Non-integrating viral delivery systems and methods related thereto

Abstract

To provide non-integrating viral delivery systems and methods related thereto.SOLUTION: A non-integrating viral delivery system is disclosed. The system includes a viral carrier, where the viral carrier contains a defective integrase gene; a heterologous viral episomal origin of replication; a sequence encoding at least one initiator protein specific for the heterologous viral episomal origin of replication where expression of the sequence encoding the at least one initiator protein specific for the heterologous viral episomal origin of DNA replication is inducible; and at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest.SELECTED DRAWING: None

Description

Technical Field

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 347,552, filed on June 8, 2016, entitled "NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS OF USE THEREOF", U.S. Provisional Patent Application No. 62 / 431,760, filed on December 8, 2016, entitled "NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS RELATED THERETO", and PCT / US16 / 66185, filed on December 12, 2016, entitled "NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS RELATED THERETO", the disclosures of which are hereby incorporated by reference.

[0002] The present disclosure generally relates to viral vectors, and systems for gene delivery, and fields of use for other therapeutic, diagnostic, or investigative purposes. More specifically, embodiments of the present disclosure relate to non-integrating viral vectors, and systems for gene delivery, and fields of use for other therapeutic, diagnostic, or investigative purposes.

Background Art

[0003] Viral vectors have been used to transduce genes and other therapeutic nucleic acid constructs into target cells due to their specific viral envelope-host cell receptor interactions and viral mechanisms for gene expression. As a result, viral vectors have been used as a vehicle for the transfer of genes into many different cell types, including but not limited to isolated tissue samples, in situ tissue targets, and cultured cell lines. The ability to introduce and express foreign genes is useful for the study of gene expression, as well as for the elucidation of cell lineages and pathways, and for providing the possibility of therapeutic interventions such as gene therapy and various types of immunotherapy.

[0004] Several viral systems, including lentivirus, murine retrovirus, adenovirus, and adeno-associated virus, have been proposed as potential therapeutic gene transfer vectors. However, numerous hurdles have prevented their widespread use as approved therapeutics. Research and development hurdles include, but are not limited to, expression stability and control, genomic packaging ability, and construct-dependent vector stability. Furthermore, in vivo application of viral vectors can be limited by the host immune response to viral structural proteins and / or transduced gene products, which can lead to detrimental anti-vector immunological effects.

[0005] Researchers have attempted to find stable expression systems as a way to overcome some of these hurdles. One approach is to utilize recombinant polypeptides, or gene regulatory molecules including small RNAs, in such expression systems. These systems employ chromosomal integration of the transduced retroviral genome or at least a portion thereof into the genome of the host cell. A significant limitation of these approaches is that the site of gene integration is generally random, and the number and ratio of genes integrated at any given site are often unpredictable. Thus, vectors that rely on chromosomal integration provide for the permanent maintenance of recombinant genes that can exceed the treatment interval, while plasmids or other non-replicating DNAs are not well controlled and may decay before the desired treatment interval is completed.

[0006] Another approach is the use of transient expression systems. Under transient expression systems, expression of the gene of interest is based on non-integrating plasmids and thus typically is lost as the cells subsequently divide or the plasmid vector is destroyed by endogenous nucleases. Thus, transient gene expression systems typically do not reach sufficient expression over time and typically require repeated treatment, which is generally understood to be an undesirable feature. SUMMARY OF THE INVENTION

Means for Solving the Problem

[0007] A stable virus delivery system and method are provided. In various embodiments, the delivery system includes an inducible expression system. According to one embodiment, the delivery system is non-integrating. In another embodiment, the delivery system is non-integrating and inducible.

[0008] In various embodiments and implementations, the system variously includes one or all of the viral vectors, where the viral vector includes a defective integrase gene, a heterologous viral episomal DNA origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication, where the expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The viral vector can be a lentivirus. The heterologous viral episomal DNA origin of replication can be derived from a papillomavirus. The heterologous viral episomal DNA origin of replication can be derived from a human papillomavirus or a bovine papillomavirus.

[0009] The heterologous viral episomal DNA replication origin can be derived from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA replication origin can be derived from the long control region (LCR) of HPV16. The heterologous viral episomal DNA replication origin can contain SEQ ID NO: 1. Optionally, the heterologous viral episomal DNA replication origin can contain a 5' truncation of SEQ ID NO: 1. The heterologous viral episomal DNA replication origin can contain a 5' truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO: 1. The heterologous viral episomal DNA replication origin can have at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag1 (SEQ ID NO: 2) (also referred to herein as fragment 1), or Frag2 (SEQ ID NO: 3) (also referred to herein as fragment 2), or Frag3 (SEQ ID NO: 4) (also referred to herein as fragment 3), or Frag4 (SEQ ID NO: 5) (also referred to herein as fragment 4) of the LCR of HPV16. The heterologous viral episomal DNA replication origin can contain Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16.

[0010] At least one initiator protein specific for a heterologous viral episomal DNA replication origin may comprise E1 or an operable fragment thereof. At least one initiator protein specific for a heterologous viral episomal DNA replication origin may comprise E2 or an operable fragment thereof. At least one initiator protein specific for a heterologous viral episomal DNA replication origin may comprise EBNA-1 or an operable fragment thereof. Optionally, the system may comprise at least two initiator proteins specific for a heterologous viral episomal replication origin. At least two initiator proteins specific for a heterologous viral episomal DNA replication origin may comprise either E1 alone or in combination with E2, or operable fragments thereof. The sequence encoding at least one initiator protein may be present in a single separate plasmid or non-integrating viral vector. Optionally, the system may comprise at least two initiator proteins specific for a heterologous viral episomal DNA replication origin, wherein the sequences encoding the at least two initiator proteins may be present in a single separate plasmid or non-integrating viral vector. Optionally, the system may comprise at least two initiator proteins specific for a heterologous viral episomal DNA replication origin, wherein the sequence for the first initiator protein and the sequence for the second initiator protein may be present in separate plasmids or non-integrating viral vectors.

[0011] With regard to the disclosed non-integrating viral delivery system, at least one gene product may comprise an antibody, an antibody fragment, or a growth factor. The antibody may comprise an anti-HER2 antibody or a fragment thereof. The growth factor may comprise vascular endothelial growth factor (VEGF) or a variant thereof. The miRNA may comprise CCR5 miRNA.

[0012] In another aspect, a pharmaceutical composition is disclosed. The pharmaceutical composition comprises the non-integrating viral delivery system disclosed herein and at least one pharmaceutically acceptable carrier.

[0013] In another aspect, provided is a method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a cell. The method includes contacting the cell with an effective amount of a non-integrating viral delivery system, where the system includes a viral vector, and the viral vector includes one or all defective integrase genes, a heterologous viral episomal DNA origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication, wherein expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA.

[0014] In another aspect, provided is a method of expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a subject in need thereof. The method includes administering to the subject in need thereof an effective amount of a non-integrating viral delivery system, where the system includes a viral vector, where the viral vector includes one or all defective integrase genes, a heterologous viral episomal DNA origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication, where expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. The sequence encoding at least one initiator protein may be present on a single separate plasmid, and the at least one initiator protein may include either E1 or E2 alone or in combination, or a functional fragment thereof. The method may further include administering to the subject in need thereof a first amount of a single separate plasmid for initiating a first expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. The method may further include administering to the subject in need thereof a second amount of a single separate plasmid for initiating a second expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. In situations where the second amount is lower than the first amount, the expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA may decrease. In situations where the second amount is higher than the first amount, the expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA may increase.

[0015] In another aspect, the non-integrating viral delivery system disclosed herein is optimized to produce low-level basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The heterologous viral episomal DNA replication origin can include at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with SEQ ID NO: 1 or Frag1 of the LCR of HPV16 (SEQ ID NO: 2).

[0016] In another aspect, the non-integrating viral delivery system disclosed herein is optimized such that the system produces low-level basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin can include SEQ ID NO: 1 or Frag1 of the LCR of HPV16 (SEQ ID NO: 2).

[0017] In another aspect, the non-integrating viral delivery system disclosed herein is optimized such that the system produces moderate-level basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin can include at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. The system can be optimized to produce moderate-level basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin can include Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16.

[0018] In another aspect, a method of selecting an optimized non-integrating viral delivery system is disclosed. The method includes selecting a basal expression level. Thereafter, when level X is selected, a corresponding Y is selected, where Y corresponds to a heterologous viral episomal DNA origin of replication selected to be incorporated into the non-integrating viral delivery system, and when X = a first defined level of basal expression of the cargo, Y includes LCR (SEQ ID NO: 1) or Frag1 (SEQ ID NO: 2), and when X = a second defined level of basal expression of the cargo, Y includes Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. In a plurality of embodiments, the first defined level includes less than 0.020 episomal copies of the cargo per cell. In a plurality of embodiments, the second defined level includes 0.020 or more episomal copies of the cargo per cell.

[0019] Further aspects include, for example, methods of treating an infectious disease. Further aspects include methods of preventing an infectious disease. In another aspect, a method of enhancing wound healing is disclosed. In another aspect, a method of treating a bone injury is disclosed. Further aspects include methods of treating a genetic disease using the systems detailed herein.

[0020] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to further explain the invention as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and the detailed description of the invention.

Brief Description of the Drawings

[0021]

Figure 1

[0022]

Figure 2

[0023]

Figure 3

[0024]

Figure 4

[0025]

Figure 5

[0026]

Figure 6

[0027]

Figure 7

[0028]

Figure 8

[0029]

Figure 9

[0030]

Figure 10

[0031]

Figure 11

[0032]

Figure 12

[0033]

Figure 13

[0034]

Figure 14

[0035]

Figure 15

[0036]

Figure 16

[0037]

Figure 17

[0038]

Figure 18

[0039]

Figure 19

[0040]

Figure 20

[0041]

Figure 21

DETAILED DESCRIPTION OF THE INVENTION

[0042] Disclosed herein are stable viral delivery systems and methods. In various aspects, the delivery system includes a transient expression system. According to one aspect, the delivery system is non-integrating. In another aspect, the delivery system is non-integrating and transient.

[0043] In a further aspect, non-integrating, episomally replicating viral vectors (e.g., lentiviral vectors) and methods of using the same are provided. Vectors that replicate episomally in the present disclosure may contain viral components of the viral-like Papovaviridae (e.g., bovine papillomavirus or BPV) or Herpesviridae (e.g., Epstein-Barr virus or EBV) or Hepadnaviridae (e.g., hepatitis B virus or HBV). Vectors that replicate episomally derived from these viruses may contain an origin of replication and at least one viral trans-acting factor, e.g., initiator proteins such as E1 for BPV polymerase and EBNA-1 for EBV or HBV polymerase, or the terminal binding protein of adenovirus. The process of episomal replication typically incorporates both the host cell's replication machinery and viral trans-acting factors.

[0044] By using the origin of replication of a heterologous virus, a novel vector can be engineered with an “off” switch for the expression of viral proteins required to recognize the origin of replication. Switching off DNA replication dramatically reduces the level of therapeutic DNA over time. Without being bound by any particular theory, non-replicating DNA is thought to simply degrade over time, e.g., by nuclease activity and as the host cell undergoes natural apoptosis (cell death) events. Eventually such non-replicating DNA can become undetectable and disappear completely or almost completely from the patient over time.

[0045] The disclosed systems and methods include the ability to reduce or prevent any toxic effects resulting from toxicity and overexpression or extended expression of the transduced gene. By eliminating genes once DNA replication has ceased, subsequent unwanted gene expression or knockdown of host gene expression is prevented. Similarly, by combining the beneficial aspects of episomal replication with heterologous viral systems, a platform is provided that can safely and efficiently transduce genes of interest into various cell types. Papillomavirus

[0046] Papillomaviruses replicate mainly as episomes in mammalian cells. The action of the viral E1 protein, which functions as a DNA helicase, on the viral DNA replication origin (ori) drives the production of hundreds to thousands of DNA copies per cell depending on the differentiation state of the infected epithelial cells. An attempt has been made to develop a gene delivery system based on papillomaviruses using what is known as a "shuttle plasmid." Many studies have been conducted to demonstrate the safety and durability of gene expression using a bacterial DNA replication origin that enables DNA production in E. coli and a papillomavirus ori that enables episomal replication in mammalian cells. In most cases, the ori was derived from bovine papillomavirus.

[0047] Papillomaviruses have evolved to infect epidermal and epithelial cells. As the infected cells differentiate from the basal surface to the luminal surface, papillomaviruses increase DNA replication, and the copy number increases significantly until large amounts of virus are released at the luminal surface. This makes papillomaviruses highly infectious, as is evident from human papillomaviruses. The sharp increase in copy number is mainly due to host factors. However, this feature of papillomaviruses can be utilized for transient gene therapy targeting epidermal and epithelial surfaces.

[0048] Certain features of papillomaviruses are used in accordance with various aspects and embodiments of the present disclosure to effect episomal vector expression and replication and to target vector expression to specific cell types. Epstein-Barr virus (EBV)

[0049] Epstein-Barr virus (EBV), also known as human herpesvirus 4, is a member of the herpesvirus family. It is one of the most common human viruses, and most people are infected with EBV several times in their lives.

[0050] Epstein-Barr virus (EBV) is a double-stranded DNA virus that contains approximately 85 genes and is known to infect B cells and epithelial cells. EBV is capable of both lytic replication and latent replication. During latent replication, translocation of the circularized EBV genome into the host cell nucleus occurs, and in the nucleus, EBV can be replicated by the host cell DNA polymerase.

[0051] EBV can undergo latent replication through at least three different pathways, each of which is associated with the expression of Epstein-Barr virus nuclear antigen 1 (EBNA-1), a protein that binds to the episomal origin of replication and mediates the partitioning of episomes during host cell division. EBNA-1 has an essential role in the regulation, replication, and maintenance of EBV genes.

[0052] Certain features of EBV are used in accordance with various aspects and embodiments of the present disclosure. Hepatitis B virus (HBV)

[0053] Hepatitis B virus (HBV) is a member of the Hepadnavirus family. It is a common human virus associated with progressive liver fibrosis, hepatitis, and hepatocellular carcinoma.

[0054] HBV is a double-stranded DNA virus that replicates via an RNA intermediate and is dependent on the viral polymerase. The stable maintenance of HBV in hepatocytes is due to the presence of a covalently closed circular viral DNA form that is difficult to eradicate.

[0055] Accordingly, certain features of HBV are used in accordance with various aspects and embodiments of the present disclosure. Retrovirus

[0056] Retroviruses are a family of viruses characterized by encoding reverse transcriptase, which can generate DNA copies from an RNA template, and the integration of proviruses into the host cell chromosome. Lentiviruses are a genus of retroviruses that can deliver large amounts of viral nucleic acids into host cells. Lentiviruses are characterized by having the unique ability to infect / transduce non-dividing cells. After transduction, lentiviruses integrate their nucleic acids into the chromosomes of host cells.

[0057] Infectious lentiviruses have three major genes encoding the pathogenic proteins gag, pol, and env, as well as two regulatory genes including tat and rev. Depending on the specific serotype and virus, there may be additional accessory genes encoding proteins involved in other replication functions, including the regulation, synthesis, and / or processing of viral nucleic acids and counteracting the innate cellular defenses against lentiviral infection.

[0058] Lentiviruses contain long terminal repeat (LTR) regions that can be approximately 600 nt in length. The LTR can be segmented into U3, R, and U5 regions. The LTR can mediate the integration of retroviral DNA into the host chromosome via the action of integrase. Alternatively, without functionalizing integrase, the LTR can be used to circularize viral nucleic acids.

[0059] Viral proteins involved in the early stages of lentiviral replication include reverse transcriptase and integrase. Reverse transcriptase is an RNA-dependent DNA polymerase encoded by the virus. This enzyme uses the viral RNA genome as a template for the synthesis of a complementary DNA copy. Reverse transcriptase also has RNaseH activity for the destruction of the RNA template required for DNA second-strand synthesis to complete the production of double-stranded DNA ready for integration. Integrase processes the LTR before inserting the viral genome into the host DNA. Tat acts as a trans-activating factor during transcription to enhance the initiation and elongation of RNA copies made from viral DNA. The rev-responsive element acts post-transcriptionally to regulate mRNA splicing and transport to the cytoplasm.

[0060] Certain features of retroviruses, including lentiviruses, are used in accordance with various aspects and embodiments of the present disclosure. Vector-in-vector system

[0061] A novel vector-in-vector (VIV) system is provided that can precisely regulate gene delivery and expression by combining desired features of various viral species. Many viral vectors, including the lentiviral (LV) platform, can be used. Lentiviral transduction results in chromosomal integration of the LV payload (e.g., the gene of interest), similar to most other forms of stable transduction. In accordance with various aspects, chromosomal integration is disabled via a selective mutation that inactivates the viral integrase gene. Papillomavirus ori plus E1 protein, or EBV ori plus EBNA-1, or hepadnavirus termini plus viral polymerase are used herein as part of the gene cargo of heterologous viruses that cannot normally be maintained episomally. Incorporating this heterologous viral replication machinery into the lentiviral vector leaves an additional cargo space of approximately 5 kb that can accommodate the therapeutic gene of interest.

[0062] In other embodiments, other control elements can be incorporated within the disclosed VIV system. By way of non-limiting example, the expression of E1 or E2 or EBNA-1 or HBV polymerase can be driven by an inducible promoter. Further, by way of non-limiting example, E1 and / or E2 or variants thereof can be expressed using a plasmid or non-integrating viral vector. Many types of inducible promoters are known in the art and, for the purposes of the present disclosure, inducible promoters can include, but are not limited to, promoters that respond to antibiotics (i.e., tetracycline, aminoglycoside, penicillin, cephalosporin, polymyxin, etc.) or other drugs, copper and other metals, alcohol, steroids, light, oxygen, heat, cold, or other physical or chemical stimuli. For example, methods of using the disclosed viral system can include employing tetracycline-inducible gene expression that relies on a constant supply of drug for expression of the cargo gene. The compound used to induce the inducible promoter can be added once or repeatedly depending on the duration of episomal replication and the timing of the desired cargo delivery. DNA replication and episomal maintenance variously depend on the induction of E1, E2, and / or EBNA-1, which in turn depends on the inducer of gene expression (i.e., tetracycline).

[0063] An exemplary VIV system is shown in FIG. 1. The disclosed VIVs contain at least one gene or nucleotide sequence of interest (e.g., the cargo shown in FIG. 1A). The gene or sequence incorporated into the VIV depends on the purpose of the VIV. Referring generally to FIG. 1, the lentivirus is packaged in an integrase-deficient system, or transduction is performed in the presence of a clinical drug (e.g., dolutegravir or raltegravir) used to block integrase activity. When integration fails, the linear double-stranded vector DNA generally circularizes using the host's enzymatic machinery (e.g., FIG. 1B). Optionally, a drug-inducible promoter can be activated to express the E1 and / or E2 proteins as needed, which then drives DNA replication. The therapeutic cargo is expressed from the incorporated cassette. In various embodiments, the compound that induces the inducible promoter (also referred to herein as the "inducer") is discontinued or stopped. Stopping the inducer downregulates the synthesis of E1 and / or E2. In further embodiments, the production of E1 and / or E2 is effectively stopped. In either event, this reduces the level of episomal DNA and ultimately eliminates the vector construct.

[0064] A further exemplary illustration of the VIV system is shown in FIG. 2. The E1 initiator protein is present and the cargo is GFP under the EF1-HTLV promoter. FIGS. 1 and 2 show VIV systems containing E1, while FIG. 4 shown herein shows a VIV system containing both E1 and E2 on a single viral vector. In further embodiments, an internal ribosome entry site (IRES) is added to allow resumption of protein translation in order to express both E1 and E2 from the same mRNA. Initiator proteins such as E1 and E2 can also be expressed from separate plasmids or non-integrating lentiviral vectors.

[0065] A further exemplary illustration of the VIV system is shown in FIG. 4. The gene cargo is represented by the CMV / GFP cassette. The cargo gene sequence can be amplified by polymerase chain reaction (PCR). For example, synthetic oligonucleotide primers such as primers that are identical to the 5' end of the cargo gene and / or complementary to the 3' end of the cargo gene can be used. The 5' primer can be extended from its 5' end having a recognition site for an endonuclease. The 3' primer can also be extended at its 3' end having a complement for endonuclease recognition. The resulting amplified cargo gene sequence can be annealed to a suitable vector such as a lentiviral vector. Non-limiting examples of gene cargo include CMV / VEGF, CMV / anti-epidermal growth factor receptor (EGFR), anti-HER2 antibody, or miRNA-inhibited C-C chemokine receptor type 5 (CCR5).

[0066] Proper expression of the cargo can be determined by appropriate assays. For example, the copy number of DNA can be measured by quantitative PCR. Protein products translated from non-limiting examples such as vector 1 or vector 19 (described herein) can be measured, for example, by analytical flow cytometry. ELISA assays can be used to detect the presence of specific cargo such as secreted proteins like VEGF. Western blot techniques can also be used to detect specific cargo such as antibodies like anti-EGFR. Additionally, monitoring a decrease in cell surface expression of cargo proteins such as chemokine receptors like CCR5 can also be employed.

[0067] With respect to the cargo and as a non-limiting example, the gene encoding platelet-derived growth factor (PDGF) can be incorporated as a gene into the VIV used to promote wound healing together with the shRNA, siRNA, miRNA, and / or other gene-suppressing RNAs of interest. The disclosed VIV system is not limited to a particular type of gene or sequence that can be expressed.

[0068] The disclosed VIVs can incorporate many therapeutic or prophylactic genes or sequences, including, for example, antibodies against antigens associated with infectious diseases or cancer (including antigens on replicating pathogens, antigens that are exogenous toxins, and antigens on tumor cells), platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin or dystrophin-associated complex, phenylalanine hydroxylase, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA or RNA against autoimmune antigens involved in colitis, inflammatory bowel disease, or Crohn's disease, small interfering RNAs involved in addictions that regulate neurasthenia against opiates or alcohol, tumor suppressor genes, genes that regulate cell survival including pro-apoptosis or anti-apoptosis genes and pro-autophagy or anti-autophagy genes, genes encoding radiation resistance factors, genes encoding luminescent proteins used to track the metastasis of tumor cells or other cell transport phenomena, or various other therapeutically useful sequences that can be used to condition the body to obtain the maximum effect of radiation, surgery, or chemotherapy, or to protect tissues from radiation, surgery, or chemotherapy, to improve organ transplantation, or to suppress hyperreactivity particularly in the airways by modifying host or graft tissues.

[0069] Without limiting any of the foregoing, the cargo can include diagnostic proteins such as GFP and mCherry, as well as cDNA, microRNA, shRNA, and antibodies. Further, the cargo can include specific cargoes such as VEGF and BMP described herein.

[0070] In a further aspect, as a "safety switch", it is desirable to maintain the gene in an episomal form of the VIV system. For example, when a particular gene product is toxic, upon cessation of the inducer molecule, DNA replication decreases or stops. Thereafter, the episome number decreases and the gene and vector eventually disappear. Unlike conventional regulated gene expression, the disclosed expression constructs are degraded by endogenous nucleases and diluted by cell division until they effectively disappear, thereby preventing any short-term or long-term breakthrough expression.

[0071] According to a further aspect, by maintaining the gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNAs in episomal form, it is also possible to regulate the copy number over a wide range at levels much higher than those achieved by conventional lentiviral transduction.

[0072] The disclosed VIV system exhibits many advantages. For example, episomal DNA is less sensitive to chromosomal modifications, which can result in gene silencing of conventional transduction vectors. Similarly, the VIV episomal DNA vector supports active gene delivery for at least about 1 to about 4 months and, in some cases, longer, from short to medium term. In other embodiments, the episomal DNA vector supports active gene delivery for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks or longer. In other embodiments, the episomal DNA vector supports active gene delivery for about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these periods, for example, 1 month and 1 week, or 3 months and 2 weeks, can also be used in the methods disclosed herein.

[0073] There are beneficial aspects specifically related to the use of lentiviral vectors for the incorporation of the disclosed VIV system, but the disclosed system is not limited to a single type of viral vector. Without limitation, viruses that use any DNA virus or DNA intermediate, including but not limited to lentivirus, adeno-associated virus (AAV), adenovirus, vaccinia, herpes virus, measles virus, hepadnavirus, parvovirus, and murine virus, can be used as carriers for incorporating the VIV system of the present specification.

[0074] Without limiting any of the foregoing, in one aspect of the present disclosure, a non-integrating viral delivery system is disclosed. The system includes a viral vector, where the viral vector includes one or more defective integrase genes, a heterologous viral episomal origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal origin of replication, the expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication being inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The viral vector can be a lentivirus. The heterologous viral episomal DNA origin of replication can be derived from a papillomavirus. The heterologous viral episomal DNA origin of replication can be derived from a human papillomavirus or a bovine papillomavirus.

[0075] The heterologous viral episomal DNA replication origin can be derived from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA replication origin can be derived from the long control region (LCR) of HPV16. The heterologous viral episomal DNA replication origin can include SEQ ID NO: 1. Optionally, the heterologous viral episomal DNA replication origin can include a 5' truncation of SEQ ID NO: 1. The heterologous viral episomal DNA replication origin can include at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of a 5' truncation of SEQ ID NO: 1. The heterologous viral episomal DNA replication origin can include at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. The heterologous viral episomal DNA replication origin can include Frag1 (SEQ ID NO: 2), or Frag2 (SEQ ID NO: 3), or Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. Without limiting any of the foregoing or the examples detailed herein, the genomic constitution of the LCR is shown in FIG. 11. In addition to the fragments detailed herein, additional fragments can be generated by deletions in the 5' and 3' regions of the LCR. Further, mutations, substitutions, additions and / or deletions can be made to the full-length LCR or related fragments. Further, and without limiting the foregoing or the examples detailed herein, it is understood that the components of the vectors detailed herein can be used interchangeably to develop new and / or modified vectors, which is within the scope of the embodiments of the present disclosure. Adjustability of vector-in-vector systems

[0076] In one aspect of the disclosure, the viral vector system is a sequence encoding a viral carrier, a heterologous viral episomal DNA origin of replication, and at least one initiator protein specific for the heterologous viral episomal DNA origin of replication, wherein the expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is regulated, or is adjustable or optimizable by modifying one or more of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The modification is to control the maximum dose of at least one gene product, to affect the persistence of expression in the target cell or tissue, and to prevent toxicity or side effects when a biologically active molecule that is temporarily required is delivered at the wrong dose and when expression continues after such a biologically active molecule is no longer needed or can become toxic, for treating a disease or injury using the same biologically active molecule.

[0077] In multiple embodiments, the modification of the disclosed system enables adjusting the expression level of a biologically active molecule and controlling the duration of expression to achieve cargo expression that is undetectable or nearly undetectable as may be required for a placebo control in a gene therapy trial. In multiple embodiments, this results in low-level expression that is statistically different from undetectable but does not meet the criteria for induced or high-level expression, which may be required for delivering gene editing proteins and RNAs that are safer when given at low levels and at short intervals in attempts to remove or correct a defective gene. In multiple embodiments, an elevated or induced level of cargo expression occurs, for example, including a peak expression level that is approximately five-fold higher compared to a detectable but low basal level of the same cargo. In multiple embodiments, this may be optimal when expressing therapeutic antibodies, including tumor-targeted biological agents that need to be present at high levels and be more effective when occurring at or near the tumor site but must decay and be removed from the bloodstream to avoid off-site effects on normal tissue or prevent the initiation of autoimmunity.

[0078] In multiple embodiments, the disclosed system is adjustable for treating cancer. The disclosed system replicates episomal DNA to increase the gene dosage in target cells to enable the expression of tumor-targeting antibodies such as cetuximab, rituximab, or trastuzumab at or near the tumor site, to produce antibodies at levels sufficient for effective tumor targeting, and then, when the production of the E1 / E2 protein ceases, to terminate episomal DNA replication and lead to the decay of the episomal transgene molecule with a decrease in antibody expression that conforms to the predicted decay curve of therapeutic antibodies, which has been found to improve the safety and efficacy of these and similar biological agents. The system is adjustable to reach this state.

[0079] In multiple embodiments, the disclosed system is adjustable for treating or preventing infectious diseases. The disclosed system replicates episomal DNA to increase the gene dosage in target cells to direct local production of antibodies at or near the site of infection or release antibodies into the blood and lymph circulation, to produce antibodies at levels sufficient for effective pathogen prevention or eradication by expressing therapeutic antibodies that can disrupt or neutralize pathogen replication, and then, when the production of the E1 / E2 protein ceases, to terminate episomal DNA replication and lead to the decay of the episomal transgene molecule with a decrease in antibody expression that conforms to the predicted decay curve of therapeutic antibodies, which has been found to improve the safety and efficacy of these and similar biological agents. The system is adjustable to reach this state.

[0080] In multiple embodiments, the disclosed system is adjustable for treating trauma or regenerative diseases. In multiple embodiments, the disclosed system is for expressing biologically active molecules with therapeutic efficacy, for directing local production of antibodies at or near the site of injury or disease, for increasing gene dosage in target cells by replicating episomal DNA to produce antibodies at levels sufficient for effective treatment, and for terminating episomal DNA replication when production of the E1 / E2 protein ceases, leading to decay of the episomal transgene molecule along with a decrease in the expression of the biological therapeutic to avoid side effects or toxicity resulting from persistent or very long-term expression of the biological therapeutic required during a short treatment window, and is adjustable.

[0081] In multiple embodiments, the LCR fragment can be selected and used according to the desired treatment course or outcome. As shown in the non-limiting examples provided in FIGS. 20-21, Table 1, and Examples 16-20, the viral delivery system is adjustable or optimized according to the desired treatment course or outcome. [Table 1-1] [Table 1-2]

[0082] In multiple aspects of the present disclosure, based on the desired treatment course or outcome, the viral delivery system is adjustable or optimized according to factors in the first quadrant, second quadrant, third quadrant, or fourth quadrant.

[0083] In multiple embodiments, the factor in the first quadrant comprises a viral delivery system in which the LCR is selected from full-length, Frag2, Frag3, Frag4, or variants thereof. The factor in the first quadrant provides transient basal expression of the gene cargo using the described vector system. In most cases, the DNA copy number is expected to be approximately one-twentieth of the highest level achievable with this system. By carefully selecting the promoter driving the expression of the cargo, the flexibility and tissue specificity of this system are further increased.

[0084] In multiple embodiments, the factor in the second quadrant comprises a viral delivery system in which the LCR is selected from Frag2, Frag3, Frag4, or variants thereof. The factor in the second quadrant also includes the E1 and / or E2 initiator proteins. In multiple embodiments, the E1 and / or E2 initiator proteins are provided via a plasmid. In multiple embodiments, the E1 and / or E2 initiator proteins are provided via a lentiviral vector. The factor in the second quadrant provides a high episomal DNA copy number with potentially very high gene expression levels, again depending on promoter selection. Additionally, the use of shorter LCR fragments increases the size of the DNA insert that can be incorporated as cargo.

[0085] In multiple embodiments, the factor in the third quadrant comprises a viral delivery system in which the LCR is selected from LCR, Frag1, or variants thereof. The factor in the third quadrant also includes the E1 and / or E2 initiator proteins. In multiple embodiments, the E1 and / or E2 initiator proteins are provided via a plasmid. In multiple embodiments, the E1 and / or E2 initiator proteins are provided via a lentiviral vector. The factor in the third quadrant provides a high but slightly lower episomal copy number than can be obtained in the second quadrant. The advantage of the third quadrant is the very low basal level of episomal DNA, which allows for the creation of a highly controllable system by introducing or not introducing the E1 / E2 proteins.

[0086] In multiple embodiments, the factor in the fourth quadrant comprises a viral delivery system where the LCR is selected from a full-length LCR, Frag1, or variants thereof. The selection of the factor in the fourth quadrant results in very low expression that may be required for placebo controls or initial doses in dose escalation trials or dose-finding trials to establish the maximum tolerable level or optimal level for a desired indication.

[0087] In multiple aspects of the present disclosure, when a very low basal level of cargo expression is desired, the factor in the fourth quadrant is introduced into the viral delivery system. In multiple embodiments, the factor in the fourth quadrant comprises Frag1 or a full-length LCR or variants thereof. In multiple embodiments, when a slightly higher basal level of cargo expression is desired, the factor in the first quadrant is introduced into the viral delivery system. In multiple embodiments, the factor in the first quadrant comprises Frag2, Frag3, Frag4, or variants thereof.

[0088] In multiple embodiments, when a high induced level of cargo expression is desired, the factor in the second quadrant or the factor in the third quadrant is introduced into the viral delivery system. In multiple embodiments, the factor in the second quadrant comprises Frag2, Frag3, Frag4, or variants thereof. In multiple embodiments, the factor in the second quadrant comprises an E1 and / or E2 initiator protein. In multiple embodiments, the factor in the third quadrant comprises an LCR, Frag1, or variants thereof. In multiple embodiments, the factor in the third quadrant comprises an E1 and / or E2 initiator protein. In multiple embodiments, when a high induced level of cargo expression is desired and a larger cargo size is contemplated, the factor in the second quadrant is introduced into the viral delivery system. In multiple embodiments, when a high induced level of cargo expression is desired and a smaller cargo size is contemplated, the factor in the third quadrant is introduced into the viral delivery system. Thus, the tunability or optimization of the current system enables tunability or optimization based on cargo size.

[0089] In multiple embodiments, when an increase in the large fold change between the basal level and the induced level of cargo expression is desired, a factor in the third quadrant is introduced into the viral delivery system. In multiple embodiments, the factor in the third quadrant includes the LCR, Frag1, or variants thereof. In multiple embodiments, the factor in the third quadrant includes the E1 and / or E2 initiator proteins.

[0090] In multiple embodiments, when an increase in the small fold change between the basal level and the induced level of cargo expression is desired, a factor in the second quadrant is introduced into the viral delivery system. In further embodiments, when an increase in the small fold change between the basal level and the induced level of cargo expression is desired as compared to the third quadrant profile shown in FIGS. 12 and 20, a factor in the second quadrant is introduced into the viral delivery system. In multiple embodiments, the factor in the second quadrant includes Frag2, Frag3, Frag4, or variants thereof. In multiple embodiments, the factor in the second quadrant includes the E1 and / or E2 initiator proteins.

[0091] In another aspect, a method of treating a subject for a first quadrant treatment course is provided. The method includes administering to the subject a viral delivery system comprising a factor in the first quadrant. In multiple embodiments, the factor in the first quadrant includes a viral delivery system selected from an LCR that is full length, Frag2, Frag3, Frag4, or variants thereof.

[0092] In another aspect, a method of treating a subject for a second quadrant treatment course is provided. The method includes administering to the subject a viral delivery system comprising a factor in the second quadrant. In multiple embodiments, the factor in the second quadrant includes Frag2, Frag3, Frag4, or variants thereof. In multiple embodiments, the factor in the second quadrant includes the E1 and / or E2 initiator proteins.

[0093] In another aspect, a method of treating a subject for a treatment course in the third quadrant is provided. The method includes administering to the subject a viral delivery system comprising a third quadrant factor. In a plurality of embodiments, the third quadrant factor comprises an LCR, Frag1, or variants thereof. In a plurality of embodiments, the third quadrant factor comprises an E1 and / or E2 initiator protein.

[0094] In another aspect, a method of treating a subject for a treatment course in the fourth quadrant is provided. The method includes administering to the subject a viral delivery system comprising a fourth quadrant factor. In a plurality of embodiments, the fourth quadrant factor comprises an LCR, Frag1, or variants thereof.

[0095] In another aspect, at least one initiator protein specific for a heterologous viral episomal DNA replication origin is present in the viral system. In a plurality of embodiments, at least one initiator protein specific for a heterologous viral episomal DNA replication origin comprises E1 or a functional fragment thereof. In a plurality of embodiments, at least one initiator protein specific for a heterologous viral episomal DNA replication origin comprises E2 or a functional fragment thereof. In a plurality of embodiments, at least one initiator protein specific for a heterologous viral episomal DNA replication origin comprises EBNA-1 or a functional fragment thereof. In a plurality of embodiments, the system comprises at least two initiator proteins specific for a heterologous viral episomal replication origin. In a plurality of embodiments, at least two initiator proteins specific for a heterologous viral episomal DNA replication origin are E1 and E2 or functional fragments thereof. In a plurality of embodiments, the sequence encoding at least one initiator protein is present in a single separate plasmid. In a plurality of embodiments, the system comprises at least two initiator proteins specific for a heterologous viral episomal replication origin, and the sequences encoding the at least two initiator proteins can be present in a single separate plasmid. In a plurality of embodiments, the system comprises at least two initiator proteins specific for a heterologous viral episomal replication origin, and the sequence for the first initiator protein and the sequence for the second initiator protein can be present in separate plasmids.

[0096] In a plurality of aspects of the present disclosure, at least one gene product is present. In a plurality of embodiments, the at least one gene product comprises an antibody, an antibody fragment, a growth factor, or a small RNA. In a plurality of embodiments, the antibody comprises an anti-HER2 antibody or a fragment thereof. In a plurality of embodiments, the growth factor comprises vascular endothelial growth factor (VEGF) or a variant thereof. In a plurality of embodiments, the small RNA comprises shRNA, siRNA, or miRNA. In a plurality of embodiments, the miRNA comprises CCR5 miRNA. Method

[0097] Aspects of the present disclosure include methods of administering a VIV system to a patient in need thereof, wherein the VIV system encodes at least 1, at least 2, at least 3, at least 4, or at least 5 target genes. Considering the versatility, therapeutic potential, and VIV systems disclosed, the VIV systems described in aspects of the present disclosure include, but are not limited to, antibodies against antigens associated with infectious diseases or toxins produced by infectious agents, platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin or dystrophin-associated complex, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA or RNA against autoantigens involved in colitis, inflammatory bowel disease, or Crohn's disease, small interfering RNAs involved in drug addiction that regulate neurasthenia against opiates or alcohol, tumor suppressor genes, genes that regulate cell survival including pro-apoptosis or anti-apoptosis genes and pro-autophagy or anti-autophagy genes, genes encoding radiation tolerance factors, genes encoding luminescent proteins used to track tumor cell metastasis or other cell transport phenomena, or various other therapeutically useful sequences that can be used to condition the body to obtain the maximum effect of radiation, surgery, or chemotherapy, or to protect tissues from radiation, surgery, or chemotherapy, improve organ transplantation, or modify host or graft tissues to suppress hyperreactivity, particularly in the airway.

[0098] Furthermore, without limiting any of the foregoing, in another aspect, a method is provided for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a cell. The method includes contacting the cell with an effective amount of a non-integrating viral delivery system, where the system includes a viral vector, the viral vector including a defective integrase gene, a heterologous viral episomal origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal origin of replication, the expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication being inducible, and including at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA.

[0099] In another aspect, provided is a method of expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a subject in need thereof. The method includes administering to the subject in need thereof an effective amount of a non-integrating viral delivery system, where the system includes a viral vector, and the viral vector includes a defective integrase gene, a heterologous viral episomal origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal origin of replication, where expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. The sequence encoding at least one initiator protein may be present on a single separate plasmid, and the at least one initiator protein may be either E1 or E2 alone or in combination, or fragments thereof. The method optionally includes administering to the subject in need thereof a first amount of a single separate plasmid for initiating a first expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. The method optionally includes administering to the subject in need thereof a second amount of a single separate plasmid for initiating a second expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. In circumstances where the second amount is lower than the first amount, the expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA may decrease. In circumstances where the second amount is higher than the first amount, the expression level of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA may increase. Infectious disease

[0100] Methods are provided for treating or preventing infectious diseases. Prophylactic delivery of monoclonal antibodies is currently being practiced in high-risk individuals, e.g., individuals at high risk of exposure to infectious diseases due to their health status or geographical location. Prophylactic delivery includes, for example, delivery of protective antibodies against lethal viral agents to protect individuals traveling within endemic regions (e.g., military medics and relief workers entering Ebola-infected areas). Vaccines have been little tested for diseases such as Ebola or Lassa fever virus, or dengue fever, or chikungunya virus, or Plasmodium spp. which cause malaria, and chronic expression of prophylactic antibody genes via the use of integrating vectors has unknown health risks. Thus, a medically highly desired effective antibody expression that is high but transient is required.

[0101] The disclosed VIV systems and methods of delivering high copy numbers of a gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNAs over a limited period of time meet this medical need. Non-limiting examples of gene products that can be delivered to treat infectious diseases are antibodies specific for the infectious disease in question.

[0102] In one aspect, the disclosure relates to methods of treating, preventing, or minimizing a condition, symptom, or side effect associated with an infectious disease. In certain embodiments, the infectious disease can be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa fever virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious diseases. In some embodiments, the VIV system can be administered prophylactically or after infection with an infectious disease.

[0103] In another aspect, the VIV system can be used to prevent an infectious disease. A subject suspected of having an increased risk of exposure to a particular infectious disease can receive administration of a prophylactically effective amount of a VIV encoding an antibody that specifically targets the infectious disease in question.

[0104] In certain embodiments, the infectious disease can be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa fever virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious diseases. In certain embodiments, the VIV vector can be administered prophylactically or after infection with an infectious disease. Wound healing

[0105] Wound healing In another embodiment, the present disclosure relates to methods of treating, preventing, or minimizing conditions, symptoms, or side effects associated with wound healing. The disclosed compositions can be administered systemically or directly to wounds following an accident, injury, or surgery. In the case of surgery, the VIV system can be administered prophylactically to promote healing. In the case of wounds due to an accident, injury, or surgery, the VIV system can be administered some time after wound formation. For example, the VIV system can be administered within about 1, about 2, about 3, about 4, about 5, about 10, about 12, about 24, about 36, about 48, about 60, about 72, about 84, about 96, about 108, about 120, or about 168 hours after wound formation.

[0106] Another application of the methods and compositions of the present disclosure is the transient delivery of a VIV construct that can express platelet growth factors that accelerate wound healing. High doses of platelet-derived growth factor (PDGF), related growth factors, fragments thereof, and nucleotide variants related thereto are required to be very rapid but transient. The disclosed systems and methods are ideal for this type of application.

[0107] Additional short-term applications include the expression of brain-derived growth factors for the intermittent treatment of alcohol abuse, nerve growth factors for spinal cord regeneration, and topical applications for skin conditions.

[0108] Bone diseases or injuries In one embodiment, the present disclosure relates to a method of enhancing bone healing, comprising the steps of identifying a subject having a bone injury and administering to the subject a therapeutically effective amount of the viral delivery system disclosed herein. The viral delivery system includes a viral vector, a heterologous viral episomal origin of replication, a sequence encoding an initiator protein specific for the heterologous viral episomal origin of replication, and at least one gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest, wherein the viral vector has a defective integrase gene and the expression of the sequence encoding the initiator protein specific for the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter. The bone injury can be due to an accident, trauma, or surgery and can be a nonunion or an acute fracture or a required spinal fusion. In some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest encodes bone morphogenetic protein 1-4 or cyclooxygenase-2 or vascular endothelial growth factor or fragments thereof. Further, in certain embodiments, the variants described above are preferred for treating bone injury or related diseases and they are within the scope of the present disclosure.

[0109] In one embodiment, the present disclosure relates to a method for enhancing bone healing, comprising the steps of identifying a subject having a bone disorder and administering to the subject a therapeutically effective amount of a viral delivery system according to the present disclosure. The viral delivery system includes a viral vector, a heterologous viral episomal origin of replication, a sequence encoding an initiator protein specific for the heterologous viral episomal origin of replication, and at least one gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest, wherein the viral vector has a defective integrase gene, and the expression of the sequence encoding the initiator protein specific for the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter. The bone disorder can be, for example, due to an accident, injury, or surgery, and can be nonunion of bone, an acute fracture, or a required spinal fixation. Further, the bone disorder can be low bone density, low blood flow to the bone, aging, a genetic condition, and the like. In some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest encodes bone morphogenetic protein 1-4, cyclooxygenase-2, or vascular endothelial growth factor. Hereditary genetic disease

Table 2

[0110] In embodiments, the present disclosure relates to methods of treating, preventing, or minimizing conditions, symptoms, or side effects associated with hereditary genetic diseases. Some examples of such hereditary genetic diseases are disclosed in Table 2 of this specification, along with the causative type of mutation and the chromosome involved, using the following nomenclature. P - point mutation, or any insertion / deletion entirely within one gene D - deletion of one or more genes C - gain, loss, or both of entire chromosomes (see chromosomal abnormalities) T - trinucleotide repeat disorder: the gene is elongating in length

[0111] Current gene therapies include attempts to edit genomic DNA via gene deletion, replacement, or re-sequencing. Various gene therapy systems known in the art include Talen, CRISPR-Cas9, zinc finger endonuclease, TALEN, etc., which rely on lentiviral transduction for delivery of genetic material. However, unlike the present disclosure, these systems can modify unexpected sites by active chromosomal modification systems, remain active intracellularly for an extended period of time, and can have unexpected results leading to new genetic diseases including cancer. A truly practical system for modifying host DNA requires transient and well-regulated expression via methods such as those disclosed herein.

[0112] In one embodiment, the present disclosure relates to a method of treating a hereditary genetic disease, comprising the steps of identifying a subject having a hereditary genetic disease and administering to the subject a therapeutically effective amount of a viral delivery system according to the present disclosure. The viral delivery system includes a viral vector, a heterologous viral episomal origin of replication, one or more of the sequences encoding an initiator protein specific for the heterologous viral episomal origin of replication, and at least one gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest, wherein the viral vector has a defective integrase gene and the expression of the sequence encoding the initiator protein specific for the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter. The hereditary genetic disease can be, for example, the diseases listed in Table 2, and in some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest encodes the non-mutated form of the gene listed in Table 2. Without limitation, a particular hereditary genetic disease can be CF, and the treatment can be traced by expressing the non-mutated form of CFTR as detailed herein.

[0113] In another embodiment, a guide RNA targeting sequence is incorporated into the VIV system disclosed. The guide RNA sequence is a sequence used to direct a gene editing mechanism to a specific site within the host genome that is mutated or otherwise in need of modification. By including the guide RNA within the cargo of the VIV system, modification of the chromosomal section in need of modification becomes possible, and the same modification occurs within the VIV, accelerating degradation and / or dilution by the host. In one embodiment, the disclosed viral delivery system comprises a viral vector, a heterologous viral episomal origin of replication, one or more of the sequences encoding an initiator protein specific for the heterologous viral episomal origin of replication, at least one gene of interest, shRNA, siRNA, miRNA, and / or other gene silencing RNAs, and at least one guide RNA, wherein the viral vector has a defective integrase gene and the expression of the sequence encoding an initiator protein specific for the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter.

[0114] Ex vivo modification of cells or tissues In another aspect, the VIV system can be used to modify cells or tissues used in the treatment of diseases. Cells can include, but are not limited to, primary cells such as lymphocytes, stem cells, epithelial cells, and nerve cells. For example, the VIV system can be used to modify lymphocytes redirected against a specific disease, including cancer, infectious diseases, or autoimmunity, and when the long-term presence of the genetically modified cells poses a health risk. For example, the VIV system can be used to program pluripotent stem cells that require high levels of transcriptional factors at defined intervals and when the long-term presence of the integrated viral vector is not desirable. Suitable epithelial cells include epithelial cells that can be used for synthetic skin or other applications. These may require the expression of trophic or growth factors during the initial treatment that are detrimental to the function of normal tissue after treatment and are optimally delivered by the VIV system disclosed herein.

[0115] Dosage and dosage form The disclosed VIV system enables short-term, medium-term, or long-term expression of a gene or sequence of interest and episomal maintenance of the disclosed vectors. Thus, the dosing regimen can vary based on the condition being treated and the method of administration.

[0116] In one embodiment, the VIV can be administered to a subject in need thereof at various doses. Specifically, the subject can be administered at a dose of ≧10 6 infectious doses (where on average 1 dose is required to transduce 1 target cell). More specifically, the subject can be administered at a dose of ≧10 7 , ≧10 8 , ≧10 9 , or ≧10 10 infectious doses. The upper limit of VIV dosing is determined for each disease indication and is based on the toxicity / safety profile for an individual product or product lot.

[0117] Furthermore, the VIV can be administered once or twice a day. Alternatively, the VIV can be administered to a subject in need thereof once a week, once every two weeks, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every 18 months, every two years, every 36 months, or every three years or at longer intervals.

[0118] In various aspects and embodiments, the VIV is administered as a pharmaceutical composition. In an embodiment, a pharmaceutical composition comprising the VIV can be formulated for clinical application in a wide range of nasal, pulmonary, oral, topical, or parenteral dosage forms. Each of the dosage forms can contain diluents such as various disintegrants, surfactants, fillers, thickeners, binders, wetting agents, or other pharmaceutically acceptable excipients. A pharmaceutical composition comprising the VIV can also be formulated for injection.

[0119] The VIV composition can be administered using any pharmaceutically acceptable method, such as intranasal administration, buccal administration, sublingual administration, oral administration, rectal administration, ocular administration, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intracisternal, intraperitoneal) administration, pulmonary administration, vaginal administration, topical administration, local administration, local administration after scarring, mucosal administration via aerosol or via buccal or nasal spray formulations, etc.

[0120] Furthermore, the VIV composition can be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, troches, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, and suspensions. Furthermore, the composition can be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof. Furthermore, the composition can be a transdermal delivery system.

[0121] In another embodiment, the pharmaceutical composition comprising VIV can be formulated into a solid dosage form for oral administration, and the solid dosage form can be a powder, granule, capsule, tablet, or pill. In another embodiment, the solid dosage form can contain one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. Furthermore, the solid dosage form can contain a lubricant such as talc or magnesium stearate in addition to the excipient. In an embodiment, the oral dosage form can be an immediate release or modified release form. Modified release dosage forms include controlled or extended release, enteric release, etc. Excipients used in modified release dosage forms are generally known to those skilled in the art.

[0122] In an embodiment, the pharmaceutical composition comprising VIV can be formulated as a sublingual or buccal dosage form. Such dosage forms include sublingual tablets or solution compositions administered under the tongue, and buccal tablets placed between the cheek and the gum.

[0123] In another embodiment, the pharmaceutical composition comprising VIV can be formulated as a nasal dosage form. Such dosage forms of the present disclosure include solution, suspension, and gel compositions for nasal delivery.

[0124] In embodiments, the pharmaceutical composition can be formulated into a liquid dosage form for oral administration, such as a suspension, emulsion, or syrup. In embodiments, the liquid dosage form can include various excipients such as wetting agents, sweeteners, flavors, or preservatives in addition to commonly used simple diluents such as water and liquid paraffin. In embodiments, the composition containing VIV or a pharmaceutically acceptable salt thereof can be formulated to be suitable for administration to pediatric patients.

[0125] In embodiments, the pharmaceutical composition can be formulated into a dosage form for parenteral administration, such as a sterile aqueous solution, suspension, emulsion, non-aqueous solution, or suppository. In embodiments, the non-aqueous solution or suspension can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate. As the base material for suppositories, witepsol, macrogol, tween 61, cocoa butter, laurin oil, or glycerinated gelatin can be used.

[0126] The dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, time and mode of administration, excretion rate, and severity of the disease.

[0127] Definitions Terms not specifically defined herein are understood to have the same meaning as understood by those skilled in the art.

[0128] As used herein, the term "about" is understood by those skilled in the art and varies to some extent depending on the context in which it is used. When terms that are not obvious to those skilled in the art even considering the context in which the term is used are used, "about" means plus or minus 10% of the specific term.

[0129] The term "administration of" or "administering" an active substance means providing the active substance of the present disclosure to a subject in need of treatment in a therapeutically useful form and in a form that can introduce it into the body of the individual in a therapeutically effective amount.

[0130] The term "basal level" refers to the expression of the cargo when no initiator protein has been added.

[0131] The term "BMP" refers to bone morphogenetic protein.

[0132] The term "cargo" refers to a gene or gene product expressed using the viral delivery systems disclosed herein.

[0133] The term "CF" refers to cystic fibrosis, and the term "CFTR" refers to the cystic fibrosis transmembrane conductance regulator protein.

[0134] The terms "express", "expressed", or "encoding" refer to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is then translated into a peptide, polypeptide, or protein. Expression can include splicing of mRNA in eukaryotic cells or other forms of post-transcriptional or post-translational modification.

[0135] The term "fragment 1" is synonymous with "F1" and "Frag1" and refers to the fragment 1 truncation of the LCR detailed herein. The term "fragment 2" is synonymous with "F2" and "Frag2" and refers to the fragment 2 truncation of the LCR detailed herein. The term "fragment 3" is synonymous with "F3" and "Frag3" and refers to the fragment 3 truncation of the LCR detailed herein. The term "fragment 4" is synonymous with "F4" and "Frag4" and refers to the fragment 1 construct of the LCR detailed herein.

[0136] The terms "individual", "host", "subject", and "patient" are used interchangeably herein.

[0137] The term "induced level" refers to the expression of the cargo after addition of at least one initiator protein.

[0138] The term "LCR" refers to, for example, the long control region of HPV16.

[0139] The term "PDGF" refers to platelet-derived growth factor.

[0140] The term "treatment course in the first quadrant" includes a reference to the treatment course included in the first quadrant of FIG. 21. As a non-limiting example, the treatment course in the first quadrant includes gene editing, safety research, and the objectives outlined in Example 17. The term "treatment course in the second quadrant" includes a reference to the treatment course included in the second quadrant of FIG. 21. As a non-limiting example, the treatment course in the second quadrant includes cell reprogramming, checkpoint inhibition, and the objectives outlined in Example 18. The term "treatment course in the third quadrant" includes a reference to the treatment course included in the third quadrant of FIG. 21. As a non-limiting example, the treatment course in the third quadrant includes passive immunization, immune stimulation, and the objectives outlined in Example 19. The term "treatment course in the fourth quadrant" includes a reference to the treatment course included in the fourth quadrant of FIG. 21. As a non-limiting example, the treatment course in the fourth quadrant includes placebo control and the objectives outlined in Example 20.

[0141] The term "Quadrant 1 factor" refers to any biological factor that promotes a basal episomal copy number profile as shown in Quadrant 1 of FIG. 20. By way of non-limiting example, Quadrant 1 factors include the Frag2, Frag3, and Frag4 sequences. The term "Quadrant 2 factor" refers to any biological factor that promotes an inducible episomal copy number profile as shown in Quadrant 2 of FIG. 20. By way of non-limiting example, Quadrant 2 factors include the Frag2, Frag3, and Frag4 sequences in combination with the E1 and / or E2 initiator proteins. The term "Quadrant 3 factor" refers to any biological factor that promotes an inducible episomal copy number profile as shown in Quadrant 3 of FIG. 20. By way of non-limiting example, Quadrant 3 factors include the LCR and Frag1 sequences in combination with the E1 and / or E2 initiator proteins. The term "Quadrant 4 factor" refers to any biological factor that promotes a basal episomal copy number profile as shown in Quadrant 4 of FIG. 20. By way of non-limiting example, Quadrant 4 factors include the LCR and Frag1 sequences.

[0142] The term "shRNA" refers to short hairpin RNA; the term "siRNA" refers to small (or short) interfering RNA; and the term "miRNA" refers to microRNA.

[0143] The term "therapeutically effective amount" refers to and denotes a sufficient amount of an active substance of the present disclosure within a suitable composition and in a suitable dosage form for treating or preventing the symptoms, progression, or onset of complications found in a patient suffering from a given disease, injury, disorder, or condition. The therapeutically effective amount will vary depending on the state or severity of the patient and the age, weight, etc. of the subject being treated. The therapeutically effective amount can vary depending on any of a number of factors, including, for example, the route of administration, the state of the subject, and other factors understood by one of ordinary skill in the art.

[0144] The term "treatment" or "treating" generally refers to an intervention into an attempt to modify the natural course of the subject being treated, and can be performed for prevention or during the course of clinical pathology. Desired effects include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, suppressing, weakening, or inhibiting any direct or indirect pathological result of a disease, improving or alleviating a medical condition, and producing remission or improvement of prognosis.

[0145] The term "very low", when used in the context of basal expression levels, refers to very low expression levels and / or episomal copy numbers (as appropriate), and may include undetectable expression and / or episomal copy numbers. As a non-limiting example, a very low expression level includes fewer than 0.020 episomal copies per cell. The term "very low", when used in the context of basal expression levels, may also be referred to herein as the "first defined level". The term "slightly higher", when used in the context of basal expression levels, refers to a level of low expression and / or episomal copy number that is slightly higher compared to the "very low" criterion. As a non-limiting example, a slightly higher expression level includes episomal copies of 0.020 or higher per cell and fewer than 0.2 episomal copies per cell. The term "slightly higher", when used in the context of basal expression levels, may also be referred to herein as the "second defined level".

[0146] As used herein, the term "VIV" refers to a vector-in-vector system for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The term "VIV", when used herein, is used synonymously with viral delivery systems and transient vectors.

[0147] The following examples are provided to illustrate aspects of the present invention. However, the present invention is not limited to the specific conditions or details described in these examples. All published publications referred to herein are specifically incorporated by reference.

Example

[0148] Example 1 VIV for treating infectious diseases This example demonstrates an exemplary VIV construct for treating infectious diseases.

[0149] In this example, FIG. 1A represents an exemplary linear VIV construct for treating Ebola virus infectious diseases. Here, at least one of the "cargo" portions shown in FIG. 1A encodes an antibody that specifically targets the Ebola virus. As shown in FIG. 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.

[0150] A therapeutically effective amount of a VIV encoding an antibody that specifically targets the Ebola virus can be administered to a subject suspected of having or diagnosed with the Ebola virus, alone or in combination with one or more additional agents for treating or preventing Ebola. The VIV encoding an antibody that specifically targets the Ebola virus and / or the additional agent(s) can be administered orally, intranasally, intrathecally, intravitreally, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. The subject is then evaluated daily for the presence and / or severity of Ebola virus-related signs and symptoms including, but not limited to, fever, fatigue, malaise, debilitation, red eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. Treatment is maintained until such time as one or more signs or symptoms of Ebola virus infection are improved or eliminated.

[0151] It is reasonably predicted that a subject suspected of being infected with Ebola virus or diagnosed with having Ebola virus and administered with a therapeutically effective amount of VIV encoding an antibody that specifically targets Ebola virus will show a reduction in severity or elimination of one or more symptoms associated with Ebola virus infection. Furthermore, it is highly anticipated that administering VIV encoding an antibody that specifically targets Ebola virus in combination with one or more additional agents will have a synergistic effect.

[0152] These results indicate that VIV encoding an antibody that specifically targets Ebola virus is useful in the treatment of Ebola virus. Example 2 VIV for preventing infectious diseases

[0153] This example demonstrates an exemplary VIV construct for preventing infectious diseases. In this example, Figure 1A represents an exemplary linear VIV construct for preventing infection with Ebola virus infectious disease. Here, at least one of the "cargo" portions shown in Figure 1A encodes an antibody that specifically targets Ebola virus. As shown in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize the viral nucleic acid.

[0154] A prophylactically effective amount of a VIV encoding an antibody that specifically targets the Ebola virus, alone or in combination with one or more additional agents for treating or preventing Ebola, can be administered to a subject suspected of having an increased risk of contracting the Ebola virus prior to entering an area where the risk of contracting Ebola is increased. The VIV encoding an antibody that specifically targets the Ebola virus and / or the additional agent(s) can be administered orally, intranasally, intrathecally, intravitreally, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. The subject is then evaluated daily for the presence and / or severity of signs and symptoms associated with the Ebola virus, including but not limited to fever, fatigue, malaise, debilitation, red eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. Treatment is maintained for a time such that one or more signs or symptoms of Ebola are prevented.

[0155] A subject suspected of or diagnosed as having been exposed to the Ebola virus and administered a prophylactically effective amount of a VIV encoding an antibody that specifically targets the Ebola virus can reasonably be expected to have a reduced risk of exposure to Ebola. Furthermore, it is reasonably predictable that administration of a combination of a VIV encoding an antibody that specifically targets the Ebola virus and one or more additional agents will have a synergistic effect. These results indicate that a VIV encoding an antibody that specifically targets the Ebola virus is useful in the prevention of the Ebola virus. Example 3 VIV for enhancing wound healing

[0156] This example demonstrates an exemplary VIV construct for enhancing wound healing. In this example, FIG. 1A represents an exemplary linear VIV construct for enhancing wound healing. Here, at least one of the "cargo" portions shown in FIG. 1A encodes platelet-derived growth factor (PDGF) (SEQ ID NO: 17). As shown in FIG. 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.

[0157] A therapeutically effective amount of a VIV encoding platelet-derived growth factor (PDGF) can be administered to a subject having a wound (e.g., due to an accident, injury, or surgery) alone or in combination with one or more additional agents for treating or sterilizing the wound. The VIV PDGF and / or the additional agent(s) can be administered orally, intranasally, intrathecally, intravitreally, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. The subject is then evaluated daily to determine the status of the wound. The treatment is maintained until the wound heals and scarring is minimized.

[0158] It is reasonably predicted that a subject having a wound and administered a therapeutically effective amount of VIV PDGF will show enhanced wound healing. Further, it is reasonably expected that administering a VIV encoding PDGF in combination with one or more additional agents will have a synergistic effect. These results indicate that a VIV encoding PDGF is useful for enhancing wound healing. Example 4 VIV for treating bone injuries

[0159] This example demonstrates an exemplary VIV construct for treating bone injuries. In this example, FIG. 1A depicts an exemplary linear VIV construct for treating bone injuries. Here, at least one of the "cargo" portions shown in FIG. 1A encodes bone morphogenetic protein (BMP) (SEQ ID NO: 18). As shown in FIG. 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.

[0160] A therapeutically effective amount of a VIV encoding bone morphogenetic protein (BMP) is administered to a subject suspected of having or diagnosed with a bone injury, either alone or in combination with one or more additional agents for treating the bone injury. The VIV encoding BMP and / or the additional agent(s) are administered orally, intranasally, intramedullary, intravitreally, intradermally, transmucosally, iontophoretically, locally, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. The subject is then evaluated weekly for the presence and / or severity of signs and symptoms associated with the bone injury to determine the rate and strength of healing. The treatment is maintained until the bone has healed.

[0161] It is reasonably predicted that a subject suspected of having or diagnosed with a bone injury and administered a therapeutically effective amount of a VIV encoding BMP will exhibit a reduction in the severity of the injury and an enhancement of healing. Furthermore, it is reasonably expected that administering a VIV encoding BMP in combination with one or more additional agents will have a synergistic effect. These results indicate that a VIV encoding BMP is useful in the treatment of bone injuries or diseases. Example 5 VIV for Treating Genetic Diseases

[0162] This example demonstrates an exemplary VIV construct for treating cystic fibrosis (CF). In this example, FIG. 1A depicts an exemplary linear VIV construct for treating CF, a genetic disease. Here, at least one of the "cargo" portions shown in FIG. 1A encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (NM_000492). As shown in FIG. 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.

[0163] A therapeutically effective amount of a VIV encoding the cystic fibrosis transmembrane conductance regulator (CFTR) can be administered to a subject suspected of having or diagnosed with (CF) alone or in combination with one or more additional agents for treating CF. The VIV encoding CFTR and / or the additional agent(s) can be administered orally, intranasally, intrathecally, intravitreally, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. The subject is then evaluated weekly for the presence and / or severity of CF-related signs and symptoms including, but not limited to, poor growth, persistent cough, thick sputum and mucus, wheezing, shortness of breath, decreased exercise ability, repeated lung infections, nasal inflammation, greasy stools, intestinal obstruction, and poor weight gain. Treatment is maintained until such time as one or more signs or symptoms of CF are improved or eliminated.

[0164] It is reasonably predictable that a subject suspected of having or diagnosed with CF and administered a therapeutically effective amount of a VIV encoding CFTR will show a reduction in severity or elimination of one or more symptoms associated with CF. Furthermore, it is reasonably expected that administering a VIV encoding CFTR in combination with one or more additional agents will have a synergistic effect. These results indicate that a VIV encoding CFTR is useful in the treatment of CF. Example 6 VIV containing E1 for expressing cargo

[0165] A vector according to Figure 2 containing the green fluorescent protein gene (GFP) as cargo was prepared. DNA containing the complete locus control region and E1 protein of human papillomavirus type 16 (NCBI accession number U89348, SEQ ID NO: 19) was chemically synthesized. Individual segments and / or coding sequences were first synthesized. These were amplified by polymerase chain reaction (PCR) using synthetic oligonucleotide primers identical to the 5' end of the green fluorescent protein gene and synthetic oligonucleotide primers complementary to the 3' end of the green fluorescent protein. The 5' primer (SEQ ID NO: 20) extended from its 5' end having a recognition site for BamHI or EcoRI endonuclease. The 3' primer (SEQ ID NO: 21) extended at its 3' end having a complement of the BamHI or EcoRI endonuclease recognition site. Subsequently, the obtained amplified green fluorescent protein gene sequence was digested with BamHI and EcoRI restriction endonucleases.

[0166] The lentiviral vector was obtained from System Biosciences, Inc. The plasmid was cleaved with BamHI and EcoRI enzymes and mixed with the overamplified green fluorescent protein gene sequence at a ratio of insert to vector of 1:3.

[0167] Subsequently, the enzyme activity was stopped by heat inactivation at 70 degrees Celsius for 20 minutes. The above mixture was cooled to room temperature to allow annealing.

[0168] The annealing reaction was carried out at room temperature for 30 minutes using bacteriophage T4 DNA ligase. 2.5 microliters of the obtained ligation mixture was added to 25 microliters of STBL3 competent bacterial cells.

[0169] Subsequently, transfection was carried out by a simple (1 minute) heat shock at 42 degrees Celsius.

[0170] Bacterial cells were streaked onto agar plates containing ampicillin to obtain bacterial cultures. These cultures were grown in Luria broth.

[0171] To confirm the insertion of the amplified green fluorescent protein gene sequence into the lentiviral vector packaging plasmid, DNA was extracted from the above bacterial cultures and purified by standard methods. The purified DNA was digested with the same endonucleases used to create the construct. The fragment lengths were analyzed by agarose gel electrophoresis, and the amplified green fluorescent protein gene sequence was verified by DNA sequencing using specific primers obtained from Eurofins MWG Operon LLC.

[0172] Lentiviral vector stocks were prepared as follows. At least two lentiviral packaging plasmid plus cargo plasmid were co-transfected into HEK cells that express viral genes and genomic RNA, assembled into integrase-deficient lentiviral particles, and released into the culture medium. Cell-free supernatants were generated and harvested at intervals of 3 to 10 days after transfection. Lentiviral particles were purified by standard procedures including combinations of methods that may include centrifugation, tangential flow filtration, size exclusion chromatography, size exclusion filtration, or ion exchange chromatography. The concentration and biological activity (transducing units per ml) for each stock were determined.

[0173] Mammalian cells containing 293T cells were used to test the formation, copy number, and expression of lentivirus-derived episomes. The 293T cells were transduced with integrase-deficient lentiviral particles in the presence of polybrene at a multiplicity of infection ranging from 1 to 10. Unabsorbed virus was removed by washing the cells 3 hours after application, and the cells were cultured for 3 days. The cells were observed under a fluorescence microscope, and the cells expressing GFP were counted. Untransduced 293T cells were used as a negative control. The data were reported as GFP-positive cells per 100 viable cells in the culture. At least 300 cells were counted per microscopic field, and 5 - 10 fields were counted in each replicate experiment. Four independent transduction experiments were performed, including one negative control (the leftmost data column) and three replicate experiments (i.e., the data columns designated as Experiment 1, Experiment 2, and Experiment 3), to determine the frequency of transduced cells. The data are shown in Figure 3 and show the expression of GFP over three replicate experiments. Example 7 VIV containing E1 and E2 for expressing cargo

[0174] Referring to Figure 4, vector 19 can be constructed to contain both the E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) initiator proteins. Here, the gene cargo is a CMV / GFP expression cassette under the control of an inducible promoter.

[0175] 293T cells can be transduced with Vector 19 at a multiplicity of infection of between 1 and 20 transduction units per cell. After 3 hours, the cells are washed with medium to remove unadsorbed virions and returned to the culture. Between 12 and 24 hours after transduction, the cells are treated with at least one dosage of a compound that can induce the inducible promoter. When a compound that can induce the inducible promoter is added, the mRNAs of E1 and E2 are transcribed from the episome, combined with the locus control region fragment 2 (LCR / F2) (SEQ ID NO: 3), and assembled, causing DNA replication. The lentivirus-derived episome begins to decay approximately 24 to 36 hours after the cessation of promoter induction. The protein product from the cargo within Vector 19 is measured by analytical flow cytometry. Example 8 Introduction of E1 and E2 for expressing cargo

[0176] To determine the effect of E1 and E2 expressing cargo, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 (SEQ ID NO: 1) long control region (LCR) or the 3' fragments as described herein in fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5) (i.e., the vector in FIG. 5A).

[0177] Referring to FIG. 5A, the full-length LCR or 3' fragment was utilized in the LCR region shown in FIG. 5A. More specifically, the illustration of the designed construct is demonstrated as vectors 9 - 13 in FIG. 7 of this specification. The additional elements shown in FIG. 7 refer to the psi packaging element (SEQ ID NO: 22); the rev element (SEQ ID NO: 23); the cPPT (central polypurine tract) element (SEQ ID NO: 24); and the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25).

[0178] After 24 hours, the cells were transfected with a plasmid containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using Lipofectamine 2000. After 2 days, mCherry expression was analyzed by FACS. The results of these experiments are shown in FIG. 6A of this specification.

[0179] To contrast with the above experiment in which E1 and E2 were introduced via a plasmid, a second set of experiments was conducted as described below. Briefly, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 long control region (LCR) (SEQ ID NO: 1) or shorter fragment 1 (SEQ ID NO: 2) based on the generalized vector shown in FIG. 5A of this specification. At the same time, the cells were transduced with a lentivirus expressing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 2 days, mCherry expression was analyzed by FACS as shown in FIG. 6B of this specification. As shown in FIG. 6B of this specification, when E1 and E2 were introduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length LCR (SEQ ID NO: 1) or shorter fragment 1 (also referred to as fragment 1 in this specification and also referred to as SEQ ID NO: 2 in this specification), a greater percentage of mCherry cells was achieved.

[0180] The data detailed in this example demonstrate that when E1 and E2 were expressed via lentivirus-mediated expression, there was stronger expression of the full-length HPV ori (LCR) and fragments, and thus greater activation.

[0181] Second, the data from this example demonstrate that there are differences in HPV ori activation depending on the size of the LCR region. For example, referring to FIG. 6, when using the full-length LCR (SEQ ID NO: 1) and fragment 1 (SEQ ID NO: 2), there were more significant changes in mCherry expression compared to when using fragment 2 (SEQ ID NO: 3), 3 (SEQ ID NO: 4), and 4 (SEQ ID NO: 5). Example 9 Expression of VEGF

[0182] As described herein, VEGF can be selected, inter alia, as a "cargo" region for treating bone injury. To further analyze VEGF expression levels, 293T cells were transduced with a D64V integrase-deficient lentiviral vector containing human cDNA for VEGF (SEQ ID NO: 26) and fragment 1 of the HPV16 long control region (LCR) (SEQ ID NO: 2) (see Figure 5B for a general description of the VEGF-containing vector). At the same time, the cells were transduced with a lentiviral vector containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). Two days later, the cell culture medium was collected and analyzed using an ELISA kit for VEGF (Thermo Scientific). As shown in Figure 8, there was an increase in VEGF levels (3594 pg / ml) using the VEGF expression vector, and a further increase (11856 pg / ml) when E1 and E2 were used.

[0183] In a manner similar to the results of mCherry from Example 8 above, the results demonstrate that there were differences in HPV ori activation depending on the size of the LCR region. As shown in Figure 8, there was an approximately 3-fold change in VEGF levels after the addition of E1 / E2. Thus, the full-length LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2) expressed the gene of interest (i.e., VEGF) at a low level, but there was a strong induction of expression when E1 / E2 was introduced. In contrast, the other fragments tested expressed at higher initial levels and the differences upon introduction of E1 / E2 were reduced. Example 10 Development of E1- and E2-containing vectors

[0184] Using standard molecular biology techniques (e.g., Sambrook; Molecular Cloning: A Laboratory Manual, 4th Edition) and the techniques described herein, a series of lentiviral vectors containing the HPV LCR as well as E1 and E2 were developed as described in more detail below. These vectors are also shown in Figure 9 of this specification.

[0185] Referring to FIG. 9, vector 20 was developed, which is a general lentiviral vector for expressing cDNA, microRNA, or shRNA. Referring to vector 20, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); promoter; cDNA, microRNA, shRNA or other cargo element; woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25), an LCR portion that can contain the LCR fragment detailed herein; and long terminal repeat (SEQ ID NO: 28).

[0186] Referring to FIG. 9, vector 21 was developed, which is a lentiviral vector for expressing E1. Referring to vector 21, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1 (SEQ ID NO: 6), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25); and long terminal repeat (SEQ ID NO: 28).

[0187] Referring to FIG. 9, vector 22 was developed, which is a lentiviral vector for expressing E1-C (carboxy terminus) (SEQ ID NO: 8). Referring to vector 22, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-C (SEQ ID NO: 8); woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25); and long terminal repeat (SEQ ID NO: 28).

[0188] Referring to FIG. 9, vector 23 was developed, which is a lentiviral vector for expressing E2(HPV16) (SEQ ID NO: 7). Referring to vector 23, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev responsive element (RRE) (SEQ ID NO: 23); UbiC promoter (SEQ ID NO: 30); E2(HPV16) (SEQ ID NO: 7); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long terminal repeat (SEQ ID NO: 28).

[0189] Referring to FIG. 9, vector 24 was developed, which is a lentiviral vector for expressing E2-11(HPV11) (SEQ ID NO: 9). Referring to vector 24, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev responsive element (RRE) (SEQ ID NO: 23); UbiC promoter (SEQ ID NO: 30); E2-11(HPV11) (SEQ ID NO: 9); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long terminal repeat element (SEQ ID NO: 28).

[0190] Referring to FIG. 9, vector 25 was developed, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO: 10). Referring to vector 25, from left to right, the important components of the developed vector are as follows: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-T2A-E2 (SEQ ID NO: 10); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long terminal repeat (SEQ ID NO: 28).

[0191] Referring to FIG. 9, vector 26 was developed, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO: 10) and the full-length LCR (SEQ ID NO: 1) or a fragment thereof (e.g., SEQ ID NOs: 2-5). Referring to vector 26, from left to right, the important components of the developed vector are as follows: long terminal repeat region (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-T2A-E2 (SEQ ID NO: 10); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25), LCR region; and long terminal repeat region (SEQ ID NO: 28).

[0192] Referring to FIG. 9, vector 27 is a general lentiviral vector for expressing, for example, cDNA, antibody, microRNA, or shRNA. Referring to vector 27, from left to right, the important components of the developed vector are as follows: long terminal repeat region (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); promoter; cDNA, microRNA, shRNA or other cargo element; post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25), EBV ori (SEQ ID NO: 31); and long terminal repeat element (SEQ ID NO: 28).

[0193] The linear vectors detailed herein circularize intracellularly as shown in FIG. 10, which shows the circularization of, for example, vector 20 (shown in FIG. 9). For the purposes of the experiments detailed herein, FIG. 10 details a primer set as arrows located at the 3' and 5' long terminal repeats (LTRs). This primer set is designed to amplify the episomal form of the lentiviral vector and does not amplify the integrated form of the vector. Appropriate primers for the detection of lentiviral episomes contain the following sequences: 3' LTR forward CTAATTCACTCCCAACGAAG (SEQ ID NO: 11); and 5’LTR reverse GCCGAGTCCTGCGTCGAGAG (SEQ ID NO: 12).

[0194] In the experiments detailed herein, the integrase-deficient lentiviral vector copy number was adjusted by combinations utilizing combinations of vector 20 with vector 21, vector 22, vector 23, or vector 24. Alternatively, the integrase-deficient lentiviral vector copy number was adjusted by combinations utilizing combinations of vector 20 with vector 25 or vector 26. Example 11 Development of LCR Fragments and Related Vectors

[0195] As discussed herein, the LCR portion of the vectors detailed herein can be fragments such as fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5), and were modified through their use.

[0196] The genomic organization of the LCR and the fragments described herein is shown in FIG. 11. In that figure, the full-length LCR (top) contains a series of AP1, YY1, E1, and E2 binding sites. For example, as shown in FIG. 11, fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5) represent an increase in the LCR with an increase in 5’ truncations in which a series of AP1, YY1, and E2 binding sites are decreased. Lentiviral vectors utilizing the LCR fragments are detailed herein (e.g., FIG. 7 and related examples herein). Example 12 Testing of Vectors Containing LCR Fragments and E1 / E2 Variants

[0197] To test vectors containing various LCR fragments detailed herein, 293T cells were transduced with a D64V integrase-deficient lentiviral vector containing either the full-length HPV16 long control region (LCR) or fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5) described herein (see, e.g., FIG. 7 and the related examples herein).

[0198] After 24 hours, the cells were transfected with a plasmid containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using Lipofectamine 2000. Two days later, DNA was extracted for analysis by qPCR. The episomal copy number was determined using primers represented by SEQ ID NO: 11 and SEQ ID NO: 12 specific for the episomal form of the lentiviral vector. Note that this primer set amplified only the 1- and 2-LTR episomes. Data for this example are shown in FIG. 12. In this figure, the numbers associated with the LCR and its fragments reflect the increase in fold change for each of the conditions after E1 and E2 addition.

[0199] As shown in FIG. 12, the basal episomal copy numbers for full-length LCR and Frag1 were very low. For example, for these two conditions (i.e., full-length LCR and Frag1), the basal episomal copy number was less than 0.020 episomal copies per cell. The basal episomal copy number was slightly higher for the Frag2, Frag3, and Frag4 constructs. For example, for these three conditions (i.e., Frag2, Frag3, and Frag4), the basal episomal copy number was 0.020 or higher episomal copies per cell. The basal episomal copy number data affected the relative fold change for each of the conditions tested. As shown in FIG. 12, when E1 / E2 was introduced into the system, the full-length LCR construct resulted in a 267-fold change increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag1 construct resulted in a 362-fold change increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag2 construct resulted in a 6-fold change increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag3 construct resulted in a 61-fold change increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag4 construct resulted in a 7-fold change increase in episomal copy number. The data detailed in FIG. 12 is also recalculated in a separate format in FIG. 20 of this specification.

[0200] In another set of related experiments, analysis was performed on mCherry expression from an integrase-deficient lentiviral vector containing the HPV LCR and its 3’ fragment. Briefly, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and either the full-length HPV16 long control region (LCR) or fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), or fragment 4 (SEQ ID NO: 5). At the same time, the cells were transduced with a lentivirus expressing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). Two days later, mCherry expression was analyzed by FACS.

[0201] As shown in FIG. 13A, the percentage of mCherry cells was determined for each of the tested conditions. The numbers associated with the LCR and its fragments reflect the increase in fold change for each of the conditions after addition of E1 and E2.

[0202] In another set of related experiments, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 long control region previously identified as SEQ ID NO: 1. At the same time, the cells were transduced with a lentivirus expressing HPV16 E1-T2A-E2 (SEQ ID NO: 10) from a single vector (see vector 25 in FIG. 9). Two days later, mCherry expression was analyzed by FACS. The data are shown in FIG. 13B. As shown in that figure, transduction with HPV16 E1-T2A-E2 (SEQ ID NO: 10) led to a significant increase in positive mCherry cells.

[0203] In another set of related experiments, analysis of mCherry expression was performed using an integrase-deficient lentiviral vector containing the HPV LCR after addition of E1, E1-C, and E2-11. Briefly, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and HPV16LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2). At the same time, the cells were transduced with HPV16 E1 (i.e., vector 21 in FIG. 9; and SEQ ID NO: 6) or the E1 carboxy (C) terminal fragment (i.e., vector 22 in FIG. 9; and SEQ ID NO: 8) and HPV16 E2 (i.e., vector 23 in FIG. 9; and SEQ ID NO: 7) or HPV11 E2 (i.e., vector 24 in FIG. 9; and SEQ ID NO: 9). Two days later, mCherry expression was analyzed by FACS. As shown in FIG. 14, the percentage of mCherry cells was determined for each of the tested conditions. The numbers associated with the tested conditions reflect the increase in fold change for each of the conditions after addition of E1 and E2. Example 13 Antibody expression

[0204] As described herein, one of the features of the disclosed system is the utility of the disclosed system for expressing antibodies. In a series of representative experiments detailed herein, anti-HER2 antibodies were expressed using a lentiviral vector system. Briefly, 293T cells were infected with a D64 integrase-deficient lentiviral vector (i.e., vector 20) containing the antibody sequence against HER2 (SEQ ID NO: 13) and the HPV LCR (SEQ ID NO: 1) sequence.

[0205] Simultaneously, the cells were infected with a lentiviral vector containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). Three days later, the cell culture medium was collected. The antibody was purified from the medium using protein A / G agarose beads. Immunoblotting was performed using sheep anti-human antibody (Thermo Scientific). Antibody production increased with the addition of E1 and E2, as shown in FIG. 15A. Furthermore, as shown in FIG. 15B, the anti-HER2 IgG concentration was determined using an EasyTiter IgG kit (Thermo Scientific).

[0206] Furthermore, as shown in FIG. 16 herein, additional antibodies can also be expressed using the system disclosed herein. In FIG. 16, an immunoblot demonstrating the expression of anti-EGFR antibody (SEQ ID NO: 14) is shown. Briefly, 293T cells were infected with a D64 integrase-deficient lentiviral vector containing the antibody sequence against EGFR (see SEQ ID NO: 14 below) and the HPV fragment 2 (SEQ ID NO: 3).

[0207] After 24 hours, the cells were infected with a lentiviral vector containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 3 days, cell lysates and cell culture media were harvested. Antibodies were purified from the media using protein A / G agarose beads and extracted from the cells by cell lysis. Immunoblots were performed using sheep anti-human antibody (Thermo Scientific) and anti-actin (Sigma) antibody for protein loading control of the cell lysates. Antibody production increased in both the cell lysates and media supplemented with E1 and E2, as shown in Figure 16. Example 14 MicroRNA Expression and Knockdown

[0208] As described herein, one feature of the disclosed system is the utility of the disclosed system for expressing microRNA. As a non-limiting example, constructs were designed to express microRNA for CCR5 based on SEQ ID NO: 15.

[0209] Briefly, HeLa cells expressing CCR5 were infected with a D64 integrase-deficient lentiviral vector (i.e., vector 20) containing the microRNA sequence for CCR5 (SEQ ID NO: 15) and the full-length HPV LCR (SEQ ID NO: 1) sequence. At the same time, the cells were infected with a lentiviral vector containing E1 and E2. After 3 days, the cells were harvested and analyzed for CCR5 expression by FACS analysis using an anti-CCR5 APC-conjugated antibody. As shown in Figure 17, the percentage of CCR5-positive cells decreased from 92.6% to 70.9% using LV-LCR miR-CCR5 and to 44% using LV-LCR miR-CCR5 + E1 and E2.

[0210] In a related experiment, a D64 integrase-deficient lentiviral vector containing the microRNA sequence for CCR5 and the fragment 2 (SEQ ID NO: 3) LCR sequence was utilized. As shown in Figure 18, there was a similar decrease in CCR5 expression after the addition of miR-CCR5, and an even further decrease when E1 and E2 were added.

[0211] Referring to FIG. 18 in more detail, the upper panel shows the distribution of cells each represented by a single point based on the expression level of mCherry. The lower panel shows the corresponding changes in CCR5 expression, which are related to the levels of DNA replication and miRNA production for CCR5. CCR5 is detected by a fluorescent monoclonal antibody used to stain the cell surface. In the absence of any LV vector (left panel), there is no expression of mCherry (all cells are in sector 1), and CCR5 expression is uniformly high at about 200 fluorescence intensity units. By adding LV-LCR containing miRCCR5 (fragment 2; SEQ ID NO: 3), the inventors found a basal expression of mCherry in cells (where 55% of the cells were found in sector 2) and a partial decrease in CCR5 expression (dashed line in the lower, middle panel) leading to a new population with fluorescence intensity units concentrated at about 30 intensity units. By adding both LV-LCR miRCCR5 and a non-integrating lentiviral vector expressing E1 and E2 replication proteins, the inventors found 18.8% of the cells with the highest expression of mCherry (sector 3) and a new population with even lower CCR5 expression with fluorescence intensity units less than 20 (curve 3, gray dashed line). These data demonstrate the ability of the VIV containing LCR fragment 2 (SEQ ID NO: 3) expressing basal levels of miRCCR5 that is biologically active in the reduction of cell surface expression of the CCR5 protein. Furthermore, the results show that the addition of E1 / E2 DNA replication proteins affects the vector copy number (related to the expression of mCherry), and increased miRCCR5 expression leads to a further decrease in cell surface CCR5 expression. Example 15 EBV-based initiator protein

[0212] As described herein, initiator proteins such as E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) can be used to enhance the efficacy of the systems described herein. The alternative initiator protein used in the current system is EBNA-1 (SEQ ID NO: 32). Thus, in a series of experiments, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing GFP and the Epstein-Barr virus (EBV) OriP sequence (SEQ ID NO: 31) (i.e., vector 27).

[0213] After 24 hours, the cells were transfected with a plasmid containing EBV EBNA-1 (SEQ ID NO: 32) using Lipofectamine 2000. Two days later, GFP expression was analyzed by FACS. As shown by representative data in Figure 19, EBV+EBNA resulted in enhanced GFP expression. Thus, this data demonstrates that the initiator protein / ori interaction is not limited to the E1 / E2 interaction and includes Epstein-Barr virus components as well. Example 16 Selection of LCR fragments for setting up an optimized virus delivery system

[0214] The LCR fragment length was selected according to the desired expression level in the cells. Figure 20 shows the data of the episomal copy number generated in Figure 12 herein. More specifically, Figure 20 illustrates a selection rubric according to one aspect of the present invention. The episomal copy per cell (Y-axis) was graphed against the LCR fragment length (X-axis). As shown in Figure 20, the variation in the expression level determined by the episomal copy per cell was due to the various LCR fragments tested herein. As shown in Figure 20, moving from right to left, the data for the full-length LCR (SEQ ID NO: 1), fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4) and fragment 4 (SEQ ID NO: 5) are shown with (black circle data points) and without (light grey circle data points) E1 / E2. As shown in Figure 12, the basal expression determined by the episomal copy per cell was lowest with the LCR and Frag1 constructs. For example, for these two conditions (i.e., full-length LCR and Frag1), the basal episomal copy number was less than 0.020 episomal copies per cell. The basal expression was slightly higher for the Frag2, Frag3 and Frag4 conditions. For example, for these three conditions (i.e., Frag2, Frag3 and Frag4), the basal episomal copy number was 0.020 or higher episomal copies per cell.

[0215] Referring to both FIGS. 11 and 20, an increase in the deletion from the 5'-end of the LCR removed important functional elements. Basal expression was defined by the number of episomal DNA copies measured by quantitative PCR assay when the LCR or LCR fragment was present within a lentivirus-derived episomal vector and in the absence of the addition of E1 / E2 proteins (e.g., light gray circle data points). Inducible activity was measured by transfecting an expression plasmid containing E1 and E2 (e.g., black circle data points) and then measuring the number of episomal DNA copies per cell by quantitative PCR assay after introducing the lentivirus-derived episomal vector. Similar results were obtained when the E1 / E2 protein expression construct was delivered as a non-integrating lentivirus vector. As detailed herein, basal expression was determined to be highest for fragments 2, 3, and 4 of the LCR. This indicates that basal expression was suppressed by the presence of YY1 transcription factor binding sites that are present in both the LCR and fragment 1 but not in fragments 2-4 as shown in FIG. 11. Among fragments 2-4, fragment 2 showed the highest basal expression and this fragment was the only fragment that contained both AP1 transcription factor binding sites. Thus, basal transcription increased when the YY1 site was removed and both AP1 sites were preserved. As detailed herein, inducible activity was determined to be highest for fragments 1 and 3, lower for fragments 2 and 4, and lowest for the intact LCR. There was an unspecified element within the LCR that was not present in fragment 1 and it acted to suppress inducible DNA replication. When the YY1 and AP1 sites were present (fragment 1), the episomal DNA levels were lower compared to when the YY1 and all AP1 sites were removed (fragment 3). When the AP1 sites were present without YY1 (fragment 2), or when the YY1, AP1, and two of four E2 binding sites were removed (fragment 4), inducible episomal DNA formation was moderate and similar to the LCR.

[0216] As summarized in Figure 20, the data detailed herein demonstrate distinguishable differences in the basal levels of expression and the ability to induce such expression. Based on this data, at least four quadrants of activity were defined as shown in Figure 20.

[0217] Referring to Figure 21, the four quadrants represent the degree of variability in activity due to the LCR and its associated fragments. As shown in Figure 21, the first quadrant reflects low activity but is 3 - 4 times higher in activity than the fourth quadrant and has a small LCR fragment. The second quadrant reflects high activity and again has a small LCR fragment. The third quadrant reflects high activity but this time has a relatively long LCR fragment. Finally, the fourth quadrant reflects very low activity and has a relatively long LCR fragment.

[0218] As detailed in Figure 21, each quadrant is rationally associated with a particular desired treatment course or outcome. As a representative example, when the desired treatment course or outcome involves gene editing, an LCR selected from the first quadrant is chosen. As a representative example, when the desired treatment course or outcome involves cell reprogramming, an LCR from the second quadrant is selected. As a representative example, when the desired treatment course or outcome is immune stimulation, an LCR from the third quadrant is selected. As a representative example, when the desired treatment course or outcome is the placebo effect, an LCR from the fourth quadrant is selected. Thus, various LCR fragments are employed using the current system based on the desired treatment course or outcome. Example 17 Treatment of individuals under the first quadrant

[0219] The treatment is designed for sickle cell anemia. In this approach, CD34+ bone marrow-derived hematopoietic progenitor stem cells (HPSCs) are removed, treated ex vivo with gene modification, and transplanted as autologous cell therapy. This strategy involves expressing inhibitory miRNAs that decrease the expression of Bcl11A protein, a potent repressor of fetal globin expression (Akinsheye et al., Blood, Vol. 118:19, 2011). When Bcl11A levels decrease, fetal globin expression increases and replaces adult globin in terms of normal cell function.

[0220] The ability to express sufficient levels of inhibitory miRNAs without dramatically increasing the viral vector dose raises concerns in safety trials, as this could in turn reduce the viability of transduced CD34+ HPSCs, decrease the efficiency of treatment, and increase the cost of therapy. To overcome the problem of increasing expression without increasing the amount of lentiviral vector, non-integrating vectors that can increase gene dosage are determined to be the best option. First, it is necessary to test whether a low dose of extrachromosomal DNA expressing Bcl11A miRNA is sufficient to inhibit Bcl11A expression and increase fetal globin expression.

[0221] A lentiviral vector (LVmiRBcl11A) is constructed using a standard generally accepted clinical-grade vector backbone and packaging system (with an integrase function inactivated by mutation) containing the following: a synthetic miRNA construct with a guide sequence that matches a sequence found within Bcl11A mRNA under the control of an appropriate promoter; a 200-nucleotide-long LCR fragment; and no accompanying expression of E1 and / or E2 replication proteins.

[0222] Transduce HPSCs with LVmiRBcl11A at a multiplicity of infection equal to 5, which is the condition that maximizes the frequency of transduced cells and minimizes HPSC cell death. Transplant the transduced cells into the bone marrow of the original donor after appropriate myeloablative conditioning. Monitor the trial participants to determine the frequency of transduced cells, the copy number of extrachromosomal DNA per cell, and the fetal globin expression levels. This first quadrant approach is reasonably predicted to result in a low copy number of extrachromosomal DNA per cell and constitute a low therapeutic dose of LVmiRBcl11A. Example 18 Treatment of individuals in the second quadrant below

[0223] Design the treatment for cell reprogramming related to sickle cell anemia. In this approach, CD34+ hematopoietic progenitor stem cells (HPSCs) derived from bone marrow are removed, treated ex vivo with gene modification, and transplanted as autologous cell therapy. This strategy is by expressing inhibitory miRNAs that reduce the expression of Bcl11A protein, a potent repressor of fetal globin expression. When Bcl11A levels decrease, fetal globin expression increases and replaces adult globin in terms of normal cell function.

[0224] The ability to express sufficient levels of inhibitory miRNAs without dramatically increasing the viral vector dose raises the concern that this could in turn reduce the viability of transduced CD34+ HPSCs, decrease the efficiency of treatment, and increase the cost of therapy.

[0225] To overcome the problem of increasing expression without increasing the amount of lentiviral vector, it is determined that a non-integrating vector that can vary gene dosage is the best option. Following initial tests using the first quadrant condition (short LCR fragment without the accompanying expression of E1 and / or E2 replication proteins) (i.e., Example 17), it is necessary to test whether a high dosage of extrachromosomal DNA expressing Bcl11A miRNA is sufficient to inhibit Bcl11A expression and increase fetal globin expression. Due to the inducible nature of the gene dosage using a short LCR and the accompanying expression of E1 and / or E2 replication proteins, the same dosage of LVmiRBcl11A can be delivered with a non-integrating lentiviral vector for transient expression of E1 and / or E2 proteins to increase the gene dosage by more than 5-fold without an increase in the lentiviral vector dosage that reduces CD34+ HPSC viability.

[0226] Construct a lentiviral vector (LVmiRBcl11A) using a standard generally accepted clinical grade vector backbone and packaging system (with an integrase function inactivated by mutation) containing: a synthetic miRNA construct with a guide sequence complementary to a sequence found within Bcl11A mRNA under the control of an appropriate promoter; a 200 nucleotide long LCR fragment; for controlling DNA replication, the E1 and / or E2 replication proteins are expressed in a non-integrating lentiviral vector without the LCR.

[0227] Transduce HPSCs with LVmiRBcl11A at a multiplicity of infection equal to 5, which is the condition that maximizes the frequency of transduced cells and minimizes HPSC cell death. After appropriate cytoreductive conditioning, engraft the transduced cells into the bone marrow of the original donor. Monitor the clinical trial participants to determine the frequency of transduced cells, the copy number of extrachromosomal DNA per cell, and the fetal globin expression level. The second quadrant approach is reasonably predicted to result in a high copy number of extrachromosomal DNA per cell and constitute a high therapeutic dosage of LVmiRBcl11A.

[0228] By comparing the tests shown in Examples 17 and 18, determine the optimal conditions for transducing CD34+ HPSCs with LVmiRBcl11A to maximize the efficiency and efficacy of the treatment. Example 19 Treatment of individuals in the lower third quadrant

[0229] The passive immunization treatment proposed for HIV disease involves the use of CRISPR-Cas9 gene editing to delete the cell surface integrin receptor alpha4beta7, which promotes virus attachment and entry into susceptible T cells. The treatment strategy involves isolating T cells from peripheral blood and then transducing them with a lentivirus carrying an anti-alpha4beta7 CRISPR-Cas9 construct containing a guide RNA specific for the alpha4beta7 gene sequence. The isolated T cells are transduced with the therapeutic lentivirus to delete the alpha4beta7 receptor. The cells are then returned to the body via injection. Once in circulation, these HIV-resistant cells can increase in number and initiate the provision of normal immune function, including the ability to resist HIV replication. A high dose of the CRISPR-Cas9 lentiviral vector is predicted to be necessary to achieve uniform deletion of the alpha4beta7 gene. One arm of the proposed clinical trial (i.e., Example 20) utilizes a non-integrating lentiviral vector with the long form of the LCR that is required to increase the copy number above barely detectable levels and that expresses the CRISPR-Cas9 alpha4beta7 but does not contain the E1 and / or E2 replication proteins.

[0230] In this treatment arm of the clinical trial, there is an accompanying delivery of a non-integrating lentivirus that expresses the E1 and / or E2 replication proteins in a construct that cannot replicate DNA and does not contain the LCR while delivering the same LVCRISPR-Cas9 alpha4beta7. This increases the gene dose without changing the amount of LV-CRISPR-Cas9 alpha4beta7 required to efficiently transduce T cells and is considered the high-dose treatment arm of the clinical trial.

[0231] Construct a lentiviral vector and incorporate the following elements within a commonly used viral vector backbone: a 720-nucleotide-long LCR that is inducible when the E1 and / or E2 replication proteins are provided; an expression cassette containing an appropriate promoter for gene transcription for the CRISPR-Cas9 protein and an alpha4beta7 complementary guide RNA. The vector is packaged with a mutation in the integrase gene to prevent normal viral DNA integration. Use a second non-integrating lentivirus to provide transient expression of the E1 and / or E2 DNA replication proteins in a construct that does not contain the LCR and cannot replicate DNA.

[0232] Since the gene dosage is increased by the addition of the E1 and / or E2 proteins, T cells are ex vivo modified with a non-integrating lentiviral vector having high CRISPR-Cas9 and guide RNA expression. The cells are returned to the subjects in the treatment arm of the study. Clinical outcomes are evaluated based on an increase in the proportion of T cells carrying an alpha4beta7 gene deletion in the presence of HIV, and improvement in T cell function and natural control of HIV replication in the absence of antiretroviral medications. This quadrant 3 approach is reasonably predicted to result in an increase in the proportion of T cells carrying an alpha4beta7 gene deletion in the presence of HIV, and improvement in T cell function and natural control of HIV replication in the absence of antiretroviral medications. Example 20 Treatment of individuals in the lower quadrant 4

[0233] Treatments proposed for HIV disease include the use of CRISPR-Cas9 gene editing to delete the cell surface integrin receptor alpha4beta7, which promotes viral attachment and entry into susceptible T cells. The treatment strategy involves isolating T cells from peripheral blood and then transducing them with a lentivirus carrying an anti-alpha4beta7 CRISPR-Cas9 construct containing a guide RNA specific to the alpha4beta7 gene sequence. The isolated T cells are transduced with the therapeutic lentivirus to delete the alpha4beta7 receptor and then returned to the body via injection. Once returned to circulation, these HIV-resistant cells can increase in number and initiate the provision of normal immune function, including the ability to resist HIV replication.

[0234] Before initiating clinical trials of the treatment, it is important to confirm the safety and specificity of the vector. A major concern is whether the therapeutic gene cassette containing the alpha4beta7-specific guide RNA will integrate and cause genotoxicity. This concern arises because the guide RNA has direct homology to the human genome and the action of integrating a construct capable of long-term CRISPR-Cas9 expression can result in unpredictable outcomes, including cell transformation and cancer.

[0235] To demonstrate that vector integration into the alpha4beta7 gene is not a high-probability event, the control trial is designed to include one arm that modifies T cells ex vivo before injection using a non-integrating transient vector. In vitro tests are not sufficient to assess the risk because the number of events analyzed in vivo is much larger than can be simulated in in vitro or ex vivo tests.

[0236] Construct a lentiviral vector containing the following elements within a generally used viral vector backbone: a 720-nucleotide-long LCR without the accompanying expression of E1 and E2 proteins; an expression cassette containing an appropriate promoter for gene transcription for the CRISPR-Cas9 protein and an alpha4beta7 complementary guide RNA. The vector is packaged with a mutation in the integrase gene to prevent normal viral DNA integration.

[0237] Since gene dosage does not increase without E1 and / or E2 proteins, T cells are ex vivo modified with non-integrating lentiviral vectors having minimal CRISPR-Cas9 or guide RNA expression. Cells are returned to the subjects in the control arm of the study, and chromosomal DNA is extracted and appropriate PCR-based tests are performed to identify viral DNA recombined with chromosomal DNA, thereby measuring the pattern of viral DNA integration. The recombination sites of any integrated DNA are determined by high-throughput DNA sequencing and reported as potential genotoxic events indicating the likelihood of adverse events. This quadrant 4 approach is reasonably predicted to be an effective control for monitoring recombination events. Sequence The following sequences are referenced herein.

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

Table 3-30

[0238] Although certain preferred embodiments of the present invention have been described and specifically illustrated herein, the present invention is not intended to be limited to such embodiments. Various modifications thereto can be made without departing from the scope and spirit of the present invention. The present invention provides, for example, the following items. (Item 1) a. A viral vector containing a defective integrase gene, b. A heterologous viral episomal DNA replication origin, c. A sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding the at least one initiator protein specific for the heterologous viral episomal DNA replication origin is inducible, and d. At least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA A non-integrating viral delivery system comprising. (Item 2) The non-integrating viral delivery system according to Item 1, wherein the viral vector is a lentivirus. (Item 3) The non-integrating virus delivery system according to item 1, wherein the heterologous viral episomal DNA replication origin is derived from a papillomavirus. (Item 4) The non-integrating virus delivery system according to item 3, wherein the heterologous viral episomal DNA replication origin is derived from a human papillomavirus or a bovine papillomavirus. (Item 5) The non-integrating virus delivery system according to item 4, wherein the heterologous viral episomal DNA replication origin is derived from human papillomavirus type 16 (HPV16). (Item 6) The non-integrating virus delivery system according to item 5, wherein the heterologous viral episomal DNA replication origin is derived from the long control region (LCR) of HPV16. (Item 7) The non-integrating virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin comprises SEQ ID NO: 1. (Item 8) The non-integrating virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin comprises a 5'-truncation of SEQ ID NO: 1. (Item 9) The non-integrating virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin comprises a 5'-truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO: 1. (Item 10) The non-integrating virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 11) The non-integrating virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin contains Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 12) The non-integrating virus delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin contains E1 or an operable fragment thereof. (Item 13) The non-integrating virus delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin contains E2 or an operable fragment thereof. (Item 14) The non-integrating virus delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin contains EBNA-1 or an operable fragment thereof. (Item 15) The non-integrating virus delivery system according to item 1, comprising at least two initiator proteins specific to the heterologous viral episomal DNA replication origin. (Item 16) The non-integrating virus delivery system according to item 15, wherein the at least two initiator proteins specific to the heterologous viral episomal DNA replication origin are E1 and E2 or their operable fragments. (Item 17) The non-integrating virus delivery system according to item 1, wherein the sequence encoding the at least one initiator protein is present in a single separate plasmid or non-integrating virus vector. (Item 18) The non-integrating virus delivery system according to item 1, wherein the system comprises at least two initiator proteins specific to the heterologous viral episomal DNA replication origin, and the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-integrating virus vector. (Item 19) The non-integrating viral delivery system according to item 1, wherein the system comprises at least two initiator proteins specific for the heterologous viral episomal DNA replication origin, wherein the sequence for the first initiator protein and the sequence for the second initiator protein are present in separate plasmids or non-integrating viral vectors. (Item 20) The non-integrating viral delivery system according to item 1, wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor. (Item 21) The non-integrating viral delivery system according to item 20, wherein the antibody comprises an anti-HER2 antibody or a fragment thereof. (Item 22) The non-integrating viral delivery system according to item 20, wherein the growth factor comprises vascular endothelial growth factor (VEGF) or a variant thereof. (Item 23) The non-integrating viral delivery system according to item 1, wherein the miRNA comprises CCR5 miRNA. (Item 24) A pharmaceutical composition comprising the non-integrating viral delivery system according to item 1 and at least one pharmaceutically acceptable carrier. (Item 25) A method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a cell, comprising contacting the cell with an effective amount of a non-integrating viral delivery system wherein the system comprises i. a viral carrier containing a defective integrase gene, ii. a heterologous viral episomal DNA replication origin, iii. a sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA replication origin, wherein expression of the sequence encoding the at least one initiator protein specific for the heterologous viral episomal DNA replication origin is inducible, and iv. At least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA A method comprising: (Item 26) A method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a subject in need thereof, comprising: administering to the subject an effective amount of a non-integrating viral delivery system, wherein the system comprises: i. A viral vector containing a defective integrase gene, ii. A heterologous viral episomal origin of replication, iii. A sequence encoding at least one initiator protein specific for a heterologous viral episomal DNA origin of replication, wherein expression of the sequence encoding the at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and iv. At least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA A method comprising: (Item 27) The method according to item 26, wherein the sequence encoding the at least one initiator protein is present on a single separate plasmid, and the at least one initiator protein is E1 or E2. (Item 28) The method according to item 27, further comprising administering to the subject in need thereof a first amount of the single separate plasmid for initiating a first expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. (Item 29) The method according to item 28, further comprising administering to the subject in need thereof a second amount of the single separate plasmid for initiating a second expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. (Item 30) The method according to item 29, wherein when the second amount is lower than the first amount, the expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA is decreased. (Item 31) The method according to item 29, wherein when the second amount is higher than the first amount, the expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA is increased. (Item 32) The non-integrating viral delivery system according to item 1, wherein the system is optimized to result in a low basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with SEQ ID NO: 1 or Frag1 (SEQ ID NO: 2) of the LCR of HPV16. (Item 33) The non-integrating viral delivery system according to item 1, wherein the system is optimized to result in a low basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin comprises SEQ ID NO: 1 or Frag1 (SEQ ID NO: 2) of the LCR of HPV16. (Item 34) The non-integrating viral delivery system according to item 1, wherein the system is optimized to result in a moderate basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 35) The system is optimized to produce a moderate basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin comprises Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. The non-integrating viral delivery system according to item 1. (Item 36) A method of selecting an optimized non-integrating viral delivery system, selecting a basal expression level comprising, wherein when level X is selected, the corresponding Y is selected, where Y is selected to be incorporated into the non-integrating viral delivery system and corresponds to a heterologous viral episomal DNA replication origin, when X = the first defined level of basal expression of the cargo, Y comprises the LCR (SEQ ID NO: 1) or Frag1 (SEQ ID NO: 2), when X = the second defined level of basal expression of the cargo, Y comprises Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. A method. (Item 37) The method according to item 36, wherein the first defined level comprises less than 0.020 episomal copies of the cargo per cell. (Item 38) The method according to item 36, wherein the second defined level comprises 0.020 or more episomal copies of the cargo per cell.

Claims

[Claim 1] The method or non-integrating viral delivery system described in the specification.

Images