Engineered adeno-associated (AAV) vectors for transgene expression

Abstract

To provide engineered AAV vectors for transgene expression, e.g., in the CNS, PNS, inner ear, heart, or retina, and methods of use thereof, and also provide methods for discovering new engineered AAV vectors that mediate transgene expression in desired cell types.SOLUTION: The present invention provides an AAV capsid protein, comprising an amino acid sequence that comprises at least five contiguous amino acids derived from the sequence FVVGQSY (SEQ ID NO:2), inserted into a region of the capsid that is exposed on the capsid surface.SELECTED DRAWING: Figure 1-1

Description

Technical Field

[0001] Claim of Priority This application claims the benefit of U.S. Provisional Patent Application No. 62 / 825,703, filed on Mar. 28, 2019 The entire content of the above document is incorporated herein by reference .

[0002] Research or Development Supported by the Federal Government This invention was made with government support under grants AG047336 and DC017117 from the National Institutes of Health. The government has certain rights in this invention .

[0003] This specification describes, for example, engineered AAV vectors for transgene expression in the CNS, PNS, inner ear, heart, or retina, and methods of using them. Methods are also provided for discovering new engineered AAV vectors that mediate transgene expression in desired cell types .

Background Art

[0004] The AAV9 vector has shown significant potential for delivery to the CNS after systemic delivery and has achieved clinical success in pediatric patients with spinal muscular atrophy 1 However, systemic injection of high doses of AAV vectors can be associated with the induction of T cell responses that can eliminate transduced cells . 2 In monkeys, there is one report of high systemic doses of an AAV9-like vector resulting in animal death due to toxicity and systemic inflammation 3 A recent Phase I clinical trial using high doses of AAV9 for the treatment of muscular dystrophy resulted in immune responses in one patient after vector injection ​​​​​​The reaction was observed, so it was put on hold by the FDA. The reason for the need for high doses is that the efficiency of AAV based on the number of genomic copies per vector is relatively low in order to provide sufficient transgene expression in a significant number of target cells. Therefore, developing new AAV capsids that enable more efficient transduction at lower doses should result in better therapeutic efficacy while reducing safety issues such as immunotoxicity. The efficiency of AAV is relatively low when based on the number of genomic copies per vector in order to provide sufficient transgene expression in a significant number of target cells. Therefore, developing new AAV capsids that enable more efficient transduction at lower doses should result in better therapeutic efficacy while reducing safety issues such as immunotoxicity. The efficiency of AAV is relatively low when based on the number of genomic copies per vector in order to provide sufficient transgene expression in a significant number of target cells. Therefore, developing new AAV capsids that enable more efficient transduction at lower doses should result in better therapeutic efficacy while reducing safety issues such as immunotoxicity.

Summary of the Invention

[0005] Described herein is a method for identifying novel viral clones using an adeno-associated virus (AAV) vector genome having a two-part expression cassette. The first is a Cre-recombinase cassette under the promoter of interest. The second part is an AAV promoter for driving the expression of an engineered capsid gene cloned "in cis" relative to the first part of the viral genome. Using cells that express a reporter gene (e.g., green fluorescent protein) but have a loxP / stop site upstream such that reporter expression is prevented until Cre delivered by the AAV vector removes the stop site, the viral vector is selected for transgene expression (sensitive Cre expression). Reporter gene-positive cells can be isolated, and the recovered AAV capsid sequences will have a higher likelihood of mediating efficient transgene expression. Also described herein are engineered viral sequences that drive efficient expression in the central nervous system (CNS), and peripheral nervous system (PNS), heart, liver, and inner ear. Described herein is a method for identifying novel viral clones using an adeno-associated virus (AAV) vector genome having a two-part expression cassette. The first is a Cre-recombinase cassette under the promoter of interest. The second part is an AAV promoter for driving the expression of an engineered capsid gene cloned "in cis" relative to the first part of the viral genome. Using cells that express a reporter gene (e.g., green fluorescent protein) but have a loxP / stop site upstream such that reporter expression is prevented until Cre delivered by the AAV vector removes the stop site, the viral vector is selected for transgene expression (sensitive Cre expression). Reporter gene-positive cells can be isolated, and the recovered AAV capsid sequences will have a higher likelihood of mediating efficient transgene expression. Also described herein are engineered viral sequences that drive efficient expression in the central nervous system (CNS), and peripheral nervous system (PNS), heart, liver, and inner ear. Using cells that express a reporter gene (e.g., green fluorescent protein) but have a loxP / stop site upstream such that reporter expression is prevented until Cre delivered by the AAV vector removes the stop site, the viral vector is selected for transgene expression (sensitive Cre expression). Reporter gene-positive cells can be isolated, and the recovered AAV capsid sequences will have a higher likelihood of mediating efficient transgene expression. Also described herein are engineered viral sequences that drive efficient expression in the central nervous system (CNS), and peripheral nervous system (PNS), heart, liver, and inner ear. Also described herein are engineered viral sequences that drive efficient expression in the central nervous system (CNS), and peripheral nervous system (PNS), heart, liver, and inner ear. Also described herein are engineered viral sequences that drive efficient expression in the central nervous system (CNS), and peripheral nervous system (PNS), heart, liver, and inner ear.

[0006] Accordingly, provided herein is an AAV capsid protein comprising an amino acid sequence comprising at least 4 contiguous amino acids derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2). In some embodiments, the AAV capsid protein comprises an amino acid sequence comprising at least 5 contiguous amino acids derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2). In some embodiments, the AAV capsid protein comprises an amino acid sequence comprising at least 6 contiguous amino acids derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2). Alternatively, the AAV capsid protein comprises an amino acid sequence comprising at least 4, 5, or 6 contiguous amino acids derived from the sequences (SEQ ID NOs: 17-1 50) shown in FIG. 2A or 7C. In some embodiments, the AAV is AAV9. In some embodiments, the AAV capsid protein comprises AAV9 VP1.

[0007] In some embodiments, the sequence is inserted into the capsid at the positions corresponding to amino acids 588 and 589 of SEQ ID NO: 6, at the VP1 / VP2 interface (amino acid 138), or at any site of

[0008] 583-590.

[0009] Also provided herein is a nucleic acid encoding an AAV capsid protein as described herein.

[0010] In addition, provided herein is a vector comprising a capsid protein as described herein, preferably a wild type

[0011] type vector. ​​​​AAV that does not contain the VP1, VP2, or VP3 capsid protein is provided. In one embodiment, the AAV further comprises a transgene, preferably a therapeutic transgene.

[0012] A method for delivering a transgene to a cell, e.g., in vivo or ex vivo / in vitr o to the cell, is further provided. The method comprises contacting the cell with the AAV as described herein. In some embodiments, the cell is a neuron (optionally selected, a dorsal root ganglion neuron or a spiral ganglion neuron), an astrocyte, a cardiomyo cyte, or a muscle cell, an astrocyte, a glial cell, an inner hair cell, an outer hair cell, a supporting cell , a fibrocyte of the inner ear, a photoreceptor, an interneuron, a retinal ganglion, or a retinal pigment epithelium .

[0013] In some embodiments, the cell is present in a living subject, e.g., a mammalian subject, preferably present in a human. In some embodiments, the cell is present in a tissue selected from the brain, spinal cord, dorsal root ganglion, heart, inner ear, eye, or muscle, and combinations thereof. In some embodiments the subject has Alzheimer's disease, Parkinson's disease, X-linked adrenoleukodystrophy, Ca navan disease, Niemann-Pick disease, spinal muscular atrophy, Huntington's disease, connexin-26, A usher 3A type, usher 2D type, hair cell-related hearing loss, hair cell-related hearing loss (D FNB7 / 11), inner hair cell-related hearing loss (DFNB9), usher 1F type, Assi er 1B type, retinitis pigmentosa (RP; asymptomatic), Leber congenital amaurosis, Leber hereditary optic neuropathy, usher syndrome (RP; syndrome with deafness), Duchenne muscular dystrophy has allograft vasculopathy, or hemophilia A and B. The methods and compositions described herein can be used to treat such conditions by administering a therapeutically effective amount of AAV carrying a therapeutic transgene sufficient to improve one or more symptoms of the condition, reduce the risk, or delay the onset.

[0014] In some embodiments, the cells are present in the subject's brain and the AAV is administered intracranially by parenteral delivery or intrathecally.

[0015] In some embodiments, intrathecal delivery is by lumbar injection, cisternal magna injection, or parenchymal injection.

[0016] In some embodiments, the AAV is delivered by parenteral delivery, preferably by intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular delivery.

[0017] In some embodiments, the cells are present in the subject's eye and the AAV is administered by subretinal or intravitreal (intravireal) injection.

[0018] In some embodiments, the cells are present in the subject's inner ear and the AAV is administered to the cochlea by application above or through the round window membrane, through a fenestration created by a surgical cochleostomy adjacent to the round window, through the oval window of the bony labyrinth, or through the semicircular canals.

[0019] Also described herein is (i) a sequence encoding Cre recombinase driven by a promoter, (ii) a sequence encoding the AAV9 capsid protein as described herein A peptide, such as a heptamer peptide, is inserted between the sequences encoding amino acids (aa) 588-58 9 of the capsid, driven by a promoter, and a library construct AAV containing a sequence downstream of the Cre cassette is provided. In some embodiments, the peptide comprises a random peptide sequence or a preselected peptide sequence.

[0020] A library is further provided that includes a plurality of library constructs as described herein thereof. In some embodiments, when the peptide sequence is random, the library includes library constructs having sequences encoding all possible variants of the heptamer .

[0021] In addition, methods are provided herein for identifying capsids engineered to mediate transgene expression in a preselected cell type. The method comprises: (a) administering the library of claim 23 or 24 to a non-human model animal, preferably a mammal, wherein the cells of the model animal express a loxP-flanked STOP cassette upstream of a reporter sequence; (b) isolating cells of the preselected cell type; (c) selecting cells in which the reporter sequence is expressed; (d) isolating at least a portion of the library construct, preferably the portion containing the heptamer, from the selected cells in which the reporter sequence of step (c) is expressed; and (e) determining that the heptamer in the library construct isolated in step (d) is identified, wherein the isolated heptamer is capable of mediating transgene expression in the preselected cell type. ​​​​​​​​​

[0022] In some embodiments, the reporter array encodes a fluorescent reporter protein.

[0023] In some embodiments, the model animal is transgenic for a loxP-flanked STOP cassette upstream of the reporter array or can express a loxP-flanked STOP cassette upstream of the reporter array from a second construct.

[0024] In some embodiments, determining that a heptamer in a library construct has been identified involves using DNA sequencing analysis.

[0025] Also, in some embodiments, the method comprises, before and / or after step (e), using PCR to amplify a sequence comprising a heptamer sequence, optionally comprising a complete capsid sequence, from the library construct isolated in step (d); cloning the amplified sequence back into a second set of library vectors; repackaging the second set of library vectors; and performing steps (a)-(d) or (a)-(e) on the second set of library vectors.

[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials for use in this invention are described herein, and other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and​​​​​​​​​​​​ Arrays, database entries, and other references are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0027] Other features and advantages of the invention will become apparent from the following detailed description, figures, and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0028]

Figure 1-1

Figure 1-2

Figure 1-3

Figure 2-1

Figure 2-2

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3-4

Figure 4-1

Figure 4-2

Figure 4-3

Figure 4-4

Figure 5-1

Figure 5-2

Figure 6

Figure 7-1

Figure 7-2

Figure 7-3

Figure 7-4

Figure 8-1

Figure 8-2

Figure 9

Figure 10-1

Figure 10-2

Figure 11

Figure 12-1

Figure 12-2

Figure 13

Figure 14-1

Figure 14-2

Figure 14-3

Figure 14-4

Figure 14-5

Figure 14-6

Figure 14-7

Figure 14-8

Figure 15

Figure 16-1

Figure 16-2

Figure 16-3

Mode for Carrying Out the Invention

[0029] A promising approach for efficiently delivering a transgene to target cells is the AAV vector cap Subject a pool or library of capsid variants to an in vivo selection process, which is unambiguously by the "survival of the fittest" approach process 4~8 Random oligomeric nucleotides are used to insert short-chain (6-9 amino acids) random peptides into the exposed regions of the capsid surface of an AAV library, which has shown success in identifying new AAV capsid variants with unique properties such as enhanced transduction in target tissues 9、10 A major limitation of AAV libraries is that the final readout of the selection process does not always distinguish between capsids that mediate functional transgene expression and those that do not AAV transduction is a process that includes multiple steps from cell receptor binding and entry to nuclear transport, double-strand synthesis, and ultimately gene and protein expression 11 Recent advances in the conventional AAV library approach called CREATE have enabled the selective isolation of capsids that have been successful in nuclear translocation in the context of Cre-expressing transgenic animals, and a Cre-sensitive AAV genome has been engineered 12 This specification describes a capsid selection system that uses the capabilities of the Cre / loxP system, an example of which is called iTransduce Instead of using Cre transgenic mice, AAV was engineered to encode both a capsid with a peptide insert and a Cre expression cassette together Subsequently, selection of capsids that mediate the entire process of transduction, including transgene expression, was performed in mice using a Cre-sensitive fluorescent reporter to enable selection In vivo selection of the library mediated significant transduction efficiency in the CNS for AAV caps ​​​​​​​​​​Identifying Sid and another capsid that mediates transduction in the inner ear was achieved.

[0030] The inventors used the iTransduce system to mediate highly efficient transgene expression in the mouse CNS (testing two systems respectively) and the inner ear, and isolated two new AAV capsids, designated AAV-F and AAV-S herein. The AAV-F capsid also mediated robust transduction of primary human neurons.

[0031] Interestingly, by using expression-based selection, three peptide clones (STTLYSP (SEQ ID NO: 1), FVVGQSY ( SEQ ID NO: 2), and FQPCP (SEQ ID NO: 3)) that accounted for 97% of the NGS reads were identified. Since FQPCP * had a stop codon * , this genome was thought to have been cross-packaged into another capsid during production. Cross-packaging has been pointed out to occur in AAV libraries . This may also be true for STTLYSP (SEQ ID NO: 1, "AAV-S") (Figure 2). Since AAV-S mediated robust transduction of peripheral organs (Figure 4e) and the inner ear (Figure 15), it was not a defective vector. AAV-S 15 was likely to be cross-packaged because its production efficiency was very high (Table 4). On the other hand, AAV-F (FVVGQSY (SEQ ID NO: 2)) was extremely efficient in transduction and was one of only two promising candidates from NGS (Figure 2). Such candidates were both detectable at very low levels in the round 2 library pool and might have been prone to cross-packaging. and was one of only two promising candidates from NGS (Figure 2). Such candidates were both detectable at very low levels in the round 2 library pool ​(Figure 2). Therefore, the inventors were able to confirm that their enrichment was not due to existing biases.

[0032] The inventors performed iTransduce system validation using an agnostic approach to cell type (whole brain), so it is not surprising that AAV-F was highly tropic for astrocytes and neurons, the cells transduced by AAV9. In future studies, the inventors plan to isolate capsids that can drive Cre expression from AAV library vectors by combining cell-specific promoters and magnetic cell sorting to transduce cells resistant to conventional AAV vector transduction.

[0033] In addition to the ability to select clinical candidate AAV vectors, the iTransduce system can be used to identify vectors for use as research tools. The recently identified AAV-PHP.B capsid serves as an efficient vector for genetically modifying the mouse brain. 12 However, the AAV-PHP.B capsid does not transduce BALB / c or BALB / c-related mouse strains. 13、14、16 Interestingly, robust transduction of the brains of BALB / c and C57BL / 6 mice was observed after intravenous injection of AAV-F. This indicates that the mechanism of enhanced transduction with AAV9 is different between AAV-PHP.B and AAV-F. Also, this enables the use of AAV-F as an efficient tool for CNS research in the widely used BALB / c strain (labome.com / method / Laboratory / Mouse-Strains.html).​​​​​​​​​​​​​​ -Mice-and-Rats.html). Additionally, as shown herein, AAV-F can mediate robust transgene expression in the CNS both after direct injection and after intrathecal bolus injection, and AAV-S can mediate transgene expression in the inner ear.

[0034] To further test AAV-F, future studies in larger animals can be performed, for example, in preclinical studies. Dose escalation studies can be performed to test the dose-related toxicity of AAV-F, as observed in NHP using PHP.B. 14 To enable better cross-species translation of transduction efficiency, iterative rounds of selection can be performed in different species (e.g., mice and then rats). For example, this can be done in mice, followed by loxP-introduced STOP tdTomato transgenic rats. 17 Alternatively, direct selection of the iTransduce library can be performed in transgenic marmosets 18、19 or other non-human non-transgenic primates (Figures 16A and 16B).

[0035] Methods for Identifying Optimized Capsid Sequences A "viral vector library" is a pooled variant of viruses that can promote the clonal isolation of viruses specific for a target cell / tissue / organ of interest under selection pressure (in vivo or in vitro). One limitation of current library technologies is that many of the candidate virus clones have poor transgene expression (the final vector required), ​​​It is not mediated by the function of the vector. The main reason for this limitation is that no strategy has been devised to enable vector selection based on transgene expression. This specification describes a method of using an adeno-associated virus (AAV) vector genome having a two-part expression cassette. The first is a Cre-recombinase cassette under the promoter of interest. The second part is an AAV promoter that drives the expression of the capsid gene, cloned "in cis" relative to the first part of the viral genome. Now, cells that express a reporter gene (e.g., green fluorescent protein) but have loxP / termination sites upstream such that reporter expression is prevented until Cre delivered by the AAV vector removes the termination site are used to select viral vectors for transgene expression (sensitive Cre expression). Reporter gene-positive cells can be isolated, and the recovered AAV capsid sequences will have a higher likelihood of mediating efficient transgene expression. It is that no strategy has been devised to enable vector selection based on transgene expression. This specification describes a method of using an adeno-associated virus (AAV) vector genome having a two-part expression cassette. The first is a Cre-recombinase cassette under the promoter of interest. The second part is an AAV promoter that drives the expression of the capsid gene, cloned "in cis" relative to the first part of the viral genome. Now, cells that express a reporter gene (e.g., green fluorescent protein) but have loxP / termination sites upstream such that reporter expression is prevented until Cre delivered by the AAV vector removes the termination site are used to select viral vectors for transgene expression (sensitive Cre expression). Reporter gene-positive cells can be isolated, and the recovered AAV capsid sequences will have a higher likelihood of mediating efficient transgene expression. Therefore, this specification provides a library construct AAV comprising (i) Cre recombinase driven by a promoter, e.g., the minimal chicken beta-actin (CBA) promoter; (ii) a peptide as described herein, e.g., a random heptamer peptide or a selected heptamer peptide, the sequence encoding which is inserted into the capsid protein, and a promoter (e.g., the p41 promoter)-driven AAV9 capsid sequence downstream of the Cre cassette. Preferably, the peptide is inserted between the sequences encoding amino acids (aa) 588-589 of the capsid without interfering with the function of the virus.

[0036] Therefore, this specification provides a library construct AAV comprising (i) Cre recombinase driven by a promoter, e.g., the minimal chicken beta-actin (CBA) promoter; (ii) a peptide as described herein, e.g., a random heptamer peptide or a selected heptamer peptide, the sequence encoding which is inserted into the capsid protein, and a promoter (e.g., the p41 promoter)-driven AAV9 capsid sequence downstream of the Cre cassette. Preferably, the peptide is inserted between the sequences encoding amino acids (aa) 588-589 of the capsid without interfering with the function of the virus. (aa) 588-589 of the capsid without interfering with the function of the virus.​​​​​​​​ without promoting infection of the selected cells, as long as the activity to promote infection is maintained, at other locations, for example, VP1 / VP2 interface (amino acid 138) or may be inserted at any site from 583 to 590 It may be. The CBA promoter is a strong active promoter that drives Cre in most cell types. The P41 promoter is an AA V-specific native promoter that drives Cap gene expression. Other promoters that can be used include, but are not limited to, these, the synapsin promoter, the GFAP promoter, the CD68 promoter, the F4 / 80 promoter, the CX3CR1 promoter, the CD3 or CD4 promoter, the CMV promoter, the liver-specific promoter. Other examples are listed below. In addition, the construct may contain a stop codon at the ends of the Cre cDNA and the cap DNA. A poly A signal is present after the Cre cassette and the cap cassette. Cre recombinase is known in the art. For example, see Van Duyne, Microbiol Spectr. 2015 Feb;3(1):MDNA3-0014-2014. Figure 1A provides an exemplary library construct. See also, Microbiol Spectr. 2015 Feb;3(1):MDNA3-0014-2014. Figure 1A provides an exemplary library construct.

[0037] Also provided herein is a library (i.e., a composition comprising a plurality of library constructs ). When a random heptamer sequence is used, the library preferably contains constructs encoding all or almost all possible variants of the heptamer.

[0038] The method shown in Figure 1B(i) is for different peptide inserts expressed in the capsid A library containing (e.g., Ai9 transgenic mice), rabbits, rats, or monkeys, etc. administered to a model animal, which may include a reporter sequence, e.g., a fluorescent reporter protein sequence, e.g., upstream of the tdTomato reporter gene, optionally inserted at the Gt(ROSA)26Sor locus with a loxP - flanked STOP cassette. The model animal may be transgenic, or the loxP - flanked STOP cassette upstream of the reporter sequence may be expressed from a second construct, e.g., a second AAV administered to the animal model (e.g., before, after, or simultaneously with the library construct). Any AAV capsid that enters the target cells but does not functionally transduce the cells (does not express Cre) will not turn on reporter expression. Capsids that can mediate functional transduction (express Cre) will turn on tdTomato expression. As shown in Figure 1B(ii), cells are isolated from the target organ (e.g., brain, eye, ear, retina, heart, etc.), and then the transduced cells can be sorted by reporter gene expression and optionally a cell marker. As shown in Figure 1B(iii), capsid DNA is obtained and analyzed, e.g., optionally, by PCR - amplifying sequences from the sorted cells, cloning them back into a library vector, and repackaging for another round of selection. DNA sequencing analysis can be used to monitor the selection process after each round.

[0039] Promoter The library constructs described herein include two promoters, one driving Cre recombinase and the other driving the AAV capsid sequence.

[0040] It includes at least one promoter sequence, such as a so-called "ubiquitous" promoter that drives expression in most cell types, for example, the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer), the chicken beta-actin (CBA) promoter (optionally with an RSV enhancer), the Rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the dihydrofolate reductase promoter, the phosphoglycerol kinase promoter, the phosphoglycerol kinase (PGK) promoter , the EF1 alpha promoter, ubiquitin C (UBC), beta-glucuronidase (GUSB), and the CMV immediate / early gene enhancer / CBA promoter are known in the art.

[0041] The expression of Cre recombinase can also be driven by tissue-specific promoters, such as, among others, tissue-specific promoters of the CNS, liver, heart, snail, retina, or T cells. In some embodiments, tissue-specific promoters of the CNS include the neuron promoter, the macrophage / microglia promoter, and the astrocyte promoter. The synapsin promoter (neuron), neuron-specific enolase (NSE) (neuron), MeCP2 (methyl-CpG-binding protein 2) (neuron), glial fibrillary acidic protein (GFAP) (astrocyte), oligodendrocyte ​​​​​​​​​Dendrocyte transcription factor 1 (Olig1) (oligodendrocyte), CNP (2’,3 ’-cyclic-nucleotide 3’-phosphodiesterase) (broad), or CBh (hyper lid CBA or MVM intron having a CBA promoter) (broad) containing at least one tissue-specific promoter known in the art. For example, see U.S. Patent Application Publication No. 20190032078. Macrophage / microglia promoters include, but are not limited to, the following: C-X3-C motif chemokine receptor 1 (CX3CR1) promoter, CD68 promoter, ionized calcium-binding adapter molecule 1 (IBA1) promoter, transmembrane protein 119 (TMEM119) promoter, spalt-like transcription factor 1 (SALL1) promoter, adhesion G protein-coupled receptor E1 (F4 / 80) promoter, spinal cord proliferative sarcoma virus enhancer, negative control region deleted d1587rev primer-binding site substitution (MND) (negative control region deleted, d1587rev primer-binding site substituted ) promoter, integrin subunit alpha M (ITGAM; CD11b - myeloid cells (neutrophils, monocytes, and macrophages)) promoter. For inner ear expression, the promoter may be, for example, PKG, CAG, prestin, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, oncomod, or myo7A promoter. See Ryan et al., Adv Otorhinolaryngol. 2009; 66: 99-115. See

[0042] ​​​ Reporter protein A number of reporter proteins are known in the art, including the following : Green fluorescent protein (GFP), variants of green fluorescent protein (GFP10), Enhanced GFP (eGFP), TurboGFP, GFPS65T, TagGFP2, mU KGEmerald GFP, Superfolder GFP, GFPuv, destabilized EGFP (dEGFP), Azami Greeen, mWasabi, Clover, mClover3, mNeonGreen, NowGFP, Sapphire, T-Sa pphire, mAmetrine, photoactivatable GFP (PA-GFP), Kaede , Kikume, mKikGR, tdEos, Dendra2, mEosFP2, Dro npa, blue fluorescent protein (BFP), eBFP2, Adurite BFP, mTagB FP, mKalama1, mTagBFP2, shBFP, cyan fluorescent protein (CF P), eCFP, dark cyan (Cerulian) CFP, SCFP3A, destabilized ECFP (dEC FP), CyPet, mTurquoise, mTurquoise2, mTFPI, light switchable CFP2 (PS-CFP2), TagCFP, mTFP1, mMidori ishi-Cyan, aquamarine, mKeima, mBeRFP, LSS-m Kate2, LSS-mKate1, LSS-mOrange, CyOFP1, Sand ercyanin, red fluorescent protein (RFP), eRFP, mRaspberry, mRuby, mApple, mCardinal, mStable, mMaroon11 , mGarnet2, tdTomato, mTangerine, mStrawberr y, TagRFP, TagRFP657, TagRFP675, mKate2, HcRe d, t-HcRed, HcRed-Tandem, mPlum, mNeptune, Ni rFP, Kindling, far-red fluorescent protein, yellow fluorescent protein (YFP), e YFP, destabilized EYFP (dEYFP), TagYFP, Topaz, Venus, S YFP2, mCherry, PA-mCherry, Citrine, mCitrine , Ypet, IANRFP-AS83, mPapaya1, mCyRFP1, mHone ydew, mBanana, mOrange, Kusabira Orange, Kus abira Orange2, mKusabira Orange, mOrange2, mKO K , mKO2, mGrape1, mGrape2, zsYellow, eqFP6 11, Sirius, Sandercyanin, shBFP-N158S / L173I , near-infrared protein, iFP1.4, iRFP713, iRFP670, iRFP682 , iRFP702, iRFP720, iFP2.0, mIFP, TDsmURFP, mi RFP670, Brilliant Violet (BV)421, BV605, BV5 10, BV711, BV786, PerCP, PerCP / Cy5.5, DsRed, D sRed2, mRFP1, pocilloporin, jellyfish GFP, Monst er GFP, paGFP, or phycobilin protein, or any one of them biologically active variant or fragment.

[0043] Kit Also, this specification includes those with or without a random heptamer sequence, as described herein A kit is provided that includes one or more library constructs AAV as described above. Also , the kit may include a construct that includes a loxP flanked STOP cassette upstream of a reporter sequence. It may also be.

[0044] Engineered AAV capsid protein The method modifies the ability of AAV, e.g., AAV1, AAV2, AAV8, or AAV9, to mediate transgene expression when inserted into the capsid of the specified cell. Two peptide sequences were identified. In some embodiments, the peptide comprises a sequence of at least 7 amino acids. In some embodiments, the amino acid sequence comprises at least 4, e.g., 5, 6 or 7 contiguous amino acids of the sequence (STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2)). Peptides containing reverse sequences, e.g., PSYLTTS (SEQ ID NO: 4) and YSQGVVF

[0045] (SEQ ID NO: 5), can also be used. Alternatively, the peptide may comprise at least 4, 5, or 6 contiguous amino acids derived from the sequences shown in FIG. 2A or 7C (SEQ ID NOs: 17-150). It may also contain.

[0046] AAV Viral vectors for use in the methods, kits, and compositions preferably include capsid peptides as described herein and, optionally, transgenes for expression in target tissues. Recombinant retroviruses, adenoviruses, adeno-associated viruses, alphaviruses, and lentiviruses are included.

[0047] A preferred viral vector system useful for nucleic acid delivery in the method is adeno-associated virus (A is an adeno-associated virus (AAV). AAV is a small non-enveloped virus with a 25 nm capsid. No diseases are known or shown to be associated with the wild-type virus. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit long-term episomal transgene expression, and AAV shows excellent transgene expression in the brain, particularly in neurons. The space for exogenous DNA is limited to approximately 4.7 kb. DNA can be introduced into cells using AAV vectors such as those described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985). Various nucleic acids have been introduced into different cell types using AAV vectors (see, for example, Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993)). Numerous alternative AAV variants exist (more than 100 have been cloned), and AAV variants are identified based on desired characteristics. In some embodiments, the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AV6.2, AAV7, AAV8, rh.8, AAV9, rh .10, rh.39, rh.43, or CSp3, and when used in the CNS, some ​​​ In an embodiment, the AAV is AAV1, AAV2, AAV4, AAV5, AAV6, AAV V8, or AAV9. As an example, AAV9 has been shown to cross the blood-brain barrier somewhat efficiently. Using this method, a peptide sequence as described herein can be inserted into the capsid protein, for example, into AAV9 capsid protein VP1 between amino acids 588 and 589, to genetically engineer the AAV capsid to increase permeability across the BBB or to specific tissues.

[0048] An exemplary wild-type AAV9 capsid protein VP1 (Q6JC40-1) sequence is as follows.

[0049]

Chemical formula

[0050] Thus, provided herein is an AAV comprising one or more of the peptide sequences described herein, for example, a capsid protein comprising the sequences described herein, for example, a capsid protein comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the peptide sequence is inserted, for example, into the sequence between amino acids 588 and 589.

[0051] Exemplary AAV sequences are provided below. The inserted peptide sequence is highlighted in bold and double underlined in the protein sequence and in bold and uppercase in the DNA sequence.

[0052] AAV-F capsid protein sequence

[0053]

Chemical formula

[0054]

Chem.

[0055]

Chem.

[0056]

Chem.

[0057]

Chem.

[0058]

Chem.

[0059] The AAV sequence may be, for example, at least 80, 8 5, 90, 95, 97, or 99% identical to the reference AAV sequence shown herein, and, for example, preferably, variants that do not reduce the ability of AAV to mediate transgene expression in cells can be exemplified . To determine the percent identity between two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced into one or both of the first and second amino acid or nucleic acid sequences for optimal alignment, and non-homologous sequences may be ignored for comparison purposes). In preferred embodiments, for comparison purposes, the sequences are aligned using an algorithm that provides a best fit between the sequences being compared. The percent identity between the two sequences is determined by counting the number of positions at which the identical residues occur in both sequences, dividing that number by the total number of positions in the alignment, and multiplying the result by 100 . For example, to align the sequences for optimal comparison purposes, gaps may be introduced into one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences may be ignored for comparison purposes . In preferred embodiments, for comparison purposes, the sequences are aligned using an algorithm that provides a best fit between the sequences being compared. The percent identity between the two sequences is determined by counting the number of positions at which the identical residues occur in both sequences, dividing that number by the total number of positions in the alignment, and multiplying the result by 100 The length of the reference array to be aligned is at least 80% of the length of the reference array, and in some embodiments it is at least 90% or 100%. Then, the amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are compared. Where the position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position (as used herein, amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap (as shown in Equation 1).

[0060] Comparison of sequences and determination of the percentage of identity between two sequences can be achieved using mathematical algorithms For example, the percentage of identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm incorporated into the GAP program of the GCG software package (available on the World Wide Web at gcg.com), using the initial settings of parameters such as a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5, and the Blossum62 scoring matrix.

[0061] Transgene Also, in some embodiments, AAV comprises a transgene sequence (i.e., a heterologous sequence), such as ​​​​, a therapeutic agent as described in this specification or as known in the art, or a fluorescent protein, such as a fluorescent protein, an enzyme that catalyzes a reaction to produce a detectable product, or a transgene encoding a cell surface antigen may be included. The transgene is preferably linked to a sequence that promotes / drives the expression of the transgene in the target tissue.

[0062] Exemplary transgenes for use as therapeutic agents include the following: neuronal apoptosis inhibitory protein (NAIP), nerve growth factor (NGF), glial cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF ), tyrosine hydroxylase (TH), GTP-cyclohydrolase (GTPCH), amino acid decarboxylase (AADC), aspartoacylase (ASPA), β-globin, hemoglobin, tissue plasminogen activator, and blood factors such as coagulation factors; colony-stimulating factor (CSF); interleukin-1 (IL-1), interleukin-2 (IL -2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), etc. interleukins; keratinocyte growth factor (KGF), stem cell factor (SCF), fibroblast growth factor (FGF such as basic FGF and acidic FGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), bone morphogenetic protein (BMP), epidermal growth factor (EGF), growth differentiation factor-9 (GDF-9), hepatoma-derived growth factor (HDGF), myostatin (G DF-8), nerve growth factor (NGF), neurotrophin, platelet-derived growth factor (PD GF), thrombopoietin (TPO), transforming growth factor alpha (TG F-alpha); Growth factors such as F-α) and transforming growth factor beta (TGF-β); soluble TNF -α receptor, soluble VEGF receptor, soluble interleukin receptor (e.g., soluble I L-1 receptor and soluble type II IL-1 receptor), soluble gamma / delta T cell receptor , soluble receptors such as ligand-binding fragments of soluble receptors; enzymes such as α-glucosidase, imiglucarase , and β-glucocerebrosidase; enzyme activators such as tissue plas minogen activator; chemokines such as IP-10, monokine induced by interferon gamma (Mig), Groa / IL-8, RANTES, MIP-1α , MIP-1β, MCP-1, and PF-4; angiogenesis agents such as vascular endothelial growth factor (V EGF, e.g., VEGF121, VEGF165, VEGF-C, VEGF-2), transforming growth factor-beta, basic fibroblast growth factor, glioma-derived growth factor , angiogenin, and angiogenin-2; anti-angiogenesis agents such as soluble VEGF receptor ; protein vaccines; nerve growth factor (NGF), bradykinin, cholecystokinin, gastin, secretin, oxytocin, gonadotropin-releasing hormone, beta-endorphin, enkephalin, substance P, somatostatin , prolactin, galanin, growth hormone-releasing hormone, bombesin, dynorphin, warfarin, neurotensin, motilin, thyrotropin, neuropeptide Y, luteinizing hormone forming hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II , thyrotropin-releasing hormone, vasoactive intestinal peptide, and sleep peptide, etc. ; and substances such as warfarin, neurotensin, motilin, thyrotropin, neuropeptide Y, luteinizing hormone forming hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II , thyrotropin-releasing hormone, vasoactive intestinal peptide, and sleep peptide, etc. Neuronal active peptides; thrombolytic agents; atrial natriuretic peptide; relaxin; glia Fibrous acidic protein; follicle-stimulating hormone (FSH); human alpha-1 antitrypsin in; leukemia inhibitory factor (LIF); transforming growth factor (TGF); tissue factor, luteinizing hormone; macrophage activating factor; tumor necrosis factor (TNF); neutrophil chemotactic factor (NCF); nerve growth factor; tissue inhibitor of metalloproteinase; vasoactive intestinal peptide ; angiogenin; angiotropin; fibrin; hirudin; and IL-1 receptor antagonist and the like. Some other examples of the target protein include the following: ciliary neurotrophic factor (CNTF); neurotrophin 3 and 4 / 5 (NT-3 and 4 / 5); glial cell-derived neurotrophic factor (GDNF); aromatic a mino acid decarboxylase (AADC); coagulation proteins related to hemophilia such as factor VIII, factor IX, factor X, etc.; dystrophin or nini-dystrophin; lysosomal acid lipase; phenylalanine hydroxylase (PAH); glucose-6-phosphatase, acid maltase, glycogen debranching enzyme, muscle glycogen phosphorylase, liver glycogen phosphorylase, muscle phosphofructokinase ase, phosphorylase kinase (e.g., PHKA2), glucose transporter (e.g., GLUT2), aldolase A, beta-enolase, and glycogen synthase and other glycogenosis-related enzymes; lysosomal enzymes (e.g., beta-N-acetylhexosaminidase A); and any variants thereof.

[0063] ​In addition, the transgene may encode an antibody, for example, an immune checkpoint inhibitor antibody against PD-L1, PD-1, CTLA-4 (cytotoxic T lymphocyte-associated protein-4; CD152), LAG-3 (lymphocyte activation gene 3; CD223), TIM-3 (T cell immunoglobulin and mucin domain 3; HAVCR2), TIGIT (T cell immunoreceptor with Ig and ITIM domains), B7-H3 (CD276), VSIR (V-set immune regulatory receptor, aka VISTA, B7H5, C10orf54), BTLA30 (B- and T lymphocyte attenuator, CD272), GARP (glycoprotein A repeat predominant), PVRIG (PVR-related immunoglobulin domain-containing), or VTCN1 (V-set domain-containing T cell activation inhibitor 1, aka B7-H4). Other transgenes may include small or inhibitory nucleic acids that alter / reduce the expression of the target gene, such as siRNA, shRNA, miRNA, antisense oligos, or long non-coding RNAs that alter gene expression (see, for example, WO 2012087983 pamphlet and US Patent Application Publication No. 20140142160), or CRISPR Cas9 / cas12a and guide RNAs. In addition, the virus may contain one or more sequences that promote the expression of the transgene, such as one or more promoter sequences; enhancer sequences such as 5' untranslated regions (UTRs) or 3' UTRs; polyadenylation sites; and / or insulator sequences.

[0064]

[0065] ​​​​​​​​​​​​​​​Alternatively, in some embodiments, the promoter is a tissue-specific promoter of the brain, such as a neuron-specific or glia-specific promoter. In certain embodiments , the promoter is a promoter of a gene selected from neuron nucleus (NeuN), glial fibrillary acidic protein (GFAP ), MeCP2, adenomatous polyposis coli (APC), ionized calcium-binding adapter molecule 1 (Iba-1), synapsin I (SYN), calcium / calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase, and also platelet-derived growth factor beta chain. In some embodiments , the promoter is a pan-cell type promoter, such as, for example, cytomegalovirus (CMV), beta-glucuronidase (GUSB), ubiquitin C (UBC), or ra tus sarcoma virus (RSV) promoter. The woodchuck hepatitis virus post-transcriptional response element (WPRE) can also be used.

[0066] Also, in some embodiments, the AAV has one or more additional mutations that increase delivery to a target tissue, such as the CNS, or reduce tissue off-target, such as , a mutation that reduces liver delivery when CNS, heart, or muscle delivery is intended (e.g., as described in Pulicherla et al. (2011) Mol Ther 19:1070-1078); or for example, Chen et al. (2008) Nat Med 15:1215-1218 or Xu et al., (2005) V irology 341:203-214 or U.S. Patent No. 9,102,949, U.S. Patent No. 95859 ​​As described in the specification No. 71 and U.S. Patent Application Publication No. 20170166926 has the addition of other peptides. Also, available at sfn.org / ~ / media / SfN / Documents / Short%20Course s / 2011%20Short%20Course%20I / 2011_SC1_Gray.ashx. Gray and Samulski (2011) "Vector design and considerations for CNS applications," in Gene Vector D esign and Application to Treat Nervous System Disorders ed. Glorioso J., editor. (Washington, DC: Society for Neuroscience;) See pages 1 - 9

[0067] Method of Use Using the methods and compositions described herein, any composition, e.g., a sequence of interest, can be delivered to a tissue, e.g., the central nervous system (brain), heart, muscle, peripheral nervous system (e.g., dorsal root ganglia or the spinal cord), or the inner ear, or the retina. In some embodiments, the method includes delivery to a specific brain region, e.g., the cortex, cerebellum, hippocampus, substantia nigra, tonsils. In some embodiments, the method includes lumbar delivery, e.g., to the subarachnoid space or epidural space. In some embodiments, the method includes delivery to neurons, astrocytes, or glial cells including. In some embodiments, the method includes delivery to inner and / or outer hair cells, spiral ganglion neurons, supporting cells, or fibrous cells of the inner ear. In some embodiments, the method includes delivery to photoreceptors, interneurons, retinal ganglion cells (e.g., using AAV - F), or includes delivery to the retinal pigment epithelium (RPE) of the retina (e.g., using AAV-S).

[0068] In some embodiments, the methods and compositions, such as AAV, are used to deliver nucleic acid sequences to a subject having a disease, such as a CNS disease. See, for example, U.S. Patent No. 9,102,949, U.S. Patent No. 9,585,971, and U.S. Patent Application Publication No. 2017 / 0166926. In some embodiments, the subject has a condition listed in Tables 1-3. See, for example, U.S. Patent No. 9,102,949, U.S. Patent No. 9,585,971, and U.S. Patent Application Publication No. 2017 / 0166926. In some embodiments, the subject has a condition listed in Tables 1-3. See, for example, U.S. Patent No. 9,102,949, U.S. Patent No. 9,585,971, and U.S. Patent Application Publication No. 2017 / 0166926. In some embodiments, the subject has a condition listed in Tables 1-3. In some embodiments, the vector is used to deliver a therapeutic agent to treat the corresponding disease listed in Tables 1-3. In some embodiments, the vector is used to deliver a therapeutic agent to treat the corresponding disease listed in Tables 1-3. The therapeutic agent may be delivered, for example, as a nucleic acid encoding a therapeutic protein, or other nucleic acids such as antisense oligonucleotides, siRNA, and shRNA via a viral vector, or as a fusion protein / complex with a peptide as described herein. The therapeutic agent may be delivered, for example, as a nucleic acid encoding a therapeutic protein, or other nucleic acids such as antisense oligonucleotides, siRNA, and shRNA via a viral vector, or as a fusion protein / complex with a peptide as described herein. The therapeutic agent may be delivered, for example, as a nucleic acid encoding a therapeutic protein, or other nucleic acids such as antisense oligonucleotides, siRNA, and shRNA via a viral vector, or as a fusion protein / complex with a peptide as described herein. The therapeutic agent may be delivered, for example, as a nucleic acid encoding a therapeutic protein, or other nucleic acids such as antisense oligonucleotides, siRNA, and shRNA via a viral vector, or as a fusion protein / complex with a peptide as described herein.

[0069] Using the methods and compositions described herein, such conditions in a subject in need thereof can be treated by administering a therapeutically effective amount of AAV carrying a transgene sufficient to improve one or more symptoms, reduce the risk, or delay the onset of the condition. Using the methods and compositions described herein, such conditions in a subject in need thereof can be treated by administering a therapeutically effective amount of AAV carrying a transgene sufficient to improve one or more symptoms, reduce the risk, or delay the onset of the condition. Using the methods and compositions described herein, such conditions in a subject in need thereof can be treated by administering a therapeutically effective amount of AAV carrying a transgene sufficient to improve one or more symptoms, reduce the risk, or delay the onset of the condition. Using the methods and compositions described herein, such conditions in a subject in need thereof can be treated by administering a therapeutically effective amount of AAV carrying a transgene sufficient to improve one or more symptoms, reduce the risk, or delay the onset of the condition.

[0070] [Table 1]

[0071] [Table 2]

[0072]

Table 3

[0073] Pharmaceutical Composition and Administration Method The methods described herein include the use of a pharmaceutical composition comprising AAV as an active ingredient.

[0074] The pharmaceutical composition typically includes a pharmaceutically acceptable carrier. As used herein, the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delaying agents, etc., and is compatible with drug administration.

[0075] The pharmaceutical composition is typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intraarterial, subcutaneous, intraperitoneal, intrathecal, intramuscular, or injection or infusion administration. Thus, delivery may be systemic or local. For example, when delivering to the inner ear, it can be applied through or over the round window membrane, through a surgical cochleostomy perforation adjacent to the round window, through the window of the bony oval window, or through the semicircular canal for delivery to the cochlea (see, for example, Kim et al., Mol Ther Methods Clin Dev. 2019 Jan 11;13:197-204; Ren et al., Front Cell Neurosci. 2019; 13: 323); when delivering to the retina, subretinal or intravitreal injection can be used (see, for example, Ochakovski et al., Front Neurosci. 2017; 11: 174; Xue et al., Eye (Lond). 2017 Sep;31(9):1 See 308-1316.

[0076] Methods for formulating suitable pharmaceutical compositions are known in the art and are described, for example, in Remi ngton: The Science and Practice of Pharmacy, 21st ed., 2005; and Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY) series of books. For example, solutions or suspensions for parenteral application may contain the following components: sterile diluents such as water for injection, saline solution, fixed oils, polyethylene glycol glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite ; chelating agents such as ethylenediaminetetraacetic acid; buffering agents such as acetate, citrate , or phosphate; and agents for adjusting tonicity such as sodium chloride or dextrose. The pH can be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions

[0077] and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In the case of intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremoph or EL (trademark) (BASF, Parsippany, NJ) or phosphate buffered saline. Examples include phosphate buffered saline (PBS). In all cases, the composition should be sterile and fluid to the extent that easy injectability exists. The composition should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium including water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, in the case of dispersions, by the maintenance of the required particle size, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. In many cases, it will be preferable to include in the composition isotonic agents such as sugars; polyhydric alcohols such as mannitol and sorbitol; sodium chloride. Prolonged absorption of the injectable composition can be brought about by including in the composition an agent that delays absorption such as aluminum monostearate and gelatin. and should not be subject to contamination by microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium including water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, in the case of dispersions, by the maintenance of the required particle size, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. In many cases, it will be preferable to include in the composition isotonic agents such as sugars; polyhydric alcohols such as mannitol and sorbitol; sodium chloride. Prolonged absorption of the injectable composition can be brought about by including in the composition an agent that delays absorption such as aluminum monostearate and gelatin.

[0078] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound with one or a combination of the ingredients enumerated above in an appropriate solvent, followed by filter sterilization if necessary. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains the basic dispersion medium and the other ingredients required from those enumerated above. Sterile ​​​​​For sterile powders for preparing injectable solutions, preferred preparation methods are vacuum drying and freeze drying, which yield powders of the active ingredient and any additional desired ingredients from a previously sterile filtered solution.

[0079] In one embodiment, the therapeutic compound is prepared using carriers that prevent rapid elimination of the therapeutic compound from the body, such as controlled release formulations including implants and microencapsulation delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyoesters, and polylactic acid can be used. Such formulations can be prepared using standard techniques or can be obtained commercially, for example, from Alza Corporation and Nova Pharmaceu ticals, Inc. Liposome suspensions (including liposomes targeting selected cells having monoclonal antibodies against cell antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as described in U.S. Patent No. 4,522,811. The pharmaceutical composition may be included in a kit, container, pack, or dispenser, together with instructions for administration. For example, the kit may include a composition comprising AAV containing the peptide as described herein.

[0080] The present invention is further described in the following examples and is as set forth in the claims herein.

Examples

[0081] The invention is further described in the following examples and is The scope of the invention is not limited thereby.

[0082] Substances and methods Unless otherwise stated, the following substances and methods were used in the following examples.

[0083] AAV library construction iTransduce plasmid: pAAV-CBA-Cre- mut -p41-Ca p9del The inventors constructed an iTransduce library backbone plasmid called pAAV-CBA-Cre mut -p41-Cap9del. This contains two expression cass sets: 1) a mutant Cre cDNA under the ubiquitous promoter CBA by the inventors (CCG->CCT, encoding the Pro15 amino acid, but eliminating the originally existing AgeI site) was introduced into CBA-Cre (CCG->CCT, encoding the Pro15 amino acid, but eliminating the originally existing AgeI site) was introduced into CBA-Cre was introduced, 2) the AAV9 capsid gene (residues 1680 to 1 mut under the AAV5 p41 promoter of GenBank AF085716.1) and the splicing sequence of the AAV2 rep gene ( as described in 12 ) and p41-Cap9del composed of the same is included in cis. The mutant Cre cDNA (C

[0084] re re mut ) and the p41-CAP9(del)-polyA fragment flanked by KpnI and SalI restriction sites were both synthesized by GenSc ript and cloned into the puC57 backbone. The inventors first opened the ring of our pAAV-CBA-WPRE backbone (with NcoI-blunt / SalI and thereby eliminated the originally existing eGFP-WPRE fragment) of eGFP-WP Instead of RE, the mutated Cre cDNA (fragment KpnI-blunt, SalI) Subcloning into pAAV-CBA-Cre mut -Poly A Plasmid We then constructed K449R, which allows for the creation of a unique XbaI site. The mutation was carried in the Cap9 sequence and the 447 The p41-Cap9del fragment, in which the bp Cap sequence was deleted, was introduced.

[0085] To generate random heptamer peptide cap fragments and to be recovered by PCR Plasmid for subcloning CAP9 fragment: pUC57-Cap9-Xba I / KpnI / AgeI First, the present inventors cloned 447 of the AAV9 capsid sequence between the XbaI site and AgeI site. bp region (pAAV-CBA-Cre mut -Sequences missing from p41-Cap9del ) was synthesized by Genscript (Piscataway, NJ). The capsid sequence was then subcloned into the pUC57-Kan plasmid. So, we used WT AAV9 as described by Deverman et al. (2015). The EarI site in the WT AAV9 cap allows for restriction digestion removal of this 447 bp region has been similarly removed. This also creates a unique KpnI site. The Cap9-XbaI / KpnI / AgeI cap fragment was used to clonalize AAV9 VP1. A random 21-mer inserted between the nucleotides encoding amino acids 588 and 589 An initial library of nucleotide sequences (encoding 7-mer peptides) was generated. The inventors used a strategy similar to that of Deverman et al. (2015). Briefly, pUC57-Cap9-XbaI / KpnI / AgeI served as a template for amplifying the cap DNA and inserting a random 21-mer sequence using forward and reverse primers. Primer information: XF-extend (5’GT ACTATCTCTCTAGAACtattaacggttc3’; SEQ ID NO: 11) and the reverse primer 588iRev 5’(GTATTCCTTGGTTTTGAAC CCAACCGGTCTGCGCCTGTGCXMNNMNNMNNMNNMNNMNN MNNTTGGGCACTCTGGTGGTTTGTG3’; SEQ ID NO: 12). In the sequence, the MNN repeats refer to randomized 21-mer nucleotides (purchased from IDT). XF-ext end and 588iRev were used for PCR with Phusion polymerase (NEB) and pUC57-Cap9-XbaI / KpnI / AgeI as the template. The 447 bp PCR product was digested overnight at 37°C with XbaI and AgeI, and the product was gel purified (Qiagen). Similarly, pAAV-CBA-Cre- -p41 -Cap9del was digested with XbaI and AgeI and gel purified. Next, a ligation reaction (1 hour at room temperature) with T4 DNA ligase (NEB) was performed using a 3:1 cap insert to vector molar ratio. The subsequent ligated plasmid was named pAAV-CBA-Cre- -p41-Cap9-7-mer and contained a random mut -p41 insert in the cap gene between nucleotides encoding 588 and 589 of AAV 9 VP1, and was mut -p41-Cap9-7-mer, encoding a random insert in the cap gene between nucleotides encoding 588 and 589 of AAV 9 VP1. It contained a pool of plasmids into which 7 body peptides were inserted.

[0086] This plasmid (pUC57-Cap9-XbaI / KpnI / AgeI) was used by the inventors as a recipient plasmid for subcloning the CAP9 fragment amplified by PCR from brain tissue. The inventors also used it as a recipient plasmid for subcloning the CAP9 fragment amplified by PCR from brain tissue. The inventors digested with SacI and NsiI and ligated to remove the upstream KpnI site of the pUC57 plasmid. This made it possible to uniquely identify the KpnI site of the capsid fragment. See the following. The inventors digested with SacI and NsiI and ligated to remove the upstream KpnI site of the pUC57 plasmid. This made it possible to uniquely identify the KpnI site of the capsid fragment. See the following.

[0087] Rep expression plasmid The inventors used a strategy similar to that of Deverman et al. 12 to construct a rep expression plasmid called pAR9-Cap9 -stop / AAP / Rep. The entire cDNA was synthesized by Genscript and cloned into the pUC57-Kan plasmid. The entire cDNA was synthesized by Genscript and cloned into the pUC57-Kan plasmid. Stop codons were inserted in place of the start codons of VP1, VP2, and VP3, so the parental AAV9 capsid was not produced, but the expression of AAP and rep was maintained. Stop codons were inserted in place of the start codons of VP1, VP2, and VP3, so the parental AAV9 capsid was not produced, but the expression of AAP and rep was maintained.

[0088] AAV library production and purification For each production, the inventors seeded 1.5×10 7 293T cells / dish in 15-cm tissue culture dishes. The next day, using the calcium phosphate method, the adenovirus helper plasmid (pAdΔF6, 26 μg per plate), the rep plasmid (pAR9-Cap9 -stop / AAP / Rep, 12 μg per plate), and the ITR-adjacent AAV library (pAAV-CBA-Cre-mut / p41-Cap9-7-mer, 1 plate Cells were transfected with 1 μg of each construct to induce AAV production. The day after transfection the medium was replaced with DMEM containing 2% FBS. AAV was purified from cell lysates using iodixanol density gradient ultracentrifugation. ZEBA spin columns (7K MWCO; Thermo Fisher Scientific) were used to perform buffer exchange into PBS, and further concentration was performed using an Amicon Ultra 100 kDa MWCO ultrafiltration centrifugal device (Millipore). Vectors were stored at -80 °C until use. We used TaqMan qPCR with ITR sequence-specific primers and probes to quantify the AAV genome copy number (vg) in AAV preparations 。 。 。 20、21 。

[0089] Next-generation sequencing of libraries Next-generation sequencing was performed on a plasmid AAV9 library pool to track capsid packaging. Sequencing was also performed following PCR rescue of the cap fragment (from either brain tissue or isolated tdTomato-positive cells sorted by flow cytometry). In each round of selection, viral DNA corresponding to the insert-containing region was amplified by PCR using the Phusion High-Fidelity PCR kit from New England Biolabs (forward primer: 5’-AATCCTGGACCTGCTATGGC-3’ (SEQ ID NO: 13) reverse primer: 5’-TGCCAAACCATACCCGGAAG-3’ (SEQ ID NO: 14)). PCR amplification was performed using Q5 polymerase (New England Biolabs) 。 。 It was carried out using bs). A unique barcode adapter was annealed to each sample, and the samples were sequenced on an Illumina Miseq (150 bp reads). Approximately 50 - 100,000 reads per sample were analyzed. The sequencing output files were first quality - checked using FastQC (bioinformatics.babraham.ac.uk / projects / fastqc / ) and then analyzed with a program written in Python. Briefly, the sequences were sorted based on the presence or absence of inserts, and then the insert - containing sequences were compared to a baseline reference sequence, and error - free reads were tabulated based on the incidence of each detected unique insert. The inserts were translated and normalized.

[0090] Animal All animal experiments were approved by the Research Animal Care Sub - Committee of Massachusetts General Hospital in accordance with the guidelines set forth in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The inventors used adult - aged (8 - 10 weeks old) Ai9 (strain number 007909), C57BL / 6 (strain number 000664), and BALB / c (strain number 000651) mice. All of these were from The Jackson Laboratory, Bar Harbor, Maine. All animals were euthanized 3 weeks after injection and perfused transcardially. Tissues were harvested and fixed in 4% paraformaldehyde in PBS, snap - frozen in liquid nitrogen, or separated for flow cytometry.

[0091] In vivo selection of brain - tropic capsids ​​​​​​​​​​​​​​​To the Ai9 mice, the dose shown in the results section with the unit of vg was intravenously (tail vein ) injected, and the mice were euthanized 3 weeks after injection, and tissues were collected.

[0092] The mice were deeply anesthetized with isofluorane and decapitated. For round 1 , the brain was quickly dissected, and two coronal sections (2 mm thick) were collected. One section was used to extract total brain DNA (DNeasy Blood and Tissue Kits , Qiagen, Hilden, Germany). The other coronal section was fixed with 4% PFA and paraffin-embedded for immunohistology (tdTomato positive cells were detected by DAB staining using a rabbit anti-RFP antibody from Rockland Immunochemicals after each selected round). Then, for round 2, the brain tissue was cut into 1 mm slices with a scalpel blade and the neurons were isolated by Papain Dissociation 3 Small System (Worthington) according to the manufacturer's instructions. After isolation , myelin was removed (Miltenyi's myelin removal beads II, human, mouse, rat ), and Td-tomato positive cells were sorted with an S3eTM cell sorter (Bio-Rad). First, the gates were set to exclude cell debris, and the cells were sorted by selecting only singlets . Cell suspensions from Ai9 (positive control) injected with AAV9-PHP.B-Cre and Ai9 mice injected with PBS (negative control) were used to set the gates, and tdTomato positive and negative cells were sorted. After sorting, the tdTomato positive cells were immediately pelleted by centrifugation, and ARCTURUS PicoPure was used. tdTomato positive and negative cells were sorted. After sorting, the tdTomato positive cells were immediately pelleted by centrifugation, and ARCTURUS PicoPure DNA was extracted using a DNA extraction kit (ThermoFisher).

[0093] After DNA extraction, the Cap9 insert (containing a 21-mer sequence encoding a heptameric peptide ) was amplified using the following primers: Cap9_Kpn / Age_For: 5’ -AGCTACCGACAACAACGTGT-3’ (SEQ ID NO: 15) and Cap9_ Kpn / Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ (SEQ ID NO: 16) (Phusion High-Fidelity PCR kit, New England Biolabs). The amplicon was then purified (Monarch PCR&DNA Cleanup kit, New England Biolabs), digested with K pnI, AgeI, BanII, and the Cap9 KpnI-AgeI fragment (144b p) was purified by agarose gel (Monarch DNA Gel Extraction kit, New England Biolabs), and then ligated into pUC57-Cap9-XbaI / AgeI / K pnI plasmid (opened with KpnI and AgeI and dephosphorylated with Calf inositol pho sphatase. New England Biolabs). The ligation product was transformed into electrocompetent DH5 alpha bacteria ( New England Biolabs), and the entire transformant was grown overnight in LB-ampicillin medium. The pUC57-Cap9-XbaI / AgeI / Kpn I plasmid was purified by maxi prep (Qiagen). The plasmid was digested with Xba I / AgeI to release a 447bp cap fragment, which was gel purified and then the following la ter ... For the production of the UncAAV library, it was ligated to similarly digested pAAV-CBA-Cre- mut / p41-Cap9del.

[0094] AAV rep / cap plasmid containing AAV-F and AAV-S peptide inserts To produce a vector encoding the transgene of interest (e.g., GFP), a rep / cap plasmid encoding an AAV9 capsid presenting the peptide insert of interest was generated. To do so, the inventors removed adjacent fragments at the VP3 amino acid 588 site for peptide sequence insertion using BsiWI and BaeI to digest the AAV9 rep / cap plasmid. Next, the inventors ordered a 997 bp dsDNA fragment from Integrated DNA Technologies (IDT, Coralville, IA) containing Gibson homology arms overlapping with BsiWI / BaeI-digested A AV9, as well as a 21-mer nucleotide sequence encoding the peptide of interest in-frame after amino acid 5 88 of VP3. Finally, the inventors performed Gibson Assembly using Gibson Assembly (registered trademark) Master Mix (NEB, Ipswich, MA) to ligate the peptide-containing insert to the AAV9 rep / cap plasmid. AAV vectors for transduction analysis For each production, the inventors seeded 1.5 × 10 cells / dish in 15 cm tissue culture dishes. The next day, using the calcium phosphate method, the adenovirus helper plasmid

[0095] of 293T cells / dish 7 in a 15 cm tissue culture dish. was seeded. The next day, using the calcium phosphate method, the adenovirus helper plasmid ​​(pAdΔF6, 26 μg per plate), rep / cap plasmid (AAV9, AAV-F, AAV-S; 12 μg per plate), and ITR flanking transgene ca set plasmid (single-stranded AAV-CBA-GFP-WPRE 22 , 10 μg per plate) were transfected into cells to induce AAV production. The day after transfection, the medium was replaced with DMEM containing 2% FBS. AAV was purified from cell lysates using iodixanol density gradient ultracentrifugation. ZEBA spin columns ( 7K MWCO; Thermo Fisher Scientific) were used for buffer exchange into PBS, and further concentration was performed using an Amicon Ultra 100 kDa MWCO ultrafiltration centrifugation device (Millipore). The vector was stored at -80 °C until use. The inventors quantified the AAV genome copy number in the AAV preparation using TaqMan qPCR with BGH polyA sequence-specific primers and probes. 23 .

[0096] Animal euthanasia and tissue collection Mice (strains shown in each figure) were slowly injected with 200 μl of the test AAV vector diluted with sterile PBS (low dose: 4×10 12 vg / kg and high dose: 3.2×10 13 vg / kg ) via the lateral tail vein, and then the injection site was gently pinched with a finger until bleeding stopped. Three weeks after injection, the mice were euthanized and perfused transcardially with sterile chilled phosphate-buffered saline ( PBS). Next, the brain was bisected longitudinally into two hemispheres. One hemisphere was Fixed post for 48 hours with 15% glycerol / 4% paraformaldehyde diluted with PBS and then cryopreserved with 30% glycerol for an additional 48 - 72 hours. Also, in the high - dose cohort, for immunohistology, small pieces of heart, muscle (gastrocnemius), and retina were processed. The inventors produced three independent preparations of AAV - S, AAV - F, and AAV9 (Table I). The transduction results in mice were from one preparation of each vector but the inventors reproduced such results in two additional independent experiments.

[0097] Immunohistology and high - magnification images of AAV - CBA - GFP - transduced neurons and neuronal cell populations Using a cryostat microtome, coronal floating sections (40 μm) were cut. After washing away glycerol with Tris - buffered saline (TBS) buffer, the frozen sections were permeabilized with 0.5% Triton X - 100 (AmericanBio) in TBS for 30 minutes at room temperature and blocked with 5% normal goat serum (or normal donkey serum) and 0.05% Triton in TBS for 1 hour at room temperature. The primary antibodies were incubated overnight at 4°C in TBS containing 2.5% NGS and 0.05 % Triton, and the next day, Alexa Fluor488 or - Cy3 - conjugated secondary antibodies (Jackson Immun oResearch Laboratories, Baltimore, USA) were incubated for 1 hour at room temperature. The primary antibodies used in this study were chicken anti - GFP (Aves Labs, Tigard, USA), mouse anti - NeuN (EMD Millipore, Burlington, USA); rabbit anti - glutamine synthetase (Abcam, Cambridge, USA); rabbit ​​​​​Anti-Olig2 (EMD Millipore, Burlington, USA); rabbit anti-Iba1 (Wako, Japan); rabbit anti-CamKII (Abcam, Cambridge, USA); mouse anti-GAD67 (EMD Millipore, Burlington, USA); rabbit anti-ChAT (EMD Millipore, Burlington, USA); mouse anti-calbindin (Ab cam, Cambridge, USA); and rabbit anti-TH (Novus Biologicals ls, Littleton, USA). Sections were mounted with Vectashield mounting medium containing DAPI (Vector Laboratories, Burlingame, USA).

[0098] To identify the neuronal cell types transduced by each vector and investigate the various neuron subtypes targeted by AAV-F, high-resolution images showing the co-localization of GFP and each cell marker were taken using AxioVision software and a Zeiss Axio Imager Z epifluorescence microscope equipped with a 60× objective lens.

[0099] Imaging and quantification of global GFP signal coverage To quantify the overall native GFP fluorescence signal in brain and liver sections, a robotic slide scanner virtual microscope VS120 (Olympus) was used, and the entire batch of slides was imaged at once using an Olympus UPLSAPO 10× objective lens. To reduce variability, the entire batch of slides was imaged in one session. The initial exposure time for GFP was set so that the fluorescence signal was neither saturated nor undersaturated across all experimental groups and was maintained without variation across the entire batch scan ​​​It was done. The order of the slides was randomized, and blinding was maintained until the final statistical analysis. Then, Ol Using Olympus cellSens Standard software, the GFP coverage percentage of each brain compartment was analyzed. First, the region of interest (ROI) was defined using the "ROI-po lygon" tool. The inventors applied a similar detection threshold to the GFP channels of all the slides analyzed and then quantified the GFP-positive area within this initial ROI (the threshold was set to a similar level for the analysis of all mouse brain sections, but different thresholds were applied for the analysis of all mouse liver sections and all rat brain sections). Then the percentage of the GFP-positive area corresponding to the total surface of the ROI was calculated. Since the inventors set a threshold for the eGFP fluorescence intensity above the autofluorescence level, autofluorescence signals were taken into account in the inventors' analysis (to ensure that only signals from AAV-GFP-transduced cells were considered). In addition, since there was a possibility of showing a high level of autofluorescence, each ROI of each brain section was set avoiding the area closest to the ends of the sections. Also, the ventricular cavities were excluded from the inventors' analysis. Finally, three technical replicates (brain sections) per mouse were measured, and all measurements were performed blindly until the final step of the analysis. Stereological-based quantitative analysis of the percentage of transduced astrocytes and neurons After co-staining brain sections with GFP and NeuN (neuron marker) or GFP and GS (glutamine synthetase, a pan-astrocyte marker), stereological-based studies were performed as previously described . The inventors performed microglia and o As there was a possibility of showing a high level of autofluorescence, each ROI of each brain section was set avoiding the area closest to the ends of the sections. Also, the ventricular cavities were excluded from the inventors' analysis. Finally, three technical replicates (brain sections) per mouse were measured, and all measurements were performed blindly until the final step of the analysis. excluded from the inventors' analysis. Finally, three technical replicates (brain sections) per mouse were measured, and all measurements were performed blindly until the final step of the analysis. Stereological-based quantitative analysis of the percentage of transduced astrocytes and neurons

[0100] After co-staining brain sections with GFP and NeuN (neuron marker) or GFP and GS (glutamine synthetase, a pan-astrocyte marker), stereological-based studies were performed as previously described After co-staining brain sections with GFP and NeuN (neuron marker) or GFP and GS (glutamine synthetase, a pan-astrocyte marker), stereological-based studies were performed as previously described studies were performed as previously described 24、25 as described previously. The inventors performed microglia and o Oligodendrocytes were not included in this analysis because a substantial amount of these cell types was not transduced. Stereological evaluation of the percentage of AAV-transduced neurons and astrocytes was performed blindly using the motorized stage of an Olympus BX51 epifluorescence microscope equipped with a DP70 digital CCD camera, an X-Cite fluorescence lamp, and the attached CAST stereology software version 2.3.1.5 (Olympus, Tokyo, Japan) after blinding to what the initial injected vector was. First, the cortex was outlined under a 4× objective lens. Random sampling of the selected area was defined using the optical dissector probe of the CAST software. To assess the percentage of astrocytes or neurons transduced with AAV9, AAV9-PHP.B, AAV-S, and AAV-F, 10% of the cortical surface for “high transduction” AAV and 20% for “low transduction” AAV were serpentinely sampled (taking into account the low frequency of GFP-positive cells in such cases), and stereology- based counting was performed. For each counting frame, the total number of astrocytes (GS-positive cells) or neurons (NeuN-positive cells), and the percentage of GFP-positive cells in each of those populations were evaluated. Only glial and neuronal cells with DAPI-positive nuclei within the counting frame were considered.

[0101] Vector genome quantification in the brain and liver To isolate the AAV genome for in vivo distribution of the vector genome, small pieces of one cerebral hemisphere and the liver were freshly frozen. For freshly frozen brain and liver samples, we The y Blood and Tissue Kit (Qiagen) was used according to the manufacturer's instructions to isolate genomic and AAV vector DNA from 10 mg of tissue. The DNA was quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). Next, the inventors performed Taqman qPCR using 50 ng of genomic DNA as a template with probes and primers for the polyA region of the transgene expression cassette (the same assay used for titer measurement of the purified AAV vector). To ensure equal genomic DNA input for each sample, the inventors performed separate qPCR for each sample using a Taqman probe and primer set (Thermo Fisher Scientific, assay ID Mm01180221_g1, gene symbol Gm12070) that detects GAPDH genomic DNA. For each organ / tissue, the inventors adjusted the AAV vector genomic copy number for each sample by taking into account any differences in GAPDH Ct values using the following formula: (AAV vector genomic copy number) / (2). The ΔCt value was calculated using the following formula: GAPDH Ct value of the target sample - average GAPDH Ct value (highest Ct value) of the sample with the lowest amount of GAPDH. The data was represented as the number of AAV vector genomes per 50 ng of genomic DNA. to isolate genomic and AAV vector DNA from 10 mg of tissue. The DNA was quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Scientif ic). Next, the inventors performed Taqman qPCR using 50 ng of genomic DNA as a template with probes and primers for the polyA region of the transgene expression cassette and the same assay used for titer measurement of the purified AAV vector). To ensure equal genomic DNA input for each sample, the inventors performed separate qPCR for each sample using a Taqman probe and primer set that detects GAPDH genomic DNA (Thermo Fisher Scientific, assay ID Mm011 80221_g1, gene symbol Gm12070). For each organ / tissue, the inventors adjusted the AAV vector genomic copy number for each sample by taking into account any differences in GAPDH Ct values using the following formula: (AAV vector genomic copy number) / (2 ) ΔCt to account for any differences in GAPDH Ct values and the AAV vector genomic copy number for each sample was adjusted. The ΔCt value was calculated using the following formula: GAPDH Ct value of the target sample - average GAPDH Ct value (highest Ct value) of the sample with the lowest amount of GAPDH. The data was represented as the number of AAV vector genomes per 50 ng of genomic DNA. The ΔCt value was calculated using the following formula: GAPDH Ct value of the target sample - average GAPDH Ct value (highest Ct value) of the sample with the lowest amount of GAPDH (the highest Ct value). The data was represented as the number of AAV vector genomes per 50 ng of genomic D NA.

[0102] Human neuron transduction: Primary human fetal neural stem cells (NSCs) were obtained in full compliance with NIH ethical guidelines from the Birth Defects Research Laboratory (Washington University It was obtained from the University of Washington, Seattle. The isolation procedure was used with minor modifications as previously described in detail. Briefly, the brain tissue was incubated for 45 minutes in 0.25% trypsin, DNase (90 units / mL) diluted with Hank's balanced salt solution (HBSS). The tissue was titrated and transferred to heat-inactivated fetal bovine serum at 4°C and centrifuged at 500 g for 20 minutes. The pellet was resuspended in NSC complete medium composed of x-Vivo15 (without phenol red and gentamicin; Lonza) supplemented with 10 μg of basic fibroblast growth factor (Life Technologies), 100 μg of epidermal growth factor (Life Technologies), 5 μg of leukemia inhibitory factor (EMD Millipore), 60 ng / mL of N-acetylcysteine (Sigma-Aldrich), 4 mL of neural survival factor-1 supplement (Lonza), 5 mL of 100×N-2 supplement (Life Technologies), 100 U of penicillin, 100 μg / mL of streptomycin (Life Technologies), and 2.5 μg / mL of fungizone (Life Technologies). Subsequently, the supernatant was filtered through a 40 μm cell strainer (Corning Life Science). Neurospheres with a diameter larger than 40 μm were separated with Accutase (for 10 minutes). The neural differentiation medium was composed of 1×Neurobasal medium, 2% B-27 serum-free supplement, and 2 mM GlutaMAX-I supplement (all from Invitrogen) and was supplemented with human recombinant brain-derived neurotrophic factor (BDNF) (10 ng / mL; Peprotech). thing 26 with minor modifications in 0.25% trypsin, DNase (90 units / mL) diluted with Hank's balanced salt solution (HBSS). The tissue was titrated and transferred to heat-inactivated fetal bovine serum at 4°C and centrifuged at 500 g for 20 minutes. The pellet was resuspended in NSC complete medium composed of 10 μg of basic fibroblast growth factor (Lif e Technologies), 100 μg of epidermal growth factor (Life Techno logies), 5 μg of leukemia inhibitory factor (EMD Millipore), 60 ng / mL of N-acetylcysteine (Sigma-Aldrich), 4 mL of neural survival factor -1 supplement (Lonza), 5 mL of 100×N-2 supplement (Life T echnologies), 100 U of penicillin, 100 μg / mL of streptomycin (Life Technologies), and 2.5 μg / mL of fungizone (Life Technologies), and supplemented with x-Vivo15 (without phenol red and gentamicin; Lonza). Subsequently, the supernatant was filtered through a 40 μm cell strainer (Corning Life Sc ience). Neurospheres with a diameter larger than 40 μm were separated with Accut ase (for 10 minutes). The neural differentiation medium was composed of 1×Neurobasal medium, 2% B-27 serum-free supplement, and 2 mM GlutaMAX-I supplement (all from Invitrogen) and was supplemented with human recombinant brain-derived neurotrophic factor (BD NF) (10 ng / mL; Peprotech). ​

[0103] Growing the differentiating NSCs in the differentiation medium of the chamber slide for 2 weeks, and then the designated AAV vector encoding GFP (added at 7×10 9vg / well, 150 vg / cell ) was used for treatment. One week after transduction, the cells were fixed with 4% paraformaldehyde and permeabilized with 0.05% Triton X- 100 (Sigma-Aldrich) in 1× phosphate-buffered saline (PBS; Invitrogen). The cells were stained with the primary monoclonal antibody ( TU-20) against neuron-specific class IIIβ-tubulin (1:50; Abcam). The secondary antibody conjugated to Alexa Fluor594 (diluted 1:200; Invitro gen) was added for 1 hour, followed by the addition of DAPI for 30 minutes. Then, the slides were mounted using ProLong antifade reagent (Invitro gen). Maximum projection images were generated from the Z-stack images captured using a Nikon A1R confocal microscope. The Z-stack was loaded into Imaris and the images were rendered into 3D volumes using the surface module. GFP+ neurons (channel 1 - green) and class IIIβ-tub ulin-positive neurons (channel 2 - red) were counted. The Imaris colocalization module was used to determine the double-positive neuron population for the above.

[0104] Statistics Statistical analysis of the data was performed using GraphPad Prism software (version 8.0 0). One-way ANOVA followed by Tukey's multiple comparison test was performed for the above.

[0105] Statistics Statistical analysis of the data was performed using GraphPad Prism software (version 8.0 0). One-way ANOVA followed by Tukey's multiple comparison test was performed, Performed across different groups AAV9, AAV9-PHP.B, AAV-S, and AAV-F. Values of p < 0.05 were considered statistically significant. Results are shown as mean ± S.E.M . Similar analyses were performed for the in vivo distribution assay of the AAV genome in the brain and liver, as well as for the transduction of human neurons .

[0106] Direct stereotactic injection of the vector Adult C57BL / 6 mice were anesthetized by intraperitoneal injection of ketamine / xylazine (100 mg / kg and 50 mg / kg body weight, respectively), and positioned in a stereotactic fixation frame (Kopf Instruments, Tujunga, USA). Injections of the vector were performed in the cortex (somatosensory cortex) and hippocampus. A total of 3 μl of the virus suspension was injected at a rate of 0.15 μl / min (1.65×10 and 5.6×10 gc for each injection site of AAV-F and AAV-S), using a 33-gauge sharp needle attached to a 10 μl Hamilton syringe (Sigma-Ald rich, St. Louis, USA). The stereotactic coordinates of the injection sites were calculated from bregma (cortex coordinates: anteroposterior -1 mm, mediolateral ±1 mm, and dorsoventral -0.8 mm; hippocampus coordinates: anteroposterior -2 mm, mediolateral ±1.7 mm, and dorsoventral -2 .5 mm). 10 10 . .

[0107] Intrathecal bolus delivery (IT bolus) Adult C57BL / 6 mice were anesthetized with isoflurane. After shaving and cleaning the skin in the lumbar region, a 3 - 4 cm mid-sagittal incision was made in the skin to expose the muscle and spine . A catheter was inserted between the L4 - L5 spinal regions, and an airtight Hamilton syringe with a 33-gauge steel needle was used ​​​​​​Attached to a syringe. 10 microliters of AAV9-CBA-GFP (1.25×1 0 11 vg) vector or AAV-F-CBA-GFP (8.8×10 10 vg) was slowly injected at a rate of 2 μl / min. The mice were sacrificed 3 weeks after injection.

[0108] For low magnification imaging of the entire spinal cord and brain sections, the inventors stained overnight with anti-GFP (Invitro gen, catalog number G10362, diluted 1:250), followed by secondary antibody staining and imaging as shown in Figure 3.

[0109] For immunostaining of cell types in the brain and spinal cord, fixed tissue sections were washed with PBS , blocked with goat serum, and permeabilized with 0.3% Triton in PBS. The target antibodies were diluted in blocking buffer and incubated overnight at 4°C.

[0110] Primary antibodies: anti-GFP: catalog number ab1218 (abcam); diluted 1:1000 GFAP: catalog number catz0334 (Dako); diluted 1:500 NeuN: catalog number ab177487 (abcam); diluted 1:300

[0111] After overnight incubation, the slides were washed well with PBS containing 0.1% Tween. Fluorescent dye-conjugated secondary antibodies (1:500 dilution) were added and incubated for 1 hour at room temperature. After washing, the slides were washed with PBS and mounted using DAPI mounting solution (The rmoFisher, catalog number P36931). The slides were imaged using a Zeiss LSM800 confocal laser scanning microscope. rmoFisher, catalog number P36931) and mounted. The slides were imaged using a Zeiss LSM800 confocal laser scanning microscope. The slides were imaged using a Zeiss LSM800 confocal laser scanning microscope.

[0112] Transmission electron microscopy A carbon-coated grid (Electron Microscopy Sciences, EMS) was hydrophilized by exposure to a glow discharge of 25 mA for 20 s. For each AAV vector pre, 5 μl was adsorbed onto the grid for 1 minute and stained with 1% uranyl acetate (EMS #22400) for 20 s. The grid was examined with a Tecnai Spirit BioTWIN and imaged with an AMT 2k CCD camera. aiG 2 The work was performed at the Electron Microscopy Facility of Harvard Medical School. Counting was performed as follows: Five representative images of each vector preparation were taken, and all intact capsids and empty capsids were counted using the counting tool in Photoshop (CS6 ). The percentage of empty capsids in each image was calculated and plotted. )

[0113] [Example 1] Design of an AAV library based on iTransduce-expression First, the inventors constructed an AAV library plasmid consisting of an AAV2 ITR-adjacent expression cassette composed of a chicken beta-actin (CBA)-driven Cre recombinase and a p41 promoter-driven AAV9 capsid (schematic in Figure 1a). By PCR, a pseudo-random 21-base nucleotide was inserted between the AAV9 VP1 nucleotides encoding amino acids 588 / 589. Prior to virus packaging, the inventors sequenced this plasmid library using low-depth next-generation sequencing (NGS) and confirmed that the majority of plasmids had 21-mer inserts and lacked variant bias (data not shown). Then, the inventors ​ They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii). They packaged a capsid library and performed NGS to verify that the vector construction process maintained sufficient diversity for selection. iTransduce depends on each unique capsid possessing both its own cap gene and a Cre expression construct (Figure 1b). An AAV library was intravenously injected into transgenic mice (Ai9) carrying a loxP-introduced STOP tdTomato cassette (Figure 1b-i). Such capsids that successfully transduced cells enabled tdTomato expression in any target organ or cell type (without depending on the availability of specific Cre transgenic mouse lines), and then these tdTomato-positive cells could be sorted by flow cytometry from the tissue of interest (optionally with a cell-specific marker, Figure 1b-ii). The viral DNA rescued from such cells should correspond to capsid variants that can effectively overcome all extracellular and intracellular biological barriers to transgene expression (Figure 1b-iii).

[0114] [Example 2] Selection of new AAV9 capsid variants for identifying functional capsids using transgene expression To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. 11 To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. 12 To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. To test the iTransduce library strategy, the inventors performed a proof-of-concept selection to attempt to isolate AAV capsid variants with the ability to transduce brain cells after systemic injection. A library of 1.27×10 vector genomes (vg, 5×10 vg / kg) was intravenously injected into the tail veins of one adult male and one female Ai9 mouse. Three weeks after injection, the mice were sacrificed. Sections of the liver, brain, spleen, and kidney were excised. and immunostained for tdTomato. We readily detected tdToma to-positive cells (most likely hepatocytes) in the liver, and tdT omato-positive cells (both neurons and astrocytes) were scattered in the brain and other organs (Figure 7a ). We also tested whether we could rescue the cap DNA containing the 21-base insert by PCR, and we detected specific bands in 1 0 organs / tissues of the mice injected with the library, but not in the control uninjected mice (Figure 7b). We pooled the remaining brain tissues from female and male mice and extracted the DNA from all brain tissues first for the first round of selection. We amplified the cap DNA containing the 21-mer insert and analyzed their identity and read counts using NGS. We observed that specific peptides were significantly enriched in the library population collected from the brain tissues after a single round of selection compared to the unselected library and the variants recovered from the liver (Figure 7c, data not shown). Next , we isolated the insert-containing region of the viral DNA and recloned it back into the AAV plasmid backbone for the second round of selection, and repackaged the capsid ("brain-enriched capsid library"). In the second round of selection, two Ai9 mice (one male and one female) were injected with the library rescued from round 1 (1.91×10 vg, 7.64×10 vg / k

[0115] ). vg, 7.64×10 10 vg, 7.64×10 11 vg / k The dose of g) was injected and the animals were sacrificed 3 weeks later. Before injection, the sequence containing the variant region was amplified and sequenced by NGS to confirm that no existing bias was introduced into the vector pool (Figure 2). Brain tissue was isolated to obtain a cell suspension for sorting tdTomato positive cells by flow cytometry. The inventors sorted 3,834 tdTomato positive cells (0.043% of the initial cell suspension) by flow cytometry (Figure 8a - 8b). This indicates successful transduction. The viral DNA derived from the tdTomato sorted cells was amplified and sequenced as previously done (Figure 2). The viral DNA isolated from tdTomato positive cells showed that 97% of the reads were occupied only by three peptides: STTLYSP, FVVGQSY, and FQPCP * ( * indicates a stop codon) as shown (Figure 2b). The inventors selected two of these: STTLYSP (designated AAV - S) and FVVGQSY (designated AAV - F ) for in vivo functional evaluation (the inventors excluded the evaluation of FQPC P because it was likely a product of cross - packaging * ). As seen in Figure 2, both of these sequences were detectable at low levels (about 0.4% of the reads for each variant) in the round 2 library, but were highly enriched in the brain after selection.

[0116] [Example 3] The AAV - F capsid mediates efficient transgene expression in the mouse CNS. Such peptides expressed on the AAV capsid enable efficient transduction by the AAV vector ​​To test whether it can mediate transgene expression, the inventors used a single-stranded C apsid (A AV-S and AAV-F) that packages a BA promoter-driven GFP expression cassette (Figure 3a). For comparison, the inventors included the parental AA V9 vector and AAV9-PHP.B. AAV9-PHP.B is the most widely studied A AV9 variant with a heptameric peptide insertion (TLAVPFK) generated by directed evolution 12 . All vectors were produced well and showed a production efficiency slightly lower than that of AAV9 (Table 4).

[0117]

Table 4

[0118] Adult male C57BL / 6J mice were injected via the lateral tail vein with one of the following vectors: AAV9, AAV9-PHP.B , AAV-S, and AAV-F (n = 3 each) at low or high doses ( 1×10 11 vg and 8×10 11 vg vectors, respectively; approximately 4×10 12 and 3.2×10 13 vg / kg). Three weeks after injection, the mice were sacrificed and organs were harvested for endogenous (unstained) GFP fluorescence analysis. The inventors quantified the percentage of coverage of the GFP signal in serial sagittal brain sections (analyzing 3 sections per animal ). Notably, AAV-F at 1×10 vg and 8×10 11 vg was 119-fold (p < 0 ), respectively, compared to the parental AAV9 vector 11 ​​​.0001) and showed a 68-fold (p = 0.0004) increase in GFP fluorescence coverage (Figs. 3b, 3c, 3e, 3f; Figs. 9A - 9B). AAV9 and AAV-S showed similar G FP coverage levels (Figs. 3b, 3c, 3e, 3f). AAV9-PHP.B at low doses resulted in slightly higher GFP coverage compared to AAV-F, but 8×10 11 vg dose, similar levels of GFP coverage were observed (Figs. 3b, 3 c, 3e, 3f). Similar to AAV9-PHP.B, AAV-F transduced the spinal cord with remarkable efficiency (Fig. 3d). Most regions of the brain were efficiently targeted by AAV-F, and robust GFP signals were observed in the cortex, hippocampus, striatum, cerebellum, and olfactory bulb (Fig. 3 f).

[0119] To understand in detail the cell types targeted by AAV-S and AAV-F, the inventors next performed a series of co-immunostainings using markers for GFP, as well as neurons (NeuN), astrocytes (glu tamine synthetase, GS), microglia (Iba-1), and oligodendrocytes (Olig2). AAV-F and A AV-S, similar to the other two reference vectors, mainly transduced neurons and astrocytes (none of the variants were thought to efficiently transduce microglial cells or oligodendroglial cells. Figs. 4a, 4b). Stereological quantification of neurons and astrocytes in the cortex at a dose of 1×10 vg showed that AAV-F was 65-fold more efficient in astrocytes and 171-fold more efficient in neurons compared to conventional AAV9 11 at a dose of 1×10 vg. Although it was confirmed to have efficient transduction ability, the difference between AAVS and AAV9 was not significant (the percentage of GFP-positive astrocytes was 0.6 3% ± 0.24% for AAV9 and 0.36 ± 0.15% for AAV-S, respectively. The percentage of GFP-positive neurons was 0.039% ± 0.002% for AAV9 and 0.02 9 ± 0.002% for AAV-S. The ± values all represent the standard error of the mean, SEM). Note that A AV-F targeted significantly more astrocytes (40.78 ± 0.73%) than AAV9-PHP.B (28.21 ± 0.25%), and the opposite was true for neurons (6.67 ± 0.5% for AAV-F and 10.59 ± 0.16% for AAV9-PHP.B, Fig. 4c). This suggests that in mice, the tropism between these two vectors is slightly different. In addition, AAV-F transduced various neuron subtypes, including excitatory (CamKII-positive) and inhibitory (GAD67-positive) cortical neurons, striatal dopaminergic neurons (expressing tyrosine hydroxylase, TH), cerebellar Purkinje neurons (calbindin-positive), and spinal motor neurons (expressing the choline acetyltransferase marker, Ch AT. Fig. 10a). Stereological counting of the cortex (Fig. 4c) and images of high-dose AAV-F vs. AAV9 (Fig. 3f) were consistent, and the inventors observed efficient transduction of neurons and astrocytes by AAV-F in the striatum, hippocampus, and cerebellum at a dose of 1 × 10 vg / mouse, but not by AAV9 (Fig. 10b). 11

[0120] ​​​​To better understand whether high-level GFP transgene expression by AAV-F in the brain corresponds to a higher level of AAV genome in the brain, the inventors isolated vector and mouse genomic DNA from the liver and brain and performed qPCR on 8 × 10 vg dose mice. AAV-F showed a 20-fold enhancement of the AAV genome in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend 11 in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure 3). PHP.B showed a slightly lower expression level in the liver compared to AAV9 and AAV-F (however, AAV-S was not applicable. Figure 4d). AAV-F showed levels in the liver similar to AAV9, and AAV-S showed a lower but not significant downward trend in the brain compared to AAV9 (p < 0.0001) (Figure 4d). As reported, AAV9-PHP.B had a much higher amount of AAV genome in the brain compared to AAV9 (25-fold), while AAV-S was at a low level similar to the GFP fluorescence data (Figure .05, t-test).

[0121] To investigate transgene expression in peripheral organs after systemic injection, the inventors analyzed GFP fluorescence in the liver, heart, skeletal muscle, and retina (Figure 4e). Not surprisingly, all vectors efficiently transduced the liver. In the heart and skeletal muscle, AAV- F showed levels similar to AAV9, and AAV-S showed a lower but not significant downward trend S yielded more bright GFP signals / compartments than AAV9 and AAV-F. Ka psids all had low transduction or did not mediate transduction in the retina, as expected since all were delivered intravenously. Interestingly, AAV-9 and AAV-S did not transduce the neural retina, but consistent expression was observed in the retinal pigment epithelium (RPE). AAV9-P HP.B and AAV-F both transduced cells in multiple layers of the retina, most notably in the ganglion cell layer (G CL). GFP expression was also observed in the inner nuclear layer (INL), and significant expression was shown in the outer plexiform layer (OPL). This may reflect transduction of bipolar or inhibitory horizontal cell types. Transduction by AAV vectors in mice can vary significantly between gender and mouse strain. Therefore, the inventors investigated whether the most efficient capsid, AAV-F, could efficiently transduce the brain after systemic injection in female C57 BL / 6 as well as male BALB / c mice. Mice were injected with 1×10

[0122] (4×10 vg / kg). The inventors observed robust and efficient transduction regardless of strain or gender (Figures 5a- 5c). These results were in contrast to what had been previously reported, namely that AAV9-PHP.B lacked efficacy for central nervous system transduction after systemic delivery in the BA LB / c strain (Figures 5b, 5c) 11vg (4×10 12 vg / kg). The inventors also observed robust and efficient transduction regardless of strain or gender (Figures 5a- 5c). These results were in contrast to what had been previously reported, namely that AAV9-PHP.B lacked efficacy for central nervous system transduction after systemic delivery in the BA LB / c strain (Figures 5b, 5c) (Figure 5b, 5c). 13、14 .

[0123] To investigate whether the excess empty capsids in AAV-F could account for the increased in vivo distribution to the brain compared to AAV9, the inventors used iodixanol to Most empty capsids were removed by density gradient purification and two separate preparations of AAV-F were subjected to transmission electron microscopy (TEM) and compared to two independent preparations of AAV9. As seen in Figures 12A - 12E, we observed no significant difference in empty capsid levels between AAV-F and AAV9 (empty capsids of AAV9 and AAV-F were 4.63 ± 1.99% vs 5.2 ± 2.18% on average, respectively. Mean ± SD, p = 0.54, independent t-test).

[0124] Next, we tested whether AAV-F would be useful as a vector for CNS transduction by other routes of administration. We first tested AAV-S and AAV-F for transgene expression in the brain after direct hippocampal injection in adult C57BL / 6 mice. We found that both capsids achieved extensive expression of GFP mainly in neurons after direct injection (Figure 13). Intrathecal injection of AAV vectors for spinal cord transduction has shown promise for treatment of this compartment. One drawback is the limited spread of the vector to the brain after lumbar injection of the vector. We compared AAV9 and AAV-F after bolus intrathecal injection of the vector into the lumbar region of the spinal cord in adult C57BL / 6 mice. Three weeks after injection, the mice were sacrificed and the spinal cord and brain were analyzed. Notably, AAV-F resulted in much stronger GFP expression throughout the spinal cord compared to AAV9, transducing both white and gray matter. In contrast, AAV9 transduction was mainly limited to white matter. Surprisingly, we found astrocytes and neurons in the brains of mice injected with AAV-F ​ Transduction was also detected with [vector name], but not with AAV9 (Figure 14).

[0125] [Example 4] AAV-F mediates enhanced transduction of human neurons Since the selection was performed in mice, the inventors analyzed whether the robust transduction characteristics of AAV-F also apply to human cells. Primary human stem cell-derived neurons were transduced with equimolar amounts of AAV9, AAV-S, and AAV-F encoding GFP. After one week, they were fixed, stained with class III β-tubulin, and the percentage of GFP-positive neurons was analyzed. Notably, AAV-F transduced 62% of the neurons, which was three-fold higher than AAV9 (p < 0.05) (Figure 6a, 6 b). AAV-S resulted in a slightly but statistically significant (p < 0.05) increase in transduction efficiency compared to AAV9 (Figure 6a).

[0126] [Example 5] AAV-S transduces the inner ear with high efficiency In recent years, the development of new AAV vectors designed to target specific organs and cell types with high efficacy has been observed. Many of them use heptameric peptide insertions that modify the transduction characteristics of specific AAV serotypes. However, such vectors can often be reused to transduce other tissues, including those that are difficult to treat, such as the inner ear. Transduction of certain cell types in the inner ear, such as hair cells, remains a challenge, and many conventional AAV vectors cannot consistently target outer hair cells (OHCs), one class of hair cells.

[0127] ​​​​​​As described above, one (AAV-F) showed very promising and high levels of CNS expression after systemic injection, while the other (AAV-S) did not. Systemically injected AAV -S did not effectively cross the blood-brain barrier, but transduced various tissues such as the heart, liver, and muscle. After direct injection into the brain, AAV-S showed high local transduction efficiency in neurons even at relatively low doses. To assay the transduction characteristics in the inner ear, the inventors produced AAV-S encoding a single-stranded expression cassette driving EGFP under the CBA promoter and injected it into neonatal (P1) mice through the round window. The inventors found that AAV-S transduced the cochlear hair cells very well. Both inner and outer hair cells were transduced with efficiencies up to 100% and 99% at the tested 10 dose (2×10 VG) (Figures 15a, 15b). The inventors also observed significant transduction in the spiral limbus and spiral ganglion (Figures 15c, 15 d). Overall, the inventors show herein that AAV-S can be used for gene therapy of the inner ear.

[0128] [Example 6] Using the iTransduce system for selection in non-transgenic adult primates, isolate a capsid that efficiently transduces fibroblasts Perform two to three rounds of selection of AAV capsids targeting fibroblasts in non-human primates, such as cynomolgus monkeys. To identify AAV capsids that are fibroblast-selective and have transduction ability, the iTransduce AAV library was used with GJB2-loxP-introduced S ​Encode the TOP-tdTomato cassette (sized to fit within the AAV capsid) and perform selection by co-injecting with AAV9-PHP.B. In the NHP inner ear AAV9-PHP.B-CBA-GFP transduces many cells of the cochlea, including fibroblasts, HCs, and spiral ganglion neurons. In this selection strategy (see Fig. 16A), tdTomato expression is limited to fibroblasts under the GJB2 promoter, essentially creating inner ear transgenic NHP. Select AAV capsids that enter fibroblasts and turn on tdTomato by flow cytometry from isolated cochleae, rescue the capsid DNA for NGS, clone it, and identify peptide sequences that enable AAV-mediated expression in fibroblasts. After enriching individual peptides, perform deep sequencing as described above to inform when to stop additional rounds of selection (perhaps when a particular peptide

[0129] accounts for >25% of the leads). Alternatively, or in addition, perform 2–3 rounds of selection of AAV capsids targeting spinal cord cells in non-human primates, e.g., cynomolgus monkeys. To identify AAV capsids with spinal cord-selective transduction ability, perform selection by co-injecting the iTransduce AAV library with AAV9 encoding the CBA-loxP-flanked STOP-mPlum cassette (sized to fit within the AAV capsid). In the NHP spinal cord, The AAV capsid was sorted by flow cytometry from the isolated spinal cord, and the capsid DNA was rescued for N GS and cloned to identify peptide sequences that enable AAV-mediated expression in spinal cord cells. After enriching individual peptides, de -sequencing was performed as described above to signal when to stop additional rounds of selection (presumably when a particular peptide accounted for >25% of the leads).

[0130] Once candidate capsid clones were identified, they were vectorized to encode a GFP cassette as before. Next, after direct round window membrane (RMW) injection (e.g., as shown in 16A) or intrathecal injection (e.g., as shown in 16B), the capsids were tested for transduction of target cells.

[0131] References

[0132]

Table 5-1

[0133]

Table 5-2

[0134]

Table 5-3

[0135]

Table 5-4

[0136]

Table 5-5

[0137]

Table 5-6

[0138]

Table 5-7

[0139]

Table 5-8

[0140] Other embodiments The present invention has been described in conjunction with its detailed description, but the above description is for illustrative purposes only and is not intended to limit the scope of the present invention as defined by the appended claims It should be understood that other aspects, advantages, and modifications are within the scope of the following claims

Claims

1. A small sequence derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2) An AAV capsid protein comprising an amino acid sequence comprising at least four consecutive amino acids.

2. A small sequence derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2) The AAV capsid of claim 1, comprising an amino acid sequence containing at least five consecutive amino acids. High protein.

3. A small sequence derived from the sequence STTLYSP (SEQ ID NO: 1) or FVVGQSY (SEQ ID NO: 2) The AAV capsid of claim 1, comprising an amino acid sequence comprising at least six consecutive amino acids. High protein.

4. The AAV capsid according to any one of claims 1 to 3, wherein the AAV is AAV9. protein.

5. The AAV capsid protein according to any one of claims 1 to 4, comprising AAV9 VP1. Quality.

6. The sequence is inserted at positions corresponding to amino acids 588 and 589 of SEQ ID NO:

6. The AAV capsid protein of claim 5.

7. A nucleic acid encoding an AAV capsid protein according to any one of claims 1 to 6.

8. The capsid protein according to any one of claims 1 to 6, preferably wild type An AAV that does not contain the VP1, VP2, or VP3 capsid proteins.

9. The AAV of claim 8, further comprising a transgene, preferably a therapeutic transgene.

10. A method for delivering a transgene to a cell, comprising: subjecting said cell to a method according to any one of claims 1 to 9. The method comprises contacting a subject with an AAV according to any one of claims 1 to 4.

11. The cells are neurons (optionally dorsal root ganglion neurons or spiral ganglion neurons). myocytes, astrocytes, myocardial cells, or myocytes, astrocytes, glial cells, endocrine Hair cells, outer hair cells, supporting cells, fibrocytes of the inner ear, photoreceptors, interneurons, retinal nerve cells The method of claim 10, wherein the retina is a mesentery or a retinal pigment epithelium.

12. The method of claim 11 , wherein the cell is present in a living subject.

13. The method of claim 11 , wherein the subject is a mammalian subject.

14. The cells may be derived from the brain, spinal cord, dorsal root ganglion, heart, inner ear, eye, or muscle, and combinations thereof. The method according to any one of claims 10 to 13, wherein the IL-15 is present in a tissue selected from the group consisting of:

15. The subject may have Alzheimer's disease, Parkinson's disease, X-linked adrenoleukodystrophy, Naban disease, Niemann-Pick disease, spinal muscular atrophy, Huntington's disease, connexin-26, Usher type 3A, Usher type 2D, hair cell related hearing loss, hair cell related hearing loss (D FNB7 / 11), inner hair cell related hearing loss (DFNB9), Usher type 1F, Asher type Retinitis Pigmentosa (RP; non-syndromic), Leber congenital amaurosis, Leber hereditary Optic neuropathy, Usher syndrome (RP; syndrome associated with hearing loss), Duchenne muscular dystrophy 15. The method of claim 14, wherein the patient has hemophilia, allograft vasculopathy, or hemophilia A and B.

16. The cells are present in the brain of the subject, and the AAV is delivered parenterally, intracerebrally, or intrathecally. The method according to any one of claims 10 to 13, wherein the administration is by delivery.

17. 17. The method of claim 16, wherein the intrathecal delivery is by lumbar injection, cisternal injection, or intraparenchymal injection. How to.

18. The AAV is delivered parenterally, preferably intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly. The method of any one of claims 10 to 16, wherein said compound is delivered by intramuscular delivery.

19. The cells are present in the eye of the subject, and the AAV is administered by subretinal or intravitreal injection. The method according to any one of claims 10 to 13, wherein the

20. The cells are present in the inner ear of the subject, and the AAV is present above or below the round window membrane. through a surgical cochleotomy hole adjacent to the round window, through the bony oval window window 13. The method according to claim 10, wherein the composition is administered to the cochlea by application through the cochlea or semicircular canal.

2. The method according to claim 1 ,

21. (i) a promoter-driven sequence encoding the Cre recombinase; (ii) a sequence encoding the AAV9 capsid protein, comprising a heptamer peptide is inserted between the sequence encoding amino acids (aa) 588 to 589 of the capsid, , a sequence driven by a promoter and downstream of the Cre cassette A library construct comprising:

22. The heptamers may be random heptamer peptides or preselected heptamer peptides.

22. The library construct AAV of claim 21 , comprising a peptide.

23. 23. A library comprising a plurality of the library constructs of claim 21 or 22.

24. A library having sequences encoding all possible variants of said heptamer The library of claim 23 comprising a construct.

25. Identifying engineered capsids that mediate transgene expression in preselected cell types A method for (a) administering to a non-human model animal, preferably a human model animal, a library according to claim 23 or 24, A step of administering to a mammal, wherein the cells of the model animal have a gene encoding a reporter sequence upstream of the reporter sequence. expressing the loxP-flanked STOP cassette located in (b) isolating cells of said preselected cell type; (c) selecting cells in which the reporter sequence is expressed; (d) at least a portion of said library construct, preferably the portion comprising said heptamer and extracting from the selected cells in which the reporter sequence of step (c) is expressed. releasing; and (e) identifying the heptamers in the library constructs isolated in step (d); determining that the isolated heptamer has been selected from the preselected heptamers; and mediating transgene expression in the selected cell type. The method includes:

26. The method of claim 25, wherein the reporter sequence encodes a fluorescent reporter protein. method.

27. The model animal contains a loxP-flanked STOP cassette upstream of the reporter sequence. or a loxP-flanked vector upstream of the reporter sequence. The recombinant STOP cassette of claim 25 can be expressed from a second construct. method.

28. Determining that the heptamer in the library construct has been identified includes DNA 26. The method of claim 25, comprising using A sequencing analysis.

29. Before and / or after step (e), PCR is used to generate a fragment containing the heptamer sequence, optionally including the complete capsid sequence. amplifying sequences from the library constructs isolated in step (d); The amplified sequences are cloned back into a second set of library vectors. Steps: repackaging the second set of library vectors; and For the second library vector, steps (a) to (d) or (a) to ( Step e) of carrying out 26. The method of claim 25, further comprising:

Images