Gene therapy for the treatment of mucopolysaccharidosis type IIIA.

Abstract

Provided herein is a recombinant AAV (rAAV) comprising an AAV capsid and a vector genome packaged within the AAV capsid, the vector genome comprising an AAV 5' inverted terminal repeat (ITR), an engineered nucleic acid sequence encoding a functional hSGSH, optionally including stabilizing amino acid changes, a regulatory sequence that directs expression of hSGSH in a target cell, and an AAV 3' ITR. Also provided are pharmaceutical compositions comprising the rAAV described herein in a formulation buffer, and methods of treating a human subject diagnosed with MPS IIIA.

Description

[Background technology]

[0001] Mucopolysaccharidosis type IIIa (MPSIIIa, MPSIIIA, or Sanfilippo syndrome type A) is an autosomal recessive genetic disorder caused by a deficiency of the enzyme N-sulfoglycosamine sulfohydrolase (SGSH), involved in the lysosomal catabolism of the glycosaminoglycan (GAG) heparan sulfate. The deficiency leads to the intracellular accumulation of undegraded heparan sulfate and gangliosides GM2 and GM3 in the central nervous system, causing neuronal dysfunction and neuroinflammation. The disease first manifests around 3 years of age as cognitive delay, followed by abnormal hyperactivity and aggressive behavior. Disease progression then leads to loss of motor and neurological function during the first decade, with death at a median age of 15 years.

[0002] Medications (such as anticonvulsants for seizures) are used to alleviate symptoms and improve quality of life. Hematopoietic stem cell transplantation does not seem to significantly alleviate neuropsychological deterioration. Although recombinant enzymes are available for the deficiency in MPS III, trials with enzyme replacement therapy (ERT) have not been favorable for improving prognosis because the enzyme is not able to enter the central nervous system. For example, Germaine L Defendi.Genetics of See Mucopolysaccharidosis Type III. Medscape. March 21, 2014. Dietary changes do not prevent disease progression, but limiting milk, sugar, and dairy products has helped some people with excess mucus.

[0003] Various gene therapy approaches have been described as having the potential for effective treatment of MPSIIIA. However, current constructs have not achieved the desired level of therapeutic efficacy, and there is no standard of care or cure for the treatment of Sanfilippo syndrome. There is a continuing need in the art for compositions and methods for the effective treatment of MPS IIIA. Summary of the Invention

[0004] Provided herein is a therapeutic recombinant replication-deficient adeno-associated virus (rAAV) that contains an engineered nucleic acid sequence encoding a functional human N-sulfoglycosamine sulfohydrolase (hSGSH), a regulatory sequence that directs expression in a target cell. In one aspect, provided herein is an rAAV comprising an adeno-associated virus (AAV) capsid and a vector genome, the vector genome comprising an AAV 5' inverted terminal repeat (ITR), an expression cassette, and an AAV 3' ITR, the expression cassette comprising an engineered nucleic acid sequence encoding a functional human N-sulfoglycosamine sulfohydrolase (hSGSH), the hSGSH coding sequence comprising a signal peptide sequence and a mature hSGSH coding sequence, the mature hSGSH coding sequence having a nucleic acid sequence of a sequence of SEQ ID NO: 16, or (a) a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 16 encoding SEQ ID NO: 23, or (b) a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 16 encoding SEQ ID NO: 23, the hSGSH coding sequence being operably linked to a regulatory control sequence that directs expression of hSGSH in a cell. In certain embodiments, the rAAV comprises the mature hSGSH coding sequence of SEQ ID NO: 22 (hSGSH.A482Y-E488V) that encodes SEQ ID NO: 23. In certain embodiments, the signal peptide sequence is a native signal sequence having the nucleic acid sequence of SEQ ID NO: 31, or a sequence that encodes SEQ ID NO: 32 and is at least about 95% identical to SEQ ID NO: 31. In certain embodiments, the signal peptide is an exogenous signal peptide, and the exogenous signal peptide sequence is a BiP signal peptide sequence having the nucleic acid sequence of SEQ ID NO: 29, or a sequence that encodes SEQ ID NO: 30. In certain embodiments, the hSGSH coding sequence comprises a BiP signal sequence at the amino terminus of mature hSGSH (the 5' end of the mature hSGSH coding sequence) and a vIGF2 peptide at the carboxy terminus of mature hSGSH (the 3' end of the mature hSGSH coding sequence), and a nucleic acid sequence of SEQ ID NO:20, or a sequence that encodes SEQ ID NO:21 and is at least about 95% identical to SEQ ID NO:20. In certain embodiments, the hSGSH coding sequence comprises a nucleic acid sequence of SEQ ID NO:26, or a sequence that encodes SEQ ID NO:27 and is at least about 95% identical to SEQ ID NO:26. In some embodiments, the regulatory sequence further comprises one or more of a CB7 promoter, a Kozak sequence, an intron, an enhancer, a TATA signal, and a polyadenylation (polyA) signal sequence, and optionally, the regulatory sequence further comprises a WPRE element.

[0005] In certain embodiments, the vector genome comprises the nucleic acid sequence (i) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.rBG SEQ ID NO: 3), (ii) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.rBG SEQ ID NO: 7), (iii) CB7.CI.hSGSHcoV1.rBG SEQ ID NO: 10), (iv) CB7.CI.hSGSHcoV1-4xmiR183.rBG SEQ ID NO: 13), (v) CB7.CI.BIP.hSGS Hcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.rBG SEQ ID NO: 40), (vi) CB7.CI.BIP.hSGSHcov1(A482Y-E488V).vIGF2.WPRE.4xmiR183.rBG SEQ ID NO: 1), or (vii) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.4xmiR183.rBG (SEQ ID NO: 14 or a sequence at least 95% identical to SEQ ID NO: 14). In certain embodiments, the capsid is an AAVhu68 capsid, an AAVhu95 capsid, or an AAVrh91 capsid.

[0006] In a further aspect, provided herein are compositions and pharmaceutical compositions comprising the rAAV or vector described herein and an aqueous suspension medium. In certain embodiments, the rAAV or composition thereof is for use in the treatment of Mucopolysaccharidosis III A (MPS IIIA or Sanfilippo Syndrome A) and / or for use in improving walking or mobility, reducing tremors, reducing spasticity, improving posture, or reducing the progression of vision loss in a subject in need of treatment for Mucopolysaccharidosis III A.

[0007] In another aspect, a method is provided for treating a subject with MPS IIIA, alleviating symptoms of MPS IIIA, or delaying the progression of MPS IIIA. The method comprises administering to a subject in need thereof an effective amount of a rAAV or vector described herein. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal administration, intracisternal administration, or intraventricular administration ...ventricular administration, or intraventricular administration. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal administration, intraventricular administration, or intraventricular administration. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal 9 GC ~ approx. 1 × 10 per gram of brain mass 13 It is formulated for administration at a dose of GC.

[0008] In certain embodiments, provided herein is a nucleic acid molecule comprising an expression cassette selected from SEQ ID NOs: 2, 5, 8, 11, and 14. In certain embodiments, the nucleic acid molecule is a plasmid. In certain embodiments, a packaging cell is provided comprising the expression cassette, vector genome, or plasmid.

[0009] These and other aspects of the invention will become apparent from the following detailed description of the invention. [Brief description of the drawings]

[0010] [Figure 1A] Various designed hSGSH constructs are shown that contain the wild-type (WT) mature SGSH coding sequence and further contain either the endogenous signal sequence or the binding immunoglobulin protein (BiP) signal sequence, a linker, a vIGF2 peptide (i.e., a peptide that binds to the CI-MPR), and / or a lysosomal cleavage sequence. [Figure 1B] 1 shows the expression levels of secreted SGSH in the HEK293 cell medium 3 days after transfection, analyzed using Western blot. [Figure 1C] Quantified SGSH expression levels (from Western blot analysis; Fig. 1B ) plotted as normalized SGSH secretion levels are shown. [Figure 2A]1 shows the expression levels of secreted SGSH in the HEK293 cell medium 4 days after transfection, analyzed using Western blot. [Figure 2B] Quantified SGSH expression levels (from Western blot analysis; Fig. 2A ) plotted as normalized SGSH secretion levels are shown. [Figure 2C] FIG. 1 shows a schematic diagram of a further engineered mature SGSH coding sequence for use in constructs containing the BiP signal sequence and vIGF2 peptide. [Figure 3A] Shown is SGSH enzyme activity from serum samples collected from mice administered AAVhu68.hSGSH (1x1010 GC or 1x1011 GC) on day 7 of the study. [Figure 3B] Shown is SGSH enzyme activity from serum samples collected from mice administered AAVhu68.hSGSH (1x1011 GC or 1x1011 GC) on day 28 of the study. [Figure 4A] SGSH enzyme activity from homogenized liver tissue samples collected from mice administered 1×10 10 GC and 1×10 11 GC is shown. [Figure 4B] SGSH enzyme activity from homogenized brain tissue samples collected from mice administered 1×10 10 GC and 1×10 11 GC is shown. [Figure 5A] Expression levels of SGSH analyzed from liver tissue homogenate samples from mice administered AAVhu68.hSGSH at doses of 1×10 10 GC and 1×10 11 GC are shown. [Figure 5B] The quantified expression levels of SGSH analyzed by Western blot (shown in FIG. 5A) are shown. [Figure 6A] Shows expression and quantification of SGSH in the cortex following administration of AAVhu68.hSGSH containing a WPRE. [Figure 6B] Shows expression and quantification of SGSH in the cerebellum following administration of AAVhu68.hSGSH containing a WPRE. [Figure 6C]Shows expression and quantification of SGSH in the hippocampus following administration of AAVhu68.hSGSH containing WPRE. [Figure 6D] Shows expression and quantification of SGSH in the brainstem following administration of AAVhu68.hSGSH containing a WPRE. [Figure 7A] FIG. 1 shows the results of SGSH protein concentration, plotted as ng / g, analyzed from liver tissue samples collected from mice administered AAVhu68.hSGSH at doses ranging from 1×10 10 GC to 1×10 11 GC. [Figure 7B] Correlation between SGSH enzyme activity (measured using a fluorescent assay) and signal peptide assays performed on liver samples collected from mice administered a high dose of AAVhu68.hSGSH (Figure 7A, 1 x 1011 GC) is shown. [Figure 8A] Figure 1 shows an end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. The average size (μm2) of LAMP1 positive cells in the cerebellum is shown. [Figure 8B]Figure 1 shows an end point analysis of lysosomal compartment reduction as examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. Percent LAMP1 area in the cerebellum is shown. [Figure 8C] Figure 1 shows an end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. The average size (μm2) of LAMP1 positive cells in the brainstem is shown. [Figure 8D]Figure 1 shows an end point analysis of lysosomal compartment reduction as examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. Percent LAMP1 area in the brainstem is shown. [Figure 8E] Figure 1 shows an end point analysis of lysosomal compartment reduction as examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. The average size (μm2) of LAMP1 positive cells in the cortex is shown. [Figure 8F]Figure 1 shows an end point analysis of lysosomal compartment reduction as examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a low dose (1x1010) of AAVhu68.hSGSH. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. Percent LAMP1 area in the cortex is shown. [Figure 9A] Figure 1 shows end-point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. Average size (μm2) of LAMP1 positive cells in the cerebellum is shown. [Figure 9B] Figure 1 shows endpoint analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. Percent LAMP1 area in the cerebellum is shown. [Figure 9C]Figure 1 shows end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. The average size (μm2) of LAMP1 positive cells in the brainstem is shown. [Figure 9D] Figure 1 shows end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. Percent LAMP1 area in the brainstem is shown. [Figure 9E] Figure 1 shows end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. The average size (μm2) of LAMP1 positive cells in the cortex is shown. [Figure 9F]Figure 1 shows end point analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered a high dose (1x1011) of AAVhu68.hSGSH. G6 and G7 (KO and WT PBS controls) as in Figure 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2. Percent LAMP1 area in the cortex is shown. [Figure 9H] Figures 8A-8F show the percent LAMP1 area in the cortex in G1, G2, and G3, as defined by the Mann-Whitney test, at a dose of 2x1010 GC in 2-3 month old mice, measured at 1 month. [Figure 9I] Figure 1 shows the percent LAMP-1 area in the cerebellum of G1, G2, and G3 at a dose of 2x1010GC in 2-3 month old mice measured at 1 month using the Mann-Whitney test. [Figure 9J] Figure 1 shows the percent LAMP-1 area in the hippocampus in G1, G2, and G3 at a dose of 2x1010GC in 2-3 month old mice measured at 1 month using the Mann-Whitney test. [Figure 10A] Figure 1 shows SGSH activity and GAG reduction in the brain of male and female mice. Shown is SGSH activity in the brain plotted as activity (nmol / mL / hr). [Figure 10B] Figure 1 shows SGSH activity and GAG reduction in the brain of male and female mice. SGSH activity in the brain plotted as log activity. [Figure 10C] Figure 1 shows SGSH activity and GAG reduction in the brains of male and female mice. GAG levels in the brain are plotted as ng GAG(HS) per mg protein. [Figure 11A]Figure 1 shows SGSH activity in GAG reduction in the spinal cord of male and female mice. Shown is SGSH activity in the spinal cord plotted as activity (nmol / mL / hr). [Figure 11B] Figure 1 shows SGSH activity in GAG reduction in the spinal cord of male and female mice. SGSH activity in the spinal cord plotted as log activity. [Figure 11C] Figure 1 shows SGSH activity in GAG reduction in the spinal cord of male and female mice. GAG levels in the spinal cord are plotted as ng GAG(HS) per mg protein. [Figure 12A] Figure 1 shows SGSH activity in GAG reduction in liver of male and female mice. Shown is SGSH activity in liver plotted as activity (nmol / mL / hr). [Figure 12B] Figure 1 shows SGSH activity in GAG reduction in liver of male and female mice. Shown is SGSH activity in liver plotted as log activity. [Figure 12C] Figure 1 shows SGSH activity in GAG reduction in liver of male and female mice. GAG levels in liver are plotted as ng GAG(HS) per mg protein. [Figure 13A] Shown is SGSH activity in serum (nmol / mL / hr) measured 7 days after ICV injection and plotted as activity. [Figure 13B] Shown is SGSH activity in serum (nmol / mL / hr) plotted as log activity 7 days after ICV injection. [Figure 13C] Shown is SGSH level activity in plasma (nmol / mL / hr) plotted as activity measured 1 month after ICV injection. [Figure 13D] Shown is SGSH level activity in plasma (nmol / mL / hr) plotted as log activity measured 1 month after ICV injection. [Figure 14A] Shown are levels of total GM3 in mouse brain plotted as pmol GM3 per mg protein. [Figure 14B]Shown are levels of total GM3 in mouse brain, potted as log-scale pmol GM3 per mg protein. [Figure 15A] Shown are levels of SGSH baseline activity in untreated NHP brain slices plotted as nmol / mg / hr measured in the medulla, cerebellum, thalamus and frontal cortex. [Figure 15B] 1 shows the levels of SGSH baseline activity in untreated NHP spinal cord sections plotted as nmol / mg / hr measured in spinal cord cervical, thoracic, lumbar, and dorsal root ganglion (DRG) cervical, lumbar, and thoracic sections. [Figure 15C] 1 shows axonal degeneration following delivery of AAVhu68.hSGSH, AAVrh91.hSGSH, or AAVhu68hSGSH containing engineered peptides. Average dorsal root ganglion (DRG) necrosis is shown. [Figure 15D] 1 shows axon degeneration following delivery of AAVhu68.hSGSH, AAVrh91.hSGSH, or AAVhu68hSGSH containing engineered peptides. Average spinal cord axon degeneration is shown. [Figure 15E] 1 shows axon degeneration following delivery of AAVhu68.hSGSH, AAVrh91.hSGSH, or AAVhu68hSGSH containing engineered peptides. Average median nerve axon degeneration is shown. [Figure 16] Shown are SGSH transgene expression levels at various MOIs plotted as AFU (800 / 700 nm) in neurospheres treated with AAV.hSGSH containing WT SGSH constructs, engineered SGSH constructs, or engineered SGSH constructs further containing the WPRE element within the AAV vector genome. [Figure 17A] SGSH activity in treated mouse brains. [Figure 17B] 1 shows GAG(HS) levels in the brain. [Figure 17C] Figure 1 shows total GM3 in mouse brain. These results indicate that addition of the WPRE to the engineered candidate rescues expression to levels similar to the WT construct, allowing for comparable or better storage clearance. [Figure 18A]Shown is SGSH activity in treated NHP cerebellar brain tissue compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 18B] Shown is SGSH activity in treated NHP medullary brain tissue compared against background in G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 18C] Shown is SGSH activity in treated NHP frontal cortex brain tissue compared against background in G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 18D] Shown is SGSH activity in treated NHP thalamic brain tissue compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 19A] Shown is SGSH activity in treated NHP spinal cord sections (SC cervical) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 19B]Shown is SGSH activity in treated NHP spinal cord sections (SC thorax) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 19C] Shown is SGSH activity in treated NHP spinal cord sections (SC lumbar) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). [Figure 20A] SGSH activity in treated NHP plasma is shown. [Figure 20B] SGSH activity in treated CSF is shown. [Figure 21A] Total anti-hSGSH IgG titers in NHP plasma are shown. [Figure 21B] Total anto-hSGSH titers in CSF are shown. [Figure 22A] Shown are the results of nerve conduction velocity (NCV) plotted as NP (nerve polarity in Amp) in the left median nerve. [Figure 22B] Shown are the results of nerve conduction velocity (NCV) plotted as NP (nerve polarity in Amp) in the right median nerve. [Figure 22C] Shown are nerve conduction velocity (NCV) results plotted as velocity in the left median nerve. [Figure 22D] Nerve conduction velocity (NCV) results are shown plotted as velocity in the right median nerve. [Figure 23] 1 shows serum Nfl in treated NHPs and indicates that serum NfL corresponds with the severity of histopathological axonal degeneration. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Provided herein are compositions and methods of compositions useful for treating Mucopolysaccharidosis Type IIIa (MPS IIIA) and / or alleviating the symptoms of MPS IIIA. These compositions comprise a nucleic acid sequence encoding a functional human N-sulfoglycosamine sulfohydrolase (hSGSH) and a regulatory sequence that directs expression of the nucleic acid sequence in a target cell, the hSGSH coding sequence comprising a signal peptide sequence and a mature hSGSH coding sequence, the mature hSGSH coding sequence having a nucleic acid sequence of the sequence of SEQ ID NO: 16, or (a) a nucleic acid sequence that encodes SEQ ID NO: 23 and is at least 85% identical to SEQ ID NO: 16, or (b) a nucleic acid sequence that encodes SEQ ID NO: 23 and is at least 99% identical to SEQ ID NO: 16.

[0012] In one embodiment, the compositions and methods described herein include nucleic acid sequences, expression cassettes, vectors, recombinant viruses, other compositions, and methods for the expression of functional hSGSH. In another embodiment, the compositions and methods described herein include nucleic acid sequences, expression cassettes, vectors, recombinant viruses, host cells, other compositions, and methods for generating compositions comprising a nucleic acid sequence encoding functional human SGSH. In yet another embodiment, the compositions and methods described herein include nucleic acid sequences, expression cassettes, vectors, recombinant viruses, other compositions, and methods for the delivery of a nucleic acid sequence encoding functional hSGSH to a subject for the treatment of MPS IIIA. In one embodiment, the compositions and methods described herein are useful for providing therapeutic levels of SGSH to the central nervous system (CNS). Additionally or alternatively, the compositions and methods described herein are useful for providing therapeutic levels of SGSH to the periphery, for example, the blood, liver, kidney, or peripheral nervous system. In certain embodiments, the adeno-associated virus (AAV) vector-based methods described herein provide expression of the SGSH protein to a subject in need thereof, thereby restoring a desired function of SGSH, alleviating symptoms associated with MPS IIIA, or alleviating symptoms associated with MPS IIIA. The present invention provides a novel therapeutic option that improves biomarkers associated with MPS IIIA or helps facilitate other treatment(s) for MPS IIIA.

[0013] As used herein, the term "therapeutic level" refers to at least about 5%, about 10%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, greater than 100%, about 2-fold, about 3-fold, or about 5-fold enzyme activity of healthy controls. Suitable assays for measuring SGSH enzyme activity are described herein. In some embodiments, such therapeutic levels of SGSH may result in alleviation of symptoms associated with MPS III-A, improvement of disease biomarkers associated with MPS IIIA, or promotion of other treatment(s) for MPS IIIA, e.g., GAG levels in cerebrospinal fluid (CSF), serum, urine, and / or other biological samples, prevention of neurocognitive decline, reversal of certain MPS IIIA associated symptoms, and / or prevention of progression of certain MPS IIIA associated symptoms, or any combination thereof.

[0014] As used herein, a "healthy control" refers to a subject or a biological sample from a subject, where the subject does not have MPS IIIA disorder. A healthy control is one from a subject. In one embodiment, the healthy control is a pool of subjects.

[0015] As used herein, the term "biological sample" refers to any cell, biological fluid, or tissue. Samples suitable for use in the present invention may include, but are not limited to, whole blood, white blood cells, fibroblasts, serum, urine, plasma, saliva, bone marrow, cerebrospinal fluid, amniotic fluid, and skin cells. Such samples may be further diluted with saline, buffer, or a physiologically acceptable diluent. Alternatively, such samples are concentrated by conventional means.

[0016] With respect to the description of the present invention, each of the compositions described herein is contemplated, in another embodiment, to be useful in the methods of the present invention. In addition, each of the compositions described herein that are useful in the methods is also contemplated, in another embodiment, to be an embodiment of the present invention itself.

[0017] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published documents which provide such persons with general guidance to many of the terms used in this application.

[0018] As used herein, the "disease", "disorder", and "condition" is Mucopolysaccharidosis type IIIA (also known as Sanfilippo syndrome type A or Sanfilippo disease type A, MPSIIIA, MPS IIIA, MPS IIIa).

[0019] As used herein, the term "symptom(s) associated with MPS IIIA" or "symptom(s)" refers to symptom(s) found in MPS IIIA patients as well as in MPS IIIA animal models. Such symptoms include, but are not limited to, speech delay; difficulties with social interaction and communication; sleep disorders; progressive intellectual disability and loss of previously acquired skills (developmental regression); seizures and movement disorders; large head; slightly enlarged liver (mild hepatomegaly); soft protrusions around the navel (umbilical hernia) or lower abdomen (inguinal hernia); short stature, stiff joints, mild dysostosis multiplex, multiple skeletal abnormalities; chronic diarrhea; recurrent upper respiratory tract infections; recurrent otitis media; hearing impairment; vision impairment; asymmetric septal hypertrophy; coarse facial features; stiff hair; dense calvarial atresia (Dense calvarial atresia); and chronic bronchitis (Calvarium ulceration). calvaria); dysostosis multiplex; growth abnormalities; heparan sulfate excretion in the urine; GAG accumulation in cerebrospinal fluid (CSF), serum, urine, and / or any other biological sample; abnormal expression and / or enzymatic activity of N-acetyl-alpha-D-glucosaminidase (NAGLU) or N-sulfoglycosamine sulfohydrolase (IDUA); accumulation of GM2 and GM3; altered activity in lysosomal enzymes; accumulation of free nonesterified cholesterol in the CNS; inflammatory responses in the CNS and skeletal tissues; excessive hair growth (hypertrichosis); hyperactivity; ovoid thoracolumbar vertebrae; splenomegaly; fusion of the eyebrows; enlarged ribs; hernias; and unsteady gait.

[0020] As used herein, "patient" or "subject" refers to male or female humans, dogs, and animal models used in clinical studies. In one embodiment, the subject of these methods and compositions is a human diagnosed with MPS IIIA. In certain embodiments, the human subject of these methods and compositions is a prenatal child, a newborn, an infant, a toddler, a preschooler, an elementary school child, a teenager, a young adult, or an adult. In further embodiments, the subject of these methods and compositions is a pediatric MPS IIIA patient.

[0021] Laboratory and urine tests (excess mucopolysaccharides are excreted in the urine) are the first steps in diagnosing MPS disease. Enzyme assays that measure the levels of enzyme activity in blood, skin cells, or various cells are also used to provide a definitive diagnosis of MPS IIIA. Various genetic tests that detect SGSH mutations associated with MPS IIIA are available. Tests are available. See, e.g., ncbi.nlm.nih.gov / gtr / conditions / -C0086647 / , ncbi.nlm.nih.gov / gtr / all / tests / ?term=C0086647[DISCUI]. Prenatal testing using amniocentesis and chorionic villus sampling can verify whether a fetus is affected with the disorder. Genetic counseling can help parents with a family history of mucopolysaccharidoses determine whether they carry the mutated gene that causes the disorder. See, e.g., A Guide to Understanding MPS III, National MPS Society, 2008, mpssociety.org / learn / diseases / mps-iii / .

[0022] N-Sulfoglycosamine sulfohydrolase (SGSH) As used herein, the terms "N-sulfoglycosamine sulfohydrolase" and "SGSH" are used interchangeably with heparan-N-sulfatase, HNS. The present invention includes any variant of SGSH protein expressed from the nucleic acid sequences provided herein, or functional fragments thereof, that when delivered in a composition or by the methods provided herein, restores a desired function, alleviates symptoms, improves symptoms associated with biomarkers associated with MPS IIIA, or facilitates other treatment(s) for MPS IIIA. Examples of suitable biomarkers for MPS III include those described in WO2017 / 136533, which are incorporated herein by reference.

[0023] As used herein, the term "functional SGSH" refers to the full-length or fragments of an enzyme having the amino acid sequence of full-length wild-type (natural) human SGSH (as set forth in SEQ ID NO: 36 and UniProtKB Accession No. P51688), variants thereof, mutants thereof with conservative amino acid substitutions, fragments thereof, any combination of variants and mutants with conservative amino acid substitutions, providing at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, or about the same or more than 100% of the biological activity level of normal human SGSH. Full-length wild-type (natural) human SGSH (SEQ ID NO: 36) includes the native signal (or leader) peptide and mature hSGSH (SEQ ID NO: 17). In some embodiments, functional SGSH refers to a wild-type protein having the sequence of SEQ ID NO: 36. In certain embodiments, functional hSGSH includes the native leader sequence. In certain embodiments, the functional hSGSH comprises an exogenous leader sequence. In certain embodiments, the functional hSGSH comprises an exogenous leader sequence that is an exogenous human immunoglobulin heavy chain binding protein BIP leader sequence (BiP or Bip). See also WO2012 / 071422 A2 and U.S. Patent No. 9,279,007, which are incorporated herein by reference. In certain embodiments, the functional hSGSH further comprises a peptide that allows endocytosis, where the peptide binds to the CI-MPR. In certain embodiments, the peptide that binds to the CI-MPR is a vIGF2 peptide. In certain embodiments, the functional hSGSH is a fusion protein that comprises an exogenous leader peptide sequence that is a BIP leader sequence, mature hSGSH, and a vIGF2 peptide connected via a linker. In certain embodiments, the functional hSGSH comprises mature hSGSH with at least one or more mutations that enhance the stability and / or expression of hSGSH in cells (i.e., stabilizing amino acid residue changes).In certain embodiments, the functional hSGSH is a fusion protein comprising an exogenous leader peptide sequence that is a BIP leader sequence, mature hSGSH comprising the stabilizing amino acid residue changes A482Y and E488V, and a vIGF2 peptide connected via a linker.

[0024] As used herein, a "conservative amino acid replacement" or "conservative amino acid substitution" refers to the modification, substitution, or replacement of an amino acid with a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, and size) known by those of skill in the art. See, for example, FRENCH et al. What is a conservative substitution? Journal of Molecular Evolution, March 1983, Volume 19, Issue 2, pp 171-175 and YAMPOLSKY et al., "A conservative substitution" refers to the modification, substitution, or replacement of an amino acid with a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, and size) known by those of skill in the art. See also, al. The Exchangeability of Amino Acids in Proteins, Genetics. 2005 Aug;170(4):1459-1472.

[0025] In certain embodiments, the functional SGSH is an SGSH variant comprising A482Y, which consists of the amino acid sequence of SEQ ID NO: 36, with tyrosine (Tyr, Y) at amino acid 488 instead of alanine (Ala, A) in the wild type, and E488V, which consists of the amino acid sequence of SEQ ID NO: 36, with valine (Val, V) at amino acid 488 instead of glutamic acid (Glu, E) in the wild type. Additional examples of SGSH variants may include those predicted by bioinformatics tools available to those of skill in the art. See, for example, Ugrinov KG, "SEQ ID NO: 36: SGSH variants at amino acid 488 instead of glutamic acid (Glu, E) in the wild type, which is incorporated herein by reference in its entirety. et al.A multiparametric computational algorithm for comprehensive assessment of See genetic mutations in mucopolysaccharidosis type IIIA(Sanfilippo syndrome)PLoS One.2015 Mar 25;10(3):e0121511.doi:10.1371 / journal.pone.0121511.eCollection 2015.

[0026] In certain embodiments, the functional hSGSH refers to the amino acid sequence of SEQ ID NO: 19, where the amino acid sequence comprises an exogenous leader peptide and a mature hSGSH coding sequence. In certain embodiments, the mature hSGSH further comprises stabilizing amino acid residue changes and / or substitutions A482Y and E488V, e.g., in SEQ ID NO: 23. In certain embodiments, the functional hSGSH refers to the amino acid sequence of SEQ ID NO: 25, where the functional hSGSH comprises an exogenous leader peptide and a mature hSGSH comprising the stabilizing amino acid changes A482Y and E488V.

[0027] In certain embodiments, the functional hSGSH refers to the amino acid sequence of SEQ ID NO: 21, which comprises an exogenous leader peptide, a mature hSGSH, and a vIGF2 peptide. In certain embodiments, the functional hSGSH refers to the amino acid sequence of SEQ ID NO: 27, which comprises an exogenous leader peptide, a mature hSGSH including the stabilizing amino acid changes A482Y and E488V, and a vIGF2 peptide.

[0028] There are various assays for measuring the expression and activity levels of SGSH by conventional methods, for example, ncbi_nlm_nih_gov / gtr / all / tests / ?term=C0086647[DISCUI]&filter=method:12;testtype:clinical, Karpova EA et al, A fluorimetric enzyme assay for the diagnosis of Sanfilippo disease type A (MPS IIIA). J Inherit Metab Dis. 1996; 19(3):278-85, Tardieu M et al, Intracerebral administration of adeno-associated viral vector serotype rh.10 carrying human SGSH and SUMF1 cDNAs in chimeric mice, each of which is incorporated by reference in its entirety. dren with mucopolysaccharidosis type IIIA disease:results of a phase I / II trial.Hum Gene Ther.2014 Jun;25(6):506-16.doi:10.1089 / hum.2013.238.Epub 2014 May 5, Whyte LS et al,Variables influencing fluorimetric N-sulfoglucosamine sulfohydrolase(SGSH)activity measurement in brain homogenates.Mol Genet Metab Rep.2015 Oct 22;5:60-62.doi:10.1016 / j.ymgmr.2015.10.005.eCollection 2015 Dec, Hopwood JJ et al.Diagnosis of Sanfilippo type A syndrome by See estimation of sulfamidase activity using a radiolabelled tetrasaccharide substrate. Clin Chim Acta. 1982 Aug 18;123(3):241-50.

[0029] nucleic acid In one aspect, a nucleic acid sequence encoding a functional SGSH protein is provided. In one embodiment, the nucleic acid sequence is an engineered coding sequence, and the functional hSGSH coding sequence comprises a signal peptide sequence and a mature hSGSH coding sequence, and the mature hSGSH coding sequence has a nucleic acid sequence of the sequence of SEQ ID NO: 16, or (a) a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 16 and encodes SEQ ID NO: 23, or (b) a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 16 and encodes SEQ ID NO: 23. In a particular embodiment, the mature hSGSH coding sequence that is 99% identical to SEQ ID NO: 16 is SEQ ID NO: 22 and encodes SEQ ID NO: 23 (hSGSH.A482Y.E488V). In a particular embodiment, the mature hSGSH coding sequence is SEQ ID NO: 16. In a particular embodiment, the mature hSGSH coding sequence is at least about 85% identical to SEQ ID NO: 16 and encodes SEQ ID NO: 23.

[0030] In one aspect, the SGSH coding sequence is an engineered sequence. In one embodiment, the engineered sequence is useful for improving production, transcription, expression, or safety in a subject. In another embodiment, the engineered sequence is useful for increasing the efficacy of the resulting therapeutic composition or treatment. In a further embodiment, the engineered sequence is useful for increasing the efficacy of the expressed functional SGSH protein, but may also allow for lower doses of therapeutic reagents that deliver the functional protein, increasing safety. In certain embodiments, the hSGSH coding sequence is engineered and encodes a functional SGSH protein that includes the stabilizing amino acid changes A482Y and E488V.

[0031] In certain embodiments, a functional hSGSH coding sequence comprises a signal peptide sequence located 5' to the mature hSGSH coding sequence. In certain embodiments, the signal peptide is at the amino-terminus (N-terminus) of the mature hSGSH. In certain embodiments, a functional hSGSH coding sequence comprises a signal peptide sequence that is a native signal peptide sequence. In certain embodiments, the native signal peptide comprises a nucleic acid sequence of SEQ ID NO:31, or a sequence at least about 95% identical to SEQ ID NO:31 that encodes the amino acid sequence of SEQ ID NO:32.

[0032] In certain embodiments, the functional hSGSH coding sequence comprises a signal peptide sequence that is an exogenous signal peptide sequence. In certain embodiments, the exogenous signal peptide is a BIP signal peptide. In certain embodiments, the exogenous signal peptide that is a BIP peptide has the nucleic acid sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30. The sequence includes a sequence that is at least about 95% identical to SEQ ID NO:29, which encodes

[0033] In certain embodiments, the functional hSGSH coding sequence further comprises a vIGF2 peptide connected via a linker. In certain embodiments, the vIGF2 peptide comprises the nucleic acid sequence of SEQ ID NO: 33, or a sequence that encodes SEQ ID NO: 34 and is at least about 95% identical to SEQ ID NO: 33. In certain embodiments, the vIGF2 peptide is connected via a linker at the carboxy terminus (C-terminus) of mature hSGSH. In certain embodiments, the vIGF2 peptide coding sequence including the linker is located 3' to the mature hSGSH coding sequence.

[0034] In one aspect, the functional hSGSH coding sequence is an engineered sequence that includes, from 5' to 3', a signal peptide coding sequence and a mature hSGSH coding sequence. In some embodiments, the functional hSGSH coding sequence is an engineered sequence that includes, from 5' to 3', a signal peptide coding sequence and a mature hSGSH coding sequence including the stabilizing amino acid changes A48Y and E488V. In another aspect, the functional hSGSH coding sequence is an engineered sequence that includes, from 5' to 3', a signal peptide coding sequence, a mature hSGSH coding sequence, and a vIGF2 coding sequence including a linker. In some embodiments, the functional hSGSH coding sequence is an engineered sequence that includes, from 5' to 3', a signal peptide coding sequence, a mature hSGSH coding sequence including the stabilizing amino acid changes A48Y and E488V, and a vIGF2 coding sequence including a linker.

[0035] In one embodiment, provided is an engineered nucleic acid sequence comprising the sequence of SEQ ID NO: 35, which sequence includes the native signal sequence and encodes a functional hSGSH (hSGSH; SEQ ID NO: 36). In one embodiment, provided herein is an engineered nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence that encodes a functional hSGSH that is at least about 99% identical to SEQ ID NO: 35. In another embodiment, the hSGSH coding sequence is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO: 35, and the sequence encodes a functional hSGSH.

[0036] In one embodiment, provided is an engineered nucleic acid sequence comprising the sequence of SEQ ID NO: 18, which sequence includes the BIP signal sequence and encodes a functional hSGSH (BIP.hSGSH; SEQ ID NO: 19). In one embodiment, provided herein is an engineered nucleic acid sequence of SEQ ID NO: 18, or a nucleic acid sequence that encodes a functional hSGSH that is at least about 99% identical to SEQ ID NO: 18. In another embodiment, the SGSH coding sequence is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO: 18, and the sequence encodes a functional hSGSH.

[0037] In one embodiment, provided is an engineered nucleic acid sequence comprising the sequence of SEQ ID NO:20, which sequence includes the BIP signal sequence and encodes a functional hSGSH that is a fusion hSGSH (BIP.hSGSH.vIGF2; SEQ ID NO:21). In one embodiment, provided herein is an engineered nucleic acid sequence of SEQ ID NO:20, or a nucleic acid sequence that encodes a functional hSGSH that is at least about 99% identical to SEQ ID NO:20. In another embodiment, the SGSH coding sequence is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO:20, and the sequence encodes a functional hSGSH.

[0038] In one embodiment, provided is an engineered nucleic acid sequence comprising the sequence of SEQ ID NO:24, the sequence comprising the BIP signal sequence and encoding a functional hSGSH comprising the stabilizing amino acid changes A482Y and E488V (BIP.hSGSH.A488Y.E488V; In one embodiment, provided herein is an engineered nucleic acid sequence of SEQ ID NO:24, or a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:24, which encodes a functional hSGSH. In another embodiment, the SGSH coding sequence is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO:24, and the sequence encodes a functional hSGSH.

[0039] In one embodiment, provided is an engineered nucleic acid sequence comprising the sequence of SEQ ID NO:26, the sequence including the BIP signal sequence and including the stabilizing amino acid changes A482Y and E488V, and encoding a functional hSGSH that is a fusion hSGSH (BIP.hSGSH.A488Y.E488V.vIGF2; SEQ ID NO:27). In one embodiment, provided herein is an engineered nucleic acid sequence of SEQ ID NO:26, or a nucleic acid sequence that encodes a functional hSGSH that is at least about 99% identical to SEQ ID NO:26. In another embodiment, the SGSH coding sequence is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO:26, and the sequence encodes a functional hSGSH.

[0040] As described herein, a "nucleic acid" may be RNA, DNA, or modifications thereof, may be single-stranded or double-stranded, and may be selected from the group including, for example, a nucleic acid encoding a protein of interest, an oligonucleotide, a nucleic acid analog, such as peptide nucleic acid (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acid (LNA), and the like. Nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of any type of nucleotide (e.g., peptide nucleic acid oligomers). Those skilled in the art will understand that functional variants of these nucleic acid molecules are also intended to be part of the present invention. Functional variants are nucleic acid sequences that can be directly translated using the standard genetic code to provide an amino acid sequence identical to that translated from the parent nucleic acid molecule. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequences encoding proteins that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, such as, but not limited to, RNAi, shRNAi, siRNA, microRNAi (mRNAi), antisense oligonucleotides, and the like.

[0041] In certain embodiments, nucleic acid molecules encoding functional human SGSH (hSGSH) and other constructs encompassed by the present invention and useful for generating expression cassettes and vector genomes can be engineered for expression in mammalian cells, such as yeast cells, insect cells, or human cells. Methods are known and have been previously described (e.g., WO96 / 09378). A sequence is considered engineered if at least one non-preferred codon compared to the wild-type sequence is replaced by a more preferred codon. As used herein, a non-preferred codon is a codon that is used less frequently in an organism than another codon that codes for the same amino acid, and a more preferred codon is a codon that is used more frequently in an organism than a non-preferred codon. The codon usage frequency of a particular organism can be found in a codon frequency table, such as www.kazusa.jp / codon. Preferably, more than one non-preferred codon, preferably most or all non-preferred codons, are replaced by a more preferred codon. Preferably, the codon most frequently used in the organism is used in the engineered sequence. Substitution with preferred codons generally results in higher expression. It will also be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, many different nucleic acid molecules can encode the same polypeptide. It will also be understood that those skilled in the art may, using routine techniques, make nucleotide substitutions that do not affect the amino acid sequence encoded by the nucleic acid molecule to reflect the codon usage of any particular host organism in which the polypeptide is expressed. Thus, unless otherwise specified, a "nucleic acid sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleic Acids The sequences may be cloned using routine molecular biology techniques or may be generated de novo by DNA synthesis, which may be carried out using routine procedures by service companies operating in the field of DNA synthesis and / or molecular cloning (e.g. GeneArt, GenScript, Life Technologies, Eurofins).

[0042] By "engineered" is meant that the nucleic acid sequence encoding the functional SGSH protein described herein is assembled and placed in any suitable genetic element, such as naked DNA, phage, transposon, cosmid, episome, etc., which is introduced into a host cell carrying the SGSH sequence thereon, for example, to generate a non-viral delivery system (e.g., RNA-based system, naked DNA, etc.), or to generate a viral vector in a packaging host cell, and / or for delivery to a host cell of interest. In one embodiment, the genetic element is a vector. In one embodiment, the genetic element is a plasmid. Methods used to create such engineered constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0043] The terms "percent identity (%)", "sequence identity", "percent sequence identity", or "percent identical" in the context of nucleic acid sequences refer to residues in two sequences that are the same when aligned for correspondence. Comparison of sequence identity lengths can be, and preferably are, over the full length of a genome, the full length of a gene coding sequence, or over a fragment of at least about 500-5000 nucleotides. However, identity between smaller fragments, e.g., of at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 nucleotides or more, can also be desirable.

[0044] Percent identity can be readily determined for amino acid sequences spanning the full length polypeptide of a protein, about 32 amino acids, about 330 amino acids, or peptide fragments thereof, or the corresponding nucleic acid sequence encoding the sequence. Suitable amino acid fragments can be at least about 8 amino acids in length and can be up to about 700. In general, when referring to "identity", "homology", or "similarity" between two different sequences, the "identity", "homology", or "similarity" is determined with reference to "aligned" sequences. An "aligned" sequence or "alignment" refers to multiple nucleic acid or protein (amino acid) sequences, often containing corrections for missing or additional bases or amino acids compared to a reference sequence.

[0045] The alignment is performed using any of a variety of publicly or commercially available multiple sequence alignment programs. Sequence alignment programs are available for amino acid sequences, including, for example, "Clustal X", "Clustal Omega", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs. Generally, any of these programs are used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the level of identity or alignment as provided by the referenced algorithms and programs. See, for example, JD Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).

[0046] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include "Clustal W", "Clustal Omega", "CAP Examples of such programs include "Sequence Assembly", "BLAST", "MAP" and "MEME", which are accessible through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the Vector NTI utility can be used. There are also many algorithms known in the art, including those contained in the programs described above, that can be used to measure nucleotide sequence identity. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG version 6.1. Fasta™ provides alignment and percent sequence identity of the best overlapping regions between the query and search sequences. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ using its default parameters (word size 6 and NOPAM factor of the scoring matrix) as provided in GCG version 6.1, which is incorporated herein by reference.

[0047] As used herein, "desired function" refers to SGSH enzyme activity that is at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of that of a healthy control.

[0048] As used herein, the phrases "alleviate symptoms," "ameliorate symptoms," or grammatical variations thereof, refer to the reversal of symptoms associated with MPS IIIA, the resolution or prevention of progression of symptoms associated with MPS IIIA. In one embodiment, alleviation or amelioration refers to the total number of symptoms in a patient after administration of a described composition(s) or use of a described method being reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% compared to before administration or use. In another embodiment, alleviation or amelioration refers to the severity or progression of symptoms after administration of a described composition(s) or use of a described method being reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% compared to before administration or use.

[0049] It should be understood that the compositions in the SGSH functional proteins and SGSH coding sequences described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0050] Expression cassettes and vector genomes Provided herein is a gene therapy vector comprising an expression cassette comprising an engineered nucleic acid sequence comprising a coding sequence for hSGSH operably linked to a regulatory sequence that directs the expression of the engineered nucleic acid.In certain embodiments, the expression cassette comprises

[0051] As used herein, "expression cassette" refers to a nucleic acid molecule that includes a biologically useful nucleic acid sequence and a regulatory sequence operably linked thereto that directs or regulates the transcription, translation, and / or expression of the nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, mRNA, etc.) and the gene product. As used herein, "operably linked" sequences include both regulatory sequences that are contiguous or non-contiguous with the nucleic acid sequence, and regulatory sequences that act in cis or trans with the nucleic acid sequence. Such regulatory sequences typically include, for example, one or more of a promoter, enhancer, intron, Kozak sequence, polyadenylation sequence, and TATA signal. An expression cassette includes, among other elements, regulatory sequences upstream (5') of the gene sequence, e.g., one or more of a promoter, enhancer, intron, etc., and enhancers, or sequences downstream of the gene sequence. The expression cassette may contain one or more of the following regulatory sequences: 3'-regulatory sequences, e.g., a 3' untranslated region (3'UTR) containing a polyadenylation site. In certain embodiments, the regulatory sequence is operably linked to the nucleic acid sequence of the gene product, and the regulatory sequence is separated from the nucleic acid sequence of the gene product by an intervening nucleic acid sequence, i.e., a 5' untranslated region (5'UTR). In certain embodiments, the expression cassette contains the nucleic acid sequence of one or more gene products. In some embodiments, the expression cassette may be a monocistronic or bicistronic expression cassette. In other embodiments, the term "transgene" refers to one or more DNA sequences from an exogenous source that are inserted into a target cell. Typically, such expression cassettes for generating viral vectors contain coding sequences for gene products described herein adjacent to a packaging signal of the viral genome, and other expression control sequences, such as those described herein. In certain embodiments, the vector genome may contain two or more expression cassettes.

[0052] The term "exogenous" as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the chromosome or at the location present in the host cell. An exogenous nucleic acid sequence also refers to a sequence that is derived from and inserted into the same host cell or subject, but exists in a non-native state, e.g., in a different copy number or under the control of different regulatory elements.

[0053] The term "heterologous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein is derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed. When used with reference to a protein or nucleic acid of a plasmid, expression cassette, or vector, the term "heterologous" indicates that the protein or nucleic acid is present with another sequence or subsequence from the protein or nucleic acid in question that is not found in the same relationship to each other in nature.

[0054] In one embodiment, the regulatory sequence comprises a promoter. In one embodiment, the promoter is the chicken β-actin promoter (CB). In a further embodiment, the promoter is CB7 (CB7 promoter), which is a hybrid of the cytomegalovirus immediate early (CMV IE) enhancer and the chicken β-actin promoter. In a particular embodiment, the CB7 promoter comprises the nucleic acid sequence of SEQ ID NO: 44. In another embodiment, suitable promoters include, but are not limited to, the elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene. 1990 Jul 16;91(2):217-23), the synapsin 1 promoter (see, e.g., Kuegler S et al, Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther. 2003 Feb;10(4):337-47), the neuron-specific enolase (NSE) promoter (see, e.g., Kim J et al, Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology. 2004 Feb;145(2):613-9. Epub 2003 Oct 16), or the CB6 promoter (see, e.g., Large-Scale Production of Adeno-Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, M ol Biotechnol. 2016 Jan;58(1):30-6. doi:10.1007 / s12033-015-9899-5).

[0055] In certain embodiments, additional or alternative promoter sequences may be included as part of the expression control sequence (regulatory sequence), for example, located between the selected 5'ITR sequence and the coding sequence. Constitutive promoters, regulatable promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters responsive to physiological cues may be utilized in the vectors described herein. The promoter(s) may be selected from different sources, for example, human cytomegalovirus (CMV) immediate early enhancer / promoter, SV40 early enhancer / promoter, JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latency-associated promoter (LAP), Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and chicken beta-actin promoter.

[0056] In one embodiment, the expression cassette is designed for expression and secretion in a human subject. In one embodiment, the expression cassette is designed for expression in the central nervous system (CNS), including the cerebrospinal fluid and the brain. In a further embodiment, the expression cassette is useful for expression in both the CNS and the liver. Suitable promoters may be selected, including but not limited to constitutive promoters, tissue-specific promoters, or inducible / regulatable promoters. An example of a constitutive promoter is the chicken beta-actin promoter. Various chicken beta-actin promoters have been reported, either alone or in combination with various enhancer elements (e.g., CB7 is a chicken beta-actin promoter with cytomegalovirus enhancer elements; CAG promoter, which contains the promoter, the first exon and the first intron of chicken beta-actin, and the splice acceptor of rabbit beta-globin gene; CBh promoter, SJ Gray et al, Hu Gene Ther, 2011 Sep;22(9):1143-1153). Liver (albumin, Miyatake et al., (1997) J. Virol., 71:5124 32; Hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther.,3:1002 9; alpha fetoprotein (AFP), Arbuthnot et al.,(1996) Hum. Gene Ther.,7:1503 14), neuron (neuron-specific enolase (NSE) promoter, Andersen et al.,(1993) Cell. Mol. Neurobiol.,13:503 15; neurofilament light chain gene, Piccioli et al.,(1991) Proc. Natl. Acad. Sci. USA,88:5611 5; and neuron-specific vgf gene, Piccioli et al.,(1995) Neuron,15:373 84), as well as other tissue-specific promoters are well known. Alternatively, regulatable promoters can be selected. See, for example, WO2011 / 126808B2, incorporated herein by reference.

[0057] In addition to a promoter, the vector may contain one or more other suitable transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA (e.g., WPRE), sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, optionally, sequences that enhance secretion of the encoded product.

[0058] In one embodiment, the regulatory sequence further comprises an enhancer. In another embodiment, the regulatory sequence contains two or more expression enhancers. These enhancers can be the same or different. For example, the enhancer can include the alpha mic / bik enhancer or the CMV enhancer. This enhancer can be present in two copies located adjacent to each other. Alternatively, the double copies of the enhancer can be separated by one or more sequences.

[0059] In one embodiment, the regulatory sequence further comprises an intron. In a further embodiment, the intron is a chicken beta-actin intron. In a particular embodiment, the chicken beta-actin intron comprises the nucleic acid sequence of SEQ ID NO: 45. In a particular embodiment, the intron is a chimeric intron (CI), which is a hybrid intron consisting of a human beta-globin splice donor and an immunoglobulin G (IgG) splice acceptor element. Other suitable introns include those known in the art, such as those described in WO2011 / 126808. Other suitable introns include those known in the art, and may be the human β-globulin intron, and / or the commercially available Promega® introns, and those described in WO2011 / 126808.

[0060] In one embodiment, the regulatory sequence further comprises a polyadenylation signal (polyA). Examples of suitable polyA sequences include, for example, rabbit globin polyA, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. In certain embodiments, the polyA is rabbit beta globin polyA (rabbit globin polya or rBG). See, for example, WO2014 / 151341. In certain embodiments, the rabbit beta globin polyA comprises the nucleic acid sequence of SEQ ID NO: 46. In certain embodiments, human growth hormone (hGH) polyadenylation sequence, SV40 polyA, or synthetic polyA may be included in the expression cassette.

[0061] In certain embodiments, the provided expression cassettes may include one or more expression enhancers, such as post-transcriptional regulators from woodchuck (WPRE), human (HPRE), ground squirrel (GPRE), or arctic ground squirrel (AGSPRE) hepatitis virus, or synthetic post-transcriptional regulators. These expression enhancers are particularly advantageous when placed in the 3'UTR and can significantly increase mRNA stability and / or protein yield. In certain embodiments, the provided expression cassettes include a regulatory sequence that is a woodchuck hepatitis virus post-transcriptional regulator (WPRE) or a variant thereof. Suitable WPRE sequences are provided within the vector genomes described herein and are known in the art (e.g., as described in U.S. Pat. Nos. 6,136,597, 6,287,814, and 7,419,829, which are incorporated by reference). In certain embodiments, the WPRE is a variant mutated to eliminate expression of the woodchuck hepatitis B virus X (WHX) protein, e.g., containing a mutation in the start codon of the WHX gene. See also Kingsman SM, Mitrophanous K., & Olsen JC (2005), Potential Oncogene Activity of the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (Wpre).'' Gene Ther.12(1):3-4 and Zanta-Boussif MA, Charrier S., Brice-Ouzet A., Martin S., Opolon P., Thrasher AJ, Hope TJ, & Galy A. (2009), Validation of a Mutated Pre Sequence Allowing High and Sustained Transgene Expression While Abrogating Whv-X Protein Synthesis:Application t See also o the Gene Therapy of Was, Gene Ther. 16(5):605-19. In other embodiments, the enhancer is selected from a non-viral source. In certain embodiments, the WPRE sequence is absent. In certain embodiments, the WPRE comprises the nucleic acid sequence of SEQ ID NO:43.

[0062] In certain embodiments, the expression cassette comprises an hSGSH coding sequence, and may include other regulatory sequences therefor, where the necessary regulatory sequences are operably linked to the hSGSH coding sequence in a manner that allows for its transcription, translation, and / or expression in the target cell.

[0063] In certain embodiments, the target cell may be a central nervous system cell. In certain embodiments, the target cell is one or more of an excitatory neuron, an inhibitory neuron, a glial cell, a cortical cell, a frontal cortical cell, a cerebral cortical cell, and a spinal cord cell. In certain embodiments, the target cell is a peripheral nervous system (PNS) cell, such as a retinal cell. Other cells other than cells from the nervous system may also be selected as target cells, such as monocytes, B lymphocytes, T lymphocytes, NK cells, lymph node cells, tonsillar cells, bone marrow mesenchymal cells, stem cells, bone marrow stem cells, cardiac cells, epithelial cells, esophageal cells, stomach cells, fetal transection cells, colon cells, rectal cells, liver cells, kidney cells, lung cells, salivary gland cells, thyroid cells, adrenal gland cells, breast cells, pancreatic cells, islet cells of Langerhans, gallbladder cells, prostate cells, bladder cells, skin cells, uterine cells, cervical cells, testicular cells, or any other cells that express functional SGSH enzyme in subjects without MPSIIIA.

[0064] In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence with BIP exogenous leader peptide-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence with BIP exogenous leader peptide 5' to the hSGSH coding sequence and vIGF2 peptide 3' to the hSGSH coding sequence-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence with BIP exogenous leader peptide 5' to the hSGSH coding sequence and vIGF2 peptide 3' to the hSGSH coding sequence-optionally WPRE-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence comprising a BIP exogenous leader peptide 5' to the hSGSH coding sequence and a vIGF2 peptide 3' to the hSGSH coding sequence, optionally wherein the hSGSH comprises stabilizing amino acid changes A482Y and E488V (hSGSH.A482Y-E488V)-optionally a WPRE-rabbit beta-globin poly A.

[0065] In certain embodiments, the expression cassette comprises a CB7 promoter (SEQ ID NO: 44) - optionally a chicken beta actin intron sequence (SEQ ID NO: 45) - an hSGSH coding sequence including a BIP exogenous leader peptide 5' to the hSGSH coding sequence and a vIGF2 peptide 3' to the hSGSH coding sequence - optionally a WPRE (SEQ ID NO: 43) - a rabbit beta-globin poly A (SEQ ID NO: 46). In certain embodiments, the expression cassette comprises a CB7 promoter (SEQ ID NO: 44) - optionally a chicken beta actin intron sequence (SEQ ID NO: 45) - an hSGSH (optionally hSGSH.A482Y-E488V) coding sequence including a BIP exogenous leader peptide 5' to the hSGSH coding sequence and a vIGF2 peptide 3' to the hSGSH coding sequence - optionally a WPRE (SEQ ID NO: 43) - a rabbit beta-globin poly A (SEQ ID NO: 46). In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO:8.

[0066] In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 4 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 4. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 11 (CB7.CI.hSGSHcoV1.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 11. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO:8 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.rBG), or a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO:8.

[0067] It is to be understood that the compositions in the expression cassettes described herein are intended to apply to other compositions, regimens, aspects, embodiments and methods described throughout the specification.

[0068] miRNA In certain embodiments, in addition to the hSGSH coding sequence, another non-AAV coding sequence may be included, such as a peptide, polypeptide, protein of interest, a functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product. Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNAs (mRNAs). miRNAs are typically naturally expressed as final 19-25 untranslated RNA products. miRNAs exert their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA duplexes and further processed into "mature" single-stranded miRNA molecules. The mature miRNAs guide the multiprotein complex miRISC, which identifies target sites, e.g., within the 3'UTR region, of target mRNAs based on complementarity to the mature miRNA.

[0069] As used herein, a "miRNA target sequence" is a sequence located on the DNA positive strand (5' to 3') that is at least partially complementary to a miRNA sequence, including a miRNA seed sequence. The miRNA target sequence is exogenous to the untranslated region of the encoded transgene product and is designed to be specifically targeted by the miRNA in cells in which repression of transgene expression is desired. The term "miR183 cluster target sequence" refers to the miR183 cluster (alternatively referred to as family), which includes miR-183 and -182 (Dambal, S. et al., herein incorporated by reference). al. Nucleic Acids Res 43:7173-7188, 2015) in response to one or more members of the miRNA target sequence. Without wishing to be bound by theory, the messenger RNA (mRNA) of the transgene (encoding a gene product) is present in the cell type to which the expression cassette containing the miRNA is delivered, so that specific binding of the miRNA to the 3'UTR miRNA target sequence results in silencing and cleavage of the mRNA, thereby reducing or eliminating expression of the transgene only in cells expressing the miRNA.

[0070] Typically, the miRNA target sequence is at least 7 nucleotides to about 28 nucleotides in length, at least 8 nucleotides to about 28 nucleotides in length, 7 nucleotides to 28 nucleotides, 8 nucleotides to 18 nucleotides in length, about 12 to about 28 nucleotides in length, about 20 to about 28 nucleotides in length, about 30 to about 32 nucleotides in length, about 40 to about 42 The target sequence is about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides long and contains at least one contiguous region (e.g., 7 or 8 nucleotides) that is complementary to the miRNA seed sequence. In certain embodiments, the target sequence includes a sequence that has exact complementarity (100%) with the miRNA seed sequence, or a sequence that has partial complementarity with some mismatches with the miRNA seed sequence. In certain embodiments, the target sequence includes at least 7-8 nucleotides that are 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence consists of a sequence that is 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence contains multiple copies (e.g., 2, 3, 4 or more copies) of a sequence that is 100% complementary to the seed sequence. In certain embodiments, the region of 100% complementarity comprises at least 30% of the length of the target sequence. In certain embodiments, the remainder of the target sequence has at least about 80% to about 99% complementarity to the miRNA. In certain embodiments, in an expression cassette containing a DNA positive strand, the miRNA target sequence is the reverse complement of the miRNA.

[0071] In certain embodiments, the miRNA target sequence of at least the first and / or at least the second miRNA target sequence of the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTACCAGTGCCAAA (miR183, SEQ ID NO: 28); (ii) AGTTGAGTTCTACCATTGCCAAA (miR182, SEQ ID NO: 47).

[0072] In certain embodiments, the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-183 target sequence. In certain embodiments, the vector genome or expression cassette contains a miR-183 target sequence that includes AGTGAATTCTACAGTGCCATA (SEQ ID NO: 28) (the sequence complementary to the miR-183 seed sequence is underlined). In certain embodiments, the vector genome or expression cassette contains two or more copies (e.g., two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the vector genome or expression cassette contains four copies of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence contains a sequence with partial complementarity to SEQ ID NO:28, and thus, when aligned to SEQ ID NO:28, there are one or more mismatches. In certain embodiments, the miR-183 target sequence contains a sequence with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO:28, and the mismatches can be non-contiguous. In certain embodiments, the miR-183 target sequence contains a region of 100% complementarity, which region also constitutes at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity contains a sequence with 100% complementarity to the miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence has at least about 80% to about 99% complementarity to miR-183. In certain embodiments, an expression cassette or vector genome comprises a miR-183 target sequence that comprises a truncated SEQ ID NO: 28, i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5' or 3' end of SEQ ID NO: 28. In certain embodiments, an expression cassette or vector genome comprises a transgene and an miR-183 target sequence.In yet other embodiments, the expression cassette or vector genome comprises at least 2, 3, or 4 miR-183 target sequences.

[0073] In certain embodiments, the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-182 target sequence. The vector genome or expression cassette contains a miR-182 target sequence comprising AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 47). In certain embodiments, the vector genome or expression cassette contains two or more copies (e.g., two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and contains at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence contains a sequence that has partial complementarity to SEQ ID NO: 47, and thus, when aligned to SEQ ID NO: 47, there are one or more mismatches. In certain embodiments, the miR-183 target sequence contains a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 47, and the mismatches can be non-contiguous. In certain embodiments, the miR-182 target sequence comprises a region of 100% complementarity, which region also comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence having 100% complementarity to the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity to miR-182. In certain embodiments, the expression cassette or vector genome comprises a miR-182 target sequence comprising a truncated SEQ ID NO:47, i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' or 3' ends of SEQ ID NO:47. In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-182 target sequence. In yet other embodiments, the expression cassette or vector genome comprises at least 2, 3, or 4 miR-182 target sequences.

[0074] The term "tandem repeat" is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences can be consecutive, i.e., the 3' end of one is immediately upstream of the 5' end of the next sequence, without any intervening sequence, or vice versa, directly following each other. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.

[0075] As used herein, a "spacer" is any selected nucleic acid sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, located between two or more consecutive miRNA target sequences. In certain embodiments, the spacer is 1-8 nucleotides in length, 2-7 nucleotides in length, 3-6 nucleotides in length, 4 nucleotides in length, 4-9 nucleotides in length, 3-7 nucleotides in length, or longer. Suitably, the spacer is a non-coding sequence. In certain embodiments, the spacer may be four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC. In certain embodiments, the spacer is independently selected from one or more of: (A) GGAT, (B) CACGTG, (C) GCATGC, (D) GCGGCCGC, (E) CGAT, (F) ATCGGT, and / or (G) TCAC.

[0076] In certain embodiments, the tandem repeat contains two, three, four or more identical miRNA target sequences. In certain embodiments, the tandem repeat contains at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeat may contain two or three identical miRNA target sequences and a different fourth miRNA target sequence.

[0077] In certain embodiments, the expression cassette comprises at least two different tandem repeats. There may be a set. For example, 3'UTR may contain tandem repeats immediately downstream of transgene, UTR sequence, two or more tandem repeats closer to the 3' end of UTR. In another example, 5'UTR may contain one, two or more miRNA target sequences. In another example, 3' may contain tandem repeats, and 5'UTR may contain at least one miRNA target sequence.

[0078] In certain embodiments, the expression cassette contains 2, 3, 4 or more tandem repeats that begin within about 0-20 nucleotides of the transgene's stop codon. In certain embodiments, the expression cassette contains 2, 3, 4, 5, 6, 7, 8 or more tandem repeats that begin within about 0-20 nucleotides of the transgene's stop codon. In other embodiments, the expression cassette contains miRNA tandem repeats at least 100 to about 4000 nucleotides from the transgene's stop codon. The target miRNA sequence may be selected from SEQ ID NO:28 and / or SEQ ID NO:47.

[0079] In certain embodiments, the vector genome further comprises at least one, at least two, at least three, or preferably at least four tandem repeats of dorsal root ganglion (drg)-specific miRNA target sequences. In certain embodiments, the vector genome further comprises at least one, at least two, at least three, at least four, at least five, at least six, or preferably at least eight tandem repeats of dorsal root ganglion (drg)-specific miRNA target sequences. See, e.g., PCT / US19 / 67872, filed December 20, 2019, now published as WO2020 / 132455. See also U.S. Provisional Patent Application No. 63 / 023,593, filed May 12, 2020, U.S. Provisional Patent Application No. 63 / 038,488, filed June 12, 2020, U.S. Provisional Patent Application No. 63 / 043,562, filed June 24, 2020, and U.S. Provisional Patent Application No. 63 / 079,299, filed September 16, 2020, and U.S. Provisional Patent Application No. 63 / 152,042, filed February 22, 2021, which are incorporated by reference in this specification, and International Patent Application No. PCT / US21 / 32003.

[0080] In certain embodiments, the expression cassette comprises at least eight miRNA drg de-targeting sequences. In certain embodiments, the expression cassette comprises at least eight miRNA drg de-targeting sequences, including miR182 and miR183. In certain embodiments, the expression cassette comprises at least eight miRNA drg de-targeting sequences, including miR182 and miR183. drg detargeting sequences, at least the first, at least the second, at least the third, and at least the fourth miRNA are miR182 sequences, and at least the fifth, at least the sixth, at least the seventh, and at least the eighth miRNA are miR183 sequences. In certain embodiments, the expression cassette or vector genome comprises at least eight miRNA drg detargeting sequences, at least the first, at least the second, at least the third, and at least the fourth miRNA are miR183 sequences, and at least the fifth, at least the sixth, at least the seventh, and at least the eighth miRNA are miR182 sequences.

[0081] In certain embodiments, the present invention provides an expression cassette having a nucleic acid molecule comprising an hSGSH coding sequence, four miR182 sequences, four miR183 sequences, and other suitable regulatory sequences operably linked to the SGSH coding sequence as defined herein. In certain embodiments, the expression cassette comprises an open reading frame (ORF) sequence (e.g., an ORF comprising an hSGSH coding sequence operably linked to a regulatory control sequence) and a DRG detargeting sequence. In certain embodiments, the DRG detargeting sequence is located 5' to the coding sequence. In certain embodiments, the DRG detargeting sequence is located 3' to the coding sequence.

[0082] In certain embodiments, the regulatory sequence comprises a CB7 promoter. In certain embodiments, the regulatory sequence comprises one or more intron(s), one or more enhancer(s), and polyA. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence-at least four copies of miRNA182-at least four copies of miR183-rabbit beta-globin polyA. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence with BIP exogenous leader peptide-at least four copies of miRNA182-at least four copies of miR183-rabbit beta-globin polyA. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-hSGSH coding sequence comprising a BIP exogenous leader peptide 5' to the hSGSH coding sequence and a vIGF2 peptide 3' to the hSGSH coding sequence-at least four copies of miR182-at least four copies of miR183-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO:37.

[0083] In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-a hSGSH coding sequence that is a wild type coding sequence-at least four copies of miRNA182-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-a hSGSH coding sequence that is a wild type coding sequence-at least four copies of miR183-rabbit beta-globin poly A. In certain embodiments, the expression cassette comprises a CB7 promoter-optionally a chicken beta actin intron sequence-a hSGSH coding sequence that is a wild type coding sequence-at least four copies of miRNA182-at least four copies of miR183-rabbit beta-globin poly A. In certain embodiments, the wild type hSGSH coding sequence comprising the native signal peptide and mature hSGSH comprises SEQ ID NO:60.

[0084] In certain embodiments, the expression cassette refers to a nucleic acid molecule of SEQ ID NO: 2, 38, 41. In certain embodiments, the expression cassette refers to a nucleic acid molecule of SEQ ID NO: 2, encoding hSGSH and comprising four tandem repeats of miRNA183 (miR183, SEQ ID NO: 28). In certain embodiments, the expression cassette refers to a nucleic acid molecule of SEQ ID NO: 41, encoding hSGSH and comprising four tandem repeats of miRNA182 (miR182, SEQ ID NO: 48). In certain embodiments, the expression cassette refers to a nucleic acid molecule of SEQ ID NO: 38, encoding hSGSH and comprising four tandem repeats of miRNA182 (miR182, SEQ ID NO: 48) and four tandem repeats of miRNA183 (miR183, SEQ ID NO: 28).

[0085] In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 14 (CB7.CI.hSGSHcoV1-4xmiR183.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100%, and / or any value therebetween identical to SEQ ID NO: 14. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 41 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100%, and / or any value therebetween identical to SEQ ID NO: 41. In certain embodiments, the expression cassette comprises a nucleic acid sequence of SEQ ID NO:2 (CB7.CI.BIP.hSGSHcov1(A482Y-E488V).vIGF2.WPRE.4xmiR183.rBG), or a sequence that is at least 95% similar to SEQ ID NO:2. , at least 96%, at least 97%, at least 98%, at least 99% to at least 100%, and / or any value therebetween. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 38 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.4xmiR183.rBG), or a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100%, and / or any value therebetween identical to SEQ ID NO: 38.

[0086] vector In one aspect, provided herein is a vector comprising an engineered nucleic acid sequence encoding a functional human N-sulfoglycosamine sulfohydrolase (hSGSH) and a regulatory sequence directing expression in a target cell, wherein the hSGSH coding sequence comprises a signal peptide sequence and a mature hSGSH coding sequence. In one embodiment, the mature hSGSH coding sequence is SEQ ID NO: 16 and encodes the amino acid sequence SEQ ID NO: 17. In certain embodiments, the mature hSGSH coding sequence is a sequence that encodes the amino acid sequence of SEQ ID NO: 17 that is at least about 85% identical to SEQ ID NO: 16. In certain embodiments, the mature hSGSH coding sequence is a sequence that encodes the amino acid sequence of SEQ ID NO: 23 that is at least about 85% identical to SEQ ID NO: 16. In a further embodiment, the mature hSGSH coding sequence is at least 99% identical to SEQ ID NO: 16 and encodes the amino acid sequence of SEQ ID NO: 23. In yet a further embodiment, the mature hSGSH coding sequence is SEQ ID NO: 22 or a sequence that encodes the amino acid sequence of SEQ ID NO: 23 that is at least about 99% identical to SEQ ID NO: 22.

[0087] In certain embodiments, the vector comprises an hSGSH coding sequence, including a native leader peptide sequence and a mature hSGSH coding sequence, wherein the hSGSH mature coding sequence is selected from SEQ ID NO: 16, or a sequence at least 95% identical to SEQ ID NO: 16, or a sequence at least about 95% identical to SEQ ID NO: 22. In certain embodiments, the vector comprises an hSGSH coding sequence, including an exogenous leader peptide sequence and a mature hSGSH coding sequence, wherein the hSGSH mature coding sequence is selected from SEQ ID NO: 16, or a sequence at least 95% identical to SEQ ID NO: 16, or a sequence at least about 95% identical to SEQ ID NO: 22.

[0088] In certain embodiments, the vector comprises an hSGSH coding sequence, including a native leader peptide sequence and a mature hSGSH coding sequence, wherein the hSGSH coding sequence is SEQ ID NO: 35, or a sequence at least 95% identical to SEQ ID NO: 35. In certain embodiments, the vector comprises an hSGSH coding sequence, including an exogenous leader peptide sequence and a mature hSGSH coding sequence, wherein the hSGSH coding sequence is SEQ ID NO: 18, or a sequence at least 95% identical to SEQ ID NO: 18. In certain embodiments, the vector comprises an hSGSH coding sequence, including an exogenous leader peptide sequence and a mature hSGSH coding sequence including the stabilizing amino acid residue changes A482Y and E488V, wherein the hSGSH coding sequence is SEQ ID NO: 24, or a sequence at least 95% identical to SEQ ID NO: 24.

[0089] In a further embodiment, the vector comprises an hSGSH coding sequence, including an exogenous leader peptide sequence, a mature hSGSH coding sequence, a linker sequence, and a vIGF2 peptide sequence, wherein the hSGSH coding sequence is SEQ ID NO: 20, or a sequence at least 95% identical to SEQ ID NO: 20. In a further embodiment, the vector comprises an hSGSH coding sequence, including an exogenous leader peptide sequence, a mature hSGSH coding sequence including the stabilizing amino acid residue changes A482Y and E488V, a linker sequence, and a vIGF2 peptide sequence, wherein the hSGSH coding sequence is SEQ ID NO: 26, or a sequence at least 95% identical to SEQ ID NO: 26. It is an array.

[0090] A "vector" as used herein is a biological or chemical moiety that contains a nucleic acid sequence and can be introduced into a suitable target cell for replication or expression of the nucleic acid sequence. Examples of vectors include, but are not limited to, recombinant viruses, plasmids, lipoplexes, polymersomes, polyplexes, dendrimers, cell penetrating peptide (CPP) conjugates, magnetic particles, or nanoparticles. In one embodiment, a vector is a nucleic acid molecule into which an exogenous or heterologous nucleic acid, or an engineered nucleic acid, encoding a functional SGSH, can be inserted and then introduced into a suitable target cell. Such vectors preferably have one or more origins of replication and one or more sites into which recombinant DNA can be inserted. For example, vectors encoding drug resistance genes often have a means by which cells containing the vector can be selected from cells that do not. Common vectors include plasmids, viral genomes, and "artificial chromosomes". Conventional methods for generating, producing, characterizing, or quantifying vectors are available to those skilled in the art.

[0091] In one embodiment, the vector is a non-viral plasmid and includes the described expression cassettes, e.g., "naked DNA," "naked plasmid DNA," naked RNA, and mRNA, associated with various compositions and nanoparticles, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymer, lipid, and / or cholesterol-based-nucleic acid conjugates, and other constructs such as those described herein. See, for example, X. Su et al, Mol. Pharmaceutics, 2011, 8(3), pp 774-787, Web Publication: March 21, 2011, WO2013 / 182683, WO2010 / 053572, and WO2012 / 170930, all of which are incorporated herein by reference.

[0092] In certain embodiments, the vectors described herein are "replication-defective viruses" or "viral vectors," referring to synthetic or artificial viral particles in which an expression cassette containing a nucleic acid sequence encoding SGSH is packaged within a viral capsid or envelope, and any viral genomic sequences packaged within the viral capsid or envelope are also replication-defective, i.e., unable to produce progeny virions, but retaining the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless," containing only nucleic acid sequences encoding SGSH flanked by signals required for amplification and packaging of the artificial genome), although these genes can be supplied during production. Thus, it is considered safe for use in gene therapy, since replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication.

[0093] As used herein, a recombinant viral vector is an adeno-associated virus (AAV), adenovirus, bocavirus, hybrid AAV / bocavirus, herpes simplex virus, or lentivirus.

[0094] As used herein, the term "host cell" may refer to a packaging cell line in which a vector (e.g., recombinant AAV) is produced. A host cell may be a prokaryotic or eukaryotic cell (e.g., human, insect, or yeast) that contains exogenous or heterologous DNA introduced into the cell by any means, such as electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Examples of host cells include, but are not limited to, isolated cells, cell cultures, Escherichia coli cells, yeast cells, human cells, non-human cells, mammalian cells, and the like. These may include cells, non-mammalian cells, insect cells, HEK-293 cells, liver cells, kidney cells, cells of the central nervous system, neurons, glial cells, or stem cells.

[0095] As used herein, the term "target cell" refers to any target cell in which expression of functional SGSH is desired. In certain embodiments, the term "target cell" is intended to refer to a cell of a subject being treated for MPS IIIA. Examples of target cells may include, but are not limited to, liver cells, kidney cells, cells of the central nervous system, neurons, glial cells, and stem cells. In certain embodiments, the vector is delivered to the target cell ex vivo. In certain embodiments, the vector is delivered to the target cell in vivo.

[0096] It is to be understood that the vector compositions described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0097] Recombinant adeno-associated virus (rAAV) Provided herein is a recombinant adeno-associated virus (rAAV) useful for treating mucopolysaccharidosis type III A (MPS IIIA). The rAAV comprises (a) an AAV capsid, and (b) a vector genome packaged within the AAV capsid of (a). Preferably, the selected AAV capsid targets the cells to be treated. In certain embodiments, the capsid is from clade F. However, in certain embodiments, another AAV capsid source, i.e., clade A, may be selected. In certain embodiments, the AAV capsid is an AAVhu68 capsid. In certain embodiments, the AAV capsid is an AAVrh91 capsid. In certain embodiments, the AAV capsid is an AAVhu95 capsid. In certain embodiments, the AAV capsid is an AAVhu96 capsid. The vector genome comprises an AAV 5' inverted terminal repeat (ITR), an engineered nucleic acid sequence encoding a functional hSGSH as described herein, regulatory sequences that direct expression of functional hSGSH in target cells, and an AAV 3' ITR.

[0098] As used herein, the term "vector genome" refers to a nucleic acid molecule that is packaged into a viral capsid, e.g., an AAV capsid, and capable of being delivered to a host cell or a patient's cell. In certain embodiments, the vector genome contains at its extreme 5' and 3' ends the terminal repeat sequences (AAV inverted terminal repeats (ITRs)) necessary for packaging the vector genome into a capsid, and contains therebetween an expression cassette that includes the MECP2 gene described herein operably linked to sequences that direct expression of the vector genome.

[0099] The AAV sequence of the vector typically includes cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are approximately 145 base pairs (bp) in length. Preferably, substantially complete sequences encoding the ITRs are used in the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989) and K. Fisher et al., J. Virol., 70:520 532 (1996)). One example of such a molecule for use in the present invention is a "cis-acting" plasmid containing a transgene, where the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The ITRs are from a different AAV than the one that supplies the capsid. In one embodiment, the ITR sequences are from AAV2. A shortened version of the 5'ITR, termed ΔITR, has been described, in which the D sequence and terminal resolution site (trs) are deleted. In certain embodiments, the vector genome (e.g., of a plasmid) comprises a shortened AAV2 ITR of 130 base pairs, in which the external A element is deleted. The shortened ITRs can be restored to the wild-type length of 145 base pairs during vector DNA amplification using the internal A element as a template, and packaged into the capsid to form viral particles. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV sources can be selected. If the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector can be referred to as pseudotyped. However, other configurations of these elements may be suitable.

[0100] In one aspect, the rAAV is for use in the treatment of Mucopolysaccharidosis III A (MPS IIIA). In one embodiment, the rAAV comprises a vector genome comprising a 5'AAV ITR, an expression cassette, and a 3'AAV ITR, wherein the expression cassette comprises an engineered nucleic acid sequence encoding a functional hSGSH, wherein the functional hSGSH coding sequence comprises a signal peptide sequence and a mature hSGSH coding sequence, wherein the mature hSGSH coding sequence has a nucleic acid sequence of a sequence of SEQ ID NO: 16, or (a) a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 16 that encodes SEQ ID NO: 23, or (b) a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 16 that encodes SEQ ID NO: 23, wherein the hSGSH coding sequence is operably linked to a regulatory control sequence that directs expression of hSGSH in a cell. In certain embodiments, the rAAV comprises an expression cassette (hSGSH.A482Y.E488V) comprising a mature hSGSH coding sequence of SEQ ID NO: 22, which encodes SEQ ID NO: 23 and is 99% identical to SEQ ID NO: 16. In certain embodiments, the mature hSGSH coding sequence is SEQ ID NO: 16. In certain embodiments, the mature hSGSH coding sequence is at least about 85% identical to SEQ ID NO: 16 and encodes SEQ ID NO:23.

[0101] In certain embodiments, the regulatory sequence comprises a CNS-specific promoter, such as the human cynaspulin promoter (hSyn), or a constitutive promoter, such as CB7, CBh, or a regulatable promoter. In certain embodiments, the regulatory element comprises one or more of a Kozak sequence, a TATA signal, an intron, an enhancer, and a polyadenylation sequence.

[0102] In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 3 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 3. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 7 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 7. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 10 (CB7.CI.hSGSHcoV1.rBG), or a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 10. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 13 (CB7.CI.hSGSHcoV1-4xmiR183.rBG), or a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 13. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 40 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V 40. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 1 (CB7.CI.BIP.hSGSHcov1(A482Y-E488V).vIGF2.WPRE.4xmiR182.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 40. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 1 (CB7.CI.BIP.hSGSHcov1(A482Y-E488V).vIGF2.WPRE.4xmiR183.rBG), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 1. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 37 (CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.4xmiR183.rBG), or a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to at least 100% identical to SEQ ID NO: 37.

[0103] In certain embodiments, the clade F AAV capsid is an AAVhu68 capsid [see, e.g., US2020 / 0056159, PCT / US21 / 55436, SEQ ID NOs:48 and 49 for nucleic acid sequences, and SEQ ID NO:50 for amino acid sequence], an AAVhu95 capsid [see, e.g., U.S. Provisional Application No. 63 / 251,599, filed October 2, 2021, and PCT / US2022 / 077315, filed September 30, 2022, SEQ ID NO: 54 and 55 (hu95 nucleic acid sequence), and SEQ ID NO:56 (hu95 amino acid sequence), or an AAVhu96 capsid [see, e.g., U.S. Provisional Application No. 63 / 251,599, filed October 2, 2021, and PCT / US2022 / 077315, filed September 30, 2022, SEQ ID NOs:57 and 58 (hu96 nucleic acid sequence), and SEQ ID NO:59 (hu96 amino acid sequence). In certain embodiments, the AAV capsid is a clade A capsid, such as an AAVrh91 capsid (nucleic acid sequences of SEQ ID NOs:51 and 52; amino acid sequence of SEQ ID NO:53). See PCT / US20 / 030266, filed April 29, 2020, now published WO2020 / 223231, which are incorporated by reference herein, and International Application No. PCT / US21 / 45945, filed August 13, 2021, which are incorporated by reference herein.

[0104] In certain embodiments, the AAV capsid for the compositions and methods described herein is selected based on target cells.In certain embodiments, the AAV capsid transduces CNS cells and / or PNS cells.In certain embodiments, other AAV capsids can be selected.The AAV capsid is selected from cy02 capsid, rh43 capsid, AAV8 capsid, rh01 capsid, AAV9 capsid, rh8 capsid, rh10 capsid, bb01 capsid, hu37 capsid, rh02 capsid, rh20 capsid, rh39 capsid, rh64 capsid, AAV6 capsid, AAV1 capsid, hu44 capsid, hu48 capsid, cy05 capsid, hu11 capsid, hu32 capsid, pi2 capsid, or variations thereof. In certain embodiments, the AAV capsid is a clade F capsid, such as an AAV9 capsid, an AAVhu68 capsid, a hu31 capsid, a hu32 capsid, or a variation thereof. See, for example, WO2005 / 033321, published April 14, 2015, WO2018 / 160582, and US2015 / 0079038, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV capsid is a non-clade F capsid, such as a clade A, B, C, D, or E capsid. In certain embodiments, the non-clade F capsid is AAV1 or a variation thereof. In certain embodiments, the AAV capsid transduces a target cell other than a nervous system cell. In certain embodiments, the AAV capsid is a clade A capsid (e.g., AAV1, AAV6, AAVrh91), a clade B capsid (e.g., AAV2), a clade C capsid (e.g., hu53), a clade D capsid (e.g., AAV7), or a clade E capsid (eg, rh10).

[0105] rAAV consists of an AAV capsid and a vector genome. The AAV capsid is a collection of a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 proteins, and a heterogeneous population of vp3 proteins. As used herein, when used to refer to vp capsid proteins, the term "heterogeneous" or any grammatical variation thereof refers to a collection of non-identical elements, for example, having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0106] As used herein, the term "heterogeneous" or any grammatical variation thereof when used to refer to vp capsid proteins refers to a population of non-identical members, e.g., having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. The term "heterogeneous population" used in reference to vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of vp1, vp2, and vp3 proteins within a capsid. AAV capsids contain subpopulations within vp1, vp2, and vp3 proteins that have modifications from predicted amino acid residues. These subpopulations contain, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations contain at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs, and optionally further contain other deamidated amino acids, where deamidation results in an amino acid change and other optional modifications.

[0107] In certain embodiments, AAV capsids are provided that have a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) that contain multiple highly deamidated "NG" positions. In certain embodiments, the highly deamidated positions are at the positions shown below with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced "NG" is removed, and a mutated "NG" is engineered into another position.

[0108] In certain embodiments, the AAV capsid is an AAVhu68 capsid or an AAVrh91 capsid. In certain embodiments, the AAVhu68 capsid comprises the amino acid sequence of SEQ ID NO:50. In certain embodiments, the AAVhu68 capsid comprises (i) an AAVhu68 vp1 protein, an AAVhu68 vp2 protein, and an AAVhu68 vp3 protein produced from a nucleic acid sequence encoding SEQ ID NO:50, or (ii) a heterogeneous population of AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins, wherein a subpopulation of AAVhu68 vp1, AAVhu68 vp2, and AAV hu68 vp3 proteins comprises at least 50% to 100% deamidated asparagine (N) at each of the asparagine-glycine pair positions 57, 329, 452, 512, compared to amino acid sequence of SEQ ID NO:50, and wherein the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, interconverted aspartic acid / isoaspartic acid, or a combination thereof, as determined using mass spectrometry. In certain embodiments, the nucleic acid sequence encoding the AAVhu68 vp1 protein is SEQ ID NO:48, or a sequence that encodes the amino acid sequence of SEQ ID NO:50, which is at least 80% to at least 99% identical to SEQ ID NO:48, optionally where the nucleic acid sequence is at least 80% to at least 99% identical to SEQ ID NO:48. In certain embodiments, the nucleic acid sequence encoding the AAVhu68 vp1 protein is SEQ ID NO:49, or a sequence that encodes the amino acid sequence of SEQ ID NO:50, which is at least 80% to at least 99% identical to SEQ ID NO:49, optionally where the nucleic acid sequence is at least 80% to at least 97% identical to SEQ ID NO:49.

[0109] As used herein, the terms "target cell" and "target tissue" may refer to any cell or tissue intended to be transduced by the subject AAV vector. The terms may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (visual cells), or heart.

[0110] Additionally, provided herein is a rAAV production system useful for producing the rAAV described herein. The production system comprises a cell culture comprising (a) a nucleic acid sequence encoding an AAV capsid protein, (b) a vector genome, and (c) sufficient AAV rep and helper functions to allow the vector genome to be packaged into an AAV capsid. In certain embodiments, the vector genome is SEQ ID NO: 3, 7, 10, 13, 40, 1, or 37. In certain embodiments, the cell culture is a human embryonic kidney 293 cell culture. In certain embodiments, the AAV rep is from a different AAV. In certain embodiments, the AAV rep is from AAV2. In certain embodiments, the AAV rep coding sequence and the cap gene are on the same nucleic acid molecule, and optionally, there is a spacer between the rep sequence and the cap gene.

[0111] For use in producing AAV viral vectors (e.g., recombinant (r)AAV), the vector genome can be carried on any suitable vector, e.g., a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered to be suitable for replication and packaging in prokaryotic, insect, or mammalian cells in vitro, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of skill in the art.

[0112] In certain embodiments, a nucleic acid (e.g., a plasmid) useful for rAAV production comprises a vector genome comprising a 5'ITR, a CB7 promoter sequence, a chicken beta actin intron, a Kozak sequence, a BIP.hSGSH.vIGF2 coding sequence, a rBG polyA sequence, and a 3'ITR. In certain embodiments, a nucleic acid (e.g., a plasmid) useful for rAAV production comprises a vector genome comprising a 5'ITR, a CB7 promoter sequence, a chicken beta actin intron, a Kozak sequence, a BIP.hSGSH.A482Y.E488V.vIGF2 coding sequence, a rBG polyA sequence, and a 3'ITR. In certain embodiments, a nucleic acid (e.g., a plasmid) useful for rAAV production comprises a vector genome comprising a 5'ITR, a CB7 promoter sequence, a chicken beta actin intron, a Kozak sequence, a BIP.hSGSH.A482Y.E488V.vIGF2 coding sequence, at least four tandem repeats of miR182, a rBG polyA sequence, and a 3'ITR. In certain embodiments, a nucleic acid (e.g., a plasmid) useful for rAAV production comprises a vector genome comprising a 5'ITR, a CB7 promoter sequence, a chicken beta actin intron, a Kozak sequence, a BIP.hSGSH.A482Y.E488V.vIGF2 coding sequence, at least four tandem repeats of miR183, a rBG polyA sequence, and a 3'ITR. In certain embodiments, a nucleic acid (e.g., a plasmid) useful for rAAV production comprises a vector genome, including a 5' ITR, a CB7 promoter sequence, a chicken beta actin intron, a Kozak sequence, a BIP.hSGSH.A482Y.E488V.vIGF2 coding sequence, at least four tandem repeats of miR182, at least four tandem repeats of miR183, a rBG polyA sequence, and a 3' ITR.

[0113] Methods for generating and isolating AAV suitable for use as a vector are known in the art (see generally, e.g., Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem. Engin / Biotechnol. 99:11, each of which is incorporated herein by reference in its entirety). 9-145; Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J. Gene Med. 10:717-733, and references cited below. As used herein, gene therapy vector refers to the rAAV described herein and is suitable for use in treating patients. The ITRs are the only AAV components required in cis, in the same construct as the nucleic acid molecule containing the gene, to package the gene into virions. The cap and rep genes can be supplied in trans.

[0114] In certain embodiments, the manufacturing process for rAAV includes methods described in U.S. Provisional Patent Application No. 63 / 371,597, filed August 16, 2022, and U.S. Provisional Patent Application No. 63 / 371,592, filed August 16, 2022, which are incorporated by reference in their entireties.

[0115] In one embodiment, the selected genetic element can be delivered to the AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Suitable AAV packaging cells can also be produced. Methods used to produce such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. For example, see Molecular Cloning: A See Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0116] The term "AAV intermediate" or "AAV vector intermediate" refers to assembled rAAV capsids that lack the desired genomic sequence packaged therein. These may also be referred to as "empty" capsids. Such capsids may contain no detectable genomic sequence of the expression cassette, or may contain only partially packaged genomic sequence, which is insufficient to achieve expression of a gene product. These empty capsids are not functional for introducing a gene of interest into a host cell.

[0117] The recombinant adeno-associated virus (AAV) described herein can be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, US7588772 B2. Such methods include culturing a host cell that contains an expression cassette consisting of a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, at a minimum, an AAV inverted terminal repeat (ITR) and a transgene, and sufficient helper functions to allow the expression cassette to be packaged into an AAV capsid protein. Methods for producing capsids, coding sequences therefor, and methods for producing rAAV viral vectors have been described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0118] In one embodiment, a producer cell culture is provided that is useful for producing a recombinant AAV having a capsid selected from AAVhu68, AAVrh91, AAVhu95, or AAVhu96. Such cell cultures can be produced by expressing a nucleic acid that expresses an AAV capsid protein in a host cell (e.g., SEQ ID NO:48 or SEQ ID NO:49; a nucleic acid molecule suitable for packaging into an AAVhu68 capsid, e.g., a non-AAV nucleic acid sequence encoding a gene operably linked to an AAV ITR, as well as a regulatory sequence that directs expression of the gene in a host cell; a recombinant AAVhu68 capsid, or an AAVrh91 capsid (e.g., SEQ ID NO:5 The vector genome contains sufficient AAV rep functions and adenovirus helper functions to allow packaging of the vector genome into a recombinant AAVhu68, AAVrh91, AAVhu95, or AAVhu96 capsid (e.g., SEQ ID NO:57 or SEQ ID NO:58). In one embodiment, the cell culture is comprised of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., Spodoptera frugiperda (Sf9) cells). In certain embodiments, the baculovirus provides the helper functions necessary to package the vector genome into a recombinant AAVhu68, AAVrh91, AAVhu95, or AAVhu96 capsid.

[0119] Optionally, the rep function is provided by an AAV other than AAV2 selected to complement the source of the ITRs.

[0120] In one embodiment, the cells are produced in a suitable cell culture (e.g., HEK293 or Sf9) or suspension. Methods for producing gene therapy vectors described herein include methods well known in the art, such as the generation of plasmid DNA used in the production of gene therapy vectors, the generation of vectors, and the purification of vectors. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmids are AAV cis-plasmids encoding the AAV vector genome and the gene of interest, AAV trans-plasmids containing the AAV rep and cap genes, and adenovirus helper plasmids. The vector production process may include method steps such as initiation of cell culture, passaging of cells, seeding of cells, transfection of cells with plasmid DNA, medium exchange with serum-free medium after transfection, and collection of vector-containing cells and culture medium. The collected vector-containing cells and culture medium are referred to herein as crude cell harvest. In yet another system, the gene therapy vector is introduced into insect cells by infection with a baculovirus-based vector. For a discussion of these production systems generally, see, e.g., Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20:922-929, the contents of each of which are incorporated herein by reference in their entirety. Methods of making and using these and other AAV production systems are also described in the following United States patents, the contents of each of which are incorporated by reference in their entirety: U.S. Pat. Nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0121] The crude cell harvest may then be subjected to further processing, including concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector. Affinity chromatography purification followed by anion exchange resin chromatography is used to purify the vector drug product and remove empty capsids. These methods are described in more detail in WO2017 / 160360, filed December 9, 2016, entitled "Scalable Purification Method for AAV9," which is incorporated herein by reference. For AAV8, see WO2017 / 100676, filed December 9, 2016, and for rh10, see WO2017 / 100676, filed December 9, 2016, and WO2017 / 100676, filed December 11, 2015, entitled "Scalable Purification Method for AAV9," which is incorporated herein by reference. For AAV1, the purification methods of WO2017 / 100704, entitled "Scalable Purification Method for AAVrhlO," filed on December 11, 2015, and WO2017 / 100674, filed on December 9, 2016, for "Scalable Purification Method for AAV1," are all incorporated herein by reference. Other suitable methods may be selected.

[0122] To calculate the content of empty and full particles, the VP3 band volume for a selected sample (e.g., in the examples herein, a preparation purified by iodixanol gradient, number of genome copies (GC) = number of particles) is plotted against the GC particles loaded. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test article peak. The number of particles (pt) per 20 μL loaded is then multiplied by 50 to obtain particles (pt) / mL. The ratio of particles to genome copies (pt / GC) is obtained by dividing pt / mL by GC / mL. pt / mL-GC / mL gives empty pt / mL. The percentage of empty particles is obtained by dividing empty pt / mL by pt / mL and multiplying by 100.

[0123] In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method involves subjecting the cured AAV stock to SDS-polyacrylamide gel electrophoresis (e.g., gradient gels containing 3-8% Tris-acetate in buffer) of any gel capable of separating the three capsid proteins, then running the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon. An anti-AAV capsid antibody is then used as the primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody that contains a detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively determine the binding between the primary and secondary antibodies, a method for detecting binding is used, preferably a detection method that can detect radioisotope radiation, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples can be taken from column fractions and heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and capsid proteins resolved in precast gradient polyacrylamide gels (e.g., Novex). Silver staining can be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, i.e., SYPRO Ruby or Coomassie stain.In one embodiment, the concentration of AAV vector genome (vg) in the column fractions can be measured by quantitative real-time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using a TaqMan™ fluorogenic probe specific for the primers and the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as that contained within the AAV vector is used to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) value obtained from the sample is used to normalize it against the Ct value of the plasmid standard curve to determine the vector genome. Titers are determined. Digital PCR-based endpoint assays can also be used.

[0124] In one embodiment, an optimized q-PCR method utilizing a broad spectrum serine protease, such as Protease K (e.g., commercially available from Qiagen, etc.) is used. More specifically, the optimized qPCR genomic titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with Proteinase K buffer and treated with Proteinase K, followed by heat inactivation. Suitably, the sample is diluted with an amount of Proteinase K buffer equal to the sample size. The Proteinase K buffer may be concentrated two-fold or more. Typically, Proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally performed at about 55° C. for about 15 minutes, but can be performed at lower temperatures (e.g., about 37° C. to about 50° C.) for longer periods (e.g., about 20 minutes to about 30 minutes) or at higher temperatures (e.g., up to about 60° C.) for shorter periods (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95°C for about 15 minutes, although the temperature can be lowered (e.g., from about 70 to about 90°C) and the time can be extended (e.g., from about 20 to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described for the standard assay.

[0125] Additionally or alternatively, droplet digital PCR (ddPCR) may be used. For example, a method for determining single-stranded and self-complementary AAV vector genome titer by ddPCR has been described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr; 25 (2): 115-25. doi: 10.1089 / hgtb.2013.131. Epub 2014 Feb 14.

[0126] Briefly, a method for separating rAAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) particles having packaged genomic sequences from genome-defective AAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) intermediates comprises subjecting a suspension containing recombinant AAVhu68 (or AAVrh91) viral particles and AAVhu68 (or AAVrh91, or AVhu95, or AAVhu96) capsid intermediates to high performance liquid chromatography, in which the AAVhu68 (or AAVrh91, or AAVhu95, or AAVhu96) viral particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at a pH of about 10.2 (or about 9.8 for AAVrh91) and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 nanometers (nm) and about 280 nm. The pH can range from about 10 to 10.4, although less optimal for rAAVhu68 and AAVrh91. In this method, AAV full capsids are collected from fractions that elute when the A260 / A280 ratio reaches the infection point. In one example, in an affinity chromatography step, the diafiltered product may be applied to an affinity resin (Life Technologies) that efficiently captures AAV serotypes. Under these ionic conditions, AAV particles are efficiently captured while a significant percentage of residual cellular DNA and proteins flow through the column.

[0127] The rAAV.hSGSH (e.g., rAAV.BIP.hSGSH or rAAV.BIP.hSGSH.vIGF2, or rAAV.BIP.hSGSH.A482Y.E488V or rAAV.BIP.hSGSH.A482Y.E488V.vIGF2) is suspended in a suitable physiologically compatible composition (e.g., buffered saline). This composition can be frozen for storage and later thawed, and optionally diluted with a suitable diluent. Alternatively, the vector can be prepared as a composition suitable for delivery to a patient without undergoing a freezing and thawing step.

[0128] As used herein, the term "clade" refers to a group of AAVs. This term refers to a group of AAVs that are systematically related to each other, as determined using a Neighbor-Joining algorithm based on an alignment of vp1 amino acid sequences with a bootstrap value of at least 75% (out of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less. Neighbor-joining algorithms have been described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics, Oxford University Press, New York (2000). Computer programs that can be used to implement this algorithm are available, for example, MEGA The v2.1 program implements a modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequence of the AAV vp1 capsid protein, one of skill in the art can readily determine whether a selected AAV is contained in one of the clades identified herein, in another clade, or outside these clades. See, for example, G Gao, et al, J Virol, 2004 Jun;78(10):6381-6388, which identifies clades A, B, C, D, E, and F, and provides the nucleic acid sequences of novel AAVs, GenBank Accession Nos. AY530553-AY530629. See also WO2005 / 033321.

[0129] As used herein, the term "NAb titer" is a measure of how much neutralizing antibodies (e.g., anti-AAV Nabs) are produced that neutralize the physiological effect of the targeted epitope (e.g., AAV). Anti-AAV NAb titers can be measured, for example, as described in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009.199(3):p.381-390, which is incorporated herein by reference in its entirety.

[0130] The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers to constructs in which the coding region carried by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of the scAAV associate to form one double-stranded DNA (dsDNA) unit capable of immediate replication and transcription. See, for example, DM McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis," Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated by reference herein in its entirety.

[0131] "Replication-defective virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged into a viral capsid or envelope, and any viral genomic sequences packaged within the viral capsid or envelope are replication-defective, i.e., they are unable to produce progeny virions, but can retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (though the genome contains the gene of interest flanked by signals required for amplification and packaging of the artificial genome). These genes can be supplied during production. Thus, they are considered safe for use in gene therapy, since replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication.

[0132] As used herein, the terms "rAAV" and "artificial AAV" are used interchangeably and refer to, but are not limited to, AAV including a capsid protein and a vector genome packaged therein, the vector genome including a nucleic acid heterologous to AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such an artificial capsid can be produced by any suitable technique using a selected AAV sequence (e.g., a fragment of vp1 capsid protein) in combination with a heterologous sequence that can be obtained from a different selected AAV that is a non-contiguous portion of the same AAV, from a non-AAV viral source, or from a non-viral source. The artificial AAV can be, but is not limited to, a pseudotyped AAV capsid, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. A pseudotyped vector in which the capsid of one AAV is replaced with a heterologous capsid protein is useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotype vectors. The selected genetic element can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA-coated pellets, viral infection, and protoplast fusion. The methods used to create such constructs are known to those skilled in the art of nucleic acid manipulation, and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0133] Often, rAAV particles are referred to as DNase resistant. However, in addition to this endonuclease (DNase), other endo- and exo-nucleases can be used in the purification steps described herein to remove contaminating nucleic acids. Such nucleases can be selected to degrade single-stranded and / or double-stranded DNA, and RNA. Such steps can contain a single nuclease, or a mixture of nucleases directed to different targets, which can be endonucleases or exonucleases.

[0134] The term "nuclease resistant" indicates that the AAV capsid is constructed entirely around an expression cassette designed to deliver genes into a host cell, and protects these packaged genomic sequences from degradation (digestion) during a nuclease incubation step designed to remove contaminating nucleic acids that may be present from the production process.

[0135] As used herein, the term "heterologous" or any grammatical variation thereof when used to refer to vp capsid proteins refers to a population of non-identical elements, for example, having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0136] The term "heterologous" as used in reference to the vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. AAV capsids contain subpopulations within the vp1, vp2, and vp3 proteins that have predicted amino acid residue modifications. These subpopulations contain, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations contain at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs, and optionally further contain other deamidated amino acids, where deamidation may be accompanied by amino acid changes and other Optional modifications occur.

[0137] As used herein, a "subpopulation" of vp proteins refers to a group of vp proteins that have at least one defined common feature and that consists of at least one group member and fewer than all members of the reference group, unless otherwise specified. For example, a "subpopulation" of vp1 proteins, unless otherwise specified, is at least one vp1 protein and fewer than all vp1 proteins in an assembled AAV capsid. A "subpopulation" of vp3, unless otherwise specified, can be one vp3 protein and fewer than all vp3 proteins in an assembled AAV capsid. For example, in an assembled AAV capsid, vp1 protein can be a subpopulation of vp proteins, vp2 protein can be another subpopulation of vp proteins, and vp3 is yet another subpopulation of vp proteins. In another example, vp1, vp2, and vp3 proteins can contain subpopulations having, e.g., at least one, two, three, or four highly deamidated asparagines, e.g., different modifications at asparagine-glycine pairs.

[0138] Pharmaceutical Compositions In one aspect, provided herein is a pharmaceutical composition comprising a vector as described herein in a formulation buffer. In one embodiment, provided herein is a pharmaceutical composition comprising a rAAV as described herein in a formulation buffer. In one embodiment, the rAAV is at about 1×10 9 Genome copies (GC) / mL ~ approx. 1 x 10 14 In a further embodiment, the rAAV is formulated at about 3×10 9 GC / mL ~ approx. 3×10 13 In yet a further embodiment, the rAAV is formulated at about 1×10 9 GC / mL ~ approx. 1×10 13 In one embodiment, the rAAV is formulated at a concentration of at least about 1×10 11 It is formulated in GC / mL.

[0139] Also provided herein is a composition comprising a rAAV or vector described herein and an aqueous suspension medium. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal administration, or intracerebroventricular administration. In one aspect, the composition contains at least one rAAV stock, and optional carriers, excipients, and / or preservatives. As used herein, a "stock" of rAAV refers to a population of rAAV. Despite the heterogeneity of capsid proteins due to deamidation, the rAAVs within the stock are expected to share the same vector genome. A stock can include, for example, rAAVs with capsids having selected AAV capsid proteins and heterogeneous deamidation patterns characteristic of a selected production system. A stock can be produced from a single production system or pooled from multiple runs of a production system. A variety of production systems can be selected, including but not limited to those described herein.

[0140] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharma- ceutical active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase "pharmaceutical acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like may be used to introduce the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivery vector genome may be formulated for delivery either encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, and the like.

[0141] In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, e.g., physiologically It is an aqueous liquid suspension that is buffered to a suitable pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be delivered as a concentrate that is diluted for administration to a subject. In other embodiments, the composition can be lyophilized and reconstituted at the time of administration.

[0142] A suitable surfactant or combination of surfactants may be selected from among non-ionic surfactants that are non-toxic. In one embodiment, a primary hydroxyl terminated bifunctional block copolymer surfactant is selected, such as Pluronic® F68 [BASF], also known as Poloxamer 188, with a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers may be selected, i.e., non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycapric acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named with the letter "P" (for poloxamer) followed by three digits, the first two digits x 100 giving the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 giving the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. In one embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (w / w%, weight to weight basis) of the suspension. In another embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (v / v%, volume to volume basis) of the suspension. In yet another embodiment, the surfactant is present in an amount of up to about 0.0005% to about 0.001% of the suspension, where n% indicates n grams per 100 mL of suspension.

[0143] In another embodiment, the composition comprises a carrier, diluent, excipient and / or adjuvant. A suitable carrier can be easily selected by a person skilled in the art in view of the indication for which the introduced virus is intended. For example, one suitable carrier includes saline, which can be formulated with various buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include a component that prevents rAAV from sticking to the injection tube but does not interfere with rAAV binding activity in vivo. A suitable surfactant, or combination of surfactants, may be selected from among non-toxic non-ionic surfactants. In one embodiment, a bifunctional block copolymer surfactant terminated in a primary hydroxyl group is selected, such as Poloxamer 188 (also known under the trade names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® P188), having a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers may be selected, i.e. non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycapric acid glyceride), polyoxy-oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named with the letter "P" (for poloxamer) followed by three digits, where the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may comprise a maximum of about 0.0005% to about 0. It may be present in an amount of 0.01%.

[0144] In certain embodiments, compositions containing rAAV.hSGSH are delivered at a pH in the range of 6.8 to 8, or 7.2 to 7.8, or 7.5 to 8. For intrathecal delivery, a pH greater than 7.5, e.g., 7.5 to 8, or 7.8, may be desirable.

[0145] In certain embodiments, the formulation may contain a buffered saline solution that does not contain sodium bicarbonate. Such formulations may contain a buffered saline solution that contains one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and combinations thereof in water, such as Harvard buffer. In one embodiment, the buffer is PBS. In another embodiment, the buffer is artificial cerebrospinal fluid (aCSF), such as Elliot's formulation buffer, or Harvard apparatus perfusion solution (artificial CSF with final ionic concentrations (in mM): Na150, K3.0, Ca1.4, Mg0.8, P1.0, Cl155). The aqueous solution may further contain Kolliphor® P188, a poloxamer, which is commercially available from BASF and was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2.

[0146] In another embodiment, the formulation may contain a buffered saline solution comprising 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% poloxamer (Kolliphor®) 188, pH 7.2. See, e.g., harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard buffers are preferred due to better pH stability observed with Harvard buffers.

[0147] In certain embodiments, the formulation buffer is artificial CSF containing Pluronic F68. In other embodiments, the formulation may contain one or more penetration enhancers. Examples of suitable penetration enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0148] Optionally, the compositions of the present invention may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and carrier(s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0149] The composition according to the invention may comprise a pharma- ceutically acceptable carrier as defined above. Suitably, the composition described herein comprises an effective amount of one or more AAV suspended in a pharma- ceutically suitable carrier and / or mixed with suitable excipients designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In certain embodiments, an ommaya reservoir is used for delivery. In one example, the composition is formulated for intrathecal delivery. In one example, the composition is formulated for intrathecal (iv) delivery.

[0150] In one embodiment, a therapeutically effective amount of the vector is included in the pharmaceutical composition. The choice of carrier is not a limitation of the present invention. Other conventional pharma- ceutically acceptable carriers, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbitol ... Suitable chemical stabilizers include acetic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0151] The phrase "pharmacologically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host.

[0152] As used herein, the term "dosage" or "amount" can refer to the total dosage or amount delivered to a subject over the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or divided dosage) administration.

[0153] Additionally, the replication-defective virus composition may be administered to a human patient in a dose range of about 1.0×10 (to treat an average subject weighing 70 kg), including all integers or fractions within the range. 9 GC~approx. 1.0×10 16 GC range, preferably 1.0 x 10 12 GC~1.0×10 14 The composition can be formulated in dosage units containing an amount of replication-defective virus in the range of GC. In one embodiment, the composition contains at least 1 x 10 per dose, including all integers or decimals within the range. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9 x 10 9 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or decimals within the range. 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9 x 10 10In another embodiment, the composition is formulated to contain at least 1×11 GC per dose, including all integers or decimals within the range. 11 , 2×11 11 , 3×11 11 , 4×11 11 , 5×11 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9 x 10 11 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or decimals within the range. 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9 x 10 12 In another embodiment, the composition is formulated to contain at least 1×13 GC per dose, including all integers or decimals within the range. 13 , 2×13 13 , 3×13 13 , 4×13 13 , 5×13 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9 x 10 13 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or decimals within the range. 14 , 2×10 14 , 3×10 14 , 4×1014, 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9 x 10 14 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or decimals within the range. 15 , 2×10 15 , 3×10 15 , 4×1015 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9 x 10 15 In one embodiment, for human applications, the dose is 1×10 per dose, including all integers or fractions within the range. 10 ~Approx. 1×10 12 It may be in the GC range.

[0154] In one embodiment, a pharmaceutical composition comprising an rAAV described herein comprises about 1×10 9 GC ~ approx. 1 × 10 per gram of brain mass 13 It is administered in the dose of GC.

[0155] It is to be understood that the compositions in the pharmaceutical compositions described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0156] use In one aspect, the method provided herein is a method of treating a human subject diagnosed with MPS IIIA. Currently, when clinical suspicion of MPS III exists, the first step is to detect urinary ... MPS IIIA requires quantitative tests to detect the presence of GAGs. The DMB test is based on binding of GAGs with dimethylmethylene blue and quantification of the GAG-DMB complex by spectrophotometry. The sensitivity of this test is 100% and the specificity is 75-100%. Due to the fact that in some patients with attenuated forms of the disease, the levels of GAG excretion with healthy controls may overlap and the increased excretion of heparan sulfate in MPS III may be negligible, a negative result when detecting GAGs in urine does not exclude the presence of MPS III. The current gold standard technique for diagnosis is the determination of enzyme activity in cultured skin fibroblasts, leukocytes, plasma, or serum. The specific diagnosis of MPS IIIA is confirmed by showing a reduction or absence of one of the SGSH enzyme activities involved in the degradation of heparan sulfate in the patient's leukocytes or fibroblasts; the reduction should be less than 10%, while the other sulfatases are normal, when compared with the activity in healthy individuals. Since diseases caused by multiple sulfatase deficiencies also show reduced activity of heparan N-sulfatase, N-acetylglucosamine 6-sulfatase, and other sulfatases, biochemical analysis of at least other sulfatases is necessary to confirm the diagnosis of MPS III and therefore exclude multiple sulfatase deficiencies. However, the diagnostic method is not limiting of the present invention and other suitable methods may be selected.

[0157] The method includes administering to the subject a suspension of a vector described herein. In one embodiment, the method includes administering to the subject about 1×10 per gram of brain mass. 9 GC ~ approx. 1 × 10 per gram of brain mass 14 The rAAV described herein is administered in a formulation buffer at a dose of GC.

[0158] The composition(s) and method(s) provided herein achieve efficacy in treating a subject in need of treatment for MPS IIIA. The efficacy of the method in a subject can be demonstrated by assessing (a) an increase in SGSH enzyme activity, (b) alleviation of MPS IIIA symptoms, (c) improvement of biomarkers associated with MPS IIIA, e.g., polyamine (e.g., spermine) levels, e.g., GAG levels in cerebrospinal fluid (CSF), serum, urine, and / or other biological samples, or (e) promotion of any treatment(s) for MPS IIIA. In certain embodiments, efficacy can be determined by monitoring cognitive improvement and / or correction of anxiety, improvement of gait and / or mobility, reduction of tremor frequency and / or severity, reduction of spasticity / convulsions, improvement of posture, improvement of corneal opacity. Additionally or alternatively, the efficacy of the method can be predicted based on an animal model. In another embodiment, a multi-parameter grading scale was developed to assess disease correction and response to the MPSIIIA vector therapy described herein in an animal model. Animals are assigned a score based on a combination of assessments of tremors, posture, hair quality, spasticity, corneal haze, and ambulation / mobility. In certain embodiments, any combination of one or more of these factors, alone or in combination with other factors, may be used to indicate efficacy. See, e.g., Burkholder et al. Curr Protoc Mouse Biol.June 2012,2:145-65, Tumpey et al.J Virol.May 1998,3705-10, and Guyenet et al.J Vis Exp, May 2010, 39;1787). Cognitive improvement and anxiety correction in treated animals are assessed by assessing locomotion in an open field (i.e., the beam-break assay described, for example, in Tatem et al. J Vis Exp, 2014, (91):51785) and by the elevated plus maze assay (described, for example, in Walf and Frye, Nat Protoc, 2007, 2(2):322-328).

[0159] As used herein, "promotion of any treatment(s) for MPS IIIA" or any grammatical variation thereof refers to the promotion of a treatment or treatments for MPS IIIA that are associated with a disease or condition that is ... "MPS IIIA" refers to a reduction in the dosage or frequency of treatment for MPS IIIA in a subject other than the composition(s) or method(s). Examples of suitable treatments facilitated by the composition(s) or method(s) described herein may include, but are not limited to, pharmaceuticals used to alleviate symptoms (such as seizures and sleep disorders) and improve quality of life, hematopoietic stem cell transplants such as bone marrow transplants or umbilical cord blood transplants, enzyme replacement therapy (ERT) via intravenous administration or intraventricular infusion, and any combination thereof. In one embodiment, the described methods result in a subject showing improvement in biomarkers associated with MPS IIIA.

[0160] "Increased SGSH enzyme activity" is used interchangeably with the term "increased desired SGSH function" and refers to SGSH activity of at least about 5%, 10%, 15%, 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of the SGSH enzyme range in healthy patients. SGSH enzyme activity can be measured by the assays described herein. In one embodiment, SGSH enzyme activity can be measured in serum, plasma, blood, urine, CSF, or another biological sample. In one embodiment, administration of the compositions described herein or use of the methods described herein results in an increase in SGSH enzyme activity in serum, plasma, saliva, urine, or other biological sample. Alternatively, other CSF biomarkers, such as CSF GAG levels and spermine levels, can be measured to determine the therapeutic effect. See, for example, WO2017 / 136533.

[0161] Neurocognition can be determined by conventional methods, see, e.g., WO2017 / 136500 A1. Prevention of neurocognitive decline refers to a slowing of neurocognitive decline in a subject administered a composition described herein or undergoing a method described herein by at least about 5%, at least about 20%, at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%, compared to that of an MPS IIIA patient.

[0162] As used herein, the term "biomarker" or "biomarker associated with MPS IIIA" refers to the presence, concentration, expression level, or activity of a biological or chemical molecule in a biological sample of a subject that correlates in a positive or negative manner with the progression or onset of MPS IIIA. In one embodiment, the biomarker is GAG levels in cerebrospinal fluid (CSF), serum, urine, skin fibroblasts, white blood cells, plasma, or any other biological sample. In another embodiment, the biomarker is assessed using clinical chemistry. In yet another embodiment, the biomarker is liver volume or spleen volume. In one embodiment, the biomarker is heparan N-sulfatase, N-acetylglucosamine 6-sulfatase, and other sulfatases activity. In another embodiment, the biomarker is spermine levels in CSF, serum, or another biological sample. In yet another embodiment, the biomarker is lysosomal enzyme activity in serum, CSF, or another biological sample. In one embodiment, the biomarker is assessed via magnetic resonance imaging (MRI) of the brain. In another embodiment, the biomarker is a neurocognitive score measured by a neurocognitive development test. As used herein, the phrase "improvement of a biomarker" refers to a reduction in a biomarker that is positively correlated with disease progression or an increase in a biomarker that is negatively correlated with disease progression, where the reduction or increase is at least about 5%, at least about 20%, at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% compared to before administration of the compositions described herein or use of the methods described herein.

[0163] In one embodiment, the method further comprises detecting or monitoring a biomarker associated with MPS IIIA in the subject prior to initiating therapy with a therapy provided herein. In certain embodiments, the method includes detecting a biomarker that is a polyamine (such as spermine) in a sample from a subject (see WO / 2017 / 136533, which is incorporated herein by reference). In certain embodiments, spermine concentration levels are detected in patient samples to monitor the effectiveness of treatment for MPSIII using the vectors described herein.

[0164] Currently, patients with MPSIIIA are not considered candidates for bone marrow transplantation (BMT), substrate synthesis suppression therapy (SRT), or enzyme replacement therapy (ERT). However, in certain embodiments, gene therapy patients treated with vectors expressing SGSH as described herein have, at a minimum, sufficient enzyme expression levels such that any near-normal range of enzyme levels can be treated with ERT or SRT. Such ERT can be a combination therapy, in which the dose of ERT is monitored and adjusted over months or years after vector administration. Additionally or alternatively, SRT can be a combination therapy, in which the dose of SRT is monitored and adjusted over months or years after vector administration.

[0165] As used herein, enzyme replacement therapy (ERT) is a medical treatment consisting of replacing enzymes in patients who are deficient or lacking in a particular enzyme. Enzymes are usually produced as recombinant proteins and administered to patients. In one embodiment, the enzyme is a functional SGSH. In another embodiment, the enzyme is a recombinant protein that contains functional SGSH. Systemic, intrathecal, intracerebroventricular, or intracisternal delivery can be achieved using ERT. As used herein, substrate synthesis inhibition therapy (SRT) refers to a therapy that uses small molecule drugs to partially inhibit the biosynthesis of compounds that accumulate in the absence of SGSH. In one embodiment, SRT is a genistein-mediated therapy. For example, Ritva Tikkanen et al,Less Is More:Substrate Reduction Therapy for Lysosomal Storage Disorders.Int J Mol Sci.2016 Jul;17(7):1065.Published online 2016 Jul 4.doi:10.3390 / ijms17071065, Delgadillo V et al,Genistein supplementation in patients affected by See Sanfilippo disease. J Inherit Metab Dis. 2011 Oct;34(5):1039-44. doi:10.1007 / s10545-011-9342-4. Epub 2011 May 10, and de Ruijter J et al, Genistein in Sanfilippo disease: a randomized controlled crossover trial. Ann Neurol. 2012 Jan;71(1):110-20. doi:10.1002 / ana.22643.

[0166] Suitable volumes for delivery of these doses and concentrations can be determined by one of skill in the art. For example, a volume of about 1 μL to 150 mL can be selected, with larger volumes being selected for adults. Typically, for newborns, suitable volumes are about 0.5 mL to about 10 mL, and for months-old infants, about 0.5 mL to about 15 mL can be selected. For infants, a volume of about 0.5 mL to about 20 mL can be selected. For children, a volume of up to about 30 mL can be selected. For pre-teens and teenagers, a volume of up to about 50 mL can be selected. In yet other embodiments, patients can receive intrathecal administration in a volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL is selected. Other suitable volumes and dosages may be determined. Dosages are adjusted to balance therapeutic benefit against any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized.

[0167] In one embodiment, the rAAV described herein is about 1×10 per gram of brain mass. 9 GC ~ approx. 1 × 10 per gram of brain mass 14 In certain embodiments, the GC is administered at a dose of 100 mg / kg / day. So, rAAV is about 1 × 10 per kg of body weight. 9 GC ~ approx. 1 x 10 per kg of body weight 13 It is co-administered systemically at the GC dose.

[0168] In one embodiment, the subject is delivered a therapeutically effective amount of the vector described herein. As used herein, "therapeutically effective amount" refers to an amount of a composition comprising a nucleic acid sequence encoding hSGSH that delivers and expresses an amount of the enzyme to a target cell sufficient to achieve efficacy. In one embodiment, the dosage of the vector is about 1×10 per gram of brain mass, including all integer or decimal amounts within the range and endpoints. 9 GC ~ Approximately 1 × 10 per gram (g) of brain mass 13 In another embodiment, the dosage is 1×10 per gram of brain mass. 10 GC ~ approx. 1 × 10 per gram of brain mass 13In certain embodiments, the dose of the vector administered to the patient is at least about 1.0×10 9 GC / g, approx. 1.5×10 9 GC / g, approx. 2.0×10 9 GC / g, approx. 2.5×10 9 GC / g, approx. 3.0×10 9 GC / g, approx. 3.5×10 9 GC / g, approx. 4.0×10 9 GC / g, approx. 4.5×10 9 GC / g, approx. 5.0×10 9 GC / g, approx. 5.5×10 9 GC / g, approx. 6.0×10 9 GC / g, approx. 6.5×10 9 GC / g, approx. 7.0×10 9 GC / g, approx. 7.5×10 9 GC / g, approx. 8.0×10 9 GC / g, approx. 8.5×10 9 GC / g, approx. 9.0×10 9 GC / g, approx. 9.5×10 9 GC / g, approx. 1.0×10 10 GC / g, approx. 1.5×10 10 GC / g, approx. 2.0×10 10 GC / g, approx. 2.5×10 10 GC / g, approx. 3.0×10 10 GC / g, approx. 3.5×10 10 GC / g, approx. 4.0×10 10 GC / g, approx. 4.5×10 10 GC / g, approx. 5.0×10 10 GC / g, approx. 5.5×10 10 GC / g, approx. 6.0×10 10 GC / g, approx. 6.5×10 10 GC / g, approx. 7.0×10 10 GC / g, approx. 7.5×10 10 GC / g, approx. 8.0×10 10 GC / g, approx. 8.5×10 10 GC / g, approx. 9.0×10 10 GC / g, approx. 9.5×10 10 GC / g, approx. 1.0×10 11 GC / g, approx. 1.5×10 11 GC / g, approx. 2.0×1011 GC / g, about 2.5×10 11 GC / g, about 3.0×10 11 GC / g, about 3.5×10 11 GC / g, about 4.0×10 11 GC / g, about 4.5×10 11 GC / g, about 5.0×10 11 GC / g, about 5.5×10 11 GC / g, about 6.0×10 11 GC / g, about 6.5×10 11 GC / g, about 7.0×10 11 GC / g, about 7.5×10 11 GC / g, about 8.0×10 11 GC / g, about 8.5×10 11 GC / g, about 9.0×10 11 GC / g, about 9.5×10 11 GC / g, about 1.0×10 12 GC / g, about 1.5×10 12 GC / g, about 2.0×10 12 GC / g, about 2.5×10 12 GC / g, about 3.0×10 12 GC / g, about 3.5×10 12 GC / g, about 4.0×10 12 GC / g, about 4.5×10 12 GC / g, about 5.0×10 12 GC / g, about 5.5×10 12 GC / g, about 6.0×10 12 GC / g, about 6.5×10 12 GC / g, about 7.0×10 12 GC / g, about 7.5×10 12 GC / g, about 8.0×10 12 GC / g, about 8.5×10 12 GC / g, about 9.0×10 12 GC / g, about 9.5×10 12 GC / g, about 1.0×10 13 GC / g, about 1.5×10 13 GC / g, about 2.0×10 13 GC / g, about 2.5×10 13 GC / g, about 3.0×10 13 GC / g, about 3.5×10 13 GC / g, about 4.0×1013 GC / g, approx. 4.5×10 13 GC / g, approx. 5.0×10 13 GC / g, approx. 5.5×10 13 GC / g, approx. 6.0×10 13 GC / g, approx. 6.5×10 13 GC / g, approx. 7.0×10 13 GC / g, approx. 7.5×10 13 GC / g, approx. 8.0×10 13 GC / g, approx. 8.5×10 13 GC / g, approx. 9.0×10 13 GC / g, approx. 9.5×10 13 GC / g, or approximately 1.0 x 10 14 GC / g brain mass.

[0169] Dosage is adjusted to balance the therapeutic effect against any side effects, and such dosage may vary depending on the therapeutic application for which the recombinant vector is used.The level of expression of the transgene product can be monitored to determine the frequency of dosing that results in viral vector, preferably AAV vector containing minigene.Optionally, the same dosing regimen as described for therapeutic purposes using the composition of the present invention can be utilized for immunization.

[0170] In one embodiment, the method further comprises subjecting the subject to an immunosuppressive combination therapy. Immunosuppressants for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T-cell inhibitors, macrolides (e.g., rapamycin or rapalogs), and cytostatic agents (including alkylating agents, antimetabolites, cytotoxic antibiotics, antibodies, or agents active against immunophilins). Immunosuppressants may include nitrogen mustards, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, IL-2 receptor (CD25)-specific antibodies or CD3-specific antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-α) binding agents.

[0171] In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 7 days, or earlier prior to gene therapy administration. Such therapy may include simultaneous administration of two or more drugs on the same day, such as prednerisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin). One or more of these drugs may be continued at the same dose or at adjusted doses after gene therapy administration. Such therapy may be for about a week (7 days), about 60 days, or longer, as needed. In certain embodiments, a tacrolimus-free regimen is selected.

[0172] In certain embodiments, the methods include measuring serum anti-hSGSH antibodies. Suitable assays for measuring anti-hSGSH antibodies as described herein are available.

[0173] In one embodiment, the rAAV described herein is administered once to a subject in need thereof, hi another embodiment, the rAAV is administered two or more times to a subject in need thereof.

[0174] The recombinant vectors described above can be delivered to host cells according to published methods. The rAAV, preferably suspended in a physiologically compatible carrier, can be administered to a human or non-human mammalian patient. In certain embodiments, for administration to a human patient, the rAAV is preferably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Preferably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. The pH of cerebrospinal fluid is about 7.28 to about 7.32, so for intrathecal delivery, a pH within this range may be desirable, and for intravenous delivery, a pH of about 6.8 to about 7.2 may be desirable. However, for other delivery routes, other pHs within the broadest range, and subranges thereof, may be selected.

[0175] As used herein, the term "intrathecal delivery" or "intrathecal administration" refers to the route of administration of a drug via injection into the spinal canal, more specifically into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intraventricular cerebroventricular (ICV)), suboccipital / intracisternal, and / or C1-2 puncture. For example, the material may be introduced by means of a lumbar puncture to diffuse throughout the subarachnoid space. Another example may be an injection into the cisterna magna. In certain embodiments, the rAAV, vector, or composition described herein is administered to a subject in need thereof via intrathecal administration. In certain embodiments, intrathecal administration is performed as described in U.S. Patent Publication No. 2018-0339065A1, published November 29, 2019, which is incorporated herein by reference in its entirety.

[0176] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to the administration of a drug directly into the cerebrospinal fluid of the cisterna magna, more specifically, by suboccipital puncture or by direct injection into the cisterna magna, or by a permanently placed tube. Point out the route.

[0177] In certain embodiments, treatment with the compositions described herein has minimal to mild subclinical degeneration of DRG sensory neurons in animals and / or human patients that is well tolerated with respect to sensory neurotoxicity and subclinical sensory neuron pathology.

[0178] It is to be understood that the compositions in the methods described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0179] kit In certain embodiments, kits are provided that include concentrated vector suspended in a (optionally frozen) formulation, optional dilution buffer, and devices and other components required for intrathecal, intraventricular, or intracisternal administration. In another embodiment, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to allow injection. Such buffer may allow for about 1:1 to 1:5 dilution of the concentrated vector, or more. In other embodiments, more or less buffer or sterile water is included to allow for dose titration and other adjustments by the treating physician. In yet other embodiments, the kit includes one or more components of the device. Suitable dilution buffers are available, such as saline, phosphate buffered saline (PBS), or glycerol / PBS.

[0180] It is to be understood that the compositions in the kits described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0181] Devices and methods for delivery of pharmaceutical compositions to the cerebrospinal fluid - Patents.com In one aspect, the rAAV or compositions thereof provided herein may be administered intrathecally via the methods and / or devices described in WO2017 / 136500 and WO2018 / 160582, which are provided in this section and are incorporated herein by reference. Alternatively, other devices and methods may be selected. In certain embodiments, the method includes a step of CT-guided suboccipital injection into the cisterna magna of a patient via a spinal needle. As used herein, the term computed tomography (CT) refers to radiography in which a three-dimensional image of a body structure is constructed by a computer from a series of planar cross-sectional images made along an axis. In certain embodiments, the vectors and / or compositions thereof described herein are administered via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternomagna [ICM]). In certain embodiments, the device is described in U.S. Patent Publication No. 2018-0339065A1, published November 29, 2019, which is incorporated herein by reference in its entirety. In certain embodiments, the vectors, rAAV, or compositions thereof provided herein may be administered using an Ommaya reservoir.

[0182] It is to be understood that the compositions in the devices described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0183] As used herein, the term "administering" or any grammatical variation thereof refers to the delivery of a composition described herein to a subject.

[0184] The words "comprise", "comprises" and "comprising" are to be interpreted inclusively rather than exclusively. The words "consist" and "consisting" and variations thereof should be interpreted as exclusive rather than inclusive. Although various embodiments herein have been presented using the word "comprising," under other circumstances, the relevant embodiment is also intended to be included and described using the words "consisting of" or "consisting essentially of." As used throughout this specification and claims, the terms "comprising," "containing," and "including," and variations thereof, are inclusive of other components, factors, integers, steps, etc. Conversely, the term "consisting" and variations thereof, exclude other components, factors, integers, steps, etc.

[0185] It should be noted that the terms "a" or "an" refer to one or more. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0186] As used herein, unless otherwise specified, the term "about" or "to" refers to a ±10% variation from and between the reference integers. For example, "about" 500 μM includes ±50 (i.e., 450 to 550, including the integers therebetween). For other values, particularly when referring to percentages (e.g., meaning 90%), the term "about" includes all values ​​within the range, including both integers and decimals.

[0187] As used herein, the term "about," when used to modify a numerical value, means a variation of ±10% (±10%, e.g., ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, ±10, or values ​​therebetween) from the given reference, unless otherwise specified.

[0188] In certain cases, the term "E+#" or "e+#" is used to refer to a power. For example, "5E10" or "5e10" refers to 5 × 10 10 These terms may be used interchangeably.

[0189] With regard to the description of the various embodiments herein, it is contemplated that, in another embodiment, each of the compositions described herein is useful and is useful in the methods of the invention. In addition, each of the compositions described herein that are useful in the methods is also contemplated, in another embodiment, to be an embodiment of the invention itself.

[0190] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published documents which provide such persons with general guidance to many of the terms used in this application. EXAMPLES

[0191] The following examples are provided to illustrate certain aspects of the claimed invention, but the invention is not limited to these examples.

[0192] This is a method to treat Mucopolysaccharidosis type IIIA (MPSIIIA, or Sanfilippo A syndrome) using a recombinant adeno-associated virus serotype hu68 (or other pantropic / neurotropic serotypes) containing a ubiquitous promoter expressing an engineered version of human N-sulfoglucosamine sulfohydrolase (hSGSHco) containing a polyA sequence. Several engineered sequence-encoded versions of hSGSH are covered: Sequence (N-sulfoglucosamine sulfohydrolase isoform 1 precursor [Homo sapiens] NCBI Reference Sequence: NP_000190.1), another frequent missense single nucleotide polymorphism rs7503034 encoding NP_000190.1:p.Arg456Pro, fusion protein vIGF2-hSGSHco, fusion protein vIGF2-hSGSHco(R456P). More details regarding the sequences are included herein and throughout the application.

[0193] The vector is administered via intracerebroventricular (ICV) or intrathecal (IT) delivery. IT delivery encompasses both the lumbar route and the suboccipital cisterna magna. The rationale is to drive high hSGSH expression in the CNS to correct the neurological symptoms of MPSIIIA disease.

[0194] In addition, thorough coding sequence engineering optimization and protein optimization (testing alternative SNPs, engineering targeting peptides, etc.) provide an efficient gene therapy strategy that allows for lowering the minimum effective dose compared to conventional approaches using WT proteins or first generation approaches using different coding sequence engineering processes.

[0195] Example 1. Comparison of engineered SGSH and engineered SGSH constructs in WT mice in vitro. In this study, engineered hSGSH coding sequences were compared for expression (i.e., quantification) and activity. hSGSH activity was assayed in serum samples obtained on days 7 and 28.

[0196] A variety of SGSH assays are available for investigating the activity and quantification of SGSH. One SGSH assay is a fluorescence-based SGSH activity assay that uses pure commercial grade SGSH, conditioned medium, and mouse tissue homogenate. Another SGSH assay is an HPLC-based SGSH activity assay, which requires further optimization. Yet another SGSH assay is a mass spectrometry-based SGSH activity assay, which also requires further optimization. Additionally, a mass spectrometry-based signal peptide SGSH protein quantification assay can be used.

[0197] First, we investigated the constructs in vitro. In this study, we tested the expression of various hSGSH constructs in HEK293 cells (Figure 1A). Figure 1A shows various designed hSGSH constructs that contain the wild-type (WT) mature SGSH coding sequence and further contain either an endogenous signal sequence or a binding immunoglobulin protein (BIP) signal sequence, a linker, a vIGF2 peptide (i.e., a peptide that binds to the CI-MPR), and / or a lysosomal cleavage sequence. HEK293 cells were transfected with plasmids containing nucleic acid sequences encoding the constructs as described in Figure 1A. Media collected from HEK293 cells were then analyzed for expression and secretion of the SGSH constructs 3 and 4 days after transfection. Figure 1B shows the expression levels of SGSH secreted into HEK293 cell media 3 days after transfection, analyzed using Western blot. Figure 1C shows the quantified SGSH expression levels (from Western blot analysis; Figure 1B) plotted as normalized SGSH secretion levels. Figure 2A shows the expression levels of SGSH secreted into HEK293 cell media 4 days post-transfection analyzed using Western blot. Figure 2B shows the quantified SGSH expression levels (from Western blot analysis; Figure 2A) plotted as normalized SGSH secretion levels. The mature SGSH coding sequence (Figure 2C) was further engineered for use in constructs containing the BiP signal sequence and vIGF2 peptide.

[0198] Furthermore, in HEK293F cells, A containing WT and engineered SGSH transgenes The in vitro expression of AV plasmids was examined. Figure 16A shows the expression levels of SGSH secreted into HEK293 cell medium after transfection with AAV plasmids, including engineered SGSH constructs, engineered SGSH constructs with WPRE elements, and WT SGSH constructs, analyzed using Western blot. Figure 16B shows AAV quantified SGSH expression (normalized to WT SGSH) after transfection of HEK293F cells with AAV plasmids. These results show that engineered SGSH expression was increased by approximately 40% by including the WPRE element (n=1). For reference, Figures 16C and 16D show typical expression observed with mammalian expression vectors. Figure 16C shows SGSH expression levels after transfection with plasmids containing SGSH constructs with and without vIGF2 peptide, examined using Western blot analysis. Figure 16D shows SGSH expression levels quantified from Western blot analysis and plotted normalized to WT SGSH expression levels. These results indicate increased expression levels of SGSH in the SGSH construct containing vIGF2.

[0199] We next examined the engineered constructs in vivo in WT mice. In this study, mice (1-2 months old) were administered rAAV containing vector genomes containing various hSGSH coding sequences (i.e., WT and engineered; also referred to as AAVhu68.hSGSH) with the AAVhu68 capsid and expression driven by the CB7 promoter.

[0200] Injections were performed on day 0 of the study. Serum samples were collected on days 7 and 28 of the study. An autopsy was performed on day 28 during which brain and liver tissues were collected. Serum samples were collected from day 7 post-injection and stored at -80°C. An autopsy was performed on day 28, samples were collected and stored at -80°C. More specifically, serum samples were collected instead of plasma samples on day 28 post-injection. Stored samples included brain (right half) and liver tissues, which were analyzed for hSGSH enzyme activity and expression (i.e., Western blot). The other half of the liver and brain (left) tissues were fixed in formalin and transferred to the pathology core for hSGSH IHC. The table directly below summarizes the study layout. [Table 1]

[0201] SGSH enzyme activity was analyzed in serum on days 7 and 28 of the study using a fluorescent activity assay. Collected serum samples were diluted 1:50. Figure 3A shows the results of the SGSH enzyme activity assay using a fluorescent activity assay. 10 GC or 1×10 11 FIG. 3B shows SGSH enzyme activity from serum samples collected from mice administered AGC. AVhu68.hSGSH(1×10 11 GC or 1×10 11 Figure 4A shows SGSH enzyme activity from serum samples collected from mice treated with 1 × 10 GC. The results show that an approximately two-fold increase was observed between SGSH concentrations in treated serum and PBS-treated serum (control group). Furthermore, SGSH enzyme activity was examined from brain and liver tissues collected from mice at necropsy. Figure 4B shows that SGSH enzyme activity was increased in mice treated with 1 × 10 GC. 10 GC and 1×10 11 Figure 4B shows SGSH enzyme activity from homogenized liver tissue samples collected from mice administered GC. 10 GC and 1×10 11Figure 5A shows SGSH enzyme activity from homogenate brain tissue samples collected from mice administered GC. These results support liver transduction, as significant SGSH activity was observed in liver tissue homogenate samples. SGSH activity in brain tissue homogenate was not statistically higher than WT. Furthermore, SGSH expression levels were examined in liver tissue homogenate samples by Western blot. Figure 5B shows SGSH enzyme activity from homogenate samples collected from 1 × 10 10 GC and 1×10 11 Figure 5B shows the expression levels of SGSH analyzed from liver tissue homogenate samples from mice administered AAVhu68.hSGSH at a dose of GC. Figure 5B shows the quantified expression levels of SGSH analyzed by Western blot (shown in Figure 5A). Western blot analysis of brain homogenates showed no visible banding at the same intensity as in liver. Bands were indistinguishable in high contrast between groups (blot not shown). 1 x 10 11 GC dose, 1 × 10 10 Immunohistochemical microscopy analysis of liver tissues collected from mice administered AAVhu68.hSGSH containing various constructs (CoV1, CoV1-R456P, CoV2, CoV3) with doses of GC or treated with PBS was performed (data not shown). These results confirm the expression of hSGSH in liver tissues as analyzed by Western blot.

[0202] Additionally, a signal peptide assay was performed on SGSH in liver tissue samples. 10 GC~1×10 11 Figure 7B shows the results of SGSH protein concentration, plotted as ng / g, analyzed from liver tissue samples collected from mice administered AAVhu68.hSGSH at a dose of GC. 11 1 shows the correlation between SGSH enzyme activity (measured using a fluorescent assay) and signal peptide assays performed on liver samples collected from mice administered GC.

[0203] Additionally, the effect of the WPRE element in the vector genome was examined. Figure 6A shows expression and quantification of SGSH in the cortex after administration of AAVhu68.hSGSH containing a WPRE. Figure 6B shows expression and quantification of SGSH in the cerebellum after administration of AAVhu68.hSGSH containing a WPRE. Figure 6C shows expression and quantification of SGSH in the hippocampus after administration of AAVhu68.hSGSH containing a WPRE. Figure 6D shows expression and quantification of SGSH in the brainstem after administration of AAVhu68.hSGSH containing a WPRE. These results show that the addition of the WPRE to the engineered candidate rescues expression to levels similar to the WT construct.

[0204] In summary, high dose (HD; 1 × 10 11 GC) or at a mild dose (LD; 1 × 10 10 When mice receive the rAAVhu68.hSGSH construct via GC, none of the groups show significant transduction of the brain. Analysis of liver tissue homogenate samples shows significant transduction in all treatment groups.

[0205] Construct "SGSH-CoV1" (or CoV1) showed slightly higher activity in the liver than other CohSGSH constructs (e.g., CoV1-R456P, CoV2, CoV3) and statistically different levels of activity between high and low doses on both days 7 and 28 in serum. Furthermore, we confirmed that Arg456Pro is not a benign variant. Western blot analysis supports the activity assay data.

[0206] Production of rAAV containing hSGSH In the studies herein, fusion proteins containing exogenous BIP leader and / or vIGF peptide fused to an engineered sequence encoding human SGSH were generated, and comparative studies were performed with corresponding constructs that did not contain exogenous BIP peptide and vIGF2 peptide sequences. Triple transfection techniques are used to generate rAAV, utilizing (1) a cis plasmid encoding the AAV2 rep protein and AAVhu68 VP1 cap gene, (2) a cis plasmid containing adenovirus helper genes not provided by the packaging cell line expressing adenovirus E1a, and (3) a trans plasmid containing a vector genome for packaging into the AAV capsid. See, e.g., US2020 / 0056159. The trans plasmid is designed to contain either a vector genome, including hSGSH with an exogenous leader peptide (BIP), hSGSH with the native hSGSH leader peptide including the vIGF2 peptide, or hSGSH with the native hSGSH leader peptide without the vIGF2 peptide. The vector genomes include: (i) CB7.CI.BIP.hSGSHcov1(A482Y-E488V).vIGF2.WPRE.4xmiR183.rBG (SEQ ID NO: 1); (ii) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.rBG (SEQ ID NO: 3), (iii) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.rBG (SEQ ID NO: 7), (iv) CB7.CI.hSGSHcoV1.rBG (SEQ ID NO: 10), (v) CB7.CI.hSGSHcoV1-4xmiR183.rBG (SEQ ID NO: 13), (vi) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.4xmiR183.rBG (SEQ ID NO: 37), or (vii) CB7.CI.BIP.hSGSHcov1-A482Y_E488V.vIGF2.WPRE.4xmiR182.rBG (sequence number 40).

[0207] The vector genome contains an AAV5' inverted terminal repeat (ITR) and an AAV3'ITR at the extreme 5' and 3' ends, respectively. The ITRs flank the sequence of an expression cassette packaged within the AAV capsid, which has sequences encoding hSGSH, hSGSH.A482Y.E488V, BIP-hSGSH, or BIP-hSGSH.A482Y.E488V, where BIP refers to the ab exogenous signal peptide. The expression cassette further comprises regulatory sequences operably linked to the fusion protein coding sequence, including a CB7 promoter, a chicken beta actin intron, a rabbit beta-globin polyA, and, optionally, a WPRE element, which is a mutated WPRE element. See also Kingsman et al., 2005 and Zanta-Boussif et al., 2009.

[0208] Example 2. MPS IIIA Vector Screening Study MPS IIIA Mice We next investigated the efficacy of the SGSH construct in MPSIIIA KO mice. In this study, we used the hSGSH coV1 engineered construct based on the results observed in Example 1 (WT mouse expression study). AAVhu68 capsid was used for delivery of the hSGSHcoV1 construct in MPSIIIA and WT (control) mice (N-110 KO mice, and N=10 WT mice). 1×10 10 (low dose) and 5 × 10 10 Mice were administered AAVhu68.hSGSH at a dose of 0.1 mg / kg / day (high dose). Mice were 2-3 months old at the time of ICV injection. The study duration was 1 month. Additionally, multiple variations of engineered hSGSHcoV1 constructs were examined, including those containing the BiP signal peptide, stabilizing amino acid (AA) changes, and / or the vIGF2 peptide. The study endpoints used were size reduction of lysosomal compartments (as examined via LAMP1 immunofluorescence (IF) analysis), storage reduction (as examined via GAG storage HS and MS), and SGSH expression levels (as examined via enzyme activity assays and immunohistochemistry analysis). [Table 2]

[0209] Tissue samples collected for Cohort 1 included brain, spinal cord, and liver. Tissue samples collected for Cohort 2 included heart and spleen.

[0210] 8A to 8F show the results of a low dose (1 × 10 10 ) were used for immunofluorescence and histochemistry analysis in MPS IIIA SGSH KO mice administered AAVhu68.hSGSH. Figure 8A shows end-point analysis of lysosomal compartment reduction examined via LAMP1 quantification. Group 1 (G1) = AAVhu68.CB7.hSGSHcoV1, G2 = AAVhu68.CB7.BIP-hSGSHcoV1, G3 = AAVhu68.CB7.BIP-hSGSHcoV1-vIGF2, G4 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1, G5 = AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2, G6 = KO mouse PBS control, G7 = WT mouse PBS control. Figure 8B shows mean size (μm) of LAMP1 positive cells in the cerebellum. 2 ) in the cerebellum. Figure 8C shows the average size (μm) of LAMP1 positive cells in the brainstem. 2 ) in the brainstem. Figure 8D shows the LAMP1 area percentage in the brainstem. Figure 8E shows the average size (μm 2 ) is shown. FIG. 8F shows LAMP1 area percent in the cortex.

[0211] 9A to 9J show the results of the high dose (1×10 116 shows endpoint analysis of lysosomal compartment reduction examined via LAMP1 quantification using immunofluorescence and histochemistry in MPS IIIA SGSH KO mice administered AAVhu68.hSGSH (A482Y E488V), G6 and G7 (KO and WT PBS controls) as in FIG. 8, G8=AAVhu68.CB7.hSGSHcoV1, G11=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G12=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G13=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G14=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G15=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G16=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G17=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G18=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G19=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G20=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G21=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G22=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G23=AAVhu68.CB7.BIP-hSGSH(A482Y E488V), G24=AAV E488V)coV1-vIGF2.

[0212] FIG. 9A shows the average size (μm) of LAMP1-positive cells in the cerebellum. 2 ) in the cerebellum. Figure 9C shows the average size (μm) of LAMP1 positive cells in the brainstem. 2 ) in the brainstem. Figure 9D shows the LAMP1 area percentage in the brainstem. Figure 9E shows the average size (μm 2 ) in 2-3 month old mice, measured at 1 month using the Mann-Whitney test. 10 Figure 9I shows the percent LAMP1 area in the cortex of G1, G2, and G3 as defined in Figures 8A-8F at doses of GC. Figure 9I shows the percent LAMP1 area in 2-3 month old mice measured at 1 month using the Mann-Whitney test. 10 Figure 9J shows the percent LAMP-1 area in the cerebellum of G1, G2, and G3 at doses of GC. 2 × 10 in 2-3 month old mice measured at 1 month using the Mann-Whitney test. 10 Percent LAMP-1 area in the hippocampus in G1, G2, and G3 at GC doses is shown. These results show that similar performance of WT (group 1) and engineered WPRE (group 3) candidates was observed near the injection site, and in the cerebellum, no SGSH was detected by IHC regardless of group, and only the engineered WPRE candidate showed clearance of LAMP1 positive material.

[0213] The following assays were then further performed: SGSH enzyme activity, glycosaminoglycan (GAG) (HS) accumulation / reduction, and anti-SGSH antibody titers. SGSH enzyme activity was examined using liquid chromatography with tandem mass spectrometry (LC-MS / MS) quantification of product formation from a one-step reaction using 2-naphthalene-GlcNS. GAG (HS) accumulation / reduction was examined using LC-MS / MS quantification of disaccharide degradation products from butanolysis of HS in tissues. Anti-SGSH antibody titers were examined using ELISA.

[0214] Figures 10A-C show SGSH activity and GAG reduction in the brains of male and female mice. Figure 10A shows SGSH activity in the brain plotted as activity (nmol / mL / hr). Figure 10B shows SGSH activity in the brain plotted as log activity. Figure 10C shows GAG levels in the brain plotted as ng GAG(HS) per mg protein.

[0215] Additionally, SGSH activity and inhibition of substrate synthesis were examined in the brains of treated mice one month after administration. 12 Mice were administered the indicated rAAV (hSGSHcoV1, coV1BIP-hSGSH(A482Y E488V)coV1-vIGF2, and coV1BIP-hSGSH(A482Y E488V)coV1-vIGF2 containing a WPRE) at doses of 1000 mg / kg (vg / kg). Figure 17A shows SGSH activity in treated mouse brains. Figure 17B shows GAG(HS) levels in the brain. Figure 17C shows total GM3 in mouse brains. These results indicate that the addition of the WPRE to the engineered candidates rescues expression to levels similar to the WT construct, allowing for comparable or better storage clearance.

[0216] Figures 11A-11C show SGSH activity in GAG reduction in the spinal cord of male and female mice. Figure 11A shows SGSH activity in the spinal cord plotted as activity (nmol / mL / hr). Figure 11B shows SGSH activity in the spinal cord plotted as log activity. Figure 11C shows GAG levels in the spinal cord plotted as ng GAG(HS) per mg protein.

[0217] Figures 12A-C show SGSH activity in GAG reduction in liver of male and female mice. Figure 12A shows SGSH activity in liver plotted as activity (nmol / mL / hr). Figure 12B shows SGSH activity in liver plotted as log activity. Figure 12C shows GAG levels in liver plotted as ng GAG(HS) per mg protein.

[0218] Figure 13A shows SGSH activity in serum (nmol / mL / hr) plotted as activity measured 7 days after ICV injection. Figure 13B shows SGSH activity in serum (nmol / mL / hr) plotted as log activity measured 7 days after ICV injection. Figure 13C shows SGSH level activity in plasma (nmol / mL / hr) plotted as activity measured 1 month after ICV injection. Figure 13D shows SGSH level activity in plasma (nmol / mL / hr) plotted as log activity measured 1 month after ICV injection.

[0219] Additionally, GM3 levels were examined in mouse brain samples. Figure 14A shows the total GM3 levels in mouse brain plotted as pmol GM3 per mg protein. Figure 14B shows the total GM3 levels in mouse brain plotted as logarithmic scale pmol GM3 per mg protein. These results show that low dose engineered construct (BIP stabilized AA SGSH-vIGF2) has better performance than others.

[0220] In summary, the engineered hSGSH-coV1 construct was examined and compared to four (4) other engineered SGSH candidates. SGSH activity was observed to be highest with the hSGSH-coV1 construct. Additionally, GAG reduction was observed to be equally reduced in two (2) engineered versions, coV1BIP-hSGSH(A482Y E488V)coV1 and coV1BIP-hSGSH(A482Y E488V)coV1-vIGF2. Furthermore, GM3 reduction was observed to be superior with low doses of coV1BIP-hSGSH(A482Y E488V)coV1-vIGF2. All candidates reduced LAMP1 staining compared to MPSIIIA KO mice at high doses. Variability in results was observed at low doses due to poor expression of the engineered constructs. Considering the above results, further studies will focus on BIP-hSGSH(A482Y_E488Y)coV1-vIGF2 and hSGSHcoV1 (unengineered) to be used as controls.

[0221] Example 3. MPS IIIA vector studies in mice and non-human primates (NHPs). Next, the efficacy of AAV.hSGSH containing an engineered SGSH coding sequence (BIP-hSGSH(A482Y_E488Y)coV1-vIGF) will be further examined.

[0222] First, this study examines SGSH expression and enzyme activity in an engineered construct (BIP-hSGSH(A482Y_E488Y)coV1-vIGF) containing the WPRE element in the AAV vector genome (see also Example 1). Additionally, the effect of adding miR detargeting sites is examined to evaluate the impact on efficacy. miR detargeting is performed by adding four or more miRNA targeting sequences, namely miR182 and miR183.

[0223] Next, the biodistribution and transduction levels of AAV.hSGSH when administered to non-human primates (NHPs) using AAVhu68 and AAVrh91 capsids will be examined and compared. Additionally, the transduction levels of AAV.hSGSH.WPRE with AAVhu68 capsid will be examined and compared. Additionally, the safety, efficacy and impact of AAV.hSGSH further comprising a DRG detargeted miRNA target sequence will be evaluated. The table immediately below shows a summarized layout of the NHP study. Briefly, a total of 15 NHPs (N-3 / group) were administered 3×10 IgG (adjusted based on rhesus brain weight (e.g., 90 g)) via ICM (intracistern magna). 13 AAV will be administered at a dose of GC. The primary readouts of the study will be pharmacology (SGSH expression levels), toxicology, and histopathology. [Table 3]

[0224] A pilot study was performed to examine and measure baseline SGSH activity in untreated rhesus monkeys (NHPs) prior to AAV.hSGSH vector administration. Figure 15A shows the levels of SGSH baseline activity in untreated NHP brain sections plotted as nmol / mg / hr measured in the medulla, cerebellum, thalamus, and frontal cortex. Figure 15B shows the levels of SGSH baseline activity in untreated NHP spinal cord sections plotted as nmol / mg / hr measured in the spinal cord cervical, thoracic, lumbar, and dorsal root ganglion (DRG) cervical, lumbar, and thoracic sections. These data show significant SGSH activity observed in DRG sections and plasma. Figure 15B shows the levels of SGSH baseline activity in untreated NHP spinal cord sections plotted as nmol / mg / hr measured in the spinal cord cervical, thoracic, lumbar, and dorsal root ganglion (DRG) cervical, lumbar, and thoracic sections. See Figures 15C-15E. FIG. 23 shows serum NfL in treated NHPs and indicates that serum NfL corresponds with the severity of histopathological axonal degeneration.

[0225] FIG. 18A shows the results of the analysis of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVr Figure 18B shows SGSH activity in treated NHP cerebellar brain tissue compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). Figure 18B shows SGSH activity in treated NHP medullary brain tissue compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). Figure 18C shows SGSH activity in treated NHP frontal cortex brain tissue compared against background in G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). Figure 18D shows SGSH activity in treated NHP thalamus brain tissue compared against background in G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE).

[0226] Figure 19A shows SGSH activity in treated NHP spinal cord sections (SC cervical) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). Figure 19B shows SGSH activity in treated NHP spinal cord sections (SC thoracic) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE). FIG. 19C shows SGSH activity in treated NHP spinal cord slices (SC lumbar) compared against a background of G1 (AAVhu68.CB7.hSGSHcoV1), G2 (AAVrh91.CB7.hSGSHcoV1), and G4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE).

[0227] Figure 20A shows SGSH activity in treated NHP plasma. Figure 20B shows SGSH activity in treated CSF.

[0228] Figure 21A shows total anti-hSGSH IgG titers in NHP plasma. Figure 21B shows total anto-hSGSH titers in CSF. These results indicate that the Group 2 (rAAVrh91.hGSH) construct is more immunogenic in CSF and plasma than the Group 1 (AAVhu68.CB7.hSGSHcoV1) or 4 (AAVhu68.CB7.BIP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE) constructs.

[0229] Additionally, ELISPOT was performed on samples from NHPs treated with G1 (AAVhu68.CB7.hSGSHcoV1; Table A) and G4 (AAVhu68.CB7.BiP-hSGSH(A482Y E488V)coV1-vIGF2.WPRE; Table B), the results of which are shown in the table below. [Table 4] [Table 5]

[0230] Figure 22A shows nerve conduction velocity (NCV) results plotted as NP (neural polarity in Amp) in the left median nerve. Figure 22B shows nerve conduction velocity (NCV) results plotted as NP (neural polarity in Amp) in the right median nerve. Figure 22C shows nerve conduction velocity (NCV) results plotted as velocity in the left median nerve. Figure 22D shows nerve conduction velocity (NCV) results plotted as velocity in the right median nerve. These results show that NP or velocity in the median nerve did not show significant reduction with the engineered WPRE candidates.

[0231] In summary, mouse bioanalysis studies showed that SGSH activity of all candidates was comparable to untreated WT in brain and liver and generally indistinguishable from one another, with substrate synthesis inhibition being most reduced in the engineered WPRE candidate. Brain lysosomal pathology correction by LAMP-1 IF was most reduced away from the injection site by using the engineered WPRE candidate. Additionally, NHP pilot safety / pharmacology showed that expression appeared to be equal or better than the lead engineered WPRE candidate. The engineered hSGSH-WPRE had a similar immunogenicity profile to the non-engineered one based on ELISPOT data. The engineered hSGSH-WPRE showed the best safety profile based on DRG toxicity biomarkers (NfL) and histopathology.

[0232] Example 4. AAV.hSGSH efficacy in mouse neurospheres. In this study, we investigate and compare the SGSH expression levels and efficacy of AAV.hSGSH, which contains WT SGSH constructs, engineered SGSH constructs, and engineered SGSH constructs that further contain the WPRE element within the AAV vector genome. In this study, we used 48-well plates seeded with WT neurospheres (which differentiate into the astrocyte lineage) and incubated for 10 days after AAV treatment to allow maximum expression. We used cellular western analysis (i.e., plate images) in which 800 channel fluorescence (green) indicates transgene expression via secondary antibody (anti-SGSH) and 700 channel fluorescence (red) indicates cell mass via the CellTag™ tool. The table immediately below shows a schematic of the plate layout and experimental conditions / treatments used. [Table 6]

[0233] Figure 16 shows SGSH transgene expression levels at various MOIs plotted as AFU (800 / 700 nm) in AAV.hSGSH-treated neurospheres containing WT SGSH constructs, engineered SGSH constructs, or engineered SGSH constructs further containing the WPRE element within the AAV vector genome. Data was normalized to account for varying cell mass. The engineered SGSH virus resulted in less transgene expression than wild type, which is in line with the in vivo data above, while transient transfection of the plasmid in HEK cells shows that engineered expression is higher than wild type. These results are encouraging in that the addition of WPRE can significantly enhance expression of the engineered construct in vivo.

[0234] All documents cited herein are incorporated herein by reference. The electronic sequence listing entitled "UPN-19-9075PCT_20221111.xml" having a size of 257,646 bytes, created on November 11, 2022, submitted herewith, and the entire contents of the electronic sequence listing (e.g., sequences and text of the sequence listing) are incorporated herein by reference. U.S. Provisional Patent Application No. 63 / 278,775, filed November 12, 2021, and U.S. Provisional Patent Application No. 63 / 288,293, filed December 10, 2021, are incorporated herein by reference. The present invention has been described with reference to certain embodiments, but it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be within the scope of the appended claims.

Claims

1. A recombinant adeno-associated virus (rAAV) comprising an adeno-associated virus (AAV) capsid and a vector genome, wherein the vector genome comprises an AAV 5' inverted terminal repeat (ITR), an expression cassette, and an AAV 3' ITR, and the expression cassette comprises an engineered nucleic acid sequence encoding a functional human N-sulfoglycosamine sulfohydrolase (hSGSH), wherein the hSGSH coding sequence comprises a signal peptide sequence and a mature hSGSH coding sequence; the mature hSGSH code has the nucleic acid sequence of SEQ ID NO: 16, or a nucleic acid sequence that is (a) at least 85% or (b) at least 99% identical thereto and encodes SEQ ID NO: 23; the hSGSH coding sequence is operably linked to a regulatory control sequence that directs expression of the hSGSH in a cell; Recombinant adeno-associated virus. (i) the mature hSGSH coding sequence 99% identical to SEQ ID NO:16 is SEQ ID NO:22, which encodes SEQ ID NO:23 (hSGSH.A482Y-E488V); or (ii) the mature hSGSH coding sequence is SEQ ID NO: 16; or (iii) the mature hSGSH coding sequence has the nucleic acid sequence of SEQ ID NO: 16 or a nucleic acid sequence that is 85% identical thereto and encodes SEQ ID NO: 23; or (iv) the signal peptide sequence is a native signal sequence having the nucleic acid sequence of SEQ ID NO: 31, or a sequence at least about 95% identical to SEQ ID NO: 31, which encodes SEQ ID NO: 32; The rAAV of claim 1.

3. The regulatory control sequence is (i) comprising a CMV IE enhancer, a chicken beta-actin (CB) promoter and a chicken beta-actin intron, or (ii) one or more of a Kozak sequence, an intron, an enhancer, a TATA signal, and a polyA sequence, and optionally containing the rabbit globin polyadenylation sequence, 3. The rAAV of claim 1 or 2.

4. The rAAV of any one of claims 1 to 3, wherein the regulatory control sequence further comprises a mutant WPRE element.

5. the vector genome further comprises at least one, two, three, four or more tandem repeats of a dorsal root ganglion (drg)-specific miRNA target sequence, wherein the at least one, two, three, four or more tandem repeats comprise at least a first miRNA target sequence, at least a second, at least a third, and / or at least a fourth miRNA target sequence; and optionally The miRNA target sequence includes at least a first miRNA target sequence, at least a second miRNA target sequence, at least a third miRNA target sequence, and / or at least a fourth miRNA target sequence that targets miR182 or miR183; The rAAV according to any one of claims 1 to 4.

6. 6. The rAAV of claim 5, wherein the miRNA of the at least first, at least second, at least third, and / or at least fourth miRNA target sequences of the expression cassette mRNA or DNA positive strand is AGTGTGAGTTCTACCATTGCCAAA (miR182, SEQ ID NO: 47); and / or AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 28).

7. 7. The rAAV of any one of claims 1 to 6, wherein the vector genome further comprises at least eight tandem repeats comprising at least a first, at least a second, at least a third, at least a fourth, at least a fifth, at least a sixth, at least a seventh, and at least an eighth miRNA target sequence, which may be the same or different, targeting miR183 or miR182, and optionally the at least eight tandem repeats comprising at least four tandem repeats of a dorsal root ganglion (drg)-specific miRNA182 target sequence and at least four tandem repeats of a drg-specific miRNA183 target sequence. (a) the drg-specific miRNA target sequences of the at least first, at least second, at least third, at least fourth, at least fifth, at least sixth, at least seventh, and / or at least eighth miRNA target sequences of the expression cassette mRNA or DNA positive strand are (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 28), and (ii) AGTGTGAGTTCTACCATTGCCAAA (miR182, SEQ ID NO: 47), and / or (b) the drg-specific miRNA target sequence of the at least first, at least second, at least third, and / or at least fourth miRNA target sequence of the expression cassette mRNA or DNA positive strand is AGTGTGAGTTCTACCATTGCCAAA (miR182, SEQ ID NO: 47), and the at least fifth, at least sixth, at least seventh, and / or at least eighth miRNA target sequence of the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 28); The rAAV of claim 7.

9. two, three, four or more, or the at least eight of the miRNA target sequences are separated by a spacer, and optionally the spacers are independently selected from one or more of: (A) GGAT, (B) CACGTG, (C) GCATGC, (D) gcggccgc, (E) cgat, (F) atcggt, and / or (G) tcac; and further optionally, the spacers located between the miRNA target sequences may be located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence. The rAAV according to any one of claims 5 to 7.

10. the at least one, two, three, four or more, or the at least eight tandem repeats of a dorsal root ganglion (drg)-specific miRNA target sequence are (i) the 3' untranslated region (UTR) of the hSGSH; or (ii) the 5' untranslated region (UTR) of the hSGSH The rAAV of any one of claims 5 to 9, operably linked to

11. The rAAV of any one of claims 1 to 3, wherein the rAAV vector genome comprises the nucleic acid sequence of SEQ ID NO: 10 (AAV.CB7.CI.hSGSHcoV1.rBG).

12. The rAAV of any one of claims 1 to 6, wherein the rAAV vector genome comprises the nucleic acid sequence of SEQ ID NO: 13 (CB7.CI.hSGSHcoV1-4xmiR183.rBG).

13. The rAAV of any one of claims 1 to 12, wherein the AAV capsid is a clade F AAV.

14. 14. The rAAV of any one of claims 1 to 13 for use in the treatment of Mucopolysaccharidosis IIIA (MPS IIIA or Sanfilippo syndrome type A) and / or for use in improving gait or mobility, reducing tremors, reducing spasticity, improving posture, or reducing progression of vision loss in a subject in need of treatment for Mucopolysaccharidosis IIIA.

15. A composition comprising a stock of rAAV according to any one of claims 1 to 14 and an aqueous suspension medium.

16. A pharmaceutical composition comprising the rAAV of any one of claims 1 to 14 in a formulation buffer.

17. 17. The composition of claim 15 or the pharmaceutical composition of claim 16, formulated for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection.

18. 1 x 10 per gram of brain mass 9 GC ~ approximately 1 x 10 per gram of brain mass 13 can be administered in a dose of GC; and / or formulated to have a pH of about 7.28 to about 7.32; 18. The pharmaceutical composition of claim 16 or 17.

19. 1. A vector comprising an expression cassette, said expression cassette comprising an hSGSH coding sequence, said hSGSH coding sequence being a nucleic acid sequence encoding functional human N-sulfoglycosamine sulfohydrolase (hSGSH) under the control of regulatory control sequences that direct expression of said hSGSH, said hSGSH coding sequence comprising a signal peptide sequence and mature hSGSH, said mature hSGSH coding sequence being selected from SEQ ID NO: 16, or a sequence at least about 95% identical to SEQ ID NO: 16, or SEQ ID NO: 22, or a sequence at least about 95% identical to SEQ ID NO:

22.

20. 20. The vector of claim 19, wherein the vector is a viral vector selected from a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adenovirus, or a non-viral vector selected from naked DNA and naked RNA.

21. 1. A nucleic acid molecule comprising an expression cassette comprising an engineered functional human N-sulfoglycosamine sulfohydrolase (hSGSH) gene and regulatory control sequences, wherein the expression cassette is flanked by a 5' inverted terminal repeat (ITR) and a 3' ITR, the engineered hSGSH gene encodes functional hSGSH, the hSGSH coding sequence comprises a signal peptide sequence and mature hSGSH, and the mature hSGSH coding sequence is selected from SEQ ID NO: 16 and SEQ ID NO:

22.

22. 22. The nucleic acid sequence of claim 21, wherein the expression cassette is selected from SEQ ID NO: 11 and SEQ ID NO:

14.

23. 23. A packaging host cell comprising the nucleic acid molecule of claim 21 or claim 22.

24. The packaging host cell of claim 23, (i) the host cell further comprises an AAV rep coding sequence operably linked to a sequence that expresses rep proteins in the packaging host cell, an AAV capsid coding sequence operably linked to a sequence that expresses AAV capsid proteins in the packaging host cell, and helper virus functions necessary to enable packaging of the expression cassette and ITRs into the AAV capsid; and / or (ii) the AAV capsid is selected from AAVhu68 and AAVrh91; 24. The packaging host cell of claim 23.

25. 13. An rAAV production system useful for producing the rAAV of any one of claims 1 to 12, comprising: (a) a nucleic acid sequence encoding an AAV capsid protein; (b) a vector genome; and (c) a rAAV production system comprising a cell culture containing sufficient AAV rep and helper functions to allow packaging of the vector genome into the AAV capsid.

26. The rAAV production system described in claim 25, wherein (i) the AAV capsid is selected from AAVhu68 and AAVrh91, or (ii) the vector genome is selected from SEQ ID NOs: 10 and 13.

27. 15. A suspension of the rAAV of any one of claims 1-14 for use in a method of treating a human subject diagnosed with MPS IIIA and / or improving gait or mobility, reducing tremors, reducing seizures, improving posture, or reducing the progression of vision loss in a subject in need of treatment for MPS IIIA, wherein the method comprises administering to the subject 1 x 10 per gram of brain mass in a formulation buffer. 9 GC ~ approximately 1 x 10 per gram of brain mass 13 Administering said suspension of rAAV at a dose of GC.

Images