) of about 5% to about 90%, about 5% to about 70%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 10% to about 70%, about 10% to about 50%, or about 10% to about 40% of the total lipids present in the composition. In some embodiments, the total non-cationic lipids may be present in a weight ratio (wt%) of about 5% to about 90%, about 5% to about 70%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 10% to about 70%, about 10% to about 50%, or about 10% to about 40% of the total lipids present in the composition. In some embodiments, the percentage of non-cationic lipids in the liposomes may be greater than about 5 wt%, greater than about 10 wt%, greater than about 20 wt%, greater than about 30 wt%, or greater than about 40 wt%. In some embodiments, the percentage of total non-cationic lipids in the liposomes may be greater than about 5 wt%, greater than about 10 wt%, greater than about 20 wt%, greater than about 30 wt%, or greater than about 40 wt%. In some embodiments, the percentage of total non-cationic lipids in the liposomes may be less than about 5 wt%, less than about 10 wt%, less than about 20 wt%, less than about 30 wt%, or less than about 40 wt%. In some embodiments, the percentage of total non-cationic lipids in the liposomes may be less than about 5 wt%, less than about 10 wt%, less than about 20 wt%, less than about 30 wt%, or less than about 40 wt%.
[0242] Cholesterol-based lipids In some embodiments, the liposome comprises one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Pat. No. 5,744,335), or the following structure: [ka] Examples of imidazole cholesterol esters include imidazole cholesterol esters (ICEs) having the formula:
[0243] In an embodiment, the cholesterol-based lipid is cholesterol.
[0244] In some embodiments, the cholesterol-based lipid may comprise a molar ratio (mol%) of about 1% to about 30%, or about 5% to about 20% of the total lipid present in the liposome. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than about 5 mol%, greater than about 10 mol%, greater than about 20 mol%, greater than about 30 mol%, or greater than about 40 mol%. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be about 5 mol% or less, about 10 mol% or less, about 20 mol% or less, about 30 mol% or less, or about 40 mol% or less.
[0245] In some embodiments, the cholesterol-based lipid may be present in a weight ratio (wt%) of about 1% to about 30%, or about 5% to about 20% of the total lipid present in the liposome. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than about 5 wt%, greater than about 10 wt%, greater than about 20 wt%, greater than about 30 wt%, or greater than about 40 wt%. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be about 5 wt% or less, about 10 wt% or less, about 20 wt% or less, about 30 wt% or less, or about 40 wt% or less.
[0246] PEG modified lipid In some embodiments, the liposomes comprise one or more PEGylated lipids.
[0247] Also contemplated by the present invention is the use of derivatized lipids, such as polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides, including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide) (PEG-CER), either alone or preferably in combination with other lipid formulations, including delivery vehicles (e.g., lipid nanoparticles).
[0248] Contemplated PEG-modified lipids include C6-C 20 Examples of exchangeable lipids include, but are not limited to, polyethylene glycol chains of up to 5 kDa length covalently attached to lipids with alkyl chains of up to 5 kDa length. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. The addition of such components may prevent complex aggregation and may also provide a means to increase circulation lifetime and increase delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or they may be selected to be rapidly exchanged from the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids have shorter acyl chains (e.g., C 14 Or C 18 ) is a PEG-ceramide.
[0249] The PEG-modified phospholipids and derivatized lipids of the present invention may comprise a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome transfer vehicle. In some embodiments, the one or more PEG-modified lipids comprise about 4% of the total lipids by molar ratio. In some embodiments, the one or more PEG-modified lipids comprise about 5% of the total lipids by molar ratio. In some embodiments, the one or more PEG-modified lipids comprise about 6% of the total lipids by molar ratio.
[0250] Amphiphilic Block Copolymers In some embodiments, a suitable delivery vehicle contains an amphiphilic block copolymer (eg, a poloxamer).
[0251] A variety of amphiphilic block copolymers can be used to practice the present invention. In some embodiments, the amphiphilic block copolymers are also referred to as surfactants or non-ionic surfactants.
[0252] In some embodiments, amphiphilic polymers suitable for the present invention are selected from poloxamers (Pluronic®), poloxamines (Tetronic®), polyoxyethylene glycol sorbitan alkyl esters (polysorbates), and polyvinylpyrrolidone (PVP).
[0253] Poloxamer In some embodiments, a suitable amphiphilic polymer is a poloxamer. For example, a suitable poloxamer is of the following structure: [ka] (wherein a is an integer between 10 and 150 and b is an integer between 20 and 60). For example, a is about 12 and b is about 20, or a is about 80 and b is about 27, or a is about 64 and b is about 37, or a is about 141 and b is about 44, or a is about 101 and b is about 56.
[0254] In some embodiments, poloxamers suitable for the present invention have from about 10 to about 150 ethylene oxide units. In some embodiments, poloxamers have from about 10 to about 100 ethylene oxide units.
[0255] In some embodiments, a suitable poloxamer is poloxamer 84. In some embodiments, a suitable poloxamer is poloxamer 101. In some embodiments, a suitable poloxamer is poloxamer 105. In some embodiments, a suitable poloxamer is poloxamer 108. In some embodiments, a suitable poloxamer is poloxamer 122. In some embodiments, a suitable poloxamer is poloxamer 123. In some embodiments, a suitable poloxamer is poloxamer 124. In some embodiments, a suitable poloxamer is poloxamer 181. In some embodiments, a suitable poloxamer is poloxamer 182. In some embodiments, a suitable poloxamer is poloxamer 183. In some embodiments, a suitable poloxamer is poloxamer 184. In some embodiments, a suitable poloxamer is poloxamer 185. In some embodiments, a suitable poloxamer is poloxamer 188. In some embodiments, a suitable poloxamer is poloxamer 212. In some embodiments, a suitable poloxamer is poloxamer 215. In some embodiments, a suitable poloxamer is poloxamer 217. In some embodiments, a suitable poloxamer is poloxamer 231. In some embodiments, a suitable poloxamer is poloxamer 234. In some embodiments, a suitable poloxamer is poloxamer 235. In some embodiments, a suitable poloxamer is poloxamer 237. In some embodiments, a suitable poloxamer is poloxamer 238. In some embodiments, a suitable poloxamer is poloxamer 282. In some embodiments, a suitable poloxamer is poloxamer 284. In some embodiments, a suitable poloxamer is poloxamer 288. In some embodiments, a suitable poloxamer is poloxamer 304. In some embodiments, a suitable poloxamer is poloxamer 331. In some embodiments, a suitable poloxamer is poloxamer 333.In some embodiments, a suitable poloxamer is Poloxamer 334. In some embodiments, a suitable poloxamer is Poloxamer 335. In some embodiments, a suitable poloxamer is Poloxamer 338. In some embodiments, a suitable poloxamer is Poloxamer 401. In some embodiments, a suitable poloxamer is Poloxamer 402. In some embodiments, a suitable poloxamer is Poloxamer 403. In some embodiments, a suitable poloxamer is Poloxamer 407. In some embodiments, a suitable poloxamer is a combination thereof.
[0256] In some embodiments, suitable poloxamers have an average molecular weight of about 4,000 g / mol to about 20,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 1,000 g / mol to about 50,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 1,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 2,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 3,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 4,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 5,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 6,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 7,000 g / mol. In some embodiments, suitable poloxamers have an average molecular weight of about 8,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 9,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 10,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 20,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 25,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 30,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 40,000 g / mol. In some embodiments, a suitable poloxamer has an average molecular weight of about 50,000 g / mol.
[0257] Other amphiphilic polymers In some embodiments, the amphiphilic polymer is a poloxamine, such as tetronic 304 or tetronic 904.
[0258] In some embodiments, the amphiphilic polymer is polyvinylpyrrolidone (PVP), such as PVP having a molecular weight of 3 kDa, 10 kDa, or 29 kDa.
[0259] In some embodiments, the amphiphilic polymer is a polyethylene glycol ether (Brij), polysorbate, sorbitan, and derivatives thereof. In some embodiments, the amphiphilic polymer is a polysorbate, such as PS 20.
[0260] In some embodiments, the amphiphilic polymer is a polyethylene glycol ether (Brij), a poloxamer, a polysorbate, a sorbitan, or a derivative thereof.
[0261] In some embodiments, the amphiphilic polymer is a polyethylene glycol ether. In some embodiments, a suitable polyethylene glycol ether is a compound of formula (S-1): [ka] or its salts or isomers (In the formula, t is an integer between 1 and 100; R 1BRIJ is independently 10~40 Alkyl, C 10~40 Alkenyl, or C 10~40 alkynyl; and optionally, R 5PEG One or more methylene groups are independently selected from the group consisting of C 3~10 Carbocyclylene, 4-10 membered heterocyclylene, C 6~10 Arylene, 4-10 membered heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NRC(O)N(R)-, -C(O)O- -OC(O)-, -OC(O)O- - OC(O)N(R N )-, -NR N C(O)O- -C(O)S- -SC(O)-, -C(=NR N)-, -C(=NR)N(R)-, -NRNC(=NR N )- -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NR N C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O- -OS(O)O- -OS(O)2- -S(O)2O- -OS(O)2O- -N(R N )S(O)-, -S(O)N(R N )- -N(R N )S(O)N(R N )- -OS(O)N(R N )- -N(R N )S(O)0- -S(O)2- -N(R N )S(O)2- -S(O)2N(R N )-, -N(R N )S(O)2N(R N )- -OS(O)2N(R N )-or-N(R N )S(O)2O-; and R N Each instance of is independently hydrogen, C 1~6 alkyl, or nitrogen protecting group).
[0262] In some embodiments, R 1BRIJ is C, which is alkyl. For example, a polyethylene glycol ether can be prepared by the compound of formula (S-la): [ka] or a salt or isomer thereof, wherein s is an integer between 1 and 100.
[0263] In some embodiments, R 1BRIJ is C which is alkenyl. For example, a suitable polyethylene glycol ether is a compound of formula (S-lb): [ka] or a salt or isomer thereof, wherein s is an integer between 1 and 100.
[0264] Typically, the amphiphilic polymer (e.g., poloxamer) is present in the formulation in an amount less than its critical micelle concentration (CMC). In some embodiments, the amphiphilic polymer (e.g., poloxamer) is present in the mixture in an amount less than about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% below its CMC. In some embodiments, the amphiphilic polymer (e.g., poloxamer) is present in the mixture in an amount less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% below its CMC. In some embodiments, the amphiphilic polymer (e.g., poloxamer) is present in the mixture in an amount that is about 55%, 60%, 65%, 70%, 75%, 80%, 90%, or 95% less than its CMC.
[0265] In some embodiments, less than about 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the original amount of amphiphilic polymer (e.g., poloxamer) present in the formulation remains upon removal. In some embodiments, the remaining amount of amphiphilic polymer (e.g., poloxamer) remains in the formulation upon removal. As used herein, the remaining amount refers to the amount remaining after substantially all of the material in the composition (the amphiphilic polymer described herein, such as poloxamer) has been removed. The remaining amount may be qualitatively or quantitatively detectable using known techniques. The remaining amount may not be detectable using known techniques.
[0266] In some embodiments, a suitable delivery vehicle comprises less than 5% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 3% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 2.5% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 2% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 1.5% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 1% amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 0.5% (e.g., less than 0.4%, 0.3%, 0.2%, 0.1%) amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of an amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle comprises less than 0.01% of an amphiphilic block copolymer (e.g., poloxamer). In some embodiments, a suitable delivery vehicle contains a residual amount of an amphiphilic polymer (e.g., poloxamer). As used herein, a residual amount refers to the amount remaining after substantially all of the material in the composition (the amphiphilic polymer described herein, such as poloxamer) has been removed. The residual amount may be qualitatively or quantitatively detectable using known techniques. The residual amount may not be detectable using known techniques.
[0267] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, alone or in combination with other carriers, including various lipids, as described herein. Thus, in some embodiments, liposome delivery vehicles, as used herein, also encompass nanoparticles containing polymers. Suitable polymers can include, for example, polyacrylates, polyalkoxyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginates, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it can be a branched PEI with a molecular weight in the range of 10-40 kDa, for example, 25 kDa branched PEI (Sigma #408727).
[0268] According to various embodiments, the selection of cationic lipid, non-cationic lipid, PEG-modified lipid, cholesterol-based lipid, and / or amphiphilic block copolymer including lipid nanoparticles and the relative molar ratio of such components (lipids) to each other are based on the characteristics of the selected lipid, the nature of the intended target cell, and the characteristics of the nucleic acid to be delivered. Additional considerations include, for example, the saturation of alkyl chain, and the size, charge, pH, pKa, membrane fusogenicity and toxicity of the selected lipid. Thus, the molar ratio can be adjusted accordingly.
[0269] Liposomes Suitable for Use with the Present Invention Suitable liposomes for the present invention may comprise any one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEG-modified lipids, amphiphilic block copolymers and / or polymers described herein in various ratios. In some embodiments, the lipid nanoparticles comprise no more than five distinct nanoparticle components. In some embodiments, the lipid nanoparticles comprise no more than four distinct nanoparticle components. In some embodiments, the lipid nanoparticles comprise no more than three distinct nanoparticle components. As non-limiting examples, suitable liposome formulations may comprise a combination selected from cKK-E12, DOPE, cholesterol and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; ICE, DOPE, cholesterol and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K.
[0270] In certain embodiments, liposomes for use with the present invention comprise a lipid component consisting of a cationic lipid, a non-cationic lipid (e.g., DOPE or DEPE), a PEG-modified lipid (e.g., DMG-PEG2K), and optionally cholesterol. Cationic lipids particularly suitable for inclusion in such liposomes include GL-TES-SA-DME-E18-2, TL1-01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, HGT4002 (also referred to herein as Guan-SS-Chol), GL-TES-SA-DMP-E18-2, HEP-E4-E10, HEP-E3-E10, and TL1-04D-DMA. These cationic lipids have been found to be particularly suitable for use in liposomes administered via pulmonary delivery via nebulization. Of these, HEP-E4-E10, HEP-E3-E10, GL-TES-SA-DME-E18-2, GL-TES-SA-DMP-E18-2, TL1-01D-DMA and TL1-04D-DMA performed particularly well.
[0271] In some embodiments, the HBEC-ALI (human bronchial epithelial cell-air-liquid interface) system can be used to assess mucociliary transport (MCT) using micro-optical coherence tomography (uOCT), for example, by visualizing MCT using fluorescent microbeads. Thus, HBEC-ALI can be used to assess the efficacy of liposomes encapsulating codon-optimized DNAI1 mRNA sequences for use in treating primary ciliary dysfunction (PCD).
[0272] Exemplary liposomes for use according to the invention include GL-TES-SA-DME-E18-2, TL1-01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, GL-TES-SA-DMP-E18-2, HEP-E4-E10, HEP-E3-E10 and TL1-04D-DMA as the cationic lipid component, DOPE as the non-cationic lipid component, cholesterol as the helper lipid component, and one of DMG-PEG2K as the PEG-modified lipid component. In some embodiments, the molar ratio of cationic lipid, non-cationic lipid, cholesterol and PEG-modified lipid can be between about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the molar ratio of cationic lipid, non-cationic lipid, cholesterol and PEG-modified lipid is approximately 40:30:20:10, respectively. In some embodiments, the molar ratio of cationic lipid, non-cationic lipid, cholesterol, and PEG-modified lipid is approximately 40:30:25:5, respectively. In some embodiments, the molar ratio of cationic lipid, non-cationic lipid, cholesterol, and PEG-modified lipid is approximately 40:32:25:3, respectively. In some embodiments, the molar ratio of cationic lipid, non-cationic lipid, cholesterol, and PEG-modified lipid is approximately 50:25:20:5.
[0273] In some embodiments, the lipid components of liposomes particularly suitable for pulmonary delivery consist of HGT4002 (also referred to herein as Guan-SS-Chol), DOPE, and DMG-PEG2K. In some embodiments, the molar ratio of cationic lipid to non-cationic lipid to PEG-modified lipid is approximately 60:35:5.
[0274] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) comprises about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the percentage of the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is greater than about 30%, greater than about 35%, greater than about 40%, greater than about 45%, greater than about 50%, greater than about 55%, or greater than about 60% of the liposome by molar ratio.
[0275] In some embodiments, the ratio of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids may be between about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids is approximately 50:25:20:5.
[0276] Ratio of separate lipid components In embodiments in which the lipid nanoparticle comprises three or fewer distinct lipid components, the ratio of the total lipid content (i.e., the ratio of lipid component (1):lipid component (2):lipid component (3)) is preferably x:y:z, where: (y+z)=100-x (where:
[0277] In some embodiments, each of "x," "y," and "z" represents the molar percentage of three separate lipid components, and the ratios are molar ratios.
[0278] In some embodiments, "x," "y," and "z" each represent the weight percentage of three separate lipid components, and the ratios are by weight.
[0279] In some embodiments, the lipid component (1), represented by the variable "x", is a sterol-based cationic lipid.
[0280] In some embodiments, the lipid component (2), represented by the variable "y", is a helper lipid.
[0281] In some embodiments, the lipid component (3), represented by the variable "z", is a PEG lipid.
[0282] In some embodiments, the variable "x", which represents the molar percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
[0283] In some embodiments, the variable "x", which represents the molar percentage of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.
[0284] In some embodiments, the variable "x", which represents the molar percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% but less than about 95%; at least about 50% but less than about 90%; at least about 50% but less than about 85%; at least about 50% but less than about 80%; at least about 50% but less than about 75%; at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%. In embodiments, the variable "x" is at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%.
[0285] In some embodiments, the variable "x", which represents the weight percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
[0286] In some embodiments, the variable "x", which represents the weight percentage of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.
[0287] In some embodiments, the variable "x", which represents the weight percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% but less than about 95%; at least about 50% but less than about 90%; at least about 50% but less than about 85%; at least about 50% but less than about 80%; at least about 50% but less than about 75%; at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%. In embodiments, the variable "x" is at least about 50% but less than about 70%; at least about 50% but less than about 65%; or at least about 50% but less than about 60%.
[0288] In some embodiments, the variable "z" representing the molar percentage of lipid component (3) (e.g., PEG lipid) is about 1% or less, about 2% or less, about 3% or less, about 4% or less, about 5% or less, about 6% or less, about 7% or less, about 8% or less, about 9% or less, about 10% or less, about 15% or less, about 20% or less, or about 25% or less. In some embodiments, the variable "z" representing the molar percentage of lipid component (3) (e.g., PEG lipid) is about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%. In embodiments, the variable "z", representing the molar percentage of lipid component (3) (e.g., a PEG lipid), is from about 1% to about 10%, from about 2% to about 10%, from about 3% to about 10%, from about 4% to about 10%, from about 1% to about 7.5%, from about 2.5% to about 10%, from about 2.5% to about 7.5%, from about 2.5% to about 5%, from about 5% to about 7.5%, or from about 5% to about 10%.
[0289] In some embodiments, the variable "z" representing the weight percentage of lipid component (3) (e.g., PEG lipid) is about 1% or less, about 2% or less, about 3% or less, about 4% or less, about 5% or less, about 6% or less, about 7% or less, about 8% or less, about 9% or less, about 10% or less, about 15% or less, about 20% or less, or about 25% or less. In some embodiments, the variable "z" representing the weight percentage of lipid component (3) (e.g., PEG lipid) is about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%. In embodiments, the variable "z", representing the weight percentage of lipid component (3) (e.g., PEG lipid), is from about 1% to about 10%, from about 2% to about 10%, from about 3% to about 10%, from about 4% to about 10%, from about 1% to about 7.5%, from about 2.5% to about 10%, from about 2.5% to about 7.5%, from about 2.5% to about 5%, from about 5% to about 7.5%, or from about 5% to about 10%.
[0290] For compositions having three separate lipid components, the variables "x," "y," and "z" can be in any combination as long as the sum of the three variables is 100% of the total lipid content.
[0291] Preparation of liposomes encapsulating mRNA The liposome delivery vehicle for use in the composition of the present invention can be prepared by various techniques currently known in the art.For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques, for example, by depositing selected lipids on the inner wall of a suitable container or vessel by dissolving the lipids in a suitable solvent, followed by evaporating the solvent to leave a thin film inside the vessel or by spray drying.Then, aqueous phase can be added to the vessel by vortexing, resulting in the formation of MLVs.Then, unilamellar vesicles (ULVs) can be formed by homogenizing, sonicating or releasing the multilamellar vesicles.In addition, unilamellar vesicles can be formed by detergent removal techniques.
[0292] Various methods are described in US Patent Application Publication No. 2011 / 0244026, US Patent Application Publication No. 2016 / 0038432, US Patent Application Publication No. 2018 / 0153822, US Patent Application Publication No. 2018 / 0125989, and US Provisional Patent Application No. 62 / 877,597, filed July 23, 2019, all of which are incorporated herein by reference, and may be used to practice the present invention. As used herein, Process A refers to the conventional method of encapsulating mRNA by mixing the mRNA with a mixture of lipids without first preforming the lipids into lipid nanoparticles, as described in US Patent Application Publication No. 2016 / 0038432. As used herein, Process B refers to a process of encapsulating messenger RNA (mRNA) by mixing preformed lipid nanoparticles with the mRNA, as described in U.S. Patent Application Publication No. 2018 / 0153822.
[0293] Briefly, the process of preparing lipid liposomes loaded with mRNA or MCNA includes heating (i.e., applying heat to the solution from a heat source) one or more of the solutions to (or maintaining at) a temperature above ambient temperature, and another solution is a solution containing preformed lipid nanoparticles, including a mixed solution containing mRNA and mRNA encapsulated in lipid nanoparticles. In some embodiments, the process includes heating one or both of the mRNA solution and the preformed lipid nanoparticle solution prior to the mixing step. In some embodiments, the process includes heating one or more of the solutions containing preformed lipid nanoparticles, including a solution containing mRNA and mRNA encapsulated in lipid nanoparticles during the mixing step. In some embodiments, the process includes heating the mRNA encapsulated in lipid nanoparticles after the mixing step. In some embodiments, the temperature to which one or more of the solutions are heated (or one or more of the solutions are maintained) is or exceeds about 30° C., about 37° C., about 40° C., about 45° C., about 50° C., about 55° C., about 60° C., about 65° C., or about 70° C. In some embodiments, the temperature to which one or more of the solutions are heated ranges from about 25-70° C., about 30-70° C., about 35-70° C., about 40-70° C., about 45-70° C., about 50-70° C., or about 60-70° C. In some embodiments, the temperature above ambient temperature to which one or more of the solutions are heated is about 65° C.
[0294] Various methods can be used to prepare an mRNA solution suitable for the present invention. In some embodiments, the mRNA can be dissolved directly in a buffer solution as described herein. In some embodiments, the mRNA solution can be made by mixing the mRNA stock solution with a buffer solution before mixing with a lipid solution for encapsulation. In some embodiments, the mRNA solution can be made by mixing the mRNA stock solution with a buffer solution just before mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution can contain mRNA in water at a concentration of about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml or more.
[0295] In some embodiments, the mRNA stock solution is mixed with the buffer solution using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps.
[0296] Typically, the buffer solution is mixed at a rate higher than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x faster than that of the mRNA stock solution. In some embodiments, the buffer solution is mixed at a flow rate in the range of about 100-6000 ml / min (e.g., about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, 4800-6000 ml / min, or 60-420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of about 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or more.
[0297] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of about 10 to 600 ml / min (e.g., about 5 to 50 ml / min, about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of about 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or more.
[0298] According to the present invention, the lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulation of mRNA. In some embodiments, the suitable lipid solution is ethanol-based. For example, the suitable lipid solution may contain a mixture of desired lipids dissolved in pure ethanol (i.e., 100% ethanol). In another embodiment, the suitable lipid solution is isopropyl alcohol-based. In another embodiment, the suitable lipid solution is dimethyl sulfoxide-based. In another embodiment, the suitable lipid solution is a mixture of suitable solvents including, but not limited to, ethanol, isopropyl alcohol, and dimethyl sulfoxide.
[0299] Suitable lipid solutions may contain a mixture of desired lipids at various concentrations, for example, a mixture of desired lipids at a total concentration of about 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml or more. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration in the range of about 0.1-100 mg / ml, 0.5-90 mg / ml, 1.0-80 mg / ml, 1.0-70 mg / ml, 1.0-60 mg / ml, 1.0-50 mg / ml, 1.0-40 mg / ml, 1.0-30 mg / ml, 1.0-20 mg / ml, 1.0-15 mg / ml, 1.0-10 mg / ml, 1.0-9 mg / ml, 1.0-8 mg / ml, 1.0-7 mg / ml, 1.0-6 mg / ml, or 1.0-5 mg / ml. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of up to about 100 mg / ml, 90 mg / ml, 80 mg / ml, 70 mg / ml, 60 mg / ml, 50 mg / ml, 40 mg / ml, 30 mg / ml, 20 mg / ml, or 10 mg / ml.
[0300] Any desired lipids can be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids including cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), amphiphilic block copolymers (e.g., poloxamers), and / or PEGylated lipids. In some embodiments, a suitable lipid solution contains a mixture of desired lipids including one or more cationic lipids, one or more helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), and one or more PEGylated lipids.
[0301] In certain embodiments, the provided compositions include liposomes in which mRNA is associated on both surfaces of the liposome and encapsulated within the same liposome.For example, during preparation of the compositions of the present invention, cationic liposomes can be associated with mRNA or MCNA through electrostatic interactions.
[0302] In some embodiments, the compositions and methods of the present invention include mRNA encapsulated in liposomes. In some embodiments, one or more mRNA species can be encapsulated in the same liposome. In some embodiments, one or more mRNA species can be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes that differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes can have different compositions of sterol-based cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes can have different molar ratios of cholesterol-based cationic lipids, neutral lipids, and PEG-modified lipids used to generate the liposomes.
[0303] The process of incorporating a desired nucleic acid (e.g., mRNA or MCNA) into a liposome is often referred to as "loading". Exemplary methods are described in Lasic, et al. FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. The nucleic acid incorporated into the liposome may be located entirely or partially in the interior space of the liposome, within the bilayer membrane of the liposome, or may be associated with the outer surface of the liposome membrane. The incorporation of a nucleic acid into a liposome is also referred to herein as "encapsulation", where the nucleic acid is completely contained within the interior space of the liposome. The purpose of incorporating an mRNA into a transfer vehicle such as a liposome is often to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid and / or systems or receptors that result in the rapid excretion of the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate the delivery of a therapeutic agent (e.g., mRNA or MCNA) to a target cell or tissue.
[0304] Suitable liposomes according to the present invention can be made in various sizes. In some embodiments, the provided liposomes can be made smaller than previously known liposomes. In some embodiments, the reduction in size of liposomes is associated with more efficient delivery of therapeutic agents (e.g., mRNA or MCNA). The selection of appropriate liposome size may take into account the site of target cells or tissues and to some extent the application for which the liposomes are made.
[0305] In some embodiments, the appropriate size of liposome is selected to promote the systemic distribution of the antibody encoded by mRNA.In some embodiments, it may be desirable to restrict the transfection of mRNA to certain cells or tissues.For example, to target hepatocytes, liposomes can be sized so that their dimensions are smaller than the fenestrations of the endothelial layer lining the hepatic sinusoids in the liver; in such a case, liposomes can easily penetrate such endothelial fenestrations to reach the target hepatocytes.
[0306] Alternatively or additionally, liposomes can be sized such that the liposome dimensions are of sufficient diameter to limit or specifically avoid distribution to certain cells or tissues.
[0307] A variety of alternative methods known in the art are available for sizing the liposome population. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension, either by bath sonication or probe sonication, results in a gradual size reduction down to small ULVs with diameters of less than about 0.05 microns. Homogenization is another method that relies on shear energy to fragment larger liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated through a standard emulsion homogenizer until a selected liposome size is observed, typically between about 0.1 and 0.5 microns. Liposome size can be determined by quasi-electrical light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-450 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonication of the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis.
[0308] Nanoparticles encapsulating the provided mRNA In some embodiments, the majority of the purified nanoparticles in the composition (i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nanoparticles) have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, about 50 nm, about 45 nm, about 40 nm, about 35 nm, or about 30 nm). In some embodiments, substantially all of the purified nanoparticles have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, about 50 nm, about 45 nm, about 40 nm, about 35 nm, or about 30 nm).
[0309] In some embodiments, the lipid nanoparticles have an average size of less than 150 nm. In some embodiments, the lipid nanoparticles have an average size of less than 120 nm. In some embodiments, the lipid nanoparticles have an average size of less than 100 nm. In some embodiments, the lipid nanoparticles have an average size of less than 90 nm. In some embodiments, the lipid nanoparticles have an average size of less than 80 nm. In some embodiments, the lipid nanoparticles have an average size of less than 70 nm. In some embodiments, the lipid nanoparticles have an average size of less than 60 nm. In some embodiments, the lipid nanoparticles have an average size of less than 50 nm. In some embodiments, the lipid nanoparticles have an average size of less than 30 nm. In some embodiments, the lipid nanoparticles have an average size of less than 20 nm.
[0310] In some embodiments, the dispersity, or molecular size heterogeneity measure (PDI), of the nanoparticles in the compositions provided by the present invention is less than about 0.5. In some embodiments, the lipid nanoparticles have a PDI less than about 0.5. In some embodiments, the lipid nanoparticles have a PDI less than about 0.4. In some embodiments, the lipid nanoparticles have a PDI less than about 0.3. In some embodiments, the lipid nanoparticles have a PDI less than about 0.28. In some embodiments, the lipid nanoparticles have a PDI less than about 0.25. In some embodiments, the lipid nanoparticles have a PDI less than about 0.23. In some embodiments, the lipid nanoparticles have a PDI less than about 0.20. In some embodiments, the lipid nanoparticles have a PDI less than about 0.18. In some embodiments, the lipid nanoparticles have a PDI less than about 0.16. In some embodiments, the lipid nanoparticles have a PDI less than about 0.14. In some embodiments, the lipid nanoparticles have a PDI less than about 0.12. In some embodiments, the lipid nanoparticles have a PDI less than about 0.10. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.08.
[0311] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles in the compositions provided by the present invention encapsulate mRNA within each individual particle. In some embodiments, substantially all of the purified lipid nanoparticles in the composition encapsulate mRNA within each individual particle. In some embodiments, the lipid nanoparticles have an encapsulation efficiency between 50% and 99%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 60%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 65%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 70%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 75%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 80%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 85%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 90%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 92%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 95%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 98%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 99%.
[0312] In some embodiments, the lipid nanoparticles have an N / P ratio between 1 and 10. As used herein, the term "N / P ratio" refers to the molar ratio of positively charged molecular units in the cationic lipids in the lipid nanoparticles to the negatively charged molecular units in the mRNA encapsulated in the lipid nanoparticles. Therefore, the N / P ratio is usually calculated as the ratio of the moles of amine groups in the cationic lipids in the lipid nanoparticles to the moles of phosphate groups in the mRNA encapsulated in the lipid nanoparticles. In some embodiments, the lipid nanoparticles have an N / P ratio greater than 1. In some embodiments, the lipid nanoparticles have an N / P ratio of about 1. In some embodiments, the lipid nanoparticles have an N / P ratio of about 2. In some embodiments, the lipid nanoparticles have an N / P ratio of about 3. In some embodiments, the lipid nanoparticles have an N / P ratio of about 4. In some embodiments, the lipid nanoparticles have an N / P ratio of about 5. In some embodiments, the lipid nanoparticles have an N / P ratio of about 6. In some embodiments, the lipid nanoparticles have an N / P ratio of about 7. In some embodiments, the lipid nanoparticles have an N / P ratio of about 8.
[0313] In some embodiments, the compositions according to the invention contain at least about 0.01 mg, 0.05 mg, 0.1 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. In some embodiments, the compositions contain between about 0.1 mg and 1000 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 0.5 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 0.8 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 1 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 5 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 8 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 10 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 50 mg of encapsulated mRNA. In some embodiments, the compositions contain at least about 100 mg of encapsulated mRNA. In some embodiments, the composition contains at least about 500 mg of encapsulated mRNA. In some embodiments, the composition contains at least about 1000 mg of encapsulated mRNA.
[0314] Pharmaceutical Compositions The present invention provides compositions for use in the treatment of primary ciliary dyskinesia (PCD). The compositions of the present invention are for use in the manufacture of a medicament for the treatment of primary ciliary dyskinesia (PCD).
[0315] The provided liposome-encapsulated or associated mRNA and compositions containing same can be administered and dosed according to existing medical practice, taking into consideration the subject's clinical condition, the site and method of administration, the administration schedule, the subject's age, sex, weight and other factors relevant to a clinician of ordinary skill in the art. As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of therapeutic agent contained in the pharmaceutical composition of the present invention. Generally, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject, mammal (e.g., treat, regulate, cure, prevent and / or ameliorate PCD). For example, a therapeutically effective amount can be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. Generally, the amount of therapeutic agent (e.g., mRNA encoding DNAI1 protein) administered to a subject in need thereof will depend on the subject's characteristics. Such characteristics include the subject's condition, disease severity, general health, age, sex and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other relevant factors. In addition, both objective and subjective assays can optionally be used to identify optimal dosage ranges.
[0316] In some embodiments, an effective therapeutic dose of a pharmaceutical composition comprising an mRNA encoding a dynein axoneme intermediate chain 1 protein is administered to a mammal at a dosing interval sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal compared to a pre-treatment state for the duration of the dosing interval or longer.
[0317] In some embodiments, the mammal is a human. A suitable therapeutic dose that may be applicable to humans can be derived based on animal testing. A basic guideline for deriving a human equivalent dose from a test carried out in animals can be obtained from the US>Food and Drug Administration (FDA) website at https: / / www.fda.gov / downloads / drugs / guidances / ucm078932.pdf, entitled "Guidance for Industry Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers". Based on the guideline for non-proportional scaling, a suitable dose in mice, for example, 0.6 mg / kg, would be related to a human equivalent dose of 0.0048 mg / kg. Thus, taking into account the derived human equivalent dose, a predicted human therapeutic dose can be derived based on testing in other animals.
[0318] In some embodiments, the dosing interval is once every 2 days or more. In some embodiments, the dosing interval is once every 3 days or more. In some embodiments, the dosing interval is once every 4 days or more. In some embodiments, the dosing interval is once every 5 days or more. In some embodiments, the dosing interval is once every 6 days or more. In some embodiments, the dosing interval is once every 7 days or more. In some embodiments, the dosing interval is once every 8 days or more. In some embodiments, the dosing interval is once every 9 days or more. In some embodiments, the dosing interval is once every 10 days or more. In some embodiments, the dosing interval is once every 11 days or more. In some embodiments, the dosing interval is once every 12 days or more. In some embodiments, the dosing interval is once every 13 days or more. In some embodiments, the dosing interval is once or more than 14 days, once or more than 15 days, or once or more than 20 days, or once or more than 21 days, or once or more than 22 days, or once or more than 23 days, or once or more than 24 days, or once or more than 25 days, once or more than 26 days, or once or more than 27 days, or once or more than 28 days, or once or more than 29 days, or once or more than 30 days, or once or more than 31 days. In some embodiments, the dosing interval is once every 40, 45, or 50 days, or once or more than 60 days, or any number of days in between. In some embodiments, the dosing interval is once every 80, 90, or once or more than 120 days, or once or more than 150 days, or any number of days in between.
[0319] In some embodiments, the low dose of the therapeutic agent is administered at a dosing interval of once every two weeks or more, which is sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal compared to the pre-treatment state. In some embodiments, the low dose of the therapeutic agent is administered at a dosing interval of once every three weeks or more, which is sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal compared to the pre-treatment state. In some embodiments, the dosing interval is once every four weeks or more. In some embodiments, the dosing interval is once every five weeks or more. In some embodiments, the dosing interval is once every six weeks or more. In some embodiments, the dosing interval is once every eight weeks or more. In some embodiments, the dosing interval is once every twelve, fifteen, or eighteen weeks or more.
[0320] In some embodiments, the dosing interval is once a month. In some embodiments, the dosing interval is once every two months. In some embodiments, the dosing interval is once every three months, or once every four months, or once every five months, or once every six months, or any interval in between.
[0321] In some embodiments, administering the provided compositions results in an increase in DNAI1 mRNA expression levels in a biological sample from a subject compared to a baseline expression level before treatment. Typically, the baseline level is measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administering the provided compositions results in an increase in DNAI1 mRNA expression levels of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a baseline level immediately before treatment. In some embodiments, administering the provided compositions results in an increase in DNAI1 mRNA expression levels compared to a DNAI1 mRNA expression level in an untreated subject.
[0322] According to the present invention, a therapeutically effective dose of the provided composition, when administered regularly, results in an increase in DNAI1 protein expression or activity level in a subject, compared to baseline DNAI1 protein expression or activity level before treatment. Typically, DNAI1 protein expression or activity level is measured in a biological sample obtained from a subject, such as blood, plasma or serum, urine, or solid tissue extract. In some embodiments, administration of the composition of the present invention results in detectable DNAI1 expression in the liver. In some embodiments, administration of the provided composition results in an increase in DNAI1 protein expression or activity level in a biological sample (e.g., plasma / serum or urine) of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline level before treatment. In some embodiments, administration of a provided composition results in an increase in DNAI1 protein expression or activity levels in a biological sample (e.g., plasma / serum or urine) of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels for at least 24 hours, at least 48 hours, at least 72 hours, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, or at least 15 days.
[0323] In some embodiments, a therapeutic dose is sufficient to achieve at least some stabilization, amelioration, or elimination of symptoms and other indicators such as biomarkers, and is selected by one of skill in the art as an appropriate measure of disease progression, disease regression, or amelioration.
[0324] Suitable routes of administration include, for example, oral, rectal, vaginal, mucosal, intratracheal or pulmonary, including inhalation, or intestinal administration; intradermal, transdermal (topical), intramuscular, subcutaneous, intramedullary injection, and parenteral delivery, including intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal.
[0325] In some embodiments, a therapeutically effective dose comprising an mRNA encoding a DNAI1 protein is administered to a subject by intramuscular administration.
[0326] In some embodiments, a therapeutically effective dose comprising an mRNA encoding DNAI1 is administered to a subject by subcutaneous administration.
[0327] In certain embodiments, the intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, the administration results in delivery of the mRNA to a muscle cell. In some embodiments, the administration results in delivery of the mRNA to a hepatic cell (i.e., a liver cell). In certain embodiments, the intramuscular administration results in delivery of the mRNA to a muscle cell.
[0328] Most commonly, a therapeutically effective dose comprising mRNA encoding dynein axonemal intermediate chain protein 1 is administered to the subject by intravenous administration.
[0329] Alternatively or additionally, the mRNA and compositions encapsulated in liposomes of the present invention can be administered in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into the tissue to be targeted, preferably in a sustained release formulation. Local delivery can be effected in various ways, depending on the tissue to be targeted. For example, an aerosol containing the composition of the present invention can be inhaled (for nasal, tracheal, or bronchial delivery); for example, the composition of the present invention can be injected at the site of injury, disease manifestation, or pain; the composition can be provided in a troche for oral, tracheal, or esophageal application; can be provided in liquid, tablet, or capsule form for administration to the stomach or intestinal tract, or in suppository form for rectal or vaginal application; or can be delivered to the eye by using creams, drops, or injections. Formulations containing the provided compositions complexed with therapeutic molecules or ligands can also be administered surgically, for example, in conjunction with polymers or other structures or materials that can allow the composition to diffuse from the implantation site to surrounding cells. Alternatively, they may be applied surgically without the use of a polymer or support.
[0330] In a particular embodiment, the DNA encoding the mRNA I1 is administered intravenously, and the intravenous administration is associated with delivery of the mRNA to hepatocytes.
[0331] In some embodiments, a therapeutically effective dose comprising an mRNA encoding a dynein axonemal intermediate chain protein is administered for suitable delivery to the liver of the mammal, hi some embodiments, a therapeutically effective dose comprising an mRNA encoding a dynein axonemal intermediate chain protein is administered for suitable expression in liver cells of the mammal to which it is administered.
[0332] The methods of the present invention provided contemplate single and multiple administration of a therapeutically effective amount of the therapeutic agent described herein (e.g., mRNA encoding DNAI1 protein). The therapeutic agent may be administered at regular intervals depending on the nature, severity and extent of the subject's condition (e.g., PCD). In some embodiments, a therapeutically effective amount of the therapeutic agent of the present invention (e.g., mRNA encoding DNAI1 protein) may be administered intrathecally periodically at regular intervals (e.g., once a year, once every 6 months, once every 5 months, once every 3 months, every other month (once every 2 months), monthly (once a month), every other week (once every 2 weeks), twice a month, once every 30 days, once every 28 days, once every 14 days, once every 10 days, once every 7 days, weekly, twice a week, daily or continuously).
[0333] In some embodiments, the liposomes and / or compositions provided are formulated so that they are suitable for sustained release of the mRNA contained therein. Such sustained release compositions can be conveniently administered to a subject at extended administration intervals. For example, in one embodiment, the compositions of the present invention are administered to a subject twice a day, every day, or every other day. In some embodiments, the compositions of the present invention are administered to a subject twice a week, once a week, once every 7 days, once every 10 days, once every 14 days, once every 28 days, once every 30 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once a month, twice a month, once every 6 weeks, once every 8 weeks, once every other month, once every 3 months, once every 4 months, once every 6 months, once every 8 months, once every 9 months, or once a year.
[0334] In a preferred embodiment, the composition of the present invention is administered to a subject once a week, once every two weeks, or once a month. In a more preferred embodiment, the composition of the present invention is administered to a subject once every two weeks or once a month. In a most preferred embodiment, the composition of the present invention is administered to a subject once a month.
[0335] In some embodiments, the mRNA is administered simultaneously with an additional therapy.
[0336] Also contemplated are compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) that deliver or release the mRNA over an extended period of time. Preferably, the sustained release means utilized is combined with modifications made to the mRNA to enhance stability.
[0337] The therapeutically effective amount is generally administered in a dosing regimen that may include multiple unit doses. For any particular therapeutic protein, the therapeutically effective amount (and / or the appropriate unit dose within an effective dosing regimen) may vary depending on the route of administration, for example, when combined with other pharmaceuticals. The particular therapeutically effective amount (and / or unit dose) for any particular patient may also depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the particular pharmaceutical agent utilized; the particular composition utilized; the patient's age, weight, general health, sex, and diet; the time of administration, the route of administration, and / or the rate of excretion or metabolism of the particular protein utilized; the duration of treatment; and similar factors as are well known in the medical field. In accordance with the present invention, a therapeutically effective dose of the provided composition, when administered regularly, results in a reduction in the intensity, severity, or frequency of, or delays the onset of, at least one symptom or characteristic of PCD.
[0338] Also contemplated herein are lyophilized pharmaceutical compositions comprising one or more of the liposomes disclosed herein and related methods for the use of such compositions, for example as disclosed in International Patent Application PCT / US12 / 41663, filed June 8, 2012, the teachings of which are incorporated herein by reference in their entirety. For example, the lyophilized pharmaceutical compositions according to the present invention can be reconstituted prior to administration or reconstituted in vivo. For example, the lyophilized pharmaceutical compositions can be formulated in a suitable dosage form (e.g., an intradermal dosage form such as a disk, rod, or membrane) and administered such that the dosage form is rehydrated in vivo over time by the individual's body fluids.
[0339] In some embodiments, the pharmaceutical composition comprises a lyophilized liposome delivery vehicle comprising a cationic lipid, a non-cationic lipid, a PEG-modified lipid, and cholesterol. In some embodiments, the pharmaceutical composition has a Dv50 of less than 500 nm, less than 300 nm, less than 200 nm, less than 150 nm, less than 125 nm, less than 120 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm, or less upon reconstitution. In some embodiments, the pharmaceutical composition has a Dv90 of less than 750 nm, less than 700 nm, less than 500 nm, less than 300 nm, less than 200 nm, less than 150 nm, less than 125 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm, or less upon reconstitution. In some embodiments, the pharmaceutical composition upon reconstitution has a polydispersity index value of less than 1, less than 0.95, less than 0.9, less than 0.8, less than 0.75, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.25, less than 0.2, less than 0.1, less than 0.05 or less. In some embodiments, the pharmaceutical composition upon reconstitution has an average particle size of less than 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, less than 175 nm, less than 150 nm, less than 125 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm.
[0340] In some embodiments, the lyophilized pharmaceutical composition further comprises one or more lyoprotectants, such as sucrose, trehalose, dextran, or inulin. Typically, the lyoprotectant is sucrose. In some embodiments, the pharmaceutical composition is stable for at least 1 month or at least 6 months when stored at 4° C., or for at least 6 months when stored at 25° C. In some embodiments, the biological activity of the mRNA of the reconstituted lyophilized pharmaceutical composition is greater than 75% of the biological activity observed prior to lyophilization of the composition.
[0341] The provided liposomes and compositions can be administered to any desired tissue. In some embodiments, the DNAI1 mRNA delivered by the provided liposomes or compositions is expressed in the tissue to which the liposomes and / or compositions are administered. In some embodiments, the delivered mRNA is expressed in a tissue different from the tissue to which the liposomes and / or compositions are administered. Exemplary tissues to which the delivered mRNA can be delivered and / or expressed include, but are not limited to, the liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid.
[0342] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit a particular medical need. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1, 2, 3, 6, 12, 24, 48, 72, 96 hours, 1 week, 2 weeks, or 1 month after administration of the provided liposomes and / or compositions.
[0343] In some embodiments, administering the provided compositions results in an increase in the level of DNAI1 protein in liver cells (e.g., hepatocytes) of the subject, compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administering the provided compositions results in an increase in DNAI1 protein level in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of liver cells, compared to the baseline level before treatment. In some embodiments, administering the provided compositions results in an increase in DNAI1 protein level in liver cells, compared to the DNAI1 protein level in liver cells of an untreated subject.
[0344] In some embodiments, administering the provided compositions results in an increase in the DNAI1 protein level in the plasma or serum of the subject compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administering the provided compositions results in an increase in the DNAI1 protein level in the plasma or serum of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level before treatment. In some embodiments, administering the provided compositions results in an increase in the DNAI1 protein level in the plasma or serum of the subject compared to the DNAI1 protein level in the plasma or serum of an untreated subject.
[0345] In some embodiments, administering the provided compositions results in an increase in DNAI1 enzyme activity in a biological sample from a subject compared to a baseline level before treatment. Typically, the baseline level is measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., liver). In some embodiments, administering the provided compositions results in an increase in DNAI1 enzyme activity of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a baseline level immediately before treatment. In some embodiments, administering the provided compositions results in an increase in DNAI1 enzyme activity compared to DNAI1 activity in an untreated subject.
[0346] In some embodiments, the subject is a mammal. In some embodiments, the mammal is an adult. In some embodiments, the mammal is an adolescent. In some embodiments, the mammal is an infant or juvenile mammal. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the subject is between 6 and 80 years of age. EXAMPLES
[0347] While certain compounds, compositions and methods of the invention have been described with specificity in accordance with certain embodiments, the following examples are merely illustrative of the compounds of the invention and are not intended to be limiting thereof.
[0348] Example 1. Establishment of an in vitro disease model In this example, pseudostratified epithelium was generated from human induced pluripotent stem cells. The development of this model allows for the testing of lung diseases that are difficult to test in human models.
[0349] A schematic of the in vitro directed differentiation method to generate pseudostratified epithelium from human embryonic stem cells is shown in Figure 1. Following timed treatment with exogenous growth factors that mimic the in vivo endodermal developmental pathway, culture at the air-liquid interface led to the maturation of patches of tightly junctionally attached differentiated airway epithelial cells indicative of a stratified epithelium.
[0350] To further evaluate that the cultured epithelium indeed mimics suitable epithelium for testing lung disease, immunofluorescence was performed. As shown in Figure 2A, ACT staining showed the presence of robust cilia in the epithelial lining. Furthermore, Figure 2B shows the robust expression of MUC5AC at distinct locations from beta-actin. Overall, the immunofluorescence data show that the pluripotent cells differentiated into ciliated, club, globlet and basal cells that mimic airway epithelium.
[0351] In addition to the "wild-type" model, an "iso-wild-type" (or "iso-WT") model and a "disease" model were generated in a similar manner from the iPSC line. For the "iso-wild-type" model, the CRISPR-Cas system was used in an attempt to knock down the DNAI1 gene. However, the CRISPR-Cas treatment was not successful and the iPSC line maintained DNAI1, and is therefore referred to as the "iso-wild-type" model. For the "disease" model, two alleles for DNAI1 were successfully deleted. To validate the "iso-wild-type" and "disease" models, the cilia length of each line was calculated from H&E (hematoxylin and eosin) stained samples and compared with that of cilia in HBEC (human bronchial epithelial cell) samples, the gold standard for airway epithelium (Figure 3A). Cilia length is crucial for proper ciliary movement of the mucosa, and the cilia in PCD patients are too short to function adequately. Figure 3B shows that the cilia length in the Iso-WT model is not statistically different from that of the HBEC model, indicating that Iso-WT mimics non-diseased airway epithelium. Furthermore, the data validate that the disease model created in this example has significantly shorter cilia, indicative of a PCD disease model.
[0352] Example 2: Significant improvement in ciliary beat frequency by administration and delivery of hDNAI1 mRNA This example shows that administration of mRNA encoding hDNAI1 protein encapsulated in lipid nanoparticles (LNPs) to a disease model resulted in restoration of ciliary beat frequency (CBF).
[0353] PCD is a genetically heterogeneous disorder of cilia motility. It is characterized by ciliary dysfunction and impaired mucociliary clearance, which results in a range of clinical symptoms. Ciliary beat frequency (CBF) is commonly used as a screening test and is currently associated with testing of ciliary function.
[0354] In this study, CBF was used to determine the efficacy of mRNA-LNPs in treating PCD using the disease model described in Example 1. 8 μg of mRNA encoding DNAI1 encapsulated in lipid nanoparticles was administered to the apical side of ALI cultures. As positive controls, iso-wild type and wild type ALI cultures described in Example 1 were used. As negative controls, untreated disease models were used, which received 10% trehalose. As shown in Figure 4A, a significant improvement in CBP was observed 24 hours after transfection with mRNA-LNPs. (CBF values were higher than standard for all samples due to the low frame / second capture capacity of the camera in this study.)
[0355] Overall, the data in this example demonstrate that the mRNA-LNPs of the present invention are able to increase CBF in PCD patients and restore it to wild-type, non-disease models.
[0356] Example 3: Single dose administration of mRNA encoding DNAI1 in vivo In this example, single dose administration of mRNA encoding DNAI1 encapsulated in LNPs was tested.
[0357] The mRNA containing SEQ ID NO:10 was encapsulated in LNPs containing either TL1-01D-DMA or SY-3-E14-DMAPr cationic lipids. The mRNA-LNPs were then nebulized once into mice, and DNAI1 protein expression was measured in the lungs and trachea. As shown in Figure 5A, a dose response was observed in the mRNA levels from the lungs immediately after exposure to both lipids.
[0358] Next, flow cytometry was performed to determine the % of cells that were DNAI1 positive. According to Ostrowski, obtaining 20% DNAI1+ cells can restore ciliary function and promote ciliary clearance (Ostrowski,LE et al. "Restoring ciliary function to differentiated primary ciliary dyskinesia cells with a lentiviral vector." Gene therapy vol.21,3(2014):253-61). As shown in Figure 5B, a single administration of mRNA-LNPs containing TL-1-01D-DMA as a cationic lipid resulted in a ciliary DNAI1 positive transfection efficiency of less than 3%, with a peak at 4 hours after administration. Figure 5C shows the immunohistochemistry data at 6 hours after nebulization, indicating that DNAI1 expression is localized to the airway epithelium.
[0359] Example 4: Dose-response effects following aerosol exposure after a single dose In this example, nebulized administration of a single dose of mRNA encoding DNAI1 encapsulated in LNPs was tested.
[0360] Animals were treated with MRT-DNAI1-LNP nebulized in a DSI inhalation tower, such that the route of administration is relevant to potential human treatments using a nebulizer. This will also allow for the determination of dose-exposure relationships. Animals were exposed for different lengths of time ranging from 30 min to 6 h, while maintaining a constant concentration of MRT-DNAI1-LNP at 0.6 mg / mL. On the third day and at 48 h after exposure, lungs were harvested and enzymatically digested with an optimized protocol to obtain single cell suspensions. Dead cells were excluded using Zombie NIR, after which cell markers for CD45 and CD31 were used to separate leukocyte and endothelial populations, respectively. Epithelial cells were then selected by negative selection for CD45 and CD31. Multiciliated cells were then selected using positive selection for acetylated tubulin (i.e., CD45Neg, CD31Neg, CD326Pos, TUBAPos). Gating of live cells, epithelial cells, and multiciliated cells was performed on untreated samples to determine baseline levels of DNAI1 expression (<1%) and compared to treated samples. Gating parameters were kept constant throughout the experiment. Figure 6A shows a representative density plot of multiciliated epithelial cells that were DNAI1 positive in untreated versus treated cells. A novel population of cells that were TUBA+ / DNAI1+ was seen in the gated region, demonstrating protein expression. Figure 6B shows lung flow cytometry results from different exposure times. There is a dose-response association demonstrating that the longer the exposure, the more TUBA+ / DNAI1+ cells there are. Levels of mRNA were assessed in the lungs immediately after dosing by RTqPCR. A dose-exposure association was observed, suggesting that animals were appropriately dosed and correlating with the flow cytometry data showing dose-response (Figure 6C).
[0361] Example 5. Duration of DNAI1 expression in mouse lungs In this example, the effect of administering mRNA encoding DNAI1 encapsulated in LNPs was examined by measuring the duration of DNAI1 expression after exposure.
[0362] Animals were treated with a single 6-hour exposure with two different LNPs to determine the duration of DNAI1 expression after exposure. Lungs were harvested either immediately after dosing, 4, 8, or 15 days (Figure 7). Lungs harvested on days 4, 8, and 12 were enzymatically digested with an optimized protocol to obtain single cell suspensions. As before, a flow cytometry panel was used for gating. Gating of live cells, epithelial cells, and multiciliated cells was performed on untreated samples to determine baseline levels of DNAI1 expression (<2%) and compared to treated samples. Baseline levels may vary slightly from experiment to experiment in flow cytometry experiments. However, gating parameters were kept constant throughout any one experiment. Figure 7 shows the percentage of DNAI1 positive events in live multiciliated epithelial cells from lungs on days 4, 8, and 15 with two different LNPs. Overall, DNAI1 expression was still detectable 15 days after aerosol exposure to MRT-DNAI1 encapsulated in LNPs.
[0363] Example 6: Repeated dose administration of mRNA encoding DNAI1 in vivo restores CBF In this example, expression of LNP-encapsulated mRNA encoding DNAI1 following a repeated daily dosing regimen was examined.
[0364] mRNA containing SEQ ID NO: 10 was encapsulated in LNPs containing either TL1-01D-DMA ("Lipid 2") or SY-3-E14-DMAPr ("Lipid 1") lipids. Animals were exposed to either a single 30-minute exposure or five daily 30-minute exposures. For animals with a single exposure, lungs were collected either immediately after dosing or at 4 days, 72 hours after exposure. For animals with multiple exposures, lungs were harvested immediately after dosing, 5 days, 8 days, 72 hours after the last exposure, or 12 days, 7 days after the last exposure. For lungs harvested immediately after dosing, they were analyzed for mRNA by RTqPCR or parent lipid by mass spectrometry. For lungs harvested on days 8 and 12, they were enzymatically digested with an optimized protocol to obtain single cell suspensions. Dead cells were excluded using Zombie NIR, and then cell markers for CD45 and CD31 were used to separate leukocyte and endothelial populations, respectively. Epithelial cells were then selected by negative selection for CD45 and CD31. Multiciliated cells were then selected using positive selection for acetylated tubulin (i.e., CD45Neg, CD31Neg, CD326Pos, TUBAPos). Gating of live cells, epithelial cells, and multiciliated cells was performed on untreated samples to determine baseline levels of DNAI1 expression (<1%) and compared to treated samples. Gating parameters were kept constant throughout the experiment.
[0365] Figure 8A shows a representative density plot of multiciliated epithelial cells that were DNAI1 positive in treated versus untreated cells. A new population of cells that were TUBA+ / DNAI1+ was seen in the gated region, demonstrating protein expression. This study was a head-to-head comparison of the two main cationic lipids in LNPs encapsulating MRT-DNAI1, LNP1 and LNP2. The results show that repeated administration results in distinct ciliated and DNAI1 positive populations for both lipids. Remarkably, expression was maintained at day 12.
[0366] The fimbrial DNAI1 positive transfection efficiency was determined and plotted as shown in FIG. 8B, which shows the flow cytometry results from all animals in the study. After a single aerosol administration, there is no significant difference between either untreated animals or animals treated with 30 minutes of exposure. For animals treated for several days, there is no significant difference between untreated and treated animals 72 hours after the last administration. However, by the 12th day and 7th day after the last administration, there was a significant increase in the number of cells that expressed human DNAI1 in multiciliated cells with both cationic lipids.
[0367] Figure 8C quantitatively summarizes the gMFI data. Analysis of the flow cytometry data for geometric mean fluorescence intensity (gMFI) showed that there was a continued increase in DNAI1 fluorescence by day 12 (Figure 8C). In the single-dose groups (groups 2 and 3), there was a small population of cells that had low DNAI1 signals on day 4 (right panel, red). In the repeated-dose group 4, there was an increase in the number of cells that expressed low levels of DNAI1 with MRT-DNAI1-LNP1 on day 8. In the repeated-dose group 5, there was no difference in the number of cells that showed DNAI1 expression compared to group 3 with the single-dose group (middle panel, orange). However, by day 12, both animals in groups 4 and 5 had an increase in the number of cells that expressed high levels of DNAI1 in multiciliated cells (left panel, green). The kinetics of expression with LNP2 may have a delayed onset of expression, but can achieve high levels similar to those administered with LNP1. DNAI1 expression intensity in multiciliated cells increases over the course of one week from the last dose, and this increase achieves statistical significance at day 12 in both treatment groups using one-way ANOVA *p<0.05 compared to untreated, Fisher's LSD test.
[0368] Expression levels are shown in Figure 8D. Dose-exposure assessment was performed by RT-qPCR from the lungs of animals immediately after dosing (Figure 8D). Overall, there was an increase in mRNA for LNP1 comparing day 1 (group 2) versus day 5 (group 4). A similar trend was observed in mRNA levels for LNP2 comparing day 1 (group 3) versus day 5 (group 5). Higher levels of mRNA were observed in animals dosed with LNP2 than LNP1 comparing values on the same days, but overall there were no significant differences between groups using one-way ANOVA / Tukey's multiple comparison test.
[0369] Overall, the data show that the % of DNAI1 positive cells significantly increased on day 12 (approximately 7 days after the last dose). Furthermore, the % of DNAI1 positive cells increased to approximately 10%, a significant amount that can restore cilia function.
[0370] Next, an experiment was performed to evaluate the activity of the expressed DNAI1 by measuring the ciliary beat frequency (CBF). Wild-type mice and DNAI1 heterozygote mice were used as positive controls. DNAI1-encoding mRNA encapsulated in SY-3-E14-DMAPr containing LNPs was sprayed into DNAI1 knockout mice. Tracheal samples were collected and CBF was imaged at 500 fps at 32°C. As shown in Figure 8E, administration of mRNA-LNPs to knockout mice had higher CBF compared to heterozygote mice, indicating that repeated administration of DNAI1-encoding mRNA restored ciliary activity.
[0371] Example 7. Modeling weekly administration of mRNA encoding DNAI1 restores pilus activity This example shows the modeling of a weekly dosing regimen in terms of DNAI1 expression.
[0372] Analysis of the percentage of ciliated cells and DNAI1 positive cells for up to 15 days showed that protein expression peaked on day 8 and was still present on day 15 (Figure 9A). Based on this data, the approximate half-life of DNAI1 protein was estimated to be about 2 weeks. Data modeling was then performed to test whether weekly dosing would be a viable option for treating PCD, assuming that DNAI1 has a half-life of 2 weeks. As shown in Figure 9B, modeling indicates that weekly dosing can achieve 40% or 80% cells expressing DNAI1 in some cases. The predicted level of eMax is at least 40% by week 5, regardless of the cationic lipid used.
[0373] Example 8. DNAI1 expression following a weekly repeated administration paradigm of DNAI1 mRNA-LNP This example demonstrates the effect of weekly administration of mRNA encoding DNAI1 encapsulated in LNPs.
[0374] Given the duration of expression with repeated daily dosing and the ability to detect protein expression, additional work was performed to test the duration of durability following repeated weekly intratracheal instillation of MRT-DNAI1-LNP1. Animals were dosed weekly for up to 6 weeks with either saline or MRT-DNAI1-LNP1. Cohorts of animals from each group were euthanized and lungs were harvested 7 days after dosing 1-6. In addition, cohorts of animals were euthanized 3, 7, and 15 days after the last dose. The right lung was snap frozen and analyzed by Western blot for global protein levels, and the left lung was fixed for IHC for spatial distribution.
[0375] FIG. 10A shows the results from Western blot. For saline-treated animals, there is a single green band representing mouse Dnaic1 protein. For test article-treated animals, the upper green band represents human DNAI1 protein, while the lower green band represents mouse Dnaic1 protein. All lanes were loaded with a total of 10 μg of lung homogenate. The loading control protein detected is vinculin (red band), demonstrating that similar amounts of protein were added per lane. The graph below summarizes the band intensity of human DNAI1 protein (DNAI1 relative fluorescence units (RFU)) as a function of time.
[0376] To determine the spatial distribution of DNAI1 protein expression throughout the lungs with weekly administration, right lungs were harvested for fixation in 10% NBF overnight, followed by storage in 70% ethanol until paraffin embedding. Fixed tissue was then sectioned and used for IHC to detect human DNAI1. The IHC protocol was optimized for human-specific DNAI1 detection with minimal background from mouse Dnaic1 signal. Figure 10B shows representative IHC results from either saline-treated or test article-treated animals. Overall, there was an increase in the number of DNAI1-positive airway epithelial cells from animals that had increased the number of intratracheal instillations. This increase in IHC staining is consistent with the increased DNAI1 signal observed from lung homogenates by Western blot.
[0377] Example 9. Functional evaluation of DNAI1 expression in disease models In addition to characterizing DNAI1 expression in mouse lungs, additional experiments were performed to determine whether increased ciliary activity was possible with repeated aerosol delivery. While CD1 mice were used to characterize MRT-DNAI1 expression, ciliary function in these mice did not impair CBF (data not shown), and correction may not be discernible. An inducible Dnaic1 knockout model (Dnaic1 FL / EX CreERT+ / -) shows a PCD phenotype in the upper airways, but does not show increased lung disease in the lower airways. However, after inducing a decrease in endogenous Dnaic1 with tamoxifen treatment, ciliary activity is no longer observed by microscopy. An in vitro air-liquid interface model derived from tracheal tissue demonstrated that lentiviral transduction of mouse Dnaic1 increases the percent of ciliary surface area. Here, this PCD disease model was to determine whether exogenous DNAI1 expression can increase ciliary activity in vivo. Knockout of Dnaic1 was induced with tamoxifen treatment via intraperitoneal injection at approximately 8 weeks of age. To allow for turnover of multiciliated cells, mice were maintained for another 8-10 weeks before using them in experiments. Based on expression data generated in CD1 mice, a repeated dosing regimen was created that would allow for accumulation of DNAI1-positive multiciliated populations. Animals were dosed utilizing MRT-DNAI1-LNP2 for 2 hours per exposure, three times per week for a total of 3 weeks. Untreated Dnaic1 knockout animals were used as controls to observe baseline CBF. Additionally, C57BL / 6 control mice were used as a wild-type positive control group since the Dnaic1 disease model has a C75Bl / 6 / 129 background. Animals were recorded 72 hours after the last exposure and the trachea was used to measure ciliary beating frequency using high-speed video microscopy imaged using a 40x water immersion objective by acquiring 5 seconds of video at 500 frames per second in an environmentally controlled chamber at 37° C. and 5% CO. Ciliary activity was calculated by creating a kymograph of ciliary beating frequency in ImageJ and is presented in FIG.
[0378] C57BL / 6 mice showed a frequency of approximately 15 Hz, which served as our control for normal ciliary activity. Untreated diseased animals had a significant reduction in ciliary beat frequency, likely due to a reduction in ciliated cells after tamoxifen treatment. Notably, exposure to MRT-DNAI1-LNP2 treatment resulted in an increase in ciliary activity that was significantly different from untreated mice. While CBF was still lower than in C57BL / 6 mice, these data demonstrate that treatment with exogenous DNAI1 mRNA after inhalation can improve ciliary activity.
[0379] Equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not limited to the foregoing description, but is instead set forth in the following claims.
Claims
1. A composition for use in the treatment of primary ciliary dyssynchrony (PCD), the composition comprising mRNA encoding dynein axoneme intermediate chain 1 (DNAI1) protein, the mRNA being administered at a therapeutically effective dose and interval such that the subject maintains expression of the DNAI1 protein in the respiratory epithelium at a level that is at least 10% of the wild-type level.
2. the airway epithelium is (i) Lung epithelium; (ii) basal cells, club cells, ciliated cells, goblet cells, tuft cells, pulmonary neuroendocrine cells (PNECs), pulmonary salt cells, fold cells, and caruncle cells; or (iii) Fimbriae Including, Optionally, the subject maintains expression of the DNAI1 protein in the respiratory epithelium at a level of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the wild-type level.
3. 3. The composition of claim 1 or 2, wherein the subject achieves an increase in ciliary beat frequency (CBF) compared to a control.
4. (i) the CBF is increased by at least 10% compared to the control; (ii) the CBF is increased by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to a control; (iii) the control is CBF in the subject prior to administration of the mRNA encoding the DNAI1 protein; (iv) said administration of said mRNA rescues said CBF in said subject to a normal CBF level, and optionally said normal CBF level is 6-9 Hz; (v) the CBF is measured by high-speed video microscopy (HSVM) or a high-speed digital video camera; and / or (vi) the CBF is measured at a temperature of 25°C, 32°C, or 37°C; The composition according to claim 1 or 2.
5. said administration of said mRNA results in a DNAI1-positive transfection efficiency of greater than 5% in ciliated cells; Optionally, the administration of the mRNA results in a DNAI1 positive transfection efficiency of greater than 7%, greater than 8%, greater than 10%, greater than 12%, greater than 15%, greater than 18%, greater than 20%, or greater than 25%.
6. The composition of claim 1 or 2, wherein the DNAI1 mRNA is encapsulated in a liposome.
7. The composition of claim 6 , wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.
8. (i) the one or more cationic lipids are selected from the group consisting of TL1-01D-DMA, TL1-10D-DMA, GL-TES-SA-DMP-E18-2, HEP-E4-E10, HEP-E3-E10, and TL1-04D-DMA, GL-TES-SA-DME-E18-2, Guan-SS-Chol, SY-3-E14-DMAPr, RL3-07D-DMA, cKK-E12, OF-02, ICE (imidazole-based ester), and combinations thereof; optionally, the cationic lipid is TL1-01D-DMA or SY-3-E14-DMAPr; (ii) the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1′-rac-glycerol)), or combinations thereof; and / or (iii) the one or more PEG-modified lipids comprise a poly(ethylene)glycol chain up to 5 kDa in length covalently attached to the lipid by an alkyl chain C6-C20 in length, optionally the one or more PEG-modified lipids are DMG-PEG2K; and / or (iv) the composition further comprises a suitable excipient; The composition of claim 7.
9. 3. The composition of claim 1 or 2, wherein the one or more cationic lipids comprise about 30-60% of the liposomes by molar ratio, optionally wherein the one or more cationic lipids comprise about 30%, 40%, 50%, or 60% of the liposomes by molar ratio.
10. (i) the liposome comprises no more than three distinct lipid components; or (ii) the liposome comprises four distinct lipid components; Optionally, the four distinct lipid components are a cationic lipid, a non-cationic lipid, cholesterol, and a PEG-modified lipid; Additionally, optionally, (a) the cationic lipid is selected from GL-TES-SA-DME-E18-2, TL1-01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, GL-TES-SA-DMP-E18-2, HEP-E4-E10, HEP-E3-E10, and TL1-04D-DMA; (b) the non-cationic lipid is DOPE or DEPE; and / or (c) the molar ratios of the cationic lipid, non-cationic lipid, cholesterol, and PEG-modified lipid are about 30-60:25-35:20-30:1-15, respectively; The composition according to claim 1 or 2.
11. 3. The composition of claim 1 or 2, wherein the liposomes have a diameter of about 80 nm to 200 nm, or wherein the liposomes are 150 nm or less in diameter, optionally wherein the liposomes have a diameter of about 100 nm or less.
12. the DNAI1 mRNA is codon-optimized; Optionally, the codon-optimized mRNA produces at least 10% more, 15% more, 20% more, 25% more, or at least 30% more DNAI1 protein compared to a non-codon-optimized mRNA sequence; 3. The composition of claim 1 or 2, further optionally, wherein the codon-optimized mRNA produces at least 30% more DNAI1 protein compared to a non-codon-optimized mRNA sequence.
13. (i) the DNAI1 mRNA comprises one or more modified nucleotides, optionally the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine; or (ii) the mRNA is unmodified; The composition according to claim 1 or 2.
14. (i) the mRNA comprises a 5' untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO: 2 or 3; (ii) the mRNA comprises a 3' untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO: 4 or 5; and / or (iii) The composition of claim 1 or 2, wherein the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 6 to 10, optionally wherein the mRNA comprises a coding sequence at least 80% or at least 90% identical to any one of SEQ ID NOs: 6 to 10, further optionally wherein the mRNA comprises a coding sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 6 to 10, or wherein the mRNA comprises a coding sequence set forth in SEQ ID NOs: 6 to 10.
15. (i) administering the mRNA to the subject is performed by pulmonary, intratracheal, intranasal, intravenous, intramuscular, or subcutaneous delivery, optionally administering the mRNA to the subject is performed by pulmonary delivery; and / or (ii) administering the mRNA to the subject is carried out by nebulization; The composition according to claim 1 or 2.
16. (A)(i) the mRNA is administered once daily, optionally for 3 consecutive days, 4 consecutive days, 5 consecutive days, 6 consecutive days, 7 consecutive days, 8 consecutive days, 9 consecutive days, or 10 consecutive days; (ii) the composition is administered once a week; (iii) the composition is administered once every two weeks; (iv) the composition is administered twice a month; or (v) the composition is administered once a month; and / or (B) the composition is administered at repeat intervals, optionally occurring every 3 days, every week, every 2 weeks, every 3 weeks, or every 4 weeks, and further optionally occurring every 4 weeks; The composition according to claim 1 or 2.
17. (i) said administration of said mRNA results in detectable DNAI1 protein expression in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis, and optionally said DNAI1 protein expression is detectable for at least 24 hours, 48 hours, 72 hours, 8 days, or 15 days; (ii) said administration of said mRNA results in detectable DNAI1 protein expression in said lung; (iii) said administration of said mRNA results in detectable DNAI1 protein expression in said lung epithelium; and / or (iv) the DNAI1 protein expression is detectable throughout the length of the pilus; The composition according to claim 1 or 2.
18. 3. The composition of claim 1 or 2, wherein the mRNA is administered at a dose ranging from 1 mg to 36 mg daily for 5 consecutive days.