Aptamers and small molecule ligands

JP2024546954A5Pending Publication Date: 2025-12-22MEIRAGTX UK LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024535970
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-15
Filing Date
2022-12-15
Publication Date
2025-12-22

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure provides an aptamer that binds to a certain small molecule. Also contemplated is a riboswitch and a polynucleotide cassette for regulating the expression of a target gene, where the polynucleotide cassette comprises the aptamer disclosed herein. Further provided is a small molecule that binds to the aptamer disclosed herein and is a modulator of target gene expression, where the target gene comprises a riboswitch that comprises the aptamer described herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to oligonucleotide aptamers that bind to certain small molecules, and methods for generating aptamers that bind to the small molecules. Also contemplated are riboswitches and polynucleotide cassettes for regulating expression of a target gene, wherein the polynucleotide cassette comprises an aptamer disclosed herein. Further provided are small molecules that are modulators of target gene expression, wherein the target gene comprises a riboswitch comprising an aptamer described herein. [Background technology]

[0002] Aptamers are oligonucleotides that bind to target ligands with high affinity and specificity. These nucleic acid sequences have proven to have high therapeutic and diagnostic value, with the recent FDA approval of the first aptamer drug and additional aptamer drugs in the clinical pipeline. Their high specificity and versatility have established RNA aptamers as one of the important tools in the emerging field of RNA nanotechnology in the fight against human diseases, including cancer, viral infections, and other diseases.

[0003] In addition, aptamers can be used as part of a riboswitch that exerts a particular effect in the presence or absence of an aptamer ligand. For example, a riboswitch can be used to regulate gene expression in response to the presence or absence of an aptamer ligand.

[0004] However, aptamers / ligands derived from prokaryotic sources or generated using in vitro selection methods often fail to demonstrate the functionality required for the expression of therapeutic target genes in eukaryotic systems. For example, the ligand of an aptamer may be a cellular molecule that would not be suitable for use in a system to regulate therapeutic gene products, for example, because the presence of the ligand would prevent the regulation of target gene expression or because the ligand is otherwise unsuitable for administration to cells or tissues. Therefore, there is a need for new aptamer sequences, small molecule ligands, and aptamer / ligand combinations that can regulate gene expression in response to the presence or absence of small molecule ligands. Summary of the Invention

[0005] Provided herein are aptamer sequences that bind to small molecules of Formulas I-XXII, including those listed in Table A, and analogs or derivatives thereof. Riboswitches and polynucleotide cassettes for regulating expression of target genes are also contemplated, where the polynucleotide cassette comprises an aptamer disclosed herein. Further provided are methods of using the aptamers, the riboswitches, and / or the polynucleotide cassettes to regulate target genes, including therapeutic genes. Also provided herein are small molecules that are modulators of expression of target genes, where the target gene comprises a riboswitch comprising an aptamer described herein.

[0006] In one aspect, the present disclosure provides an aptamer comprising a sequence encoding an aptamer disclosed herein. In embodiments, the sequence encoding the aptamer comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCX7X8X9X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G, X7 is A or T; X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A, X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T, X 22 But T, X 23 is A, G, or T (combined, SEQ ID NO: 681).

[0007] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCX7X8X9X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G, X7 is A, X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A, X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T, X 22 But T, X 23 is A, G, or T (combined, SEQ ID NO: 682).

[0008] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A, G, or T; X8 is any nucleotide; X9 is any nucleotide, X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, C, or T (combined, SEQ ID NO: 683).

[0009] In some embodiments, X7 to X 12 are not simultaneously A, T, T, G, C, and A, respectively.

[0010] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A or T; X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A (combined, SEQ ID NO: 684).

[0011] In some embodiments, X7 to X 12 are not simultaneously A, T, T, G, C, and A, respectively.

[0012] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A, X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A (combined, SEQ ID NO: 685).

[0013] In some embodiments, X7 to X 12 are not simultaneously A, T, T, G, C, and A, respectively.

[0014] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C, G, or T; X2 is any nucleotide, X3 is any nucleotide, X4 is any nucleotide, X5 is any nucleotide, X6 is any nucleotide (combined, SEQ ID NO: 686).

[0015] In some embodiments, X1-X6 are not simultaneously C, A, T, C, G, and A, respectively.

[0016] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is any nucleotide, X5 is A, G, or T; X6 is any nucleotide (combined, SEQ ID NO: 687).

[0017] In some embodiments, X1-X6 are not simultaneously C, A, T, C, G, and A, respectively.

[0018] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G (combined, SEQ ID NO: 688).

[0019] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide.

[0020] In some embodiments, X 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, respectively.

[0021] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 22 But T, X 23is A, G, or T (combined, SEQ ID NO: 689).

[0022] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein X 16 is any nucleotide, X 17 is any nucleotide, X 18 is any nucleotide, X 19 is any nucleotide, X 20 is any nucleotide, X 21 are C, G, and T (combined, SEQ ID NO: 690).

[0023] In some embodiments, X 16 ~X 21 are not simultaneously A, T, C, A, T, and G, respectively.

[0024] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T (combined, SEQ ID NO: 691).

[0025] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical, to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558.

[0026] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

[0027] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

[0028] In embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical, to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. In embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

[0029] In some embodiments, the aptamer sequences disclosed herein further comprise additional sequences at the 5' and 3' ends that are complementary to and can form part of the aptamer P1 stem. In some embodiments, this P1 stem of the aptamer is, contains, or overlaps with the effector region of a riboswitch disclosed herein. In some embodiments, the aptamer P1 stem comprises the 5' splice site sequence of the 3' intron and a sequence complementary thereto. For example, the P1 stem can include AGGGTGAGT, AAAGTAAGC, GCAG TA AGT, GAGGTGTGG, A / CAGGTA / GAGT, NAGGTA / GAGT, NAGGTAAGT, A / CA / TGGTANGT, or NAG / AGTAAGT (where N can be A, G, C, or T).

[0030] In embodiments, the aptamers disclosed herein bind to one or more of the small molecules of Formulas I-XXII, including those listed in Table A.

[0031] In one aspect, the present disclosure provides an RNA aptamer encoded by an aptamer-encoding sequence disclosed herein.

[0032] In one aspect, the disclosure provides a nucleic acid sequence encoding a recombinant riboswitch for regulating target gene expression in response to a small molecule, where the riboswitch comprises an aptamer disclosed herein.

[0033] In another aspect, the present disclosure provides a polynucleotide cassette for regulating expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds a small molecule, wherein the sequence encoding the aptamer comprises a sequence encoding an aptamer disclosed herein.

[0034] In embodiments, the polynucleotide cassette comprises: (a) A riboswitch and (b) an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron; wherein the riboswitch (i) comprises an effector region comprising a stem-forming sequence that includes a 5' splice site sequence of a 3' intron (and a sequence complementary to the 5' splice site sequence of the 3' intron); and (ii) the aptamer comprises an aptamer sequence disclosed herein; The alternatively spliced ​​exon contains a stop codon that is in-frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the mRNA of the target gene.

[0035] In some embodiments, the effector stem is or comprises the P1 stem of an aptamer disclosed herein, i.e., comprises a first sequence linked to the 5' end of an aptamer disclosed herein and a second sequence linked to the 3' end of an aptamer disclosed herein.

[0036] In some embodiments, the polynucleotide cassette is located in the protein coding sequence of the target gene. In some embodiments, the polynucleotide cassette is located in an untranslated region of the target gene or in an intron of the target gene.

[0037] In embodiments, the small molecule has a structure according to Formula I: [ka] During the ceremony, X1, X2, and X3, at each instance, are independently selected from CR1, CHR1, N, NH, O, and S, where adjacent X1, X2, and X3 are not simultaneously selected to be O or S; The dashed line represents an optional double bond; Y1, Y2, and Y3, at each instance, are independently selected from CR2 and N; n is 1 or 2, and when n is 1, only one of the dashed lines is a double bond; LA, [ka] or L, [ka] is selected from wherein k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and z is selected from the integers 1, 2, 3, 4, and 5; c, d, e, f, g, h, and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from -NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; A, [ka] is selected from wherein X4, X5, X6, and X7 are independently selected from CR3 and N; X8 is N or CH; X b is selected from O, NH, and NCH3; wherein R1, R2, and R3 are each independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; Additionally or alternatively, two R3 on adjacent ring positions may join together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, x is 0, 1, 2 or 3; R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, y is 0, 1, 2 or 3; W is O or NR4, where R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); with the proviso that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; or a pharmaceutically acceptable salt thereof.

[0038] In embodiments, the small molecule has a structure according to Formulas II-XXII, including, for example, the structures provided in Table A.

[0039] In one aspect, the present disclosure provides a vector comprising the polynucleotide cassette, aptamer-encoding sequence / aptamer sequence, or riboswitch disclosed herein. In embodiments, the vector is a viral vector or a non-viral vector. In embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.

[0040] In one aspect, the present disclosure provides a cell comprising a vector, polynucleotide cassette, aptamer-encoding sequence / aptamer sequence, or riboswitch disclosed herein.

[0041] The present disclosure also provides methods of regulating expression of a target gene using a polynucleotide cassette, aptamer-encoding sequence / aptamer sequence, or riboswitch disclosed herein by providing to a cell or tissue a small molecule of Formulas I-XXII, including, for example, the small molecules shown in Table A. [Brief explanation of the drawings]

[0042] [Figure 1a] TPP aptamer-homologous sequences regulate gene expression in response to TPP and fursultiamine. Schematic of a synthetic riboswitch cassette containing intron-alternative exon-aptamer-intron. [Figure 1b]The TPP aptamer-homologous sequence regulates gene expression in response to TPP and fursultiamine. In the presence of the aptamer ligand, aptamer-ligand binding facilitates the formation of a hairpin stem that blocks the accessibility of the 5' splice site (5'ss) of the alternative exon, resulting in the elimination of the stop codon containing the alternative exon and target gene expression. The riboswitch 12C6-1 regulates luciferase gene expression in response to TPP treatment (Figure 1c) and fursultiamine treatment (Figure 1d). HEK293 cells were transfected with a luciferase construct containing the 12C6-1 riboswitch. Transfected cells were treated with the indicated concentrations of TPP or fursultiamine. Fold induction was calculated as the quotient of the luciferase activity obtained from compound-treated cells divided by the luciferase activity obtained from untreated cells. [Figure 1c] The TPP aptamer-homologous sequence regulates gene expression in response to TPP and fursultiamine. In the presence of the aptamer ligand, aptamer-ligand binding facilitates the formation of a hairpin stem that blocks the accessibility of the 5' splice site (5'ss) of the alternative exon, resulting in the elimination of the stop codon containing the alternative exon and target gene expression. The riboswitch 12C6-1 regulates luciferase gene expression in response to TPP treatment (Figure 1c) and fursultiamine treatment (Figure 1d). HEK293 cells were transfected with a luciferase construct containing the 12C6-1 riboswitch. Transfected cells were treated with the indicated concentrations of TPP or fursultiamine. Fold induction was calculated as the quotient of the luciferase activity obtained from compound-treated cells divided by the luciferase activity obtained from untreated cells. [Figure 1d]The TPP aptamer-homologous sequence regulates gene expression in response to TPP and fursultiamine. In the presence of the aptamer ligand, aptamer-ligand binding facilitates the formation of a hairpin stem that blocks the accessibility of the 5' splice site (5'ss) of the alternative exon, resulting in the elimination of the stop codon containing the alternative exon and target gene expression. The riboswitch 12C6-1 regulates luciferase gene expression in response to TPP treatment (Figure 1c) and fursultiamine treatment (Figure 1d). HEK293 cells were transfected with a luciferase construct containing the 12C6-1 riboswitch. Transfected cells were treated with the indicated concentrations of TPP or fursultiamine. Fold induction was calculated as the quotient of the luciferase activity obtained from compound-treated cells divided by the luciferase activity obtained from untreated cells. [Figure 2] Compound 004 activates the TPP aptamer riboswitch in regulating luciferase expression in HEK293 cells. Cells were transfected with the indicated riboswitch constructs and treated with various concentrations of compound 004. Luciferase activity was measured 20 hours after compound treatment, and fold induction was calculated as the luciferase activity obtained from compound-treated cells divided by the luciferase activity obtained from untreated cells. Riboswitches containing the E. coli thiM or Alishewanella tabrizica thiC aptamers (a, b) or the 12C6-1 aptamer (c, d) regulate luciferase expression in response to compound 004 treatment. [Figure 3] a: Predicted secondary structure of the 12C6-1 aptamer sequence, which has adjacent C and U1 binding sequences at the 5' end and adjacent G and complementary sequences of the U1 binding site at the 3' end. b: The 12C6-1 parent sequence and template sequences for each aptamer library, where N represents a random base. [Figure 4a]Riboswitches containing aptamers derived from 12C-1 regulate luciferase expression in HEK293 cells in response to treatment with compound 004 (Figures 4a, 4b, and 4c) and analogs (Figures 4d and 4e). [Figure 4b] Riboswitches containing aptamers derived from 12C-1 regulate luciferase expression in HEK293 cells in response to treatment with compound 004 (Figures 4a, 4b, and 4c) and analogs (Figures 4d and 4e). [Figure 4c] Riboswitches containing aptamers derived from 12C-1 regulate luciferase expression in HEK293 cells in response to treatment with compound 004 (Figures 4a, 4b, and 4c) and analogs (Figures 4d and 4e). [Figure 4d] Riboswitches containing aptamers derived from 12C-1 regulate luciferase expression in HEK293 cells in response to treatment with compound 004 (Figures 4a, 4b, and 4c) and analogs (Figures 4d and 4e). Compounds similar to compound 004 (compounds 003, 005, 008, 009, and 011) bind to 12C6-1 and activate the derivative riboswitch, regulating luciferase expression. Fold induction was calculated as the luciferase activity obtained from compound-treated cells divided by the luciferase activity obtained from untreated cells. [Figure 4e] A riboswitch containing an aptamer derived from 12C-1 regulates luciferase expression in HEK293 cells in response to treatment with compound 004 (Figures 4a, 4b, and 4c) and analogs (Figures 4d and 4e). Additional analogs (compounds 012, 013, 014, 015, 016, 018, and 019) regulate expression in a dose-dependent manner. [Figure 5a]Riboswitch-regulated expression of the mouse Epo gene and human growth hormone gene in mammalian cells. Cells transfected with the indicated constructs containing the riboswitch cassettes N4-1C11 or N5-12G6 were treated with or without the indicated concentrations of compound 004, and secreted mEpo or hGH was detected and quantified by ELISA. Riboswitches 12G6 and 1C11 regulate mEpo expression in AML12 cells in response to compound 004 treatment. [Figure 5b] Riboswitch-regulated expression of the mouse Epo gene and human growth hormone gene in mammalian cells. Cells transfected with the indicated constructs containing the riboswitch cassettes N4-1C11 or N5-12G6 were treated with or without the indicated concentrations of Compound 004, and secreted mEpo or hGH was detected and quantified by ELISA. Fold induction of mEpo by Compound 004. Fold induction was calculated as the quotient of the mEpo level obtained from cells treated with Compound 004 divided by the mEpo level obtained from cells not treated with the compound. [Figure 5c] Riboswitch-regulated expression of the mouse Epo gene and human growth hormone gene in mammalian cells. Cells transfected with the indicated constructs containing the riboswitch cassettes N4-1C11 or N5-12G6 were treated with or without the indicated concentrations of Compound 004, and secreted mEpo or hGH was detected and quantified by ELISA. The riboswitch regulates mEpo expression in C1C12 cells in response to Compound 004 treatment. [Figure 5d] Riboswitch-regulated expression of the mouse Epo gene and human growth hormone gene in mammalian cells. Cells transfected with the indicated constructs containing the riboswitch cassettes N4-1C11 or N5-12G6 were treated with or without the indicated concentrations of Compound 004, and secreted mEpo or hGH was detected and quantified by ELISA. The riboswitch regulates mEpo expression in HEK293 cells in response to Compound 004 treatment. [Figure 6a]Riboswitch-regulated luciferase expression in mouse muscle and liver. Balb / c mice (n=5) were intravenously (IV) injected with AAV8.Luci.Con1 (non-regulatable) and orally administered the indicated doses of Compound 004. Luciferase activity was measured at the indicated time points after oral compound dosing. Bioluminescence images of representative mice from each AAV-injected group before and after Compound 004 treatment. [Figure 6b] Riboswitch-regulated luciferase expression in mouse muscle and liver. Balb / c mice (n=5) were intravenously (IV) injected with AAV8.Luci.12G6 (controllable) and orally administered the indicated doses of Compound 004. Luciferase activity was measured at the indicated time points after oral administration of the compound. Whole-body imaging of luciferase luminescence signals from mice (n=5) in each AAV-injected group before and after Compound 004 treatment. [Figure 6c] Riboswitch-regulated luciferase expression in mouse muscle and liver. Balb / c mice were injected intravenously (IV) with the indicated amount of AAV8.Luci.Con1 (non-regulatable) or AAV8.Luci.12G6 (regulatable) and orally administered the indicated dose of Compound 004. [Figure 6d] Riboswitch-regulated luciferase expression in mouse muscle and liver. Luciferase expression in liver from AAV8.Luci.Con1 and AAV8.Luci.12G6 after administration of 30 mg / kg of Compound 004 is shown. [Figure 7a] Riboswitch-regulated luciferase expression in mouse muscle. Balb / c mice were intramuscularly (IM) injected with AAV8.Luci.Con1 (non-regulatable) and orally administered the indicated doses of Compound 004. Luciferase activity was measured at the indicated time points after oral compound dosing. Bioluminescence images of representative mice from each AAV-injected group before and after Compound 004 treatment. [Figure 7b]Riboswitch-regulated luciferase expression in mouse muscle. Balb / c mice were intramuscularly (IM) injected with AAV8.Luci.12G6 (regulatable) and orally administered the indicated doses of Compound 004. Luciferase activity was measured at the indicated time points after oral administration of the compound. Whole-body imaging of luciferase luminescence signals from mice (n=5) in each AAV-injected group before and after Compound 004 treatment. [Figure 7c] Riboswitch-regulated luciferase expression in mouse muscle. Balb / c mice were injected intramuscularly with the indicated amount of AAV8.Luci.Con1 (non-regulatable) or AAV8.Luci.12G6 (regulatable) and orally administered the indicated dose of Compound 004. [Figure 8] Riboswitch-regulated mouse Epo expression in muscle in vivo. Mice were injected with the indicated amount of AAV8.mEpo-12G6 vector and treated with the indicated dose of Compound 004 by oral administration. Serum mouse Epo expression was measured using a mouse Epo-specific ELISA. [Figure 9]Expression of erythropoietin (Epo) restores hemocrit in chronic kidney disease (CKD)-associated anemia in a dose-response manner to oral small molecules. The effect of riboswitch-regulated expression of Epo on hematocrit was evaluated in a mouse model of chronic kidney disease (CKD)-associated anemia. After 20 doses of compound 004 administered orally, hematocrit increased in anemic mice, with the greatest increase observed in the 100 mg / kg dose group. However, hematocrit in anemic mice injected with AAV8.mEpo.12G6 but not treated with compound 004 did not increase and remained the same as that in anemic mice not receiving AAV8.mEpo.12G6 (a). In mice treated with 10 doses of the higher compound at 300 mg / kg for 15 days, hematocrit returned to normal levels in mice injected with a lower AAV dose (1 × 10 vg per mouse). In contrast, the hematocrit of mice injected with a relatively high AAV dose (2.5 × 10 vg per mouse) exceeded normal hematocrit levels. (b) These results indicate that Epo was induced from the delivered AAV vector after riboswitch-inducing agent treatment, and that the induced Epo stimulated erythropoiesis, resulting in increased hematocrit in anemic animals. [Figure 10a] Controlled secretion of parathyroid hormone (PTH) increases serum calcium. Riboswitch 12G6 regulated hPTH expression in a dose-dependent manner (Fig. 10a). When this regulated hPTH was delivered to mice via an AAV vector, compound 004 treatment induced a dose-dependent production of hPTH in mice (Fig. 10b), and therefore, an increase in serum calcium levels (Fig. 10c). [Figure 10b] Controlled secretion of parathyroid hormone (PTH) increases serum calcium. Riboswitch 12G6 regulated hPTH expression in a dose-dependent manner (Fig. 10a). When this regulated hPTH was delivered to mice via an AAV vector, compound 004 treatment induced a dose-dependent production of hPTH in mice (Fig. 10b), and therefore, an increase in serum calcium levels (Fig. 10c). [Figure 10c]Controlled secretion of parathyroid hormone (PTH) increases serum calcium. Riboswitch 12G6 regulated hPTH expression in a dose-dependent manner (Fig. 10a). When this regulated hPTH was delivered to mice via an AAV vector, compound 004 treatment induced a dose-dependent production of hPTH in mice (Fig. 10b), and therefore, an increase in serum calcium levels (Fig. 10c). DETAILED DESCRIPTION OF THE INVENTION

[0043] Provided herein are aptamer sequences that bind to or otherwise respond to the presence of small molecules of Formulas I-XXII. In some embodiments, the aptamer sequences provided herein are useful for regulating expression of a target gene in response to the presence or absence of a small molecule ligand. Recombinant riboswitches comprising the aptamer sequences disclosed herein, as well as recombinant polynucleotide cassettes for regulating expression of a target gene, are also contemplated, wherein the polynucleotide cassette comprises a sequence encoding a riboswitch disclosed herein. Also provided herein are methods of using the aptamers, riboswitches, and / or polynucleotide cassettes to regulate target genes, including therapeutic genes, and to treat subjects in need of treatment.

[0044] Aptamers Aptamers are single-stranded nucleic acid molecules that fold into a three-dimensional structure and non-covalently bind to specific ligands with high affinity and specificity. Aptamer ligands include ions, small molecules, proteins, viruses, and cells.

[0045] Aptamer ligands can be, for example, organic compounds, amino acids, steroids, carbohydrates, or nucleotides. Non-limiting examples of small molecule aptamer ligands include antibiotics, therapeutic drugs, dyes, cofactors, metabolites, molecular markers, neurotransmitters, pollutants, toxins, food adulterants, carcinogens, and drugs of abuse. Therefore, aptamers are useful for detecting small molecules. Applications of aptamer-based small molecule detection include environmental monitoring, food safety, medicine (including diagnostics), microbiology, analytical chemistry, forensic science, agriculture, and basic biology research.

[0046] As used herein, the term "aptamer" refers to an RNA polynucleotide (or a DNA sequence encoding an RNA polynucleotide) that specifically binds to a class of ligands. The term "ligand" refers to a molecule specifically bound by an aptamer. An aptamer has a binding region capable of forming a complex with an intended target molecule (i.e., a ligand). Aptamers are typically about 15 to about 200 nucleotides in length. More commonly, aptamers are about 30 to about 100 nucleotides in length, e.g., 70 to 90 nucleotides in length. Aptamers typically contain multiple paired (P) regions, from which the aptamer forms a stem, and unpaired regions, from which the aptamer forms a linking (J) region or loop (L) region. The paired regions can be numbered consecutively starting from the 5' end (P1), and each stem can be numbered consecutively (P2, P3, etc.). Loops (LI, L2, etc.) are numbered based on adjacent paired regions, and linking regions are numbered according to the paired regions to which they bind.

[0047] In one aspect, the disclosure provides an aptamer that binds to a small molecule (e.g., one or more of the small molecules disclosed herein), wherein the sequence encoding the aptamer is: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCX7X8X9X 10 X 11 X 12 CCTX 13 X14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein X1 is C, G, or T; X2 to X5 are any nucleotides, X6 is any nucleotide and X7 is A, G, or T; X8~X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, C, or T, X 13 ~X 20 , X 21 are C, G, and T, X 22 and X 23 is any nucleotide.

[0048] In some embodiments, X1 to X6 are not simultaneously C, A, T, C, G, and A, but are X7 to X 12 are simultaneously A, T, T, G, C, and A, but not X, respectively. 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, and / or X, respectively. 16 ~X 21 are not simultaneously A, T, C, A, T, and G, respectively. In embodiments, if the 5' and 3' ends of an aptamer sequence disclosed herein are not C and G, respectively, then one or more of the above restrictions apply to the aptamer.

[0049] In one aspect, the disclosure provides an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCX7X8X9X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G, X7 is A or T; X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A, X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T, X 22 But T, X 23 is A, G, or T (collectively, SEQ ID NO: 681, i.e., SEQ ID NO: 681 is a nucleotide sequence corresponding to X1 to X2 listed in this paragraph). 23 (with listed restrictions on

[0050] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCX7X8X9X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G, X7 is A, X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A, X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T, X 22 But T, X 23 is A, G, or T (combined, SEQ ID NO: 682).

[0051] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A, G, or T; X8 is any nucleotide; X9 is any nucleotide, X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, C, or T (combined, SEQ ID NO: 683).

[0052] In some embodiments, X7 to X 12are not simultaneously A, T, T, G, C, and A, respectively.

[0053] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A or T; X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A (combined, SEQ ID NO: 684).

[0054] In some embodiments, X7 to X 12 are not simultaneously A, T, T, G, C, and A, respectively.

[0055] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X7 is A, X8 is A, C, or T; X9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X12 is A (combined, SEQ ID NO: 685).

[0056] In some embodiments, X7 to X 12 are not simultaneously A, T, T, G, C, and A, respectively.

[0057] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C, G, or T; X2 is any nucleotide, X3 is any nucleotide, X4 is any nucleotide, X5 is any nucleotide, X6 is any nucleotide (combined, SEQ ID NO: 686).

[0058] In some embodiments, X1-X6 are not simultaneously C, A, T, C, G, and A, respectively.

[0059] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is any nucleotide, X5 is A, G, or T; X6 is any nucleotide (combined, SEQ ID NO: 687).

[0060] In some embodiments, X1-X6 are not simultaneously C, A, T, C, G, and A, respectively.

[0061] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X1 is C or T, X2 is any nucleotide, X3 is any nucleotide, X4 is G or T; X5 is A, G, or T; X6 is A or G (combined, SEQ ID NO: 688).

[0062] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide.

[0063] In some embodiments, X 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, respectively.

[0064] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 is A, C, or G, X 14 is any nucleotide, X 15 is C, G, or T, X 22 But T, X 23 is A, G, or T (combined, SEQ ID NO: 689).

[0065] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein X 16 is any nucleotide, X 17 is any nucleotide, X 18 is any nucleotide, X 19 is any nucleotide, X 20 is any nucleotide, X 21 are C, G, and T (combined, SEQ ID NO: 690).

[0066] In some embodiments, X 16 ~X 21are not simultaneously A, T, C, A, T, and G, respectively.

[0067] In embodiments, the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 are A, G, and T, X 21 are C, G, and T (combined, SEQ ID NO: 691).

[0068] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical, to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558.

[0069] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

[0070] In some embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In some embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

[0071] In embodiments, the aptamer-encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical, to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. In embodiments, the aptamer-encoding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

[0072] In some embodiments, the first and last nucleotides of the aptamer-encoding sequence may be any nucleotide or no nucleotide. In some embodiments, the first two nucleotides and last two nucleotides of the aptamer-encoding sequence may be any nucleotide or no nucleotide. In these embodiments, additional sequences may be present that are 5' and 3' of the aptamer-encoding sequence and may form part of the stem-forming sequence of the riboswitch.

[0073] In one aspect, the present disclosure provides an aptamer encoded by an aptamer-encoding sequence disclosed herein.

[0074] Those skilled in the art will understand that the aptamers described herein can be ribonucleic acid (RNA) molecules. In some embodiments, the aptamers described herein are part of a longer RNA polynucleotide, including, for example, hnRNA, mRNA, siRNA, or miRNA.

[0075] Aptamer Ligand In embodiments, the aptamers disclosed herein bind to or otherwise respond to the presence or addition of a small molecule (ligand) disclosed herein, including a small molecule having a structure according to Formulas I-XXII, including a small molecule of Table A.

[0076] In embodiments, the small molecule has a structure according to Formula I: [ka] During the ceremony, X1, X2, and X3, at each instance, are independently selected from CR1, CHR1, N, NH, O, and S, where adjacent X1, X2, and X3 are not simultaneously selected to be O or S; The dashed line represents an optional double bond; Y1, Y2, and Y3, at each instance, are independently selected from CR2 and N; n is 1 or 2, and when n is 1, only one of the dashed lines is a double bond; LA, [ka] or L, [ka] is selected from wherein k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and z is selected from the integers 1, 2, 3, 4, and 5; c, d, e, f, g, h, and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from -NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; A, [ka] is selected from wherein X4, X5, X6, and X7 are independently selected from CR3 and N; X8 is N or CH; X b is selected from O, NH, and NCH3; wherein R1, R2, and R3 are each independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; Additionally or alternatively, two R3 on adjacent ring positions may join together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, x is 0, 1, 2 or 3; R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R bforms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, y is 0, 1, 2 or 3; W is O or NR4, where R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); with the proviso that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; or a pharmaceutically acceptable salt thereof.

[0077] In some embodiments of the above formula, y is 0.

[0078] In embodiments, the small molecule has a structure according to Formula II: [ka] During the ceremony, X1, X2, and X3, at each instance, are independently selected from CR1, CHR1, N, NH, O, and S, where adjacent X1, X2, and X3 are not simultaneously selected to be O or S; The dashed line represents an optional double bond; Y1, Y2, and Y3, at each instance, are independently selected from CR2 and N; n is 1 or 2, and when n is 1, only one of the dashed lines is a double bond; L, [ka] is selected from wherein k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and z is selected from the integers 1, 2, 3, 4, and 5; A, [ka] is selected from wherein X4, X5, X6, and X7 are independently selected from CR3 and N; wherein R1, R2, and R3 are each independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; m is 1 or 2; W is O or NR4, where R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); with the proviso that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; or a pharmaceutically acceptable salt thereof.

[0079] In some embodiments of the above formula, at least one of X1, X2, or X3 is N.

[0080] In some embodiments of the above formula, X1 is N.

[0081] In some embodiments of the above formula, X2 is N.

[0082] In some embodiments of the above formula, X3 is N.

[0083] In some embodiments of the above formula, two of X1, X2, and X3 are N.

[0084] In some embodiments of the above formula, X1 and X3 are N.

[0085] In some embodiments of the above formula, at least one of Y 1 , Y 2 , and Y 3 is N.

[0086] In some embodiments of the above formula, Y 1 is N.

[0087] In some embodiments of the above formula, Y2 is N.

[0088] In some embodiments of the above formula, Y3 is N.

[0089] In some embodiments of the above formula, at least one of Y1, Y2, and Y3 is CR2.

[0090] In some embodiments of the above formula, Y1 is CR2.

[0091] In some embodiments of the above formula, Y2 is CR2.

[0092] In some embodiments of the above formula, Y3 is CR2.

[0093] In some embodiments of the above formula, n is 2.

[0094] In embodiments, the small molecule has a structure according to Formula III: [ka] During the ceremony, X 2a and X 2b is independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; L and A are as provided for formula (II), X1, X 2a , X 2b , and two of X3 are N.

[0095] In embodiments, the small molecule has a structure according to formula (IV): [ka] During the ceremony, L and A are as provided for formula (II).

[0096] In any of the above embodiments of the compound, L is [ka] may be selected from:

[0097] As in any of the above embodiments of the compound, L is [ka] may be selected to be

[0098] In any of the above embodiments, the compound wherein q and r are 0 or 1.

[0099] In any of the above embodiments, the compound wherein q is 1.

[0100] In any of the above embodiments, the compound wherein r is 1.

[0101] In any of the above embodiments, the compound wherein r is 0.

[0102] In any of the above embodiments, the compound wherein q and r are 1.

[0103] In any of the above embodiments, the compound wherein q is 1 and r is 0.

[0104] In any of the above embodiments, the compound wherein m is 1.

[0105] In any of the above embodiments, the compound wherein W is selected from NH, O, and N(C1-C6 alkyl).

[0106] In any of the above embodiments, the compound wherein W is NH.

[0107] In any of the above embodiments, the compound wherein at least one of X4, X5, X6, and X7 is N.

[0108] In any of the above embodiments, the compound wherein X4 is N.

[0109] In any of the above embodiments, the compound wherein X5 is N.

[0110] In any of the above embodiments, the compound wherein X6 is N.

[0111] In any of the above embodiments, the compound wherein X7 is N.

[0112] In any of the above embodiments, the compound wherein X4 and X6 are N.

[0113] In any of the above embodiments, the compound wherein X5 and X7 are N.

[0114] In any of the above embodiments, compounds wherein X5 or X6 is N and both X4 and X7 are independently CR2.

[0115] In any of the above embodiments, A is [ka] A compound.

[0116] In any of the above embodiments, the compound has the structure of Formula V. [ka]

[0117] In any of the above embodiments, L is [ka] A compound.

[0118] In any of the above embodiments, the compound wherein Y1, Y2, and Y3, in each instance, are independently selected from CR2 and N, and R1 is selected from -H, -Cl, -Br, -I, -F, -OH, and -NH2.

[0119] In any of the above embodiments, the compound wherein z is 2.

[0120] In any of the above embodiments, the compound wherein Y2 is N.

[0121] In any of the above embodiments, the compound wherein Y2 is CR2 and R1 is selected from -H, -F, -OH, and -NH2.

[0122] In any of the above embodiments, A is [ka] A compound.

[0123] In embodiments, the small molecule has the formula: [ka] It has a structure according to the following.

[0124] In other embodiments, the small molecule has the formula: [ka] It has a structure according to the following.

[0125] In other embodiments, the small molecule has the structure of Formula VI: [ka] During the ceremony, X1, X2, and X3, at each instance, are independently selected from CR1, CHR1, N, NH, O, and S, where adjacent X1, X2, and X3 are not simultaneously selected to be O or S; The dashed line represents an optional double bond; Y1, Y2, and Y3, at each instance, are independently selected from CR2 and N; n is 1 or 2, and when n is 1, only one of the dashed lines is a double bond; L1 is, [ka] is selected from wherein c, d, e, f, g, h, and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from -NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; A, [ka] is selected from wherein X4, X5, X6, and X7 are independently selected from CR3 and N; wherein R1, R2, and R3 are each independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; m is 1 or 2; W is -O- or -N(R4)-, where R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); with the proviso that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; or a pharmaceutically acceptable salt thereof.

[0126] In additional embodiments, L is [ka] wherein B is selected from —NH— and —NHC(═O)—, and y is an integer selected from 1, 2, 3, 4, and 5.

[0127] In the above embodiment, the compound wherein at least one of X1, X2, or X3 is N.

[0128] In the above embodiment, the compound wherein X 1 is N.

[0129] In the above embodiment, the compound wherein X2 is N.

[0130] In the above embodiment, the compound wherein X3 is N.

[0131] In the above embodiment, the compound wherein in each instance two of X1, X2, and X3 are N.

[0132] In the above embodiment, the compound wherein X1 and X3 are N.

[0133] In the above embodiment, the compound wherein at least one of Y 1 , Y 2 , and Y 3 is N.

[0134] In the above embodiment, the compound wherein Y 1 is N.

[0135] In the above embodiment, the compound wherein Y2 is N.

[0136] In the above embodiment, the compound wherein Y3 is N.

[0137] In the above embodiment, the compound wherein at least one of Y1, Y2, and Y3 is CR2.

[0138] In the above embodiment, the compound wherein Y1 is CR2.

[0139] In the above embodiment, the compound wherein Y2 is CR2.

[0140] In the above embodiment, the compound wherein Y3 is CR2.

[0141] In the above embodiment, the compound wherein n is 2.

[0142] As in any of the above embodiments, a compound having the structure of formula (VII): [ka] During the ceremony, X 2a and X 2b is independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; L1 and R1 are as provided for formula (I); X1, X 2a , X 2b and two of X3 are N, or a pharmaceutically acceptable salt thereof.

[0143] In the above embodiment, a compound having the structure of formula (VIII): [ka] During the ceremony, A compound, or a pharmaceutically acceptable salt thereof, wherein L1 is as provided for formula (VI).

[0144] In the above embodiment, the compound wherein c, d, e, f, g, h, and i are independently selected from the integers 1, 2, and 3.

[0145] In the above embodiment, L1 is [ka] A compound selected from:

[0146] In the above embodiment, the compound wherein c, d, e, and f are independently selected from the integers 1, 2, and 3.

[0147] In the above embodiment, the compound wherein c, d, and e are 1.

[0148] In the above embodiment, L1 is [ka] A compound.

[0149] In the above embodiment, the compound wherein e and f are independently selected from 1, 2, and 3.

[0150] In the above embodiment, the compound wherein e and f are 1 or 2.

[0151] In the above embodiment, the compound wherein e is 1.

[0152] In the above embodiment, the compound wherein f is 2.

[0153] In the above embodiment, the compound wherein e is 1 and f is 2.

[0154] In the above embodiment, L1 is [ka] A compound.

[0155] In the above embodiment, the compound wherein c is 1, 2, or 3.

[0156] In the above embodiment, the compound wherein c is 1.

[0157] In the above embodiment, the compound wherein c is 2.

[0158] In the above embodiment, the compound wherein c is 3.

[0159] In the above embodiment, the compound wherein M is selected from -NH-, -O-, and -S-.

[0160] In the above embodiment, the compound wherein M is -NH-.

[0161] In the above embodiment, the compound wherein c is 1 and M is -NH-.

[0162] In the above embodiment, the compound wherein m is 1.

[0163] In the above embodiment, the compound wherein W is selected from -NH-, -O-, and -N(C1-C6 alkyl)-.

[0164] In the above embodiment, the compound wherein W is -NH-.

[0165] In the above embodiment, the compound wherein at least one of X4, X5, X6, and X7 is N.

[0166] In the above embodiment, the compound wherein X4 is N.

[0167] In the above embodiment, the compound wherein X5 is N.

[0168] In the above embodiment, the compound wherein X6 is N.

[0169] In the above embodiment, the compound wherein X7 is N.

[0170] In the above embodiment, the compound wherein X4 and X6 are N.

[0171] In the above embodiment, the compound wherein X5 and X7 are N.

[0172] In the above embodiment, compounds wherein X5 or X6 is N, and both X4 and X7 are independently CR2.

[0173] In the above embodiment, A is [ka] A compound.

[0174] In the above embodiment, the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0175] In other embodiments, the small molecule has the structure of Formula (IX): [ka] wherein X1, X2, and X3, at each instance, are independently selected from CR1, CHR1, N, NH, O, and S, and wherein adjacent X1, X2, and X3 are not simultaneously selected to be O or S; The dashed line represents an optional double bond; Y1, Y2, and Y3, at each instance, are independently selected from CR2 and N; R1 and R2 are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; n is 1 or 2, and when n is 1, only one of the dashed lines is a double bond; y is an integer selected from 1, 2, 3, 4, and 5; B has the structure: selected from -NH- and -NHC(=O)-, or a pharmaceutically acceptable salt thereof.

[0176] In the above embodiment, the compound wherein B is -NH-.

[0177] In the above embodiment, the compound wherein B is -NHC(=O)-.

[0178] In the above embodiment, the compound wherein y is an integer selected from 1, 2, and 3.

[0179] In the above embodiment, the compound wherein y is 1 or 3.

[0180] In the above embodiment, the compound wherein at least one of Y 1 , Y 2 , and Y 3 is N.

[0181] In the above embodiment, the compound wherein Y 1 is N.

[0182] In the above embodiment, the compound wherein Y2 is N.

[0183] In the above embodiment, the compound wherein Y3 is N.

[0184] In the above embodiment, the compound wherein at least one of Y1, Y2, and Y3 is CR2.

[0185] In the above embodiment, the compound wherein Y1 is CR2.

[0186] In the above embodiment, the compound wherein Y2 is CR2.

[0187] In the above embodiment, the compound wherein Y3 is CR2.

[0188] In the above embodiment, the compound wherein at least one of X1, X2, or X3 is N.

[0189] In the above embodiment, the compound wherein in each instance two of X1, X2, and X3 are N.

[0190] In the above embodiment, the compound wherein n is 2.

[0191] In the above embodiment, a compound having the structure of formula (X): [ka] X 2a and X 2b is independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; Here, X1, X 2a , X 2b , and two of X3 are N; A compound, or a pharmaceutically acceptable salt thereof, wherein B, R1, and y are as described in formula (VII).

[0192] In the above embodiment, a compound having the structure of formula (XIa) or formula (XIb): [ka] During the ceremony, X 2a and X 2b is independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; Here, X1, X 2a , X 2b , and two of X3 are N; A compound, or a pharmaceutically acceptable salt thereof, wherein y is an integer selected from 1, 2, and 3, and R1 is as described in formula (IX).

[0193] In the above embodiment, the compound wherein y is 1.

[0194] In the above embodiment, the compound wherein y is 3.

[0195] In the above embodiment, a compound having the structure of formula (XII): [ka] wherein B and y are as described in formula (IX), or a pharmaceutically acceptable salt thereof.

[0196] In the above embodiment, the compound wherein B is -NH-.

[0197] In the above embodiment, the compound wherein B is -NHC(=O)-.

[0198] In the above embodiment, the compound has the following structure: [ka] 10. A compound having the formula:

[0199] Compounds according to the above formulas and embodiments may be prepared, for example, according to the methods provided in PCT / US2020 / 45022 and U.S. Provisional Application No. 63 / 195779, filed June 2, 2021, the disclosures of which are incorporated herein by reference in their entireties.

[0200] In other embodiments, the small molecule has a structure according to Formula XIII: [ka] or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; where X 4 , X 6 , or X 7 0 or 1 of is N, A, [ka] is selected from the group consisting of X a is selected from N and CH; X b is selected from O, NH, and NCH3; R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R bforms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.

[0201] For compounds according to Formula XIII, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. R a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0202] For compounds according to formula XIII, y may be selected to be 0 or 1. R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0203] For compounds according to formula XIII, w may be selected from 0 or 1. R c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0204] For compounds according to formula XIII, R d may each be selected from halo, C-C alkyl, —OCH, —CF, —CHF, and —CHF, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0205] For compounds according to formula XIII, X a may be N.

[0206] For compounds according to formula XIII, X b may be O.

[0207] In some embodiments of the compound of Formula XIII, A is [ka] If selected to be x is 1, 2, or 3, and / or Two R on adjacent ring positions d together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0208] In other embodiments, the small molecule has a structure according to Formula XIV: [ka] or a pharmaceutically acceptable salt thereof, wherein: A, [ka] is selected from the group consisting of X a is selected from N and CH; R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino, alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; z is 0, 1, or 2.

[0209] For compounds according to formula XIV, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. R a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0210] For compounds according to formula XIV, y may be selected to be 0 or 1. R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0211] For compounds according to formula XIV, w may be selected from 0 or 1. c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0212] For compounds according to formula XIV, z may be selected to be 1 or 2, or z may be selected to be 1. R d may each independently be selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, and —CHF2, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH. Alternatively, z may be 0.

[0213] For compounds according to formula XIV, X a may be N.

[0214] In some embodiments of the compound of Formula XIV, A is [ka] If selected to be x is 1, 2, or 3, and / or Two R on adjacent ring positions d together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0215] In other embodiments, the small molecule has a structure according to Formula XV: [ka] or a pharmaceutically acceptable salt thereof, wherein: A, [ka] is selected from the group consisting of R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; z is 0, 1, or 2.

[0216] For compounds according to formula XV, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0217] For compounds according to formula XV, y may be selected to be 0 or 1. R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0218] For compounds according to formula XV, w may be selected from 0 or 1. R c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0219] For compounds according to formula XV, z may be selected to be 1 or 2, or z may be selected to be 1. Rd may each independently be selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, and —CHF2, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH. Alternatively, z may be 0.

[0220] In some embodiments of the compound of Formula XV, A is [ka] If selected to be x is 1, 2, or 3, and / or Two R on adjacent ring positions d together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0221] In other embodiments, the small molecule has a structure according to Formula XVI: [ka] or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; where X 4 , X 6 , or X 7 0 or 1 of is N, X a is selected from N and CH; R aare each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.

[0222] For compounds according to formula XVI, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0223] For compounds according to formula XVI, w may be selected from 0 or 1. c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0224] For compounds according to formula XVI, R d may each be selected from halo, C-C alkyl, —OCH, —CF, —CHF, and —CHF, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0225] For compounds according to formula XVI, X a may be N.

[0226] For compounds according to formula XVI, X b may be O.

[0227] In some embodiments of the compound of Formula XVI, x is 1, 2, or 3; and / or Two R on adjacent ring positions d together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0228] In other embodiments, the small molecule has a structure according to Formula XVII: [ka] or a pharmaceutically acceptable salt thereof, wherein: R a are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; x is 0, 1, 2 or 3; z is 0, 1, or 2.

[0229] For compounds according to Formula XVII, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. R a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0230] For compounds according to formula XVII, w may be selected from 0 or 1. R c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0231] For compounds according to formula XVII, z may be selected to be 1 or 2, or z may be selected to be 1. R d may each independently be selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, and —CHF2, or R dmay each independently be selected from CH, CHF, CHF, CF, F, Cl, Br, and OCH. Alternatively, two R on adjacent ring positions may d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0232] In some embodiments of the compound of Formula XVII, x is 1, 2, or 3; and / or Two R on adjacent ring positions d together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0233] In other embodiments, the small molecule has a structure according to Formula XVIII: [ka] or a pharmaceutically acceptable salt thereof, wherein: R a are each independently selected from methyl, halo, hydroxyl, and amino; R c are each independently selected from methyl, halo, hydroxyl, and amino; R d are each independently selected from methyl, halo, hydroxyl, and amino; x is 0, 1, 2 or 3; w is 0, 1, or 2; z is 0, 1, or 2.

[0234] For compounds according to Formula XVIII, x may be selected to be 1, 2, or 3, or x may be selected to be 1 or 2, or x may be selected to be 1. a may be selected to be methyl, fluoro, or chloro, or R a Alternatively, x may be 0.

[0235] For compounds according to formula XVIII, w may be selected from 0 or 1. c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0236] For compounds according to formula XVIII, z may be selected to be 0 or 1, or z may be selected to be 1.

[0237] In other embodiments, the small molecule has a structure according to formula XIX: [ka] or a pharmaceutically acceptable salt thereof, wherein: R a is selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; z is 0, 1, or 2.

[0238] For compounds according to formula XIX, R a may be selected from methyl, halo, hydroxyl, and amino, or R amay be selected to be methyl, fluoro, or chloro, or R a may be selected to be methyl.

[0239] For compounds according to formula XIX, R c may each independently be selected from methyl, halo, hydroxyl, and amino.

[0240] For compounds according to formula XIX, R d may each independently be selected from methyl, halo, hydroxyl, and amino.

[0241] In other embodiments, the small molecule has a structure according to formula XX: [ka] or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; where X 4 , X 6 , or X 7 0 or 1 of is N, X b is selected from O, NH, and NCH3; R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, m is 1 or 2; y is 0, 1, 2 or 3; R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.

[0242] For compounds according to formula XX, y may be selected to be 0 or 1. R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0243] For compounds according to formula XX, w may be selected from 0 or 1. c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0244] For compounds according to formula XX, R d may each be selected from halo, C-C alkyl, —OCH, —CF, —CHF, and —CHF, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0245] For a compound according to formula XX, Xb may be O.

[0246] In other embodiments, the small molecule has a structure according to formula XXI: [ka] or a pharmaceutically acceptable salt thereof, wherein: R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; w is 0, 1, or 2; y is 0, 1, or 2; z is 0, 1, or 2.

[0247] For compounds according to formula XXI, y may be selected to be 0 or 1. R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0248] For compounds according to formula XXI, w may be selected from 0 or 1. c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0249] For compounds according to formula XXI, R d may each be selected from halo, C-C alkyl, —OCH, —CF, —CHF, and —CHF, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0250] In other embodiments, the small molecule has a structure according to Formula XXII: [ka] or a pharmaceutically acceptable salt thereof, wherein: R b are each independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino, or in addition or alternatively, two R b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH, R c are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; R d are each independently selected from halo, C1-C3 alkyl, —OCH3, —CF3, —CH2F, —CHF2, —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; w is 0, 1, or 2; y is 0, 1, or 2; z is 0, 1, or 2.

[0251] For compounds according to formula XXII, y may be selected to be 0 or 1. R b may be selected from methyl, halo, hydroxyl, and amino, or R b may be selected from halo or methyl, or R b may be selected to be methyl.

[0252] For compounds according to formula XXII, w may be selected from 0 or 1. c may be selected from methyl, halo, hydroxyl, and amino, or R c may be selected from halo or methyl, or R c may be selected from F, Cl, or methyl.

[0253] For compounds according to formula XXII, R d may each be selected from halo, C-C alkyl, —OCH, —CF, —CHF, and —CHF; d may be selected from methyl, halo, hydroxyl, and amino, or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R on adjacent ring positions d may be joined together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.

[0254] In other embodiments, the small molecule has a structure according to a compound of Table A (or a pharmaceutically acceptable salt thereof).

[0255] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14]

[0256] In embodiments, the aptamers disclosed herein are the following compounds (or pharmaceutically acceptable salts thereof): [ka] [ka] The antibody binds to or otherwise responds to the presence of one or more of:

[0257] The term "alkyl" refers to the radical of a saturated aliphatic group, including straight-chain and branched-chain alkyl groups. In preferred embodiments, a straight-chain or branched-chain alkyl has six or fewer carbon atoms in its backbone (e.g., C1-C6 for straight chain, C3-C6 for branched chain). Alkyl groups include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, tert-butyl, pentyl, isopentyl, hexyl, and the like. The term "substituted alkyl" refers to an alkyl group having one to four substituents independently selected from halo, amino, amido, sulfonamido, OH, OCH3, nitro, and CN.

[0258] The term "cycloalkyl" refers to a saturated carbocyclic group having 3 to 6 carbons in the ring. Cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0259] The term "bicyclyl" refers to a saturated carbocyclic group having two linked ring systems, which may be fused or bridged. Bicyclic groups include bicyclic [2.1.1]hexane, bicyclic [2.2.1]heptane, decalin, and the like. The term "tricyclyl" refers to a saturated carbocyclic group having three linked ring systems, which may be fused and / or bridged. Tricyclic groups include adamantane, and the like.

[0260] Carbocyclic refers to a ring system that contains only carbon atoms as ring atoms (i.e., the ring system does not have heteroatoms as ring atoms). The carbocyclic ring system may be unsaturated, but preferred carbocycles are not aromatic.

[0261] The term "alkenyl" refers to unsaturated aliphatic groups, including straight-chain and branched-chain alkenyl groups, having at least one carbon-carbon double bond. In preferred embodiments, the alkenyl group has 2 to 6 carbon atoms (e.g., C2-C6 alkenyl).

[0262] As used herein, the term "halogen" or "halo" refers to -F, -Cl, -Br, or -I, preferably -F, -Cl, or -Br.

[0263] The term "alkoxyl" or "alkoxy," as used herein, refers to an alkyl group, as defined above, attached through an oxygen atom. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy, and the like.

[0264] The terms "amine" and "amino" refer to both unsubstituted and substituted amines, for example, moieties that can be represented by the general formula: [ka]

[0265] wherein R and R' are each independently selected from H and C1-C3 alkyl.

[0266] The term "amide" refers to both unsubstituted and substituted amide substituents, for example, a moiety that can be represented by the general formula: [ka]

[0267] wherein R and R' are each independently selected from H and C1-C3 alkyl.

[0268] The terms “sulfonamide” or “sulfonamido” refer to both unsubstituted and substituted sulfonamide substituents, such as, for example, moieties that can be represented by the general formula: [ka]

[0269] wherein R and R' are each independently selected from H and C1-C3 alkyl.

[0270] As used herein, the term "aryl" includes 5- and 6-membered monocyclic aromatic groups that may contain zero to four heteroatoms, such as benzene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine, and pyrimidine. These aryl groups with heteroatoms in the ring structure may also be referred to as "aryl heterocycles" or "heteroaryl" groups. The term "aryl" also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjacent rings (these rings are "fused rings") (at least one of the rings is aromatic). Thus, aryl includes 8- to 10-membered fused bicyclic aromatic groups (one or both rings are aromatic) that may contain zero to five heteroatoms, such as naphthylene, quinolone, isoquinoline, benzo[b]thiophene, tetrahydronaphthalene, and the like. Each aryl group may be unsubstituted or may be substituted with halogen, hydroxyl, amino, cyano, amido, sulfonamido, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C 10and optionally substituted by 1 to 5 substituents selected from bicyclyl, C1-C6 haloalkyl, C1-C6 perhaloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 perhaloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl, and heterocyclyl.

[0271] The term "heterocycle" or "heterocyclyl" refers to a non-aromatic heterocycle having 1 to 3 ring heteroatoms. Preferred heterocycles are 5- and 6-membered heterocyclic groups having 1 to 3 heteroatoms selected from the group consisting of O, N, and S.

[0272] The term "heteroatom" as used herein means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.

[0273] As used herein, each occurrence of, e.g., alkyl, R 1 , R 2 etc., when it occurs more than once in any construct, is intended to be independent of its definition elsewhere in the same construct.

[0274] It will be understood that "substituted" or "substituted with" includes the implicit condition that such substitution is subject to the allowed valence of the substituted atom and substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformations such as rearrangement, cyclization, elimination, and the like.

[0275] The aptamer ligands disclosed herein may exist in specific geometric or stereoisomeric forms, as well as mixtures thereof. Such geometric or stereoisomeric forms include, but are not limited to, cis and trans isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, racemic mixtures thereof, and other mixtures thereof. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups.

[0276] The compounds according to Formulas I-XXII may contain acidic or basic functional groups and therefore may exist in salt form. Preferably, the salt form is a pharmaceutically acceptable salt. In this regard, the term "pharmaceutically acceptable salt" refers to the relatively non-toxic, inorganic and organic acid and base addition salts of the compounds disclosed herein.

[0277] Compounds according to Formulas I-XXII may contain one or more basic functional groups, such as amino or alkylamino, and therefore can form pharmaceutically acceptable salts with pharmaceutically acceptable acids. These salts can be prepared in situ during the administration vehicle or dosage form manufacturing process, or by separately reacting a purified compound disclosed herein in its free base form with a suitable organic or inorganic acid and isolating the salt thus formed during subsequent purification. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and lauryl sulfonate (see, e.g., Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci. 66:1-19).

[0278] Pharmaceutically acceptable salts of the subject compounds include the conventional non-toxic salts or quaternary ammonium salts of the compounds, such as those derived from non-toxic organic or inorganic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, and the like, as well as salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isothioic acid, and the like.

[0279] In other cases, compounds according to Formulas I-XXII may contain one or more acidic functional groups and therefore can form pharmaceutically acceptable salts with pharmaceutically acceptable bases. These salts can also be prepared in situ during the administration vehicle or dosage form manufacturing process, or by separately reacting the purified compound in free acid form with a suitable base, such as a hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine. Representative alkali or alkaline earth salts include lithium, sodium, potassium, calcium, magnesium, and aluminum salts. Representative organic amines useful for forming base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like (see, e.g., Berge et al. (supra)).

[0280] In embodiments, the aptamers provided herein bind to or otherwise respond to one or more compounds of Formulas I-XXII provided herein, and / or bind to or otherwise respond to metabolite analogs or derivatives of compounds of Formulas I-XXII.

[0281] The specificity of the binding of an aptamer to its ligand is determined by the comparative dissociation constant (K) of the aptamer to its ligand compared to the dissociation constant of the aptamer to an unrelated molecule. d ) can be defined in terms of the K of an aptamer. Thus, a ligand can be considered to be a molecule that binds to an aptamer with higher affinity than an unrelated substance. Typically, the K of an aptamer to its ligand is d is the K of the aptamer with an unrelated molecule d In other embodiments, K d is the K of the aptamer with an unrelated molecule d at least about 20 times less, at least about 50 times less, at least about 100 times less, and at least about 200 times less, at least about 500 times less, at least about 1000 times less, or at least about 10,000 times less.

[0282] Aptamers for regulating gene expression In some embodiments, aptamers contemplated by the present disclosure are used to regulate gene expression. Regulating the expression of a target gene (e.g., a therapeutic transgene) is advantageous in a variety of situations. In the context of therapeutic gene expression, techniques that allow for regulated expression of a transgene in response to, for example, the presence of a small molecule, can enhance safety and efficacy by allowing for the regulation of the level and timing of target gene expression. In research settings, regulating gene expression allows for the systematic investigation of different experimental conditions.

[0283] In some embodiments, the aptamer-encoding sequence is part of a gene regulatory cassette that provides the ability to regulate the expression level of a target gene in response to the presence or absence of a small molecule described herein. In some embodiments, the gene regulatory cassette further comprises a target gene. As used herein, "target gene" refers to a transgene that is expressed in response to the presence or absence of a small molecule ligand disclosed herein upon binding of the small molecule to an aptamer disclosed herein. In some embodiments, the target gene comprises a coding sequence for a protein (e.g., a therapeutic protein), miRNA, or siRNA. The target gene is heterologous to the aptamer used to regulate target gene expression, heterologous to the polynucleotide cassette used to regulate the target gene, and / or heterologous to a portion of the polynucleotide cassette used to regulate the target gene.

[0284] When used to regulate expression of a target gene in response to the presence / absence of a ligand, the aptamers described herein can be part of a polynucleotide cassette that encodes the aptamer as part of a riboswitch. The terms "gene regulatory cassette," "regulatory cassette," or "polynucleotide cassette" are used interchangeably herein.

[0285] In some embodiments, the presence of a small molecule that binds to an aptamer disclosed herein results in increased expression of the target gene compared to expression of the target gene in the absence of the small molecule. In such embodiments, the aptamer acts as an "on" switch. In some embodiments, expression of the target gene is increased by at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or at least 10,000-fold in the presence of a small molecule that binds to an aptamer disclosed herein compared to the absence of the small molecule. In embodiments, expression of the target gene is increased 2x to 10x, 5x to 10x, 5x to 15x, 5x to 20x, 5x to 25x, 5x to 30x, 10x to 20x, 10x to 30x, 10x to 40x, 10x to 50x, 10x to 100x, 10x to 500x, 10x to 1,000x, 50x to 100x, 50x to 500x, 50x to 100x, 50x to 1,000x, 100x to 1,000x, or 100x to 10,000x in the presence of a small molecule that binds to an aptamer disclosed herein compared to the absence of the small molecule.

[0286] In some embodiments, the presence of a small molecule that binds to an aptamer disclosed herein results in a decrease in target gene expression compared to expression of the target gene in the absence of the small molecule. In such embodiments, the aptamer acts as an "off" switch. In some embodiments, target gene expression is at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or at least 10,000-fold lower in the presence of a small molecule that binds to an aptamer disclosed herein compared to the absence of the small molecule. In one embodiment, expression of the target gene is 2 to 10 fold lower, 5 to 10 fold lower, 5 to 15 fold lower, 5 to 20 fold lower, 5 to 25 fold lower, 5 to 30 fold lower, 10 to 20 fold lower, 10 to 30 fold lower, 10 to 40 fold lower, 10 to 50 fold lower, 10 to 100 fold lower, 10 to 500 fold lower, 10 to 1,000 fold lower, 50 to 100 fold lower, 50 to 500 fold lower, 50 to 1,000 fold lower, 100 to 1,000 fold lower, or 100 to 10,000 fold lower in the presence of a small molecule that binds to an aptamer disclosed herein compared to the absence of the small molecule.

[0287] In some embodiments, the aptamer is part of a riboswitch. A riboswitch is a regulatory segment of an RNA polynucleotide that regulates the stability of the RNA polynucleotide and / or regulates the production of a protein from the RNA polynucleotide in response to the presence or absence of an aptamer-specific ligand molecule. In some embodiments, a riboswitch comprises a sensor region (e.g., an aptamer region) and an effector region, which together sense the presence of a ligand (e.g., a small molecule) and trigger an effect that leads to an increase or decrease in expression of a target gene. The riboswitches described herein are recombinant, utilizing polynucleotides from two or more sources. In some embodiments, the sensor region and the effector region are connected by a polynucleotide linker. In some embodiments, the polynucleotide linker forms an RNA stem or pairing region (i.e., a region of the RNA polynucleotide that is double-stranded). In some embodiments, the pairing region that connects the aptamer to the effector region comprises all or a portion of the aptamer stem (e.g., all or a portion of the aptamer P1 stem).

[0288] Riboswitches containing aptamer sequences can be used, for example, to control the formation of rho-independent transcription termination hairpins, which result in premature transcription termination. Riboswitches containing aptamer sequences can also induce structural changes in RNA, resulting in the sequestration of ribosome binding sites and the inhibition of translation. Alternative riboswitch structures containing aptamer sequences disclosed herein can further affect mRNA splicing in response to the presence of small molecule ligands.

[0289] Alternative splicing riboswitches In one embodiment, the aptamers described herein are encoded as part of a gene regulatory cassette for target gene regulation by aptamer / ligand-mediated alternative splicing of the resulting RNA (e.g., pre-mRNA). In this context, the gene regulatory cassette includes a riboswitch, which includes a sensor region (e.g., an aptamer described herein) and an effector region, which together sense the presence of a small molecule ligand and alter splicing to alternative exons. Splicing refers to the process by which intronic sequences are removed from nascent pre-messenger RNA (pre-mRNA) and exons are ligated together to form mRNA. Splice sites are the junctions between exons and introns and are defined by distinct consensus sequences at the 5' and 3' ends of the intron (i.e., splice donor and splice acceptor sites, respectively). Splicing is carried out by a large, multi-component structure called the spliceosome, which is an assembly of small nuclear ribonucleoproteins (snRNPs) and a wide variety of auxiliary proteins. By recognizing various cis-regulatory sequences, the spliceosome defines exon / intron boundaries, removes intron sequences, and splices exons together into the final message (e.g., mRNA). In the case of alternative splicing, certain exons can be included or excluded, altering the final coding message and thereby the resulting expressed protein.

[0290] In one embodiment, modulation of target gene expression is achieved by using any of the DNA constructs disclosed in WO2016 / 126747, which is incorporated herein by reference in its entirety. In embodiments of the present disclosure, the riboswitch and polynucleotide cassettes disclosed in WO2016 / 126747 comprise sequences encoding aptamers described herein in place of the aptamer sequences disclosed in WO2016 / 126747.

[0291] In one embodiment, the polynucleotide cassette comprises (a) a riboswitch and (b) an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region comprising a stem-forming sequence including the 5' splice site sequence of the 3' intron (and a sequence complementary thereto), and (ii) an aptamer disclosed herein. In some embodiments, the effector region is a stem-forming region that forms the P1 stem of the aptamer (see, e.g., Figures 1b and 3a, where the 12C6-1 aptamer sequence is flanked by additional sequences that form the P1 stem of the aptamer and includes the splice site sequence and a sequence complementary thereto). Thus, in some embodiments, the effector stem is or comprises the P1 stem of an aptamer disclosed herein. In other words, the effector stem comprises a first sequence linked to the 5' end of an aptamer disclosed herein and a second sequence linked to the 3' end of an aptamer disclosed herein, wherein either the first sequence or the second sequence comprises the 5' splice site sequence of the 3' intron, and the other comprises a sequence complementary to the 5' splice site sequence of the 3' intron. In several embodiments, the effector region comprises the intron 5' splice site ("5' ss") sequence of the intron immediately 3' to the alternative exon, as well as a sequence complementary to the 5' ss sequence of the 3' intron.

[0292] 5' splice site sequences are well known in the art. There is some variation among different 5' splice site sequences, and this variation is also well understood in the art. For example, Shapiro and Senapathy (Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987 Sep 11;15(17):7155-74 or Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32, which are incorporated herein in their entirety) describe which positions in splice site sequences have some variation and which positions are constant across various eukaryotes. Similarly, Zhang (Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32, incorporated herein in its entirety) also indicates which positions in splice site sequences may have some variability and which positions are constant. Thus, one skilled in the art can easily recognize splice site sequences based on known consensus sequences and their position relative to exon / intron boundaries.Exemplary splice site sequences include, but are not limited to, AGG||GTGAGT, AAA||GTAAGC, GCA||GTA AGT, GAG||GTGTGG, A / CAG||GTA / GAGT, NAG||GTA / GAGT, NAG||GTAAGT, A / CA / TG||GTANGT, and NAG / A||GTAAGT (where || denotes the exon / intron boundary and N represents A, G, C, or T).

[0293] When the aptamer binds to its ligand, the effector region forms a stem, thus preventing splicing of the alternative exon to the splice donor site at the 3' end. Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region is in a state that provides access to the splice donor site at the 3' end of the alternative exon, resulting in inclusion of the alternative exon into the mRNA of the target gene. In some embodiments, a polynucleotide cassette is placed in a target gene to regulate expression of the target gene in response to a ligand. In one embodiment, the alternatively spliced ​​exon contains a stop codon that is in frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the mRNA of the target gene.

[0294] In one embodiment, the gene regulatory cassette comprises the sequence of SEQ ID NO: 676, where -X- represents a sequence encoding an aptamer disclosed herein. The lowercase letters indicate paired stem sequences that connect the aptamer to the remainder of the riboswitch. In one embodiment, the alternative exon (underlined in SEQ ID NO: 676 below) is replaced with another alternative exon sequence.

[0295] [ka]

[0296] The alternative exon is flanked by 5' and 3' intron sequences. The 5' and 3' intron sequences that can be used in the gene regulatory cassettes disclosed herein can be any sequences that can be spliced ​​from a target gene to generate either the target gene mRNA or the target gene mRNA containing an alternative exon, depending on the presence or absence of a ligand that binds to an aptamer. The 5' and 3' intron sequences each have sequences necessary for splicing to occur, i.e., a splice donor sequence, a splice acceptor sequence, and a branch point sequence. In one embodiment, the 5' and 3' intron sequences of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' intron sequence and the 3' intron sequence are selected from the group consisting of a truncated human beta globin intron 2 (IVS2Δ), intron 2 of the human O3-globin gene, an SV40 mRNA intron (used in the pCMV-LacZ vector from Clontech Laboratories, Inc.), intron 6 of the human triosephosphate isomerase (TPI) gene (Nott Ajit, et al. RNA. 2003, 9:6070-617), an intron of human factor IX (Sumiko Kurachi, et al. J. Bio. Chem. 1995, 270(10), 5276), an endogenous intron of the target gene itself, or any genomic fragment or synthetic intron (Yi Lai, et al. Hum Genet. 2005(37):331) containing elements sufficient for regulated splicing (Thomas A. Cooper, Methods 2005(37):331). Ther.2006:17(10):1036).

[0297] In one embodiment, the alternative exon and riboswitch are designed to reside in an endogenous intron of the target gene. That is, an intron (or a substantially similar intron sequence) naturally occurs at that position in the target gene. In this case, the intron sequence immediately upstream of the alternative exon is referred to as the 5' intron or 5' intron sequence, and the intron sequence immediately downstream of the alternative exon is referred to as the 3' intron or 3' intron sequence. In this case, the endogenous intron is modified to include splice acceptor and splice donor sequences adjacent to the 5' and 3' ends of the alternative exon. In one embodiment, the 5' intron and / or 3' intron are exogenous to the target gene.

[0298] Splice donor and splice acceptor sites within an alternative splicing gene regulatory cassette can be modified to be strengthened or weakened. That is, splice sites can be modified to resemble the splice donor or splice acceptor consensus by standard cloning methods, site-directed mutagenesis, etc. Splice sites that are more similar to the splice consensus tend to promote splicing and are therefore strengthened. Splice sites that are less similar to the splice consensus tend to hinder splicing and are therefore weakened. The splice donor consensus for the most common class of introns (U2) is A / CAG||GTA / GAGT (where || indicates the exon / intron boundary). The splice acceptor consensus is CAG||G (where || indicates the exon / intron boundary). The frequency of particular nucleotides in splice donor and splice acceptor sites has been described in the art (see, e.g., Zhang, MQ, Hum Mol Genet. 1988.7(5):919-932). The strength of 5' and 3' splice sites can be adjusted to regulate splicing of alternative exons.

[0299] Additional modifications to the 5' and 3' introns present in the alternative splicing gene regulatory cassette that can be made to regulate splicing include intronic splicing enhancer elements, intronic splicing suppressor elements, and / or splice site modifications, deletions, and / or additions, and / or branch site sequence modifications.

[0300] In one embodiment, the 5' intron is modified to include a stop codon that is in-frame with the target gene. The 5' and 3' intron sequences can also be modified to remove cryptic slicing sites that can be identified using publicly available software (see, e.g., Kapustin, Y. et al. Nucl. Acids Res. 2011.1-8).

[0301] For example, the lengths of the 5' and 3' intron sequences can be adjusted to meet the size requirements of the viral expression construct. In one embodiment, the 5' and / or 3' intron sequences are about 50 to about 300 nucleotides in length. In one embodiment, the 5' and / or 3' intron sequences are about 125 to about 240 nucleotides in length.

[0302] The stem portion of the effector region must have sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon when a ligand binds to the aptamer, while allowing access to the splice site in the absence of sufficient ligand. In some embodiments, the stem portion of the effector region comprises a stem sequence in addition to the 5' splice site sequence of the 3' intron and its complement. In some embodiments, this additional stem sequence comprises a sequence derived from the aptamer stem. The length and sequence of the stem portion can be modified using known techniques to identify a stem that allows acceptable background expression of the target gene in the absence of a ligand and allows acceptable expression levels of the target gene in the presence of a ligand. In one embodiment, the effector region stem of the riboswitch is about 7 to about 20 base pairs in length. In one embodiment, the effector region stem is 8 to 11 base pairs in length. In addition to stem length, the GC base pair content of the stem can be varied to modify stem stability.

[0303] In one embodiment, an alternative exon that is part of the alternative splicing gene regulatory cassette disclosed herein is a polynucleotide sequence that can be transcribed into pre-mRNA and alternatively spliced ​​into the mRNA of a target gene. In one embodiment, the alternative exon contains at least one sequence that inhibits translation, such that when the alternative exon is included in the mRNA of the target gene, expression of the target gene from that mRNA is prevented or reduced. In a preferred embodiment, the alternative exon contains a stop codon (TGA, TAA, TAG) that is in-frame with the target gene when the alternative exon is spliced ​​into the mRNA of the target gene. In several embodiments, the alternative exon contains, in addition to or as an alternative to a stop codon, another sequence that reduces or substantially prevents translation when the alternative exon is incorporated into the mRNA of the target gene by splicing, for example, containing a microRNA binding site, resulting in mRNA degradation. In one embodiment, the alternative exon contains an miRNA binding sequence that results in mRNA degradation. In one embodiment, the alternative exon encodes a polypeptide sequence that reduces the stability of a protein that contains the polypeptide sequence. In one embodiment, the alternative exon encodes a polypeptide sequence that directs a protein that contains the polypeptide sequence for degradation.

[0304] The basal or background level of splicing of alternative exons can be optimized by altering exonic splice enhancer (ESE) and exonic splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into alternative exons. Such changes to the sequence of alternative exons can be achieved using methods known in the art, including, but not limited to, site-directed mutagenesis. Alternatively, oligonucleotides having the desired sequence (e.g., containing all or part of an alternative exon) can be obtained from commercial sources and cloned into a gene regulatory cassette. Identification of ESS and ESE sequences can be achieved by methods known in the art, including, for example, the use of ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13):3568-3571) and / or other available resources.

[0305] In one embodiment, the alternative exon is a naturally occurring exon. In another embodiment, the alternative exon is derived from all or a portion of a known exon. In this context, "derived from" refers to a sequence containing an alternative exon that is substantially homologous to a naturally occurring exon or portion thereof, but may contain various mutations, such as mutations generated by altering exon splice enhancer (ESE) and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into an alternative exon. As used herein, "homology" and "homologous" refer to the percent identity between two polynucleotide sequences or two polypeptide sequences. The correspondence between one sequence and another can be determined by techniques known in the art. For example, homology can be determined by direct comparison of two polypeptide molecules by aligning the sequences of the two polypeptide molecules and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions that form stable duplexes between homologous regions, followed by digestion with single-strand-specific nuclease(s) and sizing of the digested fragments. Two polynucleotide sequences or two polypeptide sequences are "substantially homologous" to one another if, after optimally aligning them with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over the defined length of the molecules, as determined using the methods described above.

[0306] In one embodiment, the alternative exon is exogenous to the target gene but may be derived from a sequence of the organism in which the target gene is expressed. As used herein, "exogenous" means derived from a genotypically distinct entity from the rest of the entity to which it is compared, introduced, or integrated. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (which, when expressed, can encode a heterologous polypeptide). In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms' tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In several embodiments, the alternatively spliced ​​exon is or includes a modified DHFR exon 2 of SEQ ID NO: 677 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAG). In embodiments, the alternatively spliced ​​exon is or includes the modified DHFR exon 2 of SEQ ID NO: 678 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAATCTTCAGTAGAAG).

[0307] Aptamer-mediated cleavage by a self-cleaving ribozyme In one embodiment, aptamer-mediated expression of a target gene is regulated by aptamer-mediated regulation of a small endonucleolytic ribozyme. Ribozymes are RNA enzymes that catalyze chemical reactions. In the nucleic acids and methods disclosed herein, the ribozyme can be any small endonucleolytic ribozyme that self-cleaves in a target cell type, including, but not limited to, hammerhead, hairpin, hepatitis delta virus, Varkud satellite, twister, twister sister, pistol, or hatchet ribozymes. Thus, in one embodiment, a gene expression cassette is provided that includes a riboswitch and a riboswitch that includes a ribozyme bound to an aptamer disclosed herein. WO 2017 / 136608, incorporated herein by reference in its entirety, describes a riboswitch that activates ribozyme self-cleavage in the presence of an aptamer ligand (an "off" switch) or inhibits ribozyme self-cleavage in the presence of an aptamer (an "on" switch).

[0308] In the "off" switch scenario, aptamer / ligand binding increases the ribozyme's ribonuclease function, resulting in cleavage of the target gene RNA containing the polynucleotide cassette, thereby reducing target gene expression. An example of such an off switch is a polynucleotide cassette for regulating the expression of a target gene, comprising a riboswitch containing a twister ribozyme linked to an aptamer by a stem, wherein the stem that connects the twister ribozyme to the aptamer is linked to the ribozyme at the P3 stem of the twister ribozyme, and the target gene is linked to the P1 stem of the twister ribozyme (see, for example, Figure 1a, Figure 1b, or Figure 3a of WO2017 / 136608, and related documents, which are incorporated herein by reference).

[0309] In the "on" switch scenario, aptamer / ligand binding inhibits the ribonuclease function of the ribozyme, reducing cleavage of the target gene RNA containing the polynucleotide cassette, thereby increasing target gene expression in the presence of the ligand. An example of an on-switch is a riboswitch comprising a twister ribozyme bound to an aptamer, wherein the aptamer is bound to the 3' or 5' end of the twister ribozyme P1 stem; when the aptamer is bound to the 3' end of the twister ribozyme P1 stem, a portion of the 3' arm of the twister ribozyme P1 stem is alternatively the 5' arm of the aptamer P1 stem; when the aptamer is bound to the 5' end of the twister ribozyme P1 stem, a portion of the 5' arm of the twister ribozyme P1 stem is alternatively the 3' arm of the aptamer P1 stem (see, for example, Figures 6a-6b and related documents of WO2017 / 136608, which are incorporated herein by reference).

[0310] Aptamer regulation of polyadenylation In some embodiments, target gene expression is regulated by aptamer-regulated polyadenylation. The 3' end of nearly all eukaryotic mRNAs contains a poly(A) tail, a homopolymer of 20-250 adenosine residues. The addition of a poly(A) tail to an mRNA protects it from degradation, and thus gene expression can be influenced by modulating the polyadenylation of the corresponding mRNA.

[0311] In one embodiment, expression of a target gene is regulated by aptamer-regulated accessibility of a polyadenylation sequence, as described in WO2018 / 156658, which is incorporated herein by reference in its entirety. In such an embodiment, the riboswitch comprises an effector stem-loop and an aptamer described herein, wherein the effector stem-loop comprises a polyadenylation signal, and the aptamer and effector stem-loop are connected by a non-shared arm of the aptamer stem (e.g., the aptamer P1 stem) and an optional shared stem arm comprising a sequence complementary to the non-shared arm of the effector stem-loop (see, e.g., Figures 1a, 1b, 2a, and 5a of WO2018 / 156658, which are incorporated herein by reference, and related documents). In one embodiment, the effector stem loop is positioned 3' of the aptamer such that the alternatively shared stem arm comprises all or a portion of the 3' aptamer stem arm and all or a portion of the 5' arm of the effector stem. In one embodiment, the effector stem loop is positioned 5' of the aptamer such that the alternatively shared stem arm comprises all or a portion of the 5' aptamer stem arm and all or a portion of the 3' arm of the effector stem. In one embodiment, the polyadenylation signal comprises AATAA or ATTAA. In one embodiment, the polyadenylation signal is AATAAA or ATTAAA. In several embodiments, the polyadenylation signal is a downstream element (DSE). In one embodiment, the polyadenylation signal is an upstream sequence element (USE). In one embodiment, the polynucleotide cassette contains two riboswitches, where the effector stem-loop of a first riboswitch contains all or part of the polyadenylation signal AATAAA or ATTAAA, and the effector stem-loop of a second riboswitch contains all or part of a downstream element (DSE). In one embodiment, the two riboswitches each contain an aptamer that binds to the same ligand. In one embodiment, the two riboswitches contain different aptamers that bind to different ligands.

[0312] In some embodiments, a riboswitch comprises a sensing region (e.g., an aptamer described herein) and an effector region that includes a binding site for the small nuclear ribonucleoprotein (snRNP) U1, which is part of the spliceosome. WO 2017 / 136591 describes riboswitches in which the effector region includes a U1 snRNP binding site (and a sequence complementary thereto), and is incorporated herein by reference in its entirety. When the aptamer binds to its ligand, the effector region forms a stem, insulating the U1 snRNP binding site from binding to U1 snRNP. Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region is in a state that provides access to the U1 snRNP binding site, allowing U1 snRNP to bind to mRNA and inhibit polyadenylation, resulting in message degradation. The U1 snRNP binding site can be any polynucleotide sequence capable of binding to U1 snRNP, thereby recruiting U1 snRNP to the 3'UTR of a target gene and suppressing polyadenylation of the target gene message. In one embodiment, the U1 snRNP binding site is CAGGTAAGTA (or CAGGUAAGUA when present in mRNA). In some embodiments, the U1 snRNP binding site is a variation of this consensus sequence, e.g., a sequence that is shorter than the consensus sequence or has one or more nucleotides that vary from the consensus sequence. In one embodiment, the U1 snRNP binding site comprises the sequence CAGGTAAG. In some embodiments, the binding site is encoded by a sequence selected from CAGGTAAGTA, CAGGTAAGT, and CAGGTAAG. The U1 snRNP binding site can be any 5' splice site sequence derived from a gene, e.g., the 5' splice site derived from human DHFR exon 2.

[0313] Aptamer-mediated regulation of ribonuclease cleavage In one embodiment, target gene expression is regulated by aptamer-regulated ribonuclease cleavage. Ribonucleases (RNases) recognize and cleave specific ribonuclease substrate sequences. Provided herein are recombinant DNA constructs that, when incorporated into the DNA of a target gene, provide the ability to regulate target gene expression through aptamer / ligand-mediated ribonuclease cleavage of the resulting RNA. In some embodiments, the sequences encoding the aptamers described herein are part of a construct that includes or encodes a ribonuclease substrate sequence and a riboswitch comprising an effector region and an aptamer, such that target gene expression occurs upon binding of the aptamer to the ligand (as described in WO 2018 / 161053, incorporated herein by reference in its entirety). In several embodiments, an RNase P substrate sequence is linked to a riboswitch, wherein the riboswitch includes an effector region and an aptamer described herein, and the effector region includes a sequence complementary to a portion of the RNase P substrate sequence. Binding of a suitable ligand to the aptamer induces a conformational change in the aptamer and effector domain that alters the accessibility of the ribonuclease substrate sequence for cleavage by the ribonuclease.

[0314] In one embodiment, the aptamer sequence is located 5' to the RNase P substrate sequence, and the effector region comprises all or a portion of the leader sequence and all or a portion of the 5' acceptor stem sequence of the RNase P substrate sequence. See, e.g., Figures 1a, 1b, and 3b of WO2018 / 161053 and related documents, which are incorporated herein by reference. In further embodiments, the acceptor stem of the RNase P substrate and the riboswitch effector region are separated by 0, 1, 2, 3, or 4 nucleotides. In other embodiments, the effector region stem comprises, in addition to the leader sequence (and its complement), one or more nucleotides of the acceptor stem of the RNase P substrate and a sequence complementary to one or more nucleotides of the acceptor stem.

[0315] In one embodiment, the aptamer sequence of the polynucleotide cassette is located 3' to the RNase P substrate sequence, and the effector region comprises a sequence complementary to all or a portion of the 3' acceptor stem of the RNase P substrate sequence. See, e.g., Figure 3a of WO2018 / 161053 and related documents, which are incorporated herein by reference. In further embodiments, the effector region sequence complementary to the 3' acceptor stem of the RNase P substrate is 1 to 7 nucleotides. In other words, the effector region stem comprises 1 to 7 nucleotides of the acceptor stem and comprises a sequence complementary to those 1 to 7 nucleotides of the acceptor stem. In some embodiments, the riboswitch is located 3' to the RNase P substrate such that the effector region stem and the acceptor stem of the RNase P substrate do not overlap. In some embodiments, the effector region and acceptor stem of the RNase P substrate are directly adjacent (i.e., do not overlap). In other embodiments, the effector region and the acceptor stem of the RNase P substrate are separated by 1, 2, 3, 4, 5, or more nucleotides.

[0316] Target gene The aptamers and gene regulatory cassettes disclosed herein can be used to regulate the expression of any target gene that can be expressed in a target cell, tissue, or organism. The term "target gene" refers to a polynucleotide that can be introduced into a cell, transcribed into RNA, and translated and / or expressed under appropriate conditions. Alternatively, the target gene is endogenous to the target cell, and the gene regulatory cassette is placed within the target gene (e.g., within an existing untranslated region or intron of the endogenous target gene).

[0317] An example of a target gene is a polynucleotide encoding a therapeutic polypeptide. In one embodiment, the target gene is exogenous to the cell into which the recombinant DNA construct is transcribed. In another embodiment, the target gene is endogenous to the cell into which the recombinant DNA construct is transcribed. The target gene can be a protein-encoding gene or a sequence encoding a non-protein-coding RNA. The target gene can be, for example, a gene encoding a structural protein, an enzyme, a cell signaling protein, a mitochondrial protein, a zinc finger protein, a hormone, a transport protein, a growth factor, a cytokine, an intracellular protein, an extracellular protein, a transmembrane protein, a cytoplasmic protein, a nuclear protein, a receptor molecule, an RNA-binding protein, a DNA-binding protein, a transcription factor, a translation machinery, a channel protein, a motor protein, a cell adhesion molecule, a mitochondrial protein, a metabolic enzyme, a kinase, a phosphatase, an exchange factor, a chaperone protein, or a regulator of any of these. In embodiments, the target gene encodes erythropoietin (Epo), human growth hormone (hGH), a transcription activator-like effector nuclease (TALEN), human insulin, CRISPR-associated protein 9 (cas9), or an immunoglobulin (or portion thereof) (including, for example, a therapeutic antibody).

[0318] In embodiments, the target gene is Cas9 or CasRx, and the expression construct further comprises a sequence encoding a guide RNA (gRNA), e.g., a gRNA targeting PCSK9, that can be used to regulate expression of the gRNA target.

[0319] In some embodiments, the target gene is PTH, hi some embodiments, the target gene is insulin (e.g., comprising a sequence comprising an A chain, a B chain, and a C peptide) for use in regulating insulin levels in response to a small molecule to treat diabetes.

[0320] In embodiments, the target gene is a therapeutic antibody, including anti-PCSK9 antibodies, anti-VEGFR2 antibodies (e.g., ophthalmic), anti-amyloid Aβp3-42 antibodies, anti-IL-17 antibodies, anti-PD1 antibodies, and anti-HER2 antibodies. In embodiments where the target gene is an antibody, the heavy and light chains can be expressed from a single message separated by a proteolytic cleavage site (such as furan) or a peptide autocleavage site (e.g., a 2A peptide such as T2A or P2A).

[0321] In embodiments, the target gene encodes an antibody against a SARS-CoV-2 viral protein or antigen (such as the spike protein) (e.g., casirivimab and / or imdevimab (Regeneron), or bamlanivimab and / or etesevimab (Eli Lilly)). In embodiments, the target gene encodes all or part of the SARS-CoV-2 spike protein, where induction of expression results in production of mRNA, thus functioning like an inducible mRNA vaccine (mRNA-1273, Moderna, or Comirnaty, Pfizer-BioNTech).

[0322] In embodiments, the aptamers and gene regulatory cassettes disclosed herein are used to regulate expression of a target gene in eukaryotic cells, such as mammalian cells, and more particularly, human cells. In embodiments, the aptamers and gene regulatory cassettes disclosed herein are used to regulate expression of a target gene in the eye (including the cornea and retina), central nervous system (including the brain), liver, kidney, pancreas, heart, airway, muscle, skin, lung, cartilage, testis, artery, thymus, bone marrow, or tumor.

[0323] In one aspect, recombinant vectors for the introduction of polynucleotides comprising a target gene and a gene regulatory cassette and their uses are provided, wherein the gene regulatory cassette comprises an aptamer disclosed herein. In some embodiments, the recombinant DNA construct comprises additional DNA elements, including DNA segments that provide appropriate levels of DNA replication in host cells and expression of the target gene in target cells. Those skilled in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on their ability to promote expression of the target gene in target cells. "Vector" refers to a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle, or virus (including virus-derived sequences) containing a polynucleotide to be delivered to a host cell, either in vitro or in vivo. In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors.

[0324] Viral vectors for expression of target genes in target cells, tissues, or organisms are known in the art and include adenoviral (AV) vectors, adeno-associated viral (AAV) vectors, retroviral and lentiviral vectors, and herpes simplex type 1 (HSV1) vectors.

[0325] Adenovirus vectors include those based on human adenovirus type 2 and human adenovirus type 5, which are replication-deficient due to deletions in the E1 and E3 regions. A transcription cassette can be inserted into the E1 region to obtain an E1 / E3-deleted recombinant AV vector. Adenovirus vectors also include helper-dependent, large-capacity adenovirus vectors (also known as large-capacity "gutless" or "gutted" vectors) that do not contain viral coding sequences. These vectors contain cis-acting elements necessary for viral DNA replication and packaging, primarily inverted terminal repeats (ITRs) and packaging signals (CYs). These helper-dependent AV vector genomes have the potential to carry foreign DNA from several hundred base pairs up to approximately 36 kb.

[0326] Recombinant adeno-associated virus (rAAV) vectors include any vector derived from any adeno-associated virus serotype, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, AAV-8, AAV-9, AAV-10, etc. rAAV vectors can have AAV wild-type genes deleted in whole or in part, preferably one or more of the Rep and / or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are retained for rescue, replication, packaging, and potential chromosomal integration of the AAV genome. The ITRs need not be wild-type nucleotide sequences and may be modified (e.g., by nucleotide insertion, deletion, or substitution) so long as the sequences provide functional rescue, replication, and packaging.

[0327] Alternatively, other systems, such as lentiviral vectors, can be used. Lentiviral-based systems can transduce not only non-dividing cells but also dividing cells, making them useful for targeting non-dividing cells in the CNS, for example. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome, providing the potential for very long-term gene expression.

[0328] Polynucleotides, including plasmids, YACs, minichromosomes, and minicircles, carrying target genes containing gene regulatory cassettes can also be introduced into cells or organisms by non-viral vector systems, for example, using cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors into cells. Other methods for delivering vectors into cells include hydrodynamic injection and electroporation, as well as the use of ultrasound, for both cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see N. et al. (Adv Biomed Res. 2012;1:27), which is incorporated herein by reference.

[0329] In one aspect, the present disclosure provides a method of modulating expression of a target gene (e.g., a therapeutic gene), comprising: (a) inserting a polynucleotide cassette comprising an aptamer disclosed herein into the target gene, (b) introducing the target gene comprising the polynucleotide cassette into a cell, and (c) exposing the cell to a small molecule ligand that specifically binds to the aptamer in an amount effective to induce expression of the target gene. In aspects, expression of the target gene in the target cell confers a desired property on the cell into which it has been introduced or otherwise results in a desired therapeutic outcome.

[0330] In one embodiment, a gene regulation cassette comprising an aptamer disclosed herein is inserted into the protein coding sequence of a target gene (rather than the 5' or 3' untranslated region). In one embodiment, a single gene regulation cassette comprising an aptamer disclosed herein is inserted into a target gene. In other embodiments, two, three, four, or more gene regulation cassettes are inserted into a target gene, wherein one or more gene regulation cassettes comprise an aptamer disclosed herein. In one embodiment, two gene regulation cassettes are inserted into a target gene, wherein one or both gene regulation cassettes comprise an aptamer disclosed herein. When multiple gene regulation cassettes are inserted into a target gene, they can each comprise the same aptamer, allowing target gene expression to be regulated using a single ligand. In other embodiments, multiple gene regulation cassettes, each comprising a different aptamer, are inserted into a target gene, allowing target gene expression to be regulated by exposure to multiple different small molecule ligands.

[0331] Therapeutic methods and pharmaceutical compositions In one aspect, a method for regulating the level of a therapeutic protein delivered by gene therapy is provided. A therapeutic gene sequence containing a regulatory cassette containing an aptamer disclosed herein is delivered to target cells in the body, for example, by a vector. The cell specificity of target gene expression can be controlled by a promoter and / or other elements within the vector and / or the capsid of a viral vector. Delivery of a vector construct containing a target gene and transfection of the target tissue, resulting in stable transfection of the regulated target gene, is the first step in producing a therapeutic protein. However, due to the presence of an aptamer in the target gene sequence, the target gene is not expressed at a significant level, i.e., it is in an "off state" in the absence of a specific ligand that binds to the aptamer contained in the regulatory cassette riboswitch. Target gene expression is activated only when an aptamer-specific ligand is administered.

[0332] Delivery of the vector construct containing the target gene and delivery of the activating ligand are generally separated in time. Delivery of the activating ligand is controlled when the target gene is expressed, and the level of protein expression is also controlled. The ligand can be delivered by several routes, including, but not limited to, intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intralesional, topical, intraperitoneal, intravenous (IV), intraarterial, perivascular, intracerebral, intraventricular, oral, sublingual, sublabial, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intraarticular.

[0333] The timing of delivery of the ligand depends on the need for activation of the target gene.For example, if the therapeutic protein encoded by the target gene is always required, oral small molecule ligand can be delivered daily or multiple times a day to ensure the continuous activation of the target gene and thus the continuous expression of the therapeutic protein.If the target gene has a long-acting effect, the induction ligand can be administered less frequently, for example, once a week, once every two weeks, or once a month.

[0334] The aptamers described herein in the context of gene regulatory cassettes containing riboswitches allow for temporal control of therapeutic transgene expression in a manner determined by the temporal administration of an aptamer-specific ligand. Expression of a therapeutic transgene with only ligand administration enhances the safety of gene therapy treatments by allowing the target gene to be turned off in the absence of ligand.

[0335] Different aptamers can be used for multiple riboswitches, allowing different ligands to up- or down-regulate the expression of target genes. In certain embodiments, therapeutic genes containing regulatory cassettes each have a specific aptamer in the cassette that is activated by a specific small molecule. This means that each therapeutic gene can only be activated by a ligand specific to the aptamer contained therein. In these embodiments, each ligand activates only one therapeutic gene. This allows for the possibility that several different "target genes" can be delivered to an individual, each of which can be activated upon delivery of a ligand specific to the aptamer contained in the regulatory cassette contained in each target gene.

[0336] The aptamers disclosed herein in the context of riboswitches enable the body to produce any therapeutic protein (such as erythropoietin (EPO) or a therapeutic antibody) for which a gene can be delivered when an activating ligand is delivered. This method of therapeutic protein delivery can replace the manufacture of such therapeutic proteins ex vivo, for later injection or infusion, such as antibodies used in cancer or to block inflammatory or autoimmune diseases. The body, containing the regulated target gene, becomes a biologics manufacturing factory that is switched on when a gene-specific ligand is administered.

[0337] In one embodiment, the target protein can be a nuclease that can target and edit specific DNA sequences. Examples of such nucleases include CasRx, Cas9, zinc finger-containing nucleases, or TALENs. In the case of these nucleases, the nuclease protein may only be needed for a short period of time sufficient to edit the target endogenous gene. However, if an unregulated nuclease gene is delivered to the body, the protein may exist for the remainder of the cell's lifespan. In the case of nucleases, the longer the nuclease exists, the greater the risk of off-target editing. Regulating the expression of such proteins has significant safety benefits. In this case, a vector containing a nuclease target gene containing a regulatory cassette can be delivered to the appropriate cells in the body. Because the target gene is in an "off" state in the absence of a cassette-specific ligand, the nuclease is not produced. The nuclease is only produced when an activating ligand is administered. After a sufficient amount of time has passed to allow sufficient editing to occur, the ligand is removed and not administered again. Thus, the nuclease gene is then turned "off," no further nuclease is produced, and editing ceases. This approach can be used to correct several inherited retinopathies, including LCA10, which is caused by mutations in CEP290, and Stargardt disease, which is caused by mutations in ABCA4.

[0338] Using administration of a regulated target gene that encodes a therapeutic protein that is activated only when a specific ligand is administered, therapeutic genes can be regulated to treat many different types of diseases, for example, cancer (using a therapeutic antibody), immune disorders (using an immunomodulatory protein or antibody), metabolic diseases, rare diseases such as PNH (using an anti-C5 antibody or antibody fragment as the regulated gene), or ocular neovascularization (using a therapeutic antibody), and dry AMD (using an immunomodulatory protein).

[0339] A wide variety of specific target genes that allow for the treatment of a wide variety of specific diseases and conditions are suitable for use as target genes whose expression can be regulated using the aptamers / ligands described herein. For example, insulin or insulin analogs (preferably human insulin or human insulin analogs) may be used as target genes for treating type I diabetes, type II diabetes, or metabolic syndrome, human growth hormone may be used as target genes for treating children with growth disorders or growth hormone-deficient adults, and erythropoietin (preferably human erythropoietin) may be used as target genes for treating anemia caused by chronic kidney disease, anemia caused by myelodysplasia, or anemia caused by cancer chemotherapy. Additional target genes compatible with the aptamers and gene expression cassettes disclosed herein include, but are not limited to, cyclic nucleotide-gated cation channel alpha-3 (CNGA3) and cyclic nucleotide-gated cation channel beta-3 (CNGB3) for the treatment of color blindness, retinoid isomerohydrolase (RPE65) for the treatment of retinitis pigmentosa or Leber's congenital amaurosis, X-linked retinitis pigmentosa GTPase regulator (RPGR) for the treatment of X-linked retinitis pigmentosa, glutamic acid decarboxylase (GAD), including for the treatment of Parkinson's disease, regulator of nonsense transcript 1 (UPF1) for the treatment of amyotrophic lateral sclerosis, and aquaporins for the treatment of radiation-induced cerostomia and Sjogren's syndrome. Additional target genes include ArchT (archerhodopsin from Halorubrum strain TP009), Jaws (crux halorhodopsin from Haloarcula (Halobacterium) salinarum (Shark strain)), iC1C2 (a variant of the C1C2 chimera between channelrhodopsin ChR1 and ChR2 from Chlamydomonas reinhardtii), or Rgs9 anchor protein (R9AP), a key component of the GTPase complex mediating inactivation of the phototransduction cascade.

[0340] Expression constructs containing the aptamers disclosed herein may be particularly suitable for treating diseases caused by single gene defects, such as cystic fibrosis, hemophilia, muscular dystrophy, thalassemia, or sickle cell anemia. Thus, human β-, γ-, δ-, or ζ-globin may be used as a target gene for treating β-thalassemia or sickle cell anemia, and human factor VIII or factor IX may be used as a target gene for treating hemophilia A or hemophilia B.

[0341] In embodiments, the expression constructs / small molecules disclosed herein can be used to treat, prevent, or reduce the severity of viral diseases. In embodiments, the present disclosure provides methods for treating, preventing, or reducing the severity of COVID-19 by expressing antibodies against a SARS-CoV-2 viral protein or antigen (e.g., spike protein) in response to administration of a small molecule ligand. In embodiments, the present disclosure provides methods for preventing (or reducing the severity of) infection by SARS-CoV-2 by expressing a spike protein (or multiple serotype spike proteins) or a portion thereof using the gene regulatory cassette described herein and administering a ligand. In embodiments, the target gene is an antibody against a SARS-CoV-2 viral protein or antigen (such as a spike protein). In other embodiments, the target gene encodes all or a portion of one or more SARS-CoV-2 spike proteins, where induction of expression results in production of mRNA, thus functioning like an inducible mRNA vaccine. In embodiments, the expression construct is part of the AAV viral genome, and an AAV vector containing the expression construct is administered, for example, into the muscle of the subject, followed by administration of the ligand.

[0342] In embodiments, the present disclosure provides methods of restoring hemocrit and treating anemia by expression of Epo from a gene regulatory construct described herein, wherein a vector containing the Epo gene regulatory construct is administered to a subject in need thereof, followed by administration of a small molecule ligand described herein. In embodiments, the anemia results from chronic kidney disease in the subject.

[0343] In embodiments, the present disclosure provides methods of restoring hemocrit and treating chronic kidney disease by expression of Epo from a gene regulatory construct described herein, wherein a vector containing the Epo gene regulatory construct is administered to a subject in need thereof, followed by administration of a small molecule ligand described herein.

[0344] The small molecules described herein are generally combined with one or more pharmaceutically acceptable carriers to form pharmaceutical compositions suitable for administration to patients. Pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersion media, coating agents, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., commonly used in the pharmaceutical field. Pharmaceutical compositions may be in the form of tablets, pills, capsules, lozenges, eye drops, etc., and are formulated to be compatible with their intended administration route. Examples of administration routes include parenteral, e.g., intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and ocular.

[0345] Pharmaceutical compositions containing compounds I-XVI are administered to a patient on a dosing schedule to deliver a sufficient amount of compound to the patient to achieve the desired target gene modulation. When the dosage form is a tablet, pill, or the like, the pharmaceutical composition preferably contains 0.1 mg to 10 g of compound, 0.5 mg to 5 g of compound, 1 mg to 1 g of compound, 2 mg to 750 mg of compound, 5 mg to 500 mg of compound, 10 mg to 250 mg of compound, or 150 mg to 300 mg of compound.

[0346] The pharmaceutical composition may be administered once daily or multiple times daily (e.g., twice, three times, four times, five times, or more times daily). Alternatively, the pharmaceutical composition may be administered less frequently than once daily, for example, once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or once a month or once every few months. In some embodiments, the pharmaceutical composition may be administered to a patient only a few times, for example, once, twice, or three times.

[0347] Provided herein is a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, comprising administering to the patient a pharmaceutical composition comprising a ligand to which an aptamer disclosed herein binds or otherwise responds, wherein the patient has previously been administered recombinant DNA comprising the target gene, and the target gene comprises a gene regulatory cassette disclosed herein that provides the ability to regulate expression of the target gene by the aptamer's ligand. Provided herein is a pharmaceutical composition comprising a ligand to which an aptamer disclosed herein binds or otherwise responds, for use in a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, wherein the patient has previously been administered recombinant DNA comprising the target gene, and the target gene comprises a gene regulatory cassette disclosed herein that provides the ability to regulate expression of the target gene by the aptamer's ligand.

[0348] Aptamers for detection and / or diagnostic applications A wide range of detection and diagnostic agents can be attached to aptamers by chimeric or physical conjugation. Furthermore, aptamers can be incorporated into biosensors, microfluidic devices, and other detection platforms. In some embodiments, aptamers are conjugated to polyalkylene glycol moieties, including, but not limited to, polyethylene glycol (PEG), polypropylene glycol (PPG), polyoxyethylated glycerol (POG) and other polyoxyethylated polyols, polyvinyl alcohol (PVA) and other polyalkylene oxides, polyoxyethylated sorbitol, or polyoxyethylated glucose.

[0349] In some embodiments, the aptamer is conjugated to a detectable moiety, such as, but not limited to, a fluorescent moiety or label, an imaging agent, a radioisotope moiety, a radio-opaque moiety, or the like, e.g., a detectable label such as biotin, a fluorophore, a chromophore, a spin resonance probe, a nanoparticle (including but not limited to, gold, magnetic, and superparamagnetic nanoparticles), a quantum dot, or a radioactive label. Exemplary fluorophores include fluorescent dyes (e.g., fluorescein, rhodamine, etc.) and other luminescent molecules (e.g., luminal). A fluorophore can be environmentally sensitive such that its fluorescence changes when located near one or more residues in a modified protein that undergo a conformational change when bound to a substrate (e.g., a dansyl probe). Exemplary radiolabels include small molecules (e.g., fluorophores) containing atoms with one or more insensitive nuclei (e.g., fluorophores containing fluorophores with ... 13 C. 15 N, 2 H, 125 I, 123 I, 99 Tc, 43 K. 52 Fe, 67 Ga, 68 Ga, 111 In, etc. Other useful moieties are known in the art.

[0350] In some embodiments, the aptamer is conjugated to a therapeutic moiety, including, but not limited to, an anti-inflammatory agent, an anti-cancer agent, an anti-neurodegenerative agent, an anti-infective agent, or a general therapeutic agent.

[0351] Methods for identifying aptamers that bind to compounds Disclosed herein are methods for identifying aptamers that, in response to the addition of or exposure to a compound of Formulas I-XXII, bind to a compound of Formulas I-XXII or otherwise are part of a riboswitch, regulate target gene expression. In one embodiment, the method comprises: (i) selecting parent aptamer sequences; (ii) generating an aptamer library comprising sequences encoding the aptamers selected in (i), wherein one or more nucleotides in the aptamer-encoding sequences are randomly mutated at one or more positions corresponding to one or more unpaired regions in the aptamer, and the mutated aptamer sequences are in the context of a riboswitch that controls expression of a reporter gene; (iii) screening the library from (ii) for aptamers that have increased regulation of target gene expression (e.g., higher fold induction or repression) in response to a compound disclosed herein compared to the parent aptamer sequence; (iv) optionally repeating steps (ii) and (iii) with the aptamers identified in step (iii) rather than the aptamers selected in step (i).

[0352] The parent aptamer sequence may be a TPP aptamer, including known TPP aptamer sequences, or a putative TPP aptamer identified by searching available databases for homologous sequences. The parent aptamer sequence may be an aptamer sequence disclosed herein, such as CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (12C6-1, SEQ ID NO: 1).

[0353] The step of selecting a parent aptamer sequence can involve, for example, (i) identifying a putative TPP aptamer, (ii) inserting the aptamer into a riboswitch that regulates expression of a target gene (e.g., a reporter gene), and (iii) exposing the riboswitch / target gene construct to thiamine or a TPP analog or derivative (e.g., a compound described herein).

[0354] Putative TPP aptamers can be identified from a suitable sequence database, such as the Rfam database, which is a collection of RNA families, each represented by multiple sequence alignments, consensus secondary structures, and covariance models (CMs). In some embodiments, putative TPP aptamers are identified from the Rfam TPP riboswitch family RF00059. In some embodiments, putative TPP aptamers are identified from thiC. (GUAAUGUGUCGGAGUGCCUUAGGGAUUAUUCCCCUAAAGCUGAGACCGCAUUGCGGGAUCCGUUGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACACAUUAC, SEQ ID NO: 679) or It has a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to thiM (GUAAUGUCUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGACAUUAC, SEQ ID NO: 680).

[0355] Putative TPP aptamers can be inserted into riboswitches using techniques known to those of skill in the art. The responsiveness of the aptamers to the presence of TPP and one or more thiamine or TPP analogs or derivatives (e.g., compounds described herein) can be tested in cell culture and / or cell-free systems. Specifically, cell culture systems are eukaryotic cell cultures, including, for example, mammalian, plant, or insect cell cultures.

[0356] To identify aptamers that respond to the compounds described herein, one or more nucleotide positions in the sequence encoding the aptamer (i.e., the parent aptamer) are randomized. Regions of the sequence that can be randomized include J2-4, L3a, P4 / J4-5 to J5-4, and L5.

[0357] Nucleotide positions for randomization can be selected based on the structure of the parent aptamer sequence. Predicted secondary structures can be obtained using available programs such as RNAfold (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and / or by comparison with the crystal structure of a related aptamer (e.g., the E. coli thiM riboswitch, Edwards, TE & Ferre-D'Amare, AR, Structure. 2006 Sep;14(9):1459-68). For example, unpaired regions of the aptamer, including loop (L) regions (e.g., L3 and / or L5) and joining (J) regions (e.g., J3-2 (connecting paired regions P3 and P2), J2-4, and / or J4-5), can be identified, and one or more nucleotides within one or more unpaired regions can be randomized to generate a library of aptamers. In some embodiments, one or more nucleotides adjacent to one or more unpaired regions are randomized. Additionally, one or more nucleotides within the paired (P) region can be randomized. Furthermore, one or more nucleotides within the unpaired or paired region can be added or deleted. The mutagenized aptamer sequences can be provided as a library of aptamer sequences in the context of a riboswitch. In some embodiments, the aptamer library is provided in the context of a riboswitch as part of a gene expression cassette disclosed herein.

[0358] Aptamer-encoding sequences containing one or more mutations can be tested for responsiveness to the presence of one or more compounds described herein.

[0359] Aptamers that are responsive to a desired compound can be further mutagenized by randomizing nucleotides. As described above, nucleotides at selected positions, for example, in unpaired regions, can be randomized and libraries can be generated.

[0360] The reporter proteins encoded by the reporter genes used in the methods disclosed herein are proteins that can be assayed by detecting a property of the reporter protein, such as enzymatic activity or spectrophotometric properties, or indirectly using, for example, antibody-based assays. Examples of easily detectable reporter gene products include, but are not limited to, puromycin resistance marker (pac), 3-galactosidase, luciferase, orotidine 5'-phosphate decarboxylase (URA3), arginine permease CAN1, galactokinase (GAL1), beta-galactosidase (LacZ), or chloramphenicol acetyltransferase (CAT). Other examples of detectable signals include cell surface markers, including, but not limited to, CD4. Reporter genes suitable for use in the methods for identifying aptamers disclosed herein also include fluorescent proteins (e.g., green fluorescent protein (GFP) and its derivatives) or proteins fused to fluorescent tags. Examples of fluorescent tags and proteins include (3-F)Tyr-EGFP, A44-KR, aacuGFP1, aacuGFP2, aceGFP, aceGFP-G222E-Y220L, aceGFP-h, AcGFP1, AdRed, AdRed-C148S, aeurGFP, afraGFP, alajGFP1, alajGFP2, alajGFP3, amCyan1, amFP486, amFP495, amFP506, amFP515, amilFP484, amilFP490, amilFP497, amilFP504, and am ilFP512, amilFP513, amilFP593, amilFP597, anm1GFP1, anm1GFP2, anm2CP, anobCFP1, anobCFP2, anobGFP, apulFP483, AQ14, AQ143, Aquamarine, asCP562, asFP499, AsRed2, asulCP, atenFP, avGFP, avGFP454, avGFP480, avGFP509, avGFP510, avGFP514, avGFP523, AzamiGreen, Azurite, BDFP1.6, bfloGFPa1, bfloGFPc1, BFP, BFP.A5, BFP5, bsDronpa(on), ccalGFP1, ccalGFP3, ccalOFP1, ccalRFP1, ccalYFP1, cEGFP, cer FP505, Cerulean, CFP, cFP484, cfSGFP2, cgfmKate2, CGFP, cgfTagRFP, cgigGFP, cgreGFP, CheGFP1, CheGFP2, CheGFP4, Citrine , Citrine2, Clomeleon, Clover, cp-mKate, cpCitrine, cpT-Sapphire174-173, CyOFP1, CyPet, CyRFP1 (CyRFP1), d-RFP618, D10, d1EosFP (green), d1EosFP (red), d2EosFP (green), d2EosFP (red), deGFP1, deGFP2, deGFP3, deGFP4, dendFP (green), dendFP (red), Dendra (green), Dendra (red), Dendra2 (green), Dendra2 (red), Dendra2-M159A (green), Dendra2-M159A (orange), Dendra2-T69A (green), Dendra2-T69A (orange), dfGFP, dimer1, dimer2, dis2RFP, dis3GFP, dKeima, dKeima570, dLanYFP, DrCBD, Dreiklang (on), Dronpa (on), Dronp a-2(On), Dronpa-3(On), dsFP483, DspR1, DsRed, DsRed-Express, DsRed-Express2, DsRed-Max, DsRed.M1, DsRed.T3, DsRed.T4, DsRed2, DstC1, dTFP0.1, dTFP0.2, dTG, dTomato, dVFP, E2-Crimson, E2-Orange, E2-Red / Green, EaGFP, EBFP, EBFP1.2, EBFP1.5, EBFP2, ECFP, ECFPH148D, ECGFP, eechGFP1, eechGFP2, eechGFP3, eechRFP, efasCFP, efasGFP, eforCP, EGFP, eGFP203C, eGFP205C, Emerald, enhanced cyan-emitting GFP, EosFP (green), EosFP (red), eqFP578, eqFP611, eqFP611V124T, eqFP650, eqFP670, EYFP, EYFP-Q69K, fabdGFP, ffDronpa (on), folding reporter GFP, FP586, FPrfl2.3, FR-1, FusionRed, FusionRed-M, G1, G2, G3, Gamillus (on), Gamillus0.1, Gamillus0.2, Gamillus0.3, Gamillus0.4, GCaMP2, gfasGFP, GFP(S65T), GFP-151pyTyrCu, GFP-Tyr151pyz, GFPmut2, GFPmut3, GFPxm16, GFPxm1 61, GFPxm162, GFPxm163, GFPxm18, GFPxm181uv, GFPxm18uv, GFPxm19, GFPxm191uv, GFPxm19uv, H9, HcRed, HcRed-Tandem, HcRed7, hcriGFP, hmGFP, HriCFP, HriGFP, iFP1.4, iFP2.0, iLov, iq-EBFP2, iq-mApple, iq-mCerulean3, iq-mEmerald, iq-mKate2, iq-mVenus, iRFP670, iRFP682, iRFP702, iRFP713, iRFP720, IrisFP (green), IrisFP (orange), IrisFP-M159A (green), Jred, Kaede (green), Kaede (red), Katushka, Katushka-9-5, Katushka2S, KCY, KCY-G4219, KCY-G4219-38L , KCY-R1, KCY-R1-158A, KCY-R1-38H, KCY-R1-38L, KFP1(On), KikGR1(Green), KikGR1(Red), KillerOrange, KillerRed, KO, Kohinoor(On), laesGFP, laGFP, LanFP1, LanFP2, lanRFP-ΔS83l, LanYFP, laRFP, LSS-mKate1, LSS-mKate2, LSSmOrange, M355NA, mAmetrine, mApple, Maroon0.1, mAzami Green, mBanana, mBeRFP, mBlueberry1, mBlueberry2, mc1, mc2, mc3, mc4, mc5, mc6, McaG1, McaG1ea, McaG2, mCardinal, mCarmine, mcavFP, mcav GFP, mcavRFP, mcCFP, mCerulean, mCerulean.B, mCerulean.B2, mCerulean.B24, mCerulean2, mCerulean2.D3, mCerulean2.N, mCerulean2.N(T6 5S), mCerulean3, mCherry, mCherry2, mCitrine, mClavGR2 (green), mClavGR2 (red), mClover3, mCyRFP1, mECFP, meffCFP, meffGFP, meffRFP, mEGFP, meleCFP, meleRFP, mEmerald, mEos2 (green), mEos2 (red), mEos2-A69T (green), mEos2-A69T (orange), mEos3.1 (green), mEos3.1 (red), mEos3.2 (green), and mEos3.2 (red), mEos4a (green), mEos4a (red), mEos4b (green), mEos4b (red), mEosFP (green), mEosFP (red), mEosFP-F173S (green), mEosFP-F173S (red), mEosFP-M159A (green), mEYFP, MfaG1, mGarnet, mGarnet2, mGeos-C (on), mGeos-E (on), mGeos-F (on), mGeos-L (on), mGeos-M (on), mGeos-S (on), mG inger1, mGinger2, mGrape1, mGrape2, mGrape3, mHoneydew, MiCy, mIFP, miniSOG, miniSOGQ103V, miniSOG2, miRFP, miRFP670, miRFP670nano, miRFP670v1, miRFP703, miRFP709, miRFP720, mIrisFP (green), mIrisFP (red), mK-GO (early), mK-GO (late), mKalama1, mKate, mKateM41GS15 8C, mKateS158A, mKateS158C, mKate2, mKeima, mKelly1, mKelly2, mKG, mKikGR (green), mKikGR (red), mKillerOrange, mKO, mKO2, mKOκ, mLumin, mMaple (green), mMaple (red), mMaple2 (green), mMaple2 (red), mMaple3 (green), mMaple3 (red), mMaroon1, mmGFP, mMiCy, mmilCFP, mNectarine, m NeonGreen, mNeptune, mNeptune2, mNeptune2.5, mNeptune681, mNeptune684, Montiporasp.#20-9115, mOrange, mOrange2, moxBFP, moxCerulean3, moxDendra2 (green), moxDendra2 (red), moxGFP, moxMaple3 (green), moxMaple3 (red), moxNeonGreen, moxVenus, mPapaya, mPapaya0.7, mPlum, mPlum-E16P, mRaspberry, mRed7, mRed7Q1, mRed7Q1S1, mRed7Q1S1BM, mRFP1, mRFP1-Q66C, mRFP1-Q66S, mRFP1-Q66T, mRFP1.1, mRFP1.2, mRojoA, mRojoB, mRouge, mRtms5, mRuby, mRuby2, mRuby3, mScarlet, mScarlet-H, mScarlet-I, mStable, mSt rawberry, mT-Sapphire, mTagBFP2, mTangerine, mTFP0.3, mTFP0.7(on), mTFP1, mTFP1-Y67W, mTurquoise, mTurquoise2, muGFP, mUkG, mVenus, mVenus-Q69M, mVFP, mVFP1, mWasabi, Neptune, NijiFP(green), NijiFP(orange), NowGFP, obeCFP, obeGFP, obeYFP, OFP, OFPxm, oxBFP, oxCerulean, oxGFP, oxVenus, P11, P4, P4-1, P4-3E, P9, PA-GFP(on), Padron(on), Padron(star)(on), Padron0.9(on), PAmCherry1(on), PAmCherry2(on), PAmCherry3(on), PAmKate(on), PATagRFP(on), PATagRFP1297(on), PATagRFP13 14(on), pcDronpa(green), pcDronpa(red), pcDronpa2(green), pcDronpa2(red), PdaC1, pdae1GFP, phiYFP, phiYFPv, ecliptic pHluorin, ecliptic pHluorin(acidic), ratiometric pHluorin(acidic), ratiometric pHluorin(alkaline), pHluorin2(acidic), pHluorin2(alkaline), pHuji. , PlamGFP, pmeaGFP1, pmeaGFP2, pmimGFP1, pmimGFP2, Pp2FbFP, Pp2FbFPL30M, ppluGFP1, ppluGFP2, pporGFP, pporRFP, PS-CFP (cyan), PS-CFP (green), PS-CFP2 (cyan), PS-CFP2 (green), psamCFP, PSmOrange (far red), PSmOrange (orange), PSmOrange2 (far red), PSmOrange2 (orange) ), ptilGFP, R3-2+PCB, RCaMP, RDSmCherry0.1, RDSmCherry0.2, RDSmCherry0.5, RDSmCherry1, rfloGFP, rfloRFP, RFP611, RFP618, RFP630, RFP637, RFP639, roGFP1, roGFP1-R1, roGFP1-R8, roGFP2, rrenGFP, RRvT, rsCherry(On), rsCherryRev(On), rsCherryRev1.4(ON), rsEGFP(ON), rsEGFP2(ON), rsFastLime(ON), rsFolder(green), rsFolder2(green), rsFusionRed1(ON), rsFusionRed2(ON), rsFusionRed3(ON), rsTagRFP(ON), Sandercyanin, Sapphire, sarcGFP, SBFP1, SBFP2, SCFP1, SCFP2, SCFP3A, SCFP3B, scubGFP1, scubGFP2, scubRFP, secBFP2, SEYFP, sg11, s g12, sg25, sg42, sg50, SGFP1, SGFP2, SGFP2(206A), SGFP2(E222Q), SGFP2(T65G), SHardonnay, shBFP, shBFP-N158S / L173I, ShG24, Sirius, SiriusGFP, Skylan-NS(on), Skylan-S(on), smURFP, SNIFP, SOPP, SOPP2, SOPP3, SPOON(on), stylGFP, SuperfolderGFP, SuperfoldermTurquoise2, Superfolder mTurquoise2ox, SuperNovaGreen, SuperNovaRed, SYFP2, T-Sapphire, TagBFP, TagCFP, TagGFP, TagGFP2, TagRFP, TagRFP-T, TagRFP657, TagRFP675, TagYFP, td-RFP611, td-RFP639, tdimer2(12), tdKatushka2, TDsmURFP, tdTomato, tKeima, Topaz, TurboGFP, TurboGFP-V197L, TurboRFP, Turquoise-G L, Ultramarine, UnaG, usGFP, Venus, VFP, vsfGFP-0, vsfGFP-9, W1C, W2, W7, WasCFP, Wi-Phy, YPet, zFP538, zoan2RFP, ZsGreen, ZsYellow1, αGFP, 10B, 22G, 5B, 6C, A1a, aacuCP, acanFP, ahyaCP, amilCP, amilCP580, amilCP586, amilCP604, apulCP584, BFPsol, Blue102, CFP4, cgigCP, CheGFP3, Clover1.5, cpasCP, Cy11.5, dClavGR1.6, dClover2, dClover2A206K, dhorGFP, dhorRFP, dPapaya0.1, Dronpa-C62S, DsRed-Timer, echF P, echiFP, EYFP-F46L, fcFP, fcomFP, Fpaagar, Fpag_frag, Fpcondchrom, FPmann, FPmcavgr7.7, Gamillus0.5, gdjiCP, gfasCP , GFPhal, gtenCP, hcriCP, hfriFP, KikG, LEA, mcFP497, mcFP503, mcFP506, mCherry1.5, mClavGR1, mClavGR1.1, mClavGR1.8, m Clover1.5, mcRFP, meffCP, mEos2-NA, meruFP, mKate2.5, mOFP.T.12, mOFP.T.8, montFP, moxEos3.2, mPA-GFP, mPapaya0.3, mP apaya0.6, mRFP1.3, mRFP1.4, mRFP1.5, mTFP0.4, mTFP0.5, mTFP0.6, mTFP0.8, mTFP0.9, mTFP1-Y67H, mTurquoise-146G, mTurq uoise-146S, mTurquoise-DR, mTurquoise-GL, mTurquoise-GV, mTurquoise-RA, mTurquoise2-G, NpR3784g, PDM1-4, psupFP, Q Examples of suitable GFP-binding proteins include, but are not limited to, 80R, rfloGFP2, RpBphP1, RpBphP2, RpBphP6, rrGFP, RSGFP1, RSGFP2, RSGFP3, RSGFP4, RSGFP6, RSGFP7, Rtms5, scleFP1, scleFP2, spisCP, stylCP, sympFP, TeAPCα, tPapaya0.01, Trp-lessGFP, vsGFP, Xpa, yEGFP, YFP3, zGFP, and zRFP.

[0361] Methods for screening the aptamer libraries disclosed herein can include measuring the activity of a reporter gene under the control of an aptamer and / or comparing the activity of the reporter gene in the presence of the thiamine or TPP analog used in the screen with the activity of the reporter gene in the absence of the thiamine or TPP analog used in the screen.

[0362] Manufactured Products and Kits Kits or articles of manufacture for use in the methods described herein are also provided. In some embodiments, the kits include a composition described herein (e.g., a composition for delivering a vector containing a target gene comprising a gene regulatory cassette) in suitable packaging. Suitable packaging for the compositions described herein (e.g., injectable ophthalmic compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may be further sterilized and / or sealed.

[0363] Kits containing the compositions described herein are also provided. These kits may further include instruction(s) regarding how to use the compositions, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts containing instructions for administering the compositions or performing any of the methods described herein. For example, in some embodiments, the kits include a gene regulatory cassette comprising an aptamer sequence described herein, an rAAV for target gene expression, and one or more of a pharmaceutically acceptable carrier suitable for injection, a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing an injection. In some embodiments, the kits are suitable for intraocular injection, intramuscular injection, intravenous injection, etc.

[0364] It is to be understood and expected that modifications may be made to the compositions and methods disclosed herein by those skilled in the art, and such modifications are intended to be included within the scope of the present disclosure. The following examples further illustrate the present invention, but should not be construed as in any way limiting the scope of the invention.

[0365] All references cited herein are incorporated herein by reference in their entirety. All nucleotide sequences provided herein are in the 5' to 3' orientation unless otherwise specified. A sequence listing is filed herewith, the contents of which are incorporated herein by reference in their entirety. [Example]

[0366] Example 1: TPP aptamer-homologous sequences regulate gene expression in mammalian cells in response to thiamine pyrophosphate (TPP) and vitamin B1 analogs Testing Procedure: Riboswitch Constructs: Aptamers were synthesized by Integrated DNA Technologies, Inc. The synthesized aptamer sequence, referred to herein as aptamer sequence 12C6-1, contains the putative TPP aptamer sequence (AP008955.1 / 944373-944459, CP030117.1 / 954080-954166, CP023474.1 / 977011-977097) with a C at the 5' end and a complementary G at the 3' end adjacent to the putative TPP aptamer sequence: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 1). Using a Golden Gate cloning strategy (New England Biolabs, NEB), the synthesized aptamer sequence was cloned into an intron-exon-intron cassette, replacing the guanine aptamer in the G17 riboswitch cassette (see SEQ ID NO: 15 listed in WO2016 / 126747, which is incorporated herein in its entirety), generating the riboswitch construct Luci-12C6-1.

[0367] Transfection: 3.5 x 10 4 Human embryonic kidney (HEK) 293 cells were plated in 96-well flat-bottom plates the day before transfection. Plasmid DNA (500 ng) was added to a tube or a 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus, 1.4 μL) was added to 50 μL of Optimum I medium (Life Technologies) and allowed to stand at room temperature (RT) for 5 minutes. 50 μL of this diluted transfection reagent was then added to the DNA, mixed, and incubated at room temperature for 20 minutes. Finally, 7 μL of this solution was added to the cell wells in the 96-well plate. Four hours after transfection, the medium containing the transfection solution was replaced with medium containing either TPP or fursultiamine as the aptamer ligand.

[0368] Firefly luciferase assay for cultured cells: 24 hours after medium change, plates were removed from the incubator and equilibrated to room temperature on the bench for several minutes before being aspirated. Glo-lysis buffer (Promega, 100 μL, room temperature) was added, and the plate was allowed to stand at room temperature for at least 5 minutes. The well contents were then mixed by trituration with 50 μL, and 20 μL of each sample was mixed with 20 μL of bright-glo reagent (Promega) diluted to 10% in glo-lysis buffer. Ninety-six wells were spaced apart on an opaque white 384-well plate. After a 5-minute incubation at room temperature, luminescence was measured using a Tecan instrument with a 500-millisecond read time. Luciferase activity was expressed as mean arbitrary light units (ALU) ± standard deviation, and fold induction was calculated as the quotient of the luciferase activity obtained from cells treated with TPP or analog compounds divided by the luciferase activity obtained from cells not treated with TPP or analog compounds.

[0369] result: TPP aptamer homologous sequences (AP008955.1 / 944373–944459, CP030117.1 / 954080–954166, CP023474.1 / 977011–977097) were identified from the RNA family database RF00059 (http: / / rfam.xfam.org / family / RF00059) and tested in an alternative splicing-based synthetic aptamer riboswitch system to regulate target gene expression in response to TPP treatment. This synthetic riboswitch system comprises an intron-alternative exon-riboswitch-intron cassette (Figure 1a), in which ligand binding to the aptamer portion of the riboswitch controls the accessibility of the 5' splice site of the 3' intron, thus enabling regulation of target gene expression by modulating alternative splicing, as described in WO2016 / 126747 (incorporated herein by reference in its entirety). The putative TPP aptamer sequence, along with flanking 5'- and 3'-terminal Cs and Gs, was inserted into the intron downstream of the alternative exon containing an in-frame stop codon to generate riboswitch 12C6-1. In this configuration (Figure 1b), ligand binding likely brings the 5' and 3' ends of the aptamer sequence, including the adjacent U1 binding site and its complementary sequence, into close proximity, stabilizing the 9-bp stem structure that insulates the accessibility of the 5' splice site, allowing splicing to occur between the transgene exons and subsequent transgene expression. HEK293 cells were transfected with a luciferase construct containing the 12C6-1 riboswitch (Luci-12C6-1) and treated with TPP to increase luciferase expression. As shown in Figure 1c, cells transfected with the Luci-12C6-1 construct expressed increased luciferase expression upon TPP treatment compared to luciferase expression from cells without TPP treatment. Luciferase expression increased with increasing concentrations of TPP, demonstrating a dose-dependent response to TPP treatment. These results demonstrate that the putative TPP aptamer indeed responds to TPP treatment and regulates gene expression within the synthetic riboswitch cassette in mammalian cells.

[0370] We previously found that the TPP-responsive aptamer also responded to vitamin B1 analogs (as described in the 62 / 994,135 PTC application). Similarly, we found that the 12C6-1 riboswitch also responded to B1 analogs, such as fursultiamine, and induced luciferase gene expression in a dose-dependent manner (Figure 1d). Therefore, we used this TPP aptamer-homologous sequence to construct a synthetic mammalian aptamer riboswitch that can regulate transgene expression in the presence or absence of TPP and synthetic vitamin B1 analogs.

[0371] Example 2: Synthetic riboswitches containing thiamine pyrophosphate (TPP)-responsive aptamers regulate gene expression in response to compound 004 Experimental procedure: As described in Example 1. result: To identify additional synthetic small molecules that potentially bind and activate the 12C6-1 riboswitch in mammalian cells, we tested compound 004 (KW-62, PCT application number or cited publication), a novel TPP aptamer-binding compound generated by Weeks et al. using a fragment-based aptamer ligand discovery approach.

[0372] First, the E. coli thiM TPP aptamer, the aptamer used in Weeks' study to generate compound 004, was tested with a TPPm riboswitch construct (SEQ ID NO: 87 in 62 / 994,135) for its response to compound 004 in inducing gene expression. To assess whether this novel TPP aptamer binder could bind to a different TPP aptamer, the TPP aptamer from the Alishewanella tabrizica thiC gene (Microbiol Res. 2017 Jan;195:71-80) was tested with a TPPz riboswitch construct (SEQ ID NO: 86 in 62 / 994,135). As shown in Figure 2, both the TPPm riboswitch and the TPPz riboswitch regulated luciferase expression in a dose-dependent manner in response to compound 004 treatment. This observation indicates that compound 004 binds to the TPP aptamer in mammalian cells. However, these two riboswitches have different compound 004-induced riboswitch activities, with the TPPz riboswitch construct exhibiting much higher gene regulatory activity in response to compound 004 treatment. As shown in Figure 2a, the TPPz riboswitch construct resulted in a 26-fold increase in luciferase expression when treated with 50 μM compound 004, while the TPPm construct resulted in only a 4.1-fold increase in luciferase expression at the same concentration of compound 004. These results demonstrate that compound 004 can activate the TPP aptamer riboswitch. Furthermore, the higher dynamic range of TPPz in regulating gene expression suggests that compound 004 binds with higher affinity to the Alishewanella tabrizica thiC aptamer in the TPPz riboswitch than to the E. coli thiM TPP aptamer in the TPPm riboswitch.

[0373] Next, we tested compound 004 with the 12C6-1 riboswitch to regulate gene expression in mammalian cells. HEK293 cells were transfected with the 12C6-1 riboswitch construct and treated with various concentrations of compound 004. As shown in Figures 2c and 2d, luciferase expression increased upon treatment with compound 004, and the induced expression of luciferase was dose-dependent. The dynamic range of induced gene expression from Luci-12C6-1 was even higher than that of the TPPz riboswitch construct, resulting in a 360-fold increase in luciferase expression in the presence of 50 μM compound 004. These results indicate that compound 004 can activate this newly developed riboswitch, 12C6-1, in regulating gene expression in mammalian cells over a wide dynamic range.

[0374] Example 3: Generation of a riboswitch containing a redesigned aptamer sequence with enhanced reactivity to compound 004 Testing Procedure: Cloning of riboswitch constructs containing the 12C6-1 variant aptamer sequence: Using the 12C6-1 aptamer sequence as a template, nucleobases were randomized at specific positions within the sequence. Aptamers incorporating random mutagenesis were synthesized by Integrated DNA Technologies, Inc. Using the Golden Gate cloning strategy (New England Biolabs, NEB), the synthesized aptamer sequence was cloned into an intron-exon-intron cassette, replacing the 12C6-1 aptamer in the Luci-12C6-1 riboswitch construct to generate riboswitch constructs containing the variant aptamer sequence.

[0375] result: To further improve riboswitch activity in response to compound 004 and related compounds, the aptamer sequence 12C6-1 was subjected to mutagenesis to generate aptamer variants, and riboswitches containing the variant aptamers were screened against compound 004 for those with improved dynamic ranges of induced gene expression (fold induction) compared to that of the parent riboswitch construct, Luci-12C6-1. As shown in Figure 3a of the predicted secondary structure of the 12C6-1 aptamer (RNAfold, http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), loop or junction regions that do not appear to be involved in helix formation may be involved in tertiary structure upon ligand binding. These loop or junction regions were selected for random mutagenesis, either alone or together with adjacent stem regions, to generate riboswitches with redesigned aptamer sequences with improved activity.

[0376] Five aptamer libraries, N1, N2, N3, N4, and N5, were generated by randomizing nucleotides at positions within the J2-4, J2-3 / J3-3a / J3a-2 / P3, L3a, J4-5 / J5-4 / P4, and L5 regions of the parent 12C6-1 sequence, respectively (see Figures 3a and 3b). Single bacterial colonies were selected, and plasmids containing variant riboswitch constructs were screened in HEK293 cells for improved gene regulation activity in response to 25 μM compound 004 compared to the parent riboswitch construct Luci-12C6-1.

[0377] The nucleobases within the junction region connecting P2 and P4 (J2-4) were randomized to generate 4,096 variant sequences within library N1. Eighty-two variant aptamers were identified and screened against compound 004 (see Table 1 for variant sequences within J2-4). Approximately 93.9% of the identified riboswitch constructs exhibited reduced riboswitch activity (less than 250-fold induction), and 17.1% of these 82 riboswitch constructs exhibited minimal (2- to 2.5-fold induction) or no riboswitch activity (no induction) in inducing luciferase gene expression compared to the parent 12C6-1, which had an average induction of approximately 300-fold. Constructs carrying aptamers N1_1F1_2 and N1_2H3 resulted in a greater than 300-fold increase in luciferase gene expression, demonstrating enhanced riboswitch activity compared to the parent 12C6-1 (Table 1).

[0378] The nucleobase at position 6 within J2-3 / J3-3a / J3a-2 / P3, the region connecting P2, P3, and P3a, was randomized to generate 4096 variant sequences within library N2. 192 variants were screened for riboswitch activity, and no constructs were identified that exhibited riboswitch activity in inducing luciferase expression in response to compound 004 treatment (see Table 5 for sequence variants within J2-3 / J3-3a / J3a-2 / P3). Thus, altering the selected region did not generate riboswitches with enhanced gene regulatory activity but rather abolished riboswitch activity in response to compound 004.

[0379] Nucleobases at six positions within the L3a region were randomized, generating 4,096 variant sequences within library N3. Eighty-five variant riboswitches were identified and screened against compound 004 (see Table 2 for variant sequences within L3a), 94% of which showed reduced riboswitch activity in inducing luciferase gene expression compared to the parent 12C6-1, and 37.4% of which showed minimal (2- to 2.5-fold induction) or no riboswitch activity (no induction). One of the 85 constructs (N3_G6) showed an 858-fold induction of luciferase gene expression, and two of the 85 showed more than 400-fold induction, demonstrating enhanced riboswitch activity compared to the parent 12C6-1 (see Table 2).

[0380] Nucleobases at five positions within the P4 / J4-5 / J5-4 region were randomized to generate 1,024 variant aptamer sequences within library N4. During partial library screening, 864 riboswitches were screened against compound 004 treatment, and approximately 46.2% of the screened riboswitch constructs induced a greater than 500-fold increase in luciferase expression in response to compound 004 treatment. Of the 183 sequence-validated unique variants, one riboswitch (N4-1C11) induced a greater than 2,000-fold increase in luciferase gene expression in response to compound 004 treatment, 19 riboswitches induced a greater than 1,000-fold increase, while 33 riboswitch constructs exhibited reduced riboswitch activity compared to the parent 12C6-1, providing an average induction fold of approximately 300 (see Table 3 for variant sequences within P4 / J4-5 / J5-4).

[0381] Nucleobases at six positions within the L5 region were randomized, generating 4096 variant sequences within library N5. During the partial N5 library screen, 1222 riboswitches were screened against compound 004 treatment, and approximately 77.1% of the screened riboswitch constructs induced a greater than 500-fold increase in luciferase expression in response to compound 004 treatment. Of the 231 unique variant sequences identified, five riboswitches induced a greater than 2000-fold increase in luciferase gene expression in response to compound 004 treatment, 89 riboswitches induced a greater than 1000-fold increase, while 10 riboswitch constructs showed reduced riboswitch activity compared to the parent 12C6-1 (see Table 4 for variant sequences within L5).

[0382] Riboswitch constructs containing the redesigned aptamer sequences N4-1C11, N5-12E5, and N5-12G6 were further tested for their enhanced riboswitch activity. As shown in Figure 4a, all three riboswitches increased luciferase activity when treated with 0.01 μM Compound 004 and induced a 16-fold, 8-fold, and 36-fold increase in luciferase expression, respectively, in response to 0.1 μM Compound 004 treatment. The induced expression of luciferase increased in a dose-dependent manner (Figures 4b and 4c).

[0383] The parent riboswitch 12C-1 and its derivatives also respond to a series of compounds similar to compound 004, with the N5-12G6 riboswitch showing a stronger response (Figure 4d). Additional analogs of compound 004 were tested against the 12G6 riboswitch for inducing luciferase expression in HEK293 cells (Figure 4e and Table B below). The structures of these compounds are provided in Table A, and their synthesis is described herein.

[0384] [Table 2-1] [Table 2-2] [Table 2-3] Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19

[0385] These results indicate that sequence changes introduced into the P4 / J4-5 / J5-4 or L5 regions significantly improved riboswitch activity for compound 004. The observation that a wide range of changes improved riboswitch activity (46.2% (N4 library) and 77.1% (N5 library) showed >500-fold induction) suggests that nucleobases in these regions do not directly contact the ligand but rather participate in tertiary structure formation. Therefore, by random mutagenesis of selected regions of the native sequence, we developed riboswitches with redesigned aptamer sequences that were highly responsive to synthetic compound 004 and its analogs and regulated gene expression over a wide dynamic range in mammalian cells.

[0386] Example 4: Synthetic riboswitches regulate the expression of various target genes in response to compound 004 in mammalian cells Testing Procedure: Riboswitch Constructs: An alternative splicing riboswitch cassette containing the aptamer N5-12G6 or N4-1C11 was inserted between nucleotides 307 and 308 within the mouse erythropoietin cDNA sequence to generate constructs mEpo-12G6 and mEpo-1C11. Expression of the erythropoietin gene was driven by the CASI promoter. An intron-exon-intron cassette without the aptamer sequence was inserted into the same position within the mEpo cDNA to generate construct mEpo-Con1, which served as a control for constitutive target gene expression. The N5-12G6 riboswitch cassette was inserted between nucleotides 424 and 425 of the human growth hormone (hGH) cDNA driven by the CMV promoter.

[0387] Enzyme-linked immunosorbent assay (ELISA) for mouse erythropoietin (mEpo): AML-12 or C2C12 cells were transfected with TransIT-X2 transfection reagent (Mirus Bio) as described in Example 1. Four hours after transfection, the transfected cells were treated with or without Compound 004 at the indicated doses. Supernatants from the transfected cells were collected 24 hours after compound treatment and subjected to ELISA for detection of mEpo in the supernatants according to the manufacturer's instructions (R&D).

[0388] ELISA for human growth hormone (hGH): HEK293 cells were transfected with TransIT-293 transfection reagent (Mirus Bio) as described in Example 1. Four hours after transfection, the transfected cells were treated with or without Compound 004 at the indicated doses. Supernatants from the transfected cells were collected 24 hours after Compound 004 treatment and subjected to ELISA for the detection of hGH in the supernatant according to the manufacturer's instructions (R&D Systems).

[0389] result: As discussed in Example 3, the isolated riboswitch containing the redesigned aptamer sequence efficiently regulates the expression of the reporter protein luciferase in response to various concentrations of compound 004. To test the ability of the newly isolated aptamer riboswitch to regulate the expression of other target genes, riboswitch cassettes containing the redesigned aptamer sequences N5-12G6 and N4-1C11 were inserted into the cDNA sequence of mouse erythropoietin (mEpo) and the cDNA sequence of the human growth hormone gene (hGH) to generate regulatable constructs of these two genes.

[0390] First, we examined the ability of riboswitches containing aptamers N5-12G6 and N4-1C11 to regulate mEpo expression in the mouse hepatocyte cell line AML12. As shown in Figure 5a, in the absence of compound 004, cells transfected with construct mEpo-12G6 or construct mEpo-1C11 expressed very low levels of mEpo. However, upon treatment with compound 004, mEpo expression was enhanced in a dose-dependent manner in AML12 cells. In response to treatment with 1.85 μM compound 004, mEpo expression was induced approximately 148-fold in cells expressing construct mEpo-12G6 and 71-fold in cells expressing construct mEpo-1C11, compared to expression in the absence of compound 004 (see Figure 5b). The riboswitch-regulatable mEpo constructs were also tested in the mouse myoblast cell line C2C12 cells. Consistent with the observations in AML12 cells, mEpo expression was very low in the absence of Compound 004 and was induced in a dose-dependent manner upon treatment with Compound 004 (FIG. 5c).

[0391] The activity of the riboswitch in regulating transgene expression was further tested with the human growth hormone (hGH) gene in HEK293 cells. In the absence of compound 004, cells transfected with the hGH-12G6 construct expressed approximately 0.83 ng / ml of hGH. In contrast, the hGH expression level was significantly increased in transfected cells treated with compound 004. With 3.1 μM compound 004 treatment, cells expressed 202 ng / ml of hGH, approximately 243-fold higher than the hGH expression from cells without compound treatment (Figure 5d). This enhanced expression increased with increasing concentrations of compound 004, demonstrating the dose-dependence of riboswitch-regulated gene expression in human cells.

[0392] These results demonstrate that the ability of riboswitches containing the redesigned aptamer sequences to induce gene expression in response to small molecules is not restricted to specific target gene sequences or specific cell types, indicating the general applicability of these aptamer riboswitches in regulating target gene expression.

[0393] Example 5: Synthetic riboswitches regulate gene expression in mice in vivo To evaluate the ability of the designed aptamer to induce and regulate gene expression in vivo, mice were transduced with an adeno-associated viral vector (AAV) carrying the designed riboswitch, which was inserted into the gene for the reporter protein luciferase.

[0394] Testing Procedure: AAV2.8 viral particle production: The AAV8 particles used to transduce mice contained a viral genome derived from AAV2 and a capsid derived from AAV8. The firefly luciferase gene, containing an intron-exon-intron cassette with either (1) an aptamer-free, non-regulatable intron cassette ("Luci-Con1") or (2) a riboswitch cassette containing the aptamer N5-12G6 ("Luci-12G6"), was cloned into an AAV2 plasmid vector. Expression of the luciferase gene was driven by the CASI promoter, which contains CMV and ubiquitin C enhancer elements and the chicken β-actin promoter. The viral vector was packaged into an AAV8 capsid and produced according to the manufacturer's protocol (Vigene Biosciences).

[0395] Animal testing: For inducible luciferase studies, female Balb / c mice were inoculated with 5 x 10 of competent AAV8 viral particles. 10 , 1.0×10 11 , or 2.5 × 10 11Genome copies (GC) were injected once via tail vein or intramuscularly into the quadriceps of the hind limb. Compound 004 was formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 / deionized (DI) water and administered orally. 30 days after AAV vector delivery, mice were orally treated with 10 mg / kg of Compound 004 by oral gavage. Luciferase activity was measured the day before dosing and 6, 24, and 48 hours after dosing. After the first oral administration of Compound 004, mice were subjected to two additional dosing rounds and imaging cycles as follows: Day 37 (post-AAV administration): 30 mg / kg, Day 44: 100 mg / kg.

[0396] For the regulated mouse erythropoietin (mEpo) studies, each female Balb / c mouse received 1.0 × 10 vectors containing the riboswitch N5-12G6 regulated mEpo gene (AAV8.mEpo.12G6). 11 , 5×10 10 , 1×10 10 , or 5 × 10 9 GC was injected into the quadriceps muscle. Five weeks after AAV injection, mice were treated with Compound 004 formulated in 0.5% methylcellulose (MC):0.25% Tween® 80 / deionized (DI) water by oral gavage. Sixteen hours after oral administration, mice were subjected to submandibular blood collection. Ten-fold diluted serum was used to measure mouse serum Epo using ELISA (Invitrogen).

[0397] Chronic kidney disease-related animals: Male C57Bl / 6 mice, 2.5 × 10 per mouse 10 vg or 1.0×10 10 Mice were intramuscularly injected with 1000 mg of AAV8.mEpo.12G6. One week after AAV injection, mice were treated with 50 mg / kg adenine (Sigma) by oral gavage daily for a total of 28 treatments over 5 weeks. Hematocrit was measured after adenine treatment and before small molecule inducer treatment, and was monitored every 7–10 days after daily oral small molecule inducer dosing.

[0398] Non-invasive live animal bioluminescence imaging: Before imaging, mice were anesthetized with 2% isoflurane and injected with 150 mg / kg body weight of D-luciferin luciferase substrate. At the indicated time points after dosing, images were taken within 10 minutes after luciferin injection using an IVIS® SpectrumCT (Perkin Elmer, MA). Luciferase activity was expressed as mean photons / second ± standard deviation (n=5). Fold induction of luciferase gene expression was calculated as the quotient of photons / second obtained from mice treated with compound 004 divided by the value obtained from mice the day before compound treatment.

[0399] result: To test the role of riboswitches in regulating gene expression in animals, AAV8 vectors carrying luciferase genes with or without riboswitches were intravenously delivered to mice. Four weeks after AAV injection, the mice were treated with compounds by oral gavage. Six hours after a single dose of compound (10 mg / kg), luciferase activity significantly increased in mice injected with an AAV vector containing a luciferase gene containing the riboswitch 12G6 compared to the luciferase signal before compound treatment, while in mice injected with the same dose of the non-regulatory control vector Con1, luciferase expression did not change significantly after compound administration (see Figures 6a and 6b). With a single administration of the compound inducer, induced luciferase activity was highest 6 hours after administration and decreased 24 hours after administration. By 48 hours, the luciferase signal returned to baseline levels (pre-administration), demonstrating the reversibility of the on-off state of transgene expression in the presence and absence of the compound inducer, as well as the riboswitch gene regulatory system. Subsequent administration of higher doses in the same mice induced a further increase in luciferase signal, demonstrating dose-dependence. Similar results were observed in mice injected intramuscularly with the AAV8.Luci.12G6 vector (Figures 7a and 7b).

[0400] Luciferase expression from AAV8.Luci.12G6 showed tighter regulation with lower background expression levels in the absence of compound 004, while luciferase expression from AAV8.Luci.1B6 showed looser regulation with higher background expression levels in the absence of compound 004, but also showed higher peak luciferase expression in response to compound 004 (Figures 6c and 7c).

[0401] The ability of riboswitches to regulate gene expression in animals was further evaluated using the mouse erythropoietin gene (mEpo). Mice were injected with 1 x 10 6 AAV8 vectors containing the mEpo gene with the 12G6 riboswitch cassette. 11 GC was injected intramuscularly. Serum vector-expressed mEpo levels were elevated in mice treated with 30 mg / kg of compound 004 compared with mice not treated with the compound. Furthermore, serum vector-expressed mEpo levels further increased with higher compound doses and AAV administration, demonstrating a dose-dependent increase in transgene expression with increasing compound inducer (Figure 8). The effect of riboswitch-regulated expression of Epo on hematocrit was evaluated in a mouse model of chronic kidney disease (CKD)-associated anemia. After 20 oral doses of compound 004, hematocrit increased in anemic mice, with the greatest increase observed in the 100 mg / kg dose group. However, hematocrit did not increase in anemic mice injected with AAV8.mEpo.12G6 but not treated with the compound inducer, remaining the same as that in anemic mice not receiving AAV8.mEpo.12G6 (Figure 9a). In mice treated with 10 doses of the higher compound dose at 300 mg / kg for 15 days, hematocrit increased significantly compared to the lower AAV dose (1 × 10 per mouse). 10 vg) per mouse. In contrast, the AAV response returned to normal in the group of mice injected with a relatively high AAV dose (2.5 × 10 per mouse). 10The hematocrit of mice injected with Epo (vg) exceeded normal hematocrit levels. These results indicate that Epo was induced from the AAV vector after treatment with the riboswitch inducer, and that the induced Epo stimulated erythropoiesis, resulting in an increase in hematocrit in anemic animals.

[0402] These results demonstrate that riboswitches containing the redesigned aptamer sequence can regulate target gene expression in vivo in a dose-dependent manner in liver and muscle via orally administered small-molecule inducers. These results further demonstrate that the newly developed aptamer riboswitch functions in regulating therapeutic genes such as erythropoietin.

[0403] Example 6. Synthetic riboswitches regulate parathyroid hormone in mice in vivo. Testing Procedure: Riboswitch construct: An alternative splicing riboswitch cassette containing the aptamer N5-12G6 was inserted between nucleotides 181 and 182 of the human parathyroid hormone (hPTH) cDNA sequence to generate the construct hPTH-12G6. Expression of the erythropoietin gene was driven by the CASI promoter.

[0404] Enzyme-linked immunosorbent assay (ELISA) for human PTH: HEK293 cells were transfected with TransIT-293 transfection reagent (Mirus Bio) as described in Example 1. Four hours after transfection, the transfected cells were treated with or without compound 004 at the indicated doses. Supernatants from the transfected cells were collected 48 hours after compound treatment and subjected to ELISA for the detection of human PTH in the supernatants according to the manufacturer's instructions (Abcam).

[0405] AAV2.9 viral particle production: The AAV9 particles used to transduce mice contained the viral genome (ITRs) from AAV2 and the capsid from AAV9. hPTH-12G6 was cloned into an AAV plasmid backbone using the CASI promoter, and the AAV plasmid was packaged into the AAV9 capsid to generate the vector AAV9.hPTH-12G6 (Signagen).

[0406] Animal testing: C57BL / 6 mice, 2.5 x 10 per mouse 11 AAV9 viral genome (VG) AAV9 viral particles, AAV9.hPTH-12G6, were intramuscularly injected into both quadriceps muscles. Compound 004 was formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 / deionized (DI) water and administered orally. 30 days after AAV vector delivery, mice were orally treated with 0 mg / kg, 30 mg / kg, 100 mg / kg, or 300 mg / kg of Compound 004 by oral gavage for 3 days.

[0407] result: Similar to the luciferase or Epo gene, the riboswitch 12G6 regulated hPTH expression in a dose-dependent manner (Fig. 10a). When this regulated hPTH was delivered to mice via an AAV vector, compound 004 treatment induced dose-dependent hPTH production in the mice (Fig. 10b) and, therefore, an increase in serum calcium concentration (Fig. 10c). These results, along with regulated Epo expression in CKD anemia, demonstrate that riboswitches containing the aptamers disclosed herein can control the expression of therapeutic genes in animals in response to the small molecule ligands (inducers) disclosed herein.

[0408] Examples 7 to 24. experimental All solvents and reagents were obtained commercially and used as received. 1H NMR spectra were recorded on a Bruker instrument (300 MHz or 400 MHz) in the aforementioned deuterated solvents. Chemical shifts are given in ppm, and coupling constants are in Hertz. All final compounds were purified by flash chromatography using 220-400 mesh silica gel or reverse-phase HPLC with CH3CN / water as the solvent. Thin-layer chromatography was performed on silica gel 60 F-254 (0.25 nm thick) plates. Visualization was achieved with UV light and / or 10% phosphomolybdic acid / ethanol solution. Nominal (low-resolution) mass spectra were acquired on either a Waters LCT or an Applied Biosystems API 3000 mass spectrometer. High-resolution mass spectra (HRMS) were acquired on either a Waters LCT or an Agilent TOF mass spectrometer. All other LC-MS experiments were performed on an Agilent 1100 HPLC coupled to an Agilent single quadrupole mass spectrometer. Compound purity was determined by LC-MS at wavelengths of 230 nM and 254 nM. All final compounds reported here have a purity of 95% or greater.

[0409] Example 7 N-((8-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 012) [ka] Step 1. 5-Fluoro-7-vinylquinoxaline [ka] A mixture of 7-bromo-5-fluoroquinoxaline (814 mg, 3.59 mmol, 1.00 equiv.), potassium trifluoro(vinyl)boranide (961 mg, 7.17 mmol, 2.00 equiv.), Pd(dppf)Cl.CHCl (586 mg, 717 μmol, 0.20 equiv.), and CsCO (2.34 g, 7.17 mmol, 2.00 equiv.) in dioxane (8.00 mL) and HO (1.60 mL) was degassed and purged with N three times. The mixture was then stirred under N at 100 °C for 1 h, quenched with water (5.00 mL), and extracted with EtOAc (5.00 mL × 2). The reaction organic layer was washed with brine (5.00 mL), dried over NaSO, filtered, and concentrated in vacuo. The residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 1:0 to 5:1, R f =0.60) to give the title compound (0.536 g, 85.8%) as a white solid. MS (ES+) m / e 175.1 (M+H) + .

[0410] Step 2. 8-Fluoroquinoxaline-6-carbaldehyde [ka] To a solution of 5-fluoro-7-vinylquinoxaline (536 mg, 3.08 mmol, 1.00 equiv) in THF (10.7 mL) and HO (5.36 mL) was added OsO (117 mg, 462 μmol, 24.0 μL, 0.15 equiv) and NaIO (3.29 g, 15.4 mmol, 853 μL, 5.00 equiv). The mixture was stirred at 15 °C for 2 h. The insoluble precipitate was removed by passing through a Celite column, and the filtrate was extracted with ethyl acetate (5.00 mL × 3). The combined organic layers were washed with brine (5.00 mL), dried over NaSO, and concentrated in vacuo to give a residue. The residue was purified by column chromatography (SiO, petroleum ether:ethyl acetate = 1:0 to 5:1) to give the title compound (516 mg, 95.2%) as a yellow solid. MS (ES+) m / e 177.1 (M+H) + .

[0411] Step 3. tert-Butyl (E)-4-(3-(((8-fluoroquinoxalin-6-yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate [ka] To a solution of 8-fluoroquinoxaline-6-carbaldehyde (250 mg, 1.42 mmol, 1.00 equiv) in EtOH (10 mL) was added tert-butyl 4-(3-aminopyridin-4-yl)piperazine-1-carboxylate (435 mg, 1.56 mmol, 1.10 equiv), CHCOOH (128 mg, 2.13 mmol, 122 μL, 1.50 equiv), and MS 4A (400 mg). The mixture was stirred at 80° C. for 3 hours and concentrated under reduced pressure to remove AcOH and EtOH to give the title compound (619 mg, crude) as a yellow oil. MS (ES+) m / e 437.2 (M+H). + .

[0412] Step 4. tert-Butyl 4-(3-(((8-fluoroquinoxalin-6-yl)methyl)amino)pyridin-4-yl)piperazine-1-carboxylate [ka] To a solution of tert-butyl (E)-4-(3-(((8-fluoroquinoxalin-6-yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate (619 mg, 1.42 mmol, 1.00 equiv) in MeOH (10 mL) was added NaBH (107 mg, 2.84 mmol, 2.00 equiv). The mixture was stirred at 0°C-5°C for 0.5 h and quenched with saturated NH Cl (10.0 mL). The filtrate was concentrated in vacuo. The residue was extracted with ethyl acetate (10.0 mL × 3). The combined organic layers were washed with brine (5 mL), dried over Na SO and concentrated in vacuo to give a residue. The residue was purified by preparative HPLC (column: YMC Triart C18 250 x 50 mm x 7 μm, mobile phase: [water (FA)-ACN], B%: 22% to 52%, 10 min). The title compound (400 mg, 64.3%) was obtained as a white solid. MS (ES+) m / e 439.2 (M+H) + .

[0413] Step 5. N-((8-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine To a solution of tert-butyl 4-(3-(((8-fluoroquinoxalin-6-yl)methyl)amino)pyridin-4-yl)piperazine-1-carboxylate (200 mg, 456.1 μmol, 1.00 equiv) in MeOH (4.00 mL) was added dropwise HCl / MeOH (4 M, 4.00 mL) at 20° C. The mixture was stirred for 3 h and then concentrated under reduced pressure to give the title compound (174 mg, 96.6%) as a dark solid. 1 H NMR (400 MHz, D2O) δ 9.62 (br s, 2H), 8.99 (dd, J = 14.4, 1.8 Hz, 2H), 8.09 (d, J = 6.4 Hz, 1H), 7.92 (s, 1H), 7.84 - 7.77 (m, 2H), 7.40 (d, J = 6.4 Hz, 1H), 6.87 (br s, 1H), 4.74 (br d, J = 4.8 Hz, 2H), 3.50 (br s, 4H), 3.41 (br s, 4H).MS (ES+) m / e 339.1 (M+H)+ .

[0414] Example 8 N-((7-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 013) [ka] Step 1. 4-Bromo-5-chlorobenzene-1,2-diamine [ka] To a solution of 4-bromo-5-chloro-2-nitroaniline (5.00 g, 20.0 mmol, 1.00 equiv) in EtOH (120 mL) was added SnCl (18.0 g, 79.5 mmol, 4.00 equiv). The mixture was stirred at 70 °C for 3 hours, cooled to room temperature, and poured into ice water (200 mL). Saturated NaOH (200 mL) was added to adjust the pH of the mixture to basic, and then the mixture was extracted with EtOAc (200 mL × 2). The combined organic phases were washed with brine, dried (NaSO), filtered, and concentrated in vacuo to give the title compound (4.11 g, crude) as a white solid. MS (ES+) m / e 222.9 (M+H) + .

[0415] Step 2. 6-Bromo-7-chloroquinoxaline [ka] To a solution of 4-bromo-5-chlorocyclohexa-3,5-diene-1,2-diamine (4.11 g, 18.6 mmol, 1.00 equiv.) in EtOH (164 mL) was added oxaldehyde (5.38 g, 37.1 mmol, 40% purity, 2.00 equiv.). The mixture was stirred at 15° C. for 12 hours, cooled to 15° C., and filtered. The filter cake was washed with EtOH (10 mL×2) and dried to give the title compound (2.70 g, crude) as a yellow solid. MS (ES+) m / e 452.0 (M+H) + .

[0416] Step 3. 6-Chloro-7-vinylquinoxaline [ka] A mixture of 6-bromo-7-chloroquinoxaline (1.00 g, 4.11 mmol, 1.00 equiv.), potassium trifluoro(vinyl)boranide (1.10 g, 8.21 mmol, 2.00 equiv.), Pd(dppf)Cl.CHCl (671 mg, 821 μmol, 0.200 equiv.), and CsCO (2.68 g, 8.21 mmol, 2.00 equiv.) in dioxane (10.0 mL) and HO (2.00 mL) was degassed, purged with N three times, stirred under N atmosphere at 100 °C for 1 h, quenched with water (5.00 mL), and extracted with EtOAc (5.00 mL × 2). The organic layer was washed with brine (5.00 mL), dried over NaSO, filtered, and concentrated in vacuo. The residue was purified by preparative TLC (SiO2, petroleum ether: ethyl acetate = 5:1, R f =0.60) to give the title compound (0.634 g, 81.0%) as a yellow oil. MS (ES+) m / e 191.1 (M+H) + .

[0417] Step 4. 7-Chloroquinoxaline-6-carbaldehyde [ka] To a solution of 6-chloro-7-vinylquinoxaline (534 mg, 2.80 mmol, 1.00 equiv) in THF (10.7 mL) and HO (5.34 mL) was added OsO (107 mg, 420 μmol, 21.80 μL, 0.15 equiv) and NaIO (3.00 g, 14.0 mmol, 776 μL, 5.00 equiv). The mixture was stirred at 15 °C for 0.5 h. The insoluble material was removed by passing through a Celite column, and the filtrate was extracted with ethyl acetate (5.00 mL × 3). The combined organic layers were washed with brine (5.00 mL), dried over NaSO, and concentrated in vacuo to give a residue. The residue was analyzed by preparative TLC (SiO, petroleum ether:ethyl acetate = 1:1, R f=0.4) to give the title compound (164 mg, 30.4%) as a white solid. MS (ES+) m / e 193.2 (M+H) + .

[0418] Step 5. tert-Butyl (E)-4-(3-(((7-chloroquinoxalin-6-yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate [ka] To a solution of 7-chloroquinoxaline-6-carbaldehyde (208 mg, 1.08 mmol, 1.00 equiv) in EtOH (8.30 mL) was added tert-butyl 4-(3-aminopyridin-4-yl)piperazine-1-carboxylate (331 mg, 1.19 mmol, 1.10 equiv), CHCOOH (97.3 mg, 1.62 mmol, 92.6 μL, 1.50 equiv), and MS 4A (594 mg). The mixture was stirred at 80 °C for 3 h and concentrated under reduced pressure to remove AcOH and EtOH to give the title compound (489 mg, crude) as a yellow oil. MS (ES+) m / e 453.3 (M+H). + .

[0419] Step 6. tert-Butyl 4-(3-(((7-chloroquinoxalin-6-yl)methyl)amino)pyridin-4-yl)piperazine-1-carboxylate [ka] To a solution of tert-butyl (E)-4-(3-(((7-chloroquinoxalin-6-yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate (489 mg, 1.08 mmol, 1.00 equiv) in MeOH (8.0 mL) was added NaBH (81.7 mg, 2.16 mmol, 2.00 equiv). The mixture was stirred at 0–5° C. for 0.5 h, quenched with saturated NH Cl (10.0 mL), and filtered to give the filtrate. The filtrate was concentrated in vacuo. The residue was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (5 mL), dried over Na SO , and concentrated to give a residue. The residue was purified by preparative HPLC (Waters xbridge 150 x 25 mm x 10 μm, mobile phase: [water (NH4HCO3)-ACN], B%: 35% to 65%, 11 min) to give the title compound (170 mg, 34.6%) as a yellow solid. MS (ES+) m / e 455.2 (M+H) + .

[0420] Step 7. N-((7-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine To a solution of tert-butyl 4-(3-(((7-chloroquinoxalin-6-yl)methyl)amino)pyridin-4-yl)piperazine-1-carboxylate (170 mg, 374 μmol, 1.00 equiv) in dioxane (2.00 mL) was added HCl / dioxane (4 M, 157 μL, 1.68 equiv). The mixture was stirred at 15° C. for 0.5 h and filtered. The filter cake was concentrated in vacuo to give the title compound (64.3 mg, 40.9%) as a brown solid. 1 H NMR (400 MHz, D2O) δ 8.86 - 8.79 (m, 2H), 8.20 - 8.13 (m, 1H), 8.04 - 7.96 (m, 1H), 7.88 (br s, 1H), 7.69 (d, J = 0.88 Hz, 1H), 7.41 (d, J = 6.4 Hz, 1H), 4.76 (s, 2H), 3.68 - 3.60 (m, 4H), 3.56 - 3.52 (m, 4H).MS (ES+) m / e 355.2 (M+H) +.

[0421] Example 9 4-(1,4-diazepan-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 014) [ka] Step 1. 4-Bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine [ka] To a solution of quinoxaline-6-carbaldehyde (5.00 g, 28.9 mmol, 1.00 equiv.) and 4-bromopyridin-3-amine (5.94 g, 37.6 mmol, 1.30 equiv.) in THF (100 mL) was added Ti(i-PrO) (16.4 g, 57.8 mmol, 17.1 mL, 2.00 equiv.). The reaction mixture was stirred at 50 °C for 16 h and cooled to 20 °C. MeOH (100 mL) and NaBH (4.37 g, 115.6 mmol, 4.00 equiv.) were added, and the resulting solution was stirred at 20 °C for 1 h, quenched by the addition of ice water (400 mL) at 0 °C, and extracted with EtOAc (200 mL × 3). The combined organic layers were washed with 200 mL of brine, dried over NaSO, filtered, and concentrated under reduced pressure to give a residue. The crude product was triturated with EtOAc (50.0 mL) at 20° C. for 30 minutes, then filtered to collect the yellow solid, affording the title compound (6.00 g, 65.8%) as a yellow solid. 1H NMR (400 MHz, D2O) δ 8.94 - 8.90 (m, 2H), 8.09 (d, J = 8.8 Hz, 1H), 8.03 (d, J = 0.8 Hz, 1H), 7.91 - 7.86 (m, 2H), 7.64 (d, J = 5.2 Hz, 1H), 7.49 (d, J = 5.2 Hz, 1H), 6.52 (t, J = 6.4 Hz, 1H), 4.77 (d, J = 6.4 Hz, 2H).MS (ES+) m / e 315.1 (M+H)+.

[0422] Step 2. 4-(1,4-diazepan-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (M173) To a solution of 4-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (200 mg, 634.6 μmol, 1.00 equiv.) and tert-butyl 1,4-diazepane-1-carboxylate (1.90 mmol, 3.00 equiv.) in NMP (2.00 mL) was added DIPEA (328.1 mg, 2.54 mmol, 442.1 μL, 4.00 equiv.). The mixture was stirred at 180° C. for 8 hours. The reaction mixture was directly purified by preparative HPLC (HCl conditions) without workup. The purified product was dissolved in MeOH (1.00 mL), and then HCl / MeOH (4.0 M, 1.00 mL, 35.7 equiv.) was added. The mixture was stirred at 20° C. for 1 h and purified by preparative HPLC (HCl condition) to give the title compound (116.8 mg, 36.5%) as a brown solid. 1 H NMR (400 MHz, D2O) δ 8.81 (s, 2H), 8.05 - 8.03 (m, 1H), 7.97 (s, 1H), 7.87 - 7.84 (m, 2H), 7.58 (s, 1H), 7.26 - 7.24 (m, 1H), 4.63 (s, 2H), 3.88 - 3.86 (m, 2H), 3.66 - 3.57 (m, 4H), 3.47 - 3.45 (m, 2H), 3.44 - 3.40 (m, 2H), 2.20 - 2.17 (m, 2H).MS (ES+) m / e 435.2 (M+H) + . Example 10 4-(2-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 015) [ka] To a solution of 4-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (200 mg, 634 μmol, 1.00 equiv.) and tert-butyl 3-methylpiperazine-1-carboxylate (1.90 mmol, 3.00 equiv.) in NMP (2.00 mL) was added DIPEA (328 mg, 2.54 mmol, 442.1 μL, 4.00 equiv.). The mixture was stirred at 180° C. for 8 hours. The reaction mixture was directly purified without workup to give the title compound (94.0 mg, 43.3%) as a brown solid. 1 H NMR (400 MHz, DMSO-d6) δ 8.84 (s, 2H), 8.13 - 8.11 (m, 1H), 8.07 (s, 1H), 8.01 - 7.99 (m, 1H), 7.89 (s, 1H), 7.80 - 7.78 (m, 1H), 6.87 (d, J = 5.6 Hz, 1H), 4.78 - 4.75 (m, 1H), 4.68 - 4.66 (m, 2H), 4.02 - 3.90 (m, 1H), 3.28 - 3.22 (m, 3H), 3.18 - 3.04 (m, 1H), 2.77 - 2.74 (m, 1H), 2.50 - 2.44 (m, 1H), 1.18 (d, J = 6.4 Hz, 3H).MS (ES+) m / e 335.3 (M+H) + .

[0423] Example 11 4-(3-Methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 016) [ka] To a solution of 4-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (500 mg, 1.59 mmol, 1.00 equiv.) and tert-butyl 2-methylpiperazine-1-carboxylate (476 mg, 2.38 mmol, 1.50 equiv.) in NMP (2.00) was added DIPEA (328 mg, 2.54 mmol, 442 μL, 4.00 equiv.). The mixture was stirred at 180° C. for 8 hours. The reaction mixture was directly purified without workup to give the title compound (403.5 mg, 39.6%) as a brown solid. 1 H NMR (400 MHz, DMSO-d6) δ 8.85 - 8.83 (m, 2H), 8.08 - 7.99 (m, 1H), 7.97 - 7.95 (m, 2H), 7.89 - 7.86 (m, 1H), 7.67 (s, 1H), 7.37 (d, J = 6.4 Hz, 1H), 4.76 - 4.73 (m, 2 H), 3.94 - 3.91 (m, 2 H), 3.71 - 3.64 (m, 1 H), 3.61 - 3.60 (m, 1 H), 3.47 - 3.44 (m, 1 H), 3.26 - 3.24 (m, 1 H), 3.10 - 3.04 (m, 1 H), 1.40 (d, J = 6.4 Hz, 3 H).MS (ES+) m / e 335.2 (M+H) + .

[0424] Example 12 4-(Piperidin-4-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 017) [ka] Step 1. tert-Butyl 3'-amino-3,6-dihydro-[4,4'-bipyridine]-1(2H)-carboxylate [ka] A mixture of 4-bromopyridin-3-amine (1.00 g, 5.78 mmol, 1.00 equiv), tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydropyridine-1(2H)-carboxylate (1.97 g, 6.36 mmol, 1.10 equiv), Pd(OAc) (129 mg, 578 μmol, 0.10 equiv), Xantphos (668 mg, 1.16 mmol, 0.20 equiv), and KPO (1.60 g, 11.6 mmol, 2.00 equiv) in dioxane (10.0 mL) and HO (2.00 mL) was stirred at 80 °C for 12 h and then at 110 °C for 12 h. The reaction mixture was quenched with water (50.0 mL) and extracted with EtOAc (50.0 mL × 2). The combined organic layers were dried over Na2SO4, filtered, and concentrated. The residue was purified by silica gel chromatography (eluting with petroleum ether: EtOAc = 1:1 to 0:1, R f =0.3) to give the title compound (0.70 g, 43.9%) as a yellow oil. MS (ES+) m / e 276.2 (M+H) + .

[0425] Step 2. tert-Butyl 4-(3-aminopyridin-4-yl)piperidine-1-carboxylate [ka] A mixture of tert-butyl 3'-amino-3,6-dihydro-[4,4'-bipyridine]-1(2H)-carboxylate (0.70 g, 2.54 mmol, 1.00 equiv.) and Pd / C (0.10 g, 2.54 mmol, 10% purity, 1.00 equiv.) in MeOH (10.0 mL) was stirred under H2 (15 psi) at 25 °C for 2 h. The mixture was filtered and washed with MeOH (10 mL). The filtrate was concentrated to give the title compound (550 mg, 78.0%) as a yellow oil. MS (ES+) m / e 278.2 (M+H) + .

[0426] Step 3. tert-Butyl 4-(3-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)piperidine-1-carboxylate [ka] A mixture of tert-butyl 4-(3-aminopyridin-4-yl)piperidine-1-carboxylate (200 mg, 718.5 μmol, 1.00 equiv.), quinoxaline-6-carbaldehyde (113.6 mg, 718.5 μmol, 1.00 equiv.), and Ti(i-PrO) (224 mg, 790 μmol, 233 μL, 1.10 equiv.) in THF (5.00 mL) was stirred at 70 °C for 36 h. NaBHCN (90.3 mg, 1.44 mmol, 2.00 equiv.) was added, and the mixture was stirred at 25 °C for 0.5 h and poured into saturated NaHCO (20.0 mL). The resulting solution was extracted with EtOAc (10.0 mL × 2). The organic layer was washed with water (20.0 mL × 2), dried over NaSO, and concentrated. The residue was purified by reverse-phase HPLC (formic acid condition) to give the title compound (62.0 mg, 20.5%) as a yellow solid. MS (ES+) m / e 421.2 (M+H) + .

[0427] Step 4. 4-(piperidin-4-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine To a solution of tert-butyl 4-(3-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)piperidine-1-carboxylate (48.3 mg, 115 μmol, 1.00 equiv) in MeOH (1.00 mL) was added HCl / MeOH (4.00 M, 1.00 mL, 34.7 equiv). The mixture was stirred at 20° C. for 1 hour and concentrated to give the title compound (35.0 mg, 82.0%) as a brown oil. 1H NMR (400 MHz, D2O) δ 8.85 (s, 2H), 8.10 - 8.08 (m, 1H), 7.99 (s, 1H), 7.94 - 7.92 (m, 1H), 7.89 - 7.87 (m, 1H), 7.70 - 7.66 (m, MS (ES+) m / e 320.1 (M+H) + .

[0428] Example 13 4-(Pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 018) [ka] Step 1. tert-Butyl 3-((3-nitropyridin-4-yl)oxy)pyrrolidine-1-carboxylate [ka] To a mixture of 4-chloro-3-nitropyridine (1.00 g, 6.31 mmol, 1.00 equiv) and tert-butyl 3-hydroxypyrrolidine-1-carboxylate (1.18 g, 6.31 mmol, 1.00 equiv) in THF (10.0 mL) was added t-BuOK (2.12 g, 18.9 mmol, 3.00 equiv) at 0 °C. The mixture was stirred at 25 °C for 12 h, quenched with NH Cl (30 mL), and extracted with EtOAc (30.0 mL × 2). The combined organic layers were washed with water (30.0 mL), dried over Na SO , filtered, and concentrated in vacuo to give the title compound (1.50 g, crude) as a yellow solid. MS (ES+) m / e 310.1 (M+H) + .

[0429] Step 2. tert-Butyl 3-((3-aminopyridin-4-yl)oxy)pyrrolidine-1-carboxylate [ka] To a solution of tert-butyl 3-((3-nitropyridin-4-yl)oxy)pyrrolidine-1-carboxylate (1.50 g, 4.85 mmol, 1.00 equiv) and NH4Cl (1.30 g, 24.3 mmol, 5.00 equiv) in EtOH (25.0 mL) and HO (25.0 mL) was added Fe (1.35 g, 24.3 mmol, 5.00 equiv). The mixture was stirred at 45 °C for 1 h and filtered. The filtrate was extracted with EtOAc (100 mL x 2). The combined organic layers were washed with water (100 mL), dried over Na2SO4, filtered, and concentrated to give the title compound (900 mg, crude) as a brown solid. MS (ES+) m / e 280.2 (M+H) + .

[0430] Step 3. tert-Butyl 3-((3-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)oxy)pyrrolidine-1-carboxylate [ka] A mixture of tert-butyl 3-((3-aminopyridin-4-yl)oxy)pyrrolidine-1-carboxylate (450 mg, 1.61 mmol, 1.00 equiv), quinoxaline-6-carbaldehyde (254 mg, 1.61 mmol, 1.00 equiv), AcOH (145 mg, 2.42 mmol, 138 μL, 1.50 equiv), and 4A MS (1.00 g, 1.61 mmol, 1.00 equiv) in EtOH (2.00 mL) was stirred at 80 °C for 12 h. NaBH(OAc) (1.50 g) was added, and the mixture was stirred at 25 °C for 12 h, quenched with NaHCO (40.0 mL), and extracted with DCM (30.0 mL × 2). The combined organic layers were dried over Na2SO4, filtered and concentrated to give the title compound (500 mg, crude) as a yellow oil. MS (ES+) m / e 422.2 (M+H) + .

[0431] Step 4. 4-(Pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine [ka] To a solution of t-butyl 3-((3-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)oxy)pyrrolidine-1-carboxylate (100 mg, 237 μmol, 1.00 equiv) in dioxane (2.00 mL) was added HCl / dioxane (2.00 mL). The mixture was stirred at 20° C. for 1 hour and concentrated to give the title compound (50.0 mg, 64.2%) as a dark solid. 1 H NMR (400 MHz, D2O) δ 8.87 - 8.86 (m, 2H), 8.10 - 8.07 (m, 1H), 8.0 - 7.98 (m, 2H), 7.96 - 7.89 (m, 1H), 7.63 (s, 1H), 7.37 - 7.35 (m, 1H), 5.64 (s, 1H), 3.84 - 3.58 (m, 6H), 2.53 - 2.48 (m, 2H).MS (ES+) m / e 322.2 (M+H) + .

[0432] Example 14 5-Chloro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 019) [ka] Step 1. tert-Butyl 4-(3-chloro-5-nitropyridin-4-yl)piperazine-1-carboxylate [ka] A mixture of 3,4-dichloro-5-nitropyridine (1.00 g, 5.18 mmol, 1.00 equiv), tert-butyl piperazine-1-carboxylate (965 mg, 5.18 mmol, 1.00 equiv), and DIEA (736 mg, 5.70 mmol, 992 μL, 1.10 equiv) in i-PrOH (10.0 mL) was stirred at 25 °C for 12 hours. The reaction solution was concentrated to give the title compound (1.78 g, crude) as a yellow solid. MS (ES+) m / e 343.1 (M+H) + .

[0433] Step 2. tert-Butyl 4-(3-amino-5-chloropyridin-4-yl)piperazine-1-carboxylate [ka] To a solution of tert-butyl 4-(3-chloro-5-nitropyridin-4-yl)piperazine-1-carboxylate (1.78 g, 5.19 mmol, 1.00 equiv.) and NH4Cl (4.17 g, 77.9 mmol, 15.0 equiv.) in EtOH (20.0 mL) and HO (15.0 mL) was added Fe (1.45 g, 25.9 mmol, 5.00 equiv.). The mixture was stirred at 25 °C for 4 h and filtered. The filtrate was extracted with DCM (100 mL × 3). The combined organic layers were washed with water (50.0 mL), dried over Na2SO4, filtered, and concentrated to give the title compound (1.53 g, 94.1%) as a yellow solid. MS (ES+) m / e 355.1 (M+H) + .

[0434] Step 3. tert-Butyl 4-(3-chloro-5-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)piperazine-1-carboxylate [ka] A mixture of tert-butyl 4-(3-amino-5-chloropyridin-4-yl)piperazine-1-carboxylate (200 mg, 639 μmol, 1.00 equiv.), quinoxaline-6-carbaldehyde (101 mg, 639 μmol, 1.00 equiv.), AcOH (57.6 mg, 959 μmol, 54.8 μL, 1.50 equiv.), and 4A MS (0.5 g) in EtOH (1.00 mL) was stirred at 80° C. for 12 hours. NaBHCN (90.3 mg, 1.44 mmol, 2.00 equiv.) was added, and the mixture was stirred at 25° C. for 1 hour. The reaction solution was concentrated to give the title compound (250 mg, crude) as a yellow solid.

[0435] Step 4. 5-Chloro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine To a solution of tert-butyl 4-(3-chloro-5-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)piperazine-1-carboxylate (250 mg, 549 μmol, 1.00 equiv) in dioxane (5.00 mL) was added HCl / dioxane (4.00 M, 1.00 mL, 7.28 equiv). The mixture was stirred at 25° C. for 12 hours. The resulting solid was collected by filtration, washed with dioxane (1.00 mL), and dried to give the title compound (180 mg, 83.7%) as a brown solid. 1 H NMR (400 MHz, DMSO-d6) δ 9.5 (br s, 2 H), 8.95- 8.90 (m, 2 H), 8.11-8.06 (m, 2 H), 7.93-7.90 (m, 1 H), 7.87 (s, 2 H), 7.25 (s, 1 H), 4.79 (s, 2 H), 3.43 (br s, 8 H).MS (ES+) m / e 355.1 (M+H) + .

[0436] The following compounds were synthesized using essentially the same procedures described for the preceding compounds with the appropriate starting materials.

[0437] Example 15 4-(Azetidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 022) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.90 (q, J = 2.0 Hz, 2H), 8.07 (d, J = 8.8 Hz, 1H), 8.02 (d, J = 1.2 Hz, 1H), 7.89 (dd, J1= 1.6 Hz, J2= 8.4 Hz, 1H), 6.57 (d, J = 5.2 Hz, 1H), 6.16 (br s, 1H), 5.14 - 5.06 (m, 1H), 4.66 (d, J = 6.0 Hz, 2H), 4.41 - 4.17 (m, 1H), 3.82 - 3.41 (m, 6H).MS (ES+) m / e 308.2 (M+H) + .

[0438] Example 16 5-Methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 023) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.84 (s, 2H), 8.12 (d, J = 8.80 Hz, 1H), 8.05 (s, 1H), 7.82 - 7.76 (m, 2H), 7.74 (br s, 1H), 5.53 (br t, J = 5.80 Hz, 1H), 4.66 (d, J = 5.60 Hz, 2H), 3.45 - 3.23 (m, 2H), 3.22 - 2.78 (m, 7H), 2.35 (s, 3H).MS (ES+) m / e 335.1 (M+H) + .

[0439] Example 17 6-Fluoro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 024) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.86 (s, 2H), 8.14 (d, J = 8.80 Hz, 1H), 8.07 (s, 1H), 7.85-7.74 (m, 1H), 7.37 (s, 1H), 6.50 (s, 1H), 4.63 (br d, J = 5.50 Hz, 2H), 4.48 (br t, J = 4.90 Hz, 1H), 3.11 (s, 8H).MS (ES+) m / e 339.1 (M+H) + .

[0440] Example 18 (S)-5-Chloro-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 025) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.85 (s, 2H), 8.13 (d, J = 8.40 Hz, 1H), 8.03 (s, 1H), 7.87 (s, 1H), 7.80 (s, 1H), 7.76 (dd, J = 1.80, 8.80 Hz, 1H), 5.70 (br s, 1H), 4.68 (d, J = 6.00 Hz, 2H), 3.58 - 3.45 (m, 1H), 3.22 - 3.11 (m, 2H), 3.03 - 2.81 (m, 4H), 1.12 (br d, J = 6.00 Hz, 3H).MS (ES+) m / e 369.0 (M+H) + .

[0441] Example 19 (R)-5-chloro-4-(2-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 026) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.85 (s, 2H), 8.12 (d, J = 8.80 Hz, 1H), 8.02 (s, 1H), 7.86 (s, 1H), 7.81 (s, 1H), 7.74 (dd, J = 1.60, 8.80 Hz, 1H), 5.94 (br t, J = 5.80 Hz, 1H), 4.69 (br d, J = 6.00 Hz, 2H), 3.87 - 3.76 (m, 1H), 3.51 (br t, J = 10.60 Hz, 1H), 3.23 - 3.06 (m, 2H), 2.95 (br t, J = 11.00 Hz, 1H), 2.85 - 2.70 (m, 1H), 2.57 (br t, J = 10.40 Hz, 1H), 0.88 (d, J = 6.00 Hz, 3H).MS (ES+) m / e 369.0 (M+H) + .

[0442] Example 20 4-(Azetidin-3-yloxy)-5-chloro-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 027) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.90 - 8.74 (m, 2H), 8.14 - 8.01 (m, 2H), 7.97 (br s, 1H), 7.85 (br d, J = 7.2 Hz, 1H), 7.74 (s, 1H), 5.61 (br t, J = 6.0 Hz, 1H), 4.79 - 4.77 (m, 2H), 4.69 - 4.57 (m, 4H).MS (ES+) m / e 342.1 (M+H)+ .

[0443] Example 21 4-(Azetidin-3-yloxy)-N-((8-fluoroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 028) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.48 - 9.10 (m, 2H), 9.00 (dd, J1= 1.6 Hz, J2= 14.0 Hz, 2H), 8.12 (d, J = 6.4 Hz, 1H), 7.93 (s, 2H), 7.74 (dd, J1= 1.6 Hz, J2= 11.2 Hz, 1H), 7.45 - 7.31 (m, 1H), 7.22 (d, J = 6.4 Hz, 1H), 5.45 (br s, 1H), 4.76 (br d, J = 6.0 Hz, 2H), 4.66 - 4.49 (m, 2H), 4.29 (br d, J = 8.8 Hz, 2H).MS (ES+) m / e 426.2 (M+H) + .

[0444] Example 22 4-(Azetidin-3-yloxy)-N-((7-chloroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 029) [ka] 1H NMR (400 MHz, DMSO-d6) δ 9.57 (s, 2H), 8.95 (d, J = 10.0 Hz, 2H), 8.29 (s, 1H), 8.19 (d, J = 6.0 Hz, 1H), 7.99 (s, 1H), 7.94 (s, 1H) 7.33 - 7.32 (m, 2H), 5.53 - 5.51 (m, 1H), 4.77 (d, J = 4.8 Hz, 2H), 4.62 - 4.58 (m, 2H), 4.33 (d, J = 8.4 Hz, 2H).MS (ES+) m / e 342.0 (M+H) + .

[0445] Example 23 (R)-4-(2-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 020) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.89 (s, 2H), 8.07 (d, J = 8.4 Hz, 1H), 7.97 (s, 1H), 7.86 (dd, J = 1.6, 8.4 Hz, 1H), 7.80 - 7.73 (m, 2H), 6.95 (d, J = 5.2 Hz, 1H), 6.01 (br t, J = 6.0 Hz, 1H), 4.83 - 4.59 (m, 2H), 3.20 (br s, 1H), 3.05 - 2.91 (m, 3H), 2.91 - 2.81 (m, 1H), 0.82 (d, J = 6.4 Hz, 3H).MS (ES+) m / e 335.2 (M+H) + .

[0446] Example 24 (R)-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 021) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.81 (s, 2H), 8.03 - 7.91 (m, 3H), 7.83 (d, J = 8.8 Hz, 1H), 7.59 (s, 1H), 7.33 (d, J = 6.4 Hz, 1H), 5.61 (br MS (ES+) m / e 322.3 (M+H) + .

[0447] Example 25 4-(2,5-diazabicyclo[2.2.1]heptan-2-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 030) [ka] 1 H NMR (400 MHz, D2O) δ 8.85 (s, 2H), 8.10 - 8.08 (m, 1H), 8.02 (s, 1H), 7.91 - 7.89 (m, 1H), 7.86 - 7.84 (m, 1H), 7.56 (s, 1H), 7.01 -7.00 (m, 1H), 5.14 (s, 1H), 4.65 - 4.59 (m, 3H), 4.20 - 4.16 (m, 1H), 3.87 - 3.84 (m, 1H), 3.65 - 3.62 (m, 1H), 3.53 - 3.50 (m, 1H), 2.35 - 2.32 (m, 1H), 2.18 - 2.15 (m, 1H).MS (ES+) m / e 333 (M+H) + .

[0448] Example 26 4-(3,6-diazabicyclo[3.1.1]heptan-6-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 031) [ka] 1 H NMR (400 MHz, D2O) δ 8.79 (s, 2H), 8.00 (d, J = 8.8 Hz, 1H), 7.92 (s, 1H), 7.86 (d, J = 6.4 Hz, 1H), 7.81 (dd, J = 8.8, 1.60 Hz, 1H), 7.60 (s, 1H), 6.82 (d, J = 6.8 Hz, 1H), 4.93 (d, J = 6.8 Hz, 2H), 4.53 (s, 2H), 3.77 (d, J = 13.6 Hz, 2H), 3.60 (d, J = 13.2 Hz, 2H), 3.15 - 3.09 (m, 1H), 1.98 (d, J = 10.4 Hz, 1H).MS (ES+) m / e 333 (M+H) + .

[0449] Example 27 4-(Hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 032) [ka] 1 H NMR (400 MHz, D2O) δ 8.85 (s, 2H), 8.10 - 8.08 (m, 1H), 8.03 (s, 1H), 7.92 - 7.90 (m, 1H), 7.93 - 7.81 (m, 1H), 7.51 (s, 1H), 7.02 - 7.00 (m, 1H), 4.65 (s, 2H), 3.78 - 3.75 (m, 4H), 3.63 - 3.62 (m, 2H), 3.32 - 3.30 (m, 4H).MS (ES+) m / e 347 (M+H) + .

[0450] Example 28 4-(4-aminopiperidin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 033) [ka] 1 H NMR (400 MHz, D2O) δ 8.86 (s, 2H), 8.09 - 8.07 (m, 1H), 7.99 (s, 1H), 7.91 - 7.87 (m, 2H), 7.56 (s, 1H), 7.28 - 7.27 (m, 1H), 4.77 - 4.72 (m, 2H), 3.89 - 3.86 (m, 2H), 3.53 - 3.46 (m, 1H), 3.00 (t, J = 12.0 Hz, 2H), 2.21 - 2.18 (m, 2H), 1.93 - 1.84 (m, 2H).MS (ES+) m / e 335 (M+H) + .

[0451] Example 29 N 4 -(piperidin-4-yl)-N 3 -(Quinoxalin-6-ylmethyl)pyridine-3,4-diamine (Compound 034) [ka] 1 H NMR (400 MHz, D2O) δ 8.85 (s, 2H), 8.08 - 8.06 (m, 1H), 8.01 (s, 1H), 7.90 - 7.87 (m, 1H), 7.79 - 7.77 (m, 1H), 7.41 (s, 1H), 6.91 -6.89 (m, 1H), 4.66 (s, 2H), 4.04 - 3.98 (m, 1H), 3.56 - 3.52 (m, 2H), 3.22 - 3.15 (m, 2H), 2.34 - 2.30 (m, 2H), 1.88 - 1.85 (m, 2H).MS (ES+) m / e 335 (M+H) + .

[0452] Example 30 N 4 -methyl-N 4 -(pyrrolidin-3-yl)-N3 -(Quinoxalin-6-ylmethyl)pyridine-3,4-diamine (Compound 035) [ka] 1 H NMR (400 MHz, D2O) δ 8.83 (s, 2H), 8.06 - 8.04 (m, 1H), 8.00 (s, 1H), 7.90 -7.87 (m, 1H), 7.83 - 7.81 (m, 1H), 7.52 (s, 1H), 6.94 - 6.92 (m, 1H), 4.70 - 4.69 (m, 2H), 4.09 - 3.95 (m, 4H), 3.74 - 3.70 (m, 1H), 2.77 (s, 3H), 2.58 - 2.51 (m, 1H), 2.30 - 2.25 (m, 1H).MS (ES+) m / e 335 (M+H) + .

[0453] Example 31 N-(quinoxalin-6-ylmethyl)-4-(3-(trifluoromethyl)piperazin-1-yl)pyridin-3-amine (Compound 036) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.85 (s, 2H), 8.15 - 8.12 (m, 1H), 8.06 - 8.03 (m, 2H), 7.94 (s, 1H), 7.81 - 7.78 (m, 1H), 6.93 - 6.91 (m, 1H), 4.76 - 4.72 (m, 1H), 4.68 - 4.67 (m, 2H), 3.51 - 3.48 (m, 1H), 3.41 - 3.37 (m, 1H), 3.29 - 3.27 (m, 2H), 3.05 - 2.99 (m, 1H), 2.97 - 2.94 (m, 1H), 2.86 - 2.84 (m, 1H).MS (ES+) m / e 389 (M+H) + .

[0454] Example 32 N-(quinoxalin-6-ylmethyl)-4-(2-(trifluoromethyl)piperazin-1-yl)pyridin-3-amine (Compound 037) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.85 (s, 2H), 8.15 - 8.13 (m, 1H), 8.05 - 8.03 (m, 2H), 7.93 (s, 1H), 7.80 - 7.78 (m, 1H), 6.94 - 6.92 (m, 1H), 4.74 - 4.73 (m, 1H), 4.68 - 4.67 (m, 2H), 3.51 - 3.48 (m, 1H), 3.41 - 3.37 (m, 1H), 3.29 - 3.27 (m, 2H), 3.05 - 2.95 (m, 2H), 2.88 - 2.85 (m, 1H), 1.98 - 1.96 (m, 1H).MS (ES+) m / e 389 (M+H) + .

[0455] Example 33 4-(3-((quinoxalin-6-ylmethyl)amino)pyridin-4-yl)piperazin-2-one (Compound 038) [ka] 1 H NMR (400 MHz, D2O) δ 8.87 (s, 2H), 8.14 - 8.11 (m, 1H), 8.02 - 8.00 (m, 1H), 7.94 (s, 1H), 7.84 - 7.82 (m, 2H), 7.10 - 7.08 (m, 1H), 5.48 (s, 2H), 4.63 (s, 2H), 3.94 (t, J = 6.8 Hz, 2H), 3.40 (t, J = 6.8 Hz, 2H).MS (ES+) m / e 335 (M+H) + .

[0456] Example 34 4-Morpholino-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 039) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.85 - 8.84 (m, 2H), 8.14 - 8.12 (m, 1H), 8.06 - 8.05 (m, 1H), 8.03 - 8.02 (m, 1H), 7.89 (s, 1H), 7.80 - 7.78 (m, 1H), 6.91-6.90 (m, 1H), 4.79 - 4.78 (m, 1H), 4.68 - 4.67 (m, 2H), 3.90 - 3.87 (m, 4H), 3.09 - 3.07 (m, 4H).MS (ES+) m / e 322 (M+H) + .

[0457] Example 35 3-(Piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-4-amine (Compound 040) [ka] 1 H NMR (400 MHz, D2O) δ 8.86 (s, 2 H), 8.09 (m, 2 H), 7.95 (s, 1 H), 7.88 - 7.83 (m, 2 H), 6.82-6.80 (m, 1 H), 4.94 (s, 2 H), 3.49- 3.42 (m, 4 H), 3.27-3.18 (m, 4 H).MS (ES+) m / e 321 (M+H) + .

[0458] Example 36 (S)-4-(2-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 041) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.90 (s, 2H), 8.08 (d, J = 8.8 Hz, 1H), 7.98 (s, 1H), 7.90 - 7.85 (m, 1H), 7.79 - 7.74 (m, 1H), 6.96 (d, J = 4.8 Hz, 1H), 6.00 (t, J = 6.0 Hz, 1H), 4.78 - 4.61 (m, 2H), 3.24 - 3.16 (m, 1H), 3.06 - 2.82 (m, 4H), 2.58 - 2.52 (m, 2H), 2.50 - 2.46 (m, 2H), 0.83 (d, J = 6.0 Hz, 3H).MS (ES+) m / e 335 (M+H) + .

[0459] Example 37 (S)-4-(3-メチルピペラジン-1-イル)-N-(キノキサリン-6-イルメチル)ピリジン-3-アミン(Compound 042)

change

[0460] Example 38 (R)-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 043) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.90 (s, 2H), 8.08 (d, J = 8.4 Hz, 1H), 8.00 (s, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (d, J = 5.2 Hz, 1H), 7.70 (s, 1H), 6.83 (d, J = 5.2 Hz, 1H), 5.65 (t, J = 6.0 Hz, 1H), 4.68 (br d, J = 6.0 Hz, 2H), 3.17 (br t, J = 8.8 Hz, 2H), 3.03 - 2.92 (m, 3H), 2.57 - 2.52 (m, 1H), 2.22 (t, J = 10.4 Hz, 1H), 1.01 (d, J = 6.4 Hz, 3H).MS (ES+) m / e 335 (M+H) + .

[0461] Example 39 (S)-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 044) [ka] 1H NMR (400 MHz, DMSO-d6) δ 8.85 (s, 2H), 8.07 (d, J = 8.8 Hz, 1H), 8.01 - 7.94 (m, 2H), 7.87 (d, J = 8.8 Hz, 1H), 7.63 (s, 1H), 7.36 (d, J = 6.4 Hz, 1H), 5.65 - 5.61 (m, 1H), 4.86 - 4.81 (m, 1H), 3.85 - 3.78 (m, 1H), 3.77 - 3.68 (m, 1H), 3.59 (t, J = 7.6 Hz, 2H), 2.53 - 2.46 (m, 2H).MS (ES+) m / e 322 (M+H) + .

[0462] Example 40 4-(ピペリジン-4-イルオキシ)-N-(キノキサリン-6-イルメチル)ピリジン-3-アミン(Compound 045)

change

[0463] Example 41 N-(quinoxalin-6-ylmethyl)-4-(2,6-diazaspiro[3.3]heptan-2-yl)pyridin-3-amine (Compound 046) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.94 (s, 2H), 8.72 (br s, 2H), 8.15 - 8.05 (m, 2H), 7.94 - 7.87 (m, 2H), 7.49 (s, 1H), 6.59 (d, J = 6.4 Hz, 1H), 6.00 (br t, J = 5.2 Hz, 1H), 4.62 (s, 4H), 4.58 (br d, J = 5.2 Hz, 2H), 4.21 (br s, 4H).MS (ES+) m / e 333 (M+H) + .

[0464] Example 42 4-(2-(dimethylamino)ethoxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 047) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.91 (s, 2H), 8.27 (br s, 1H), 8.14 - 8.08 (m, 2H), 8.02 - 7.95 (m, 1H), 7.81 (s, 1H), 7.42 (d, J = 6.4 Hz, 1H), 4.89 - 4.61 (m, 4H), 3.66 (br d, J = 4.4 Hz, 3H), 2.88 (d, J = 4.8 Hz, 6H).MS (ES+) m / e 324 (M+H) + .

[0465] Example 43 4-(Piperazin-1-yl)-3-((quinoxalin-6-ylmethyl)amino)benzonitrile (Compound 048) [ka]

[0466] Example 44 N-((8-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 049) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.03 (dd, J = 2.00, 7.20 Hz, 2H), 8.94 (br s, 2H), 8.12 (d, J = 1.60 Hz, 1H), 8.07 (d, J = 6.00 Hz, 1H), 8.01 (s, 1H), 7.82 (s, 1H), 7.33 (d, J = 6.00 Hz, 1H), 6.67 - 6.48 (m, 1H), 4.73 (br d, J = 6.00 Hz, 2H), 3.41 (br s, 8H).MS (ES+) m / e 355 (M+H) + .

[0467] Example 45 N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 050) [ka] 1H NMR (400 MHz, CDCl3) δ 8.83 (d, J = 1.60 Hz, 1H), 8.80 (d, J = 2.00 Hz, 1H), 8.07 (d, J = 7.60 Hz, 1H), 8.02 (d, J = 5.20 Hz, 1H), 7.89 (s, 1H), 7.79 (d, J = 10.40 Hz, 1H), 6.88 (d, J = 5.20 Hz, 1H), 4.84 (br d, J = 6.00 Hz, 1H), 4.72 (d, J = 6.00 Hz, 2H), 3.11 - 2.95 (m, 9H).MS (ES+) m / e 339 (M+H) + .

[0468] Example 46 2-Fluoro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 051) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.84 (s, 2H), 8.08 (d, J = 8.40 Hz, 1H), 8.01 (s, 1H), 7.74 (dd, J = 2.00, 8.80 Hz, 1H), 7.59 (d, J = 0.80, 4.40 Hz, 1H), 6.76 (d, J = 5.20 Hz, 1H), 4.74 (d, J = 8.40 Hz, 2H), 4.41 (br d, J = 2.80 Hz, 1H), 3.18-3.00 (m, 8H).MS (ES+) m / e 339 (M+H) + .

[0469] Example 47 5-chloro-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 052) [ka] 1H NMR (400 MHz, CDCl3) δ 8.87 - 8.77 (m, 2H), 8.02 (d, J = 7.60 Hz, 1H), 7.87 (s, 1H), 7.83 (s, 1H), 7.78 (d, J = 10.40 Hz, 1H), 5.77 (br t, J = 6.00 Hz, 1H), 4.73 (br d, J = 6.40 Hz, 2H), 3.76 - 2.70 (m, 9H).MS (ES+) m / e 373 (M+H) + .

[0470] Example 48 5-Chloro-N-((8-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 053) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.89 (d, J = 3.60 Hz, 2H), 7.91-7.83 (m, 2H), 7.76 (s, 1H), 7.46 (d, J = 10.40 Hz, 1H), 5.77 (br t, J = 6.00 Hz, 1H), 4.67 (d, J = 6.00 Hz, 2H), 3.64 (br s, 2H), 3.15 (br s, 2H), 2.99 (br s, 2H), 2.90 (br s, 2H).MS (ES+) m / e 373 (M+H) + .

[0471] Example 49 5-Chloro-N-((7-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 054) [ka] 1H NMR (400 MHz, D2O) δ 8.85 (d, J = 4.80 Hz, 2H), 8.21 (s, 1H), 8.08 (s, 1H), 7.93 (s, 1H), 7.78 (s, 1H), 4.82 (s, 2H), 3.69 (br s, 4H), 3.51 (br t, J = 4.80 Hz, 4H).MS (ES+) m / e 389 (M+H) + .

[0472] Example 50 5-Chloro-N-((8-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 055) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.96 (d, J = 1.60 Hz, 1H), 8.91 (d, J = 1.20 Hz, 1H), 7.98 (s, 1H), 7.89 (s, 2H), 7.77 (s, 1H), 5.78 (br t, J = 5.80 Hz, 1H), 4.67 (d, J = 6.40 Hz, 2H), 3.68 - 3.52 (m, 2H), 3.21 - 2.75 (m, 7H).MS (ES+) m / e 389 (M+H) + .

[0473] Example 51 (R)-5-chloro-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 056) [ka] 1H NMR (400 MHz, CDCl3) δ 8.95-8.80 (m, 2H), 8.13 (d, J = 8.40 Hz, 1H), 8.03 (s, 1H), 7.87 (br s, 1H), 7.83-7.70 (m, 2H), 5.70 (br s, 1H), 4.67 (br d, J = 6.00 Hz, 2H), 3.54 (br t, J = 10.80 Hz, 1H), 3.36-2.75 (m, 7H), 1.13 (br d, J = 5.60 Hz, 3H).MS (ES+) m / e 369 (M+H) + .

[0474] Example 52 (S)-N-((7-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 057) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.84 (d, J = 2.00 Hz, 1H), 8.82 (d, J = 1.60 Hz, 1H), 8.22 (s, 1H), 8.08 (s, 1H), 8.02 (d, J = 4.80 Hz, 1H), 7.86 (s, 1H), 6.89 (d, J = 5.20 Hz, 1H), 4.94-4.85 (m, 1H), 4.73 (d, J = 5.60 Hz, 2H), 3.32 - 3.19 (m, 3H), 3.18 - 3.05 (m, 2H), 2.90 - 2.77 (m, 1H), 2.58 - 2.45 (m, 1H), 1.22 (d, J = 6.40 Hz, 3H).MS (ES+) m / e 369 (M+H) + .

[0475] Example 53 (R)-N-((7-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 058) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.83 (dd, J = 1.60, 9.60 Hz, 2H), 8.22 (s, 1H), 8.10 - 8.06 (m, 1H), 8.01 (d, J = 5.20 Hz, 1H), 7.87 (s, 1H), 6.89 (d, J = 5.20 Hz, 1H), 4.94 - 4.86 (m, 1H), 4.73 (d, J = 6.00 Hz, 2H), 3.32 - 3.19 (m, 3H), 3.18 - 3.07 (m, 2H), 2.89 - 2.79 (m, 1H), 2.52 (br t, J = 10.8 Hz, 1H), 1.22 (d, J = 6.40 Hz, 3H).MS (ES+) m / e 369 (M+H) + .

[0476] Example 54 (S)—N-((8-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 059) [ka] 1H NMR (400 MHz, CDCl3) δ 8.90 (dd, J = 2.00, 6.00 Hz, 1H), 8.95 - 8.76 (m, 1H), 8.02 (d, J = 5.20 Hz, 1H), 7.94 - 7.84 (m, 2H), 7.52 (dd, J = 1.20, 10.40 Hz, 1H), 6.92 - 6.85 (m, 1H), 4.85 - 4.78 (m, 1H), 4.66 (d, J = 6.00 Hz, 2H), 3.24 (br d, J = 12.00 Hz, 3H), 3.15 - 3.05 (m, 2H), 2.87 - 2.70 (m, 1H), 2.49 (br t, J = 10.40 Hz, 1H), 1.20 (d, J = 6.40 Hz, 3H).MS (ES+) m / e 353 (M+H) + .

[0477] Example 55 (R)-N-((8-フルオロキノキサリン-6-イル)メチル)-4-( 3-メチルピペラジン-1-イル)ピリジン-3-アミン (Compound 060)

change

[0478] Example 56 (S)-5-Chloro-4-(2-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 061) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.84 (s, 2H), 8.12 (d, J = 8.40 Hz, 1H), 8.02 (s, 1H), 7.85 (s, 1H), 7.80 (s, 1H), 7.74 (dd, J = 2.00, 8.80 Hz, 1H), 5.95 (br t, J = 6.00 Hz, 1H), 4.69 (d, J = 6.40 Hz, 2H), 3.83 - 3.79 (m, 1H), 3.49 (dt, J = 2.80, 11.60 Hz, 1H), 3.12 (br t, J = 10.40 Hz, 2H), 2.94 (br d, J = MS (ES+) m / e 369 (M+H) + .

[0479] Example 57 (R)-N-((7-chloroquinoxalin-6-yl)methyl)-4-(2-methylpiperazin-1-yl)pyridin-3-amine (Compound 062) [ka] 1H NMR (400 MHz, CDCl3) δ 8.83 (dd, J = 2.00, 9.50 Hz, 2H), 8.21 (s, 1H), 8.07 - 8.00 (m, 2H), 7.98 (s, 1H), 7.04 - 6.99 (m, 1H), 5.43 - 5.34 (m, 1H), 4.80 - 4.67 (m, 2H), 3.52 - 3.44 (m, 1H), 3.35 (br s, 2H), 3.18 (s, 2H), 3.01 - 2.94 (m, 1H), 2.89 - 2.83 (m, 1H), 1.00 (d, J = 6.00 Hz, 3H).MS (ES+) m / e 369 (M+H) + .

[0480] Example 58 (S)-N-((7-クロロキノキサリン-6-イル)メチル)-4-( 2-メチルピペラジン-1-イル)ピリジン-3-アミン (Compound 063)

change

[0481] Example 59 4-(Azetidin-3-yloxy)-N-((8-chloroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 064) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.00 (s, 2H), 8.09 (s, 1H), 8.02 (s, 1H), 7.73 - 7.65 (m, 2H), 6.59 - 6.53 (m, 1H), 6.16 (br s, 1H), 5.09 (br d, J = 6.00 Hz, 1H), 4.65 (br d, J = 6.40 Hz, 2H), 3.84 (br s, 2H), 3.67 - 3.58 (m, 2H).MS (ES+) m / e 342 (M+H) + .

[0482] Example 60 (R)-N-((8-fluoroquinoxalin-6-yl)methyl)-4-(2-methylpiperazin-1-yl)pyridin-3-amine (Compound 065) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.89 (d, J = 5.60 Hz, 2H), 8.01 (br d, J = 4.00 Hz, 1H), 7.90 (s, 2H), 7.49 (d, J = 10.40 Hz, 1H), 6.98 (d, J = 4.80 Hz, 1H), 5.38 (br t, J = 5.60 Hz, 1H), 4.67 (t, J = 5.60 Hz, 2H), 3.33-2.88 (m, 5H), 2.68 (br d, J = 10.00 Hz, 2H), 0.94 (d, J = 6.00 Hz, 3H).MS (ES+) m / e 353 (M+H) + .

[0483] Example 61 (R)-N-((8-chloroquinoxalin-6-yl)methyl)-4-(2-methylpiperazin-1-yl)pyridin-3-amine (Compound 066) [ka] 1 H NMR (400 MHz, CDCl3) δ 8.95 (d, J = 1.60 Hz, 1H), 8.90 (d, J = 2.00 Hz, 1H), 8.07-7.97 (m, 2H), 7.95-7.86 (m, 2H), 6.99 (br d, J = 4.80 Hz, 1H), 5.37 (br t, J = 5.20 Hz, 1H), 4.67 (t, J = 5.20 Hz, 2H), 3.41-3.26 (m, 1H), 3.25-2.96 (m, 4H), 2.84-2.66 (m, 2H), 1.02-0.92 (m, 3H).MS (ES+) m / e 369 (M+H) + .

[0484] Example 62 N-((5-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 067) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.74 (s, 2H), 9.03 (s, 2H), 8.12 (d, J = 6.4 Hz, 1H), 7.94 (d, J = 8.8 Hz, 1H), 7.82-7.87 (m, 2H), 7.41 (d, J = 6.4 Hz, 1H), 6.79 (s, 1H), 4.78 (d, J = 4 Hz, 2H), 3.49 (s, 4H), 3.39 (s, 4H).MS (ES+) m / e 339 (M+H) + .

[0485] Example 63 N-((8-methylquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 068) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 15.8 - 14.5 (m, 1H), 9.77 (s, 2H), 9.08 (d, J = 6.4 Hz, 2H), 8.55 (s, 1H), 8.15 (d, J = 6.4 Hz, 1H), 8.02 (s, MS (ES+) m / e 335 (M+H) + .

[0486] Example 64 N-((7-methylquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 069) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.61 (br d, J = 2.1 Hz, 1H), 8.88 (d, J = 1.8 Hz, 1H), 8.82 (d, J = 1.8 Hz, 1H), 8.12 (d, J = 6.4 Hz, 1H), 7.98 (s, 1H), 7.78 (s, 1H), 7.70 (s, 1H), 7.45 (d, J = 6.2 Hz, 1H), 6.75 (br t, J = 5.4 Hz, 1H), 4.68 (br d, J = 5.0 Hz, 2H), 3.52 (br d, J = 4.9 Hz, 4H), 3.41 (br s, 4H), 3.16 (s, 2H), 2.62 (s, 3H).MS (ES+) m / e 335 (M+H) + .

[0487] Example 65 N-((7,8-dimethylquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 070) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.68 (dd, J1= 14.8 Hz, J1= 1.6 Hz 2H), 8.00 (d, J = 6.4 Hz, 1H), 7.60 (s, 1H), 7.98 (s, 1H), 7.50 (s, 1H), 7.42 (d, J = 6.4 Hz, 1H), 4.60 (s, 2H), 3.60-3.54 (m, 8H), 2.48 (s, 3H), 2.38 (s, 3H).MS (ES+) m / e 349 (M+H)+.

[0488] Example 66 N-((8-methoxyquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 071) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 14.65 - 15.30 (m, 1 H) 9.74 (br s, 2 H) 8.73 - 9.07 (m, 2 H) 8.08 (br d, J=6 Hz, 1 H) 7.78 (s, 1 H) 7.55 (s, 1 H) 7.40 (br d, J=4.89 Hz, 2 H) 6.87 (br s, 1 H) 4.71 (br s, 2 H) 4.01 (s, 3 H) 3.34 - 3.62 (m, 8 H).MS (ES+) m / e 351 (M+H) + .

[0489] Example 67 N-((7-methoxyquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 072) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.79 (s, 2H), 8.84 (s, 1H), 8.73 (s, 1H), 8.09 (d, J = 6 Hz, 1H), 7.75 (d, J = 9.2 Hz, 2H),7.54 (s, 1H), 7.42 (d, J = 6 Hz, 1H), 6.73 (br s, 1H), 4.64 (s, 2H), 3.51 (s, 4H), 3.40 (s, 4H).MS (ES+) m / e 351 (M+H) + .

[0490] Example 68 5-Fluoro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 073) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.77 (br s, 2H), 8.93 (s, 2H), 8.34 (d, J = 5.0 Hz, 1H), 8.14 - 8.02 (m, 2H), 7.92 (dd, J = 1.6, 8.6 Hz, 1H), 7.81 (s, 1H), 7.45 - 7.16 (m, 1H), 4.81 (s, 2H), 3.66 - 3.22 (m, 9H).MS (ES+) m / e 339 (M+H) + .

[0491] Example 69 5-Bromo-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 074) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.03 - 8.88 (m, 2H), 8.28 (d, J = 1.0 Hz, 1H), 8.17 (d, J = 8.6 Hz, 1H), 8.09 (d, J = 1.0 Hz, 1H), 8.02 - 7.96 (m, 1H), 7.92 (d, J = 0.9 Hz, 1H), 4.91 - 4.91 (m, 2H), 3.74 (br s, 4H), 3.62 (br s, 4H).MS (ES+) m / e 390 (M+H) + .

[0492] Example 70 5-Methoxy-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 075) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.57 (br d, J = 3.1 Hz, 2H), 8.92 (s, 2H), 8.09 (d, J = 8.7 Hz, 1H), 8.03 (s, 1H), 7.96 (s, 1H), 7.90 (dd, J = 1.8, 8.7 Hz, 1H), 7.72 (s, 1H), 7.28 (br s, 1H), 4.79 (br s, 2H), 3.93 (s, 3H), 3.37 (br s, 8H).MS (ES+) m / e 351 (M+H) + .

[0493] Example 71 5-(Difluoromethyl)-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 076) [ka] 1H NMR (400 MHz, DMSO-d6) δ 9.67 (br s, 2 H) 8.93 (s, 2 H) 8.22 (s, 1 H) 8.06 - 8.12 (m, 2 H) 8.04 (s, 1 H) 7.93 (dd, J=8.62, 1.77 Hz, 1 H) 7.26 - 7.63 (m, 1 H) 7.18 (br s, 1 H) 4.84 (br s, 2 H) 3.40 - 3.52 (m, 8 H).MS (ES+) m / e 371 (M+H) + .

[0494] Example 72 5-Chloro-N-((8-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 077) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.84-9.38 (m, 2H), 9.01 (d, J = 1.6 Hz, 1H), 8.97 (d, J = 1.6 Hz, 1H), 8.13 (s, 1H), 7.94 (s, 1H), 7.88 (s, 1H), 7.80 (d, J = 11.2 Hz, 1H), 7.54-7.12 (m, 1H), 4.78 (s, 2H), 3.45 (br s, 8H).MS (ES+) m / e 373 (M+H) + .

[0495] Example 73 5-Chloro-N-((5-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 078) [ka] 1H NMR (400 MHz, DMSO-d6) δ 8.84-8.87 (m, 2H), 8.06 (s, 1H), 7.78-7.80 (m, 3H), 4.81 (s, 2H), 3.64 (s, 4H), 3.49 - 3.52 (m, 4H).MS (ES+) m / e 373 (M+H) + .

[0496] Example 74 5-Fluoro-N-((5-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 079) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.36 (s, 2H), 9.03 (s, 2H), 8.19 (d, J = 4.0 Hz, 1H), 7.93 (d, J = 8.8 Hz, 1H), 7.86 (d, J = 7.6 Hz, 1H), 7.83 (s, 1H), 6.94 (s, 1H), 4.80 (s, 2H), 3.38 (s, 8H).MS (ES+) m / e 357 (M+H) + .

[0497] Example 75 5-Fluoro-N-((8-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 080) [ka] 1H NMR (400 MHz, DMSO-d6) δ 9.77 (s, 2 H), 9.01 (d, J = 1.6 Hz, 1 H), 8.97 (s, 1H), 8.35 (d, J = 5.2 Hz, 1H), 7.94(s, 1 H), 7.80 -7.83 (m, 2H), 7.33 (s, 1 H), 4.79 (s, 2H), 3.49 (s, 4 H), 3.41(s, 4H).MS (ES+) m / e 357 (M+H) + .

[0498] Example 76 N-((8-chloroquinoxalin-6-yl)methyl)-5-fluoro-4-(piperazin-1-yl)pyridin-3-amine (Compound 081) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.73 (s, 2H), 9.03 (d, J = 6.4 Hz, 2H), 8.33 (d, J = 5.2 Hz, 1H), 8.16 (d, J = 1.2 Hz, 1H), 8.04 (s, 1H), 7.85 (s, 1H), 7.29 (s, 1H), 4.80 (s, 2H), 3.48-3.41 (m, 8H).MS (ES+) m / e 373 (M+H) + .

[0499] Example 77 5-Fluoro-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 082) [ka] 1H NMR (400 MHz, DMSO-d6) δ 9.69 (br s, 2H), 8.93 (dd, J = 1.8, 15.9 Hz, 2H), 8.38 (d, J = 5.0 Hz, 1H), 8.02 - 7.88 (m, 3H), 7.22 - 7.06 (m, 1H), 4.82 (br s, 2H), 3.56 - 3.31 (m, 8H).MS (ES+) m / e 357 (M+H)+.

[0500] Example 78 N-((7-chloroquinoxalin-6-yl)methyl)-5-fluoro-4-(piperazin-1-yl)pyridin-3-amine (Compound 083) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.62 (br s, 2H), 8.96 (dd, J = 1.7, 10.4 Hz, 2H), 8.36 (d, J = 4.8 Hz, 1H), 8.30 - 8.30 (m, 1H), 8.31 (s, 1H), 7.96 (s, 1H), 7.89 (s, 1H), 7.12 (br s, 1H), 4.79 (br s, 2H), 3.50 (br s, 4H), 3.38 (br s, 4H) MS (ES+) m / e 373 (M+H) + .

[0501] Example 79 N-((8-fluoroquinoxalin-6-yl)methyl)-5-methyl-4-(piperazin-1-yl)pyridin-3-amine (Compound 084) [ka] 1H NMR (400 MHz, DMSO-d6) δ 9.74 (br d, J = 1.8 Hz, 2H), 9.07 - 8.92 (m, 2H), 8.04 - 7.88 (m, 2H), 7.81 (br d, J = 7.8 Hz, 2H), 7.18 (br s, 1H), 4.77 (br s, 2H), 3.46 (br s, 9H), 2.45 - 2.34 (m, 3H).MS (ES+) m / e 353 (M+H) + .

[0502] Example 80 N-((8-chloroquinoxalin-6-yl)methyl)-5-methyl-4-(piperazin-1-yl)pyridin-3-amine (Compound 085) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.90 (s, 2H), 9.01 - 9.03 (m, 2H), 8.15-8.17 (m, 1H), 8.00-8.02 (s, 1H), 7.95-7.95 (m, 1H), 7.82 - 7.784 (m, 1H), 7.24 (s, 1H), 4.78 (s, 2H), 3.47 (s, 8H), 2.39 - 2.42 (m, 3H).MS (ES+) m / e 369 (M+H) + .

[0503] Example 81 N-((7-fluoroquinoxalin-6-yl)methyl)-5-methyl-4-(piperazin-1-yl)pyridin-3-amine (Compound 086) [ka] 1H NMR (400 MHz, DMSO-d6) δ 15.86 - 15.10 (m, 1H), 9.74 (br s, 2H), 8.92 (dd, J = 1.7, 17.6 Hz, 2H), 8.09 - 7.81 (m, 4H), 7.03 (br s, 1H), 4.80 (br d, J = 3.9 Hz, 2H), 3.61 - 3.22 (m, 8H), 2.42 (s, 3H).MS (ES+) m / e 353 (M+H) + .

[0504] Example 82 N-((7-chloroquinoxalin-6-yl)methyl)-5-methyl-4-(piperazin-1-yl)pyridin-3-amine (Compound 087) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.82 - 9.44 (m, 2H), 8.96 (dd, J = 1.9, 12.6 Hz, 2H), 8.31 (s, 1H), 8.03 (s, 1H), 7.90 (d, J = 3.8 Hz, 2H), 7.00 (br t, J = 5.4 Hz, 1H), 4.77 (br d, J = 5.0 Hz, 2H), 3.59 - 3.30 (m, 8H), 2.44 (s, 3H).MS (ES + ) m / e 369 (M+H) + .

[0505] Example 83 4-(1,4-diazepan-1-yl)-N-((8-fluoroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 088) [ka] 1H NMR (400 MHz, DMSO-d6) δ 14.99 (s, 1H), 9.88 (s, 2H), 8.98 (d, J = 16 Hz, 2H), 8.02 (d, J = 6 Hz, 1H), 7.95 (s, 1H), 7.85 (d, J = 10.8 Hz, 1H), 7.74 (s, 1H), 7.33 (d, J = 6.4 Hz, 1H), 4.68 (s, 2H), 3.81 (s, 2H), 3.55 (s, 2H), 3.37 (s, 2H), 3.29 (s, 2H), 2.20 (s, 2H).MS (ES+) m / e 353 (M+H) + .

[0506] Example 84 N-((8-chloroquinoxalin-6-yl)methyl)-4-(1,4-diazepan-1-yl)pyridin-3-amine (Compound 089) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.00 - 8.94 (m, 2H), 8.11 (d, J = 1.8 Hz, 1H), 8.07 (d, J = 1.5 Hz, 1H), 8.03 (dd, J = 1.1, 6.5 Hz, 1H), 7.79 (d, J = 1.0 Hz, 1H), 7.43 (d, J = 6.5 Hz, 1H), 4.75 (s, 2H), 4.01 - 3.92 (m, 2H), 3.77 - 3.69 (m, 2H), 3.63 - 3.55 (m, 2H), 3.53 - 3.45 (m, 2H), 2.38 - 2.30 (m, 2H).MS (ES+) m / e 369 (M+H) + .

[0507] Example 85 4-(1,4-diazepan-1-yl)-N-((7-fluoroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 090) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 15.05 - 14.55 (m, 1H), 9.69 (br s, 2H), 8.93 (dd, J = 2.0, 15.6 Hz, 2H), 8.06 (dd, J = 7.2, 17.2 Hz, 2H), 7.95 (d, J = 10.8 Hz, 1H), 7.88 (s, 1H), 7.36 (d, J = 6.4 Hz, 1H), 6.68 (br s, 1H), 4.69 (br s, 2H), 3.93 - 3.76 (m, 2H), 3.57 (br t, J = 5.6 Hz, 2H), 3.41 - 3.18 (m, 4H), 2.18 (s, 2H).MS (ES+) m / e 284 (M+H) + .

[0508] Example 86 N-((7-クロロキノキサリン-6-イル)メチル)-4-(1,4-ジアゼパン-1-イル)ピリジン-3-アミン (Compound 091)

change

[0509] Example 87 4-(1,4-diazepan-1-yl)-5-fluoro-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 092) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.85 (br s, 2 H) 8.92 (q, J=1.83 Hz, 2 H) 8.30 (d, J=4.28 Hz, 1 H) 8.09 (dd, J=4.83, 3.61 Hz, 2 H) 7.97 (dd, J=8.68, 1.83 Hz, 1 H) 7.83 (s, 1 H) 4.82 (s, 2 H) 3.57 (br d, J=4.40 Hz, 2 H) 3.26 - 3.39 (m, 6 H) 2.21 (br s, 2 H).MS (ES+) m / e 353 (M+H) + .

[0510] Example 88 5-chloro-4-(1,4-diazepan-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 093) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.19-9.80 (m, 2H), 8.93-8.90 (m, 2H), 8.22 (s, 1H), 8.08 (d, J = 8.8 Hz, 2H), 7.97 (dd, J = 1.6, 8.7 Hz, 1H), 7.92 (s, 1H), 4.86 (s, 2H), 3.57 (br t, J = 5.2 Hz, 2H), 3.30 (br s, 6H), 2.24 (br s, 2H).MS (ES+) m / e 369 (M+H) + .

[0511] Example 89 4-(1,4-diazepan-1-yl)-5-methyl-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 094) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 14.77 (s, 1H), 10.33 - 9.60 (m, 2H), 8.91 (s, 2H), 8.11 - 8.03 (m, 2H), 7.99 - 7.91 (m, 2H), 7.78 (s, 1H), 7.62 (br t, J = 5.6 Hz, 1H), 7.70 - 7.51 (m, 1H), 5.05 (br s, 8H), 4.82 (br d, J = 4.8 Hz, 2H), 3.53 (br t, J = 5.1 Hz, 2H), 2.34 (s, 3H).MS (ES+) m / e 349 (M+H) + .

[0512] Example 90 4-(1,4-diazepan-1-yl)-5-fluoro-N-((8-fluoroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 095) [ka] 1 H NMR (400 MHz, D2O) δ 8.81 - 8.96 (m, 2 H) 8.02 (d, J=4.77 Hz, 1 H) 7.82 (br s, 1 H) 7.55 - 7.70 (m, 2 H) 4.86 - 4.96 (m, 2 H) 3.68 - 3.83 (m, 2 H) 3.50 (q, J=5.50 Hz, 6 H) 2.23 (quin, J=5.59 Hz, 2 H).MS (ES+) m / e 371 (M+H) + .

[0513] Example 91 N-((7-chloroquinoxalin-6-yl)methyl)-4-(1,4-diazepan-1-yl)-5-fluoropyridin-3-amine (Compound 096) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.83 (dd, J=9.17, 1.83 Hz, 2 H) 8.21 (s, 1 H) 8.03 (br d, J=1.22 Hz, 1 H) 7.89 (s, 1 H) 7.60 - 7.71 (m, 1 H) 4.72 (s, 1 H) 4.70 - 4.73 (m, 1 H) 3.60 (br s, 2 H) 3.34 (br d, J=5.50 Hz, 6 H) 2.00 - 2.18 (m, 1 H) 1.99 - 2.20 (m, 1 H).MS (ES+) m / e 387 (M+H) + .

[0514] Example 92 4-((1S,4S)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-N-((7-chloroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 097) [ka] 1H NMR (400 MHz, DMSO-d6) δ 8.93 (dd, J = 1.6, 9.2 Hz, 2H), 8.27 (s, 1H), 8.02 (s, 1H), 7.71 (d, J = 5.4 Hz, 1H), 7.49 (s, 1H), 6.67 (d, J = 5.2 Hz, 1H), 5.30 (br t, J = 6.0 Hz, 1H), 4.56 (br dd, J = 6.0, 9.6 Hz, 2H), 4.28 (s, 1H), 3.70 (dd, J = 2.0, 8.8 Hz, 1H), 3.61 (br s, 1H), 3.15 (br d, J = 8.8 Hz, MS (ES+) m / e 467 (M+H) + .

[0515] Example 93 4-((1R,4R)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-N-((7-chloroquinoxalin-6-yl)methyl)pyridin-3-amine (Compound 098) [ka] 1H NMR (400 MHz, CD3OD) δ 8.91 (dd, J = 1.8, 10.4 Hz, 2H), 8.26 (s, 1H), 8.12 (s, 1H), 8.04 - 7.95 (m, 1H), 7.77 - 7.67 (m, 1H), 7.26 - 7.14 (m, 1H), 5.14 (s, 1H), 4.87 - 4.86 (m, 2H), 4.78 - 4.58 (m, 3H), 4.30 (dd, J = 2.6, 11.7 Hz, 1H), 3.93 (dd, J = 1.2, 11.6 Hz, 1H), 3.73 - 3.63 (m, 1H), 3.57 - 3.48 (m, 1H), 2.40 (br d, J = 11.7 Hz, 1H), 2.28 - 2.13 (m, 1H).MS (ES+) m / e 367 (M+H) + .

[0516] Example 94 N-((7-chloroquinoxalin-6-yl)methyl)-4-(hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)pyridin-3-amine (Compound 099) [ka] 1 H NMR (400 MHz, D2O) δ 8.88 - 8.77 (m, 2H), 8.15 (s, 1H), 7.93 (s, 1H), 7.89 - 7.81 (m, 1H), 7.51 (s, 1H), 7.03 (br d, J = 6.7 Hz, 1H), 4.64 (s, 2H), 3.80 (br s, 4H), 3.64 (br d, J = 4.6 Hz, 2H), 3.33 (br d, J = 8.6 Hz, 4H).MS (ES+) m / e 381 (M+H) + .

[0517] Example 95 (R)—N-((7-fluoroquinoxalin-6-yl)methyl)-4-(2-methylpiperazin-1-yl)pyridin-3-amine (Compound 100) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.79 - 10.02 (m, 2 H), 8.94 (d, J = 1.6 Hz, 1 H), 8.90 (s, 1 H), 8.10 (d, J = 6 Hz, 1 H), 7.99 (s, 1 H), 7.95 (d, J = 10.8 Hz, 1 H), 7.87 (d, J = 8Hz, 1 H), 7.53 (d, J = 6 Hz, 1 H), 7.09 (s, 1 H), 4.45 - 4.87 (m, 2 H), 4.06 (s, 1 H), 3.61 - 3.51 (m, 1 H), 3.46 - 3.49 (m, 2 H), 3.16 - 3.22 (m, 2 H), 3.14 (d, J = 6 Hz, 1 H), 1.10 (d, J = 6 Hz, 3 H).MS (ES+) m / e 353 (M+H) + .

[0518] Example 96 (S)—N-((8-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 101) [ka] 1H NMR (400 MHz, DMSO-d6) δ 15.19 (s, 1H), 10.18 (d, J = 8.4 Hz, 1H), 9.80 (d, J = 8.8 Hz, 1H), 9.00 - 9.00 (m, 1H), 9.02 (d, J = 2.8 Hz, 1H), 8.16 (d, J = 1.6 Hz, 1H), 8.10 - 8.00 (m, 2H), 7.85 (s, 1H), 7.39 (d, J = 6.4 Hz, 1H), 6.93 (br s, 1H), 4.93 - 4.62 (m, 2H), 3.92 - 3.61 (m, 3H), 3.56 - 3.35 (m, 2H), 3.33 - 3.20 (m, 1H), 3.14 - 3.00 (m, 1H), 1.36 (d, J = 6.3 Hz, 3H).MS (ES+) m / e 369 (M+H) + .

[0519] Example 97 (S)—N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 102) [ka] 1H NMR (400 MHz, DMSO-d6) 15.1 (s, 1H), 10.0 - 10.1 (m, 1H), 9.64 (s, 1H), 8.95 (d, J = 1.6 Hz, 1H), 8.91 (d, J = 1.6 Hz, 1H), 8.12 (d, J = 6.4 Hz, 1H), 7.98 - 7.94 (m, 3H), 7.44 (d, J = 6.4 Hz, 1H), 6.75 (t, J = 6.4 Hz, 1H), 4.78 (d, J = 3.6 Hz, 2H), 3.78 - 3.75 (m, 2H), 3.66 - 3.62 (m, 1H), 3.42 (m, 2H), 3.33 - 3.23 (m, 1H), 3.09 - 3.04 (m, 1H), 1.34 (d, J = 6.4 Hz, 3H).MS (ES+) m / e 353 (M+H) + .

[0520] Example 98 (S)-5-フルオロ-4-(3-メチルピペラジン-1-イル)-N- (キノキサリン-6-イルメチル)ピリジン-3-アミン (Compound 103)

change

[0521] Example 99 (S)-5-Methyl-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 104) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 15.80 - 14.91 (m, 1H), 10.10 (br d, J = 9.5 Hz, 1H), 9.64 - 9.32 (m, 1H), 8.92 (s, 2H), 8.18 - 8.02 (m, 2H), 7.98 - 7.88 (m, 2H), 7.80 (s, 1H), 7.09 (br s, 1H), 4.78 (br s, 2H), 3.92 - 3.76 (m, 2H), 3.42 (br t, J = 11.6 Hz, 1H), 3.36 - 3.18 (m, 3H), 2.40 (s, 3H), 1.32 (br d, J = 6.4 Hz, 3H).MS (ES+) m / e 349 (M+H) + .

[0522] Example 100 (R)—N-((8-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 105) [ka] 1H NMR (400 MHz, DMSO-d6) δ 15.16 (br s, 1 H) 10.47 (br s, 1 H) 9.90 (br d, J=1.96 Hz, 1 H) 8.88 - 9.08 (m, 2 H) 8.11 (br d, J=6.24 Hz, 1 H) 7.99 (s, 1 H) 7.75 - 7.96 (m, 3 H) 7.47 - 7.58 (m, 1 H) 5.65 (br s, 1 H) 4.71 (br s, 2 H) 3.61 - 3.75 (m, 1 H) 3.31 - 3.55 (m, 3 H) 2.19 - 2.32 (m, 2 H).MS (ES+) m / e 340 (M+H) + .

[0523] Example 101 (R)—N-((8-chloroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 106) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 15.00 (br d, J=3.18 Hz, 1 H) 10.41 (br s, 1 H) 9.75 (br d, J=2.45 Hz, 1 H) 9.02 (q, J=1.79 Hz, 2 H) 8.21 (d, J=1.71 Hz, 1 H) 8.06 - 8.16 (m, 2 H) 7.78 - 7.97 (m, 2 H) 7.54 (d, J=6.48 Hz, 1 H) 5.64 (br s, 1 H) 4.72 (br s, 2 H) 3.69 (br dd, J=12.35, 4.89 Hz, 1 H) 3.47 - 3.54 (m, 1 H) 3.32 - 3.45 (m, 2 H) 2.20 - 2.34 (m, 2 H).MS (ES+) m / e 356 (M+H) + .

[0524] Example 102 (R)—N-((7-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 107) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.04 (s, 1H), 9.99 (s, 1H), 8.89-9.93 (m, 2H), 8.15 (d, J = 6.4 Hz, 1H), 7.91-7.94 (m, 3H), 7.72 (s, 1H), 7.58 (d, J = 6.4 Hz, 1H), 5.66 (s, 1H), 4.71 - 4.80 (m, 2H), 3.65-3.68 (m, 1H), 3.39-3.50 (m, 3H), 2.27-2.32 (m, 2H).MS (ES+) m / e 340 (M+H) + .

[0525] Example 103 (R)—N-((7-chloroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 108) [ka] 1H NMR (400 MHz, DMSO-d6) δ 14.98 - 15.25 (m, 1 H) 10.36 (br s, 1 H) 9.85 (br s, 1 H) 8.75 - 9.17 (m, 1 H) 8.94 (dd, J=13.02, 1.77 Hz, 1 H) 8.28 (s, 1 H) 8.17 (d, J=6.36 Hz, 1 H) 7.85 (d, J=12.10 Hz, 2 H) 7.75 (br s, 1 H) 7.68 - 7.81 (m, 1 H) 7.60 (d, J=6.48 Hz, 1 H) 5.67 (br s, 1 H) 4.64 - 4.84 (m, 2 H) 3.68 (br dd, J=12.53, 5.07 Hz, 1 H) 3.49 (td, J=8.07, 3.91 Hz, 1 H) 3.33 - 3.44 (m, 2 H) 2.21 - 2.39 (m, 2 H).MS (ES+) m / e 356 (M+H) + .

[0526] Example 104 (R)-5-Fluoro-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 109) [ka] 1H NMR (400 MHz, DMSO-d6) δ 10.50 (br s, 1H), 9.76 (br d, J = 1.7 Hz, 1H), 8.92 (q, J = 1.8 Hz, 2H), 8.40 (d, J = 5.4 Hz, 1H), 8.12 (d, J = 1.0 Hz, 1H), 8.09 (d, J = 8.7 Hz, 1H), 8.02 - 7.95 (m, 1H), 7.87 (s, 1H), 5.74 (br d, J = 3.1 Hz, 1H), 4.77 (s, 2H), 3.72 (br dd, J = 5.9, 13.0Hz, 2H), 3.52 - 3.35 (m, 4H), 2.34 - 2.22 (m, 2H).MS (ES+) m / e 340 (M+H) + .

[0527] Example 105 (R)-5-chloro-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 110) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.60 - 10.28 (m, 1H), 9.78 - 9.52 (m, 1H), 8.92 (q, J = 1.8 Hz, 2H), 8.22 (s, 1H), 8.15 - 8.05 (m, 2H), 7.97 (s, 2H), 5.59 (br s, 1H), 4.78 (br s, 2H), 3.66 (br dd, J = 5.8, 13.4 Hz, 1H), 3.58 - 3.32 (m, 3H), 2.31 - 2.15 (m, 2H).MS (ES+) m / e 356 (M+H) + .

[0528] Example 106 (R)-5-Methyl-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 111) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.61 (br s, 1 H) 10.44 - 10.80 (m, 1 H) 9.61 - 10.04 (m, 1 H) 9.59 - 9.87 (m, 1 H) 9.59 - 10.02 (m, 1 H) 8.92 (br s, 2 H) 8.06 - 8.12 (m, 1 H) 8.05 - 8.15 (m, 1 H) 7.96 - 8.05 (m, 1 H) 7.95 - 8.00 (m, 1 H) 7.87 - 7.93 (m, 1 H) 7.87 - 7.92 (m, 1 H) 7.80 - 7.93 (m, 1 H) 7.85 (br s, 1 H) 5.35 - 5.48 (m, 1 H) 5.42 (br s, 1 H) 4.76 - 4.77 (m, 1 H) 4.77 (br s, 1 H) 3.32 - 3.70 (m, 4 H) 2.38 (s, 1 H) 2.34 - 2.42 (m, 1 H) 2.22 (br s, 2 H).MS (ES+) m / e 336 (M+H) + .

[0529] Example 107 4-(Azetidin-3-yloxy)-5-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 112) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.87 (s, 2H), 8.17 - 8.09 (m, 2H), 8.03 (s, 1H), 7.91-7.86 (m, 2H), 5.44 - 5.30 (m, 1H), 4.79 (s, 2H), 4.70 - 4.62 (m, 2H), 4.61 - 4.51 (m, 2H).MS (ES+) m / e 388 (M+H) + .

[0530] Example 108 4-(azetidin-3-yloxy)-5-methyl-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 113) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.39 - 9.10 (m, 1H), 9.04 - 8.76 (m, 3H), 8.11 (d, J = 8.6 Hz, 1H), 8.06 - 8.00 (m, 2H), 7.95 (s, 1H), 7.88 (dd, J = 1.9, 8.8 Hz, 1H), 7.25 (br s, 1H), 5.20 (quin, J = 6.2 Hz, 1H), 4.74 (br d, J = 4.9 Hz, 2H), 4.40 (br dd, J = 5.4, 11.8 Hz, 5H), 2.27 (s, 3H).MS (ES+) m / e 322 (M+H) + .

[0531] Example 109 4-(Piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-1H-pyrrolo[2,3-b]pyridin-5-amine (Compound 114) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 12.1 (s, 1H), 9.53 (s, 2H), 8.92 (s, 2H), 8.11 - 8.08 (m, 2H), 7.95 (d, J = 8.4 Hz, 1H), 7.58 (s, 1H), 7.50 (s, 1H), 6.74 (s, 1H), 4.69 (s, 2H), 3.66 (s, 8H).MS (ES+) m / e 360 ​​(M+H) + .

[0532] Example 110 4-(Piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)quinolin-3-amine (Compound 115) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.72 (s, 2H), 8.90 (s, 2H), 8.65 (s, 1H), 8.19 (d, J = 8.0 Hz, 1H), 8.14 (d, J = 7.2 Hz, 1H), 8.08 (d, J = 8.8 Hz, 2H), 7.96 (d, J = 8.8 Hz, 1H), 7.71-7.68 (m, 2H), 7.17 (s, 1H), 4.94 (s, 2H), 3.69 (s, 8H).MS (ES+) m / e 371 (M+H) + .

[0533] Example 111 6-Methoxy-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 116) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.87 (s, 2 H), 8.92 (s, 2 H), 8.08 (d, J = 8.4, 1 H), 8.04 (s, 1 H), 7.91 (d, J = 8.8, 1 H), 7.15 (s, 1 H), 6.78 (s, 1 H), 4.63 (s, 3 H), 4.00 (s, 3 H), 3.59 (s, 4 H), 3.39 (s, 4 H).MS (ES+) m / e 351 (M+H) + .

[0534] Example 112 4-(Piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 117) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 9.60 (s, 2H), 8.91 (s, 2H), 8.09 (d, J = 8.8 Hz, 2H), 8.03 (s, 1H), 7.90 (d, J = 1.6 Hz, 1H), 7.86 (s, 1H), 7.26 (m, 1H), 4.78 (s, 2H), 3.37 (s, 4H), 3.24 (s, 4H).MS (ES+) m / e 389 (M+H) + .

[0535] Example 113 6-Methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 118) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 8.89 (s, 2 H), 8.07 (d, J = 8.8 Hz, 2 H), 8.95 (s, 2 H),7.97 (s, 1 H), 7.87 (d, J = 8.4 Hz, 1 H), 7.53 (s, 1 H), 6.71 (s, 1 H), 5.46 (s, 1 H), 4.64 (d, J = 6 Hz, 2 H), 2.89 - 3.24 (m, 8 H), 2.23 (s, 3 H).MS (ES+) m / e 335 (M+H) + .

[0536] Example 114 (R)-5-chloro-N-((8-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 119) [ka] 1H NMR (400 MHz, DMSO-d6) δ 10.45 (s, 1 H), 9.63 (s, 1 H), 8.98 (d, J = 15.6 Hz, 2 H), 8.17 (s, 1 H), 7.99 (s, 1 H), 7.97 (s, 1 H), 7.88 (d, J = 9.6 Hz, 1H), 7.76(s, 1H), 5.55 (s, 1H), 4.79 (s, 3H), 3.64 - 3.68 (m, 1H), 3.41 - 3.45 (m, 3H), 2.51 (m, 1H), 2.26 -2.29 (m, 2H).MS (ES+) m / e 374 (M+H) + .

[0537] Example 115 (R)-5-chloro-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 120) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.24 (s, 1 H), 9.55 (s, 1H), 8.92 (d, J = 14 Hz, 2H), 8.14 (s, 1H), 7.92 7.98 (m, 3H), 7.41(s, 1H), 5.49 (s, 1H), 4.75 (s, 2H), 3.50 - 3.67 (m, 1H), 3.38 - 3.45 (m, 3H), 2.52 (m, 1H), 2.25 -2.28 (m, 2H).MS (ES+) m / e 374 (M+H) + .

[0538] Example 116 (R)-5-chloro-N-((7-chloroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 121) [ka] 1H NMR (400 MHz, CDCl3) δ 8.77 - 8.78 (m, 2 H), 8.17 (d, J = 0.8 Hz, 1 H), 8.00 (s, 1 H), 7.82 (s, 1 H), 7.79 (s, 1 H), 5.86-5.88 (m, , 1 H), 4.75 - 4.80 (m, 3 H), 3.88 (d, J = 13.6 Hz, 1 H), 3.58 - 3.71 (m, 3 H), 2.43 - 2.49 (m, 2 H).MS (ES+) m / e 390 (M+H) + .

[0539] Example 117 (R)—N-((8-methylquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 122) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.53 - 10.28 (m, 1H), 9.91 - 9.65 (m, 1H), 8.91 (q, J = 2.0 Hz, 2H), 8.10 (d, J = 6.4 Hz, 1H), 7.89 (s, 1H), 7.81 (m, 3H), 7.53 (d, J = 6.4 Hz, 1H), 5.64 (m, 1H), 4.68 (m, 2H), 3.57 - 3.36 (m, 3H), 2.71 (s, 3H), 2.38 - 2.18 (m, 2H).MS (ES+) m / e 366 (M+H) + .

[0540] Example 118 (R)—N-((7-methylquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 123) [ka] 1H NMR (400 MHz, CD3OD) δ 8.98 (d, J = 2.0 Hz, 1H), 8.94 (d, J = 2.2 Hz, 1H), 8.11 (m, 1H), 8.05 (s, 1H), 8.00 (s, 1H), 7.78 (d, J = 1.2 Hz, 1H), 7.59 (d, J = 6.6 Hz, 1H), 5.74 (m, 1H), 4.81 (s, 2H), 3.92 (d, J = 13.2 Hz, 1H), 3.79 - 3.56 (m, 3H), 2.71 (s, 3H), 2.61 - 2.50 (m, 2H).MS (ES+) m / e 336 (M+H) + .

[0541] Example 119 (R)-4-(pyrrolidin-3-yloxy)-N-((8-(trifluoromethyl)quinoxalin-6-yl)methyl)pyridin-3-amine (Compound 124) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 10.62 - 10.21 (m, 1H), 9.77 - 9.57 (m, 1H), 9.07 (s, 2H), 8.47 (s, 1H), 8.36 (s, 1H), 8.13 (d, J = 6.2 Hz, 1H), 7.94 (s, 1H), 7.89 (br s, 1H), 7.54 (d, J = 6.5 Hz, 1H), 5.70 - 5.57 (m, 1H), 4.79 (br s, 2H), 3.68 (br dd, J = 4.8, 12.2 Hz, 1H), 3.57 - 3.33 (m, 3H), 2.33 - 2.21 (m, 2H).MS (ES+) m / e 389 (M+H) + .

[0542] Example 120 4-(Piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-5-(trifluoromethyl)pyridin-3-amine (Compound 125) [ka] 1 H NMR (400 MHz, MeOD) δ 8.94 (d, J = 1.8 Hz, 2H), 8.44 (s, 1H), 8.20-8.15 (m, 2H), 8.12 (s, 1H), 8.01 (dd, J = 1.6, 8.8 Hz, 1H), 4.97 (s, 2H), 3.64 (s, 8H), MS (ES+) m / z 389.3 (M+H) + .

[0543] Example 121 (S)-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-5-(trifluoromethyl)pyridin-3-amine (Compound 126) [ka] 1 H NMR (400 MHz, MeOD) δ 8.90 (s, 2H), 8.44 (s, 1H), 8.19-8.13 (m, 2H), 8.08 (s, 1H), 8.00-7.94 (m, 1H), 4.95 (s, 2H), 3.89 (dt, J1 = MS (ES+) m / z 403 (M+H) + .

[0544] Example 122 (S)-5-Methoxy-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 127) [ka] 1H NMR (400 MHz, MeOD) δ 9.04-8.82 (m, 2H), 8.15 (d, J = 8.8 Hz, 1H), 8.05 (s, 1H), 7.99-7.91 (m, 2H), 7.69 (s, 1H), 4.86-4.85 (m, 2H), 4.03 (s, 3H), 3.87-3.74 (m, 1H), 3.73-3.57 (m, 2H), 3.55-3.42 (m, 2H), 3.42-3.33 (m, 2H), 1.41 (d, J = 6.5 Hz, 3H), MS (ES+) m / z 365.3 (M+H) + .

[0545] Example 123 (S)-5-Bromo-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 128) [ka] 1 H NMR:(400 MHz, MeOD-d4) δ 8.94 (q, J = 2.0 Hz, 2H), 8.28 (d, J = 0.8 Hz, 1H), 8.16 (d, J = 8.8 Hz, 1H), 8.09 (s, 1H), 7.99 (dd, J = 1.8, 8.7 MS (ES+) m / z 415 (M+H) +

[0546] Example 124 (S)-5-(Difluoromethyl)-4-(3-methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 129) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.96 - 8.85 (m, 2H), 8.29 (s, 1H), 8.16 (d, J = 8.6 Hz, 1H), 8.07 (d, J = 15.5 Hz, 2H), 7.98 (dd, J = 1.8, 8.8 Hz, 1H), 7.33 (t, J = 54.2 Hz, 1H), 4.92 (s, 2H), 3.92 (ddd, J = 3.4, 6.6, 10.2 Hz, 1H), 3.81 - 3.70 (m, 1H), 3.68 - 3.58 (m, 3H), 3.56 - 3.45 (m, 2H), 1.43 (d, J = 6.5 Hz, 3H) MS (ES+) m / z 385 (M+H) +

[0547] Example 125 N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)-5-(trifluoromethyl)pyridin-3-amine (Compound 130) [ka] 1 H NMR (400 MHz, MeOD) δ 8.89 (dd, J = 1.8, 17.3 Hz, 2H), 8.48 (s, 1H), 8.30 (s, 1H), 8.08 (d, J = 7.8 Hz, 1H), 7.86 (d, J = 10.8 Hz, 1H), 5.00 (s, 2H), 3.63 (s, 8H), MS (ES+) m / e 407.3 (M+H) + .

[0548] Example 126 N-((7-fluoroquinoxalin-6-yl)methyl)-5-methoxy-4-(piperazin-1-yl)pyridin-3-amine (Compound 131) [ka] 1H NMR (400 MHz, MeOD) δ 8.87 (br d, J = 19.9 Hz, 2H), 8.03-7.96 (m, 2H), 7.87-7.79 (m, 2H), 4.89 (s, 2H), 4.05 (s, 3H), 3.53 (br s, 8H), MS (ES+) m / z 369.3 (M+H) + .

[0549] Example 127 N-((7-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)-5-(trifluoromethyl)pyridin-3-amine (Compound 132) [ka] 1 H NMR (400 MHz, MeOD) δ 8.91 (d, J = 1.6 Hz, 1H), 8.88 (d, J = 1.6 Hz, 1H), 8.44 (s, 1H), 8.28 (s, 1H), 8.19 (s, 1H), 8.04 (s, 1H), 4.97 (s, 2H), 3.60 (br d, J = 2.8 Hz, 8H).MS (ES+) m / z 423 (M+H) + .

[0550] Example 128 N-((7-chloroquinoxalin-6-yl)methyl)-5-methoxy-4-(piperazin-1-yl)pyridin-3-amine (Compound 133) [ka] 1 H NMR (400 MHz, MeOD δ 8.90 (dd, J = 1.8, 16.3 Hz, 2H), 8.25 (s, 1H), 7.99 (d, J = 5.5 Hz, 2H), 7.73 (s, 1H), 4.88-4.87 (m, 2H), 4.06 (s, 3H), 3.61-3.49 (m, 8H), MS (ES+) m / z 385.1 (M+H) + .

[0551] Example 129 5-Bromo-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 134) [ka] 1 H NMR:(400 MHz, MeOD-d4) δ 8.90 (d, J = 1.8 Hz, 1H), 8.86 (d, J = 1.8 Hz, 1H), 8.32 (d, J = 0.6 Hz, 1H), 8.08 - 7.99 (m, 2H), 7.86 (d, J = MS (ES+) m / z 417 (M+H) +

[0552] Example 130 5-(Difluoromethyl)-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 135) [ka] 1 H NMR (400 MHz, D2O) δ 8.92 (s, 1H), 8.89 (s, 1H), 8.32 (s, 1H), 8.13 - 8.03 (m, 2H), 7.88 (d, J = 10 Hz, 1H), 7.33 (t, J = 54 Hz, 1H), 4.95 (s, 2H), 3.61 (br d, J = 4.8 Hz, 8H).MS (ES + ) m / z 389 (M+H) + .

[0553] Example 131 5-Bromo-N-((7-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 136) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.92 (d, J = 1.8 Hz, 1H), 8.88 (d, J = 1.9 Hz, 1H), 8.32 (d, J = 0.8 Hz, 1H), 8.27 (s, 1H), 8.00 (s, 1H), 7.97 (s, 1H), 4.91 (s, 2H), 3.74 (br s, 4H), 3.58 (br t, J = 4.9 Hz, 4H) MS (ES+) m / z 345 (M+H) +

[0554] Example 132 N-((7-chloroquinoxalin-6-yl)methyl)-5-(difluoromethyl)-4-(piperazin-1-yl)pyridin-3-amine (Compound 137) [ka] 1 H NMR (400 MHz, D2O) δ 8.93 (d, J = 2.0 Hz, 1H), 8.90 (d, J = 2.0 Hz, 1H), 8.32 (s, 1H), 8.27 (s, 1H), 8.03 (d, J = 9.4 Hz, 2H), 7.35 (t, J = 54.0 Hz, 1H), 4.94 (s, 2H), 3.62 (s, 8H).MS (ES + ) m / z 405 (M+H) + .

[0555] Example 133 (S)-5-Fluoro-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 138) [ka] 1 H NMR (400 MHz, DMSO- d6) δ 10.22-10.06 (m, 1H), 9.49 (br d, J = 6.4 Hz, 1H), 8.95 (d, J = 2.0 Hz, 1H), 8.91 (d, J = 2.0 Hz, 1H), 8.35 (d, J = 4.8 Hz, 1H), 8.00 (d, J = 8.0 Hz, 1H), 7.98-7.94 (m, 2H), 4.82 (br s, 2H), 3.73-3.63 (m, 1H), 3.52-3.42 (m, 4H), 3.35 (br d, J = 2.8Hz, 1H), 3.31-3.23 (m, 1H), 1.30 (d, J = 6.8 Hz, 3H).MS (ES+) m / z 371 (M+H) +

[0556] Example 134 (S)-5-chloro-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 139) [ka] 1 H NMR (400 MHz, D2O) δ = 8.93 (d, J = 2.0 Hz, 1H), 8.89 (d, J = 1.8 Hz, 1H), 8.25 (d, J = 0.8 Hz, 1H), 8.08 (d, J = 7.6 Hz, 1H), 8.03 (s, 1H), 7.86 (d, J = 10.6 Hz, 1H), 4.97-4.94 (m, 2H), 3.99-3.86 (m, 2H), 3.79-3.63 (m, 2H), 3.61-3.47 (m, 3H), 1.43 (d, J = 6.6 Hz, 3H).MS (ES + ) m / z 387 (M+H) + .

[0557] Example 135 (S)-5-Bromo-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 140) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.90 (d, J = 1.6 Hz, 1H), 8.86 (d, J = 1.5 Hz, 1H), 8.32 (s, 1H), 8.07-8.01 (m, 2H), 7.86 (d, J = 10.8 Hz, 1H), 4.92 (s, 2H), 4.01 - 3.80 (m, 2H), 3.71 (br dd, J = 10.8, 13.1 Hz, 2H), 3.59-3.41 (m, 3H), 1.42 (d, J = 6.6 Hz, 3H) MS (ES+) m / z 432 (M+H)+

[0558] Example 136 (S)-5-(Difluoromethyl)-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 141) [ka] 1H NMR (400 MHz, MeOD) δ 8.90 (d, J = 1.6 Hz, 1H), 8.86 (d, J = 2.0 Hz, 1H), 8.32 (s, 1H), 8.18 (s, 1H), 8.07 (d, J = 8.0 Hz, 1H), 7.86 (d, J = 10.8 Hz, 1H), 7.51-7.19 (m, 1H), 4.95 (s, 2H), 3.94 (ddd, J1 = 3.2 Hz, J2 = 6.4 Hz, J3 = 10.4 Hz, 1H), 3.81-3.70 (m, 1H), 3.66-3.50 (m, 4H), 3.30-3.24 (m, 1H), 1.42 (d, J = 6.4 Hz, 3H).MS (ES+) m / z 403 (M+H) + .

[0559] Example 137 (S)—N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)-5-(trifluoromethyl)pyridin-3-amine (Compound 142) [ka]

[0560] Example 138 (S)—N-((7-fluoroquinoxalin-6-yl)methyl)-5-methoxy-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 143) [ka] 1H NMR (400 MHz, MeOD) δ 8.98-8.82 (m, 2H), 8.08-7.96 (m, 2H), 7.89-7.78 (m, 2H), 4.90 (br s, 2H), 4.05 (s, 3H), 3.80 (dt, J = 3.6, 6.6 3.74-3.59 (m, 2H), 3.53-3.44 (m, 2H), 3.41-3.32 (m, 2H), 1.40 (d, J = 6.6 Hz, 3H), MS (ES+) m / z 383.4 (M+H) + .

[0561] Example 139 (S)—N-((7-chloroquinoxalin-6-yl)methyl)-5-fluoro-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 144) [ka] 1 H NMR (400 MHz, MeOD- d4) δ 8.92 (d, J = 2.0 Hz, 1H), 8.88 (d, J = 2.0 Hz, 1H), 8.27 (s, 1H), 8.25 (d, J = 4.8 Hz, 1H), 8.02 (s, 1H), 7.88 (s, 1H), 4.90 (s, 2H), 3.78 (dt, J1 = 3.2 Hz, J2 = 6.8 Hz, 1H), 3.75-3.67 (m, 2H), 3.62-3.55 (m, 3H), 3.42-3.34 (m, 1H), 1.42 (d, J = 6.8 Hz, 3H).MS (ES+) m / z 387 (M+H) +

[0562] Example 140 (S)-5-chloro-N-((7-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 145) [ka] 1 H NMR (400 MHz, D2O) δ 8.91 (d, J = 1.8 Hz, 1H), 8.88 (d, J = 1.8 Hz, 1H), 8.26 (s, 1H), 8.19 (s, 1H), 8.02 (s, 1H), 7.92 (s, 1H), 4.90 (s, 2H), 3.91-3.78 (m, 2H), 3.71-3.55 (m, 3H), 3.55-3.47 (m, 2H), 1.42 (d, J = 6.6 Hz, 3H).MS (ES + ) m / z 403 (M+H) + .

[0563] Example 141 (S)-5-Bromo-N-((7-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 146) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.92 (d, J = 1.9 Hz, 1H), 8.88 (d, J = 1.9 Hz, 1H), 8.32 (d, J = 0.6 Hz, 1H), 8.26 (s, 1H), 8.01 (s, 1H), 7.97 (s, 1H), 4.92 (s, 2H), 4.02 - 3.92 (m, 1H), 3.86 (br dd, J = 3.4, 6.3 Hz, 1H), 3.73 (dd, J = 10.6, 13.1 Hz, 2H), 3.60 - 3.47 (m, 3H), 1.42 (d, J = 6.5 Hz, 3H) MS (ES+) m / z 449 (M+H) +

[0564] Example 142 (S)—N-((7-chloroquinoxalin-6-yl)methyl)-5-(difluoromethyl)-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 147) [ka] 1 H NMR (400 MHz, MeOD) δ 8.92 (d, J = 2.0 Hz, 1H), 8.88 (d, J = 2.0 Hz, 1H), 8.33 (s, 1H), 8.27 (s, 1H), 8.11 (s, 1H), 8.05 (s, 1H), 7.52-7.20 (m, 1H), 4.95 (s, 2H), 3.92 (ddd, J1 = 3.2 Hz, J2 = 6.6 Hz, J3 = 10.0 Hz, 1H), 3.80-3.71 (m, 1H), 3.69-3.61 (m, 2H), 3.60-3.51 (m, 2H), 3.26 (s, 1H), 1.42 (d, J = 6.4 Hz, 3H).MS (ES+) m / z 419 (M+H) + .

[0565] Example 143 (S)—N-((7-chloroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)-5-(trifluoromethyl)pyridin-3-amine (Compound 148) [ka]

[0566] Example 144 (S)—N-((7-chloroquinoxalin-6-yl)methyl)-5-methoxy-4-(3-methylpiperazin-1-yl)pyridin-3-amine (Compound 149) [ka] 1H NMR (400 MHz, MeOD) δ 8.91 (dd, J = 1.8, 16.5 Hz, 2H), 8.25 (s, 1H), 8.00 (s, 2H), 7.73 (s, 1H), 4.89 (s, 2H), 4.06 (s, 3H), 3.89-3.77 (m, 1H), 3.76-3.58 (m, 2H), 3.55-3.45 (m, 2H), 3.45-3.34 (m, 2H), 1.41 (d, J = 6.6 Hz, 3H), MS (ES+) m / z 399.1 (M+H) + .

[0567] Example 145 5-Fluoro-6-methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 150) [ka] 1 H NMR (400 MHz, MeOD) δ 9.08 (dd, J = 2.1, 10.5 Hz, 2H), 8.27-8.16 (m, 2H), 8.13-8.06 (m, 1H), 7.63 (s, 1H), 4.91 (s, 2H), 3.70 (br d, J = 3.6 Hz, 4H), 3.66-3.55 (m, 4H), 2.52 (d, J = 2.6 Hz, 3H).MS (ES+) m / z 353.2 (M+H) + .

[0568] Example 146 5-Chloro-6-methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 151) [ka] 1H NMR (400 MHz, MeOD) δ 9.05-8.98 (m, 2H), 8.20 (d, J = 8.8 Hz, 1H), 8.15 (s, 1H), 8.04 (dd, J = 1.8, 8.7 Hz, 1H), 7.71 (s, 1H), 4.90 (br m / z 369.2 (M+H), 3.71 (br s, 4H), 3.62 (br s, 4H), 2.60 (s, 3H), MS (ES+) + .

[0569] Example 147 5-Bromo-6-methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 152) [ka] 1 H NMR (400 MHz, MeOD) δ 9.02-8.91 (m, 2H), 8.17 (d, J = 8.8 Hz, 1H), 8.11 (d, J = 1.1 Hz, 1H), 8.01 (dd, J = 1.9, 8.6 Hz, 1H), 7.73 (s, 1H), 4.90-4.89 (m, 2H), 3.97-3.49 (m, 8H), 2.65 (s, 3H), MS (ES+) m / z 413.3 (M+H) + .

[0570] Example 148 5,6-Dimethyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 153) [ka] 1H NMR (400 MHz, MeOD) δ 9.07-8.90 (m, 2H), 8.19 (d, J = 8.8 Hz, 1H), 8.12 (s, 1H), 8.03 (dd, J = 1.6, 8.8 Hz, 1H), 7.54 (s, 1H), 4.86 (s, 2H), 3.61 (br s, 8H), 2.51 (s, 3H), 2.43 (s, 3H), MS (ES+) m / z 349.2 (M+H) + .

[0571] Example 149 5-(Difluoromethyl)-6-methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 154) [ka] 1 H NMR (400 MHz, MeOD) δ 8.97-8.88 (m, 2H), 8.21-8.13 (m, 1H), 8.12-8.07 (m, 1H), 8.03-7.93 (m, 1H), 7.82 (s, 1H), 7.48-7.11 (m, 1H), 4.90-4.89 (m, 2H), 3.69 (br d, J = 3.6 Hz, 4H), 3.61 (br d, J = 3.2 Hz, 4H), 2.68 (s, 3H).MS (ES+) m / z 385 (M+H) + .

[0572] Example 150 5-Fluoro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 155) [ka] 1H NMR (400 MHz, CD3OD) δ 8.96-8.90 (m, 2H), 8.17 (d, J = 8.8 Hz, 1H), 8.05 (s, 1H), 7.99 - 7.94 (m, 1H), 7.71 (s, 1H), 4.90 (s, 2H), 3.54-3.52 (m, 4H), 3.46 (br s, 4H).MS (ES+) m / z 407 (M+H) + .

[0573] Example 151 5-Chloro-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 156) [ka] 1 H NMR (400 MHz, CD3OD) δ 9.01 (dd, J1 = 2.0 Hz, J2 =12.6 Hz, 2H), 8.20 (d, J = 8.8 Hz, 1H), 8.09 (s, 1H), 8.03 (dd, J1 = 2.0 Hz, J2 =8.8 Hz, 1H), 7.76 (s, 1H), 4.93 (s, 2H), 3.96 (br t, J = 12.0 Hz, 2H), 3.73-3.62 (m, 2H), 3.52-3.44 (m, 2H), 3.24 (br d, J = 12.6 Hz, 2H).MS (ES+) m / z 423 (M+H) + .

[0574] Example 152 5-Bromo-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 157) [ka] 1H NMR (400 MHz, CD3OD) δ 9.05 (dd, J1 = 2.0 Hz, J2 = 15.0 Hz, 2H), 8.23 ​​(d, J = 8.8 Hz, 1H), 8.12 (s, 1H), 8.06 (dd, dd, J1 = 2.0 Hz, J2 = 8.8 Hz, MS (ES+) m / z 467 (M+H) + .

[0575] Example 153 5-Methyl-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 158) [ka] 1 H NMR (400 MHz, CD3OD) δ 8.96-8.90 (m, 2H), 8.16 (d, J = 8.6 Hz, 1H), 8.06 (s, 1H), 7.97 (dd, J1 = 2.0 Hz, J2 = 8.8 Hz, 1H), 7.72 (s, 1H), 4.93 (s, 2H), 3.57 (br s, 8H), 2.50 (d, J = 0.8 Hz, 3H).MS (ES+) m / z 403 (M+H) + .

[0576] Example 154 5-(Difluoromethyl)-4-(piperazin-1-yl)-N-(quinoxalin-6-ylmethyl)-6-(trifluoromethyl)pyridin-3-amine (Compound 159) [ka]

[0577] Example 155 (R)-5-Bromo-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 160) [ka] 1 H NMR:(400 MHz, MeOD-d4) δ 8.97-8.83 (m, 2H), 8.36 (d, J = 1.0 Hz, 1H), 8.14 (d, J = 8.6 Hz, 1H), 8.07 (d, J = 1.1 Hz, 1H), 7.97-7.94 (m, 2H), 5.83 (t, J = 4.6 Hz, 1H), 4.90 (br d, J = 0.9 Hz, 2H), 3.93 (d, J = 13.6 Hz, 1H), 3.80 (dt, J = 7.5, 11.0 Hz, 1H), 3.71 (dd, J = 4.4, 13.6 Hz, 1H), 3.60 (ddd, J = 3.4, 9.0, 12.0 Hz, 1H), 2.72-2.31 (m, 2H) MS (ES+) m / z 402 (M+H) +

[0578] Example 156 (R)-5-(Difluoromethyl)-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 161) [ka] 1H NMR (400 MHz, MeOD) δ 8.91 (s, 2H), 8.35 (s, 1H), 8.15 (d, J = 8.8 Hz, 1H), 8.10 (s, 2H), 7.99 (dd, J = 1.6, 8.8 Hz, 1H), 7.48-7.18 (m, MS (ES+) m / z 372.3 (M+H) + .

[0579] Example 157 (R)-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)-5-(trifluoromethyl)pyridin-3-amine (Compound 162) [ka] 1 H NMR (400 MHz, MeOD- d4) δ 8.88-8.84 (m, 2H), 8.12 (d, J = 8.80 Hz, 1H), 8.04 (s, 2H), 8.00 (s, 1H), 7.92 (dd, J1 = 2.00, J2 = 8.6 Hz, 1H), 5.24 (br t, J = 5.20 Hz, 1H), 4.77 (s, 2H), 3.30-3.19 (m, 2H), 3.02 (dd, J = 4.80, 12.9 Hz, 1H), 2.94 (ddd, J = 5.40, 8.6, 11.3 Hz, 1H), 2.19-2.01 (m, 2H).MS (ES+) m / z 390 (M+H) +

[0580] Example 158 (R)-5-Methoxy-4-(pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 163) [ka] 1 H NMR (400 MHz, MeOD) δ 9.08-9.01 (m, 2H), 8.20 (d, J = 8.8 Hz, 1H), 8.16 (s, 1H), 8.08 (dd, J = 1.8, 8.8 Hz, 1H), 8.03 (s, 1H), 7.70 (d, J = 0.8 Hz, 1H), 5.99 - 5.91 (m, 1H), 4.88 (s, 2H), 4.05 (s, 3H), 3.88 (br d, J = 13.6 Hz, 1H), 3.75-3.62 (m, 2H), 3.60-3.53 (m, 1H), 2.53-2.34 (m, 2H), MS (ES+) m / z 352.2 (M+H) + .

[0581] Example 159 (R)-5-ブロモ-N-((7-フルオロキノキサリン-6-イル)メチル) -4-(ピロリジン-3-イルオキシ)ピリジン-3-アミン (Compound 164)

change

[0582] Example 160 (R)-5-(Difluoromethyl)-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 165) [ka] 1 H NMR (400 MHz, MeOD) δ 8.88 (dd, J = 1.8, 18.4 Hz, 2H), 8.40 (s, 1H), 8.25 (s, 1H), 8.07 (d, J = 7.6 Hz, 1H), 7.87 (d, J = 10.8 Hz, 1H), 7.45-7.16 (m, 1H), 5.68 (t, J = 4.1 Hz, 1H), 4.91 (s, 2H), 3.90 (d, J = 13.6 Hz, 1H), 3.74-3.66 (m, 2H), 3.60-3.55 (m, 1H), 2.51-2.38 (m, 2H).MS (ES+) m / z 390.2 (M+H) + .

[0583] Example 161 (R)—N-((7-fluoroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)-5-(trifluoromethyl)pyridin-3-amine (Compound 166) [ka] 1H NMR (400 MHz, MeOD- d4) δ 8.87 (d, J = 2.00 Hz, 1H), 8.83 (d, J = 2.00 Hz, 1H), 8.09 (s, 1H), 8.07 (s, 1H), 8.04 (d, J = 7.60 Hz, 1H), 7.83 (d, J = 10.4 Hz, 1H), 5.23 (br t, J = 5.2 Hz, 1H), 4.79 (s, 2H), 3.30-3.15 (m, 2H), 3.00 (dd, J = 4.6, 12.9 Hz, 1H), 2.91 (ddd, J1 = 5.60 Hz, J2 = 8.60 Hz, J3 = 11.1 Hz, 1H), 2.20-2.01 (m, 2H).MS (ES+) m / z 408 (M+H) +

[0584] Example 162 (R)-N-((7-フルオロキノキサリン-6-イル)メチル)-5-メトキシ-4-(ピロリジン-3-イルオキシ)ピリジン-3-アミン (Compound 167)

change

[0585] Example 163 (R)-5-Bromo-N-((7-chloroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 168) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.91 (d, J = 1.9 Hz, 1H), 8.87 (d, J = 1.9 Hz, 1H), 8.42 (d, J = 0.9 Hz, 1H), 8.25 (s, 1H), 8.02-7.97 (m, 2H), 5.88 (t, J = 4.6 Hz, 1H), 4.90 (s, 2H), 3.94 (d, J = 13.6 Hz, 1H), 3.85-3.66 (m, 2H), 3.59 (ddd, J = 3.4, 9.0, 11.9 Hz, 1H), 2.66-2.57 (m, 1H), 2.54-2.42 (m, 1H) MS (ES+) m / z 436 (M+H) +

[0586] Example 164 (R)—N-((7-chloroquinoxalin-6-yl)methyl)-5-(difluoromethyl)-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 169) [ka] 1 H NMR (400 MHz, MeOD) δ 8.90 (dd, J = 1.9, 15.8 Hz, 2H), 8.41 (s, 1H), 8.28 (s, 1H), 8.17 (s, 1H), 8.03 (s, 1H), 7.50-7.16 (m, 1H), 5.71 (t, J = 4.7 Hz, 1H), 4.91 (s, 2H), 3.91 (d, J = 13.8 Hz, 1H), 3.75-3.65 (m, 2H), 3.61-3.54 (m, 1H), 2.59-2.37 (m, 2H).MS (ES+) m / z 390.2 (M+H) + .

[0587] Example 165 (R)—N-((7-chloroquinoxalin-6-yl)methyl)-4-(pyrrolidin-3-yloxy)-5-(trifluoromethyl)pyridin-3-amine (Compound 170) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.89 (d, J = 2.00 Hz, 1H), 8.85 (d, J = 2.00 Hz, 1H), 8.25 (s, 1H), 8.10 (s, 1H), 8.03 (s, 1H), 7.97 (s, 1H), 5.26 (br t, J = 5.20 Hz, 1H), 4.80 (s, 2H), 3.33 (br s, 1H), 3.22 (td, J1 = 7.60 Hz, J2 = 11.2 Hz, 1H), 3.03 (dd, J1 = 4.80 Hz, J2 = 12.8 Hz, 1H), 2.94 (ddd, J1 = 5.60Hz, J2 = 8.80 Hz, J3 =11.2 Hz, 1H), 2.21-2.04 (m, 2H).MS (ES+) m / z 424 (M+H) + .

[0588] Example 166 (R)-N-((7-chloroquinoxalin-6-yl)methyl)-5-methoxy-4-(pyrrolidin-3-yloxy)pyridin-3-amine (Compound 171) [ka] 1H NMR (400 MHz, MeOD) δ 8.90 (dd, J = 1.8, 16.9 Hz, 2H), 8.22 (s, 1H), 8.07 (s, 1H), 7.97 (s, 1H), 7.68 (s, 1H), 5.97 (t, J = 3.9 Hz, 1H), 4.86 (s, 2H), 4.08 (s, 3H), 3.88 (br d, J = 13.3 Hz, 1H), 3.76-3.62 (m, 2H), 3.61-3.51 (m, 1H), 2.67-2.30 (m, 2H), MS (ES+) m / e 386.2 (M+H) + .

[0589] Example 167 4-(((3R,5S)-5-Methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 172) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 9.03 (s, 2H), 8.22-8.15 (m, 2H), 8.11-8.04 (m, 2H), 7.80 (s, 1H), 7.51 (d, J = 6.4 Hz, 1H), 5.67 (m, 1H), 4.99-4.93 (s, 2H), 4.87 (s, 2H), 4.08-3.90 (m, 2H), 3.79 (dd, J = 5.2, 13.2 Hz, 1H), 2.97 (ddd, J = 6.4, 8.5, 14.8 Hz, 1H), 2.11 (m, 1H), 1.59 (d, J = 6.8 Hz, MS (ES+) m / z 336.2 (M+H) + .

[0590] Example 168 4-(((3R,5R)-5-Methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 173) [ka] 1 H NMR (400 MHz, DMSO-d6) δ 15.18 (s, 1H), 10.74-10.34 (m, 1H), 9.60 (s, 1H), 8.91 (s, 2H), 8.14-8.03 (m, 3H), 7.95 (d, J = 8.8 Hz, 1H), 7.82 (s, 1H), 7.51 (d, J = 6.4 Hz, 1H), 5.59 (m, 1H), 4.74 (s, 2H), 4.04-3.87 (m, 1H), 3.82-3.66 (m, 1H), 3.64-3.53 (m, 1H), 2.42 (dd, J = 5.9, 14.3 Hz, 1H), 2.05-1.90 (m, 1H), 1.42 (d, J = 6.5 Hz, 3H).MS (ES+) m / z 336.2 (M+H) + .

[0591] Example 169 5-フルオロ-4-(((3R,5S)-5-メチルピロリジン-3-イル)オキシ)-N-(キノキサリン-6-イルメチル)ピリジン-3-アミン(Compound 174)

change

[0592] Example 170 5-Fluoro-4-(((3R,5R)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 175) [ka] 1 H NMR (400 MHz, MeOD) δ 9.01 (s, 2H), 8.30 (d, J = 6.0 Hz, 1H), 8.22-8.14 (m, 2H), 8.06 (dd, J = 1.7, 8.7 Hz, 1H), 7.81 (s, 1H), 5.93 (q, J = 3.8 Hz, 1H), 4.91 (s, 4H), 4.34-4.19 (m, 1H), 4.02-3.85 (m, 2H), 2.78 (dd, J = 6.1, 14.8 Hz, 1H), 2.20 (ddd, J = 4.4, 11.2, 15.1 Hz, 1H), 1.57 (d, J = 6.5 Hz, 3H).MS (ES+) m / z 354.2 (M+H) + .

[0593] Example 171 5-Methyl-4-(((3R,5S)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 176) [ka] 1H NMR (400 MHz, MeOD-d4) δ 8.90 (s, 2H), 8.14 (d, J = 8.8 Hz, 1H), 8.08 (s, 1H), 7.99 - 7.94 (m, 2H), 7.83 (s, 1H), 5.52 - 5.45 (m, 1H), 4.89 - 4.86 (m, 2H), 3.91 - 3.76 (m, 2H), 3.73 - 3.61 (m, 1H), 2.88 (td, J = 7.5, 14.5 Hz, 1H), 2.50 (s, 3H), 2.23 - 2.11 (m, 1H), 1.61 (d, J = 6.6 Hz, 3H) MS (ES+) m / z 350 (M+H) +

[0594] Example 172 5-メチル-4-(((3R,5R)-5-メチルピロリジン-3-イル)オキシ)-N-(キノキサリン-6-イルメチル)ピリジン-3-アミン(Compound 177)

change

[0595] Example 173 5-Chloro-4-(((3R,5S)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 178) [ka] 1 H NMR (400 MHz, MeOD) δ 9.98-8.53 (m, 2H), 8.45-8.06 (m, 3H), 8.05-7.77 (m, 2H), 5.86 (br s, 1H), 3.97-3.80 (m, 2H), 3.71 (br dd, J = 5.4, ​​13.2 Hz, 1H), 2.95 (td, J = 7.5, 14.6 Hz, 1H), 2.36-2.21 (m, 1H), 1.62 (d, J = 6.6 Hz, 3H), MS (ES+) m / z 370.0 (M+H) + .

[0596] Example 174 5-Chloro-4-(((3R,5R)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 179) [ka] 1H NMR (400 MHz, MeOD) δ 8.97-8.91 (m, 2H), 8.27 (d, J = 1.1 Hz, 1H), 8.16 (d, J = 8.8 Hz, 1H), 8.11 (d, J = 1.1 Hz, 1H), 8.00 (dd, J = 1.9, 8.6 Hz, 1H), 7.92 (d, J = 1.1 Hz, 1H), 5.90 (br s, 1H), 4.89 (br s, 2H), 4.30 (td, J = 6.2, 11.9 Hz, 1H), 3.97-3.82 (m, 2H), 2.71 (dd, J = 6.0, 14.9 Hz, 1H), 2.23-2.08 (m, 1H), 1.54 (d, J = 6.6 Hz, 3H), MS (ES+) m / z 370.2 (M+H) + .

[0597] Example 175 5-ブロモ-4-(((3R,5S)-5-メチルピロリジン-3-イル)オキシ)-N-(キノキサリン-6-イルメチル)ピリジン-3-アミン(Compound 180)

change

[0598] Example 176 5-Bromo-4-(((3R,5R)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 181) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.89 (s, 2H), 8.36 (d, J = 0.9 Hz, 1H), 8.14 (d, J = 8.6 Hz, 1H), 8.07 (d, J = 1.1 Hz, 1H), 7.97-7.93 (m, 2H), 5.81 (br d, J = 3.9 Hz, 1H), 4.89 (br s, 2H), 4.33 (td, J = 6.1, 11.9 Hz, 1H), 3.89 (d, J = 3.0 Hz, 2H), 2.71 (dd, J = 6.1, 14.9 Hz, 1H), 2.12 (ddd, J = 4.8, 11.3, 15.0 Hz, 1H), 1.54 (d, J = 6.6 Hz, 3H) MS (ES+) m / z 416(M+H) +

[0599] Example 177 5-(Difluoromethyl)-4-(((3R,5S)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 182) [ka]

[0600] Example 178 5-(Difluoromethyl)-4-(((3R,5R)-5-methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Compound 183) [ka]

[0601] Example 179 4-(((3R,5S)-5-Methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)-5-(trifluoromethyl)pyridin-3-amine (Compound 184) [ka] 1 H NMR (400 MHz, MeOD-d4) δ 8.89 (s, 2H), 8.14 (d, J = 8.40 Hz, 1H), 8.08 (d, J = 1.20 Hz, 1H), 8.05 (s, 1H), 8.03 (s, 1H), 5.21-5.06 (m, 1H), 4.79 (s, 2H), 3.39 (br d, J = 12.8 Hz, 2H), 3.21-3.10 (m, 1H), 2.96 (dd, J1 = 5.20 Hz, J2 =12.8 Hz, 1H), 2.48 (td, J1 =7.3, J2 =14.3 Hz, 1H), 1.77-1.66 (m, 1H), 1.33 (d, J = 6.4 Hz, 3H).MS (ES+) m / z 404 (M+H) + .

[0602] Example 180 4-(((3R,5R)-5-Methylpyrrolidin-3-yl)oxy)-N-(quinoxalin-6-ylmethyl)-5-(trifluoromethyl)pyridin-3-amine (Compound 185) [ka] Sequence information:

[0603] [Table 3-1] [Table 3-2] [Table 3-3]

[0604] Table 4-1 Table 4-2 Table 4-3

[0605] Table 5-1 Table 5-2 Table 5-3 Table 5-4 Table 5-5 Table 5-6

[0606] Table 6-1 Table 6-2 Table 6-3 Table 6-4 Table 6-5 Table 6-6 Table 6-7

[0607] Table 7-1 Table 7-2 Table 7-3

[0608] Table 8-1 Table 8-2

Claims

1. A polynucleotide cassette for regulating expression of a target gene, said polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, said aptamer-encoding sequence comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 6 are any nucleotides or are not nucleotides; X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X 20 is any nucleotide, and The polynucleotide cassette as described above, wherein X 21 is C, G, or T.

2. The sequence encoding the aptamer CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 6 are C and G, respectively; X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X 20 is any nucleotide, and 2. The polynucleotide cassette of claim 1, wherein X21 is C, G, or T.

3. The sequence encoding the aptamer CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: X 16 is G or T; X 17 is A or T; X 18 is any nucleotide; X 19 is A or G; X 20 is A, G, or T; and 3. The polynucleotide cassette of claim 1 or 2, wherein X21 is C, G, or T.

4. 1. A polynucleotide cassette for regulating expression of a target gene, the polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 2 are any nucleotides or are not nucleotides; X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is G or T, X 5 is A, G, or T; X 6 is A or G, X 7 is A or T, X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A is X 13 is A, C, or G; X 14 is any nucleotide, X 15 is C, G, or T; X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 is A, G, or T; X 21 is C, G, or T; X 22 is T, and X 23 is A, G, or T.

5. 1. A polynucleotide cassette for regulating expression of a target gene, the polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 4 are any nucleotides or are not nucleotides; X 7 is A, G, or T; X 8 is any nucleotide, X 9 is any nucleotide, X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, and X 12 is A, C, or T.

6. The polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X 7 is A or T, X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, and X 12 The polynucleotide cassette of claim 5, wherein is A.

7. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X 7 But A is X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, and X 12 The polynucleotide cassette of claim 5, wherein is A.

8. 1. A polynucleotide cassette for regulating expression of a target gene, the polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 3 are any nucleotides or are not nucleotides; X 1 is C, G, or T; X 2 is any nucleotide, X 3 is any nucleotide, X 4 is any nucleotide, X 5 is any nucleotide, and X 6 is any nucleotide.

9. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is any nucleotide, X 5 is A, G, or T, and X 6 The polynucleotide cassette of claim 8, wherein is any nucleotide.

10. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is G or T, X 5 is A, G, or T, and X 6 The polynucleotide cassette of claim 8, wherein is A or G.

11. 1. A polynucleotide cassette for regulating expression of a target gene, the polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 5 are any nucleotide or no nucleotide; and X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide.

12. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 is A, C, or G; X 14 is any nucleotide, X 15 is C, G, or T; X 22 is T, and X 23 The polynucleotide cassette of claim 11 , wherein is A, G, or T.

13. 1. A polynucleotide cassette for regulating expression of a target gene, said polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, said aptamer encoding sequence comprising a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558.

14. The polynucleotide cassette of claim 13, wherein the sequence encoding the aptamer is selected from the group consisting of SEQ ID NOs: 1 and 7-558.

15. 1. A polynucleotide cassette for regulating expression of a target gene, said polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

16. 16. The polynucleotide cassette of claim 15, wherein the aptamer code is a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

17. 1. A polynucleotide cassette for regulating expression of a target gene, said polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

18. 18. The polynucleotide cassette of claim 17, wherein the aptamer-encoding sequence is selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

19. A polynucleotide cassette for regulating expression of a target gene, said polynucleotide cassette comprising a sequence encoding an aptamer that binds to a small molecule, said aptamer encoding sequence comprising a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

20. 20. The polynucleotide cassette of claim 19, wherein the aptamer-encoding sequence is selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

21. A nucleic acid sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 6 are any nucleotides or are not nucleotides; X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X20 is any nucleotide; X 21 is C, G, or T; and The nucleic acid sequence as defined above, wherein X 16 to X 21 are not simultaneously A, T, C, A, T, and G, respectively.

22. The aptamer-encoding sequence of claim 21, CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 6 are C and G, respectively; X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X20 is any nucleotide; X 21 is C, G, or T; and 21. The nucleic acid sequence of claim 20, wherein X 16 to X 21 are not simultaneously A, T, C, A, T, and G, respectively.

23. The aptamer-encoding sequence of claim 22, CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO: 6), wherein: X 16 is G or T; X 17 is A or T; X 18 is any nucleotide; X 19 is A or G; X 20 is A, G, or T; and 23. The nucleic acid sequence of claim 21 or 22, wherein X21 is C, G, or T.

24. A nucleic acid sequence encoding an aptamer, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO: 2), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 2 are any nucleotides or are not nucleotides; X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is G or T, X 5 is A, G, or T; X 6 is A or G, X 7 But A is X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 But A is X 13 is A, C, or G; X 14 is any nucleotide, X 15 is C, G, or T; X 16 is G or T, X 17 is A or T, X 18 is any nucleotide, X 19 is A or G, X 20 is A, G, or T; X 21 is C, G, or T; X 22 is T, and X 23 is A, G, or T.

25. A nucleic acid sequence encoding an aptamer, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 4 are any nucleotides or are not nucleotides; X 7 is A, G, or T; X 8 is any nucleotide, X 9 is any nucleotide, X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, C, or T, and X 7 ~X 12 are not simultaneously A, T, T, G, C, and A, respectively.

26. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X 7 is A or T, X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, and X 7 ~X 12 and are not simultaneously A, T, T, G, C, and A, respectively.

27. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 4), wherein X 7 But A is X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide, X 11 is any nucleotide or is not a nucleotide, X 12 is A, and X 7 ~X 12 and are not simultaneously A, T, T, G, C, and A, respectively.

28. A nucleic acid sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 3 are any nucleotides or are not nucleotides; X 1 is C, G, or T; X 2 is any nucleotide, X 3 is any nucleotide, X 4 is any nucleotide, X 5 is any nucleotide, X 6 is any nucleotide, and X 1 ~X 6 are not simultaneously C, A, T, C, G, and A, respectively.

29. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is any nucleotide, X 5 is A, G, or T; X 6 is any nucleotide, and X 1 ~X 6 and are not simultaneously C, A, T, C, G, and A, respectively.

30. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), wherein X 1 is C or T, X 2 is any nucleotide, X 3 is any nucleotide, X 4 is G or T, X 5 is A, G, or T, and X 6 is A or G.

31. A nucleic acid sequence encoding an aptamer that binds to a small molecule, the sequence encoding the aptamer comprising: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein The first and last nucleotides of the sequence encoding the aptamer of SEQ ID NO: 5 are any nucleotides or are not nucleotides; X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide, and X 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, respectively.

32. the aptamer-encoding sequence is CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO: 5), wherein X 13 is A, C, or G; X 14 is any nucleotide, X 15 is C, G, or T; X 22 is T, and X 23 is A, G, or T.

33. A nucleic acid sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558.

34. 34. The nucleic acid sequence of claim 33, wherein the sequence encoding the aptamer is selected from the group consisting of SEQ ID NOs: 1 and 7-558.

35. 1. A nucleic acid sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

36. 36. The nucleic acid sequence of claim 35, wherein the aptamer code is a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.

37. 1. A nucleic acid sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

38. 38. The nucleic acid sequence of claim 37, wherein the aptamer-encoding sequence is selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

39. A nucleic acid sequence encoding an aptamer that binds to a small molecule, wherein the sequence encoding the aptamer comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

40. 40. The nucleic acid sequence of claim 39, wherein the sequence encoding the aptamer is selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

41. 1. A nucleic acid sequence encoding a recombinant riboswitch for regulating expression of a target gene in response to a small molecule, wherein the riboswitch comprises an aptamer encoded by SEQ ID NOs: 1 and 7-558, or a sequence at least 95% identical to SEQ ID NOs: 1 and 7-558.

42. 1. A polynucleotide cassette for regulating expression of a target gene in response to a small molecule, said polynucleotide cassette comprising: (c) a riboswitch; and (d) an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron; the riboswitch comprises (i) an effector region comprising a stem that includes the 5' splice site sequence of the 3' intron; and (ii) an aptamer comprising a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558, or a sequence at least 95% identical to any one of SEQ ID NOs: 1 and 7-558; the polynucleotide cassette, wherein the alternatively spliced ​​exon comprises a stop codon that is in-frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the mRNA of the target gene.

43. 43. The polynucleotide cassette of claim 42, wherein the polynucleotide cassette is located in a protein-coding sequence of the target gene.

44. 43. The polynucleotide cassette of claim 42, wherein the polynucleotide cassette is located in an untranslated region of the target gene or an intron of the target gene.

45. The aptamer has a structure according to Formula I, 【Chemistry 1】 During the ceremony, X 1 , X 2 , and X 3 In each case, independently, 1 , CHR 1 , N, NH, O, and S, wherein adjacent X 1 , X 2 , and X 3 are not simultaneously selected to be O or S, The dashed line represents an optional double bond; Y 1 , Y 2 , and Y 3 In each case, independently, 2 and N; n is 1 or 2, where when n is 1, only one of the dashed lines is a double bond; L.A. 【Chemistry 2】 or L, 【Transformation 3】 is selected from wherein k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and z is selected from the integers 1, 2, 3, 4, and 5; c, d, e, f, g, h, and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; and j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from —NH—, —O—, —NHC(═O)—, —C(═O)NH—, —S—, and —C(═O)—; A is, 【Chemistry 4】 is selected from In the formula, X 4 , X 5 , X 6 , and X 7 became independent and 3 and N; X 8 is N or CH; X b is O, NH, and NCH 3 is selected from Here, R 1 , R 2 , and R 3 are each independently —H, —Cl, —Br, —I, —F, or —CF 3 , -CH 2 F, -CHF 2 , -OH, -CN, -NO 2 , -NH 2 , —NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 alkyl) 2 , -COOH, -COO(C 1 ~C 6 alkyl), -CO(C 1 ~C 6 alkyl), —O(C 1 ~C 6 alkyl), -OCO(C 1 ~C 6 alkyl), -NCO(C 1 ~C 6 alkyl), -CONH(C 1 ~C 6 alkyl), and substituted or unsubstituted C 1 ~C 6 alkyl, Additionally or alternatively, two R on adjacent ring positions 3 may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, x is 0, 1, 2 or 3; R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, y is 0, 1, 2 or 3; W is O or NR 4 where R 4 , -H, -CO(C 1 ~C 6 alkyl), substituted or unsubstituted C 1 ~C 6 selected from alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, —CO(aryl), —CO(heteroaryl), and —CO(cycloalkyl); However, X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , and X 7 and wherein at least two of the groups are N. or a pharmaceutically acceptable salt thereof.

46. The small molecule has a structure according to formula XIII: 【Transformation 5】 or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; Here, X 4 , X 6 , or X 7 0 or 1 of A is, 【Transformation 6】 is selected from the group consisting of X a is selected from N and CH; X b is O, NH, and NCH 3 is selected from R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; 46. ​​The polynucleotide cassette of claim 45, wherein w is 0, 1, or 2.

47. The small molecule has a structure according to formula XIV: 【Transformation 7】 or a pharmaceutically acceptable salt thereof, wherein: A is, 【Transformation 8】 is selected from the group consisting of X a is selected from N and CH; R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino, alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; 47. The polynucleotide cassette of claim 46, wherein z is 0, 1, or 2.

48. The small molecule has a structure according to formula XVI: 【Chemistry 9】 or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; Here, X 4 , X 6 , or X 7 0 or 1 of X a is selected from N and CH; R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; 47. The polynucleotide cassette of claim 46, wherein w is 0, 1, or 2.

49. The small molecule has a structure according to Formula XVII: 【Chemistry 10】 or a pharmaceutically acceptable salt thereof, wherein: R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; x is 0, 1, 2 or 3; 47. The polynucleotide cassette of claim 46, wherein z is 0, 1, or 2.

50. The small molecule has a structure according to formula XX: 【Chemistry 11】 or a pharmaceutically acceptable salt thereof, wherein: X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; Here, X 4 , X 6 , or X 7 0 or 1 of X b is O, NH, and NCH 3 is selected from R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; y is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; 47. The polynucleotide cassette of claim 46, wherein w is 0, 1, or 2.

51. The small molecule has a structure according to formula XXI: 【Chemistry 12】 or a pharmaceutically acceptable salt thereof, wherein: R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; w is 0, 1, or 2; y is 0, 1, or 2; 47. The polynucleotide cassette of claim 46, wherein z is 0, 1, or 2.

52. A vector comprising a polynucleotide cassette according to any one of claims 1, 2, 4 to 20, 42 to 44, and 46 to 51, or a nucleic acid sequence according to any one of claims 21, 22, and 24 to 41.

53. 53. The vector of claim 52, wherein the vector is a viral vector.

54. 54. The vector of claim 53, wherein the viral vector is selected from the group consisting of an adenoviral vector, an adeno-adeno-associated viral vector, and a lentiviral vector.

55. A cell comprising the vector of claim 53 or 54, the polynucleotide cassette of any one of claims 1, 2, 4 to 20, 42 to 44, and 46 to 51, or the nucleic acid sequence of any one of claims 21, 22, and 24 to 41.

56. A compound having a structure according to formula XIV: 【Chemistry 13】 During the ceremony, A is, 【Chemistry 14】 is selected from the group consisting of X a is selected from N and CH; R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino, alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; z is 0, 1, or 2; Here, A is 【Chemistry 15】 If selected to be x is 1, 2 or 3, and / or Two R on adjacent ring positions d taken together form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH, or a pharmaceutically acceptable salt thereof.

57. A compound having a structure according to formula XVI: 【Chemistry 16】 During the ceremony, X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; Here, X 4 , X 6 , or X 7 0 or 1 of X a is selected from N and CH; R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; x is 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; The compound, or a pharmaceutically acceptable salt thereof, wherein w is 0, 1, or 2.

58. having a structure according to formula XVII, 【Chemistry 17】 During the ceremony, R a are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from a form an oxo group, or two R a forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; x is 1, 2 or 3; 58. The compound of claim 57, or a pharmaceutically acceptable salt thereof, wherein z is 0, 1, or 2.

59. A compound having a structure according to formula XX: [Chemistry 18] During the ceremony, X 4 But CH, CR d , and N; X 6 But CH, CR d , and N; X 7 But CH, CR d , and N; Here, X 4 , X 6 , or X 7 0 or 1 of X b is O, NH, and NCH 3 is selected from R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, m is 1 or 2; y is 0, 1, 2 or 3; R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; The compound, or a pharmaceutically acceptable salt thereof, wherein w is 0, 1, or 2.

60. having a structure according to formula XXI, 【Chemistry 19】 During the ceremony, R b are each independently C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino, or in addition or alternatively, two R attached to the same carbon atom are selected from b form an oxo group, or two R b forms a 4- to 6-membered carbocyclic or heterocyclic ring having 1 or 2 heteroatoms selected from O and NH, R c each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; R d each independently represents a halo, C 1 ~C 3 Alkyl, —OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , —CN, hydroxyl, and amino; Alternatively, two R on adjacent ring positions d may be taken together to form a 5- or 6-membered aromatic ring having 0-2 heteroatoms selected from O, S, N, and NH; m is 1 or 2; w is 0, 1, or 2; y is 0, 1, or 2; 60. The compound of claim 59, or a pharmaceutically acceptable salt thereof, wherein z is 0, 1, or 2.

61. A compound having a structure according to one of the following: Table 1-1 Table 1-2 Table 1-3 Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13

62. below, 【Chemistry 20-1】 【Chemistry 20-2】 62. The compound of claim 61, having a structure according to one of: