Composition for imparting drought stress resistance

Abstract

To provide a composition for imparting drought stress resistance to a plant; a method for producing a plant body having drought stress resistance; and a method for imparting drought stress resistance to a plant body.SOLUTION: This composition for imparting drought stress resistance to a plant contains, as an active ingredient, N-acetylglutamic acid or a salt thereof, or a solvate thereof.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a technique for imparting drought stress tolerance to plants.

Background Art

[0002] Unlike animals, plants that lead a sessile life cannot move on their own, so they need to quickly respond to various environmental stresses to survive in a changing environment. Among environmental stresses, drought stress is considered to be one of the stresses that seriously affect plants due to recent global warming. When a plant is exposed to drought stress, various physiological responses to prevent water loss in the body and the synthesis of genes and plant hormones that control them are activated. For example, abscisic acid (ABA), a type of plant hormone, is induced to be synthesized by drought stress, and promotes the closure of stomata, which are the sites of gas exchange in plants, to prevent water outflow from the plant body associated with drought stress (Non-Patent Document 1). In addition, DREB2A, a master transcription factor in the drought stress response of plants, is activated along with drought stress, and controls the transcription of a group of genes that function to relieve drought stress, such as metabolic enzymes (Non-Patent Document 2). Furthermore, there is a report that in Arabidopsis thaliana in which arginine metabolism is constitutively activated by gene introduction, the accumulation of metabolic intermediates and the drought stress tolerance are increased (Non-Patent Document 3).

[0003] By utilizing the above findings, attempts have been made to develop a method for enhancing the drought stress tolerance of practical plants. However, there are problems such as the high price of ABA, the need to create recombinants for individual plants for the use of drought stress-related genes such as DREB2A, and the problems of cost, safety, and the need for a huge amount of time for the spread of the technology.

[0004] On the one hand, it has been reported that low-molecular-weight compounds enhance the environmental stress tolerance of plants, and their types are diverse, ranging from physiologically active compounds such as plant hormones to amino acids and volatile molecules. For example, γ-aminobutyric acid (GABA), which is one of the amino acids, accumulates in plants under strong light and high-temperature stress, and when GABA is added to plants, the high-temperature stress tolerance is enhanced (Non-Patent Document 4).

Prior Art Documents

Non-Patent Documents

[0005]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Summary of the Invention

Problems to be Solved by the Invention

[0006] The present invention aims to provide a composition for imparting drought stress tolerance to plants, a method for producing a plant body having drought stress tolerance, and a method for imparting drought stress tolerance to a plant body. In preparation for abnormal weather such as frequent droughts accompanying global warming and food shortages due to population growth, strengthening the drought stress tolerance of crops is one of the most important issues in order to develop crops that can withstand occasional droughts and crops that can be cultivated on land that is not suitable for cultivation due to drought.

Means for Solving the Problems

[0007] The present inventors have intensively studied a method for imparting drought stress tolerance to plants. As a result, they have found that drought stress tolerance can be imparted to plants by applying N-acetylglutamic acid or a salt or solvate thereof to the plants, and have thus completed the present invention.

[0008] That is, the present invention is as follows. [1] A composition for imparting drought stress tolerance to plants, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. [2] The composition according to [1], wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress. [3] A composition for promoting the closure of plant stomata, the enhancement of the cuticle layer, or the elongation of roots, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. [4] The composition according to [3], wherein the closure of stomata, the enhancement of the cuticle layer, or the elongation of roots is maintained or promoted under conditions of being exposed to drought stress. [5] A composition for promoting the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. [6] The composition according to any one of [1] to [5], wherein the plant is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene. [7] The composition according to any one of [1] to [6], wherein the plant is a dicotyledonous plant or a monocotyledonous plant. [8] A method for producing a plant having drought stress tolerance, comprising applying N-acetylglutamic acid or a salt or solvate thereof to a plant. [9] The method according to [8], wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress.

[10] A method for producing a plant in which stomatal closure, enhancement of the cuticle layer, or root elongation is promoted, comprising applying N-acetylglutamic acid or a salt or solvate thereof to a plant.

[11] The method according to

[10] , wherein the stomatal closure, enhancement of the cuticle layer, or root elongation is maintained or enhanced under conditions of being exposed to drought stress.

[12] A method for producing a plant in which the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene is enhanced, comprising applying N-acetylglutamic acid or a salt or solvate thereof to a plant.

[13] The method according to any one of [8] to

[12] , wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene.

[14] The method according to any one of [8] to

[13] , wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

[15] A method for imparting drought stress tolerance to a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[16] The method according to

[15] , wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress.

[17] A method for promoting stomatal closure, enhancement of the cuticle layer, or root elongation of a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[18] The method according to

[17] , wherein the stomatal closure, enhancement of the cuticle layer, or root elongation is maintained or enhanced under conditions of being exposed to drought stress.

[19] A method for promoting the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene or RD29B gene in a plant, which comprises applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[20] The method according to any one of

[15] to

[19] , wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene.

[21] The method according to any one of

[15] to

[20] , wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

Advantages of the Invention

[0009] By applying N-acetylglutamic acid or a salt or solvate thereof to a plant, drought stress tolerance can be imparted to the plant. In addition, the closure of the stomata of the plant, the enhancement of the cuticle layer, or the elongation of the roots can be promoted. In addition, the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene or RD29B gene or a homologous gene thereof in the plant can be promoted. As a result, in preparation for abnormal weather such as droughts frequently occurring due to global warming and accompanying water shortages, and food shortages due to population increase, crops that can withstand occasional droughts and crops that can be cultivated on land that is dry and unsuitable for cultivation can be produced.

Brief Description of the Drawings

[0010]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Embodiments for Carrying Out the Invention

[0011] The present invention will be described in detail below. The present invention is a composition for imparting drought stress tolerance to plants. Imparting drought stress tolerance means suppressing the effects of the stress when drought stress is applied or conferring the ability to suppress those effects in advance before drought stress is applied, and includes reducing or eliminating the effects of drought stress. The active ingredient in the composition of the present invention is N-acetylglutamic acid or a salt or solvate thereof. The present invention is also a method for imparting drought stress tolerance to plants or a method for producing plants having drought stress tolerance by applying N-acetylglutamic acid or a salt or solvate thereof to plants.

[0012] The composition containing N-acetylglutamic acid of the present invention can reduce the impact of drought stress that plants usually undergo by conferring drought stress tolerance to plants, and can enhance the growth of plants. Therefore, it can also be referred to as a composition for enhancing plant growth. The drought stress that plants usually undergo includes mild drought stress to the extent that leaf wilting, poor growth, withering, etc. do not occur.

[0013] In addition, the impact caused by drought stress means unfavorable situations for plants such as leaf wilting, poor growth, withering, etc. that occur in plants due to drought stress.

[0014] In the present invention, by applying N-acetylglutamic acid or its salt or solvate to plants, drought stress tolerance is conferred. Therefore, genetic recombination such as knocking in or knocking out specific genes involved in the drought stress tolerance of plants is not necessary. The genes involved in the drought stress tolerance of plants are not limited. For example, abscisic acid (ABA) gene, genes that induce the expression of this gene, γ-aminobutyric acid (GABA) gene, genes that induce the expression of this gene, N-acetylglutamic acid gene, genes that induce the expression of this gene, DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, RD29B gene can be mentioned, and in particular, the N-acetylglutamic acid gene and genes that induce the expression of this gene can be mentioned.

[0015] 1. N-acetylglutamic acid N-acetylglutamic acid has a structural formula represented by Formula I, the chemical formula is C7H 11 represented by NO5, and the abbreviation is NAG. Also, the appearance is white to almost white crystals to crystalline powder.

[0016]

Chemical formula

[0017] Either L-type (N-acetyl-L-glutamic acid) or D-type (N-acetyl-D-glutamic acid) can be used, but L-type (N-acetyl-L-glutamic acid) synthesized in vivo is preferred. N-acetylglutamic acid is produced, for example, by N-acetylglutamic acid synthase or ornithine acetyltransferase in prokaryotes and simple eukaryotes. Therefore, secretions, isolates, extracts, and purified products of organisms that produce N-acetylglutamic acid may be used, or the organisms themselves may be used directly. It may also be produced by an enzyme-mediated method or by a fermentation method using a mutant or non-mutated microorganism. In addition, N-acetylglutamic acid can be chemically synthesized. Of course, commercially available products may be used. Commercially available products include those manufactured by Fujifilm Wako Pure Chemical Corporation, Sigma-Aldrich, Tokyo Chemical Industry Co., Ltd., etc.

[0018] Salts include both hydrates and anhydrous salts, such as salts with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine and ornithine; and ammonium salts. The salts may be acid addition salts, and specific examples of such salts include mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, and ethanesulfonic acid; and acid addition salts with acidic amino acids such as aspartic acid and glutamic acid. Hereinafter, when referring to N-acetylglutamic acid, its salts and solvates are included.

[0019] N-acetylglutamic acid is quantified by using high performance liquid chromatography and a mass spectrometry (MS) instrument. That is, a sample containing N-acetylglutamic acid is separated into components by high performance liquid chromatography, and the amount of N-acetylglutamic acid contained in the sample is measured by performing mass spectrometry analysis (single MS or tandem MS) on the separated components.

[0020] 2. Drought stress According to the Agricultural Technology Encyclopedia by the National Agriculture and Food Research Organization (http: / / lib.ruralnet.or.jp / nrpd / ), drought stress refers to a state in which water deficiency occurs due to drought, high temperature, strong light, low temperature, low humidity, etc., disrupting the physiological environment within the plant body, and significantly reducing plant growth and yield. When the amount of water supplied to the plant body is smaller than the amount of transpiration of the plant, plant growth will be suppressed or inhibited.

[0021] Plants have the ability to suppress the decline in survival rate, growth, and yield, etc., in response to drought stress, and this ability is called drought tolerance (drought resistance).

[0022] Drought tolerance refers to the ability to withstand water deficiency. When water is deficient, plants protect themselves from drought by thickening the cuticle layer on the surface of the leaves, closing the stomata to prevent transpiration, enhancing root elongation to expand the rhizosphere in deeper moist soil, etc. Also, by accumulating compatible solutes such as sugars and amino acids in the cytoplasm to regulate osmotic pressure, the water balance is maintained. Hydrophilic LEA proteins are thought to retain water and prevent the crystallization of other proteins due to drying. Therefore, drought stress means that the plant is exposed to water conditions that are less than the water conditions under which it can normally grow, for any period of time and any number of times. Plants exposed to drought stress will experience physiological disorders, resulting in poor growth and withering. Such tolerance allows plants to counter drought stress and suppress the decline in survival rate, growth, and yield, etc., even in the presence of drought stress.

[0023] N-acetylglutamic acid confers the above-mentioned drought stress tolerance on plants, and as a result, plants can acquire tolerance to drought stress.

[0024] 3. Enhancement of expression of drought stress-responsive genes N-acetylglutamic acid enhances the expression of drought stress-responsive genes involved in drought stress tolerance in plants, and as a result, can confer drought stress tolerance on plants.

[0025] In Arabidopsis thaliana, examples of stress-responsive genes include the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene. Among these, the DREB2A gene is particularly important.

[0026] In other plant species, the expression of homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene is enhanced. In each plant species, for example, when obtaining the nucleotide sequence of a homolog, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the above genes of Arabidopsis thaliana as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates.

[0027] For example, in rice, the expression of the OsDREB2A gene and OsDREB2B gene, which are homologs of the Arabidopsis thaliana DREB2A gene, and the OsERD1 gene, which is a homolog of the Arabidopsis thaliana ERD1 gene, is enhanced. In hops, the expression of HlDREB2A, which is a homolog of the Arabidopsis thaliana DREB2A gene, and the HlNCED3 gene, which is a homolog of the Arabidopsis thaliana NCED3 gene, is enhanced. The proteins encoded by the homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene in various plant species are collectively referred to as the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene, respectively, and the proteins encoded by the homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene in various plant species are collectively referred to as DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B, respectively.

[0028] The expression of these drought stress-responsive genes increases by 1.1-fold or more, preferably 1.2-fold or more, more preferably 1.5-fold or more, more preferably 1.7-fold or more, more preferably 1.8-fold or more, more preferably 1.9-fold or more, more preferably 2.0-fold or more, more preferably 2.1-fold or more, more preferably 2.3-fold or more, more preferably 2.5-fold or more, more preferably 3.0-fold or more, more preferably 4.0-fold or more, more preferably 5.0-fold or more, more preferably 6.3-fold or more, more preferably 10-fold or more, more preferably 15-fold or more, more preferably 19-fold or more in plants to which N-acetylglutamic acid is applied, as compared to plants to which N-acetylglutamic acid is not applied. For example, in Arabidopsis thaliana, the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene increases by about 5.6-fold, 6.3-fold, 1.6-fold, 19-fold, 2.5-fold, and 1.8-fold, respectively. Also, in rice, the expression of the OsDREB2A gene, OsDREB2B gene, and OsERD1 gene increases by about 1.6-fold, 1.6-fold, and 1.5-fold, respectively. Further, in hops, the expression of the HlDREB2A gene and HlNCED3 gene increases by about 2.2-fold and 2.3-fold, respectively.

[0029] Enhancement of gene expression, whether the expression of a gene in a plant is enhanced by N-acetylglutamic acid, can be measured by extracting RNA from the plant body, synthesizing cDNA using reverse transcriptase, and analyzing the expression level by real-time PCR. Here, the enhancement of gene expression by N-acetylglutamic acid includes both cases where the expression is enhanced before drought stress is applied to the plant body and cases where the expression is enhanced when drought stress is applied.

[0030] The present invention includes a composition for enhancing the expression of a drought stress-responsive gene containing N-acetylglutamic acid or for enhancing the expression. Specifically, the present invention includes a composition for enhancing the expression of the DREB2A gene containing N-acetylglutamic acid, a composition for enhancing the expression of the ERD1 gene, a composition for enhancing the expression of the RD29A gene, a composition for enhancing the expression of the NCED3 gene, a composition for enhancing the expression of the LEA gene, and a composition for enhancing the expression of the RD29B gene. The composition of the said composition is the same as that of the composition for imparting drought stress tolerance to plants.

[0031] When a plant is treated with N-acetylglutamic acid, the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene can be enhanced. As a result, tolerance to stress caused by drought can be imparted.

[0032] That is, the imparting of drought stress tolerance by treating plants with N-acetylglutamic acid can also be achieved through enhancing the expression of the above genes. Furthermore, the treatment with N-acetylglutamic acid can, by strengthening the expression of these genes, exert effects such as not only the closure of stomata, but also the suppression of water loss by enhancing the cuticle layer, and the increase in the amount of water absorbed by root elongation. That is, the treatment of plants with N-acetylglutamic acid promotes not only the closure of stomata, but also the enhancement of the cuticle layer and root elongation. Here, the enhancement of the cuticle layer includes the thickening of the cuticle layer and changes in the components constituting the cuticle layer, and means changing the properties of the cuticle layer in a direction to suppress water evaporation. In addition, DREB2A, a master transcription factor in the drought stress response of plants, is activated along with drought stress and controls the transcription of a group of genes that function in alleviating drought stress, such as metabolic enzymes (Non-Patent Document 2). Therefore, this gene causes various reactions for plants to cope with drought stress. For example, it has been reported that when DREB2A is overexpressed in Arabidopsis thaliana, root growth is promoted under drought stress treatment conditions (Meena et al, Molecular Biology Reports, 49 (8), page 7347-7358, 2022). It can be seen that enhancing the expression of this gene promotes root growth against drought stress. Also, when the gene RAP2.4 belonging to the same gene family as DREB2A is overexpressed, it has been reported that the biosynthesis of wax that forms the cuticle layer is enhanced in the drought stress response of Arabidopsis thaliana (Yang et al, Frontiers in Plant Science, 11, page 895, 2020). It can be seen that enhancing the expression of the DREB2A gene brings about the enhancement of the cuticle layer.

[0033] 4. Target plant In the present invention, the target plants include both angiosperms and gymnosperms, preferably angiosperms. Further, angiosperms include both dicotyledonous plants and monocotyledonous plants. Examples of monocotyledonous plants include Gramineae plants such as rice, corn, barley, wheat, sorghum, etc.; Araceae plants such as taro, konjac, etc.; Amaryllidaceae plants such as onion, leek, etc.; Asparagaceae plants such as asparagus, etc. Among these, Gramineae plants are preferred. Examples of dicotyledonous plants include Cannabaceae plants such as hemp, hop, mulberry, enoki, etc.; Brassicaceae plants such as cabbage, Chinese cabbage, broccoli, radish, arugula, komatsuna, mizuna, mustard spinach, Arabidopsis thaliana, etc.; Solanaceae plants such as potato (Solanum tuberosum), tobacco, Nicotiana benthamiana, tomato, etc.; Asteraceae plants such as lettuce, artichoke, etc.; Fabaceae plants such as alfalfa, soybean, etc.; Chenopodiaceae plants such as spinach, sugar beet, etc.; Lamiaceae plants such as perilla, basil, etc.; Apiaceae plants such as carrot, Mitsuba, etc.; Cucurbitaceae plants such as melon, watermelon, cucumber, pumpkin, etc.; Malvaceae plants such as cotton, etc. Among these, Cannabaceae plants and Brassicaceae plants are preferred. Also preferably excluding tomato.

[0034] 5. Application method and dosage of N-acetylglutamic acid In order to confer drought stress tolerance on plants with N-acetylglutamic acid, N-acetylglutamic acid may be applied to the plants.

[0035] Here, the application of N-acetylglutamic acid means bringing N-acetylglutamic acid into contact with plants or incorporating it into the plants, for example, treating plants with N-acetylglutamic acid, or administering or adding N-acetylglutamic acid to plants.

[0036] N-acetylglutamic acid may be applied as it is in powder or crystalline form, dissolved in an appropriate solvent such as water or buffer solution, coexisted with excipients, etc., or formulated and applied in fertilizers, media, culture soils, pesticides, etc. N-acetylglutamic acid can be applied, for example, to plants in culture, hydroponics, soil cultivation, and pot cultivation. Specifically, N-acetylglutamic acid may be administered to the medium or soil, or directly to the plant body, and may be sprayed or atomized onto either or both of the medium / soil and the plant body. When administered to the plant body, for example, it may be administered by spraying, atomizing, coating, watering, perfusion, etc. onto the seeds, seedlings, leaves, stems, etc. of the plant, and preferably by administration that allows absorption from the roots. In the present invention, a composition containing N-acetylglutamic acid refers to a composition in which N-acetylglutamic acid is dissolved in a solvent, formulated in fertilizers, media, culture soils, pesticides, etc., or coexisted with excipients, spreading agents, etc. The composition can be applied in the form of emulsions, solutions, aqueous solvents, powders, dusts, pastes, granules, wettable powders, etc. When spraying or atomizing on plants, a sprayer or spreader may be used, and when spraying on a large scale in a wide farm, aerial spraying may be performed by a helicopter or drone.

[0037] The timing of applying N-acetylglutamic acid is not limited and may be before, at the same time as, or after exposure to drought stress. Preferably, it is applied before or at the same time as exposure to drought stress in order to confer drought stress tolerance to the plant in advance. It is particularly preferable to apply it before exposure to drought stress.

[0038] For example, when it is predicted by weather forecast that the plant will be exposed to drought stress, N-acetylglutamic acid may be applied to the plant in advance. Also, when a situation occurs in which the plant is exposed to drought stress due to a sudden change in weather, etc., N-acetylglutamic acid may be applied to the plant promptly.

[0039] In any case, N-acetylglutamic acid may be applied continuously or intermittently. Here, continuous application means, for example, mixing N-acetylglutamic acid into a medium and culturing or hydroponically cultivating for a certain period, or cultivating in soil using a tool that continuously supplies N-acetylglutamic acid. Also, intermittent application means, for example, applying at an appropriate time according to the period and degree of the expected drying stress in the case of culture or hydroponic cultivation, and in soil cultivation, it can be applied at an appropriate time according to the soil moisture condition and the expected period and degree of stress. When applying continuously, the application period is not limited, for example, the application can be continued until the cause of the drying stress disappears. Also, when applying intermittently, the number of applications and the amount are not limited, for example, it can be repeatedly applied until the cause of the drying stress disappears, including the case of applying again after continuous application.

[0040] The concentration of N-acetylglutamic acid in the composition containing N-acetylglutamic acid is not limited, and the composition can be applied so that the required amount of N-acetylglutamic acid described below can be applied to plants.

[0041] The application amount of N-acetylglutamic acid can be appropriately adjusted according to the type of plant, the degree of growth, and the degree of drying stress.

[0042] The following shows examples of the application amount. It can be applied at a concentration of, for example, 0.0001 to 1000000 μM, preferably 0.001 to 100000 μM, 0.01 to 10000 μM, 0.1 to 1000 μM, per medium volume or per soil volume.

[0043] 6. Method for Confirming the Conferment of Drought Stress Tolerance Whether the application of N-acetylglutamic acid confers drought stress tolerance to plants can be confirmed by exposing the plants to which N-acetylglutamic acid has been applied to drought stress and then visually checking the degree of leaf wilting, or by measuring the fresh weight of the above-ground part excluding the seeds and roots of the plants. Also, when N-acetylglutamic acid is applied to plants, the stomatal aperture of the leaves decreases because the closure of stomata is maintained or promoted. Therefore, whether drought stress tolerance is conferred to plants can be confirmed by measuring the stomatal aperture of the leaves. Here, stomata refer to the structures on the epidermis of terrestrial plants, consisting of two guard cells and the gap surrounded by them, and are generally more abundant on the underside of leaves (Agricultural Technology Encyclopedia. http: / / lib.ruralnet.or.jp / nrpd / #box_search=%E6%B0%97%E5%AD%94&kensuu=100&sort=0&logic=1&page=0&bunya=&koumoku=11176&db=&uid=0). N-acetylglutamic acid can confer drought stress tolerance by preventing the outflow of water in the plant body through stomatal closure. The stomatal aperture can be calculated by photographing stomata under a microscope, using image analysis software for the obtained images, measuring the lengths of the long and short sides of the stomata, and taking the ratio of the short side to the long side (Huang et al., International Journal of Molecular Sciences. 2022 Jul 24;23(15):8145). In evaluating the effect of N-acetylglutamic acid on stomata, it is preferable to select stomata present on a certain same leaf surface of the evaluation target plants treated or untreated with N-acetylglutamic acid, or to select them from multiple leaves (for example, even if the number of observed stomata is 100, photograph 50 stomata each from different leaves). This is to prevent bias in the results and obtain appropriate evaluation results. Here, in this example, the observation target was defined as the stomata on the abaxial side of the leaves, and the stomata of multiple leaves were observed.

[0044] When N-acetylglutamic acid is applied to plants, it exhibits drought stress tolerance under conditions of exposure to drought stress. That is, in a state of being exposed to drought stress, almost no adverse effects of drought stress (wilting, leaf withering, reduction in fresh weight) or adverse effects on the mechanisms that counter drought stress (increase in stomatal aperture) are observed, and even when exposed to drought stress, the plants do not wither. As a result, it is possible to prevent the influence of drought stress during the imparting of drought stress tolerance by the application of N-acetylglutamic acid. Usually, when plants are exposed to drought stress, many individuals die, and only some individuals remain without withering, and then some of these individuals may grow. In the present invention, by applying N-acetylglutamic acid, there are fewer plants that die compared to the case where no N-acetylglutamic acid treatment is performed. Preferably, even under conditions of exposure to drought stress, the plant body does not wither and can continue to grow.

[0045] For example, it can be confirmed by placing a plant to which N-acetylglutamic acid has been applied under dry conditions and then visually checking the degree of leaf withering, measuring the fresh weight of the above-ground part excluding the seeds and roots of the plant, or measuring the stomatal aperture. By stopping watering the plant, it can be placed under dry conditions. At this time, if the degree of leaf withering, the reduction in fresh weight, and the stomatal aperture are less compared to untreated plants that have not been subjected to drying treatment or plants to which N-acetylglutamic acid has not been applied, it can be determined that drought stress tolerance has been imparted.

[0046] 7. Stomatal closure, cuticle layer enhancement, root elongation Plants to which N-acetylglutamic acid has been applied exhibit the effects of stomatal closure, cuticle layer enhancement, and root elongation as described above. Whether these effects are achieved can be confirmed by comparing and measuring the stomatal aperture, the thickness and components of the cuticle layer, and the root elongation degree of plants to which N-acetylglutamic acid has been applied and plants to which it has not been applied by the above methods.

[0047] 8. Enhancement of plant growth Plants treated with N-acetylglutamic acid show enhanced growth even under dry conditions such as drought. Whether the growth enhancement effect is imparted to the plants treated with N-acetylglutamic acid can be confirmed by measuring the above-ground fresh weight of the plants treated with N-acetylglutamic acid, excluding the seeds and roots of the plants thereafter. It can also be confirmed by measuring the number of leaves, plant height, leaf color, etc.

Example

[0048] The present invention will be specifically described by the following examples, but the present invention is not limited by these examples.

[0049] Example 1: Enhancement of drought stress tolerance of lettuce by N-acetylglutamic acid treatment 1. Purpose Focusing on N-acetylglutamic acid, it was verified using lettuce, a dicotyledonous plant, as a material whether drought stress tolerance can be imparted to plants.

[0050] 2. Experimental method (1) Experimental materials Lettuce (variety: Green Wave) was used as the experimental material. The seeds were purchased from Takii Seed Co., Ltd. (https: / / www.takii.co.jp / ).

[0051] (2) Growth method A plastic tray was prepared with a water-moistened rock wool block (Daiwa Plastic), and one lettuce seed was sown in each block. Next, a 500-fold dilution of Hyponex stock solution (Hyponex Japan) containing N-acetylglutamic acid (NAG, Tokyo Chemical Industry) at a final concentration of 1 μM (hereinafter also referred to as Hyponex dilution solution containing NAG) was poured into the tray and set in an artificial weather chamber (Nippon Medical Chemical Instruments) to start growth. The culture conditions of the artificial weather chamber were a temperature of 22°C and a photoperiod control of 16 hours of light period and 8 hours of dark period. Watering (giving Hyponex dilution solution with or without NAG) was performed when the water in the rock wool block ran out, and watering with Hyponex dilution solution containing NAG was carried out once a week.

[0052] (3) Drying stress treatment and measurement of fresh weight Two weeks after sowing, the drying stress treatment was initiated by stopping the water supply to the rock wool blocks. One week after the water absorption ceased, the aerial parts of the lettuce were cut out from the rock wool blocks and weighed.

[0053] (4) Measurement of stomatal aperture of leaves Three true leaves of lettuce two weeks after sowing were collected, and the stomata on the abaxial side were photographed using an upright microscope BA81 and Moticam1080BMH (Shimadzu Rika). For the acquired images, the lengths of the long and short sides of the stomata were measured using the image analysis software ImageJ, and the stomatal aperture was calculated by taking the ratio of the short side to the long side (Huang et al., International Journal of Molecular Sciences. 2022 Jul 24;23(15):8145).

[0054] 3. Results When the lettuce grown in the absence of NAG was subjected to the drying stress treatment, the leaves wilted, but in the lettuce grown in the Hyponex dilution solution containing NAG, the wilting of the leaves due to the drying stress treatment was suppressed (Figure 1A). When comparing the fresh weights of the two, the fresh weight of the lettuce to which NAG was added was greater than that of the lettuce without NAG addition (Figure 2). Also, as a result of measuring the stomatal aperture of the leaves, the stomatal aperture significantly decreased due to the addition of NAG (Figures 3A and 3B).

[0055] 4. Conclusion Since NAG suppressed the decrease in fresh weight associated with the drying stress treatment and promoted stomatal closure, it was suggested that in lettuce, NAG confers drought stress tolerance by preventing the outflow of water in the plant body through stomatal closure.

[0056] Example 2: Enhancement of drought stress tolerance of spinach by N-acetylglutamic acid treatment 1. Purpose The stress-relieving effect of NAG observed in lettuce was verified in spinach, which is the same dicotyledonous plant. By using cultured soil for spinach cultivation, it was also confirmed whether the stress-relieving effect of NAG can be observed under soil planting conditions.

[0057] 2. Experimental method (1) Experimental materials Spinach (variety: Strong Aurai) was used as the experimental material. The seeds were purchased from Takii Seed Co., Ltd. (https: / / www.takii.co.jp / ).

[0058] (2) Growth method Prepare moistened cultured soil (Iris Ohyama) in a plastic cell tray, and sow one spinach seed per cell (area 9 cm 2 / depth 4 cm). A 500-fold dilution of Hyponex stock solution containing NAG at a final concentration of 1 μM was supplied to the tray, and the growth was started after setting it in an artificial weather chamber (manufactured by Nippon Medical & Chemical Instruments Co., Ltd.). The culture conditions of the artificial weather chamber were set at a temperature of 22 °C and a photoperiod control of 16 hours of light period and 8 hours of dark period. Water was supplied to the cultured soil when the moisture in the cultured soil disappeared and drying was observed. The supply of the Hyponex dilution containing NAG was carried out once a week.

[0059] (3) Drying stress treatment and measurement of fresh weight Two weeks after sowing, the drying stress treatment was started by stopping the water supply to the cultured soil. One week after the water absorption stopped, the above-ground part of spinach was cut out from the cultured soil and weighed.

[0060] (4) Measurement of stomatal aperture of leaves Three true leaves of spinach two weeks after sowing were collected, and the stomata on the abaxial side were photographed using an upright microscope BA81 and Moticam1080BMH (Shimadzu Rika). The obtained images were opened on the image analysis software ImageJ, the lengths of the long side and the short side of the stomata were measured, and the stomatal aperture was calculated by taking the ratio of the short side to the long side.

[0061] 3. Results When the pakchoi grown without NAG was subjected to drought stress treatment, the leaves wilted. However, in the pakchoi grown with Hyponex dilution solution containing NAG, the wilting of leaves caused by drought stress treatment was suppressed (Figure 4). When comparing the fresh weights of both, the fresh weight of the pakchoi with NAG added was greater than that of the pakchoi without NAG added (Figure 5). Also, as a result of measuring the stomatal aperture of the leaves, the stomatal aperture significantly decreased due to the addition of NAG (Figure 6).

[0062] 4. Conclusion Since NAG suppressed the decrease in fresh weight associated with drought stress treatment and promoted stomatal closure, it was suggested that in pakchoi, NAG confers drought stress tolerance by preventing the outflow of water in the plant body through stomatal closure. Also, since the pakchoi used in the experiment was grown in culture soil, it was also suggested that the drought stress alleviating effect of NAG is also exerted in potted plants.

[0063] Example 3: Enhancement of drought stress tolerance in rice by N - acetylglutamic acid treatment 1. Purpose It was verified whether the drought stress alleviating effect of NAG in dicotyledonous plants such as lettuce and pakchoi can also be confirmed in monocotyledonous plants using rice as the material.

[0064] 2. Experimental method (1) Experimental materials Rice (variety: Nipponbare) was used as the experimental material. The seeds were purchased from Uken Co., Ltd. (https: / / www.k - nouken.com / ).

[0065] (2) Growth method Rice seeds were dehulled using a thresher, soaked in a KITCHEN HITTER solution (HITTER is a registered trademark of Kao Corporation) for 30 minutes, and washed five times with sterilized water. Next, a plastic tray was prepared with a wet Rockwool block, and three rice seeds were sown per block. A 500-fold dilution of Hyponex stock solution containing NAG at a final concentration of 1 μM was poured into the tray, and the tray was set in an artificial weather chamber to initiate growth. The culture conditions in the artificial weather chamber were a temperature of 22°C and a photoperiod control of 16 hours of light and 8 hours of darkness. Water was supplied to the Rockwool block when the moisture in the block was depleted and drying was observed, and water was supplied to the Hyponex dilution solution containing NAG for rice once a week.

[0066] (3) Drying stress treatment and measurement of fresh weight Two weeks after sowing, the drying stress treatment was initiated by stopping water supply to the rice. One week after stopping water absorption, the above-ground part of the rice was cut out from the Rockwool block and weighed.

[0067] 3. Results When the drying stress treatment was applied to rice grown in the absence of NAG, the leaves wilted, but in rice grown in the Hyponex dilution solution containing NAG, the wilting of the leaves due to the drying stress treatment was suppressed (Figure 7). When the fresh weights of the two were compared, the fresh weight of the rice to which NAG was added was significantly greater than that of the lettuce without NAG addition (Figure 8).

[0068] 4. Conclusion Since NAG suppressed the decrease in fresh weight associated with the drying stress treatment, it was suggested that NAG confers drought stress tolerance in rice.

[0069] Example 4: Promotion of the expression of heat stress-responsive genes by N-acetylglutamic acid in Arabidopsis thaliana 1. Objective In the drought stress response of plants, physiological responses such as stomatal closure are induced to prevent water loss from the body, and the expression of genes that control them is also activated. In plants, the transcription factor DREB2A is activated along with drought stress and plays a central role in the regulation of the expression of genes that function in drought tolerance (Sakuma et al, Plant Cell, Volume 18, Issue 5, Pages 1292-1309, 2006). Therefore, in order to verify the effect of NAG in alleviating drought stress from the aspect of gene expression regulation, it was verified whether the expression of DREB2A and other drought stress response genes was promoted in Arabidopsis thaliana treated with NAG.

[0070] 2. Experimental methods (1) Experimental materials The wild type of Arabidopsis thaliana (accession: Col-0) was used as the experimental material. The seeds were purchased from Inplanta Innovations Co., Ltd. (https: / / www.inplanta.jp / ).

[0071] (2) Growth method As the growth medium, a liquid medium containing 1 / 2 Murashige and Skoog medium mixed salts (Nacalai) and 1 (w / v)% sucrose (FUJIFILM Wako) was used. Arabidopsis thaliana seeds were sterilized with a kitchen detergent solution (registered trademark, Kao) diluted to half the concentration with distilled water for 3 minutes, washed 3 times with sterilized distilled water, and then incubated at 4 °C overnight. The growth medium was dispensed into 12-well microplates (IWAKI) at 3 mL per well, 5 seeds were sown per well, and then transferred to an incubator (TOMY) to start growth. The set conditions of the incubator were a temperature of 22 °C and a photoperiod cycle of 16 hours of light period and 8 hours of dark period.

[0072] (3) N-acetylglutamic acid treatment and RNA extraction On the 7th day after sowing Arabidopsis thaliana, NAG was added to a final concentration of 0.4 mM in the medium and incubated for 2 hours. The incubation conditions of the incubator were a temperature of 22 °C and a photoperiod cycle of 16 hours of light period and 8 hours of dark period. After incubation, the samples were frozen in liquid nitrogen, and RNA was extracted using the RNeasy Plant Mini Kit (Thermo Fischer Scientific).

[0073] (4) Analysis of the expression level of drought stress response genes by real-time PCR cDNA required as a template for real-time PCR was synthesized from the obtained RNA. Using 1000 ng of total RNA from each sample, PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time) (TaKaRa). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. In real-time PCR, the target genes were DREB2A (AGI code: AT5G05410), ERD1 (AGI code: AT5G51070), RD29A (AGI code: ), NCED3 (AGI code: AT3G14440), LEA (AGI code: AT3G02480), RD29B (AGI code: AT5G52300), and the reference gene was ACTIN2 (AGI code: AT3G18780). A PCR reaction solution was prepared together with TB Green Ex Taq II (TaKaRa). For the PCR reaction, Thermal Cycler Dice (registered trademark) Real Time System IV (TaKaRa) was used, and the number of amplification cycles for PCR was set to 50 cycles. The primers used were as follows: DREB2A Fw: AACCTGTCAGCAACAACAGC (SEQ ID NO: 1) Rv: AAGCCTGCAAACACATCGTC (SEQ ID NO: 2) / ERD1 Fw: TGGGCTTGACATTGCTAACC (SEQ ID NO: 3) Rv: AAGGGTTGTGGATGCAATGC (SEQ ID NO: 4) / RD29A Fw: ATCATCTGGCTGGTTTGGTG (SEQ ID NO: 5) Rv: AACAACAGTGGAGCCAAGTG (SEQ ID NO: 6) / NCED3 Fw: CACGATTTCGCGATTACAGAGA (SEQ ID NO: 7) Rv: CCGGCAGCTTGAAAACGAAC (SEQ ID NO: 8) / LEA Fw: GCAAAACGCGAGCTACCAA (SEQ ID NO: 9) Rv: GTCCAGTCTGTTGCAAGGAGTCT (SEQ ID NO: 10) / RD29B Fw: GCGCACCAGTGTATGAATCCT (SEQ ID NO: 11) Rv: CGGCATGACTAAGAGACTTAGGTTT (SEQ ID NO: 12) / ACT2 Fw: GATCTCCAAGGCCGAGTATGAT (SEQ ID NO: 13) Rv: CCCATTCATAAAACCCCAGC (SEQ ID NO: 14).Subsequently, the relative expression levels of target genes upon NAG treatment were calculated by the ΔΔCt method using the Cp values obtained from real-time PCR.

[0074] 3. Results When compared with the control, upon NAG treatment, the expression levels of DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B increased by approximately 5.6-fold, 6.3-fold, 1.6-fold, 19-fold, 2.5-fold, and 1.8-fold, respectively (Figure 9).

[0075] 4. Conclusions It was suggested that NAG enhances drought stress tolerance in Arabidopsis thaliana by increasing the expression of drought stress response genes.

[0076] Example 5: Promotion of the expression of drought stress response genes by N-acetylglutamic acid in rice 1. Objective It was verified whether the effect of enhancing the expression of drought stress response genes by NAG observed in Arabidopsis thaliana could also be confirmed in rice.

[0077] 2. Experimental method (1) Search for homologs of Arabidopsis thaliana drought stress response genes in rice In designing primers for target genes required for gene expression analysis by real-time PCR, a search for homologs of Arabidopsis thaliana drought stress response genes in rice was conducted. The amino acid sequences of DREB2A and ERD1 of Arabidopsis thaliana were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of homologs were obtained using RAP-DB (https: / / rapdb.dna.affrc.go.jp / ). Also, the nucleotide sequence of a homolog of ACT2 (AGI code: AT3G18780) of Arabidopsis thaliana as a reference gene was obtained. Each homolog gene of rice was named OsDREB2A, OsDREB2B, OsERD1, and OsACT1.

[0078] (2) Experimental materials It is the same as Example 3.

[0079] (3) Growth method A liquid medium composed of 1 / 2 Murashige and Skoog medium mixed salts was used as the growth medium. Using a 50 mL Falcon tube, rice seeds were sterilized with a kitchen detergent solution diluted to half concentration with distilled water for 30 minutes, and washed 5 times with sterilized distilled water. The tube was laid horizontally, and sterilized distilled water was poured to submerge the washed seeds, and germination treatment was carried out by culturing in an incubator for 3 days. The set conditions of the incubator were a temperature of 30 °C and a day length cycle of 16 hours of light period and 8 hours of dark period.

[0080] (4) N-acetylglutamic acid treatment and RNA extraction Samples of rice germinated for 3 days were placed on a liquid medium composed of 1 / 2 Murashige and Skoog medium mixed salts. Specifically, 3 mL of the liquid medium was dispensed into each well of a 12-well microplate (IWAKI), and 3 samples were transferred per well. NAG was added to each well so that the final concentration in the medium was 0.5 mM, incubated at 30 °C for 2 hours, and then RNA was extracted from the shoot using the RNeasy Plant Mini Kit.

[0081] (5) Analysis of the expression level of drought stress response genes by real-time PCR cDNA required as a template for real-time PCR was synthesized from the obtained RNA. Using 1000 ng of total RNA from each sample, PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time). The synthesized cDNA was diluted 5-fold with sterile distilled water and used for real-time PCR. In real-time PCR, the target genes were OsDREB2A, OsDREB2B, OsERD1, and the reference gene was OsACT1. A PCR reaction solution was prepared with TB Green Ex Taq II. For the PCR reaction, Thermal Cycler Dice (registered trademark) Real Time System IV was used, and the number of amplification cycles for PCR was set to 50 cycles. The primers used were as follows: OsDREB2A Fw: AGAGAACGCGAAGGAAAAGC (SEQ ID NO: 15) Rv: TCTGGTTTTGCTCCTTCCAC (SEQ ID NO: 16); OsDREB2B Fw: AAAAAGCGACCACGGAGATC (SEQ ID NO: 17) Rv: TGCCTTCCTTGCCTTCTTTG (SEQ ID NO: 18); OsERD1 Fw: ACCTGATTTGCGAAGAAGGC (SEQ ID NO: 19) Rv: TTGCTTCGCTGATCACATCC (SEQ ID NO: 20); OsACT1 Fw: AGCACATTCCAGCAGATGTG (SEQ ID NO: 21) Rv: TTCCTGTGCACAATGGATGG (SEQ ID NO: 22). Subsequently, the relative expression levels of the target genes when treated with NAG were calculated by the ΔΔCt method.

[0082] 3. Results When compared with the control and treated with NAG, the expression levels of OsDREB2A, OsDREB2B, and OsERD1 increased by approximately 1.6-fold, 1.6-fold, and 1.5-fold, respectively (Figure 10). In rice, it was suggested that NAG enhances drought stress tolerance by increasing the expression of drought stress response genes.

[0083] Example 6: Promotion of the expression of drought stress response genes by N-acetylglutamic acid in hops 1. Objective It was verified whether the effect of promoting the expression of drought stress response genes by NAG observed in Arabidopsis thaliana and rice could also be confirmed in hops.

[0084] 2. Experimental methods (1) Search for homologs of Arabidopsis thaliana drought stress response genes in hops When designing primers for target genes required for gene expression analysis by real-time PCR, a search for homologs of Arabidopsis thaliana high-temperature responsive genes in hops was conducted. The amino acid sequences of Arabidopsis thaliana DREB2A and HlNCED3 were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of homologs of each gene were obtained using Hopbase (http: / / hopbase.cgrb.oregonstate.edu / ). When obtaining the nucleotide sequences of homologs, a TBLASTN search was performed using the Arabidopsis thaliana amino acid sequence as a query, and the gene with the highest score among the genes listed as homolog candidates was regarded as the homolog in hops. In addition, the nucleotide sequence of a homolog of Arabidopsis thaliana EF1α (AGI code: AT1G18070) was also obtained as a reference gene. Each homolog gene of hops was named HlDREB2A, HlNCED3, and HlEF1α.

[0085] (2) Experimental materials Hops (variety: Zate). Hop seedlings were purchased from Hananoyakata (http: / / hananoyakata.shop-pro.jp).

[0086] (3) Growth medium (i) Agar medium 2.2 g of mixed salts for Murashige and Skoog medium and 20 g of glucose (FUJIFILM Wako) were dissolved in 1 L of pure water and adjusted to pH 5.8. After pH adjustment, 8 g of agar (Ina Food Industry) was melted and autoclaved (121°C, 15 minutes).

[0087] (ii) Liquid medium 2.2 g of mixed salts for Murashige and Skoog medium and 20 g of glucose were dissolved in 1 L of pure water, adjusted to pH 5.8, and then autoclaved (121°C, 20 minutes).

[0088] (4) Preparation and growth method of tissue culture seedlings The tissue culture seedlings used as experimental materials were prepared by the following method. A stem fragment containing one node was cut out from the shoots of Zarts as an explant, and sterilized by incubating with 70% ethanol (FUJIFILM Wako) for 1 minute and 1% hypochlorous acid (FUJIFILM Wako) for 5 minutes. The explants were washed 3 times with sterile water for 1 minute each, and the moisture was removed with a paper towel. Then, the explants were placed on an agar medium and cultured in an incubator. The set conditions of the incubator were a temperature of 20°C and a photoperiod cycle of 16 hours of light period and 8 hours of dark period. After 2 weeks of culture, the axillary buds elongated from the nodes were cut out and placed on an agar medium, and the individuals that grew well were used as tissue culture seedlings. The tissue culture seedlings were regularly subcultured by placing the apical buds on a new agar medium.

[0089] (5) N-acetylglutamic acid treatment and RNA extraction Leaves at the 1st and 2nd nodes counted from the apical buds of the tissue culture seedlings 1.5 months after subculture were sampled and placed on a liquid medium composed of 1 / 2 Murashige and Skoog mixed salts and 2 (w / v)% glucose. Specifically, 5 mL of the liquid medium was dispensed into each well of a 6-well microplate (IWAKI), and 5 leaves of hops were placed. NAG was added to each well so that the final concentration in the medium was 1 mM, and after incubating at 20°C for 2 hours, RNA was extracted from the leaves using the RNeasy Plant Mini Kit.

[0090] (6) Analysis of the expression level of drought stress response genes by real-time PCR cDNA required as a template for real-time PCR was synthesized from the obtained RNA. Using 1000 ng of total RNA from each sample, PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time). The synthesized cDNA was diluted 5-fold with sterilized distilled water and used for real-time PCR. In real-time PCR, the target genes were HlDREB2A and HlNCED3, and the reference gene was HlEF1α. A PCR reaction solution was prepared with TB Green Ex Taq II. For the PCR reaction, Thermal Cycler Dice (registered trademark) Real Time System IV was used, and the number of PCR amplification cycles was set to 50 cycles. The primers used were as follows: HlDREB2A Fw: AAGTGGGTTGCTGAAATCCG (SEQ ID NO: 23) Rv: AGAAAGTACCGAGCCAAAGC (SEQ ID NO: 24); HlNCED3 Fw: TGCATTGACGGTGTTTACGC (SEQ ID NO: 25) Rv: TTGAACGGCGTGAACCATTC (SEQ ID NO: 26); HlEF1α Fw: TTTTGCTGTCAGGGACATGC (SEQ ID NO: 27) Rv: TTGGCAGCGGATTTGGTAAC (SEQ ID NO: 28). Subsequently, the relative expression levels of the target genes when treated with NAG were calculated by the ΔΔCt method.

[0091] 3. Results When compared with the control and treated with NAG, the expression levels of HlDREB2A and HlNCED3 increased by approximately 2.2-fold and 2.3-fold, respectively (Figure 11).

[0092] 4. Conclusions It was suggested that in hops, NAG enhances drought stress tolerance through an increase in the expression of drought stress response genes.

Industrial Applicability

[0093] By applying N-acetylglutamic acid or its salt or solvate to plants, drought stress tolerance can be imparted to the plants, and as a result, the yield of the plants can be increased even in a harsh environment with drought stress.

Claims

**Claim 1** A composition for imparting drought stress tolerance to plants, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. **Claim 2** The composition according to claim 1, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress. **Claim 3** A composition for promoting the closure of plant stomata, the enhancement of the cuticle layer, or root elongation, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. **Claim 4** The composition according to claim 3, wherein the closure of stomata, the enhancement of the cuticle layer, or root elongation is maintained or promoted under conditions of being exposed to drought stress. **Claim 5** A composition for promoting the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. **Claim 6** The composition according to any one of claims 1 to 5, wherein the plant is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene. **Claim 7** The composition according to any one of claims 1 to 5, wherein the plant is a dicotyledonous plant or a monocotyledonous plant. **Claim 8** A method for producing a plant having drought stress tolerance, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant. **Claim 9** The method according to claim 8, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress. **Claim 10** The method according to claim 8 or 9, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene. **Claim 11** The method according to claim 8 or 9, wherein the plant is a dicotyledonous plant or a monocotyledonous plant. **Claim 12** A method for imparting drought stress tolerance to a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant. **Claim 13** The method according to claim 12, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress. **Claim 14** The method according to claim 12 or 13, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of an N-acetylglutamic acid gene and a gene that induces the expression of the gene.

15. The method according to claim 12 or 13, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

Images