Modified T cell receptors and uses thereof

Abstract

The present disclosure relates to modified T cell receptors and their use to enhance binding of TCRs to BTN3A1 or the BTN2A1 / BTN3A1 complex.

Description

[Technical field]

[0001] The present disclosure relates to modified T cell receptors and methods of use. [Background technology]

[0002] Most alpha-beta (αβ) T cells become activated after recognition of peptide fragments complexed with major histocompatibility complex molecules (pMHC), which are sensed in a one-receptor-one-ligand manner by somatically rearranged T cell receptors (αβTCRs). In contrast, gamma-delta (γδ) T cells are a distinct lineage of MHC-unrestricted T cells that express rearranged antigen (Ag) receptors derived from the TCRγ (TRG) and TCRδ (TRD) loci. These cells play important roles in the priming and effector phases of immunity against infectious diseases, as well as in tissue surveillance.

[0003] In humans, the majority of circulating γδ T cells express the semi-invariant Vγ9Vδ2+ (TRGV9-TRGV2) γδ TCR that confers reactivity to a distinct class of non-peptide Ags termed phosphoantigens (pAgs), metabolic intermediates in the biosynthesis of isoprenoids. There are two classes of pAgs: those derived from the non-mevalonate pathway, such as 4-hydroxy-3-methylbut-2-enyl pyrophosphate (HMBPP), found in bacteria and apicomplexan parasites, and those derived from the mevalonate pathway, such as isopentenyl pyrophosphate (IPP), found in vertebrates. Both exogenous and self-pAgs are stimulatory to different degrees for γδ T cells, promoting potent antimicrobial and antitumor immunity, respectively.

[0004] Butyrophilin (BTN) and butyrophilin-like (BTNL) molecules are a family of surface-expressed transmembrane proteins that are typically composed of extracellular immunoglobulin superfamily variable (IgV) and constant (IgC)-like domains, and intracellular B30.2 domains. In certain combination pairs, BTN and BTNL molecules support the activation of γδ T cell subsets. For example, BTNL3 and BTNL8 are expressed by the intestinal epithelium and cooperate to promote the activation of Vγ4+ γδ T cells. Similarly, in mice, Btnl1 and Btnl6 promote the activation of gut-resident Vγ7+74 γδ T cells, and Btnl family members Skint1 and Skint2 are important for the development and function of skin-resident Vγ5Vδ1+ dendritic epidermal T cells (DETCs).

[0005] In humans, BTN member 3A1 (BTN3A1) sequesters pAg via a positively charged pocket within its intracellular B30.2 domain, which is an essential step in the initiation of Vγ9Vδ2+ T cell activation. Together with BTN member 2A1 (BTN2A1), BTN2A1 and BTN3A1 mediate the response of γδ T cells to pAg. Thus, BTN molecules have emerged as key regulators of γδ T cell-mediated immunity, and do so as heteromeric pairs. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984) [Non-Patent Document 2] J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) [Non-Patent Document 3] In T. A. Brown (ed.), Essential Molecular Biology: A Practical Approach, volumes 1 and 2, IRL Press (1991). [Non-Patent Document 4] In DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, volumes 1-4, IRL Press (1995 and 1996) [Non-Patent Document 5] FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all current updates) [Non-Patent Document 6] Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988) [Non-Patent Document 7] JE Coligan et al. (eds.), Current Protocols in Immunology, John Wiley & Sons (including all updates to date) [Non-Patent Document 8] Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402 [Non-Patent Document 9] Altschul et al. (1990) J. Mol. Biol. 215:403-410 [Non-Patent Document 10] Smith et al. (1981) J. Mol. Biol. 147:195-197 [Non-Patent Document 11] Remington's Pharmaceutical Sciences (Mack Publishing Co. NJ USA, 1991) [Non-Patent Document 12] Remington's Pharmaceutical Science, 16th edition, Mack, Ed. 1980 [Non-Patent Document 13] MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, pp. 487-498 e486 (2020) [Non-Patent Document 14] A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, pp. 32780-32790 (2012) [Non-Patent Document 15] CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, pp. 813-825 e814 (2019) [Non-Patent Document 16] A. Vyborova et al., gamma9delta2T cell diversity and the receptor interface with tumor cells. 130, pp. 4637-4651 (2020) [Non-Patent Document 17] SV Kundapura, UA Ramagopal, The CC' loop of IgV domains of the immune checkpoint receptors, plays a key role in receptor:ligand affinity modulation. Sci Rep 9, p. 19191 (2019) [Non-Patent Document 18] M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020) [Non-Patent Document 19] C. Harly et al., Key implication of CD277 / butyrophilin-3 (BTN3A) in stress cellular sensing by a major human gammadelta T-cell subset. Blood 120, pp. 2269-2279 (2012) [Non-Patent Document 20] A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, pp. 490-500 (2014) [Non-Patent Document 21] D. Melandri et al., The gammadeltaTCR combines innate immunity with adaptive immunity by utilizing spatially distinct regions for agonist selection and antigen responsiveness. 19, pp. 1352–1365 (2018) [Non-Patent Document 22] S. Gu et al., Phosphoantigen-induced conformational change of butyrophilin 3A1 (BTN3A1) and its implication on Vgamma9Vdelta2 T cell activation. Proceedings of the National Academy of Sciences of the United States of America 114, pp. E7311-E7320 (2017) [Non-Patent Document 23] CE Cano et al., BTN2A1, an immune checkpoint targeting Vgamma9Vdelta2 T cell cytotoxicity against malignant cells. Cell Rep 36, p. 109359 (2021) [Non-Patent Document 24] HK Kim et al., Deep learning improves prediction of CRISPR-Cpf1 guide RNA activity. Nat Biotechnol 36, 239-241 (2018) [Non-Patent Document 25] AR Aricescu, W. Lu, EY Jones, A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr 62, pp. 1243-1250 (2006) [Non-Patent Document 26] TG Battye, L. Kontogiannis, O. Johnson, HR Powell, AG Leslie, iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 67, pp. 271-281 (2011) [Non-Patent Document 27] A. Eichinger, I. Neumaier, A. Skerra, The extracellular region of bovine milk butyrophilin exhibits closer structural similarity to human myelin oligodendrocyte glycoprotein than to immunological BTN family receptors. Biol Chem, (2021) [Non-Patent Document 28] TJ Allison, CC Winter, JJ Fournie, M. Bonneville, DN Garboczi, Structure of a human gammadelta T-cell antigen receptor. Nature 411, pp. 820-824 (2001) [Non-Patent Document 29] PD Adams et al., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, pp. 213-221 (2010) [Non-Patent Document 30] OS Smart et al., Exploiting structure similarity in refinement: automated NCS and target-structure restraints in BUSTER. Acta Crystallogr D Biol Crystallogr 68, pp. 368–380 (2012) [Non-Patent Document 31] MD Winn et al., Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, pp. 235-242 (2011) [Non-Patent Document 32] J. Jumper et al., Highly accurate protein structure prediction with AlphaFold. Nature 596, pp. 583-589 (2021) [Non-Patent Document 33] A. Punjani, JL Rubinstein, DJ Fleet, MA Brubaker, cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14, pp. 290-296 (2017) Summary of the Invention [Problem to be solved by the invention]

[0007] However, there remains a need to better understand the mechanisms governing pAg recognition in order to provide new immunotherapies and drugs capable of inducing γδ T cell responses, for example in cancer patients, or in patients with chronic infections, or in patients with autoimmune or inflammatory diseases. [Means for solving the problem]

[0008] The inventors surprisingly demonstrated that modifications at position 53 of the V52+ chain of the T cell receptor (TCR) result in enhanced binding of the TCR to BTN3 or the BTN2 / BTN3 complex.

[0009] Thus, the disclosure provides an engineered TCR or binding fragment thereof (e.g., a BTN3 binding fragment), the engineered TCR or binding fragment thereof comprising a V52+ chain, the V52+ chain comprising an alteration at a position corresponding to lysine (K) 53 of the amino acid sequence set forth in SEQ ID NO:1, the alteration enhancing binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex compared to binding of a TCR that does not comprise the alteration.

[0010] In one embodiment, the modification enhances one or more of cytolytic function, cytokine production of one or more cytokines, or proliferation of cells expressing the modified TCR or binding fragment thereof.

[0011] In some embodiments, the modification enhances binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex by at least about 1-fold, 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.1-fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 5.5-fold, at least about 6-fold, at least about 6.5-fold, at least about 7-fold, preferably at least about 2-fold, or more preferably at least about 3-fold, compared to binding of a TCR that does not contain the modification.

[0012] The modification may be an amino acid substitution, insertion, deletion, or truncation.

[0013] In one embodiment, the modification is lysine (K) to alanine (A), lysine (K) to arginine (R), lysine (K) to asparagine (N), lysine (K) to cysteine ​​(C), lysine (K) to glutamine (Q), lysine (K) to glycine (G), lysine (K) to histidine (H), lysine (K) to isoleucine (I), lysine (K) to leucine (L), lysine (K) to methionine (M), lysine (K) to ornithine, Lysine (K) to phenylalanine (F), lysine (K) to serine (S), lysine (K) to threonine (T), lysine (K) to tryptophan (W), lysine (K) to tyrosine (Y), or lysine (K) to valine (V), lysine (K) to proline (P), lysine (K) to α-aminobutyric acid (Abu), lysine (K) to norleucine (Nle), lysine (K) to norvaline (Nva), or an artificial amino acid substitution.

[0014] In another embodiment, the modification is lysine (K) to alanine (A), lysine (K) to glycine (G), lysine (K) to isoleucine (I), lysine (K) to leucine (L), lysine (K) to methionine (M), lysine (K) to phenylalanine (F), lysine (K) to proline (P), lysine (K) to tryptophan (W), or lysine (K) to valine (V), or an artificial amino acid substitution.

[0015] In another embodiment, the modification is a substitution of lysine (K) to alanine (A), lysine (K) to arginine (R), lysine (K) to asparagine (N), lysine (K) to cysteine ​​(C), lysine (K) to glutamine (Q), lysine (K) to glycine (G), lysine (K) to histidine (H), lysine (K) to isoleucine (I), lysine (K) to leucine (L), lysine (K) to methionine (M), lysine (K) to phenylalanine (F), lysine (K) to serine (S), lysine (K) to threonine (T), lysine (K) to tryptophan (W), lysine (K) to tyrosine (Y), or lysine (K) to valine (V), or lysine (K) to proline (P). Such modifications may enhance binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex by at least about 1-fold compared to binding of a TCR that does not contain the modification.

[0016] In one embodiment, the modification is a substitution of lysine (K) with alanine (A), lysine (K) with cysteine ​​(C), lysine (K) with methionine (M), lysine (K) with serine (S), lysine (K) with tryptophan (W), lysine (K) with valine (V), or lysine (K) with proline (P). Such modifications can enhance binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex by at least about 3-fold compared to binding of a TCR that does not contain the modification.

[0017] In one embodiment, the modification is a lysine (K) to alanine (A) substitution, a lysine (K) to serine (S) substitution, a lysine (K) to tryptophan (W) substitution, or a lysine (K) to proline (P) substitution.

[0018] In one or a further embodiment, the modification is not a substitution of lysine (K) with aspartic acid (D) or a substitution of lysine (K) with glutamic acid (E).

[0019] In some embodiments, the TCR may include one or more additional amino acid modifications compared to any of the known protein sequences. In some embodiments, the one or more amino acid modifications may be independently selected from substitutions, insertions, deletions, and truncations. In some embodiments, the amino acid mutations are amino acid substitutions, which may include conservative and / or non-conservative substitutions. For example, amino acid substitutions that desirably or advantageously alter the properties of the TCR chain or complex may be made. In one embodiment, modifications may be made that prevent degradation of the TCR chain or TCR.

[0020] In one embodiment, the V52+ chain of the modified TCR or binding fragment thereof comprises an amino acid sequence having at least 70% identity to SEQ ID NO:1.

[0021] In one or a further embodiment, the modified TCR or binding fragment thereof comprises a Vy9+ chain. For example, the Vy9+ chain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0022] In one embodiment, the modified TCR comprises a V52+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:5, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0023] In one embodiment, the modified TCR consists of a V52+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:5, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0024] In one embodiment, the modified TCR comprises a V52+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 5, or any one of 78 to 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 9.

[0025] In one embodiment, the modified TCR consists of a V52+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 5, or any one of 78 to 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 9.

[0026] In one embodiment, the modified TCR comprises a V52+ chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NOs: 5, 81, 87, 89, 91, 93 or 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 9.

[0027] In one embodiment, the modified TCR consists of a V52+ chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NO:5, 81, 87, 89, 91, 93 or 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0028] In one embodiment, the modified TCR consists of a V52+ chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NO:5, 89, 91 or 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0029] In one embodiment, the modified TCR consists of a V52+ chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NO:5, 89, 91 or 94, and / or a Vy9+ chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:9.

[0030] In one or a further embodiment, the modified TCR or binding fragment thereof further comprises a TCR delta constant domain and / or a TCR gamma constant domain.

[0031] In one embodiment, the modified TCR comprises a TCR delta chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:8, and / or a TCR gamma chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:11.

[0032] In one embodiment, the modified TCR comprises a TCR delta chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 8, or any one of 95 to 110, and / or a TCR gamma chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 11.

[0033] In one embodiment, the modified TCR comprises a TCR delta chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NOs: 8, 97, 103, 105, 107, 109, 110, and / or a TCR gamma chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 11.

[0034] In one embodiment, the modified TCR comprises a TCR delta chain comprising an amino acid sequence having at least 70% identity to any one of SEQ ID NOs: 8, 105, 107, 110, and / or a TCR gamma chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 11.

[0035] In one embodiment, the modified TCR is a naturally occurring TCR, a TCR variant, a TCR fragment, or a TCR construct.

[0036] In one embodiment, the modified TCR comprises a V52+ chain and a Vy9+ chain covalently linked to each other, hi another embodiment, the modified TCR comprises a V52+ chain and a Vy9+ chain non-covalently linked to each other.

[0037] In one or a further embodiment, the TCR is a TCR heterodimer or multimer.

[0038] In one embodiment, the TCR is capable of binding to a phosphoantigen. In one embodiment, the phosphoantigen binds to the cytoplasmic domain of the BTN2A1 and / or BTN3A1 molecule. Alternatively or additionally, the phosphoantigen can bind to the ectodomain of BTN3A1. In another embodiment, the TCR is capable of binding to BTN3A1 or the BTN2A1 / BTN3A1 complex independent of the phosphoantigen.

[0039] In one embodiment, the modified TCR or binding fragment thereof further comprises one or more fusion components optionally selected from an Fc receptor; an Fc domain, including IgA, IgD, IgG, IgE and IgM; a cytokine, including IL-2 or IL-15; a toxin; an anti-CD3, anti-CD28, anti-CD5, anti-CD16 or anti-CD56 antibody or antigen-binding fragment thereof; CD247 (CD3-zeta), CD28, CD137, and CD134 domains, or combinations thereof, and optionally further comprises at least one linker.

[0040] In one embodiment, the TCR is conjugated to an antigen binding domain, e.g., an scFv, optionally via a linker. In one embodiment, the antigen is selected from CD3, CD28, CD5, CD16, CD19, CD33, CD56, GD2, and EGFR. In another embodiment, the antigen is selected from BTN2 and BTN3.

[0041] In one embodiment, the modified TCR or binding fragment is soluble.

[0042] In one embodiment, the modified TCR or binding fragment thereof is conjugated, optionally via a linker, to the transmembrane and intracellular signaling domains of a chimeric antigen receptor (CAR).

[0043] In one embodiment, the transmembrane domain is derived from CD3-zeta, CD4, CD8, or CD28.

[0044] In one or a further embodiment, the intracellular signaling domain comprises the CD3 zeta chain of a TCR and, optionally, one or more costimulatory molecules.

[0045] In one embodiment, the one or more costimulatory molecules are selected from DAP10, CD28, CD27, 4-1BB, OX40, CD30, IL2-R, IL7-R, IL21-R, NKp30, NKp44, and DNAM-1 (CD226).

[0046] In one or a further embodiment, the transmembrane domain is linked to the intracellular domain via a spacer region.

[0047] In one embodiment, the spacer region is derived from an immunoglobulin domain of an Fc receptor, CD8α, CD28, a TCR β chain, or the extracellular domain of NKG2D.

[0048] In one or a further embodiment, the modified TCR or binding fragment thereof further comprises at least one label.

[0049] The present disclosure also provides one or more nucleic acids encoding the modified TCRs or binding fragments thereof of the present disclosure.

[0050] In one embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 12 to 17, and / or ii) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 18 to 20. Includes.

[0051] In one embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 16, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 18 Includes.

[0052] In one or a further embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 17, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 20 Includes.

[0053] In one embodiment, the one or more nucleic acids are iii) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 12 to 17, 111 to 142, and / or iv) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 18 to 20. Includes.

[0054] In one embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 16, or 111 to 126, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 18 Includes.

[0055] In one or a further embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 17, or 127 to 142, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 20 Includes.

[0056] In one embodiment, the one or more nucleic acids are iii) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 16, 113, 119, 121, 123, 125, or 126; and / or iv) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 18 Includes.

[0057] In one or a further embodiment, the one or more nucleic acids are iii) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 17, 129, 135, 137, 139, 141, or 142; and / or iv) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 20 Includes.

[0058] In one embodiment, the one or more nucleic acids are v) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 16, 121, 123, or 126; and / or vi) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 18 Includes.

[0059] In one or a further embodiment, the one or more nucleic acids are v) a nucleic acid sequence having at least 70% identity to any one of SEQ ID NOs: 17, 137, 139, or 142; and / or vi) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 20 Includes.

[0060] The present disclosure also provides one or more vectors comprising one or more nucleic acids encoding the modified TCRs or binding fragments thereof of the present disclosure.

[0061] The present disclosure also provides a cell comprising a modified TCR or binding fragment thereof of the present disclosure, one or more nucleic acids of the present disclosure, or one or more vectors of the present disclosure.

[0062] In one embodiment, the cell is a lymphocyte.

[0063] In one embodiment, the lymphocytes are selected from cytotoxic T lymphocytes (CTLs), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, innate lymphoid cells (ILCs), natural killer T (NKT) cells, regulatory T cells, mucosal-associated invariant T (MAIT) cells, αβ T cells, and γδ T cells.

[0064] In one embodiment, the cell further comprises a chimeric antigen receptor (CAR), where the CAR comprises (i) an antigen binding domain, (ii) a transmembrane domain, and (iii) an intracellular signaling domain, where the intracellular signaling domain provides a stimulatory signal to the T cell upon binding of an antigen to the antigen binding domain.

[0065] In one embodiment, the antigen binding domain is capable of binding to a tumor-associated antigen (TAA), e.g., complexed with an MHC molecule or expressed independently on the cell surface.

[0066] In one embodiment, the antigen binding domain is capable of binding to CD3, CD28, CD5, CD16, CD19, CD33, CD56, GD2, or EGFR, hi another embodiment, the antigen binding domain is capable of binding to BTN2 or BTN3.

[0067] The present disclosure also provides a method for obtaining the modified TCR or binding fragment of the present disclosure, comprising: (i) incubating a cell of the present disclosure under conditions that cause expression of said modified TCR; and (ii) purifying the TCR Also provided is a method comprising:

[0068] The present disclosure also provides (i) a modified TCR or binding fragment thereof of the present disclosure; (ii) one or more nucleic acids of the disclosure; (iii) one or more vectors of the present disclosure, and (iv) a cell of the present disclosure, and (v) optionally, one or more pharma- ceutically acceptable excipients; Also provided are compositions comprising one or more of:

[0069] The present disclosure also provides a method for modifying a cell, comprising: (i) providing a cell; and (ii) introducing one or more nucleic acids of the disclosure, or one or more vectors of the disclosure, into the cell; and (iii) optionally culturing the cells; Includes.

[0070] The present disclosure also provides cells obtainable by the methods.

[0071] The present disclosure also provides the use of a modified TCR or a binding fragment thereof, such as a soluble TCR, one or more nucleic acids of the present disclosure, one or more vectors of the present disclosure, a cell of the present disclosure, or a composition of the present disclosure, as a medicament.

[0072] The present disclosure also provides the use of a modified TCR or binding fragment thereof, such as a soluble TCR, one or more nucleic acids of the present disclosure, one or more vectors of the present disclosure, a cell of the present disclosure, or a composition of the present disclosure, as a medicament for use in the detection, diagnosis, prognosis, prevention and / or treatment of cancer or an infectious disease.

[0073] The present disclosure also provides a method of preventing, treating, delaying the progression of, preventing the recurrence of, or alleviating a symptom of cancer or an infectious disease, comprising administering to a subject in need thereof a modified TCR or binding fragment thereof, such as a soluble TCR, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, a cell of this disclosure, or a composition of this disclosure.

[0074] The present disclosure also provides a method for detecting the presence of cancer or an infectious disease in a subject, comprising: (i) providing a sample from a subject; and (ii) contacting the sample with a modified TCR or binding fragment of this disclosure, such as a soluble TCR, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, or a cell of this disclosure, or a composition of this disclosure to form a complex; and (iii) detecting the complex, wherein detection of the complex indicates the presence of cancer or an infectious disease in the subject. Also provided is a method comprising:

[0075] The present disclosure also provides an in vitro method for detecting the presence of cancer or an infectious disease in a subject, comprising: (i) providing a sample from a subject; and (ii) contacting the sample with a modified TCR or binding fragment of this disclosure, such as a soluble TCR, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, or a cell of this disclosure, or a composition of this disclosure to form a complex; and (iii) detecting the complex, wherein detection of the complex indicates the presence of cancer or an infectious disease in the subject. Also provided is a method comprising:

[0076] The present disclosure also provides for the use of one or more nucleic acids of the present disclosure, or one or more vectors of the present disclosure, to generate modified lymphocytes.

[0077] The present disclosure also provides the use of a modified TCR of the present disclosure or a binding fragment thereof (e.g., a soluble TCR antagonist), one or more nucleic acids of the present disclosure, one or more vectors of the present disclosure, cells (e.g., a regulatory T cell engineered to express a modified TCR of the present disclosure), or a composition of the present disclosure for use in the prevention and / or treatment of an autoimmune disease, an inflammatory disorder, transplant rejection, graft-versus-host disease, or graft-versus-tumor effect.

[0078] The present disclosure also provides a method of preventing, treating, delaying the progression of, preventing the recurrence of, or alleviating a symptom of an autoimmune disease, transplant rejection, graft-versus-host disease, or graft-versus-tumor effect, comprising administering to a subject in need thereof a modified TCR or binding fragment thereof (e.g., a soluble TCR antagonist) of the present disclosure, one or more nucleic acids of the present disclosure, one or more vectors of the present disclosure, cells (e.g., a regulatory T cell engineered to express a modified TCR of the present disclosure), or a composition of the present disclosure. [Brief description of the drawings]

[0079] [Figure 1] (A) Size-exclusion (S200 16 / 600) gel filtration chromatography of BTN2A1 (black) and BTN3A1 (grey) ectodomains produced in MGAT1-deficient Expi293F cells. Higher elution volumes indicate smaller protein size. (B) Overlay of the BTN2A1 V-dimer from the apo structure with the BTN3A1 V-dimer structure (PDB code 4F80). (C) Surface representation of BTN2A1 with the head-to-tail dimer interface depicted in light grey and the V-dimer interface depicted in dark grey. Glycans depicted as sticks. (D) Overlay of the BTN2A1 head-to-tail dimer from the apo BTN2A1 and γδTCR-BTN2A1 (unliganded copy of BTN2A1) crystal structures. (E) Overlay of the BTN2A1 V-dimer structures from the apo and γδTCR-BTN2A1 ligand-bound (green) crystal structures. (F) Schematic of BTN2A1 depicting the CFG face of the IgV domain and the ABED face of the IgV domain. (G) Surface representation of BTN2A1 and G115 Vy9V52 TCR depicting the interface from the γδTCR-BTN2A1 complex. (H) Schematic overlay of apo and ligand-bound BTN2A1 depicting the conformational changes to residues involved in binding to Vy9V52+ TCR (shown as sticks). [Diagram 2]TN2A1 engages the flank of Vγ9. (A) Surface and schematic representation of the apo-BTN2A1 crystal structure. (B) BTN2A1 V-dimer (left) and cis (middle) or trans (right) interpretation of the head-to-tail homodimer. (C) Surface and schematic representation of the BTN2A1-Vγ9Vδ2+ TCR clone G115 crystal structure: G115 TCRδ, G115 TCRγ, liganded BTN2A1, and unliganded BTN2A1. (D) Comparison with a representative pHLA class I-αβ TCR (left, PDB code 1QSE (35)) and CD1d-α-GalCer clone 9C2 Vγ5Vδ1+ TCR (right, PDB code 4LHU (36)). Molecular contacts between Vγ9Vδ+ clone G115 TCR and the BTN2A1 ectodomain, showing (E) Arg20γ, (F) Glu70γ and His85γ, (G) Lys13γ and Lys17γ, (H) Ser16γ and Thr18γ side chains and / or main chains and their BTN2A1 contacts as sticks. H-bonds and salt bridges, grey is VDW and cation-π, black is 2mFo-DFc electron density map contoured at 1σ. [Figure 3A] BTN2A1 tetramer, BTN3A1 tetramer, control mouse CD1d tetramer, or SAv-PE staining of human HEK293T cells transfected with plasmids co-encoding GFP and either G115 Vγ9Vδ2+ or control 9C2 Vγ5Vδ1+ γδ TCR. Plots gated on GFP+ cells. Data from 1 of 10 independent experiments. Inset - Median Fluorescence Intensity (MFI) of PE parameters. [Figure 3B] γδTCR tetramer or SAv control staining of HEK293T BTN2A.BTN3AKO cells transfected with plasmids co-encoding GFP and either BTN2A1, BTN3A1 or control BTNL3, pre-incubated with anti-BTN3A mAb 20.1 or isotype control (mouse IgG1,κ) antibody. Plots gated on GFP+ cells. Inset - MFI of PE parameters of mAb 20.1-treated cells within a representative GFP+ gate. Representative of one of two independent experiments. [Figure 3C-3D]MFI of gated chimeric γδ TCR tetramer staining of (C) GFP+ BTN2A1-transfected or (D) GFP+ BTN3A1-transfected NIH-3T3 cells. Inset plot shows gating of parental cells. Graphs are shown as mean ± SEM. N > 3, each point represents an independent experiment. [Fig. 3E-3F] MFI of G115 γδTCR tetramer staining of NIH-3T3 cells transfected with (E) GFP+ BTN2A1 or (F) GFP+ BTN3A1. Graphs show mean ± SEM. N > 3, each point represents an independent experiment. [Figure 3G] GFP+ BTN2A1-transfected or GFP+ BTN3A1-transfected NIH-3T3 cells were stained with streptavidin (SAv)-PE control, Vγ9Vδ2+ 'G115 WT', 'G115 Lys53δ-Ala', 'TCR 6 WT' or 'TCR 6 Lys53δ-Ala' TCR tetramers. One representative of two independent experiments. [Figure 3H] NIH-3T3 cells transfected with GFP+ BTN2A1 or transfected with GFP+ BTN3A1 were stained with isotype control (MOPC21)-AF647 or anti-BTN3A(20.1)-AF647 antibodies followed by control SAv-PE, Vγ9Vδ2 'G115 WT' or 'G115 Lys53δ-Ala' TCR tetramer-PE staining. Cells were examined for FRET by flow cytometry in the YG 670 / 30 channel. [Figure 4]BTN3A1 supports binding of Vy9V52+ γδ TCR to the apical surface. (A) Vy9V52+ TCR tetramer-PE (clones TCR3, TCR6, TCR7 and G115) or streptavidin (SAv.) control staining of murine NIH-3T3 cells transfected with BTN2A1, BTN3A1 or no DNA after pre-incubation with anti-BTN3A mAb clones 20.1 (grey) or 103.2 (dark grey) or isotype control (IgG1, κ, black). (B) Staining of NIH-3T3 cells transfected with BTN2A1, BTN3A1 or control BTNL3 with chimeric γδ TCR tetramers composed of TCR6, TCR7 or G115 pAg-reactive γ chain plus pAg-reactive Vδ2+ or 9C2 Vδ1+ δ chain ± anti-BTN3A mAb 20.1 (grey) or isotype control (IgG1,κ, black). Median fluorescence intensity (MFI) of PE for cells treated with mAb 20.1 (grey numbers) or BTN3A1+ cells treated with isotype control (IgG1,κ) (black numbers) is shown within the delineated GFP+ gate. (C) Wild-type or mutant G115 Vγ9Vδ2+ TCR tetramer staining of NIH-3T3 cells transfected as in (B) ± anti-BTN3A mAb clone 20.1 (grey) or isotype control (IgG1,κ, black), or control mouse CD1d-α-GalCer (mCD1d tet.) or streptavidin alone (SAv) staining. The triple γ mutant contains Arg20γ-Ala / Glu70γ-Ala / His85γ-Ala mutations. Schematic inset shows the location of the BTN2A1-epitope (dark grey star) and ligand-2 epitope (light grey star). Representative of one of three independent experiments. MFI of PE for cells treated with mAb 20.1 (red numbers) or BTN3A1+ cells treated with isotype control (IgG1, κ) (black numbers) shown within the delineated GFP+ gate. [Diagram 5](A) and (B) CD69-PE expression on G115 WT or mutant Vy9V52+, 9C2 Vy5V51+ γδTCR or parental (TCR-) J.RT3-T3.5 Jurkat cells after overnight co-culture with LM-MEL-75 APCs in the presence or absence of 40 μM zoledronate. Graphs are shown as mean ± SEM. N=2, each point represents an independent experiment. (C) Surface display of G115 Vy9V52+ TCR depicting interacting residues and gatekeeper or non-involved residues based on Jurkat activation assay. [Figure 6A] Representation of the BTN2A1 BTN3A1 zipper complex. [Figure 6B-6C] (B-C) (LHS) BTN2A1 BTN3A1 complex was expressed in Expi293F cells and purified by (B) affinity (NiNTA) and (C) size exclusion (S200) chromatography. (RHS) Box-purified proteins were run on SDS-PAGE to confirm identity. MM - molecular weight marker; 2A1-BTN2A1-acidic zipper (AZ)-His6; 3A1-BTN3A1-basic zipper (BZ)-biotin ligase tag. [Figure 6D] Reactivity by ELISA of anti-BTN2A1 (clone 259), anti-BTN3A (clone 103.2), mouse IgG2a isotype control (clone BM4-2a), or mouse IgG1 isotype control (clone MOPC-21) to immobilized BTN1A1, BTN2A1, BTN3A1, or BTN2A1-BTN3A1-zipper ectodomain. [Figure 6E] The BTN2A1-BTN3A1-zipper complex was crystallized, redissolved and run on SDS-PAGE with crystal wash buffer and input BTN2A1-BTN3A1-zipper complex. MM - molecular weight marker; 2A1-BTN2A1-AZ-His6; 3A1-BTN3A1-BZ - biotin ligase tag. [Figure 6F]BTN2A1-, BTN3A1-, BTN2A1-BTN3A1 complexes or control mouse CD1d ectodomain tetramers, or control streptavidin-PE (SAv) staining of HEK293T cells co-transfected with G115 Vy9V52+ TCR wild-type, His85γ-Ala, Glu52δ-Ala, Lys53δ-Ala or control 9C2 Vy5V51+ TCR on CD3. N≧5 independent experiments. *P<0.05, **P<0.01; binding of BTN2A1-BTN3A1 complexes to Vy9V52+ TCR was determined by Kruskal-Wallis test with the two-step step-up multiple correction method of Benjamini, Krieger and Yekutieli. [Figure 7] BTN3A1 is a ligand for the γδ TCR. (A) Anti-CD3 staining of HEK293T cells co-transfected with BTN2A1-, BTN3A1-, BTN2A1-BTN3A1 complex or control mouse CD1d ectodomain tetramer, or streptavidin alone (SAv) versus G115 Vγ9Vδ2+ TCR wild type, His85γ-Ala, Glu52δ-Ala, Lys53δ-Ala or control 9C2 Vγ5Vδ1+ TCR on CD3. Schematic insets show the relative positions of the BTN2A1 epitope mutants or Ligand-2 epitope mutants. Representative of one of three independent experiments. Inset - median fluorescence for PE parameters. (B) Sensorgrams (left) and saturation plots (right) showing binding of soluble G115 Vγ9Vδ2+ TCR wild type (302-4.2 μM), His85γ-Ala (410-1.6 μM), Glu52δ-Ala (370-5.8 μM), and Lys53δ-Ala (295-4.6 μM) to immobilized BTN2A1 ectodomain homodimer, BTN2A1 ectodomain homodimer, and BTN2A1-BTN3A1 ectodomain complexes as measured by surface plasmon resonance. KDs, dissociation constants calculated at equilibrium ± SEM, derived from the mean of n=2 (WT and His85γ) or n=3 (Glu52δ and Lys53δ) independent experiments. [Figure 8]BTN2A1 and BTN3A1 directly associate to form heteromers. (A) Sensorgrams (left) and saturation plots (right) showing binding of soluble monomeric BTN2A1 ectodomain (top row, 890-28 μM), homodimeric BTN3A1 ectodomain (middle row, 1,520-24 μM), or monomeric BTN3A1 IgV domain (bottom row, 1,590-25 μM) to immobilized BTN2A1 ectodomain homodimers (red) or BTN3A1 ectodomain homodimers (blue) as measured by surface plasmon resonance. Inset graphs show Scatchard plots. KD, dissociation constants calculated at equilibrium ± SEM, derived from the mean of n=2 independent experiments and shown as dotted and broken lines on the saturation plots, respectively. (B) Crystal structure of the BTN2A1-BTN3A1 ectodomain complex, showing the asymmetric unit as a surface and the V dimer as a schematic. (C) Surface and schematic representation of the BTN2A1 V dimer-BTN3A1 V dimer repeat unit within the crystal structure. (D) Molecular contacts between BTN2A1 and the BTN3A1 ectodomain, showing as sticks the BTN2A1 Arg56 and Glu35, (E) Phe43 and Glu107, (F) Phe43 N atom and Ser44, (G) Glu35, Lys51 and Gln100 side chains, and / or the main chain and their BTN3A1 contacts. H-bonds and salt bridges, grey is cation-π, black. (H) Association between BTN2A1 and BTN3A1 ectodomains on the cell surface of mouse NIH-3T3 fibroblasts co-expressing wild-type BTN2A1 and individual BTN3A1 mutants as determined by the mean percentage of FRET+ cells ± SEM between anti-BTN2A1-AF647 (clone 259) and anti-BTN3A-PE (clone 103.2). Controls (right) show FRET between CD80 and PD-L1 or between BTN2A1 and PD-L1. n=6 except for controls where n=3, each point represents an individual experiment. NA, not applicable as BTN3A surface expression was too low to measure FRET. [Figure 9](A) Comparison of the apo BTN3A1 homodimer (PDB code 4F80) with the BTN3A1 homodimer from the BTN2A1-BTN3A1-zipper complex, and comparison of the apo BTN2A1 homodimer with the BTN2A1 homodimer from the BTN2A1-BTN3A1-zipper complex. (B) Surface representation of BTN2A1 and BTN3A1 showing the regions that contact each other. [Figure 10] Summary of the effect of single residue mutations within the (A) IgV or (B) IgC domains of BTN3A1 on anti-BTN3A reactivity (mAb clones 103.2 and 20.1) and cis-binding to BTN2A1 and G115 γδ TCR tetramer as measured by FRET. (C) Förster resonance energy transfer (FRET) between anti-BTN2A1 (clone 259) and anti-BTN3A (clone 103.2) mAb staining on gated BTN2A1+BTN3A1+NIH-3T3 cells 48 hours after co-transfection of WT BTN2A1 plus the indicated BTN3A1 mutants, or BTN2A1 plus PD-L2 or BTN3A1 plus CD80 as irrelevant controls. Mutants in dark grey were excluded from the analysis due to reduced BTN3A1 staining. Mutants in light grey are mutants with reduced FRET levels. (D) Surface representation of the BTN3A1 V dimer showing residue side chains whose mutations abrogated BTN3A1 association with BTN2A1 (gray) or did not affect its interaction with BTN2A1 (black) as determined by FRET assays (left). The BTN3A1 surface on the right shows atoms in contact with BTN2A1 based on the crystal structure. [Figure 11](A) G115 tetramer-PE staining of NIH-3T3 cells transfected with BTN3A1 WT or mutants after preincubation with anti-BTN3A-AF647 (mAb clone 20.1). Grey mutants were excluded from analysis due to reduced BTN3A1 mAb 20.1 staining. Light grey mutants are mutants with impaired G115 tetramer staining. Representative of 1 of 3 independent experiments. (B) CD25-PE expression in purified pre-expanded Vδ2+ γδ T cells after 24 h coculture with NIH-3T3 cells co-transfected with BTN2A1 plus the indicated BTN3A1 mutants or alternatively control BTNL3 plus BTNL8 ± zoledronate (5 μM). Data are from 1 of 3 independent experiments, each from 2 donors. (C) The surface of the BTN2A1 V dimer, with residues in contact with BTN3A1 based on the BTN2A1-BTN3A1 crystal structure, with residues in contact with the Vγ9Vδ2+ TCR based on the G115 TCR-BTN2A1 crystal structure, and with overlapping residues in contact with both, shown in red. [Figure 12]BTN3A1 IgV domains interact with Vγ9Vδ2+ TCR. (A) G115 Vγ9Vδ2+ TCR tetramer-PE staining of mouse NIH-3T3 fibroblasts transfected with either wild-type BTN3A1 or the indicated mutants after pretreatment with anti-BTN3A1-AF647 (clone 20.1) antibody. SAv, streptavidin-PE control staining of wild-type BTN3A1+ cells. Bar graphs show median fluorescence intensity (MFI) ± SEM. Dotted lines represent 90-98% and >98% reduction in MFI. Inset: Surface display of BTN3A1 V-dimers with mutations to residues that resulted in abrogation of anti-BTN3A antibody (20.1)-dependent G115 tetramer interaction colored dark gray (>98% reduction), light gray (90-98% reduction), or gray (<90% reduction). n=3, each point represents an independent experiment. NA, not applicable as surface expression of BTN3A was too low to measure G115 tetramer staining. (B) Changes in CD25 expression in purified in vitro expanded Vδ2+ γδ T cells co-cultured for 24 h with 5 μM zoledronate and mouse NIH-3T3 fibroblast APCs transfected with wild-type BTN2A1 and individual BTN3A1 mutants (normalized to unstimulated control for each sample). Bars show mean ± SEM. Dotted lines indicate >50% reduction in activation compared to BTN2A1-BTN3A1 WT. NA=not applicable as BTN3A1 concentration was too low to induce zoledronate-dependent γδ T cell activation. Data are from 2-3 independent experiments with n=1-2 different donors, respectively. **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA with Sidak's multiple comparison correction. Inset: Surface representation of BTN3A1 V dimer with mutations to residues in grey that conferred abrogation of zoledronate-dependent Vδ2+ γδ T cell activation or in dark grey that had no effect on Vδ2+ γδ T cell activation. [Figure 13]BTN2A1 and BTN3A1 must be displaced in order to bind Vγ9Vδ2+ TCR. (A) Anti-CD3 staining of HEK293T cells co-transfected with BTN2A1 tetramer, BTN2A1-BTN3A1 WT complex tetramer, BTN2A1-BTN3A1 Glu135-Ala complex tetramer, or control streptavidin alone (SAv) versus CD3 plus G115 Vγ9Vδ2+ TCR wild type, Glu52δ-Ala, or control 9C2 Vγ5Vδ1+ TCR. Inset - Median fluorescence intensity (MFI) for PE parameters. Representative of 1 of 6 independent experiments. (B) Sensorgrams (top) and saturation plots (bottom) showing binding of soluble G115 Vγ9Vδ2+ TCR wild-type (181-2.8 μM), Glu52δ-Ala (243-3.8 μM), and Lys53δ-Ala (139-2.2 μM) to immobilized BTN2A1-BTN3A1 wild-type complex (left), BTN2A1-BTN3A1 Glu135-Ala complex (middle), or BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys complex (right). KD, dissociation constant calculated at equilibrium ± SEM, derived from the mean of two independent experiments. (C) G115 Vy9V52+ TCR tetramer-PE or control streptavidin-PE (SAv) staining of mouse NIH-3T3 fibroblasts co-transfected with the indicated combinations of BTN2A1 and BTN3A1 wild type or cysteine ​​mutants. Representative of one of two independent experiments. (D) G115 Vy9V52+ TCR tetramer-PE or control streptavidin-PE (SAv) staining of mouse NIH-3T3 fibroblasts co-transfected with the indicated BTN2A1 and BTN3A1 cysteine ​​mutant pairs or control BTNL3 plus BTNL8 after pre-treatment of cells with graded concentrations of dithiothreitol (DTT). Inset - MFI of PE parameters. Representative of one of four independent experiments. [Figure 14](A) Structure of BTN2A1-BTN3A1 showing the positions of the two cysteine ​​mutant pairs. (B) G115 tetramer-PE staining of NIH-3T3 fibroblasts co-transfected with either WT or Cys mutant BTN2A1 plus BTN3A1 or control BTNL3 plus BTNL8 after preincubating cells with the indicated concentrations of DTT. Graphs are shown as mean ± SEM. Data pooled from 3-4 separate experiments. (C) Predicted structure of the BTN2A1-BTN3A1 complex containing a disulfide bond between the BTN2A1 and BTN3A1 molecules based on the crystal structure of the BTN2A1-BTN3A1 ectodomain complex. (D) 2D class average of the staining-negative soluble BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys ectodomain complex. (E) HEK293T cells transfected with either G115 Vy9V52+ or control 9C2 Vy5V51+γδ TCR were stained with BTN2A1 tetramers, BTN2A1-BTN3A1 complex tetramers, BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys complex tetramers, or control tetramers (mouse CD1d) or SAv.-PE alone. Where indicated, BTN molecules were pretreated with 5 mM DTT before tetramerization with SAv-PE. One representative of one or four independent experiments. (F) SDS-PAGE of BTN monomers treated with DTT as in (E). [Figure 15] Proposed model of Vγ9Vδ2+ TCR interacting with the latent BTN2A1-BTN3A1 complex on APCs following anti-BTN3A mAb 20.1 antibody treatment. Created with BioRender.com. [Figure 16](A) Surface BTN2A1 expression on HEK293T BTN2AKO.BTN3AKO cells transfected with BTN2A1 WT or the indicated BTN2A1 intracellular domain mutants, or control BTNL3 (clone 259). Representative from one of two experiments. (B) Representative plot and (C) Mean ± SEM of CD25-PE expression on purified pre-expanded Vδ2+ γδ T cells after 24 h co-culture with HEK293T BTN2AKO.BTN3AKO cells co-transfected with BTN3A1 plus the indicated BTN2A1 mutants, or alternatively with control BTNL3 alone or BTN3A1 alone, ± zoledronate (5 μM). Replicates with low transfection efficiency (<10% GFP+) were excluded from analysis. Data are from three independent experiments with n=2 different donors each. **p<0.01 by two-way ANOVA with Sidak's multiple comparison correction. Inset, molecular model of the BTN2A1 B30.2 intracellular domain generated by AlphaFold v2, with functionally important residues in red. [Figure 17] Introduction of the Lys53δ-Ala TCR mutation into primary γδ T cells enhances reactivity to the BTN2A1-BTN3A1 complex. (A) BTN2A1-BTN3A1-zipper complex, (B) BTN2A1-BTN3A1 Glu106-Ala zipper complex, and (C) BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys tetramer-PE staining versus anti-CD3 of purified primary Vδ2+ cells from a healthy donor. [Figure 18] Lys53δ-Ala TCR+ primary γδ T cells show enhanced killing of K562 tumor targets. Graphs show the percentage of non-viable gated CTV+ BTN2AKO.BTN3AKO K562 cells (left graph) or WT K562 cells (right graph) after co-culture with purified pre-expanded Vd2+ γδ T effector cells (WT; Lys53-Ala modified using gRNA#1; Lys53-Ala modified using gRNA#2) or alone under the indicated conditions. [Figure 19]Crystal structure of G115 Lys53δ-Ala TCR. 2.1 Å crystal structure of G115 Lys53δ-Ala TCR versus G115 WT TCR. 2Fo-Fc electron density of Lys53δ-Ala TCR and G115 WT TCR drawn at 1σ. [Figure 20] Mutation of Lys53δ enhances binding to the BTN2A1-BTN3A1 complex. (A) Representative dot plots and (B) summary graphs of BTN2A1-BTN3A1 heteromeric tetramer mean fluorescence tetramer (MFI) binding to BTN2A.BTN3AKO HEK293T cells transfected with Vγ9Vδ2 TCR Lys53 [denoted as "WT (reference)] or its mutants. MFI of BTN2A1-BTN3A1 heteromeric tetramers is calculated relative to gated GFP+CD3+ cells, excluding the gated "untransfected" control group on viable HEK293T cells. Data represent the mean + / - SEM of n=3-4 experiments, each shown as an individual data point in (B).

[0080] Description of sequence listing SEQ ID NO:1 is the amino acid sequence of the native variable region of δ2 (TRDV2*03). SEQ ID NO:2 is the amino acid sequence of the native variable region of δ2 (TRDV2*01). SEQ ID NO:3 is the amino acid sequence of the native variable region of δ2 (TRDV2*02). SEQ ID NO:4 is the amino acid sequence of native 62 (TRD2*03). SEQ ID NO:5 is the amino acid sequence of the Lys53-Ala mutant variable region of δ2 (TRDV2*03 Lys53-Ala, clone G115). SEQ ID NO:6 is the amino acid sequence of the Lys53-Ala mutant variable region of δ2 (TRDV2*01 Lys53-Ala). SEQ ID NO: 7 is the amino acid sequence of the Lys53-Ala mutant variable region of δ2 (TRDV2*02 Lys53-Ala). SEQ ID NO:8 is the amino acid sequence of Lys53-Ala mutant δ2 (TRD2*03 Lys53-Ala, clone G115). SEQ ID NO:9 is the amino acid sequence of the variable region of γ9 (TRGV9*01, clone G115). SEQ ID NO: 10 is the amino acid sequence of the variable region of γ9 (TRGV9*02). SEQ ID NO:11 is the amino acid sequence of γ9 (TRG9*01, clone G115). SEQ ID NO: 12 is a nucleic acid sequence encoding the variable region of δ2 (TRDV2*03). SEQ ID NO: 13 is a nucleic acid sequence encoding the variable region of δ2 (TRDV2*01). SEQ ID NO: 14 is a nucleic acid sequence encoding the variable region of δ2 (TRDV2*02). SEQ ID NO: 15 is the nucleic acid sequence encoding δ2(TRD2*03). SEQ ID NO: 16 is the nucleic acid sequence encoding the Lys53-Ala mutant variable region of δ2 (TRDV2*03 Lys53-Ala, clone G115). SEQ ID NO: 17 is the nucleic acid sequence encoding the Lys53-Ala mutant δ2 (TRD2*03 Lys53-Ala, clone G115). SEQ ID NO: 18 is the nucleic acid sequence encoding the variable region of γ9 (TRGV9*01, clone G115). SEQ ID NO:19 is a nucleic acid sequence encoding the variable region of γ9 (TRGV9*02). SEQ ID NO:20 is the nucleic acid sequence encoding γ9 (TRG9*01, clone G115). SEQ ID NO:21 is the amino acid sequence of human BTN3A1 isoform 1. SEQ ID NO:22 is the amino acid sequence of human BTN3A1 isoform 2. SEQ ID NO:23 is the amino acid sequence of human BTN3A1 isoform 3. SEQ ID NO:24 is the amino acid sequence of human BTN3A1 isoform 4. SEQ ID NO:25 is the amino acid sequence of human BTN2A1 isoform 1. SEQ ID NO:26 is the amino acid sequence of human BTN2A1 isoform 2. SEQ ID NO:27 is the amino acid sequence of human BTN2A1 isoform 3. SEQ ID NO:28 is the amino acid sequence of human BTN2A1 isoform 4. SEQ ID NO:29 is the amino acid sequence of human BTN2A1 isoform 5. SEQ ID NO:30 is the amino acid sequence of human BTN2A1 isoform 6. SEQ ID NO:31 is the amino acid sequence of CDR1 of the δ2+ chain. SEQ ID NO: 32 is the amino acid sequence of CDR2 of the δ2+ chain. SEQ ID NO: 33 is the amino acid sequence of CDR2 of the 82+ chain (clone G115). SEQ ID NO: 34 is the amino acid sequence of the CDR3 of the 82+ chain (clone G115). SEQ ID NO:35 is the amino acid sequence of CDR1 of the γ9+ chain. SEQ ID NO:36 is the amino acid sequence of CDR2 of the γ9+ chain. SEQ ID NO: 37 is the amino acid sequence of the CDR3 of the γ9+ chain (clone G115). SEQ ID NOs: 38-39: Guide RNA SEQ ID NOs: 40 to 75: primers SEQ ID NOs: 76-77: Guide RNA SEQ ID NO: 78: Alt-R HDR oligonucleotide sequence SEQ ID NO: 79 is the amino acid sequence of the Lys53-Arg mutant variable region of δ2 (TRDV2*03 Lys53-Arg, clone G115_K53R). SEQ ID NO: 80 is the amino acid sequence of the Lys53-Asn mutant variable region of δ2 (TRDV2*03 Lys53-Asn, clone G115_K53N). SEQ ID NO: 81 is the amino acid sequence of the Lys53-Cys mutant variable region of δ2 (TRDV2*03 Lys53-Cys, clone G115_K53C). SEQ ID NO: 82 is the amino acid sequence of the Lys53-Gln mutant variable region of δ2 (TRDV2*03 Lys53-Gln, clone G115_K53Q). SEQ ID NO: 83 is the amino acid sequence of the Lys53-Gly mutant variable region of δ2 (TRDV2*03 Lys53-Gly, clone G115_K53G). SEQ ID NO: 84 is the amino acid sequence of the Lys53-His mutant variable region of δ2 (TRDV2*03 Lys53-His, clone G115_K53H). SEQ ID NO: 85 is the amino acid sequence of the Lys53-Ile mutant variable region of δ2 (TRDV2*03 Lys53-Ile, clone G115_K53I). SEQ ID NO: 86 is the amino acid sequence of the Lys53-Leu mutant variable region of δ2 (TRDV2*03 Lys53-Leu, clone G115_K53L). SEQ ID NO: 87 is the amino acid sequence of the Lys53-Met mutant variable region of δ2 (TRDV2*03 Lys53-Met, clone G115_K53M). SEQ ID NO: 88 is the amino acid sequence of the Lys53-Phe mutant variable region of δ2 (TRDV2*03 Lys53-Phe, clone G115_K53F). SEQ ID NO: 89 is the amino acid sequence of the Lys53-Ser mutant variable region of δ2 (TRDV2*03 Lys53-Ser, clone G115_K53S). SEQ ID NO: 90 is the amino acid sequence of the Lys53-Thr mutant variable region of δ2 (TRDV2*03 Lys53-Thr, clone G115_K53T). SEQ ID NO: 91 is the amino acid sequence of the Lys53-Trp mutant variable region of δ2 (TRDV2*03 Lys53-Trp, clone G115_K53W). SEQ ID NO: 92 is the amino acid sequence of the Lys53-Tyr mutant variable region of δ2 (TRDV2*03 Lys53-Tyr, clone G115_K53Y). SEQ ID NO: 93 is the amino acid sequence of the Lys53-Val mutant variable region of δ2 (TRDV2*03 Lys53-Val, clone G115_K53V). SEQ ID NO: 94 is the amino acid sequence of the Lys53-Pro mutant variable region of δ2 (TRDV2*03 Lys53-Pro, clone G115_K53P). SEQ ID NO: 95 is the amino acid sequence of Lys53-Arg mutant δ2 (TRDV2*03 Lys53-Arg, clone G115_K53R). SEQ ID NO: 96 is the amino acid sequence of Lys53-Asn mutant δ2 (TRDV2*03 Lys53-Asn, clone G115_K53N). SEQ ID NO: 97 is the amino acid sequence of Lys53-Cys mutant δ2 (TRDV2*03 Lys53-Cys, clone G115_K53C). SEQ ID NO: 98 is the amino acid sequence of Lys53-Gln mutant δ2 (TRDV2*03 Lys53-Gln, clone G115_K53Q). SEQ ID NO: 99 is the amino acid sequence of Lys53-Gly mutant δ2 (TRDV2*03 Lys53-Gly, clone G115_K53G). SEQ ID NO: 100 is the amino acid sequence of Lys53-His mutant δ2 (TRDV2*03 Lys53-His, clone G115_K53H). SEQ ID NO: 101 is the amino acid sequence of Lys53-Ile mutant δ2 (TRDV2*03 Lys53-Ile, clone G115_K53I). SEQ ID NO: 102 is the amino acid sequence of Lys53-Leu mutant δ2 (TRDV2*03 Lys53-Leu, clone G115_K53L). SEQ ID NO: 103 is the amino acid sequence of Lys53-Met mutant δ2 (TRDV2*03 Lys53-Met, clone G115_K53M). SEQ ID NO: 104 is the amino acid sequence of Lys53-Phe mutant δ2 (TRDV2*03 Lys53-Phe, clone G115_K53F). SEQ ID NO: 105 is the amino acid sequence of Lys53-Ser mutant δ2 (TRDV2*03 Lys53-Ser, clone G115_K53S). SEQ ID NO: 106 is the amino acid sequence of Lys53-Thr mutant δ2 (TRDV2*03 Lys53-Thr, clone G115_K53T). SEQ ID NO: 107 is the amino acid sequence of Lys53-Trp mutant δ2 (TRDV2*03 Lys53-Trp, clone G115_K53W). SEQ ID NO: 108 is the amino acid sequence of Lys53-Tyr mutant δ2 (TRDV2*03 Lys53-Tyr, clone G115_K53Y). SEQ ID NO: 109 is the amino acid sequence of Lys53-Val mutant δ2 (TRDV2*03 Lys53-Val, clone G115_K53V). SEQ ID NO: 110 is the amino acid sequence of Lys53-Pro mutant δ2 (TRDV2*03 Lys53-Pro, clone G115_K53P). SEQ ID NO: 111 is the nucleic acid sequence encoding the Lys53-Arg mutant variable region of δ2 (TRDV2*03 Lys53-Arg, clone G115_K53R). SEQ ID NO: 112 is the nucleic acid sequence encoding the Lys53-Asn mutant variable region of δ2 (TRDV2*03 Lys53-Asn, clone G115_K53N). SEQ ID NO: 113 is the nucleic acid sequence encoding the Lys53-Cys mutant variable region of δ2 (TRDV2*03 Lys53-Cys, clone G115_K53C). SEQ ID NO: 114 is the nucleic acid sequence encoding the Lys53-Gln mutant variable region of δ2 (TRDV2*03 Lys53-Gln, clone G115_K53Q). SEQ ID NO: 115 is the nucleic acid sequence encoding the Lys53-Gly mutant variable region of δ2 (TRDV2*03 Lys53-Gly, clone G115_K53G). SEQ ID NO: 116 is the nucleic acid sequence encoding the Lys53-His mutant variable region of δ2 (TRDV2*03 Lys53-His, clone G115_K53H). SEQ ID NO: 117 is the nucleic acid sequence encoding the Lys53-Ile mutant variable region of δ2 (TRDV2*03 Lys53-Ile, clone G115_K53I). SEQ ID NO: 118 is the nucleic acid sequence encoding the Lys53-Leu mutant variable region of δ2 (TRDV2*03 Lys53-Leu, clone G115_K53L). SEQ ID NO: 119 is the nucleic acid sequence encoding the Lys53-Met mutant variable region of δ2 (TRDV2*03 Lys53-Met, clone G115_K53M). SEQ ID NO: 120 is the nucleic acid sequence encoding the Lys53-Phe mutant variable region of δ2 (TRDV2*03 Lys53-Phe, clone G115_K53F). SEQ ID NO: 121 is the nucleic acid sequence encoding the Lys53-Ser mutant variable region of δ2 (TRDV2*03 Lys53-Ser, clone G115_K53S). SEQ ID NO: 122 is the nucleic acid sequence encoding the Lys53-Thr mutant variable region of δ2 (TRDV2*03 Lys53-Thr, clone G115_K53T). SEQ ID NO: 123 is the nucleic acid sequence encoding the Lys53-Trp mutant variable region of δ2 (TRDV2*03 Lys53-Trp, clone G115_K53W). SEQ ID NO: 124 is the nucleic acid sequence encoding the Lys53-Tyr mutant variable region of δ2 (TRDV2*03 Lys53-Tyr, clone G115_K53Y). SEQ ID NO: 125 is the nucleic acid sequence encoding the Lys53-Val mutant variable region of δ2 (TRDV2*03 Lys53-Val, clone G115_K53V). SEQ ID NO: 126 is the nucleic acid sequence encoding the Lys53-Pro mutant variable region of δ2 (TRDV2*03 Lys53-Pro, clone G115_K53P). SEQ ID NO: 127 is the nucleic acid sequence encoding Lys53-Arg mutant δ2 (TRDV2*03 Lys53-Arg, clone G115_K53R). SEQ ID NO: 128 is the nucleic acid sequence encoding the Lys53-Asn mutant δ2 (TRDV2*03 Lys53-Asn, clone G115_K53N). SEQ ID NO: 129 is the nucleic acid sequence encoding the Lys53-Cys mutant δ2 (TRDV2*03 Lys53-Cys, clone G115_K53C). SEQ ID NO: 130 is the nucleic acid sequence encoding the Lys53-Gln mutant δ2 (TRDV2*03 Lys53-Gln, clone G115_K53Q). SEQ ID NO: 131 is the nucleic acid sequence encoding the Lys53-Gly mutant δ2 (TRDV2*03 Lys53-Gly, clone G115_K53G). SEQ ID NO: 132 is the nucleic acid sequence encoding Lys53-His mutant δ2 (TRDV2*03 Lys53-His, clone G115_K53H). SEQ ID NO: 133 is the nucleic acid sequence encoding the Lys53-Ile mutant δ2 (TRDV2*03 Lys53-Ile, clone G115_K53I). SEQ ID NO: 134 is the nucleic acid sequence encoding Lys53-Leu mutant δ2 (TRDV2*03 Lys53-Leu, clone G115_K53L). SEQ ID NO: 135 is the nucleic acid sequence encoding the Lys53-Met mutant δ2 (TRDV2*03 Lys53-Met, clone G115_K53M). SEQ ID NO: 136 is the nucleic acid sequence encoding Lys53-Phe mutant δ2 (TRDV2*03 Lys53-Phe, clone G115_K53F). SEQ ID NO: 137 is the nucleic acid sequence encoding the Lys53-Ser mutant δ2 (TRDV2*03 Lys53-Ser, clone G115_K53S). SEQ ID NO: 138 is the nucleic acid sequence encoding the Lys53-Thr mutant δ2 (TRDV2*03 Lys53-Thr, clone G115_K53T). SEQ ID NO: 139 is the nucleic acid sequence encoding the Lys53-Trp mutant δ2 (TRDV2*03 Lys53-Trp, clone G115_K53W). SEQ ID NO: 140 is the nucleic acid sequence encoding the Lys53-Tyr mutant δ2 (TRDV2*03 Lys53-Tyr, clone G115_K53Y). SEQ ID NO: 141 is the nucleic acid sequence encoding the Lys53-Val mutant δ2 (TRDV2*03 Lys53-Val, clone G115_K53V). SEQ ID NO: 142 is the nucleic acid sequence encoding Lys53-Pro mutant δ2 (TRDV2*03 Lys53-Pro, clone G115_K53P). SEQ ID NO: 143 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53R). SEQ ID NO: 144 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53N). SEQ ID NO: 145 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53C). SEQ ID NO: 146 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53Q). SEQ ID NO: 147 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53G). SEQ ID NO: 148 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53H). SEQ ID NO: 149 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53I). SEQ ID NO: 150 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53L). SEQ ID NO: 151 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53M). SEQ ID NO: 152 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53F). SEQ ID NO: 153 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53S). SEQ ID NO: 154 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53T). SEQ ID NO: 155 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53W). SEQ ID NO: 156 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53Y). SEQ ID NO: 157 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53V). SEQ ID NO: 158 is the amino acid sequence of CDR2 of the 82+ chain (clone G115_K53P). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0081] Overview Throughout this specification, unless otherwise stated or required by context, references to a single step, composition of matter, group of steps, or group of compositions of matter should be interpreted as covering both one and more (i.e., one or more) of that step, composition of matter, group of steps, or group of compositions of matter.

[0082] Those skilled in the art will understand that the present disclosure is subject to variations and modifications other than those specifically described. The present disclosure should be understood to include all such variations and modifications. The present disclosure also includes all of the steps, features, compositions and compounds referred to or shown herein, individually or collectively, and any and all combinations of the steps or features, or any two or more of the above.

[0083] The present disclosure should not be limited in scope by the specific examples described herein, which are intended for the purposes of illustration only. Functionally equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0084] Any example of the present disclosure herein is understood to apply mutatis mutandis to any other example of the present disclosure, unless otherwise stated. In other words, any specific example of the present disclosure can be combined with any other specific example of the present disclosure (except where mutually exclusive).

[0085] Any instance in this disclosure disclosing a specific feature or group of features or methods or method steps is to be construed as providing explicit support for disclaiming that specific feature or group of features or methods or method steps.

[0086] Unless specifically defined otherwise, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0087] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in this disclosure are standard procedures, well known to those skilled in the art. These techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989); TA Brown (ed.), Essential Molecular Biology: A Practical Approach, vols. 1 and 2, IRL Press (1991); DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, vols. 1-4, IRL Press (1995 and 1996); FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, with all updates to date); Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); and JE Coligan et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1998). These are described and explained throughout the literature in sources such as Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0088] The term "and / or," e.g., "X and / or Y," is understood to mean either "X and Y" or "X or Y," and is interpreted as providing explicit support for both meanings or either meaning.

[0089] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not to the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0090] As used herein, the term "derived from" shall be interpreted as indicating that the specified integer may be obtained from a particular source, although not necessarily directly from that source.

[0091] Selected Definitions The term "T cell receptor" or "TCR" as used herein refers to a receptor capable of specifically interacting with a target antigen, and includes full-length TCRs and antigen-binding fragments or portions thereof, naturally occurring TCRs, and TCR variants, fragments, and constructs. The TCRs of the present disclosure can be isolated, or synthetically or recombinantly produced. The term includes, for example, heterodimers comprising TCR delta and gamma chains, as well as multimeric and single chain constructs, optionally including additional domains and / or portions.

[0092] A TCR is generally considered to comprise two chains, e.g., a gamma chain and a delta chain, each chain comprising a variable region (e.g., Vgamma and Vdelta) and, optionally, one or more of a diversity (D) region, a joining (J) region and a constant region (e.g., Cgamma and / or Cdelta).

[0093] The variable region can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). For example, the variable region comprises three CDRs and three or four FRs (e.g., FR1, FR2, FR3, and optionally FR4). Each variable region comprises a binding domain that interacts with an antigen. One or more of the CDRs on each chain may be involved in antigen binding. CDR3 is highly variable due to V(D)J combinatorial diversity as well as non-templated nucleotide modifications, and often forms part of the primary antigen binding region. Within the human Vγ9+Vδ2+ repertoire, which typically responds to phosphoantigens, CDR3γ is often semi-invariant in length and composition, and the lysine at position 108 within CDR3γ encoded by TRGJP is important for γδ T cell-mediated responses to phosphoantigens. Phosphoantigens are non-peptide molecules that induce activation of Vγ9Vδ2 γδ T cells, such as HMBPP, IPP, and DMAPP.

[0094] As used herein, the term "TCR" further refers to a TCR expressed on the surface of a cell, including a T cell or a cell other than a T cell, or to an isolated or soluble TCR.

[0095] As used herein, "soluble T cell receptor" or "soluble TCR" refers to a TCR consisting of a full-length (e.g., membrane-bound) receptor chain, but, at a minimum, the transmembrane region of the receptor chain has been deleted or mutated, such that the receptor is not associated with a membrane when expressed by a cell. Most typically, a soluble receptor consists only of the extracellular domain of the native receptor chain (i.e., lacks the transmembrane and cytoplasmic domains).

[0096] Unless expressly stated, and unless the context indicates otherwise, the term "TCR" also includes antigen-binding fragments or portions of any TCR disclosed herein, including monovalent and bivalent fragments or portions, as well as single chain TCRs. The term "TCR" is not limited to naturally occurring TCRs bound to the surface of a T cell.

[0097] "Antigen-binding fragment" or "antigen-binding portion" refers to any portion of a TCR smaller than the whole that retains antigen binding. An "antigen-binding fragment" or "antigen-binding portion" may include antigen complementarity determining regions (CDRs).

[0098] "Antigen" refers to any molecule, e.g., a (poly)peptide, that can be bound by a TCR or a binding fragment thereof. In the context of the present invention, the term "binding domain" refers in particular to the region of a TCR that interacts with a BTN3 molecule (e.g., BTN3A1) or the BTN2 / BTN3 complex, e.g., the variable region of the TCR δ chain or the variable regions of the TCR δ and TCR γ chains.

[0099] The term "epitope" generally refers to a site on an antigen, typically a (poly)peptide, that a binding domain recognizes. The term "binding domain" refers to an "antigen binding site" in its broadest sense, i.e. characterizes a domain that binds / interacts with a specific epitope on an antigen target. An antigen target may contain a single epitope or may contain at least two epitopes, and may contain any number of epitopes depending on the size, conformation and type of antigen. The term "epitope" generally includes linear epitopes and conformational epitopes. A linear epitope is a continuous epitope contained in a primary amino acid sequence, typically comprising at least two or more amino acids. A conformational epitope is formed by non-contiguous amino acids juxtaposed by folding of a target antigen, particularly a target (poly)peptide.

[0100] The term "cancer antigen" or "tumor associated antigen" as used herein refers to any molecule (e.g., protein, (poly)peptide, lipid, carbohydrate, metabolite, etc.) that is exclusively or primarily expressed or overexpressed by tumor or cancer cells, such that the antigen is associated with tumor or cancer. Cancer antigens can also be expressed by normal, non-tumor, or non-cancer cells. However, in such cases, the expression of cancer antigens by normal, non-tumor, or non-cancer cells is typically not as high as that by tumor or cancer cells. In this regard, tumor or cancer cells can overexpress the antigen or express the antigen at a significantly higher level compared to the expression of the antigen by normal, non-tumor, or non-cancer cells. Cancer antigens can also be expressed by cells with different developmental or maturational states. For example, cancer antigens can also be expressed by embryonic or fetal cells that are not normally found in adult hosts. Alternatively, cancer antigens can also be expressed by stem or progenitor cells that are not normally found in adult hosts.

[0101] A cancer antigen can be an antigen expressed by any cell of any cancer or tumor. A cancer antigen can be a cancer antigen of only one type of cancer or tumor, such that the cancer antigen is associated with or characteristic of only one type of cancer or tumor. Alternatively, a cancer antigen can be (e.g., characteristic of) more than one type of cancer or tumor.

[0102] The term "variant" as used herein refers to a TCR, polypeptide, protein or antibody that has substantial or significant sequence identity or similarity to a parent TCR, its variable regions or their antigen-binding regions and has in common its biological activity, i.e. its ability to specifically bind to an antigenic target (e.g. BTN3A) with the same, same or even greater degree of antigen specificity as the parent TCR, polypeptide, protein or antibody.

[0103] The term "construct" includes, for example, proteins or polypeptides that contain at least one antigen-binding domain of the TCR of the present disclosure, but do not necessarily have in common the basic structure of a native TCR. TCR constructs and fragments are typically obtained by routine methods of genetic engineering and are often artificially constructed to contain additional functional protein or polypeptide domains. TCR constructs and fragments of the present disclosure may contain at least CDR3δ or CDR3δ and CDR3γ. Constructs and fragments may further comprise CDR1δ, CDR2δ, CDR1γ, CDR2γ, δ chain variable region, γ chain variable region, δ chain or γ chain, or combinations thereof, optionally in combination with additional protein domains or moieties. TCR constructs and fragments can specifically bind to the same antigen target (e.g., BTN3A) as the TCR of the present disclosure.

[0104] The term "TCR construct" also relates to a fusion protein or polypeptide comprising at least one antigen-binding domain of a TCR of the present disclosure and one or more fusion components. Useful components include an Ig-derived hinge domain, an Fc receptor, an Fc domain (derived from IgA, IgD, IgG, IgE, and IgM), a cytokine (such as IL-2 or IL-15), a toxin, an antibody or antigen-binding fragment thereof (such as an anti-CD3, anti-CD28, anti-CD5, anti-CD16, or anti-CD56 antibody or antigen-binding fragment thereof), CD247 (CD3-zeta), CD28, CD137, CD134 or other co-stimulatory domain, or any combination thereof. Other useful components include an antibody or antigen-binding fragment thereof that binds to BTN2, BTN3, or the BTN2 / BTN3 complex.

[0105] As used herein, the term "label" or "labeling group" refers to any detectable label.

[0106] The term "position" as used herein means either the position of an amino acid in an amino acid sequence disclosed herein or the position of a nucleotide in a nucleic acid sequence disclosed herein. The term "corresponding" as used herein also includes that the position is not only determined by the number of preceding amino acids / nucleotides, but should also be viewed from the context of the surrounding portion of the sequence. Thus, the position of a given amino acid or nucleotide according to the present disclosure may change depending on the deletion or addition of amino acids or nucleotides elsewhere in the sequence. Thus, when a position is referred to as a "corresponding position" according to the present disclosure, it is understood that the amino acids / nucleotides may differ with respect to the designated number but still have similar adjacent amino acids / nucleotides. To determine whether an amino acid residue or nucleotide in a given sequence corresponds to a particular position in an amino acid or nucleotide sequence of a "parent" amino acid / nucleotide sequence, the skilled artisan can use means and methods well known in the art, such as sequence alignment, either manually or by using a computer program.

[0107] The term "γδ T cell" refers to a cell that expresses γ and δ chains as part of the T cell receptor (TCR) complex. γδ TCRs are composed of γ and δ chains, each of which contains a variable and a constant Ig domain. The domains are formed by genetic recombination of variable (V), diversity (D) (only in the case of TCRδ), joining (J), and constant (C) genes within the TCRδ and γ loci. The variable domain of each chain contains three solvent-exposed loops that typically contact the ligand, known as the CDR1, CDR2, and CDR3 regions, the latter of which is highly diverse in composition due to VDJ combinatorial diversity and non-templated nucleotide changes (additions and deletions) at the VD and DJ recombination sites.

[0108] Human γδ T cells can be divided into four main populations based on TCR δ chain expression (δ1, δ2, δ3, δ5). Furthermore, different TCR δ and TCR γ chains combine together to form different γδ T cell types. For example, γδ T cells expressing a TCR containing γ chain variable region 9 (Vγ9) and δ chain variable region 2 (Vδ2) are referred to as Vγ9Vδ2+ T cells, and these cells often represent the majority of γδ T cells in peripheral blood. In humans, Vγ2, Vγ3, Vγ4, Vγ5, Vγ8, Vγ9, and Vγ11 rearrangements of γ chains are found.

[0109] In humans, γδ T cells can be further divided into 'Vδ2' and 'non-Vδ2' cells, the latter consisting mostly of Vδ1 chain-expressing cells, and rarely Vδ3 or Vδ5 chain-expressing cells, with Vδ4, Vδ6, Vδ7 and Vδ8 also described.

[0110] γδ T cells can mediate antibody-dependent cell-mediated cytotoxicity (ADCC) and phagocytosis, and can rapidly respond to pathogen-specific antigens without prior differentiation or expansion. γδ T cells respond directly to protein and non-peptide antigens, and are therefore largely not MHC-restricted. At least some γδ T cell-specific antigens represent evolutionarily conserved molecular patterns found in microbial pathogens and induced self-antigens, and are upregulated by cellular stress, infection, and transformation. Such antigens are generally referred to herein as "phosphoantigens" or pAgs. γδ T cells can also respond to other antigens and ligands via the TCR and (co)receptors.

[0111] In addition, γδ T cells can be further classified into a series of multiple functional populations: IFN-γ-producing γδ T cells, IL-17A-producing γδ T cells, antigen-presenting γδ T cells, follicular B helper γδ T cells, and regulatory γδ T cells. γδ T cells can promote immune responses resulting in direct cytotoxicity, cytokine production, and indirect immune responses. For example, the IFN-γ-producing phenotype is characterized by increased CD56 expression and enhanced cytolytic responses. Some γδ T cell subsets can contribute to disease progression by promoting inflammation and / or immunosuppression. For example, IL-17A-producing γδ T cells are widely involved in inflammatory responses and have pathogenic roles in infections and autoimmune diseases.

[0112] The terms "butyrophilin (BTN)" and "butyrophilin-like (BTNL)" molecules refer to regulators of immune responses that belong to the immunoglobulin (Ig) superfamily of transmembrane proteins. They are structurally related to the B7 family of costimulatory molecules and have similar immunoregulatory functions. BTNs are involved in the regulation of T cell development, activation and inhibition, as well as T cell interactions with antigen-presenting cells and epithelial cells. Certain BTNs are genetically associated with autoimmune and inflammatory diseases. The human butyrophilin family contains seven members that are subdivided into three subfamilies: BTN1, BTN2 and BTN3. The BTN1 subfamily contains only the prototypic single copy BTN1A1 gene, whereas the BTN2 and BTN3 subfamilies contain three genes, BTN2A1, BTN2A2 and BTN2A3, and BTN3A1, BTN3A2 and BTN3A3, respectively. The BTNL protein has a high degree of homology with BTN family members. The human genome contains four BTNL genes: BTNL2, 3, 8 and 9. As used herein, the terms "butyrophilin (BTN)" and "butyrophilin-like (BTNL)" molecules refer to isoforms of the BTN and BTNL molecules.

[0113] Butyrophilin and BTNL molecules typically contain two immunoglobulin-like domains: an N-terminal Ig-V-like (herein referred to as "IgV") and a C-terminal Ig-C-like domain (herein referred to as "IgC"). BTNL2 contains an additional Ig domain at the N-terminus.

[0114] For purposes of nomenclature only and not limitation, the amino acid sequence of BTN3A1 is taught in NCBI RefSeq NP_008979.3, NP_919423.1, NP_001138480.1, NP_001138481.1, XP_005248890.1, XP_005248891.1, XP_006715046.1 and / or SEQ ID NOs: 21-24. In one example, the BTN3A1 is human BTN3A1.

[0115] For purposes of nomenclature only and not limitation, the amino acid sequence of BTN2A1 is taught in NCBI RefSeq NCBI RefSeq NP_008980.1, NP_510961.1, NP_001184162.1 or NP_001184163.1 and / or SEQ ID NOs: 25 to 30. In one example, BTN2A1 is human BTN2A1.

[0116] The terms BTN2 and BTN3 as used herein refer to any isoform of the BTN2 and BTN3 family members.

[0117] As used herein, the term "binding" with respect to the interaction of an engineered V52+ TCR of the present disclosure with a BTN3 molecule or a BTN2 / BTN3 complex means that the interaction is dependent on the presence of a particular structure (e.g., an epitope) on the BTN3 molecule or the BTN2 / BTN3 complex. For example, the V52+ chain of the TCR can bind to one or more extracellular domains (e.g., IgV and / or IgC) of a BTN3 molecule, e.g., BTN3A1.

[0118] As used herein, the term "specifically binds" means that the binding interaction between the TCR of the present disclosure and the BTN3 molecule or the BTN2 / BTN3 complex is dependent on the presence of an antigenic determinant or epitope. The binding region of the modified TCR preferentially binds to or recognizes a particular antigenic determinant or epitope, even when present in a mixture of other molecules or cells expressing it. In one example, the binding region reacts or associates with a specific antigenic determinant or epitope more frequently, more rapidly, with a longer duration, and / or with greater affinity than with alternative antigenic determinants or cells expressing it. It is also understood by reading this definition that, for example, a binding region that specifically binds to a particular antigenic determinant or epitope may or may not specifically bind to a second antigenic determinant or epitope. Thus, "specific binding" does not necessarily require exclusive or undetectable binding to another antigen. The term "specifically binds" may be used interchangeably herein with "selectively binds." Generally, references to binding herein mean specific binding, with each term being understood to provide clear support for the other term. Methods for determining specific binding will be apparent to those skilled in the art. In one example, "specific binding" to a specific antigenic determinant or epitope or a cell expressing it means that the binding region of the TCR is less than 10,000 μM, less than 9000 μM, less than 8000 μM, less than 7000 μM, less than 6000 μM, less than 5000 μM, less than 4000 μM, less than 3000 μM, less than 2000 μM, less than 1000 μM, such as less than 900 μM, less than 800 μM, less than 700 μM, less than 6 ... M or less, 500 μM or less, 400 μM or less, 300 μM or less, 200 μM or less, or 100 μM or less, such as 90 μM or less, for example 85 μM or less, such as 50 μM or less, for example 45 μM, for example between 10 μM and 1,000 μM, between 10 μM and 500 μM, between 10 μM and 100 μM, between 40 μM and 90 μM, or between 45 μM and 85 μM.

[0119] As used herein, the term "enhances binding" with respect to the interaction of a modified TCR of the present disclosure with a BTN3 molecule or a BTN2 / BTN3 complex means that the TCR reacts with or associates with a BTN3 molecule or a BTN2 / BTN3 complex more frequently, more rapidly, with a longer duration, and / or with greater affinity than its unmodified counterpart having a lysine (K) at a position corresponding to amino acid 53 of the amino acid sequence set forth in SEQ ID NO:1. In one example, "enhanced binding" to BTN3 or a BTN2 / BTN3 complex or a cell expressing it means that the modified TCR binds with an equilibrium constant (KD) of 100 μM or less, 50 μM or less, 40 μM or less, 30 μM or less, or 20 μM or less, or 10 μM or less, e.g., between 10 μM and 100 μM, between 20 μM and 50 μM, between 30 μM and 50 μM, between 40 μM and 50 μM, e.g., about 45 μM. Binding of a modified TCR of the disclosure to a BTN3 molecule or BTN2 / BTN3 can induce or enhance V52+ TCR activation. The TCR can induce or enhance V52+Vγ9+ and / or V52Vγ9- γδ TCR activation. For example, the TCR can induce or enhance V52+ γδTCR activation, including but not limited to V52+Vγ9+ and / or V52+Vγ1 / 2 / 3 / 4 / 5 / 8 / 10 / 11 γδTCR activation. Activation can be phosphoantigen-independent or phosphoantigen-dependent. For example, without being bound by theory or motivation, binding of the TCR to BTN3 or the BTN2 / BTN3 complex can be independent of activating antigen (e.g., pAg). Binding of the TCR to BTN3 or the BTN2 / BTN3 complex can be stimulatory for the γδT cell and can activate one or more of cytolytic function, cytokine production of one or more cytokines, or proliferation of the γδT cell.

[0120] As used herein, the term "BTN2 / BTN3 complex" refers to a complex of BTN2 and BTN3 molecules, e.g., a complex of BTN2A1 and BTN3A1. The complex may be present on the surface of a cell, e.g., a tumor cell, a monocyte, a macrophage, a dendritic cell, a parenchymal cell, and / or a natural killer (NK) cell. The BTN2 / BTN3 complex may be a heteromeric or multimeric complex. The complex may include one or more BTN2 molecules, such as BTN2A1 and / or BTN2A2, and / or one or more BTN3 molecules, such as BTN3A1 and / or BTN3A2 and / or BTN2A3, and / or other proteins, such as ATP-binding cassette transporter A1 (ABCA1). The BTN2 and / or BTN3 molecules may exist in monomeric or dimeric form. The BTN2 and BTN3 molecules may co-exist on the cell surface or may be associated directly or indirectly (through another molecule or protein). The BTN2 / BTN3 complex may bind to an antigen directly or indirectly. For example, the cytoplasmic domains of the BTN2 and / or BTN3 molecules may bind to an antigen directly or indirectly.

[0121] As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell proliferation. Hyperproliferative and neoplastic disease states can be classified as pathological, i.e., characterizing or constituting a disease state, or non-pathological, i.e., deviations from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness.

[0122] The term "protein" is intended to include a single polypeptide chain, i.e., a series of consecutive amino acids linked by peptide bonds, or a series of polypeptide chains linked to each other covalently or non-covalently (i.e., a polypeptide complex). For example, a series of polypeptide chains may be covalently linked using suitable chemicals or disulfide bonds. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions.

[0123] It will be understood from the previous paragraph that the term "polypeptide" or "polypeptide chain" means a series of consecutive amino acids linked by peptide bonds.

[0124] An "antibody" is generally considered to be a protein comprising a variable region composed of multiple polypeptide chains, for example, a polypeptide comprising a light chain variable region (VL) and a polypeptide comprising a heavy chain variable region (VH). An antibody also generally comprises a constant domain, some of which in the case of a heavy chain can be arranged into a constant region comprising a constant fragment or a crystallizable fragment (Fc). VH and VL interact to form an Fv comprising an antigen-binding region capable of specifically binding one or a few closely related antigens. Generally, light chains from mammals are either kappa or lambda light chains, and heavy chains from mammals are alpha, delta, epsilon, gamma, or mu. Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass. The term "antibody" also encompasses humanized antibodies, primatized antibodies, human antibodies, synthetic humanized antibodies, and chimeric antibodies. The term "antibody" also includes variants lacking the encoded C-terminal lysine residue, deamidated variants and / or glycosylated variants, and / or variants including, for example, pyroglutamic acid at the N-terminus of the protein (e.g., antibody), and / or variants lacking an N-terminal residue, e.g., an N-terminal glutamine in an antibody or V-region, and / or variants including all or part of a secretory signal. Deamidated variants of encoded asparagine residues can give rise to isoaspartic acid and aspartic acid isoforms, or even succinamide containing adjacent amino acid residues. Deamidated variants of encoded glutamine residues can give rise to glutamic acid. When referring to a particular amino acid sequence, it is intended to include compositions including a heterogeneous mixture of such sequences and variants.

[0125] In the context of the present disclosure, the term "half antibody" refers to a protein comprising a single antibody heavy chain and a single antibody light chain. The term "half antibody" also encompasses proteins comprising one antibody light chain and one antibody heavy chain, where the antibody heavy chain has been mutated to prevent association with another antibody heavy chain.

[0126] The terms "full length antibody," "complete antibody," or "whole antibody" are used interchangeably and refer to an antibody in its substantially complete form, as opposed to an antigen-binding fragment of an antibody. Specifically, whole antibodies include those having heavy and light chains, including the Fc region. The constant domains may be wild-type sequence constant domains (e.g., human wild-type sequence constant domains) or amino acid sequence variants thereof.

[0127] As used herein, a "variable region" with respect to an antibody refers to the portion of the light and / or heavy chain of an antibody defined herein that specifically binds to an antigen, including, for example, the amino acid sequences of the CDRs, i.e., CDR1, CDR2, and CDR3, and framework regions (FRs). For example, a variable region includes three or four FRs (e.g., FR1, FR2, FR3, and optionally FR4) with three CDRs. VH refers to the variable region of the heavy chain. VL refers to the variable region of the light chain.

[0128] As used herein, the term "complementarity determining region" (synonyms CDR, i.e., CDR1, CDR2, and CDR3) with respect to an antibody refers to the amino acid residues of the antibody variable region whose presence is a major contributor to specific antigen binding. Each variable region typically has three CDR regions identified as CDR1, CDR2, and CDR3. In one example, the amino acid positions assigned to the CDRs and FRs are defined according to the Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991 (also referred to herein as the "Kabat numbering system"). According to the Kabat numbering system, the VH FRs and CDRs are located as follows: residues 1-30 (FR1), 31-35 (CDR1), 36-49 (FR2), 50-65 (CDR2), 66-94 (FR3), 95-102 (CDR3), and 103-113 (FR4). According to the Kabat numbering system, the VL FRs and CDRs are located as follows: residues 1-23 (FR1), 24-34 (CDR1), 35-49 (FR2), 50-56 (CDR2), 57-88 (FR3), 89-97 (CDR3), and 98-107 (FR4).

[0129] "Framework regions" (hereinafter FR) are those variable domain residues other than the CDR residues.

[0130] As used herein, the term "Fv" is understood to mean any protein in which a VL and a VH associate to form a complex having an antigen-binding site, i.e., capable of specifically binding to an antigen, whether composed of multiple polypeptides or a single polypeptide. The VH and VL forming the antigen-binding site may be in a single polypeptide chain or different polypeptide chains. Furthermore, an Fv of the present disclosure (as well as any protein of the present disclosure) may have multiple antigen-binding sites, which may or may not bind to the same antigen. The term should be understood to encompass fragments derived directly from an antibody, as well as proteins corresponding to such fragments produced using recombinant means. In some instances, the VH is not linked to the heavy chain constant domain (CH)1 and / or the VL is not linked to the light chain constant domain (CL). Exemplary Fv-containing polypeptides or proteins include Fab fragments, Fab' fragments, F(ab') fragments, scFv, diabodies, triabodies, tetrabodies or higher order complexes, or any of the above linked to their constant regions or domains, e.g., CH2 or CH3 domains, e.g., minibodies. A "Fab fragment" consists of a monovalent antigen-binding fragment of an antibody and can be produced by digestion of whole antibodies with the enzyme papain to yield a fragment consisting of an intact light chain and a portion of a heavy chain, or can be produced using recombinant means. An "Fab' fragment" of an antibody can be obtained by treating whole antibody with pepsin, followed by reduction to yield a molecule consisting of an intact light chain and a portion of a heavy chain containing the VH and a single constant domain. Two Fab' fragments are obtained per antibody treated in this manner. Fab' fragments can also be produced by recombinant means.

[0131] An "F(ab')2 fragment" of an antibody consists of a dimer of two Fab' fragments held together by two disulfide bonds and can be obtained by treating the whole antibody molecule with the enzyme pepsin without subsequent reduction. A "Fab2" fragment is a recombinant fragment comprising two Fab fragments linked together using, for example, a leucine zipper or CH3 domain. A "single-chain Fv" or "scFv" is a recombinant molecule comprising an antibody variable fragment (Fv) in which the variable region of the light chain and the variable region of the heavy chain are covalently linked by a suitable flexible polypeptide linker.

[0132] The term "constant region" with respect to an antibody refers to a portion of the heavy or light chain of an antibody other than the variable region. In the heavy chain, the constant region generally comprises multiple constant domains and a hinge region, e.g., an IgG constant region comprises the following linked components: constant heavy (CH)1, linker, CH2, and CH3. In the heavy chain, the constant region comprises Fc. In the light chain, the constant region generally comprises one constant domain (CL1).

[0133] The terms "crystallizable fragment" or "Fc" or "Fc region" or "Fc portion" (which may be used interchangeably herein) refer to a region of an antibody that contains at least one constant domain, is generally (but not necessarily) glycosylated, and is capable of binding to one or more Fc receptors and / or components of the complement cascade. The heavy chain constant region may be selected from any of the five isotypes: α, δ, ε, γ, or μ. Furthermore, the heavy chains of various subclasses (such as the IgG subclass of heavy chains) are responsible for different effector functions, and therefore, by selecting the desired heavy chain constant region, a protein with a desired effector function may be generated. Exemplary heavy chain constant regions are gamma 1 (IgG1), gamma 2 (IgG2) and gamma 3 (IgG3), or hybrids thereof.

[0134] An "antigen-binding fragment" of an antibody comprises one or more variable regions of an intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, half antibodies, and multispecific antibodies formed from antibody fragments.

[0135] As used herein, the term "monospecific" refers to a binding region that comprises one or more antigen binding sites, each of which has the same epitope specificity. Thus, a monospecific binding region can comprise a single antigen binding site (e.g., Fv, scFv, Fab, etc.) or can comprise several antigen binding sites, e.g., diabodies or antibodies, that recognize the same epitope (e.g., identical to each other). The requirement that a binding region is "monospecific" does not mean that it binds only one antigen, since multiple antigens may have shared or highly similar epitopes that can be bound by a single antigen binding site. A monospecific binding region that binds only one antigen is said to "exclusively bind" to that antigen.

[0136] The term "multispecific" refers to a binding region that comprises two or more antigen binding sites, each of which binds to a distinct epitope, e.g., each of which binds to a distinct antigen. For example, a multispecific binding region can comprise antigen binding sites that recognize two or more different epitopes of the same protein, or antigen binding sites that recognize two or more different epitopes of different proteins. In one example, a binding region can be "bispecific", i.e., it comprises two antigen binding sites that specifically bind to two distinct epitopes. For example, a bispecific binding region specifically binds to or has specificity for two different epitopes on the same protein. In another example, a bispecific binding region specifically binds to two distinct epitopes on two different proteins.

[0137] As used herein, the term "disease," "disorder," or "condition" refers to a disruption of or interference with normal function, and includes a disease or disorder, without being limited to any particular condition.

[0138] As used herein, a subject "at risk" of developing or having a disease or condition or its recurrence may or may not have detectable disease or symptoms of disease, and may or may not exhibit detectable disease or symptoms of disease prior to treatment according to the present disclosure. "At risk" refers to the subject having one or more risk factors, which are measurable parameters that correlate with the development of a disease or condition, as known in the art and / or described herein.

[0139] As used herein, the terms "treating," "treat" or "treatment" include administering a TCR or binding fragment thereof, nucleic acid, vector, cell, or composition described herein, thereby reducing or eliminating at least one symptom of a particular disease or condition, or slowing the progression of the disease or condition.

[0140] As used herein, the terms "preventing," "prevent" or "prevention" include providing prophylaxis with respect to the occurrence or recurrence of a particular disease or condition, where an individual is predisposed to or at risk of developing the disease or disease recurrence, but has not yet been diagnosed with the disease or disease recurrence.

[0141] An "effective amount" refers to an amount that is at least effective to achieve a desired result, at the dosage and for the period of time required. For example, the desired result may be a therapeutic or prophylactic result. An effective amount may be provided in one or more administrations. In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect treatment of a disease or condition as described herein. In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect activation of V52+ TCR γδ T cells. In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect one or more of the following: cytolytic function, cytokine production of one or more cytokines, or proliferation of γδ T cells. An effective amount may vary depending on the disease or condition being treated or the factor being modified, and may also vary depending on the weight, age, racial background, sex, health and / or physical condition, and other factors associated with the mammal being treated. Typically, an effective amount will be within a relatively broad range (e.g., a "dosage" range) that can be determined through routine testing and experimentation by a physician. Thus, the term should not be construed to limit the disclosure to a specific amount, such as weight or number of binding proteins. An effective amount can be administered in a single dose, or in one or more repeated doses over a treatment period.

[0142] A "therapeutically effective amount" is at least the minimum concentration required to produce a measurable improvement in a particular disease or condition. The therapeutically effective amount herein can vary depending on factors such as the disease state, age, sex, and weight of the patient, and the ability of the antibody or antigen-binding fragment thereof to induce a desired response in the individual. A therapeutically effective amount is also an amount in which any toxic or detrimental effects of the antibody or antigen-binding fragment thereof are outweighed by the therapeutically beneficial effects.

[0143] As used herein, the term "prophylactically effective amount" shall be interpreted to mean an amount sufficient to prevent or inhibit or delay the onset of one or more detectable symptoms of a disease or condition, or complications thereof.

[0144] As used herein, the term "subject" shall be taken to mean any animal, e.g., a mammal, including a human. Exemplary subjects include, but are not limited to, humans and non-human primates. For example, the subject is a human. Engineered T-cell receptors

[0145] The inventors have surprisingly demonstrated that a substitution of lysine (K or Lys) to alanine (A or Ala) at position 53 of the V52+ chain having the amino acid sequence set forth in SEQ ID NO:1 enhances binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex. Thus, a TCR of the present disclosure comprises an alteration (e.g., a substitution, deletion, or insertion) at the position corresponding to lysine (K) 53 of the amino acid sequence set forth in SEQ ID NO:1, which alteration enhances binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex. In some embodiments, the alteration forms part of the CDR2δ sequence. In one example, a TCR of the present disclosure, e.g., a CDR2δ sequence, comprises an alanine at the position corresponding to lysine (K) 53 of the amino acid sequence set forth in SEQ ID NO:1.

[0146] In one embodiment of the present disclosure, the V52+ chain comprises a variable region comprising complementarity determining region (CDR)1, CDR2, and CDR3 of the TCR5 chain. For example, the V52+ chain comprises a CDR1 (CDR1 of the 52+ chain) comprising the amino acid sequence of SEQ ID NO: 31, a CDR2 (CDR2 of the 52+ chain comprising a Lys53-Ala mutation, clone G115) comprising the amino acid sequence of SEQ ID NO: 33, and an optional CDR35 sequence. One skilled in the art will appreciate that CDR2 comprises Lys53 and varies depending on the mutations incorporated into the V52+ chain and may comprise any one of the amino acids set forth in SEQ ID NOs: 143-158. The CDR35 sequence is highly variable between different clones of V52γ5 T cells. This includes non-germline (randomly generated somatic mutations) as well as recombinational diversity caused by splicing of the V, D, and J regions of the TCR5 chain. In one example, the CDR3 delta sequence comprises the amino acid sequence of SEQ ID NO: 34 (CDR3 of the delta 2+ chain). In another or further embodiment, the TCR comprises a Vgamma+ chain, e.g., a Vgamma9+ chain. For example, the Vgamma+ chain comprises complementarity determining region (CDR) 1, CDR2, and CDR3 of the TCR gamma chain. For example, the Vgamma+ chain comprises a CDR1 (CDR1 of the gamma 9+ chain) comprising the amino acid sequence of SEQ ID NO: 35, a CDR2 (CDR2 of the gamma 9+ chain) comprising the amino acid sequence of SEQ ID NO: 36, and a CDR3 (CDR3 of the gamma 9+ chain) comprising the amino acid sequence of SEQ ID NO: 37.

[0147] The present disclosure further provides a TCR comprising a Vδ2+ chain comprising or consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 5 to 7, and, optionally, a Vγ9+ chain comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 9 or 10.

[0148] TCR sequence variants include a V52+ chain comprising an amino acid sequence having at least 70% sequence identity, at least 80% sequence identity, more preferably at least 85% sequence identity, more preferably 90% or 95% sequence identity to any one of SEQ ID NOs: 5-7, and optionally a Vγ+ chain comprising an amino acid sequence having at least 70% sequence identity, at least 80% sequence identity, more preferably at least 85% sequence identity, more preferably 90% or 95% sequence identity to SEQ ID NO: 9 or 10; provided that the TCR comprises a V52+ chain having an alteration at a position corresponding to lysine (K) 53 of the amino acid sequence set forth in SEQ ID NO: 1, and that it retains the advantageous ability of the TCR assessed in the accompanying examples (also referred to herein as the "parent" TCR), i.e., binds to BTN3 or the BTN3 / BTN2 complex to the same extent, the same or a greater extent than the parent TCR. For example, the TCR may comprise a Vδ2+ chain containing a Lys53 mutation to arginine (R), asparagine (N), cysteine ​​(C), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), methionine (M), phenylalanine (F), serine (S), threonine (T), tryptophan (W), tyrosine (Y), valine (V), proline (P).

[0149] As used herein, the term "sequence identity" refers to the degree to which two (amino acid or nucleotide) sequences have identical residues at the same positions in an alignment, which is often expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of an identical sequence will have 100% identity, while sequences that are not highly conserved and have deletions, additions, or substitutions may have a lower degree of identity. Those skilled in the art will recognize that several algorithms are available for determining sequence identity using standard parameters, e.g., Blast (Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul et al., (1990) J. Mol. Biol. 215:403-410), Smith-Waterman (Smith et al., (1981) J. Mol. Biol. 147:195-197), and ClustalW. Thus, the amino acid sequence of any one of SEQ ID NOs: 1-4 can serve, for example, as a "subject sequence" or a "reference sequence."

[0150] The TCR of the present disclosure may comprise one or more further amino acid modifications, i.e. in addition to the V52+ chain modification at a position corresponding to lysine (K) 53 of the amino acid sequence shown in SEQ ID NO:1.

[0151] Amino acid modifications can be introduced into the variable or constant regions of the TCR and can serve to modulate properties such as binding strength and specificity, post-translational processing (e.g., glycosylation), thermodynamic stability, solubility, surface expression or TCR assembly. Amino acid modifications include, for example, deletions from, and / or insertions into, and / or substitutions of residues within the amino acid sequence of the parent TCR.

[0152] Exemplary substitution variants of the TCRs of the invention are those which comprise amino acid substitutions in the variable or CDRs, framework or constant regions of the TCR chains. Particularly contemplated herein are conservative amino acid substitutions.

[0153] "Conservative substitutions" can be made, for example, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the amino acid residues involved. The 20 naturally occurring amino acids can be divided into six standard amino acid groups: (1) hydrophobic: Met, Ala, Val, Leu, Ile, (2) neutral hydrophilic: Cys, Ser, Thr; Asn, Gln, (3) acidic: Asp, Glu, (4) basic: His, Lys, Arg, (5) residues that affect chain orientation: Gly, Pro, and (6) aromatic: Trp, Tyr, Phe.

[0154] As used herein, a "non-conservative substitution" is defined as the replacement of an amino acid with another amino acid listed in a different group of the six standard amino acid groups (1) to (6) shown above.

[0155] In some embodiments, substitutions may also include non-classical amino acids (e.g., selenocysteine, pyrrolidine, N'-formylmethionine β-alanine, GABA and δ-aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and common amino acid analogs). Mutations can also be made to the nucleotide sequence of the heterodimeric protein by reference to the genetic code, including taking into account codon degeneracy.

[0156] The TCR may further comprise a constant (C) region. The constant region may be a human constant region or may be derived from another species, giving rise to a "chimeric" TCR.

[0157] The TCR may be murine. Murineization of TCR (i.e., replacing the human constant regions of the TCR chains with their murine counterparts) is a commonly applied approach to improve cell surface expression of TCRs in host cells. Murine TCRs may more effectively associate with the CD3 co-receptor and / or pair preferentially with each other, and be less prone to form mixed TCRs on human T cells engineered ex vivo to express TCRs with the desired antigen specificity, but still retain and express their "original" TCRs.

[0158] One or all of the amino acid residues in the TCR constant region can be replaced with their murine counterparts. Minimal murinization (i.e., minimal amino acid exchanges) offers the advantage of enhancing cell surface expression while simultaneously reducing the number of "foreign" amino acid residues in the amino acid sequence, thereby reducing the risk of immunogenicity.

[0159] One or more cysteine ​​bonds may be added to the constant region. The addition of disulfide bonds in the constant region may promote correct pairing of TCR chains. In addition to additional cysteine ​​bridges, other useful modifications include, for example, adding leucine zippers and / or ribosome skipping sequences, such as sequence 2A from picornavirus, to increase folding, expression and / or pairing of TCR chains.

[0160] TCR constructs of the present disclosure include heterodimers and multimers in which at least one V52+ chain and at least one Vγ+ chain are covalently linked to each other. In its simplest form, a multivalent TCR construct according to the present disclosure comprises a multimer of two or three or four or more TCRs associated with each other (e.g. covalently or otherwise linked), preferably via a linker molecule.

[0161] Suitable linker molecules include, but are not limited to, multivalent adhesion molecules such as avidin, streptavidin, neutravidin and extravidin, each of which has four binding sites for biotin. Thus, biotinylated TCRs can be formed as multimers with multiple TCR binding sites. The number of TCRs in a multimer depends on the amount of TCR relative to the amount of linker molecules used to make the multimer, and also on the presence or absence of any other biotinylated molecules. Exemplary multimers are dimers, trimers, tetramers or pentamers, or higher multimeric TCR constructs. The multimers of the present disclosure can also include additional functional entities such as labels or drugs or (solid) carriers.

[0162] The TCRs of the present disclosure can be linked via a suitable linker to spheres, preferably uniform beads, more preferably polystyrene beads, most preferably biocompatible polystyrene beads. A given fluorescent dye can be incorporated into the beads.

[0163] The TCRs of the present disclosure may be fused to one or more fusion moieties including antibodies and antibody fragments. Exemplary antibody fragments that may be used include fragments of full-length antibodies, such as (s)dAb, Fv, Fd, Fab, Fab', F(ab')2 or "r IgG" ("half antibodies"), modified antibody fragments, such as scFv, di-scFv or bi(s)-scFv, scFv-Fc, scFv-zipper, scFab, Fab2, Fab3, diabodies, single chain diabodies, tandem diabodies (Tandab's), tandem di-scFv, tandem tri-scFv, minibodies, multibodies, such as triabodies or tetrabodies, and single domain antibodies, such as nanobodies, or single variable domain antibodies that comprise only one variable domain, which may be a VHH, VH or VL.

[0164] The TCR constructs of the invention may be fused to one or more antibodies or antibody fragments to give rise to monovalent, bivalent and polyvalent / multivalent constructs, thus giving rise to monospecific constructs which specifically bind to only one target antigen, as well as bispecific and multispecific / multispecific constructs which specifically bind to more than one target antigen, for example two, three or more, via separate antigen binding sites.

[0165] If necessary, a linker can be introduced between one or more of the domains or regions of the TCR construct of the present disclosure and / or one or more of the fusion components described herein. Linkers are known in the art. In general, linkers include flexible, cleavable and rigid linkers and are selected depending on the type of construct and the intended use / application. For example, in therapeutic applications, non-immunogenic flexible linkers are often preferred to ensure some flexibility or interaction between domains while reducing the risk of adverse immunogenic reactions. Such linkers are generally composed of small non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids, including the "GS" linker, which consists of a chain of Gly and Ser residues.

[0166] Particularly useful TCR constructs are those that comprise at least one V2δ+ chain and at least one Vγ+ chain (e.g., Vγ9+ chain), optionally linked together, optionally via a linker, and fused to at least one antibody or antibody fragment (e.g., single chain antibody fragment (scFv)) directed against a surface antigen or epitope. Useful antigen targets recognized by antibodies or antibody fragments (e.g., scFv) include CD3, CD28, CD5, CD16, and CD56. The constructs can generally have any structure, so long as the "TCR portion" retains its ability to recognize the antigen target as defined herein, and the "antibody portion" binds to the desired surface antigen or epitope, thereby recruiting and targeting the respective lymphocytes to the target cell. Such constructs may advantageously serve as "adapters" that link together antigen-presenting cells (such as tumor cells) and lymphocytes (such as cytotoxic T cells or NK cells) that present the antigen target. One example of such a fusion protein is a construct engineered according to the principle of bispecific T cell engagers (BiTEs®) consisting of two single chain variable fragments (scFvs) of different antibodies on a single peptide chain of about 55 kilodaltons (kD). Thus, the TCR constructs of the present disclosure may comprise at least one TCR antigen binding domain as described herein (e.g., a V52+ chain and a Vγ+ chain fused together) linked to an scFv (or other binding domain) with a desired binding specificity, such as, for example, CD3 or CD56. The scFv (or other binding domain) binds to T cells, such as via the CD3 receptor, or to CD56 for NK cell activation, and some bind to tumor cells via an antigen target specifically expressed on tumor cells. Also contemplated herein are tribodies comprising at least one TCR antigen binding domain as described herein, an scFv (or other binding domain), and an additional domain (e.g., an Fc domain) for targeting the construct, for example, to a site of action in the body.

[0167] The TCRs of the present disclosure may be provided in "isolated" or "substantially pure" form. "Isolated" or "substantially pure" as used herein means that the TCR has been separated and / or recovered from components of its production environment such that the "isolated" TCR is free or substantially free of other contaminating components from its production environment that may interfere with its therapeutic or diagnostic use. Contaminating components may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. Thus, an "isolated" TCR is prepared by at least one purification step that removes or substantially removes these contaminating components. The foregoing definition is equally applicable, mutatis mutandis, to an "isolated" polynucleotide / nucleic acid. In some embodiments, the TCR, or cells expressing the V52+ TCR, are isolated from peripheral blood or tissue of a subject (e.g., a donor or patient, e.g., a cancer patient). A modification at Lys53δ, e.g., a Lys53δ-Ala mutation, can be introduced into isolated cells using a repair template encoding a modification at Lys53, e.g., a Lys53δ-Ala mutation, e.g., by gene editing using Cas9-mediated homology-directed repair (HDR). The cells (e.g., γδ T cells) can be primary, pre-expanded or primed cells from the same donor or "off the shelf". The TCRs of the present disclosure can include one or more further modifications as described below. The modifications described below are typically covalent modifications and can be achieved using standard techniques known in the art. In some circumstances, amino acid modifications in the TCR may be required to facilitate the introduction of said modifications.

[0168] The TCRs of the present disclosure, particularly the soluble TCRs, may be labelled. Useful labels are known in the art and may be coupled to the TCR or TCR variant using routine methods, optionally via linkers of various lengths. Generally, labels are divided into various classes depending on the assay in which they are detected, examples of which include, but are not limited to: isotopic labels, which may be radioactive or heavy isotopes such as radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 89Zr, 90Y, 99Tc, 111ln, 125l, 131l); magnetic labels (e.g., magnetic particles); redox-active moieties; optical dyes (including, but not limited to, chromophores, phosphors and fluorophores), such as fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), chemiluminescent groups, and fluorophores, which may be either small molecule fluorophores or proteinaceous fluorophores; enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase); biotinylated groups; or a predetermined polypeptide epitope recognised by a secondary reporter (e.g. a leucine zipper pair sequence, a binding site for a secondary antibody, a metal binding domain, an epitope tag, etc.). Labelling is particularly envisaged where the TCR, TCR variant or particularly a soluble TCR construct is intended for diagnostic use.

[0169] The TCRs of the present disclosure, particularly soluble TCRs, may be modified by attachment of further functional moieties, for example to reduce immunogenicity, increase hydrodynamic size (size in solution), solubility and / or stability (e.g. by providing increased protection against proteolytic degradation), and / or increase serum half-life.

[0170] Exemplary functional moieties for use in accordance with the present disclosure include peptides or protein domains that bind to other proteins in the human body (e.g., serum albumin, immunoglobulin Fc (IgFc) regions, or neonatal Fc receptors), FcRn polypeptide chains of various lengths (e.g., XTEN technology or PASylation®), various polyols such as polyethylene glycol (PEGylation), polypropylene glycol, polyalkylenes, or copolymers of polyethylene glycol and polypropylene glycol, or non-proteinaceous polymers including, but not limited to, carbohydrates such as hydroxyethyl starch (e.g., HESylation®) or polysialic acid (e.g., PolyXen® technology). In some embodiments, the TCRs of the present disclosure are fused to human serum albumin or IgFc, or engineered variants thereof with altered binding affinity to FcRn.

[0171] Other useful functional moieties include "suicide switches" or "safety switches" that can be used to shut off effector host cells containing the TCR of the present disclosure in a patient. One example is the inducible caspase 9 (iCasp9) "safety switch." Briefly, effector host cells are engineered by known methods to express a caspase 9 domain, whose dimerization is dependent on a small molecule dimerizer such as AP1903 / CIP, resulting in rapid induction of apoptosis in the engineered effector cells. Other examples of "suicide switches" or "safety switches" are known in the art, including, for example, herpes simplex virus thymidine kinase (HSV-TK), expression of CD20 followed by depletion using anti-CD20 antibodies or myc tags.

[0172] Also contemplated herein are TCRs that have undergone post-translational modifications such as phosphorylation, glycosylation patterns, ubiquitination, nitrosylation, methylation, acetylation, lipidation, etc. As is known in the art, glycosylation patterns may depend on the amino acid sequence (e.g., the presence or absence of specific glycosylated amino acid residues as discussed below) and / or the host cell or organism in which the protein is produced. Glycosylation of polypeptides is typically either N-linked or O-linked. N-linked refers to the attachment of a carbohydrate moiety to the side chain of an asparagine residue. Addition of N-linked glycosylation sites to a binding molecule is conveniently accomplished by altering the amino acid sequence to include one or more tripeptide sequences selected from asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. O-linked glycosylation sites can be introduced by the addition or substitution of one or more serine or threonine residues to the starting sequence.

[0173] Another means of glycosylation of the TCR is by chemical or enzymatic coupling of glycosides to the protein. Depending on the coupling mode used, sugars can be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups, e.g., cysteine, (d) free hydroxyl groups, e.g., serine, threonine, or hydroxyproline, (e) aromatic residues, e.g., phenylalanine, tyrosine, or tryptophan, or (f) amide groups of glutamine. Similarly, deglycosylation (i.e., removal of carbohydrate moieties present on the binding molecule) can be accomplished chemically, e.g., by exposing the TCR to trifluoromethanesulfonic acid, or enzymatically, e.g., by using endo- and exo-glycosidases.

[0174] It is also contemplated that drugs, such as small molecule compounds, may be attached to the TCRs of the present disclosure, particularly soluble TCRs. Linkage may be achieved through covalent or non-covalent interactions, such as by electrostatic forces. A variety of linkers known in the art may be used to form drug conjugates.

[0175] The TCRs, particularly soluble TCRs, of the present disclosure may be modified to introduce additional domains that aid in the identification, tracking, purification and / or isolation of the respective molecules (tags). Non-limiting examples of such tags include peptide motifs known as Myc tags, HAT tags, HA tags, TAP tags, GST tags, chitin binding domains (CBD tags), maltose binding protein (MBP tags), Flag tags, Strep tags and variants thereof (e.g. Strep II tags), His tags, CD20, Her2 / neu tags, myc tags, FLAG tags, T7 tags, SpyCatcher or GFP tags, or other fluorescent or luminescent tags known in the art.

[0176] Epitope tags are useful examples of tags that can be incorporated into the TCRs of the present disclosure. Epitope tags are short stretches of amino acids that allow for the binding of specific antibodies and therefore the identification and tracking of the binding and movement of soluble TCRs or host cells in a patient's body, or cultured host cells. Detection of epitope tags, and thus tagged TCRs, can be achieved using many different techniques. Examples of such techniques include: immunohistochemistry, immunoprecipitation, flow cytometry, immunofluorescence microscopy, ELISA, immunoblotting ("Western"), and affinity chromatography. Epitope tags can have a length of, for example, 6 to 15 amino acids, particularly 9 to 11 amino acids. It is also possible to include more than one epitope tag in the TCRs of the present disclosure.

[0177] The tag may further be used to stimulate and grow host cells containing the TCR of the disclosure by culturing the cells in the presence of a binding molecule (antibody) specific for the tag.

[0178] nucleic acid The disclosure further provides nucleic acids encoding the TCRs described herein, such as polynucleotides encoding the TCR V52+ or Vγ+ (e.g., Vγ9+) chains, the TCR V52+ or Vγ+ (e.g., Vγ9+) variable regions, and TCR variants, constructs, and fragments thereof.

[0179] The term "polynucleotide" or "nucleic acid" as used herein includes sequences of polyribonucleotides and polydeoxyribonucleotides, such as modified or unmodified RNA or DNA, each in single-stranded and / or double-stranded form, linear or circular, or mixtures thereof, including hybrid molecules. Thus, nucleic acids according to the present disclosure include DNA (dsDNA, ssDNA, cDNA, etc.), RNA (dsRNA, ssRNA, mRNA, VfRNA, etc.), combinations thereof, or derivatives thereof (such as PNA).

[0180] The polynucleotides may contain traditional phosphodiester bonds or non-traditional bonds (e.g., amide bonds as found in peptide nucleic acids (PNAs)). The polynucleotides of the disclosure may also contain one or more modified bases, e.g., tritylated bases and unusual bases such as inosine. Other modifications, including chemical, enzymatic, or metabolic modifications, are contemplated, so long as the binding molecules of the invention can be expressed from the polynucleotide. The polynucleotides may be provided in an isolated form as defined elsewhere herein. The polynucleotides may contain regulatory sequences, such as transcriptional control elements (including promoters, enhancers, operators, repressors, and transcription termination signals), ribosomal binding sites, introns, and the like.

[0181] In particular, the present invention provides polynucleotides comprising or consisting of a nucleic acid that is at least about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a reference polynucleotide sequence selected from the group consisting of SEQ ID NOs: 12-17.

[0182] The above polynucleotides may or may not contain additional or altered nucleotide sequences encoding, for example, altered amino acid residues, a signal peptide directing secretion of the encoded TCR, a constant region, or other heterologous polypeptides as described herein.Such polynucleotides may thus encode fusion polypeptides, fragments, variants, and other derivatives of the binding molecules described herein.

[0183] The present invention also includes compositions comprising one or more of the above polynucleotides. Also provided herein are compositions comprising a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a V52+ chain as described herein, and the second polynucleotide encodes a Vγ+ chain (e.g., a Vγ9+ chain).

[0184] The nucleic acid sequence of the present invention can be codon-optimized for optimal expression in desired host cells, such as human lymphocytes, or for expression in bacteria, yeast or insect cells, which are particularly envisaged for the expression of the soluble TCR of the present invention. Codon optimization refers to the replacement of codons in the sequence of interest that are generally rare in highly expressed genes of a given species with codons that are generally frequent in highly expressed genes of such species, and such codons code for the same amino acid as the replaced codon. Thus, the selection of optimal codons depends on the codon usage frequency of the host genome, as well as the presence of several desirable and undesirable sequence motifs.

[0185] vector Further provided herein is a vector comprising one or more of the polynucleotides described herein. A "vector" is a nucleic acid molecule used as a vehicle to transfer (foreign) genetic material into a host cell, e.g., where it can be replicated and / or expressed.

[0186] The term "vector" encompasses, but is not limited to, plasmids, viral vectors (including retroviral vectors, lentiviral vectors, adenoviral vectors, vaccinia viral vectors, polyoma viral vectors, and adeno-associated viral vectors (AAV)), phages, phagemids, cosmids, and artificial chromosomes (including BACs and YACs). A vector is generally itself a nucleotide sequence, typically a DNA sequence that contains an insert (transgene) and a longer sequence that serves as the "backbone" of the vector.

[0187] Engineered vectors typically contain an origin for autonomous replication in a host cell (if stable expression of the polynucleotide is desired), a selectable marker, and a restriction enzyme cleavage site (e.g., a multiple cloning site, MCS).

[0188] The vector may further comprise a promoter, a genetic marker, a reporter gene, a targeting sequence, and / or a protein purification tag. Suitable vectors are known to those of skill in the art and many are commercially available.

[0189] Targeting vectors can be used to integrate polynucleotides into host cell chromosomes by methods known in the art. Briefly, suitable means include homologous recombination or the use of hybrid recombinases that specifically target the sequence of the integration site. Targeting vectors are typically circular and are linearized before being used for homologous recombination. As an alternative, the foreign polynucleotides can be DNA fragments linked by fusion or synthetically constructed DNA fragments that are then recombined into host cells. It is also possible to use non-homologous recombination, which results in random or non-targeted integration.

[0190] The vector of the present disclosure can also be an expression vector. An "expression vector" or "expression construct" can be used to transcribe heterologous polynucleotide sequences, such as those encoding the TCR of the present disclosure, in a suitable host cell, and translate their mRNA. This process is also referred to herein as "expressing" the TCR of the present disclosure. In addition to an origin of replication, a selection marker, and a restriction enzyme cleavage site, an expression vector typically contains one or more control sequences operably linked to the heterologous polynucleotide to be expressed.

[0191] The term "control sequences" refers to nucleic acid sequences necessary for the expression of an operably linked coding sequence of a (heterologous) polynucleotide in a particular host organism or host cell, and thus includes transcriptional and translational control sequences. Typically, control sequences necessary for the expression of a heterologous polynucleotide sequence in prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. In eukaryotes, a promoter, a polyadenylation signal, an enhancer, and optionally a splice signal are typically required. In addition, specific initiation and secretion signals can also be introduced into the vector to allow the secretion of the desired polypeptide into the culture medium.

[0192] A nucleic acid is "operably linked" when it is placed in a functional relationship with another nucleic acid sequence, particularly on the same polynucleotide molecule. For example, a promoter is operably linked to a coding sequence of a heterologous gene when it is capable of affecting the expression of the coding sequence of the heterologous gene. A promoter is typically placed upstream of a gene encoding a polypeptide of interest to regulate the expression of said gene.

[0193] Exemplary control sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and / or enhancers derived from cytomegalovirus (CMV) (such as the CMV promoter / enhancer), promoters and / or enhancers derived from simian virus 40 (SV40) (such as the SV40 promoter / enhancer), promoters and / or enhancers derived from adenovirus (e.g., the adenovirus major late promoter (AdMLP)), and promoters and / or enhancers derived from polyoma. Expression vectors can also include an origin of replication and a selectable marker.

[0194] Suitable selection markers for use in eukaryotic host cells include, but are not limited to, herpes simplex virus thymidine kinase (tk) gene, hypoxanthine-guanine phosphoribosyltransferase (hgprt) gene, and adenine phosphoribosyltransferase (aprt) gene. Other genes include dhfr (methotrexate resistance), gpt (mycophenolic acid resistance), neo (G-418 resistance), and hygro (hygromycin resistance). Vector amplification can be used to increase expression levels. In general, the selection marker gene can be either directly linked to the polynucleotide sequence to be expressed, or introduced into the same host cell by co-transformation.

[0195] Thus, in view of the above, the present disclosure further provides for one or more of the nucleotide sequences described herein to be inserted into (i.e., contained in) a vector. Specifically, the present invention provides for a (replicable) vector comprising a nucleotide sequence encoding a TCR of the present disclosure, or a V52+ or Vγ+ chain thereof (e.g., a Vγ9+ chain), operably linked to a promoter.

[0196] Those skilled in the art will be able to easily select a suitable expression vector based on, for example, the host cell in which TCR expression is intended. Examples of suitable expression vectors are viral vectors such as retroviral vectors, for example MP71 vectors or retroviral SIN vectors, and lentiviral vectors or lentiviral SIN vectors. A viral vector comprising a polynucleotide encoding the TCR of the present disclosure can, for example, infect lymphocytes, which will then express the heterologous TCR. Another example of a suitable expression vector is the Sleeping Beauty (SB) transposon transposase DNA plasmid system, SB DNA plasmid. The nucleic acid and / or particularly the expression construct of the present disclosure can also be transferred into cells by transient RNA transfection. Viral vectors currently used for native TCR expression typically link the TCR-δ and TCR-γ chain genes in one vector with either an internal ribosome entry site (IRES) sequence or a self-cleaving peptide (e.g., the 2A peptide sequence from porcine tsechovirus), resulting in expression of a single messenger RNA (mRNA) molecule under the control of a viral promoter in transduced cells.

[0197] host cell The disclosure further provides a host cell comprising a TCR, nucleic acid or vector described herein.

[0198] A variety of host cells can be used in accordance with the present disclosure. As used herein, the term "host cell" encompasses a cell that can be or has been a recipient of a polynucleotide or vector described herein and / or that expresses (and optionally secretes) a TCR of the present disclosure.

[0199] The terms "cell" and "cell culture" are used interchangeably to denote the source of a TCR, unless expressly specified otherwise. The term "host cell" also includes a "host cell line."

[0200] In general, the term "host cell" includes prokaryotic or eukaryotic cells, including, but not limited to, bacteria, yeast cells, fungal cells, plant cells, and animal cells, such as insect cells and mammalian cells, e.g., mouse cells, rat cells, macaque cells, or human cells.

[0201] In view of the above, the present disclosure therefore provides, inter alia, a host cell comprising a polynucleotide or vector, such as an expression vector, that comprises a nucleotide sequence encoding a TCR or TCR construct as described herein.

[0202] The polynucleotides and / or vectors of the disclosure can be introduced into a host cell by, for example, transfection, transformation, etc. using conventional methods known in the art.

[0203] "Transfection" is the process of deliberately introducing a nucleic acid molecule or polynucleotide (including a vector) into a target cell. One example is RNA transfection, the process of introducing RNA (such as in vitro transcribed RNA, ivtRNA) into a host cell. The term is primarily used for non-viral methods in eukaryotic cells.

[0204] The term "transduction" is often used to describe viral-mediated transfer of a nucleic acid molecule or polynucleotide.

[0205] Transfection of animal cells typically involves opening temporary pores or "holes" in the cell membrane to allow uptake of the substance. Transfection can be performed using calcium phosphate, by electroporation, by cell squeezing, or by mixing cationic lipids with the substance to generate liposomes that fuse with the cell membrane and release their cargo internally. Exemplary techniques for transfection of eukaryotic host cells include lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA co-precipitation), microinjection, and electroporation.

[0206] The term "transformation" is used to describe the non-viral transfer of nucleic acid molecules or polynucleotides (including vectors) into bacteria and into non-animal eukaryotic cells, including plant cells. Transformation is therefore the genetic alteration of a bacterial cell or a non-animal eukaryotic cell, which occurs by the direct uptake and subsequent incorporation of exogenous genetic material (nucleic acid molecules) from its surroundings through the cell membrane.

[0207] Transformation can occur by artificial means. For transformation to occur, cells or bacteria must be in a state of transformation receptivity, which can occur as a time-limited response to environmental conditions such as starvation or cell density. For prokaryotic transformation, techniques can include heat shock-mediated uptake, bacterial protoplast fusion with intact cells, microinjection and electroporation. Techniques for plant transformation include Agrobacterium-mediated transfer, e.g., with A. tumefaciens, high-velocity bombardment of tungsten or gold particles, electroporation, microinjection and polyethylene glycol-mediated uptake.

[0208] Accordingly, in view of the above, the present disclosure further provides a host cell comprising at least one polynucleotide sequence and / or vector as described herein.

[0209] For expression of the TCR of the present disclosure, a host cell can be selected that modulates the expression of the inserted polynucleotide sequence and / or modifies and processes the gene product (i.e., RNA and / or protein) as desired. Such modification (e.g., glycosylation) and processing (e.g., cleavage) of the gene product can be important for the function of the TCR. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of gene products. An appropriate cell line or host system can be selected to ensure correct modification and processing of the product. To this end, eukaryotic host cells can be used that possess the cellular machinery for proper processing of the primary transcript, glycosylation and phosphorylation of the gene product.

[0210] It is contemplated herein to provide (a) a host cell for expressing and obtaining a TCR of the present disclosure, particularly in a soluble form ("production host cell"), and (b) a host cell with effector function ("effector host cell") which expresses a TCR of the present disclosure. Such "effector host cells" are particularly useful for therapeutic applications and are contemplated for administration to a subject in need thereof. Preferred "effector host cells" include lymphocytes such as cytotoxic T lymphocytes (CTL), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, αβ T cells, γδ T cells, regulatory T cells, mucosal-associated invariant T (MAIT) cells, etc.

[0211] Production host cells The "production host cells" used for expression of the soluble TCRs of the present disclosure are preferably capable of expressing large amounts of recombinant protein.

[0212] Exemplary mammalian host cells that can be used as "production host cells" include Chinese hamster ovary (CHO cells), including DHFR minus CHO cells such as DG44 and DUXBI 1, NSO cells, COS cells (a derivative of CVI with SV40 T antigen), HEK293 (human kidney) cells, Expi293 cells, and SP2 (mouse myeloma) cells. Other exemplary host cell lines include, but are not limited to, HELA (human cervical carcinoma), CVI (monkey kidney line), VERY, BHK (baby hamster kidney), MDCK, 293, WI38, R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), P3x63-Ag3.653 (mouse myeloma), BFA-IcIBPT (bovine endothelial cells), and RAJI (human lymphocytes). Host cell lines are typically available from commercial services, the American Tissue Culture Collection (ATCC), or from published literature.

[0213] Non-mammalian cells such as bacteria, yeast, insect or plant cells are also readily available and can be used as "production host cells" as described above. Exemplary bacterial host cells include Enterobacteriaceae such as Escherichia coli, Salmonella, Bacillaceae such as Bacillus subtilis, Pneumococcus, Streptococcus, and Haemophilus influenza. Other host cells include yeast cells such as Saccharomyces cerevisiae and Pichia pastoris. Insect cells include, but are not limited to, Spodoptera frugiperda cells. In accordance with the foregoing, possible expression systems (i.e. host cells comprising an expression vector as described above) include microorganisms such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors, yeast (e.g. Saccharomyces, Pichia) transformed with recombinant yeast expression vectors, insect cell lines infected with recombinant viral expression vectors (e.g. Baculovirus), plant cell lines infected with recombinant viral expression vectors (e.g. Cauliflower Mosaic Virus, CaMV, Tobacco Mosaic Virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid). Mammalian expression systems, having recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., the metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter, the vaccinia virus 7.5K promoter, the cytomegalovirus (CMV) major immediate early promoter (MIEP) promoter), are often preferred.Suitable mammalian host cells can be selected from known cell lines (e.g., COS, CHO, BLK, 293, 3T3 cells), but lymphocytes such as cytotoxic T lymphocytes (CTL), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, αβ T cells, γδ T cells, regulatory T cells, mucosal-associated invariant T (MAIT) cells, etc., can also be used.

[0214] In accordance with the foregoing, the present disclosure also provides a method for producing and obtaining a TCR as described herein, comprising the steps of: (i) culturing a host cell (i.e. a production host cell) under conditions that cause expression of said TCR; and (ii) purifying said TCR.

[0215] Any purification method known in the art can be used, for example by chromatography (e.g., ion exchange chromatography (e.g., hydroxyapatite chromatography), affinity chromatography, in particular protein A, protein G or lectin affinity chromatography, size exclusion column chromatography), centrifugation, differential solubility, hydrophobic interaction chromatography, or any other standard technique for the purification of proteins. The skilled artisan will be readily able to select a suitable purification method based on the particular characteristics of the TCR to be recovered.

[0216] Effector host cells The present disclosure also provides an "effector host cell" comprising a nucleotide sequence, vector or TCR of the present disclosure. It is envisaged that said effector host cell has been modified using conventional methods to include a nucleic acid sequence encoding a TCR of the present disclosure and expresses the TCR as described herein, particularly on the cell surface. For the purposes of the present disclosure, an "modified host cell expressing a TCR of the present disclosure" generally refers to a host cell (effector or production) that has been engineered or altered to express a TCR according to the present disclosure, for example by RNA transfection. Other methods of modification or transfection or transduction, as described elsewhere herein, are also envisaged. Thus, the term "modified host cell" includes "transfected", "transduced" and "genetically engineered" host cells that preferably express a TCR of the present disclosure.

[0217] Preferably, such "(modified) effector host cells" (particularly "(modified) effector lymphocytes") are capable of mediating effector functions via intracellular signaling upon binding of the TCR to its specific antigen target. Such effector functions include, for example, release of perforin (which creates holes in the target cell membrane), release of granzymes (proteases that act intracellularly to induce apoptosis), expression of Fas ligand (which activates apoptosis in Fas-bearing target cells), and release of cytokines, preferably Th1 / Tc1 cytokines such as IFN-γ, IL-2 and TNF-α. Thus, it is envisaged that effector host cells engineered to express a TCR of the present disclosure capable of recognising and binding to its antigen target in a subject to be treated will perform the above-mentioned effector functions, thereby killing target (e.g. cancer) cells. Cytolysis of target cells can be assessed, for example, using a CTL fluorescent killing assay that detects disappearance of fluorescently labelled target cells during co-culture with TCR-transfected recipient T cells.

[0218] In view of the above, the effector host cell preferably expresses a functional TCR, i.e., one that typically comprises a V52+ chain and a Vγ (e.g., a Vγ9+ chain) as described herein, as well as the signaling subunits CD3γ, δ, ε and ζ (CD3 complex). In addition, expression of the co-receptors CD4 or CD8 may also be desired. In general, lymphocytes, i.e., T cells, that possess the necessary genes involved in antigen binding, receptor activation and downstream signaling (e.g., Lck, FYN, CD45, and / or Zap70) are particularly suitable as effector host cells. However, effector host cells that express the TCR of the present disclosure as a "binding domain" without the CD3 signaling subunit and / or the aforementioned downstream signaling molecules (i.e., capable of recognizing the antigen target as described herein, but without effecting the functions mediated by CD3 and / or the aforementioned downstream signaling molecules) are also contemplated herein. It is envisioned that such effector cells can recognize the antigen targets described herein and, optionally, provide other functions not associated with CD3 signaling and / or signaling of the aforementioned downstream signaling molecules. Examples include NK cells or innate lymphoid cells that express the TCRs of the present disclosure and can, for example, release cytotoxic granules upon recognition of their antigen targets.

[0219] Thus, cytotoxic T lymphocytes (CTL), CD8+ T cells, CD4+ T cells, natural killer (NK) cells, natural killer T (NKT) cells, MAIT cells, αβ T cells, γδ T cells, and regulatory T cells are considered useful lymphocyte effector host cells. Such lymphocytes expressing the recombinant TCRs of the present invention are also referred to herein as "modified effector lymphocytes." However, one of skill in the art will readily recognize that, in general, any component of the TCR signaling pathway that results in a desired effector function can be introduced into a suitable host cell by recombinant genetic engineering methods known in the art.

[0220] Effector host cells, particularly lymphocytes such as T cells, may be autologous host cells obtained from the subject to be treated and transformed or transduced to express the TCR of the present disclosure. Typically, recombinant expression of the TCR is achieved by using a viral vector. Techniques for obtaining and isolating cells from patients are known in the art.

[0221] For non-V52 cells, the cells are typically transfected or transduced with the TCR, for example, using lentivirus or PiggyBac transposon systems.

[0222] Alternatively, V52+ cells can use gene editing to modify their endogenous TCR, or similarly transfect or transduce the TCR into the cells.

[0223] It is particularly envisaged that the effector host cells provided herein are for therapeutic use. Further genetic modification of the host cells may be desirable to improve therapeutic efficacy, for example, when using autologous CD8+ T cells as "effector host cells", suitable further modifications include downregulation of endogenous TCR, CTLA-4 and / or PD-1 expression, and / or amplification of costimulatory molecules such as CD28, CD134, CD137, etc. Means and methods for achieving the aforementioned genetic modifications are described in the art. Methods for targeted genomic engineering of host cells are known in the art, and in addition to gene knockdown by siRNA, include the use of so-called "programmable nucleases", including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided engineered nucleases (RGENs) derived from bacterial clustered regularly interspaced short repeats palindromic sequences (CRISPR)-Cas (CRISPR-associated) system. For example, programmable nucleases such as TALENs can be used to cleave DNA regions encoding "undesirable" proteins such as PD-1, CTLA-4 or endogenous TCR, thereby reducing their expression. When T cells are used as (effector) host cells, downregulation of endogenous TCR has the advantage of reducing undesirable "mis-pairing" of endogenous and exogenous TCR chains.

[0224] soluble T cell receptor In one example, the modified TCR of the present disclosure is a soluble V52+ TCR.

[0225] Soluble V52+ TCRs useful in the present disclosure are typically heterodimers comprising a V52+ chain and a Vγ+ chain (e.g., a Vγ9+ chain), although multimers (e.g., tetramers) comprising two different γδ heterodimers or two identical γδ heterodimers are also contemplated for use in the present disclosure.

[0226] The soluble TCR of the disclosure may be provided in a substantially pure form or as a purified or isolated preparation, for example it may be provided in a form that is substantially free of other proteins.

[0227] The multiple soluble TCRs of the present disclosure can be provided in the form of a multivalent complex.Thus, in one aspect, the present disclosure provides a multivalent TCR complex comprising multiple soluble TCRs as described herein.Each of the multiple soluble TCRs is preferably identical.

[0228] In its simplest form, a multivalent TCR complex according to the invention comprises a multimer of two or three or four or more TCRs associated (e.g., covalently or otherwise linked) with each other, preferably via a linker molecule. Suitable linker molecules include, but are not limited to, multivalent adhesion molecules such as avidin, streptavidin, neutravidin and extravidin, each of which has four binding sites for biotin. Thus, biotinylated TCR molecules can be formed as multimers of T cell receptors with multiple TCR binding sites. The number of TCR molecules in a multimer depends on the amount of TCR relative to the amount of linker molecule used to make the multimer, and also on the presence or absence of any other biotinylated molecules. Preferred multimers are dimeric, trimeric or tetrameric TCR complexes.

[0229] The TCRs can be complexed into structures for use. Suitable structures for forming complexes with one or more TCRs include membrane structures such as liposomes, and solid structures, preferably particles such as beads, e.g. latex beads. Other structures that can be externally coated with TCRs are also suitable. Preferably, the structures are coated with TCR multimers rather than individual TCRs.

[0230] In the case of liposomes, the TCR or multimers thereof may be membrane bound or otherwise associated with the membrane, techniques for this are well known to those skilled in the art.

[0231] A label or another moiety, such as a toxic or therapeutic moiety, may be included in the multivalent TCR complex of the present disclosure. For example, the label or other moiety may be included in a mixed molecule multimer. One example of such a multimeric molecule is a tetramer containing three TCR molecules and one peroxidase molecule. This can be achieved by mixing the TCR and enzyme in a molar ratio of about 3:1 to produce a tetrameric complex, and isolating the desired complex from any complex that does not contain the correct ratio of molecules. These mixed molecules may contain any combination of molecules, so long as steric hindrance does not impair or significantly impair the desired function of the molecule. The location of the binding sites on the streptavidin molecule is suitable for mixed tetramers, as steric hindrance is unlikely to occur.

[0232] The TCR (or multivalent complex thereof) of the present disclosure may alternatively or additionally be associated (e.g., covalently or otherwise linked) with a therapeutic agent, which may be, for example, a toxic moiety for use in cell killing, or an immunostimulant, such as an interleukin or cytokine. The multivalent TCR complex of the present disclosure may have enhanced binding capacity for a TCR ligand, as compared to a non-multimeric T cell receptor heterodimer. Thus, the multivalent TCR complex according to the present invention is particularly useful for tracking or targeting cells presenting a particular antigen in vitro or in vivo, and is also useful as an intermediate for the production of further multivalent TCR complexes having such uses. Thus, the TCR or multivalent TCR complex may be provided in the form of a pharma- ceutically acceptable formulation for use in vivo.

[0233] The present disclosure also provides a method for delivering a therapeutic agent to a target cell, the method comprising contacting a TCR or multivalent TCR complex according to the present disclosure with a potential target cell under conditions that allow association of the TCR or multivalent TCR complex with the target cell, wherein the TCR or multivalent TCR complex is specific for a TCR ligand and has a therapeutic agent associated therewith.

[0234] In particular, soluble TCR or multivalent TCR complexes can be used to deliver therapeutic agents to the location of cells that present a particular antigen. This is believed to be useful in many situations, especially for tumors. The therapeutic agent can be delivered to exert its effect locally, but not only on the cells to which it binds. Thus, one particular strategy envisages anti-tumor molecules linked to TCRs or multivalent TCR complexes specific for tumor antigens. In some embodiments, tumor antigens (peptides) are presented on MHC molecules, and anti-tumor molecules target the MHC-antigen (peptide) complexes.

[0235] Many therapeutic agents can be used for this purpose, such as radioactive compounds, enzymes (e.g., perforin) or chemotherapeutic agents (e.g., cisplatin). To improve the localization of toxic effects to the desired location, the toxins can be prepared inside streptavidin-linked liposomes, allowing the compounds to be released slowly. This reduces the damaging effects during transport in the body and limits the toxic effects until the TCR binds to the relevant antigen-presenting cells.

[0236] Other suitable therapeutic agents include small molecule cytotoxic agents, i.e., compounds with a molecular weight of less than 700 daltons that have the ability to kill mammalian cells. Such compounds may also contain toxic metals that may have cytotoxic effects. It should further be understood that these small molecule cytotoxic agents also include prodrugs, i.e., compounds that break down or are converted under physiological conditions to release the cytotoxic agent. Examples of such agents include cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, porfimer sodium photofrin II, temozolumide, topotecan, trimetreate glucuronate, auristatin E vincristine, and doxorubicin. Peptide cytotoxins, i.e., proteins or fragments thereof that have the ability to kill mammalian cells, may also be used. Examples include ricin, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNase and RNase. Radionuclides, i.e. unstable isotopes of elements that decay with the simultaneous emission of one or more of alpha or beta particles, or gamma rays, can also be used. Examples include iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210 and 213, actinium-225 and astatine-213. Prodrugs, e.g., prodrugs of antibodies that target enzymes, and immunostimulants, i.e., moieties that stimulate the immune response, can also be used. Examples include cytokines such as IL-2, chemokines such as IL-8, platelet factor 4, melanoma growth stimulating protein, and antibodies or fragments thereof, such as anti-CD3 antibodies or fragments thereof, complement activators, heterologous protein domains, homologous protein domains, viral / bacterial protein domains and viral / bacterial peptides.

[0237] Soluble TCRs of the present disclosure can be used to modulate T cell activation by binding to BTN3 or the BTN2 / BTN3 complex, thereby inhibiting endogenous T cell binding and T cell activation. In some embodiments, the soluble TCRs can act as competitive antagonists and compete with endogenous TCRs for binding to BTN3 or BTN2 / BTN3. Soluble TCRs of the present disclosure can bind to BTN3 or the BTN2 / BTN3 complex with, for example, about a two-fold increase in avidity compared to endogenous TCRs.

[0238] Soluble TCRs and / or multivalent TCR complexes can be used in the methods of the present disclosure to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of an autoimmune disease, transplant rejection, graft versus host disease, or graft versus tumor effect. Such methods comprise administering a soluble TCR or TCR complex as described above to a subject in need thereof in an amount sufficient to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of an autoimmune disease, transplant rejection, graft versus host disease, or graft versus tumor effect in the subject.

[0239] The use of the soluble TCR and / or multivalent TCR complexes of the present disclosure may also be used in the methods of the present disclosure to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of cancer or infection. Such methods include administering a soluble TCR or TCR complex as described above to a subject in need thereof in an amount sufficient to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of cancer or infection in the subject.

[0240] As is common in anti-cancer and autoimmune therapies, the soluble TCRs or TCR complexes of the present disclosure can be used in combination with other agents for the treatment of cancer and autoimmune diseases, as well as other related conditions found in similar patient populations. The soluble V52+ TCRs of the present disclosure can be produced by any suitable method known to those skilled in the art, and are most typically produced recombinantly. According to the present disclosure, recombinant nucleic acid molecules useful for producing soluble V52+ TCRs typically include a recombinant vector and a nucleic acid sequence encoding one or more segments (e.g., chains) of the TCR.

[0241] According to the present disclosure, a recombinant vector is an engineered (i.e., artificially created) nucleic acid molecule used as a tool for manipulating a selected nucleic acid sequence and / or for introducing such a nucleic acid sequence into a host cell. Thus, a recombinant vector is suitable for use in cloning, sequencing, and / or otherwise manipulating a selected nucleic acid sequence, such as by expressing the selected nucleic acid sequence and / or delivering it into a host cell to form a recombinant cell. Such vectors typically contain heterologous nucleic acid sequences, i.e., nucleic acid sequences that are not naturally found adjacent to the nucleic acid sequence being cloned or delivered, but vectors may also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequence encoding the protein of interest (e.g., TCR chain) or that are useful for expression of the nucleic acid molecule. Vectors can be either RNA or DNA, either prokaryotic or eukaryotic, and are typically plasmids.

[0242] Typically, a recombinant nucleic acid molecule comprises at least one nucleic acid molecule of the invention operably linked to one or more transcription control sequences. As used herein, the phrase "recombinant molecule" or "recombinant nucleic acid molecule" refers primarily to a nucleic acid molecule or nucleic acid sequence operably linked to a transcription control sequence, but may be used interchangeably with the phrase "nucleic acid molecule" when such a nucleic acid molecule is a recombinant molecule as discussed herein. According to the present disclosure, the phrase "operably linked" refers to linking a nucleic acid molecule to a transcription control sequence in such a manner that the molecule can be expressed when transfected (i.e., transformed, transduced, transfected, conjugated, or conduced) into a host cell. Transcription control sequences are sequences that control the initiation, elongation, or termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator, and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in a host cell or organism into which a recombinant nucleic acid molecule is introduced.

[0243] One or more recombinant molecules of the invention can be used to produce an encoded product (e.g., a soluble V52+ TCR) of the disclosure. In one embodiment, the encoded product is produced by expressing a nucleic acid molecule described herein under conditions effective to produce the protein. One preferred method for producing the encoded protein is by transfecting a host cell with one or more recombinant molecules to form a recombinant cell. Suitable host cells for transfection include, but are not limited to, any bacterial, fungal (e.g., yeast), insect, plant or animal cell that can be transfected. The host cell can be either an untransfected cell or a cell that has already been transfected with at least one other recombinant nucleic acid molecule. The resulting protein of the invention can either remain within the recombinant cell, be secreted into the medium, be secreted into the space between two cell membranes, or be retained on the outer surface of the cell membrane. The phrase "recovering the protein" refers to recovering the entire medium containing the protein and does not necessarily imply further steps of separation or purification. The protein produced according to the present disclosure can be purified using a variety of standard protein purification techniques, including, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.The protein produced according to the present disclosure is preferably recovered in a "substantially pure" form.As used herein, "substantially pure" refers to a purity that allows for the effective use of soluble TCR in the compositions and methods of the present disclosure.

[0244] By way of example, recombinant constructs containing the relevant gamma and delta genes (e.g., nucleic acid sequences encoding the desired portions of the gamma and delta chains of a gamma delta TCR) can be synthesized de novo or produced by PCR of TCR cDNA derived from a source of gamma delta T cells (e.g., hybridomas, clones, transgenic cells) expressing the desired receptor. PCR amplification of the desired gamma and delta genes can be designed such that the transmembrane and cytoplasmic domains of the chains are removed (i.e., creating a soluble receptor). Preferably, the portions of the genes that form interchain disulfide bonds are retained so that gamma delta heterodimer formation is preserved. In addition, if desired, sequences encoding selectable markers for purification or labeling of the product or construct can be added to the construct. The amplified gamma and delta cDNA pairs are then cloned, sequence verified, and introduced into a suitable vector.

[0245] The soluble γδ TCR DNA construct is then co-transfected, for example, into a suitable host cell (e.g., a suitable insect host cell in the case of a baculovirus vector, or a suitable mammalian host cell in the case of a mammalian expression vector) that expresses and secretes the recombinant receptor into the supernatant. The culture supernatant containing the soluble γδ TCR can then be purified using various affinity columns, such as a nickel nitrilotriacetic acid affinity column. The product can be concentrated and stored. It will be apparent to one of skill in the art that other methods and protocols can be used to produce soluble TCRs for use in the present disclosure, and such methods are expressly contemplated for use herein.

[0246] Soluble TCRs are useful as diagnostic tools and as carriers or "adapters" that specifically target therapeutic agents or effector cells to, for example, cancer cells expressing the antigen target recognized by the soluble TCR.

[0247] Chimeric Antigen Receptor The cells according to the invention may express a chimeric antigen receptor (CAR). A chimeric antigen receptor (CAR) is an engineered receptor that confers specificity to immune effector cells. The extracellular domain typically comprises the variable heavy and light chains of a monoclonal antibody in a single chain variable fragment (ScFv) format. The signaling domain typically comprises the CD3 zeta chain from a TCR. CAR redirects the specificity of the cell to recognize a given antigen, e.g., a tumor antigen (e.g., independent of MHC), allowing T cells to target cancer cells for cytotoxic killing.

[0248] Characteristically, a CAR contains 1) an antibody-like extracellular domain (antigen-binding domain) that recognizes and binds to an antigen, 2) a spacer, which is linked to a 3) transmembrane domain that tethers the receptor and connects it to 4) intracellular signaling.

[0249] The antigen-binding domain is the part of the CAR that recognizes the antigen. Numerous antigen-binding domains are known in the art, including those based on the antigen-binding site of antibodies, antibody mimetics, and T-cell receptors. For example, the antigen-binding domain may comprise a single-chain variable fragment (scFv) derived from a monoclonal antibody, a natural ligand of the target antigen, a peptide with sufficient affinity for the target, a single-domain antibody, an artificial single binder such as Darpin (designed ankyrin repeat protein), or a single chain derived from a TCR.

[0250] The antigen-binding domain may include a domain that is not based on the antigen-binding site of an antibody. For example, the antigen-binding domain may include a domain based on a protein / peptide that is a soluble ligand for a surface receptor of a tumor cell (e.g., a soluble peptide such as a cytokine or chemokine), or an extracellular domain of a membrane-anchored ligand or receptor whose binding pair counterpart is expressed on a tumor cell. The antigen-binding domain may be based on a natural ligand of the antigen. The antigen-binding domain may include affinity peptides derived from a combinatorial library, or de novo designed affinity proteins / peptides.

[0251] The antigen-binding domain may bind to a tumor-associated antigen (TAA). A wide range of TAAs are known in the art, and the CAR used in the present disclosure can include any antigen-binding domain that can specifically bind to any TAA. As an example, the CAR for use in the present invention can specifically bind to the TAA listed in Table 1.

[0252] [Table 1]

[0253] The CAR can include a spacer sequence to connect the antigen binding domain with the transmembrane domain.

[0254] Spacers function to provide flexibility to overcome steric hindrance and contribute to the length to allow the antigen-binding domain to approach the target antigen / epitope. Differences in the length and composition of the spacer region can affect flexibility, CAR expression, signal transduction, epitope recognition, strength of activation output, and epitope recognition. In addition to these effects, the length of the spacer can be important to provide sufficient intercellular distance to allow immunological synapse formation.

[0255] In principle, the "optimal" spacer length depends on the location of the target epitope on the target cell and the level of steric hindrance, with a longer spacer providing more flexibility and allowing more effective access to membrane-proximal epitopes or complex glycosylated antigens, while a shorter hinge is more successful in binding membrane-distal epitopes. In practice, however, the appropriate spacer length is often determined empirically and can be tailored to each specific antigen-binding domain pair. There are numerous examples of short spacer CARs (e.g., CD19 and carcinoembryonic antigen (CEA)) and long spacer CARs (e.g., membrane-proximal epitopes of mucin 1 (MUC1), receptor tyrosine kinase-like orphan receptor 1 (ROR1)).

[0256] The spacer can be derived from, for example, amino acid sequences from CD8, CD28, IgG1, or IgG4. However, IgG-derived spacers can interact with Fcγ receptors and thus deplete CAR-T cells, potentially reducing their persistence in vivo. These effects can be avoided by choosing a different spacer region or by further engineering the spacer region based on functional or structural considerations.

[0257] The transmembrane domain anchors the CAR to the T cell membrane, but also influences the expression level, stability of the CAR, is involved in signal transduction or synapse formation, and can dimerize with endogenous signaling molecules. The transmembrane domain may be derived from natural proteins, including, for example, CD3zeta, CD4, CD8α, or CD28, or may be artificially designed.

[0258] A transmembrane domain is any protein structure that is thermodynamically stable in a membrane. It is typically an alpha helix that contains several hydrophobic residues. The presence and width of a transmembrane domain in a protein can be determined by one of skill in the art using the TMHMM algorithm (http: / / www.cbs.dtu.dk / services / TMHMM-2.0 / ).

[0259] The transmembrane domain can be selected based on the requirements of the extracellular spacer region or the intracellular signaling domain. For example, CD3ζ transmembrane may promote CAR-mediated T cell activation, since the CD3ζ transmembrane domain mediates CAR dimerization and integration into endogenous TCR. However, these beneficial effects of the CD3ζ transmembrane domain may reduce the stability of the CAR, for example, compared to CARs with a CD28 transmembrane domain. The transmembrane domain and hinge region may affect the cytokine production and activation-induced cell death (AICD) of CAR-T cells, for example, CAR-T cells with a CD8α transmembrane domain and hinge domain release less TNF and IFNγ and are less susceptible to AICD compared to CARs with these domains derived from CD28. Proper CAR-T cell signaling is best promoted by linking the proximal intracellular domain with the corresponding transmembrane domain, while CAR expression and stability may be enhanced by using the frequently used CD8α or CD28 transmembrane domains.

[0260] The intracellular domain typically comprises an immunoreceptor tyrosine-based activation motif derived from CD3ζ. More typically, the intracellular domain comprises at least one costimulatory domain in tandem with the CD3ζ intracellular signaling domain. The two most common costimulatory domains approved by the FDA are CD28 and 4-1BB (CD137). Several alternative costimulatory domains can be used, such as inducible T cell costimulator (ICOS), CD27, MYD88 and CD40, and OX40 (CD134). CARs incorporating CD28 and 4-1BB signaling may result in stronger cytokine production and improved in vivo antitumor responses.

[0261] CAR T cells can be generated by viral transduction of T cells isolated from patients or donors and can be expanded by several orders of magnitude before being administered to patients. Retroviral or lentiviral infection of T cells is the most commonly used approach, as it results in T cells with good transduction efficiency. Alternatives to viral delivery systems include the non-viral transposon systems PiggyBac and Sleeping Beauty, which use a simple "cut and paste" transposase mechanism to integrate the CAR cDNA into the host genome.

[0262] The CAR constructs of the present disclosure can include a signal peptide so that when the CAR is expressed in a cell, such as a T cell, the nascent protein is targeted to the endoplasmic reticulum and subsequently to the surface of the cell in which it is expressed.

[0263] The core of the signal peptide can contain a long stretch of hydrophobic amino acids that tend to form a single alpha helix. The signal peptide can begin with a short stretch of positively charged amino acids, which helps enforce the proper topology of the polypeptide during translocation. At the end of the signal peptide there is typically a stretch of amino acids that is recognized and cleaved by a signal peptidase. The signal peptidase can perform the cleavage during or after translocation is complete, generating a free signal peptide and a mature protein. The free signal peptide is subsequently digested by a specific protease. The signal peptide can be at the amino terminus of the molecule.

[0264] Engineered γδ+ effector cells The present disclosure also relates to cells transfected or transduced with the modified V52+ TCR of the present disclosure, and optionally with a CAR. For example, lymphocytes can be transformed with the modified V52+ TCR of the present disclosure. In this regard, the modified V52+ TCR of the present disclosure can include a transmembrane domain and a cytoplasmic domain.

[0265] Also provided herein are adoptive T cell therapies using the genetically engineered TCR-transduced T cells of the present disclosure.

[0266] Many methods have been devised to genetically modify lymphocytes ex vivo to overexpress modified TCR. Retroviral vectors are established and currently widely used, allowing for persistent and heritable TCR expression through integration into genomic DNA. For example, gamma-retrovirus-derived retroviral vectors have been utilized for lymphocyte gene transfer in clinical applications since 1990. Alternatively, HIV-based lentiviral vectors may offer advantages such as higher and more stable expression of transgenes and potentially higher safety compared to gamma-retroviral vectors. Other possible methods for gene transfer include electroporation of mRNA constructs when TCR expression is desired to be only transient, and transposon-based systems such as "piggybac" and "sleeping beauty".

[0267] The cells to be modified by the nucleic acid or vector of the present disclosure can be isolated from the patient (autologous) or donor (allogeneic), for example from the peripheral blood of the patient or donor, according to known methods. The cells can be differentiated lineage cells, for example T lymphocytes, or can be stem or progenitor cells.

[0268] The cells can be autologous or allogeneic T cells (e.g., regulatory T cells, CD4+ T cells, CD8+ T cells, αβ T cells, NKT cells, MAIT cells, or γδ T cells), NK cells, invariant NK cells, ILC cells, mesenchymal stem cells (MSCs), or induced pluripotent stem cells. When the T cells are allogeneic, they can be pooled from several donors.

[0269] In some embodiments, the T cells are derived from blood, bone marrow, lymph, umbilical cord, or lymphoid organs. In some embodiments, the cells are human cells. The cells are typically primary cells, such as cells isolated directly from a subject and / or cells isolated from a subject and frozen. In some embodiments, the cells include one or more subsets of T cells or other cell types, such as the total population of T cells, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, differentiation potential, expansion, recirculation, localization, and / or persistence capacity, antigen specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation.

[0270] T cells (e.g., CD4 + and / or CD8 + Among the subtypes and subpopulations of T cells, there are naive T (T N ) cells, effector T cells (T EFF ), memory T cells and their subtypes, such as stem cell memory T (TSC M ) cells, central memory T (TC M ) cells, effector memory T(T EM ) cells, or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TILs), immature T cells, mature T cells, NKT cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, natural and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, αβ T cells, and γδ There are T cells.

[0271] In some embodiments, the cells, e.g., for off-the-shelf technologies, are pluripotent and / or multipotent, e.g., stem cells, e.g., induced pluripotent stem cells (iPSCs).

[0272] Several approaches have been described for the induction, activation and expansion of functional effector cells. These include: autologous cells such as tumor infiltrating lymphocytes (TILs); T cells activated ex vivo using autologous antigen presenting cells (e.g., dendritic cells), lymphocytes, artificial antigen presenting cells (APCs), or beads coated with T cell ligands and activating antibodies, or cells isolated by capturing target cell membranes; allogeneic cells that naturally express anti-host tumor TCRs; and non-tumor specific autologous or allogeneic cells that have been genetically reprogrammed or "redirected" to express tumor-reactive TCRs or chimeric TCR molecules that exhibit antibody-like tumor recognition capabilities known as "T-bodies." These approaches have given rise to a number of protocols for T cell preparation and administration that can be used in the methods described herein.

[0273] In some embodiments, one or more of the T cell populations are enriched or depleted for cells that are positive for a particular marker, such as a surface marker, or cells that are negative for a particular marker. In some cases, such a marker is absent or expressed at relatively low levels in certain populations of T cells (e.g., non-memory cells) but present or expressed at relatively high levels in certain other populations of T cells (e.g., memory cells).

[0274] In some embodiments, T cells are separated from peripheral blood mononuclear cell preparations by negative selection for markers expressed on non-T cells, such as B cells, monocytes, or on other white blood cells, such as CD14+ cells. In some embodiments, a CD4+ or CD8+ selection step is used to separate CD4+ helper T cells and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further divided into subpopulations by positive or negative selection for markers expressed, or expressed to a relatively high extent, on one or more subpopulations of naive T cells, memory T cells, and / or effector T cells.

[0275] In some embodiments, the CD8+ T cells are further enriched or depleted for naive stem cells, central memory stem cells, effector memory stem cells, and / or central memory stem cells, e.g., by positive or negative selection based on surface antigens associated with each subpopulation. In some embodiments, central memory T (T CM ) Cell enrichment is performed to increase efficacy, e.g., to improve long-term survival, expansion, and / or engraftment following administration.

[0276] The cells can be further cultured with agents to stimulate cell proliferation, differentiation and / or survival, and / or enrich for a given subpopulation, if desired. For example, T cells can be rapidly expanded using non-specific T cell receptor stimulation in the presence of feeder cells, e.g., K562 artificial APCs expressing costimulatory molecules such as CD19, CD64, CD86, CD137L, and membrane-bound mutein of IL-15 (mIL15), and either interleukin-2 (IL-2) or interleukin-15 (IL-15), with IL-2 being preferred. Non-specific T cell receptor stimulation can include, for example, OKT3, a mouse monoclonal anti-CD3 antibody (available from Ortho-McNeil®, Raritan, NJ).

[0277] Alternatively or additionally, a γδ T cell stimulant may be used, such as isopentenyl pyrophosphate (IPP), an analogue of IPP (e.g., bromohydrin pyrophosphate or (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate), an inhibitor of farnesyl pyrophosphate synthase (FPPS), or an aminobisphosphonate such as zoledronate or pamidronate. The γδ T cell stimulant may be used in combination with a general T cell mitogen, for example a mitogenic cytokine such as IL-2.

[0278] Further methods of stimulating γδ T cells are known in the art and include, for example, the use of concanavalin A, anti-γδ TCR antibodies immobilized on plastic, engineered artificial antigen presenting cells as feeders, and engineered artificial antigen presenting cells coated with anti-γδ TCR antibodies.

[0279] For example, one or more in vitro assays can be used to test the functionality of transfected or transduced cells using standard methods that serve to demonstrate T cell activation. Tests include the response of T cells to activation, i.e., proliferation and extended survival, production of cytokines such as IL-2 and IFN-γ, and ability to kill target cells. The latter can be determined, for example, by directly observing the killing of target cells, but can also be determined by indirect methods that show, for example, the release of intracellular components of target cells or the production of cytotoxic molecules by T cells. Mouse models can be used to examine the function of a given TCR in vivo. Examples of both in vitro and in vivo assays are known in the art.

[0280] Functional measurements of γδ T cell immune responses The present disclosure relates to engineered TCRs that can enhance the cytolytic function, cytokine production of one or more cytokines, and / or proliferation of T cells transformed or transfected with the TCR. In some embodiments, the T cells are γδ T cells, e.g., Vδ1+ or Vδ2+ T cells. In other embodiments, the T cells are αβ T cells, e.g., CD4+ or CD8+ T cells. The number and function of T cells can be monitored by assays that detect T cells by activities such as cytokine production, proliferation, or cytotoxicity. Such activities can correlate with clinical outcomes. For example, activation of cytolytic activity can result in lysis of tumor targets or infected cells. Activation and increased cytokine production can lead to cytokine-induced cell death of tumors or other targets.

[0281] Enhancement of the cytolytic function of T cells refers to an increase in the cytotoxicity of T cells, i.e., an increase in the specific lysis of target cells by T cells. The cytolytic function of T cells can be measured, for example, by a direct cytotoxicity assay. A cytotoxicity assay typically involves subjecting a sample containing effector cells to 51 This involves mixing the cells with Cr or Europium-loaded targets (e.g., K562 cells) and measuring the release of Cr or Europium after lysis of the target cells. Surrogate targets, such as tumor cell lines, are often used. The targets can be loaded with antigens, e.g., pAg. The percentage of lysis of the target after about 4 hours of incubation is calculated by comparing it to the maximum achievable lysis of the target. Cytotoxicity assays can be used to monitor the activity of passively delivered effector cells and active immunotherapy approaches.

[0282] Activation of cytokine production of one or more cytokines by T cells refers to an increase in total cytokine production of one or more particular cytokines (e.g., IFN-γ, TNF-α, GM-CSF, IL-2, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, or IL-17A) by γδ T cells. Cytokine secretion by T cells can be detected by measuring either bulk cytokine production (by ELISA), bead-based assays (e.g., Luminex), or enumeration of individual cytokine-producing T cells (by ELISPOT assay).

[0283] In an ELISA assay, effector cells are incubated with or without target cells, and after a given time, supernatants from the cultures are harvested and added to microtiter plates coated with antibodies against cytokines of interest. Antibodies linked to detectable labels or reporter molecules are added, the plates are washed and read. Typically, a single cytokine is measured in each well, although up to 15 cytokines can be measured in a single sample. Antibodies against cytokines of interest can be covalently attached to microspheres that carry a uniform and unique ratio of fluorescent dyes. Detection antibodies conjugated to fluorescent reporter dyes are then added, and flow cytometry is performed. By gating on the specific fluorescence indicative of a particular cytokine of interest, it is possible to quantify the amount of cytokine that is proportional to the amount of reporter fluorescence.

[0284] In a bead-based assay like Luminex, the sample is usually added to a mixture of color-coded beads that are pre-coated with a capture antibody specific for the analyte. The antibody binds to the analyte of interest. A biotinylated detection antibody specific for the analyte of interest is added, forming an antibody-antigen sandwich. Fluorophore-conjugated streptavidin is added and binds to the biotinylated detection antibody. The beads are read with a flow-based detection device. One laser sorts the beads and determines the analyte detected. A second laser determines the magnitude of the fluorophore-derived signal, which is directly proportional to the amount of analyte bound.

[0285] ELISPOT assays typically involve coating 96-well microtiter plates with purified cytokine-specific antibodies, blocking the plates to prevent nonspecific absorption of random proteins, incubating cytokine-secreting T cells with stimulator cells at several different dilutions, lysing the cells with detergent, adding a labeled secondary antibody, and detecting the antibody-cytokine complexes. The end product is usually an enzyme / substrate reaction that produces a colored product that can be quantified microscopically, visually, or electronically. Each spot represents one single cell secreting the cytokine of interest.

[0286] Cytokine production of one or more cytokines by γδ T cells can also be detected by multiparameter flow cytometry. Here, cytokine secretion in γδ T cells is blocked with Brefeldin A or Monensin (both protein trafficking inhibitors act on the Golgi apparatus in different ways, but which one is best depends on the cytokine being studied) for 4-24 hours, after which the cells are surface stained for the cytokine of interest, followed by fixation and permeabilization followed by intracellular staining using a fluorophore-conjugated antibody targeting the cytokine of interest. The cells can then be analyzed by flow cytometry. It is possible to monitor immune responses in humans by characterizing the cytokine secretion patterns of T cells in peripheral blood, lymph nodes, or tissues by flow cytometry. This can be done ex vivo without BFA or monensin treatment.

[0287] Activation of γδ T cell proliferation means an increase in the number of γδ T cells. Proliferation can be measured using a lymphoproliferative assay. A sample of effector cells is mixed with various dilutions of stimulator cells. After 72-120 hours, [ 3 DNA synthesis (as a measure of proliferation) can be quantified by adding [H]thymidine and measuring the amount of radiolabeled thymidine incorporated into DNA using a gamma counter.

[0288] Indications The present disclosure relates to modified TCRs that can be used to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of a disease or condition.

[0289] Methods for the treatment of disease relate to therapeutic uses of the TCRs, vectors or effector cells of the present disclosure. In this regard, a TCR, a vector encoding a TCR, or an effector cell comprising a TCR can be administered to a subject to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of a disease or condition.

[0290] In some embodiments, the methods include isolating cells from a donor (allogeneic) or patient (autologous), preparing, treating, culturing, and / or manipulating them as described herein (to provide effector cells), and introducing or reintroducing them into the patient, before or after cryopreservation.

[0291] Alternatively, effector cells may be derived by ex vivo differentiation of inducible or embryonic precursor cells into lineage-specific cells.

[0292] In one embodiment, the cells are engineered to enhance anti-tumor or anti-pathogen activity of the cells, for example, by promoting cytotoxicity against tumor or infected cells.

[0293] The TCRs, vectors, or effector cells of the disclosure can be used to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of cancer.

[0294] The TCRs, vectors or effector cells of the disclosure may also be used to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of, an infectious disease.

[0295] The TCRs, vectors, or effector cells of the present disclosure can be used to prevent, treat, slow the progression of, prevent recurrence of, or alleviate the symptoms of an autoimmune disease. For example, regulatory T cells can be isolated from a patient (autologous) or a donor (allogeneic), e.g., from the peripheral blood of a patient or donor, engineered to express a modified TCR of the present disclosure according to known methods, and then transplanted into a patient in need thereof.

[0296] The TCRs, vectors, or effector cells of the present disclosure can optionally be used in combination with other immunosuppressive and chemotherapeutic agents, including, but not limited to, prednisone, azathioprine, cyclosporine, methotrexate, and cyclophosphamide.

[0297] The TCR, vector or effector cells can be administered intravenously, intramuscularly, subcutaneously, transdermally, intraperitoneally, intrathecally, parenterally, intrathecally, intracavitary, intraventricularly, intraarterially, or via the cerebrospinal fluid, or by any implantable or semi-implantable, permanent or degradable device. The appropriate dosage can be determined based on the type of disease to be treated, the severity and course of the disease, the clinical condition of the individual, the individual's medical history and response to treatment, and the discretion of the attending physician.

[0298] Intratumoral injection, or injection into the tumor vasculature, is contemplated, particularly for discrete, solid, accessible tumors. Local, regional or systemic administration may also be appropriate.

[0299] Pharmaceutical Compositions Suitably, in compositions or methods for administration of a TCR, vector or effector cell to a subject, the TCR, vector or effector cell is combined with a pharma- ceutically acceptable carrier, as understood in the art. Thus, one example of the disclosure provides a composition (e.g., a pharmaceutical composition) comprising a TCR, vector or effector cell combined with a pharma- ceutically acceptable carrier.

[0300] In general terms, a "carrier" refers to a solid or liquid filler, binder, diluent, encapsulating substance, emulsifier, wetting agent, solvent, suspending agent, coating, or lubricant that can be safely administered to any subject, e.g., a human. Depending on the particular route of administration, a variety of acceptable carriers known in the art can be used, e.g., as described in Remington's Pharmaceutical Sciences (Mack Publishing Co. NJ USA, 1991).

[0301] In one example, the TCR, vector, or effector cells are administered parenterally, such as subcutaneously or intravenously. For example, the TCR, vector, or effector cells are administered intravenously. In some examples, the TCR, vector, or effector cells are administered intratumorally.

[0302] The formulation of the TCR, vector or effector cells to be administered will vary depending on the route of administration and formulation (e.g., solution, emulsion, capsule) selected. A suitable pharmaceutical composition containing the TCR, vector or effector cells to be administered can be prepared in a physiologically acceptable carrier. In the case of a solution or emulsion, suitable carriers include, for example, aqueous or alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. A variety of suitable aqueous carriers are known to those skilled in the art, including water, buffered water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), dextrose solution and glycine. Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers (see generally Remington's Pharmaceutical Science, 16th Edition, Mack, Ed. 1980). The compositions may contain, as necessary, pharma- ceutically acceptable auxiliary substances required to approximate physiological conditions, such as pH adjusting and buffering agents and toxicity adjusting agents, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate.

[0303] The TCRs may be stored in liquid phase or lyophilized for storage and reconstituted in a suitable carrier prior to use according to art-known lyophilization and reconstitution procedures. EXAMPLES

[0304] To understand the molecular mode of BTN engagement by the γδ TCR, we obtained crystal structures of the BTN2A1 ectodomain, either alone ("apo") or in combination with Vγ9 Vδ2, which diffract to 3.6 Å and 2.1 Å resolution, respectively. + We elucidated the complex between the γδ TCR and either of them (Table 2).

[0305]

Table 2A

[0306]

Table 2B

[0307] BTN2A1 has been reported to exist on the cell surface primarily as a homodimer stabilized by a membrane-proximal interchain disulfide bond (MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, 487-498 e486 (2020)). The exemplified BTN2A1 construct lacked the terminal Cys residue involved in this disulfide bond and, as a result, appeared to exist as a free monomer in solution (Figure 1A). Nevertheless, the apo form of BTN2A1 contained five copies in the asymmetric unit, arranged as two head-to-tail V-shaped homodimers ("V-dimers") (Figure 2A), with the fifth copy also forming a V-dimer via crystallographic symmetry. This V-dimer was broadly reminiscent of the BTN3A1 V-dimer (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)), but the BTN2A1 V dimer formed at an angle of 59°, which was significantly wider than the BTN3A1 V dimer (49°), and the BTN2A1 V dimer was also twisted by 25° compared to the BTN3A1 V dimer (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)) (Figure 2B and Figure 1B). The V-dimer is characterized by a small interface governed by a limited array of primarily nonpolar interactions, including three π-mediated interactions, with a surface area of ​​approximately 430 Å per molecule. 2(Figure 1C and Table 3).

[0308] [Table 3]

[0309] A head-to-tail dimer of BTN2A1 was observed in both the apo structure (Fig. 2B) and in the BTN2A1-γδ TCR complex (Fig. 1D), although the latter involved only the unliganded BTN2A1 copy via crystallographic symmetry, as the head-to-tail footprint overlaps with the γδ TCR binding site. The head-to-tail dimer is approximately 1180 Å thick per molecule compared to the V dimer. 2 (Fig. 1C and Table 4), which could form following either cis or trans interactions, similar to what has been termed the BTN3A1 head-to-tail homodimer (Fig. 2B) (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)).

[0310] [Table 4A]

[0311] [Table 4B]

[0312] The asymmetric unit of the complex contained two copies of BTN2A1 arranged as a V dimer similar to the apoBTN2A1 V dimer (Fig. 1E), with one copy of BTN2A1 liganded to the γδ TCR while the other remained unliganded (Fig. 2C). BTN2A1 engaged the side of the γ chain and bound to the Vγ9-encoded IgV domain, projecting at an angle of approximately 54°, in stark contrast to αβ TCR engagement of pMHC or γδ TCR recognition of CD1d (Fig. 2D). Previous studies have suggested that the hypervariable region 4 (HV4) loop, also known as the DE loop of Vγ9, and the CDR3δ loop are involved in the binding of BTN molecules (MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, pp. 487-498 e486 (2020); CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, pp. 813-825 e814 (2019); A. Vyborova et al., gamma9delta2T cell diversity and the receptor interface with tumor cells. 130, pp. 4637-4651 (2020)).

[0313] The crystal structure revealed that the BTN2A1 binding site on Vγ9 is distal from both the CDRs and HV4 loop (>7 Å and >9 Å, respectively) and instead exposes the entire apical face of the γδ TCR solvent (Fig. 2C). The outer face of the Vγ9 germline-encoded β-sheet formed by the A, B, D, and E β-strands (ABED face) mediates binding to the β-sheet encoded by the C, F, and G β-strands (CFG face) of the BTN2A1 IgV domain (Fig. 1F), with energetic contributions from all these chains (Fig. 1G). The γδ TCR extends 468 Å upon ligation. 2 , and BTN2A1 is 477 Å 2 (BSA of all interfaces = 945Å 2 ) (Fig. 1G), which is roughly half of a typical αβTCR-pMHC complex, with the molecules tethered to each other by 14 H-bonds or salt bridges (Table 5).

[0314] [Table 5]

[0315] In the γδ TCR, the B-, D-, and E-strands of Vγ9 contributed 57%, 17%, and 11% of the BSA, respectively, and the CC'-loop, F-, and G-strands of BTN2A1 contributed 35%, 15%, and 44%, respectively. Within the BTN2A1 interface, aromatic residues Phe43, Tyr98, and Tyr105 contributed energetically with minimal conformational changes between the apo and ligand-bound states, indicating a lock-and-key mode of binding (Figure 1H). Ser41, Gln42, Phe43, and Ser44 form a CC' loop (Figure 1F), and their involvement is consistent with the overrepresentation of this loop in other IgV-mediated interfaces (SV Kundapura, UA Ramagopal, The CC' loop of IgV domains of the immune checkpoint receptors, plays a key role in receptor:ligand affinity modulation. Sci Rep 9, 19191 (2019)). Notably, the aromatic side chain of Phe43 is planar to the guanidinium moiety of the Arg20γ side chain (Figure 2E), facilitating a cation-π interaction with a predicted electrostatic binding energy of -4.6 kcal / mol.

[0316] Arg20γ also forms a water-mediated H-bond with Gln100 of BTN2A1 along with a main-chain mediated H-bond to the Tyr105 side chain hydroxyl group (Figure 2E), providing a structural basis for the importance of Arg20γ in BTN2A1 binding and pAg reactivity (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)). Similarly, mutations to Glu70γ and His85γ abrogated BTN2A1 reactivity (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)), which are connected by intrachain H-bonds and also bind to BTN2A1, with Glu70γ H-bonding to the main chain of Phe43 and Ser44, and His85γ forming van der Waals (VDW) contacts with Ser41, Gln42, and Phe43 on BTN2A1 (Figure 2F). In addition, Lys13γ in the A strand of Vγ9, which is H-bonded to Tyr105, and Lys17γ in the B strand of Vγ9, which forms a salt bridge with Asp106, contacted each other (Figure 2G). The adjacent Thr18γ is hydrogen bonded to Glu107, and Ser16γ is hydrogen bonded to the side chain of Arg96 (Figure 2H). Thus, BTN engagement by γδ TCRs is a fundamentally unique mode of ligand recognition by the immune system.

[0317] BTN3A1 is Vγ9 Vδ2 + Modulating TCR tetramer reactivity Vγ9 Vδ2 when liganded to BTN2A1 + Given the high bioavailability of the apical surface of the TCR, we chose Vγ9 Vδ2 +They hypothesized that the TCR co-engages a second ligand. Because the BTN3A1 intracellular domain binds pAg (C. Harly et al., Key implication of CD277 / butyrophilin-3 (BTN3A) in cellular stress sensing by a major human gammadelta T-cell subset. Blood 120, 2269-2279 (2012); A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)), they first tested whether the soluble BTN3A1 ectodomain could directly bind to the γδ TCR in a Vγ9 Vδ2 T cell subset lacking endogenous BTN2A1, 2A2, 2A3p, 3A1, 3A2, and 3A3. + TCR-transfected BTN2A KO .BTN3A KO HEK293T cells were probed with BTN3A1 ectodomain tetramers. Consistent with previous reports (A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)), no reactivity was detected (Figure 3A). We next investigated the effect of pAg-induced Vγ9 Vδ2 T cells lacking human BTN or BTNL molecules. + Murine NIH-3T3 fibroblasts transfected with full-length human BTN3A1, which are essentially unable to mediate T cell activation, downregulate Vγ9 Vδ2 + We tested whether all Vγ9 Vδ2 TCR tetramers could bind to the TCR tetramer. + BTN2A1 binds to the TCR tetramer (clones TCR3, TCR6, TCR7, and G115) +Compared with NIH-3T3 cells, BTN3A1 + The cells showed little, if any, staining (Figure 4A, black plots). Previous studies have demonstrated that by crosslinking BTN3A1 on the APC surface with anti-BTN3A antibody (mAb clone 20.1), BTN3A1 binds Vγ9 Vδ2 in a manner that mimics pAg loading. + It has been shown that BTN3A is converted into a stimulatory form capable of activating T cells (14, 15). Conversely, another anti-BTN3A mAb (clone 103.2) inhibits Vγ9 Vδ2 pAg. + It is a potent antagonist of T cell reactivity (14, 15). + Cross-linking of cells with agonist mAb clone 20.1 inhibited Vγ9 Vδ2 + Clear staining of TCR tetramers was induced, especially clones TCR3, TCR7 and G115 (Figure 4A, grey plots). + This is in contrast to the antagonist anti-BTN3A mAb clone 103.2, which did not induce TCR tetramer staining, nor did mAb 20.1 treatment of untransfected or BTNL3-transfected cells (Fig. 4A, dark grey plots, and Fig. 4B). KO .BTN3A KO mAb 20.1-induced BTN3A1-dependent Vγ9 Vδ2 expression was detected using HEK293T cells + A similar pattern of TCR staining was obtained (Figure 3B). + pAg-reactive Vγ9 paired with δ chain + The chimeric TCR tetramer composed of the γ chain is BTN2A1 + Reactivity to cells was maintained, but mAb 20.1 cross-linked BTN3A1 +Reactivity to BTN3A1-transfected cells did not persist, indicating that BTN3A1 reactivity, unlike BTN2A1 reactivity, is dependent on V52 and / or the CDR3δ loop (Figure 4B, Figure 3C, and Figure 3D). Thus, mAb 20.1 pretreatment of BTN3A1-transfected cells inhibits Vγ9 V52 through recognition of a second ligand, designated herein as "ligand-2." + Ligand-2 reactivity could be induced by mAb 20.1 cross-linking of BTN3A1 in both human and mouse cell lines, and unlike BTN2A1 reactivity, this binding appeared to be dependent on the V52 domain and / or the CDR3 loop, hereafter referred to as "epitope-2" (Figure 4C, schematic inset).

[0318] Lys53δ regulates the interaction with ligand-2 Since the ABED β-sheet of Vγ9 mediates binding to BTN2A1 (Figure 2C), we asked whether the symmetrically equivalent ABED β-sheet of Vδ2 is also important for pAg sensing. Jurkat cells expressing an Ala mutant in the Vδ2-encoded ABED β-sheet did not have impaired responsiveness to zoledronate (an aminobisphosphonate that increases intracellular IPP pAg), suggesting that there is no equivalent Vδ2-encoded ABED binding interface for the BTN2A1-binding domain on Vγ9 (Figures 5A, 5B, and 5C). Since pAg-mediated γδ T cell responses depend on Arg51δ and Glu52δ, both located within the CDR2δ loop ((10, 18) and Figure 5C, dark grey residues), we screened two additional mutations within this loop: Lys53δ-Ala and Asp54δ-Ala. Asp54δ-Ala had no obvious effect on the response to zoledronate, whereas G115 Vγ9 Vδ2 harboring the Lys53δ-Ala mutation + Jurkat cells expressing the TCR showed spontaneous activation, suggesting that this residue may play a role in dampening γδ T cell responsiveness to TCR stimulation (FIGS. 5A, 5B, and 5C).

[0319] These observations were compared with those of BTN3A1 + mAb 20.1-induced Vγ9 Vδ2 in cells + To match the TCR tetramer staining, we also stained G115 Vγ9 Vδ2 with the corresponding Ala substitution. + We generated a TCR tetramer (hereafter referred to as G115 tetramer). As expected, the wild-type G115 tetramer did not express BTN2A1 + BTN3A1 interacting with NIH-3T3 fibroblasts and pretreated with mAb 20.1 + G115 tetramers carrying mutations in the BTN2A1 binding site ("epitope 1"), particularly the His85γ-Ala and Arg20γ-Ala / Glu70γ-Ala / His85γ-Ala triple mutants, also interacted with BTN2A1 cells (Figures 4C, 3E, and 3F). + We were unable to stain cells pretreated with mAb 20.1, but BTN3A1 + The G115 tetramers carrying the "epitope 2" Arg51δ-Ala or Glu52δ-Ala mutations still retained the ability to interact with cells (Figures 4C, 3E, and 3F). Conversely, the G115 tetramers carrying the "epitope 2" Arg51δ-Ala or Glu52δ-Ala mutations still retained the ability to interact with cells (Figures 4C, 3E, and 3F). + Cells were readily stained, but BTN3A1 pretreated with mAb 20.1 + Lys108γ-Ala, located within CDR3γ and close to CDR2δ (5–8 Å apart), also lost its ability to react with cells after pretreatment with mAb 20.1 (Figure 4C, Figure 3E, and Figure 3F). + The G115 tetramer, which has a Lys53δ-Ala substitution, showed reduced association with cells but not with BTN2A1 (Fig. 4C, Fig. 3E, and Fig. 3F). Strikingly, the G115 tetramer, which has a Lys53δ-Ala substitution, was the mutant that autoactivated in functional assays (Fig. 5A and Fig. 5B), and was associated with BTN2A1. + Although the absence of mAb 20.1 cross-linking did not affect reactivity to BTN3A1 cells, + Cells were stained (FIGS. 4C, 3E, and 3F). Indeed, mAb 20.1 pretreatment significantly inhibited the BTN3A1 +The reactivity of the Lys53δ-Ala G115 tetramer with BTN3A1 cells was only slightly enhanced above this spontaneous interaction level (Figure 4C and Figure 3F). + The strong interaction with cells was greater than that of other Vγ9 Vδ2 antibodies tested. + This was also true for TCR clones (Figure 3G), where the Lys53δ-Ala mutation was found to be predominant in Vγ9 Vδ2 TCR clones, regardless of CDR3 sequence heterogeneity. + This was further demonstrated by genetic modification of Lys53δ-Ala in polyclonal Vγ9 Vδ2+ T cells, resulting in the majority of Vγ9Vδ2 + This resulted in enhanced binding to BTN2A1-BTN3A1 heteromers by cells (Figure 17A). The G115 tetramer, which has a compound mutation of His85γ-Ala (in epitope 1) and Glu52δ-Ala (in epitope 2), inhibited BTN2A1 + Cells and BTN3A1 pretreated with mAb 20.1 + Vγ9 Vδ2 lost the ability to interact with both Vγ9 and Vδ2 cells (Figure 4C, Figure 3E, and Figure 3F). + To further support the observation that TCR tightly associates with BTN3A1 following anti-BTN3A mAb 20.1 pretreatment, we co-stained BTN3A1- or BTN2A1-expressing cells with control SAv-PE or Vγ9 Vδ2 TCR-PE tetramers together with isotype control-AF647 (MOPC21) or anti-BTN3A-AF647 (20.1) mAb (Figure 3H). + When cells were co-stained with Vγ9 Vδ2 TCR-PE tetramer and anti-BTN3A-AF647 Ab, Förster resonance energy transfer (FRET) was observed, suggesting close proximity (<10 nm) upon co-binding to BTN3A1 transfected cells. Taken together, these data suggest that "ligand-2," either BTN3A1 itself or a closely associated molecule, binds Vγ9 Vδ2 + Vγ9 Vδ2 via “epitope 2”, which is located on the apical surface of the TCR and incorporates residues within the CDR2δ and CDR3γ loops +Within epitope 2, Lys53δ appears to act as a gatekeeper residue for accessibility to ligand-2, suggesting that cross-linking of BTN3A1 with the agonist mAb 20.1 induces a conformational change toward ligand-2 that partially circumvents this steric barrier.

[0320] BTN3A1 is Vγ9 Vδ2 + Direct ligand for TCR We next tested the hypothesis that ligand-2 is BTN3A1 and that BTN2A1 stabilizes BTN3A1 binding to the γδ TCR. To test this, we generated soluble BTN3A1-BTN2A1 ectodomain heteromeric complexes (FIG. 6A), linked them with a C-terminal leucine zipper, and showed that they bind to the Vγ9 Vδ2 TCR. + We measured whether BTN2A1-BTN3A1 could bind to epitope 2, the ligand-2 binding site on the TCR. The BTN2A1-BTN3A1 heteromeric complex retained staining with anti-BTN2A1 and anti-BTN3A1 mAbs by ELISA (Figure 6D), and consisted of two chains after purification (BTN2A1 and BTN3A1, Figures 6B-C) and crystallization (Figure 6E), suggesting the correct three-dimensional structure.

[0321] Consistent with the BTN2A1-γδ TCR docking mode (FIG. 2C), the BTN2A1 tetramer docked with the G115 TCR as well as the G115 mutants located in epitope 2, namely Glu52δ-Ala and Lys53δ-Ala. + The soluble BTN3A1 ectodomain tetramer readily stained WT cells, but not the epitope 1 mutant His85γ-Ala (FIGS. 7A and 6F). +The BTN2A1-BTN3A1 complex tetramer also failed to interact with the G115 TCR (Figure 7A and (A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)). + BTN2A1-BTN3A1 tetramers bound to WT cells, but at slightly lower levels than BTN2A1 tetramers (Figure 7A and Figure 6F). Similar to BTN2A1 tetramers, His85γ-Ala mutation completely abolished the interaction with BTN2A1-BTN3A1 tetramers, indicating a strong dependency on BTN2A1. However, unlike BTN2A1 tetramers, BTN2A1-BTN3A1 tetramer binding was greatly modulated by mutations to epitope 2. Here, Glu52δ-Ala, which was essential for G115 tetramer staining in BTN3A1-transfected cells (Figure 4C), slightly reduced reactivity to BTN2A1-BTN3A1 compared to G115 WT TCR, whereas the gatekeeper residue mutant Lys53δ-Ala led to a clear increase in BTN2A1-BTN3A1 staining intensity (Figure 7A and Figure 6F). These data demonstrate that the soluble BTN2A1-BTN3A1 ectodomain complex can bind to the γδ TCR, but unlike BTN2A1 alone, binding of the BTN2A1-BTN3A1 complex is co-dependent on epitopes 1 and 2.

[0322] We next demonstrated that the BTN2A1-BTN3A1 complex mediates Vγ9Vδ2 expression in cell-free assays. + We investigated whether the soluble G115 WT γδ TCR could co-bind epitopes 1 and 2 of the BTN2A1 TCR by using surface plasmon resonance (FIG. 7B). D= 99μM, which is in line with the K in previous studies (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020); MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, 487-498 e486 (2020)). D = 40-50 μM) but did not bind to immobilized BTN3A1 (K D (K > 4,000 μM). Consistent with a role for epitope 1 but not epitope 2 in binding to BTN2A1, soluble G115 TCR with a His85γ-Ala substitution abrogated reactivity to BTN2A1, whereas Glu52δ-Ala and Lys53δ-Ala had no effect. Interestingly, the gatekeeper mutant Lys53δ-Ala showed low levels of binding to BTN3A1 at the highest concentrations, although the predicted affinity was very weak (K D The G115 WT γδ TCR has a similar affinity to BTN2A1 (K D = 79 μM and 99 μM) to the immobilized BTN2A1-BTN3A1 complex. However, in contrast to the binding of G115 TCR to BTN2A1, Lys53δ-Ala increased the affinity (K D = 46 μM), whereas Glu52δ-Ala slightly decreased the affinity (K D = 140 μM), binding of the G115 TCR to BTN2A1-BTN3A1 was modulated by mutations within epitope 2 of the γδ TCR. Furthermore, unlike BTN2A1, the BTN2A1-BTN3A1 complex also reacted weakly with the G115 His85γ-Ala TCR (K D = 740 μM, Figure 7B). Therefore, Vγ9Vδ2 +The pattern of ligand-2 reactivity to the TCR can be recapitulated using soluble BTN2A1-BTN3A1 complexes in both cell surface staining-based and cell-free biophysical-based assays. Together, these data demonstrate that BTN3A1, along with BTN2A1, is necessary and sufficient to engage the γδ TCR via epitopes 1 and 2.

[0323] The BTN3A1 IgV domain is the same as BTN2A1 and Vγ9Vδ2 + Interacts with both TCRs BTN2A1 and BTN3A1 are located within 10 nm of each other in cis on the cell surface (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)), but it is unclear whether they directly interact. Using surface plasmon resonance, the full-length BTN3A1 ectodomain (IgV IgC) binds to K D = 500 μM to immobilized disulfide-linked BTN2A1 homodimers, but not to immobilized BTN3A1 homodimers. In contrast, the full-length BTN2A1 ectodomain bound weakly to immobilized BTN3A1 homodimers (K D The IgV domain bound to immobilized BTN2A1 homodimers (K ∼1800 μM) and did not bind to immobilized BTN2A1 homodimers (FIG. 8A), indicating that the BTN2A1 and BTN3A1 ectodomains can directly interact, albeit with low affinity. Because the BTN3A1 ectodomain exists as a homodimer and may therefore show enhanced binding due to increased avidity in SPR assays, we also examined the monomeric BTN3A1 IgV domain, which retains specific binding to BTN2A1 (K D= 1,100 μM, FIG. 8A). To understand the molecular nature of this interaction, the BTN2A1-BTN3A1 zipper complex ectodomain was crystallized. The crystal diffracted anisotropically to 5.6 Å resolution, with a single copy of each of the BTN2A1 and BTN3A1 monomers in the asymmetric unit, forming an interface through their IgV domains with a docking angle of about 29° (FIG. 8B and Table 1). The C-terminal zipper domains are flexible and were not modeled, but there was space for them in the asymmetric unit below the IgC domain. The V-shaped homodimers of both BTN2A1 and BTN3A1 were also present in crystallographic symmetry (FIG. 8B), but were twisted by about 10° and about 16°, respectively, compared to the apoV-dimer (FIG. 9A). The BTN2A1 and BTN3A1 V-dimers, respectively, were twisted by 613 Å. 2 and 678 Å 2 The total BSA is approximately 1,300 Å. 2 The BTN2A1 and BTN3A1 V dimers bind at a planar angle of approximately 80° to form a distorted W-shaped heterotetramer (Figure 8B), which can be further extended through crystallographic symmetry to the composition [BTN2A1 ホモ二量体 BTN3A1 ホモ二量体 ] nA linear polymer of (Figure 8C) could be obtained. The BTN2A1-BTN3A1 intermolecular contacts were determined based on a model that fitted the high-resolution apo-BTN2A1 and BTN3A1 structures to a low-resolution composite electron density map. Assuming no significant side chain movements, there was a network of intermolecular salt bridges including BTN2A1-Arg56 to BTN3A1-Glu106, BTN2A1-Glu35 to BTN3A1-Lys107, BTN2A1-Glu62 to BTN3A1-Lys94, and BTN2A1-Glu107 to BTN3A1-Arg44 (Figure 8D and Figure 8E, Table 6). Furthermore, in the BTN2A1-γδ TCR structure (Figure 2E), BTN2A1-Phe43, which formed a cation-π interface with Arg20 of the TCR γ chain, also formed a cation-π interface with the Arg44 side chain of BTN3A1 (electrostatic binding energy -4.7 kcal / mol, Figure 8E). There were seven additional H-bonds mediated primarily by the C-strand, CC'-loop, and C'-strand of BTN2A1 (Table 5), including the BTN2A1-Ser44 N and O atoms contacting Ser41-O and Oγ, respectively (Figure 8F). Tyr105 of BTN3A1 also made extensive contacts with BTN2A1, including a cation-π interface with the terminal amine of BTN2A1-Lys51 (binding energy -5.4 kcal / mol), and H-bonds to the BTN2A1-Glu35 and Gln100 side chains (Figure 8G).

[0324] [Table 6]

[0325] We next tested whether the same BTN3A1 residues that engaged with BTN2A1 in the W-type complex correlated with those responsible for the reported cis-association between BTN2A1 and BTN3A1 at the cell surface (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)). Of a panel of 45 BTN3A1 Ala ectodomain mutants that included residues in both the IgV and IgC domains, 40 retained cell surface expression and reactivity with the anti-BTN3A mAb clone 103.2 (Figures 10A and 10B). Mutations to five residues: Arg44-Ala, Leu96-Ala, Tyr98-Ala (and even Tyr98-Phe), Tyr105-Ala and Glu106-Ala abrogated Förster resonance energy transfer (FRET) between anti-BTN2A and anti-BTN3A mAbs (Figure 8H and Figure 10C). These residues were mapped to the CFG face of BTN3A1 and correlated closely with the crystal structure interface (Figure 10D), thereby confirming this binding mode. Thus, BTN2A1 and BTN3A1 interact through the CFG faces of their IgV domains to form W-shaped heterodimers and / or hetero-oligomers.

[0326] Using this panel of BTN3A1 Ala mutants, we determined which residues are involved in Vγ9Vδ2 + Thirty-four of the 45 mutants in the panel retained reactivity to the anti-BTN3A mAb clone 20.1 mAb (Figures 10A and 11A). Of these, six retained reactivity to the BTN3A1 mAb pretreated with mAb 20.1. +The BTN3A1 Ala mutants completely abrogated G115 tetramer staining in cells: Val39, Arg44, His85, Tyr98, Phe104 and Tyr105, and four residues that reduced G115 tetramer staining by more than 90%: Phe26, Lys37, Ser42 and Leu96 (Figures 12A and 11A). Next, the panel of BTN3A1 Ala mutants was co-expressed with BTN2A1 (WT) in NIH-3T3 cells and used to activate V52+ T cells in the presence of zoledronate. All six BTN3A1 residue Ala mutants that abrogated G115 tetramer reactivity - Val39, Arg44, His85, Tyr98, Phe104 and Tyr105 - also abrogated V52+ T cell activation, similar to Leu96 (Figures 12B and 11B). With the exception of His85, which was mapped to the ABED face, all other residues were mapped to the CFG face. These data build on previous reports that the CFG face of the BTN3A1 IgV domain is functionally important (CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, 813-825 e814 (2019)), and further suggest that these residues are important for the Vγ9Vδ2 + It is thought to be involved in binding to TCR.

[0327] BTN2A1 and BTN3A1 bind to each other using the same epitope and bind to Vγ9Vδ2 + Binds to TCR Paradoxically, Vγ9Vδ2 +Four of the seven BTN3A1 residue Ala mutants that were important for binding to the TCR (Arg44, Leu96, Tyr98, and Tyr105) were also important for binding to BTN2A1 (Figures 8H, 9A, and 10D). Similarly, many of the residues within the BTN2A1 IgV domain that contact the γδ TCR also mediated binding to BTN3A1, including Phe43, Ser44, and Glu107 (Tables 5 and 6, Figure 11C). The overlap between BTN2A1 and the γδ TCR binding domains on BTN3A1, and conversely, the overlap between BTN3A1 and the γδ TCR binding domains on BTN2A1, provides insight into how BTN2A1 and BTN3A1 interact with each other and with Vγ9Vδ2. + This raised the important question of whether BTN2A1-γδ TCR and BTN2A1-BTN3A1 crystal structures could simultaneously co-bind to the Vγ9Vδ2 TCR. Indeed, superposition of the BTN2A1-γδ TCR and BTN2A1-BTN3A1 crystal structures identified a significant steric clash (>15 Å) between BTN3A1 and the γδ TCR, suggesting that co-binding in this manner as a ternary complex is not possible (Figure ​(Figure11D). 11D). This suggests that BTN2A1 and BTN3A1 are co-ligands for each other, but not Vγ9Vδ2 TCR. + This means that they must dissociate or undergo large conformational changes before they can co-bind to the TCR.

[0328] We tested this hypothesis using BTN2A1-BTN3A1 zipper ectodomain complex tetramers containing the BTN3A1 Glu106-Ala mutant, which largely disrupts the BTN2A1-BTN3A1 ectodomain complex by FRET measurements, but has no detrimental effect on G115 tetramer reactivity to BTN3A1 (Figure 8H and Figure 12A, respectively). Compared to the BTN2A1-BTN3A1 WT tetramer, the BTN2A1 WT-BTN3A1 Glu106-Ala tetramer stained HEK-293T cells transfected with the G115 WT γδ TCR more intensely, indicating increased affinity (Figure 13A). The Glu52δ-Ala G115 γδ TCR mutant, which abrogates binding to BTN3A1, also stained strongly with the BTN2A1-BTN3A1 Glu106-Ala tetramer, suggesting that binding to the BTN2A1 "epitope 1" on the γδ TCR is enhanced by the BTN3A1 Glu106-Ala mutation. The BTN2A1 WT-BTN3A1 Glu106-Ala tetramer stained G115 WT more strongly than the BTN2A1 tetramer, but not G115 Glu52δ-Ala γδ TCR+ cells, further suggesting that the BTN2A1 WT-BTN3A1 Glu106-Ala complex may exhibit even higher affinity than the BTN2A1 tetramer. To directly measure binding affinity, we performed SPR (Figure 13B). Consistent with tetramer staining of cell lines, the G115 WT γδ TCR binds with higher affinity than the BTN2A1-BTN3A1 WT complex (K 85 μM compared to 85 μM, respectively). D = 37 μM) bound to the immobilized BTN2A1-BTN3A1 Glu106-Ala complex, and the BTN3A1 Glu106-Ala mutation inhibited Vγ9Vδ2 + These results suggest that γδ TCR affinity for the BTN2A1-BTN3A1 Glu106-Ala complex is higher than that for the G115 γδ TCR BTN2A1 interaction (K of 99 μM). D= 37 μM), supporting a model in which the presence of both BTN ligands in an accessible conformation results in enhanced affinity mediated by a simultaneous co-binding event. Thus, BTN2A1 and BTN3A1 each bind to Vγ9Vδ2 + Containing epitopes that react with distinct determinants on the TCR, these BTN epitopes are tethered to each other at the cell surface, preventing efficient TCR engagement. For example, upon conformational changes in BTN3A1, such as those mediated by the agonist clone 20.1 mAb, the BTN ectodomain becomes dissociated from Vγ9Vδ2 + They acquire the ability to simultaneously co-bind to TCRs.

[0329] To further explore this model, we lock the BTN2A1 and BTN3A1 ectodomains together in their W-shaped conformation, thereby isolating Vγ9Vδ2 + We reasoned that their reactivity to the TCR would be abrogated. To this end, we introduced cysteine ​​(Cys) residues into the CFG face of the BTN2A1 and BTN3A1 IgV domains that were optimally spaced for the formation of interchain disulfide bonds. Using the structure of the BTN2A1-BTN3A1 complex as a guide, we identified two distinct Cys pairs: BTN2A1 Gly102-Cys and BTN3A1 Asp103-Cys, and BTN2A1 Ser44-Cys and BTN3A1 Ser41-Cys (Figure 14A). Cells co-transfected with BTN2A1 Ser44-Cys and BTN3A1 Ser41-Cys, or BTN2A1 Gly102-Cys and BTN3A1 Asp103-Cys, respectively, showed a strong reduction or complete loss of G115 tetramer reactivity. However, co-expression of these Cys mutants with the corresponding WT molecules (e.g., BTN2A1 Gly102-Cys and BTN3A1 WT, or vice versa) resulted in Vγ9Vδ2 + Reactivity to TCR is preserved, and the interchain disulfide bond is Vγ9Vδ2 + This was shown to be responsible for the loss of TCR reactivity (Figure 13C).+ BTN3A1-Cys + Treatment of the cells with graded doses of the reducing agent dithiothreitol (DTT) partially restored the ability of G115 tetramers to stain these cells (FIGS. 13D and 14B).

[0330] Based on the crystal structure of BTN2A1-BTN3A1, we predicted that the soluble BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys ectodomain complex, with the C-terminal zipper removed, would take the form of an M-type tetramer consisting of a core BTN3A1 V-dimer and two ectocopies of BTN2A1, each linked to BTN3A1 via disulfide bonds (Figure 14C). 2D class averages of negative stain micrographs of the soluble BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys complex indeed revealed the presence of M-type particles, further supporting this notion (Figure 14D). Fluorescently labeled tetrameric forms of BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys heteromers were unable to stain HEK-293T cells transfected with G115γδ TCR, but pretreatment of these soluble tetrameric complexes with DTT immediately prior to staining reduced the disulfide bonds and enhanced the staining of G115γδ TCR. + Reactivity to Vγ9Vδ2 cells was restored (Figures 14E and 14F). Thus, covalent disulfide locking of BTN2A1 and BTN3A1 inhibits Vγ9Vδ2 + Disrupting this binding prevents TCR engagement and inhibits Vγ9Vδ2 + TCR reactivity is restored.

[0331] Taken together, these findings support the idea that Vγ9Vδ2 +It was found that TCRs co-bind to BTN2A1 and BTN3A1 through two spatially distinct epitopes, with BTN2A1 engaging the side of Vγ9 and BTN3A1 binding to the apical surface. BTN2A1 and BTN3A1 also interact in cis to form W-type multimers, but in so doing are unable to engage γδ TCRs. We propose that pAg sequestration by the intracellular domain of BTN3A1 induces remodeling or multimerization of the intracellular B30.2 domains, which in turn promotes allosteric changes to the ectodomains, converting them from an inactive "latent" state to an active "open change" state. The activated BTN2A1-BTN3A1 complex binds Vγ9Vδ2 + It can react with the TCR to promote γδ T cell-mediated immunity (FIG. 15).

[0332] Analogous to pMHC recognition by αβTCR, BTN molecules have emerged as important γδ TCR ligands, although their molecular recognition modes have not been fully elucidated. + The exact mechanism by which T cells recognize pAg remains unclear. Herein, we report the first structure of a TCR engaging a non-MHC or MHC-like ligand, namely BTN2A1, which engages the flank of Vγ9 to bind Vγ9Vδ2. + We also show that a second ligand, BTN3A1, binds the apical Vγ9Vδ2 TCR, leaving the apical surface of the TCR exposed. + Binding to the TCR surface is also demonstrated.

[0333] Vγ9Vδ2 +The ability of TCRs to co-bind two ligands contrasts with the recognition of MHC and MHC-like molecules by αβ T cells, which bind one-to-one stoichiometrically. Thus, γδ TCRs appear to be able to distinguish dual from single ligand binding events. As Vγ9 is often incorporated into non-pAg-reactive Vγ9 Vδ1+ TCRs, it is possible that other non-BTN γδ T cell ligands, such as MICA, CD1, or MR1, may also co-bind with BTN2A1. Similarly, BTNL3 binds Vγ4 in a manner similar to Vγ9 and BTN2A1. + It has been determined whether BTNL8 can also co-bind with gamma delta TCRs (D. Melandri et al., The gamma delta TCR combines innate immunity with adaptive immunity by utilizing spatially distinct regions for agonist selection and antigen responsiveness. 19, pp. 1352-1365 (2018); CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, pp. 813-825 e814 (2019)).

[0334] Unlike αβTCR and BCR, which directly sense exogenous Ag, pAg-reactive γδ TCR is activated by inside-out signaling via a conformational change in BTN. Therefore, additional regulatory mechanisms may be required to maintain self-tolerance of γδ T cells. To this end, we investigated two important molecular checkpoints: Vγ9Vδ2, which suppresses BTN3A1 binding, and Vγ9Vδ2, which suppresses BTN3A1 binding. + Lys53 in the CDR2 delta loop of TCR and Vγ9Vδ2 of BTN2A1 and BTN3A1 +We identified a second mechanism by which TCR-binding epitopes partner with each other in cis on the cell surface of APCs. + The ability to induce T cell autoactivation and increased BTN3A1 reactivity suggests that by avoiding the Lys53δ side chain, BTN3A1 may be able to engage adjacent epitopes such as those incorporating Arg51δ, Glu52δ and / or Lys108γ. Both BTN2A1 and BTN3A1 bind Vγ9Vδ2 + As they are ligands for the TCR but directly interact with each other, this is thought to ensure that both ligands remain in the off state but are in close proximity to each other so that conversion of the complex to its stimulatory form upon pAg triggering is rapid and efficient. The importance of the BTN2A1 V and head-to-tail dimers remains to be explored, but they are reminiscent of the reported BTN3A1 V and head-to-tail dimers (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012); S. Gu et al., Phosphoantigen-induced conformational change of butyrophilin 3A1 (BTN3A1) and its implication on Vgamma9Vdelta2 T cell activation. Proceedings of the National Academy of Sciences of the United States of America 114, E7311-E7320 (2017)). The stoichiometry of the stimulatory BTN2A1 and BTN3A1 complexes, as well as the role of pAg, need to be addressed in future studies.

[0335] Data show that BTN3A1 is Vγ9Vδ2 +We provide three lines of evidence that BTN3A1 is a direct ligand of the TCR. First, treatment of BTN3A1-transfected (but not parental) human or mouse APCs with the agonist BTN3A mAb clone 20.1 resulted in the upregulation of Vγ9Vδ2 + Vγ9Vδ2 binds to the TCR tetramer, which is distinct from BTN2A1 binding + Second, the recombinant BTN2A1-BTN3A1 complex mediates Vγ9Vδ2 TCR epitopes in a codependent manner via these same dual epitopes. + Finally, co-binding by the BTN2A1-BTN3A1 complex was reproduced in biophysical assays, suggesting that Vγ9Vδ2 + A role for alternative ligands in TCR binding was ruled out. Taken together, these observations suggest that membrane-bound full-length BTN3A1 mediates the binding of Vγ9Vδ2 + We show that the soluble BTN3A1 ectodomain can bind to the TCR, but cannot do so unless BTN2A1 is also present, presumably because a conformational change is required. It is unclear whether BTN2A1 induces a conformational change in BTN3A1 or vice versa. Recombinant BTN2A1-BTN3A1 ectodomain complexes bind Vγ9Vδ2 with similar affinity to BTN2A1 alone. + The results suggest that the energetic penalty of co-liganding BTN2A1 and BTN3A1 with each other is offset by the increased affinity achieved by having two complementary ligands. Indeed, the enhanced binding affinity of the BTN2A1-BTN3A1 Glu106 complex supports this conclusion, and furthermore, the Vγ9Vδ2 + It also suggests that a single molecule of TCR can co-bind both ligands simultaneously.

[0336] The intracellular domains of BTN2A1 and BTN3A1 both express pAg-induced Vγ9Vδ2 +It is required for T cell activation (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020); C.E. Cano et al., BTN2A1, an immune checkpoint targeting Vgamma9Vdelta2 T cell cytotoxicity against malignant cells. Cell Rep 36, 109359 (2021)), and the BTN2A1-BTN3A1 interaction is enhanced by pAg, an immune checkpoint that targets Vgamma9Vdelta2 T cell cytotoxicity against malignant cells (C.E. Cano et al., BTN2A1, an immune checkpoint targeting Vgamma9Vdelta2 T cell cytotoxicity against malignant cells. Cell Rep 36, 109359 (2021)). One interpretation of these findings is that pAg induces an association between the intracellular domains of BTN3A1 and BTN2A1. In support of this hypothesis, we show that Vγ9Vδ2 + We identified three residues within the BTN2A1 intracellular domain that are important for T cell activation: two in the C-terminal cytoplasmic tail (Thr482 and Leu488) and one in the B30.2 domain (Arg449) (Figure 16). Association of the intracellular domains provides a torsional force that may propagate through the rigid coiled-coil domain towards the ectodomain of the BTN complex. This allows the Vγ9Vδ2 TCR to initially engage BTN2A1 with high affinity, followed by Vδ2 / Vγ9 binding to BTN3A1 to communicate the presence of pAg. Taken together, our findings reveal a fundamentally different mode of immune activation and associated regulatory mechanisms that underpin γδ T cell immunity compared to αβ T cells.

[0337] Germline modification of Vδ2 in purified γδ T cells To examine whether germline modification of Vδ2-encoded Lys53δ to an Ala residue enhances the responsiveness of Vδ2 cells to the BTN2A1-BTN3A1 complex, we performed CRISPR / Cas9 template-mediated HDR on purified prestimulated Vδ2 IgG1-specific ... + γδ T cells (Figure 17). As expected, mock treatment or nucleofection with template alone did not alter BTN2A1-BTN3A1 reactivity to Vγ9Vδ2 cells (Figure 17A). Surprisingly, however, guide RNA HDR-mediated Lys53δ-Ala mutation resulted in a substantial increase in affinity of the majority of Vγ9Vδ2 cells to the BTN2A1-BTN3A1 heterotetramer. CD3 - A residual population of cells also emerged, which, as expected, are likely cells in which the double-stranded DNA break in the Vδ2 gene had been repaired by the NHEJ mechanism, resulting in an indel and therefore a null mutation (Figure 17). + To determine whether binding to cells could be modulated by changes in the BTN2A1-BTN3A1 complex, cells were stained with the BTN2A1-BTN3A1 complex (Figure 17B) or the BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys tetramer (Figure 17C), which resulted in binding to V52 and V62, respectively. + The results showed that Vδ2 cells were highly reactive and abrogated. + Modulation of TCR binding to the BTN2A1-BTN3A1 complex can be achieved by the Lys53δ-Ala TCR mutation, and / or mutations in the BTN2A1-BTN3A1 complex, such as Glu106-Ala.

[0338] Next, the Lys53δ-Ala modified primary Vγ9Vδ2 cells were tested for their ability to kill tumor targets ( FIG. 18 ). Compared to their WT counterparts, Lys53δ-Ala Vδ2 +The cells induced significantly more killing of K562 tumor targets. Addition of the bisphosphonate drug zoledronate induced even greater killing. KO Killing was BTN-specific, as K562 targets were not killed (Figure 18). + Introduction of the Lys53δ-Ala mutation into cells results in enhanced BTN2A1-BTN3A1 reactivity with a concomitant increase in tumoricidal activity.

[0339] Crystal structure of Lys53δ-Ala TCR To determine the molecular nature of the Lys53δ-Ala substitution, the crystal structure of the Lys53δ-Ala TCR in complex with BTN2A1 was solved at 2.1 Å resolution (Figure 19). As expected, no electron density for the Lys53δ side chain was observed in the Ala53δ structure. Furthermore, although there were minor changes in the backbone conformation, the cis-peptide bond observed within CDR2δ appeared to be retained. Thus, the Lys53δ-Ala mutation causes a distinct molecular change within the CDR2δ loop of Vδ2 that is associated with the gain of affinity for BTN3A1 and the BTN2A1-BTN3A1 complex.

[0340] Mutation of Lys53δ enhances binding to the BTN2A1-BTN3A1 complex Vδ2 + Mutation of Lys to Ala at position 53 of the γδ TCR resulted in enhanced binding to BTN3A1 as well as enhanced activation of γδ T cells after pAg challenge (Figures 3, 4, 5, 7, 13, 17, and 18). We next sought to determine whether mutations to other residues in Ly53δ also enhanced recognition of the BTN2A1-BTN3A1 complex by γδ T cells. KO Vγ9Vδ2 encoding substitution mutations to Ser, Trp, Ala, Pro, Cys, Met, Val, His, Tyr, Asn, Gly, Phe, Iso, Gln, Thr, Leu, Arg, Asp, and Glu were transfected into HEK293T cells. +The Lys53δ mutant of the TCR (clone G115) was transiently transfected together with CD3. Controls (untransfected, transfected with CD3 alone, or 9C2 Vγ5 Vδ1 + G115-transfected HEK293T cells bound to BTN2A1-BTN3A1 heterotetramers compared to WT(Lys)G115 TCR-transfected HEK293T cells. Surprisingly, mutation of Lys to many residues resulted in enhanced BTN2A1-BTN3A1 binding (Figure 20 and Table 7). In particular, mutation to Ser, Trp, Ala, Pro, Cys, Met, Val, His, Tyr, Asn, Gly, Phe, Iso, Gln, Thr, Leu, and Arg all resulted in elevated levels of BTN2A1-BTN3A1 binding compared to WT(Lys)G115 TCR (Figure 20 and Table 7). Most surprisingly, the residue substitutions that induced the greatest enhancement of BTN2A1-BTN3A1 binding were Ser, Trp, Ala, and Pro (Figure 20 and Table 7). Conversely, mutation to the acidic residues Asp and Glu reduced binding of the G115 TCR to BTN2A1-BTN3A1 (Figure 20 and Table 7). Thus, mutation of the Lys53δ residue to another residue in the Vδ2+ TCR promotes enhanced binding to the BTN2A1-BTN3A1 complex.

[0341] [Table 7]

[0342] method Human samples Human peripheral blood cells (PBMCs) derived from healthy donor blood from male and female donors were obtained from the Australian Red Cross Blood Service under ethics approval 17-08VIC-16 or 16-12VIC-03 ​​with ethical approval from the University of Melbourne Human Ethics Sub-Committee (1035100) and isolated via density gradient centrifugation (Ficoll-Paque PLUS GE Health care) and red blood cell lysis (ACK buffer, manufactured in-house).

[0343] cell line Jurkat (JR3-T3.5), LM-MEL-75, HEK293T and NIH-3T3 cells were maintained in RPMI-1640 (Invitrogen) supplemented with 10% (v / v) FCS (JRH Biosciences), penicillin (100 U / ml), streptomycin (100 μg / ml), Glutamax (2 mM), sodium pyruvate (1 mM), non-essential amino acids (0.1 mM) and HEPES buffer (15 mM), pH 7.2-7.5 (all from Invitrogen Life Technologies), plus 50 μM 2-mercaptoethanol (Sigma-Aldrich) (complete RMPI). Expi293F cells were purchased from ThermoFisher (cat. no. A14527) and maintained in Expi293 expression medium (ThermoFisher, A1435101).

[0344] Isolation and expansion of γδ T cells In some experiments, γδ T cells were enriched by MACS using either anti-γδ TCR-PECy7, followed by anti-phycoerythrin-mediated magnetic bead purification. + Vδ2 +γδ T cells were further purified by sorting using an Aria III (BD). Enriched γδ T cells were stimulated in vitro for 48 h with plate-bound anti-CD3ε (OKT3, 10 μg / ml, Bio-X-Cell), soluble anti-CD28 (CD28.2, 1 μg / ml, BD Pharmingen), phytohemagglutinin (0.5 μg / ml, Sigma), and recombinant human IL-2 (100 U / ml, PeproTech), and then maintained with IL-2 for 14–21 days. Cells were cultured in complete medium consisting of a 50:50 (v / v) mixture of AIM-V (Thermo Fisher) and RPMI-1640 supplemented with 10% (v / v) FCS, penicillin (100 U / ml), streptomycin (100 μg / ml), Glutamax (2 mM), sodium pyruvate (1 mM), non-essential amino acids (0.1 mM) and HEPES buffer (15 mM), pH 7.2–7.5, and 50 μM 2-mercaptoethanol.

[0345] Flow cytometry To examine the ability of γδ TCR tetramers to bind BTN molecules, NIH-3T3 cells were transfected with BTN2A1, BTN3A1, or control BTNL3 in pMIG (kindly provided by D. Vignali (Addgene, plasmid #52107) (21)) using ViaFect® (Promega) in OptiMEM™ (Gibco, Thermo-Fisher). Forty-eight hours after transfection, cells were harvested with trypsin, filtered through a 30 or 70 μm cell strainer, and incubated with anti-BTN3A antibody (clone 20.1) or IgG1, kappa isotype control (clone MOPC-21, BioLegend, or BM4-1, kindly provided by CSL Limited) at 5 μg / mL for 15 min at room temperature. Cells were then stained with PE-labeled γδ TCR tetramer (in-house produced, see below) or control PE-conjugated streptavidin at 5 μg / mL for 30 min at room temperature. The median fluorescence intensity (MFI) of γδ TCR tetramer interacting with BTN protein was calculated using the gated GFP +Cells were examined by flow cytometry. For γδ TCR tetramer staining, data were excluded if BTN3A1 mutant protein levels were more than 2-fold lower than wild-type BTN3A1 as determined by anti-BTN3A mAb staining. To examine the ability of BTN tetramers to bind γδ TCR, HEK293T cells were co-transfected with γδ TCR gene in pMIG using FuGENE® HD (Promega) in OptiMEM™ and 2A-linked CD3εδγζ in pMIG. 48 hours after transfection, cells were harvested by pipetting, filtered through a 30 or 70 μm cell strainer, and stained with anti-CD3ε antibody for 15 min at 4°C. Cells were then stained with anti-γδ TCR, anti-TCR Vδ2, as well as PE-labeled BTN tetramers (produced in-house, see below), PE-labeled control mouse CD1d ectodomain tetramers (loaded with α-GalCer, produced in-house, see below), or control PE-conjugated streptavidin (BD) for 30 min at 4°C. Gated CD3 + GFP + The MFI of BTN tetramers on cells was measured by flow cytometry. In other assays, human peripheral blood derived cells were stained with various combinations of antibodies against CD3ε, γδ TCR, TCR Vδ2, CD45, CD25, CD69, and / or isotype control (IgG1, kappa clone MOPC-2) in addition to 7-aminoactinomycin D (7-AAD, Sigma) or LIVE / DEAD® viability markers (ThermoFisher) (Table 8). All data were acquired on an LSRFortessa™ II (BD) and analyzed using FACSDiva and FlowJo (BD) software. All samples were gated using time, forward scatter area vs. height, and viability dye parameters, respectively, to exclude unstable events, doublets, and dead cells.

[0346] [Table 8]

[0347] Generation of BTN2A.BTN3A knockout cells HEK293T cells were nucleofected with the Cas9 / RNP complex and two guide RNAs, one targeting the intronic region immediately upstream of BTN3A2 (5'-AACTTTCACCTACAAACCGC; SEQ ID NO:38) and the other targeting the intronic region downstream of BTN2A1 (5'-GAACCCTGACTGAAACGATC; SEQ ID NO:39). The guides were designed using the Broad Institute's CRISPick web tool (HK Kim et al., Deep learning improves prediction of CRISPR-Cpf1 guide RNA activity. Nat Biotechnol 36, 239-241 (2018)). After 7 days of culture, RNP+ cells were bulk sorted (FACS Aria III) and single cells were sorted after another round of culture. To confirm excision of the BTN locus, expanded clones were genotyped using PCR primers targeting BTN3A2, BTN2A1 and the excised locus (Table 9).

[0348] [Table 9]

[0349] Jurkat assay 2.5 x 10 per well of a 96-well plate 4 APC (LM-MEL-75) cells were plated and incubated overnight, followed by 2 × 10 4 G115 mutant-expressing J.RT3-T3.5 (Jurkat) cells were treated with ±zoledronate (40 μM) for 20 hours. GFP + CD69 expression on Jurkat cells was measured by flow cytometry. +A panel of 15 single residue alanine (Ala) mutants within the V52 domain of G115 TCR was generated by either site-directed mutagenesis using the primers listed in Table 6 or by cloning gene fragments (IDT). After phosphorylation (PNK, NEB) of the primers (IDT), 25 cycles of PCR were performed using G115 WT TCR in pMIG as template using KAPA HiFi Master Mix (KAPA Biosystems), and PCR products were digested with DpnI (NEB) and, in some cases, ligated with T4 DNA ligase (NEB). The sequences of the constructs were confirmed by Sanger sequencing before use.

[0350] γδ T cell functional assay For co-culture assays, NIH-3T3 cells were transfected with BTN2A1 in combination with wild-type or mutant BTN3A1, or separately with control BTNL3 and BTNL8 in pMIG using ViaFect® in OptiMEM™. 48 hours after transfection, NIH-3T3 cells (3×10 4 ) were harvested and transferred to a 96-well plate, and purified and in vitro expanded Vδ2 + γδ T cells (2 × 10 4 The cells were incubated with 100 μM IgG1 + zoledronate (5 μM) and 100 μM IgG1 + ...

[0351] Detection of Förster resonance energy transfer NIH-3T3 cells were transfected with BTN2A1 in combination with wild-type or mutant BTN3A1, or control BTN2A1 transfected with PDL2 / BTN3A1 transfected with CD80 in pMIG containing ViaFect® in OptiMEM™. 48 hours after transfection, NIH-3T3 cells (3×104 Cells (100 cells) were harvested with trypsin, filtered through a 30-70 μm cell strainer, and stained with anti-BTN2A1-AlexaFluor 647 (clone 259) and BTN3A-PE (clone 103.2) or isotype controls (clones BM4-2a and MOPC-21, respectively) for 30 min at 4 °C. + The frequency of cells identified as GFP-gated + AlexaFluor647 + PE + NIH-3T3 cells were probed. For FRET experiments, data were excluded if BTN3A1 mutant protein levels were more than 2-fold lower than BTN3A1 WT, as determined by anti-BTN3A (clone 103.2) mAb staining.

[0352] Preparation of soluble proteins and tetramers Soluble human BTN2A1-BTN3A1 ectodomains, or BTN2A1 ectodomains containing a C-terminal Cys (Cys247) and either an acidic or basic leucine zipper (24), together with soluble γδ TCR, BTN1A1, BTN2A1 lacking Cys247, BTN3A1, BTN3A1 IgV domain, and mouse CD1d ectodomain, were transfected with mammalian Expi293F or MGAT1 ectodomains using ExpiFectamine or PEI, respectively. null(GNTI) HEK-293S cells were transiently transfected with pHL-sec vector DNA encoding constructs with a C-terminal biotin ligase (AviTag™) and a His6 tag (AR Aricescu, W. Lu, EY Jones, A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr 62, 1243-1250 (2006)). Proteins were purified from culture supernatants using immobilized metal affinity chromatography (IMAC) and gel filtration and enzymatically biotinylated using BirA (in-house production). Proteins were repurified by size-exclusion chromatography and stored at -80°C. Biotinylated proteins were tetramerized with streptavidin-PE (BD) at a molar ratio of 4:1.

[0353] Structure determination BTN2A1 and G115 γδ TCR (WT or Lys53δ-Ala) were mixed at a 1:1 molar ratio (15 mg / ml in Tris-buffered saline pH 8) and crystallized in 20% polyethylene glycol (PEG) 3350 / 0.2 M sodium malonate / malonic acid pH 7.0 at 20 °C, apoBTN2A1 (10 mg / ml in Tris-buffered saline pH 8) was crystallized in 1.65 M ammonium sulfate / 2% (v / v) PEG 400 / 0.1 M HEPES pH 8 at 20 °C, and the BTN2A1-BTN3A1 zippered complex (1 mg / ml in Tris-buffered saline pH 8) was crystallized in 6% (w / v) PEG 6000 / 0.1 M magnesium sulfate / 0.1 M HEPES pH 6 at 20 °C by dropwise vapour diffusion (C3 facility, CSIRO, Crystallization was performed using the MX2 (3ID1) beamline at Australian Synchrotron. Crystals of BTN2A1-G115 γδTCR, apo-BTN2A1, and the BTN2A1-BTN3A1 zippered complex were flash frozen in mother liquor containing 27.5% (w / v) PEG / 0.2 M sodium malonate, 1.8 M ammonium sulfate / 2% (v / v) PEG 400 / 15% (v / v) glycerol, or in well liquor containing 20% ​​(v / v) glycerol, respectively. Data were collected at 100K using the MX2 (3ID1) beamline at Australian Synchrotron equipped with an Eiger detector operating at 100Hz.Data were integrated using iMosflm version 7.3.0 (T.G. Battye, L. Kontogiannis, O. Johnson, H.R. Powell, A.G. Leslie. iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 67, 271-281 (2011)) and anisotropy correction was applied to the data, processed using the Aimless package in CCP4 for BTN2A1-G115 γδTCR and submitted to the STARANISO Server (Global Phasing Ltd.) (staraniso.globalphasing.org / cgi-bin / staraniso.cgi) for apoBTN2A1 and the BTN2A1-BTN3A1 zippered complex with anisotropy cutoff.ApoBTN2A1 was analyzed by molecular replacement using the IgV and IgC domains of bovine BTN1A1 as separate search ensembles (PDB code 4HH8 (A. Eichinger, I. Neumaier, A. Skerra. The extracellular region of bovine milk butyrophilin exhibits closer structural similarity to human myelin oligodendrocyte glycoprotein than to immunological BTN family receptors. Biol Chem, (2021)) and BTN2A1-G115 γδTCR was analyzed by molecular replacement using the G115 TCR (PDB code 1 HXM (TJ Allison, CC Winter, JJ Fournie, M. Bonneville, DN Garboczi. Structure of a human gammadelta T-cell antigen receptor. Nature 411, 820-824 (2001)) and monomeric BTN2A1. The BTN2A1-BTN3A1 zippered complex was analyzed using monomeric BTN2A1 and BTN3A1 (PDB code 4F80 (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)) with Phaser (P.D. Adams et al., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213-221 (2010)).Refinement of the BTN2A1-G115 γδTCR was performed by iterative rounds of model building to the experimental map in Coot and refinement with Buster version 2.10.4 (Global Phasing) using non-crystallographic symmetry (NCS) restraints applied to BTN2A1, except for residues at the TCR binding interface (OS Smart et al., Exploiting structure similarity in refinement: automated NCS and target-structure restraints in BUSTER. Acta Crystallogr D Biol Crystallogr 68, 368-380 (2012)). Refinement of apoBTN2A1 and the BTN2A1-BTN3A1 zippered complex were similarly restrained against unliganded copies of BTN2A1 from the BTN2A1-G115 γδTCR or BTN3A1 from 4F80, except for residues at the interface. Structural models were solved using the CCP4 suite version 7.1 (M. D. Winn et al., Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235-242 (2011)). Molecular diagrams were created using PyMOL (Schrodinger). Cation-π interactions were determined as described (32). Angles were calculated between the centers of mass of the Ig domains or, in some cases, the intersection of two planes defined by three points each. Modeling was performed using AlphaFold 2.0 (J. Jumper et al., Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021)).

[0354] Surface plasmon resonance SPR experiments were performed at 25 °C on a Biacore T200 instrument (GE Healthcare) using 10 mM HEPES-HCl (pH 7.4), 150 mM NaCl, 3 mM EDTA, and 0.05% Tween 20 buffer. Biotinylated BTN ectodomain was immobilized at 1,500-2,000 resonance units (RU) on a Biacore sensor chip SA pre-immobilized with streptavidin. Soluble BTN molecules or G115 γδ TCR were serially diluted 2-fold and injected simultaneously over the test and control surfaces at a rate of 30 μl / min. After subtraction of data from a control flow cell (BTN1A1) and blank injections, interactions were analyzed using Biacore T200 evaluation software (GE Healthcare), Scrubber (Biologic) and Prism version 9 (GraphPad) to derive equilibrium dissociation constants at equilibrium.

[0355] Electron microscope Soluble BTN2A1 Gly130-Cys BTN3A1 Asp132-Cys complexes were enzymatically digested with thrombin to remove the C-terminal leucine zipper, repurified by size-exclusion and anion-exchange chromatography, and spotted onto glow-discharged 400-mesh thin carbon-coated copper grids for 30 s in 380 μg / ml TBS, followed by negative staining with 2% w / v uranyl acetate. Grids were viewed at a nominal magnification of 52,000x on an FEI Tecnai F30 (Eindhoven, NL) 300 kV transmission electron microscope. Seventeen micrographs were acquired with a CETA (Thermofisher, USA) camera with a pixel size of 3.7 Å. Particles were sampled using blob sampling followed by 2D class averaging in cryoSPARC (A. Punjani, JL Rubinstein, DJ Fleet, MA Brubaker, cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290-296 (2017)), with 10,238 particles contributing to the final set of 2D class averages.

[0356] statistical analysis γδ T cell functional assays were analyzed by two-way ANOVA with Sidak's correction when comparing γδ T cell activation (CD25+) across different BTN variants with and without treatment. All independent data points are biological replicates.

[0357] Germline modification of Vδ2 in purified γδ T cells Primary V52+ T cells were enriched from PBMCs using anti-PE magnetic beads (Miltenyl) after staining with anti-PE-cy7 γδ TCR mAb (clone: ​​11F2 at 1:20 dilution). Cells were stimulated on plates coated with anti-CD3 (clone: ​​UCHT1, at 5 μg / mL) and soluble anti-CD 28 (clone: ​​T44, at 10 μg / mL) in medium containing 10 U / mL IL-2. Three days later, cells were nucleofected with guide RNAs targeting the CDR2δ region proximal to Lys53 of the Vδ2 chain (guide RNA#1: GACTTTCATATACCGAGAAA (SEQ ID NO: 76); guide RNA#2 GGCCATAGATGTCCTTTTCT (SEQ ID NO: 77) plus a HDR single-stranded oligonucleotide template encoding the Lys53δ-Ala point mutation (Alt-R HDR oligonucleotide sequence: A*C*CTT GGA AAT TGT CTT TGA AAC CAG GGC CAT AGA TGT CCG CCT CTC GGT ATA TGA AAG TCA TTG TGT TAC CTT GGG TCT T*C*C, where * represents a phosphorothioate linkage (SEQ ID NO: 78)). Cells were maintained for an additional 7 days, at which point they were screened by flow cytometry. Tumor killing assays were performed 10 days after nucleofection.

[0358] Activation of Vδ2 T cells in the absence of phosphoantigen BTN2A1, BTN3A1, or BTN2A1-BTN3A1 zipper complex, or control protein, were immobilized at 10 μg / mL on 96-well tissue culture plates overnight at 4° C. In one group, the BTN2A1-BTN3A1 zipper complex was preincubated overnight with thrombin to cleave the zipper. The plates were washed to remove unbound ligand, and purified pre-expanded V52 + Cells were added and CD25 expression was measured in gated cells after overnight co-culture.

[0359] DNA constructs encoding point mutations of lysine 53 of the TCR-delta chain to alternative amino acids were synthesized (IDT, USA) and cloned into the pMIG mammalian expression plasmid (clone G115) containing the P2A-linked full-length Vγ9Vδ2 TCR. These G115 constructs were expressed together with pMIG-containing CD3 complexes in BTN2A.BTN3A using FuGENE HD (Promega). KO The ectodomains were co-transfected into HEK293T cells. Two days later, cells were stained with tetramerized PE-labeled BTN2A1-BTN3A1 heteromers. Heteromers consisted of the WT ectodomain or alternatively contained Glu106-Ala in BTN3A1 or both the BTN2A1 Gly102-Cys and BTN3A1 Asp103Cys mutations. Cells were co-stained with 7-AAD vital dye (Thermo Fisher Scientific), mouse anti-human CD3e BUV395 (BD), pan-γδ TCR PECy7 (BD), and TRDV2 BV711 (Biolegend) and acquired on a flow cytometer LSR Fortessa (BD).

Claims

1. 1. A modified T cell receptor (TCR) or binding fragment thereof, wherein the modified TCR comprises a V52+ chain, the V52+ chain comprising an alteration at a position corresponding to lysine (K) 53 of the amino acid sequence set forth in SEQ ID NO:1, and wherein the alteration enhances binding of the TCR to BTN3A1 or the BTN2A1 / BTN3A1 complex compared to binding of a TCR that does not comprise the alteration.

2. 2. The modified TCR or binding fragment thereof of claim 1, wherein the modification is lysine (K) to alanine (A), lysine (K) to arginine (R), lysine (K) to asparagine (N), lysine (K) to cysteine ​​(C), lysine (K) to glutamine (Q), lysine (K) to glycine (G), lysine (K) to histidine (H), lysine (K) to isoleucine (I), lysine (K) to leucine (L), lysine (K) to methionine (M), lysine (K) to phenylalanine (F), lysine (K) to serine (S), lysine (K) to threonine (T), lysine (K) to tryptophan (W), lysine (K) to tyrosine (Y), or lysine (K) to valine (V), or lysine (K) to proline (P).

3. The modified TCR or binding fragment thereof of claim 1, wherein the modification is a substitution of lysine (K) with alanine (A), lysine (K) with cysteine ​​(C), lysine (K) with methionine (M), lysine (K) with serine (S), lysine (K) with tryptophan (W), lysine (K) with valine (V), or lysine (K) with proline (P).

4. The modified TCR or binding fragment thereof of claim 1, wherein the Vδ2+ chain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:

1.

5. The modified TCR or binding fragment thereof of claim 1, wherein the modified TCR comprises a Vγ9+ chain.

6. The modified TCR or binding fragment thereof of claim 5, wherein the Vγ9+ chain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:

9.

7. The modified TCR or binding fragment thereof of claim 1, further comprising a TCR delta constant domain and / or a TCR gamma constant domain.

8. The modified TCR or binding fragment thereof of claim 7, wherein the modified TCR comprises a TCR delta chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO: 8, and / or a TCR gamma chain comprising an amino acid sequence having at least 70% identity to SEQ ID NO:

11.

9. The modified TCR or binding fragment thereof of claim 1, wherein the TCR is a native TCR, a TCR variant, a TCR fragment, or a TCR construct.

10. The modified TCR or binding fragment thereof of claim 5, wherein the modified TCR comprises a V52+ chain and a V59+ chain covalently linked to each other.

11. The modified TCR or binding fragment thereof of claim 1, wherein the TCR is a TCR heterodimer or multimer.

12. 2. The modified TCR or binding fragment thereof of claim 1, wherein the TCR is capable of binding to a phosphoantigen.

13. 2. The modified TCR or binding fragment thereof of claim 1, further comprising one or more fusion components optionally selected from an Fc receptor, an Fc domain including IgA, IgD, IgG, IgE, and IgM, a cytokine including IL-2 or IL-15, a toxin, an antibody or antigen-binding fragment thereof including an anti-CD3, anti-CD28, anti-CD5, anti-CD16 or anti-CD56 antibody or antigen-binding fragment thereof, CD247 (CD3-zeta), CD28, CD137, and CD134 domains, or combinations thereof, and optionally further comprising at least one linker.

14. The modified TCR or binding fragment thereof of claim 1, wherein the TCR is conjugated to an antigen-binding domain, optionally via a linker.

15. The modified TCR or binding fragment thereof of claim 14, wherein the antigen-binding domain is an scFv.

16. The TCR or binding fragment thereof of claim 14, wherein the antigen is selected from CD3, CD28, CD5, CD16, CD19, CD33, CD56, GD2, and EGFR.

17. The modified TCR or binding fragment thereof of claim 1, which is soluble.

18. 2. The modified TCR or binding fragment thereof of claim 1, conjugated to the transmembrane and intracellular signaling domains of a chimeric antigen receptor (CAR), optionally via a linker.

19. 19. The modified TCR or binding fragment thereof of claim 18, wherein the transmembrane domain is derived from CD3-zeta, CD4, CD8, or CD28.

20. 19. The modified TCR or binding fragment thereof of claim 18, wherein the intracellular signaling domain comprises the CD3 zeta chain of the TCR and, optionally, one or more costimulatory molecules.

21. The modified TCR or binding fragment thereof of claim 20, wherein the one or more costimulatory molecules are selected from DAP10, CD28, CD27, 4-1BB, OX40, CD30, IL2-R, IL7-R, IL21-R, NKp30, NKp44 and DNAM-1 (CD226).

22. 19. The modified TCR or binding fragment thereof of claim 18, wherein the transmembrane domain is linked to the intracellular domain via a spacer region.

23. 23. The modified TCR or binding fragment thereof of claim 22, wherein the spacer region is derived from an immunoglobulin domain of an Fc receptor, CD8α, CD28, a TCR β chain or the extracellular domain of NKG2D.

24. The modified TCR or binding fragment thereof of claim 1 further comprising at least one label.

25. 2. One or more nucleic acids encoding the modified TCR of claim 1.

26. i) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 16, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 18 26. The one or more nucleic acids of claim 25, comprising:

27. i) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 17, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 20 26. The one or more nucleic acids of claim 25, comprising:

28. 10. One or more vectors comprising one or more nucleic acids encoding the modified TCR or binding fragment thereof of claim 1.

29. A cell comprising a modified TCR or binding fragment thereof according to claim 1, one or more nucleic acids according to claim 25, or one or more vectors according to claim 28.

30. 30. The cell of claim 29, which is a lymphocyte.

31. 31. The cell of claim 30, wherein the lymphocyte is selected from a cytotoxic T lymphocyte (CTL), a CD8+ T cell, a CD4+ T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, a regulatory T cell, a mucosal-associated invariant T (MAIT) cell, an αβ T cell, and a γδ T cell.

32. 30. The cell of claim 29, further comprising a chimeric antigen receptor (CAR), the CAR comprising (i) an antigen-binding domain, (ii) a transmembrane domain, and (iii) an intracellular signaling domain, wherein the intracellular signaling domain provides a stimulatory signal to the T cell upon binding of an antigen to the antigen-binding domain.

33. The cell of claim 32, wherein the antigen-binding domain is capable of binding to a tumor-associated antigen (TAA).

34. The cell of claim 32, wherein the antigen-binding domain is capable of binding to CD3, CD28, CD5, CD16, CD19, CD33, CD56, GD2, or EGFR.

35. A method for obtaining a modified TCR or a binding fragment thereof according to any one of claims 1 to 24, comprising the steps of: (i) incubating the cell of claim 29 under conditions that cause expression of the modified TCR; and (ii) purifying the TCR The method includes:

36. (i) a modified TCR or a binding fragment thereof according to any one of claims 1 to 24; (ii) one or more nucleic acids according to any one of claims 25 to 27; (iii) one or more vectors according to claim 28, and (iv) the cell of claim 29, and (v) optionally, one or more pharma- ceutically acceptable excipients; A composition comprising one or more of:

37. 1. A method for modifying a cell, comprising: (i) providing a cell; and (ii) introducing into a cell one or more nucleic acids according to any one of claims 25 to 27 or one or more vectors according to claim 28; and (iii) optionally culturing the cells; The method includes:

38. A cell obtainable by the method of claim 37.

39. A modified TCR or binding fragment thereof according to any one of claims 1 to 24, one or more nucleic acids according to any one of claims 25 to 27, one or more vectors according to claim 28, or a cell according to any one of claims 29 to 34 or 38, or a composition according to claim 36, for use as a medicament.

40. 37. A modified TCR or binding fragment thereof according to any one of claims 1 to 24, one or more nucleic acids according to any one of claims 25 to 27, one or more vectors according to claim 28, or a cell according to any one of claims 29 to 34 or 38, or a composition according to claim 36, for use in the detection, diagnosis, prognosis, prevention and / or treatment of cancer or an infectious disease.

41. 23. A method for preventing, treating, delaying the progression of, preventing the recurrence of, or alleviating a symptom of, cancer or an infectious disease, comprising administering to a subject in need thereof a modified TCR or binding fragment thereof according to any one of claims 1 to 24, one or more nucleic acids according to any one of claims 25 to 27, one or more vectors according to claim 28, or a cell according to any one of claims 29 to 34, or 38, or a composition according to claim 36.

42. 1. A method for detecting the presence of cancer or an infectious disease in a subject in vitro, comprising: (i) providing a sample from a subject; and (ii) contacting the sample with a modified TCR or binding fragment thereof according to any one of claims 1 to 24, one or more nucleic acids according to any one of claims 25 to 27, one or more vectors according to claim 28, or a cell according to any one of claims 29 to 34 or 38, or a composition according to claim 36 to form a complex; and (iii) detecting the complex, wherein detection of the complex indicates the presence of cancer or an infectious disease in the subject. The method includes:

43. 29. One or more nucleic acids according to claim 25 or one or more vectors according to claim 28 for producing modified lymphocytes.

44. 37. A modified TCR or binding fragment thereof according to any one of claims 1 to 24, one or more nucleic acids according to any one of claims 25 to 27, one or more vectors according to claim 28, or a cell according to any one of claims 29 to 34 or 38, or a composition according to claim 36, for use in the prevention and / or treatment of autoimmune diseases, transplant rejection, graft-versus-host disease, or graft-versus-tumor effect.

45. 23. A method for preventing, treating, delaying the progression of, preventing the recurrence of, or alleviating a symptom of an autoimmune disease, transplant rejection, graft versus host disease, or graft versus tumor effect, comprising administering to a subject in need thereof a modified TCR or binding fragment thereof of any one of claims 1 to 24, one or more nucleic acids of any one of claims 25 to 27, one or more vectors of claim 28, or a cell of any one of claims 29 to 34, or 38, or a composition of claim 36.

Images