Micellar nanoparticles and uses thereof

The cationic carrier unit forms micelles with anionic payloads, addressing the challenges of crossing physiological barriers and improving delivery and stability of charged therapeutic agents.

JP2025106480APending Publication Date: 2025-07-15BIORCHESTRA LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025064597
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-06-24
Filing Date
2025-04-09
Publication Date
2025-07-15

AI Technical Summary

Technical Problem

Existing delivery systems for charged therapeutic agents like antisense oligonucleotides face challenges in crossing physiological barriers such as the blood-brain barrier and cell membranes, leading to poor bioavailability, rapid degradation, and limited cellular uptake.

Method used

A cationic carrier unit comprising a water-soluble polymer, a positively charged carrier, and an adjuvant moiety forms micelles with anionic payloads, enhancing stability and targeting capabilities to overcome these barriers.

Benefits of technology

The micelle system improves serum stability, protects against degradation, and enhances cellular uptake and targeting to specific tissues, extending the half-life and efficacy of anionic payloads.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025106480000045
    Figure 2025106480000045
  • Figure 2025106480000046
    Figure 2025106480000046
  • Figure 2025106480000047
    Figure 2025106480000047
Patent Text Reader

Abstract

To provide micellar nanoparticles and uses thereof.SOLUTION: The present disclosure includes cationic carrier units comprising (i) a water soluble polymer, (ii) a positively charged carrier, and (iii) an adjuvant moiety, wherein when the cationic carrier unit is mixed with an anionic payload (e.g., an antisense oligonucleotide) that electrostatically interacts with the cationic carrier unit, the resulting composition self-organizes into a micelle encapsulating the anionic payload in its core. The cationic carrier units can also comprise a tissue specific targeting moiety, which would be displayed on the surface of the micelle. The disclosure also includes micelles comprising the cationic carrier units of the disclosure, methods of manufacture of cationic carrier units and micelles, pharmaceutical compositions comprising the micelles, and also methods of treating diseases or conditions comprising administering the micelles to a subject in need thereof.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Reference to Electronically Submitted Sequence Listing The content of the electronically submitted sequence listing of the ASCII text file (name "4366_002PC02_Seqlisting_ST25", size: 5,392 bytes, and creation date: June 26, 2020) submitted together with this application is hereby incorporated by reference in its entirety into this specification.

[0002] Field The present disclosure provides a cationic carrier unit and a micelle system that can be used to deliver an anionic payload (e.g., an oligonucleotide) through a physiological permeation barrier (e.g., the blood-brain barrier).

Background Art

[0003] The body has certain barriers that limit the permeability of drugs through membranes. Thus, only certain substances can pass through this type of membrane. Among the important and special physiological barriers are the blood-brain barrier and cell membranes. The blood-brain barrier (BBB) is a highly selective semipermeable boundary that separates the brain and extracellular fluid from circulating blood in the central nervous system (CNS). The blood-brain barrier is formed by endothelial cells of the capillary wall, astrocyte end feet covering the capillaries, and pericytes embedded in the capillary basement membrane. This system allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids important for nerve function.

[0004] The blood-brain barrier (BBB) restricts the passage of pathogens into cerebrospinal fluid (CSF), the diffusion of solutes in the blood, and large or hydrophilic molecules, while allowing the diffusion of O2, CO2, hydrophobic molecules (e.g., hormones), and small polar molecules (Johansen et al., (2017) Journal of Cerebral Blood Flow and Metabolism. Epub (4):659-668). The BBB excludes nearly 100% of large molecule neurotherapeutics and more than 98% of all molecular drugs from the brain. Daneman & Prat (2015) “The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412. Overcoming the difficulty of delivering therapeutic agents to specific regions of the brain is a major challenge for the treatment of most brain disorders. Thus, therapeutic molecules that could be effective for diagnosis and treatment in the absence of the BBB do not cross the BBB in appropriate amounts.

[0005] Often, intracellular targeting is also difficult because exogenous molecules must first cross the cell membrane in order to reach the cytoplasm. The cell membrane is lipophilic and selectively permeable to non-polar therapeutic agents that can cross the cell membrane. On the other hand, highly charged therapeutic agents such as oligonucleotides are effectively excluded by the cell membrane.

[0006] Polynucleotides do not readily permeate cell membranes due to the charge repulsion between the negatively charged membrane and the high negative charge of the polynucleotide. As a result, polynucleotides have poor bioavailability and poor cellular uptake (typically less than 1%) (Dheur et al, Nucleic Acid Drug Dev., 9:522 (1999); Park et al, J Controlled Release, 93:188 (2003)). Generally, most polynucleotides are over 5,000 Da, so they cannot readily diffuse through cell membranes, and cellular uptake is mainly limited to the pinocytosis or endocytosis process. Once inside the cell, polynucleotides can accumulate in the lysosomal compartment, and their access to the cytoplasm or nucleus is limited. Exogenously administered polynucleotides are also very sensitive to rapid degradation by nucleases both inside and outside the cytoplasm. Studies have shown rapid degradation with a half-life of about 30 minutes for polynucleotides in the blood after intravenous administration (Geary et al, J.Pharmacol.Exp.Ther. 296:890-897 (2001)).

[0007] Thus, the problems faced in the delivery of polynucleotides, such as antisense oligonucleotides, can be broadly divided into two parts. First, the therapeutic polynucleotide must be formulated so that it can be delivered to the cytoplasm, and second, the intact and fully functional polynucleotide must reach the cell nucleus. Despite the progress in the application of oligonucleotides and oligonucleotide analogs as therapeutic agents, there is a need for delivery systems that provide improved pharmacological properties, such as serum stability, delivery to the correct organ, tissue, or cell, and membrane permeation delivery. Attempts to improve the membrane permeation delivery of nucleic acids and oligonucleotides have utilized protein carriers, antibody carriers, liposome delivery systems, electroporation, direct injection, cell fusion, viral vectors, and calcium phosphate-mediated transformation. However, many of these techniques are limited by the types of cells in which membrane permeation transport is viable and the conditions necessary to achieve such transport. Thus, there is a need for a delivery system that can selectively direct charged therapeutic agents (e.g., antisense oligonucleotides such as antimiR) to specific target cells or tissues and across permeation barriers (e.g., the plasma membrane or the BBB), while also improving serum stability and / or resistance to endogenous degrading enzymes (e.g., RNase).

Prior Art Documents

Non-Patent Documents

[0008]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Means for Solving the Problems

[0009] The present disclosure is a cationic carrier unit comprising the following formula: [WP]-L1-[CC]-L2-[AM](Scheme I) Or [WP]-L1-[AM]-L2-[CC](Scheme II) In the formula, WP is a water-soluble biopolymer moiety, CC is a positively charged carrier moiety, AM is an adjuvant moiety, L1 and L2 are independently optional linkers, When mixed with nucleic acids in an ionic ratio of about 1:1, the cationic carrier units form micelles, providing cationic carrier units.

[0010] In some embodiments, the water-soluble polymer includes poly(alkylene glycol), poly(oxyethylated polyol), poly(olefin alcohol), poly(vinyl pyrrolidone), poly(hydroxyalkyl methacrylamide), poly(hydroxyalkyl methacrylate), poly(saccharide), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazoline ("POZ"), poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water-soluble polymer includes polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). In some embodiments, the water-soluble polymer includes the following formula, [Chemical formula] wherein n is from 1 to 1000.

[0011] In some embodiments, n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some embodiments, n is from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 140 to about 150, or from about 150 to about 160.

[0012] In some embodiments, the water-soluble polymer is linear, branched, or dendritic. In some embodiments, the cationic carrier moiety comprises one or more basic amino acids. In some embodiments, the cationic carrier moiety comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.

[0013] In some embodiments, the cationic carrier moiety comprises from about 30 to about 50 basic amino acids. In some embodiments, the basic amino acids include arginine, lysine, histidine, or any combination thereof. In some embodiments, the cationic carrier moiety comprises about 40 lysine monomers.

[0014] In some embodiments, the adjuvant moiety can modulate an immune response, an inflammatory response, or the tissue microenvironment. In some embodiments, the adjuvant moiety can modulate an immune response. In some embodiments, the adjuvant moiety can modulate the tumor microenvironment in a subject having a tumor.

[0015] In some embodiments, the adjuvant moiety can inhibit or reduce hypoxia in the tumor microenvironment. In some embodiments, the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.

[0016] In some embodiments, the adjuvant moiety comprises the following formula:

Chemical formula

[0017] In some embodiments, the adjuvant moiety comprises a nitroimidazole. In some embodiments, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretramide, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. In some embodiments, the adjuvant moiety comprises an amino acid. In some embodiments, the adjuvant moiety comprises the following formula:

Chemical formula

[0018] In some embodiments, the adjuvant moiety can inhibit or reduce an inflammatory response. In some embodiments, the adjuvant moiety is a vitamin. In some embodiments, the vitamin comprises a cyclic ring or a cyclic hetero atom ring and a carboxyl group or a hydroxyl group. hetero atom ring) and a carboxyl group or a hydroxyl group.

[0019] In some embodiments, the vitamin comprises the following formula [Chem.] wherein each of Y1 and Y2 is independently selected from C, N, O, and S, and n is 1 or 2.

[0020] In some embodiments, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some embodiments, the vitamin is vitamin B3.

[0021] In some embodiments, the adjuvant moiety comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3 units. In some embodiments, the adjuvant moiety comprises at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 vitamin B3 units. In some embodiments, the adjuvant moiety comprises about 10 vitamin B3 units. In some embodiments, the adjuvant moiety comprises about 20 vitamin B3 units. In some embodiments, the adjuvant moiety comprises about 30 vitamin B3 units. In some embodiments, the adjuvant moiety comprises about 40 vitamin B3 units.

[0022] In some embodiments, the cationic carrier unit comprises a water-soluble biopolymer moiety having about 120 to about 130 PEG units, a cationic carrier moiety comprising polylysine having about 30 to about 40 lysine units, and an adjuvant moiety having about 5 to about 10 vitamin B3 units. In some embodiments, the cationic carrier unit further comprises an anionic payload that interacts with the cationic carrier unit by ionic bonding.

[0023] In some embodiments, the cationic carrier unit comprises a water-soluble biopolymer moiety having about 120 to about 130 PEG units, a cationic carrier moiety comprising polylysine having about 70 to about 90 lysine units, e.g., about 80 lysine units, and an adjuvant moiety having about 20 to about 40 vitamin B3 units, e.g., about 30 vitamin B3 units. In some embodiments, the cationic carrier unit further comprises an anionic payload that interacts with the cationic carrier unit by ionic bonding.

[0024] The present disclosure also provides micelles comprising a cationic carrier unit and an anionic payload disclosed herein, wherein the cationic carrier moiety of the cationic carrier complex and the anionic payload are associated with each other. In some embodiments, the association is a covalent bond. In other embodiments, the association is a non-covalent bond. In some embodiments, the association is an ionic bond.

[0025] In some embodiments, the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form micelles when mixed with the anionic payload in solution, where the overall ionic ratio of the positive charge of the cationic carrier moiety of the cationic carrier unit and the negative charge of the anionic payload in the solution is about 1:1. In some embodiments, the cationic carrier unit can protect the anionic payload from degradation by DNase and / or RNase. In some embodiments, the anionic payload is not conjugated to the cationic carrier unit by a covalent bond and / or the anionic payload interacts with the cationic carrier moiety of the cationic carrier unit only by ionic interactions.

[0026] In some embodiments, the half-life of the anionic payload is extended compared to the half-life of the free anionic payload that is not incorporated into the micelles. In some embodiments, the positive charge of the cationic carrier moiety of the cationic carrier unit in the micelles and the negative charge of the anionic payload are in an ionic ratio of about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, or about 1:3. In some embodiments, the positive charge of the cationic carrier moiety of the cationic carrier unit in the micelles and the negative charge of the anionic payload are in an ionic ratio of about 3:1 to about 1:3. In some embodiments, the positive charge of the cationic carrier moiety of the cationic carrier unit in the micelles and the negative charge of the anionic payload are in a charge ratio of 1:1. In some embodiments, the diameter of the micelles is about 1 nm to 100 nm, about 10 nm to about 100 nm, about 10 nm to about 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 20 nm to about 100 nm, about 20 nm to about 90 nm, about 20 nm to about 80 nm, about 20 nm to about 70 nm, about 30 nm to about 100 nm, about 30 nm to about 90 nm, about 30 nm to about 80 nm, about 30 nm to about 70 nm, about 40 nm to about 100 nm, about 40 nm to about 90 nm, about 40 nm to about 80 nm, or about 40 nm to about 70 nm.

[0027] In some embodiments, the anionic payload comprises a nucleic acid. In some embodiments, the nucleic acid comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimiR, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof. In some embodiments, the nucleic acid comprises at least one nucleoside analog. In some embodiments, the nucleoside analog comprises locked nucleic acid (LNA); 2'-O-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabinonucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-O-methyl nucleic acid (2'-OMe), 2'-O-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0028] In some embodiments, the nucleic acid comprises a nucleotide sequence having a length of 5 to 30 nucleotides. In some embodiments, the nucleotide sequence is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the nucleotide sequence has a backbone comprising phosphodiester bonds, phosphate triesters, methylphosphonate bonds, phosphoramidate bonds, phosphorothioate bonds, and combinations thereof. In some embodiments, the cationic carrier unit further comprises a targeting moiety optionally linked to a water-soluble polymer by a linker.

[0029] In some embodiments, the targeting moiety can target tissues. In some embodiments, the tissues can be the liver, brain, kidney, lung, ovary, pancreas, thyroid, chest, stomach, or any combination thereof. In some embodiments, the tissue is cancerous tissue. In some embodiments, the tissue is the liver. In some embodiments, the liver targeting moiety comprises cholesterol. In some embodiments, the tissue is the pancreas. In some embodiments, the pancreas targeting moiety comprises a ligand that binds to an integrin receptor.

[0030] In some embodiments, the targeting moiety targets the central nervous system. In some embodiments, the brain targeting moiety can be transported by the large neutral amino acid transporter 1 (LAT1). In some embodiments, the brain targeting moiety is an amino acid. In some embodiments, the brain targeting moiety comprises branched-chain or aromatic amino acids. In some embodiments, the amino acids are valine, leucine, and / or isoleucine. In some embodiments, the amino acids are tryptophan and / or tyrosine.

[0031] The present disclosure also provides compositions comprising the cationic carrier units and negatively charged molecules disclosed herein. Pharmaceutical compositions comprising the cationic carrier units, compositions, or micelles disclosed herein and a pharmaceutically acceptable carrier are also provided.

[0032] The present disclosure also provides methods for preparing the cationic carrier units disclosed herein, including synthesizing the cationic carrier units. In some embodiments, methods for preparing the micelles disclosed herein include mixing the cationic carrier units with negatively charged molecules in a solution at a 1:1 ionic ratio. In some embodiments, the method further comprises purifying the micelles.

[0033] The present disclosure also provides a method for treating a disease or condition of a subject in need of treatment for the disease or condition, the method comprising administering to the subject a micelle of the present disclosure. In some embodiments, the anionic payload of the core of the micelle exhibits a longer half-life than the corresponding anionic payload not incorporated into the micelle. In some embodiments, the subject is a mammal.

[0034] The present disclosure also provides a method for treating cancer of a subject in need of treatment for cancer, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein. In some embodiments, the cancer is glioblastoma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer. In some embodiments, the pancreatic cancer is pancreatic adenocarcinoma.

[0035] The present disclosure also provides a method for reducing inflammation in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0036] The present disclosure also provides a method for restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0037] The present disclosure also provides a method for improving the cognitive function of a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0038] In some embodiments, the neurodegenerative disease is Alzheimer's disease.

[0039] The present disclosure also provides a method for reducing amyloid plaque load in a subject suffering from Alzheimer's disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0040] In some embodiments, the micelle comprises a cationic carrier unit targeting LAT1 and an antisense oligonucleotide targeting miRNA-485-3p, for example, the antisense oligonucleotide of SEQ ID NO: 18, or a fragment, variant, or derivative thereof. In some embodiments, the fragment comprises 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 18. In some embodiments, the variant has at least 70% sequence identity to SEQ ID NO: 18. In some embodiments, the derivative comprises at least one sugar modification and / or at least one backbone modification.

Brief Description of the Drawings

[0041]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18A

Figure 18B

Figure 18C

Figure 19A

Figure 19B

Figure 20A

Figure 20B

Figure 21A

Figure 21B

Figure 22A

Figure 22B

Figure 23A

Figure 23B

Figure 24

Figure 25

Figure 26A

Figure 26B

Figure 27

Mode for Carrying Out the Invention

[0042] The present disclosure is directed to carrier units that include a water-soluble biopolymer moiety (e.g., PEG) and a charged moiety (e.g., polylysine). Electrostatic interactions between the charged moiety and a charged payload (e.g., an oligonucleotide) having an opposite charge and approximately the same or the same charge amount (i.e., the charge on the charged payload of the carrier unit and the charge on the charged payload are approximately the same or the same) neutralize the charges of the charged moiety of the carrier unit and the charged payload, resulting in a carrier unit:payload complex. The carrier unit:payload complex can self-associate to result in a micelle in which the payload is present in the core of the micelle and the water-soluble biopolymer moiety faces the solvent. In some embodiments, the carrier unit includes a charged cationic moiety that can interact with an anionic payload. Conversely, the carrier unit can include a charged anionic moiety that can interact with a cationic payload. Non-limiting examples of various embodiments are presented in the present disclosure.

[0043] Before the present disclosure is described in more detail, it is to be understood that the present disclosure is not limited to the particular compositions or process steps described, and as such can naturally vary. As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein can be readily separated from or combined with any of several other embodiments without departing from the scope or spirit of the present disclosure and has distinct components and features. Any recited method can be performed in the order of recited events or in any other order that is logically possible.

[0044] The headings provided herein do not limit the various embodiments of the present disclosure that can be defined by reference to the entire specification. It is also to be understood that the terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting, as the scope of the present disclosure is limited only by the appended claims.

[0045] Accordingly, the terms defined immediately below are more fully defined by reference to the entire specification.

[0046] I. Definitions For the sake of easier understanding of this specification, certain terms are defined first. Additional definitions are set forth throughout the detailed description of the embodiments for carrying out the invention.

[0047] Note that the term preceded by “a” or “an” refers to one or more of them. For example, “nucleotide sequence” is understood to represent one or more nucleotide sequences. Accordingly, the terms “a” (or “an”), “one or more”, and “at least one” may be used interchangeably herein. Further note that the claims may be drafted to exclude optional elements. Accordingly, this description is intended to serve as a preamble for the use of exclusive terms such as “solely”, “only”, etc. in connection with the recitation of elements of the claims, or for the use of “negative” limitations.

[0048] Furthermore, when used herein, “and / or” is considered to be a specific disclosure of each of the two specified features or components, with or without the other. Accordingly, the term “and / or” as used in expressions such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Similarly, the term “and / or” as used in expressions such as “A, B, and / or C” is intended to include each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0049] It will be understood that when an embodiment is described herein using the term “comprising”, other similar embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided.

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press provide many common dictionaries of terms used in this disclosure to those of ordinary skill in the art.

[0051] Units, prefixes, and symbols are represented in their recognized forms in the International System of Units (SI). Numerical ranges include the numbers defining the range. When a range of values is recited, it is to be understood that each intervening integer value, and each fractional part thereof, between the upper and lower limits recited for that range, as well as each subrange between such values, are also expressly disclosed. It is to be understood that the upper and lower limits of any range may independently be included in or excluded from the range, and that each range that includes either, neither, or both of the limits is also encompassed within the disclosure. Accordingly, the ranges recited herein are to be understood to be merely illustrative of the values within the range and all shorthand representations of values within the range that include the recited endpoints are contemplated. For example, the range of 1 to 10 is to be understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0052] When values are explicitly recited, values that are substantially the same quantity or amount as the recited values are also to be understood as being within the scope of the present disclosure. When combinations are disclosed, each subcombination of the elements of that combination is also clearly disclosed and is within the scope of the present disclosure. Conversely, when different elements or groups of elements are disclosed individually, combinations thereof are also disclosed. When any element of a disclosure is disclosed as having a plurality of alternatives, examples of that disclosure in which each alternative is excluded, either alone or in any combination with other alternatives, are also disclosed herein, and two or more elements of a disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0053] Nucleotides are represented by the one-letter symbols of the generally recognized nucleotides. Unless otherwise specified, nucleotide sequences are written left to right in the 5' to 3' direction. In this specification, nucleotides are represented by the one-letter symbols of the generally known nucleotides recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Thus, "a" represents adenine, "c" represents cytosine, "g" represents guanine, "t" represents thymine, and "u" represents uracil.

[0054] Unless otherwise specified, amino acid sequences are written left to right in the amino to carboxy direction. In this specification, amino acids are represented by the three-letter symbols or one-letter symbols of the generally known amino acids recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0055] The term "about" is used herein to mean "substantially", "roughly", "approximately", or "in the range of". When the term "about" is used in conjunction with a numerical range, this term modifies that range by extending the upper and lower limits of the recited numerical values. Generally, the term "about" can modify the numerical values above and below the explicitly stated value by a variation of, for example, up or down 10 percent (higher or lower).

[0056] The terms "administer", "administering", and their grammatical variations refer to introducing a composition such as a micelle of the present disclosure to a subject by a pharmaceutically acceptable route. Introduction of a composition such as a micelle of the present disclosure to a subject can be by any suitable route including intratumoral, oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, periorbital, or topical. Administration includes self-administration and administration by another human. A suitable route of administration enables the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.

[0057] As used herein, the term "about" when applied to one or more values of interest refers to a value that is approximately the same as the referenced value being specified. In a particular embodiment, the term "about" refers to a range of values within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the specified reference value, unless otherwise specified or unless otherwise apparent from the context (except where such number would exceed 100% of the possible value of such number).

[0058] As used herein, the term "conserved" refers to a nucleotide or amino acid residue of a polynucleotide sequence or polypeptide sequence, respectively, that is invariantly found at the same position in two or more sequences being compared. A relatively conserved nucleotide or amino acid is one that is conserved among related sequences as compared to nucleotides or amino acids that occur at other positions in the sequence.

[0059] In some embodiments, two or more sequences are said to be "perfectly conserved" or "identical" if they are 100% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. Conservation of a sequence can apply to the entire length of a polynucleotide or polypeptide or to portions, regions, or features thereof.

[0060] As used herein, the term "derived from" refers to a component that is isolated or produced from a particular molecule or organism using a particular molecule or organism or information (e.g., the sequence of an amino acid or nucleic acid). For example, a nucleic acid sequence derived from a second nucleic acid sequence may contain a nucleotide sequence that is identical to or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of a nucleotide or polypeptide, the derived species can be obtained, for example, by naturally occurring mutagenesis, artificial site-directed mutagenesis, or artificial random mutagenesis. The mutagenesis used to derive a nucleotide or polypeptide can be intentionally directed, intentionally random, or a combination of each. The mutagenesis of a nucleotide or polypeptide to create different nucleotides or polypeptides derived from the first can be a random event (e.g., caused by polymerase infidelity), and the identification of the derived nucleotide or polypeptide can be made, for example, by appropriate screening methods described herein. Mutagenesis of a polypeptide usually involves manipulation of the polynucleotide encoding the polypeptide.In some embodiments, the nucleotide or amino acid sequence derived from the second nucleotide or amino acid sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the second nucleotide or amino acid sequence, where the first nucleotide or amino acid sequence retains the biological activity of the second nucleotide or amino acid sequence.

[0061] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each containing a nucleic acid base sequence) that are related to each other by the Watson-Crick type base pairing rule, or between an oligomer and a target gene. For example, the nucleic acid base sequence "T-G-A (5'→3')" is complementary to the nucleic acid base sequence "A-C-T (3'→5')". Complementarity can be "partial", in which case less than all of the nucleic acid bases of a given nucleic acid base sequence match another nucleic acid base sequence according to the base pairing rule. For example, in some embodiments, the complementarity between a given nucleic acid base sequence and another nucleic acid base sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Or "perfect" or "complete" (100%) complementarity, as in the example, can exist between a given nucleic acid base sequence and another nucleic acid base sequence. The degree of complementarity between nucleic acid base sequences significantly affects the efficiency and strength of hybridization between the sequences.

[0062] The term "downstream" refers to a nucleotide sequence that is located on the 3' side of a reference nucleotide sequence. In certain embodiments, the downstream nucleotide sequence relates to the sequence following the transcription start point. For example, the translation start codon of a gene is located downstream of the transcription start site.

[0063] The terms "excipient" and "carrier" are used interchangeably and refer to an inert substance that is added to a pharmaceutical composition to facilitate the administration of a compound.

[0064] As used herein, the term "homology" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Generally, the term "homology" means the evolutionary relationship between two molecules. Thus, two homologous molecules have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both identity and similarity.

[0065] In some embodiments, polymer molecules are considered to be "homologous" to each other if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or similar (conservative substitution). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0066] As used herein, the term "identity" refers to the overall monomer conservation between polymer molecules, e.g., between polypeptide molecules or polynucleotide molecules (e.g., DNA molecules and / or RNA molecules). The term "identical" without any additional modifiers, e.g., "Protein A is identical to Protein B", means that the sequences are 100% identical (100% sequence identity). For example, expressing two sequences as "70% identical" is equivalent to expressing them as having, e.g., "70% sequence identity".

[0067] The percent identity of two polypeptide or polynucleotide sequences can be calculated, for example, by aligning the two sequences for optimal comparison (e.g., gaps may be introduced into one or both of the first and second polypeptide or polynucleotide sequences for optimal alignment, and non-identical sequences may be ignored for comparison). In certain embodiments, the length of the sequences aligned for comparison is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the full length of the reference sequence. Then the amino acids at the corresponding amino acid positions, or in the case of polynucleotides, the bases are compared.

[0068] If a position in the first array is occupied by the same amino acid as the corresponding position in the second array, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. Comparison of sequences and determination of the percent identity between two sequences can be accomplished using mathematical algorithms.

[0069] Suitable software programs for the alignment of both protein and nucleotide sequences are available from a variety of sources. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST program suite available from the BLAST website of the National Center for Biotechnology Information of the US government (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs include, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS bioinformatics program suite and are also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0070] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X, or Clustal Omega), MUSCLE, and the like.

[0071] Different regions within a single polynucleotide or polypeptide target sequence that are aligned with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. Note that the percent sequence identity value is rounded to the first decimal place. For example, 80.11, 80.12, 80.13, and 80.14 are truncated to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. Also note that length values are always integers.

[0072] In certain embodiments, the percent identity (%ID) or percent identity of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100×(Y / Z), where Y is the number of amino acid residues (or nucleic acid bases) that are evaluated as exact matches in an alignment of the first and second sequences (aligned by visual inspection or by a particular sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence exceeds the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0073] One of ordinary skill in the art will understand that the creation of a sequence alignment for calculating percent sequence identity is not limited to a comparison between two sequences that is driven solely by primary sequence data. It will also be understood that a sequence alignment can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., protein crystal structures), functional data (e.g., positions of mutations), or phylogenetic data. Suitable programs for integrating heterogeneous data to generate a multiple sequence alignment are available at www.tcoffee.org and, alternatively, for example, T-Coffee available from EBI. It will also be understood that the final alignment used to calculate percent sequence identity can be managed either automatically or manually.

[0074] As used herein, the terms "isolated," "purified," "extracted," and grammatical variations thereof are used interchangeably and refer to the state of preparation of the desired compositions of the present disclosure that have undergone one or more purification processes. In some embodiments, as used herein, isolation or purification is a process of removing (e.g., fractionating) the compositions of the present disclosure from a sample containing contaminants. In some embodiments, the isolated composition has no detectable undesirable activity or, alternatively, the level or amount of undesirable activity is at or below an acceptable level or amount. In other embodiments, the isolated composition has an amount and / or concentration of the desired composition of the present disclosure that is above an acceptable amount and / or concentration and / or activity. In other embodiments, the isolated composition is enriched as compared to the starting material from which the composition is obtained. This enrichment can be at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or more than 99.9999% as compared to the starting material. In some embodiments, the isolated preparation is substantially free of residual biological products. In some embodiments, the isolated preparation is free of any contaminating biological material at 100%, at least about 99%, at least about 98%, at least about 97%, at least about 96%, at least about 95%, at least about 94%, at least about 93%, at least about 92%, at least about 91%, or at least about 90%. Residual biological products can include non-biological materials (such as chemicals) or undesirable nucleic acids, proteins, lipids, or metabolites.

[0075] As used herein, the term "linked" refers to a first amino acid sequence or polynucleotide sequence that is attached to a second amino acid sequence or polynucleotide sequence, respectively, by a covalent or non-covalent bond. The first amino acid or polynucleotide sequence can be directly attached or juxtaposed to the second amino acid or polynucleotide sequence, or alternatively, intervening sequences can be added by covalent bonds from the first sequence to the second sequence. The term "linked" means not only the fusion at the 5' or 3' end of the first polynucleotide sequence to the second polynucleotide sequence, but also the insertion of the entire first polynucleotide sequence (or the second polynucleotide sequence, respectively) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence). The first polynucleotide sequence can be linked to the second polynucleotide sequence by a phosphodiester bond or a linker. The linker can be, for example, a polynucleotide.

[0076] The terms "miRNA" or "miR" or "microRNA" are used interchangeably and refer to microRNA molecules found in eukaryotes that are involved in RNA-based gene regulation. This term is used to refer to single-stranded RNA molecules processed from precursors. The names and their sequences of miRNAs relevant to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs by imperfect base pairing, resulting in destabilization or translational inhibition of the target mRNAs, thereby downregulating target gene expression. Conversely, the targeting of miRNAs by molecules containing miRNA binding sites (generally molecules containing sequences complementary to the seed region of miRNAs) can reduce or inhibit the translational inhibition induced by miRNAs, resulting in upregulation of target genes.

[0077] The term "mismatch" or "multiple mismatches" refers to one or more nucleobases (whether contiguous or separated) that do not match the target pre-mRNA according to the base pairing rules in an oligomeric nucleobase sequence. In many cases, perfect complementarity is desired, but some embodiments may include one or more, preferably 6, 5, 4, 3, 2, or 1 mismatch to the target pre-mRNA. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomers of the present disclosure include variations in the nucleobase sequence near the ends, variations within, and when present, are typically within about 6, 5, 4, 3, 2, or 1 subunit of the 5' and / or 3' ends. In certain embodiments, one, two, or three nucleobases may be removed and still provide accurate binding.

[0078] As used herein, the terms "modulate", "modify" and their grammatical variations generally refer to the ability to change a particular concentration, level, expression, function, or behavior, for example, when acting as an antagonist or agonist, to increase or decrease a particular concentration, level, expression, function, or behavior, e.g., directly or indirectly, to facilitate / stimulate / upregulate or to interfere with / inhibit / downregulate them. In some cases, a modifier may increase and / or decrease a particular concentration, level, activity, or function as compared to a control, or as compared to the average level of activity generally expected, or as compared to the control level of activity.

[0079] "Nucleic acid", "nucleic acid molecule", "nucleotide sequence", "polynucleotide", and grammatical variations thereof are used interchangeably and refer to ribonucleosides (adenosine, guanosine, uridine, or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, thymidine, or deoxycytidine; "DNA molecule") in the form of a phosphate ester polymer, either in single-stranded form or a double helix, or any phosphoester analog thereof, such as phosphorothioates and thioesters. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The terms nucleic acid molecule and in particular DNA or RNA molecule refer only to the primary and secondary structure of the molecule and are not limited to any particular tertiary form. Thus, the term includes, among other things, linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and double-stranded DNA found in chromosomes. When describing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the usual convention of providing only the sequence in the 5' to 3' direction along the non-transcribed strand of the DNA (i.e., the strand having the sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has been subjected to molecular biology manipulations. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. The "nucleic acid composition" of the present disclosure includes one or more nucleic acids as described herein.

[0080] As used herein, the phrases "parenteral administration" and "administered parenterally" mean a mode of administration by conventional injection other than enteral administration and topical administration and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injection and infusion.

[0081] The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable excipient", and their grammatical variations include any carrier or diluent that has been approved by the regulatory agencies of the United States federal government for use in animals, including humans, or listed in the U.S. Pharmacopeia, and that does not cause the occurrence of undesirable physiological effects to the extent of prohibiting the administration of the composition to the subject and does not inhibit the biological activity and properties of the administered compound. Pharmaceutically acceptable excipients and carriers that are useful in preparing pharmaceutical compositions and are generally safe, non-toxic, and desirable are included.

[0082] As used herein, the term "pharmaceutical composition" refers to one or more of the compounds described herein, such as micelles of the present disclosure, that are mixed or combined with, or suspended in, one or more other chemical components, such as pharmaceutically acceptable carriers and excipients. One purpose of the pharmaceutical composition is to facilitate the administration of the micelle preparation to the subject.

[0083] As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, their analogs, or mixtures thereof. This term refers to the primary structure of a molecule. Thus, this term includes triple-stranded, double-stranded, and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-stranded, double-stranded, and single-stranded ribonucleic acid ("RNA"). This term also includes polynucleotides modified by, for example, alkylation and / or capping and polynucleotides in their unmodified form.

[0084] More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose) such as tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced or unspliced, any other kind of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing a non-nucleotide backbone, such as polyamides (e.g., peptide nucleic acid "PNA") and polymorpholino polymers, and other sequence-specific synthetic nucleic acid polymers provided that they contain nucleobases in an arrangement that permits base pairing and base stacking as found in DNA and RNA.

[0085] In some embodiments of the present disclosure, the polynucleotide can be an oligonucleotide, such as an antisense oligonucleotide. In some embodiments, the oligonucleotide is RNA. In some embodiments, the RNA is synthetic RNA. In some embodiments, the synthetic RNA contains at least one unnatural nucleobase. In some embodiments, all nucleobases of a particular kind are replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, such as 5-methoxyuridine).

[0086] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may contain modified amino acids. The term also encompasses amino acid polymers that have been naturally modified or modified by intervention, such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. For example, polypeptides containing one or more amino acid analogs (e.g., non-natural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine) and other modifications known in the art are also included within the scope of the definition. As used herein, the term "polypeptide" refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single polypeptide or a multimolecular complex such as a dimer, trimer, or tetramer. They can also include single-stranded or multichain polypeptides. Most commonly, disulfide bonds are found in multichain polypeptides. The term "polypeptide" can also apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. In some embodiments, a "peptide" can be 50 amino acids in length or less, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0087] As used herein, the terms "prevent", "preventing", and variations thereof refer to partially or completely delaying the onset of a disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or signs of a particular disease, disorder, and / or condition; partially or completely delaying the progression of a particular disease, disorder, and / or condition; and / or reducing the risk of developing a pathology associated with a disease, disorder, and / or condition. In some embodiments, preventing a result is achieved by a prophylactic treatment.

[0088] As used herein, "prevention" refers to a therapeutic action or course of action used to prevent the onset of a disease or condition or to prevent or delay symptoms associated with a disease or condition.

[0089] As used herein, "preventive method" refers to means taken to maintain health and prevent or delay the onset of bleeding symptoms or to prevent or delay symptoms associated with a disease or condition.

[0090] As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. The calculation of the percent similarity of polymeric molecules to each other can be performed in the same manner as the calculation of the percent identity, except that the calculation of the percent similarity takes into account conservative substitutions that are understood in the art. It will be appreciated that the percentage of similarity depends on the comparative scale used, i.e., whether the amino acids are compared according to, for example, their evolutionary proximity, charge, volume, mobility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or a combination thereof.

[0091] The terms "subject", "patient", "individual", and "host", and variations thereof, are used interchangeably herein and are not limited, but refer to any mammalian subject, particularly a human, for which diagnosis, treatment, or therapy is desired, including humans, domestic animals (e.g., dogs, cats, etc.), livestock (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.). The methods described herein are applicable to human therapy and veterinary use.

[0092] As used herein, the expression "subject in need thereof" includes subjects such as mammalian subjects that would benefit from administration of the micelles of the present disclosure, e.g., to improve hemostasis.

[0093] As used herein, the expressions "systemic administration", "systemically administered", "peripheral administration", and "peripherally administered" mean administration other than direct administration to the central nervous system of a compound, drug, or other substance, such that it enters the patient's system and is thus subjected to metabolism and other similar processes, e.g., subcutaneous administration.

[0094] As used herein, the term "therapeutically effective amount" is an amount of a reagent or pharmaceutical compound, including the micelles of the present disclosure, sufficient to provide the desired therapeutic effect, pharmacological, and / or physiological effect for a subject in need thereof to provide the desired therapeutic effect, pharmacological, and / or physiological effect. A therapeutically effective amount can be a "prophylactically effective amount" if prevention can be considered treatment.

[0095] As used herein, the terms "treat", "treatment", or "treating" refer to, for example, reducing the severity of a disease or condition, reducing the duration of the disease course, improving or eliminating one or more symptoms associated with the disease or condition, providing a beneficial effect to a subject having the disease or condition, without necessarily curing the disease or condition. This term also includes the prevention or prophylaxis of a disease or condition or its symptoms. In one aspect, the terms "treat" or "treatment" mean inducing an immune response against an antigen in a subject.

[0096] The term "upstream" refers to a nucleotide sequence that is present on the 5' side of a reference nucleotide sequence.

[0097] II. Carrier Unit The present disclosure provides a carrier unit that can self-organize into micelles or can be incorporated into micelles. The carrier unit of the present disclosure includes a water-soluble biopolymer moiety (e.g., PEG) and a charged carrier moiety. As illustrated in FIG. 1, in some embodiments, the charged carrier moiety is cationic (e.g., polylysine), while in other embodiments, the charged carrier moiety is anionic (e.g., polyglutamic acid).

[0098] The carrier unit of the present disclosure can be used to deliver a charged payload (e.g., a therapeutic or diagnostic agent). A carrier unit having a cationic charged carrier moiety can be used to deliver an anionic payload (e.g., a polynucleotide). A carrier unit having an anionic charged carrier moiety can be used to deliver a cationic payload (e.g., a positively charged small molecule drug). Refer to FIG. 1.

[0099] Neutral or hydrophobic payloads can also be delivered using the carrier unit of the present disclosure by using an adapter (e.g., a cationic or anionic adapter as illustrated in FIG. 2). The adapter covalently binds, for example, to a hydrophobic payload and provides such a payload with an appropriate amount of charge to interact with the charged carrier moiety of the carrier unit of the present disclosure. Thus, in some embodiments, the payload of the present disclosure can include a charged moiety (the "adapter" moiety) and a biologically active moiety (e.g., a therapeutic moiety) that can interact (e.g., by electrostatic interaction) with the charged carrier moiety of the carrier unit of the present disclosure. In some embodiments, the adapter moiety and the biologically active moiety are directly linked, while in some other embodiments, they can be linked by a linker.

[0100] (i) A charged carrier moiety, and (ii) an electrostatic interaction between a charged payload (e.g., a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, etc.) or a charged portion thereof (e.g., an adapter moiety), a. the charged carrier moiety and the charged payload or a charged portion thereof have different net charges (i.e., one is cationic and the other is anionic), b. the net charge amounts are of the same order or the same (i.e., the number of charges of the charged portion of the carrier unit and the charged payload or a charged portion thereof is of the same order or the same), during the electrostatic interaction, the charges of the charged portion and the charged payload neutralize each other, resulting in a carrier unit:payload complex.

[0101] The resulting carrier unit:payload complex has a hydrophilic "head" containing a water-soluble biopolymer moiety and a hydrophobic "tail" containing a charged carrier moiety electrostatically bound to the payload, and is amphiphilic.

[0102] Carrier unit: The payload complex can self-associate alone or in combination with other amphiphilic molecules to yield micelles in which the payload is present in the core of the micelle and the water-soluble biopolymer moiety faces the solvent. The term "micelles of the present disclosure" encompasses not only typical micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes. Considering that polymersomes contain a lumen, it should be understood that all disclosures related to the "core" of a typical micelle are equally applicable to the lumen in a polymersome containing the carrier unit of the present disclosure. Thus, in some embodiments, the micelles of the present disclosure can include payload molecules bound to the carrier unit of the present disclosure and payload molecules in the lumen of the micelle (e.g., the lumen of a polymersome). In some embodiments, the payload bound to the carrier unit and the payload in the lumen are the same. In some embodiments, the payload bound to the carrier unit and the payload in the lumen are different.

[0103] The carrier unit of the present disclosure can include a targeting moiety covalently attached to the water-soluble biopolymer moiety by one or more optional linkers. Once the micelle is formed, the targeting moiety is located on the surface of the micelle, can deliver the micelle to a specific target tissue, a specific cell type, and / or can facilitate transport through a physiological barrier (e.g., the cell plasma membrane or the BBB). In some embodiments, the micelles of the present disclosure can include two or more targeting moieties.

[0104] The carrier unit of the present disclosure can also include an adjuvant moiety covalently attached to a charged carrier moiety. The adjuvant moiety can serve two purposes. The adjuvant moiety can provide a charge for electrostatic interaction with the payload and / or can have, for example, a therapeutic effect, an adjuvant therapeutic effect, or can have a beneficial effect on the homeostasis of the target cell or target tissue.

[0105] As shown in the schematic diagram of FIG. 1, in some embodiments, the payload is not covalently attached to the carrier unit. However, in other embodiments, the payload can be covalently attached to a linker such as a carrier unit, e.g., a cleavable linker.

[0106] Non-limiting examples of various embodiments are shown in the present disclosure. The present disclosure relates in particular to the use of cationic carrier units for delivering anionic payloads such as, for example, nucleic acids. However, it will be apparent to those skilled in the art that the present disclosure can be equally applied to the delivery of cationic payloads or neutral payloads by reversing the charges of the carrier moiety and the payload (i.e., using an anionic carrier moiety for the carrier unit to deliver a cationic payload), or by using a neutral payload linked to an anionic or cationic adapter that electrostatically interacts with the anionic or cationic carrier moiety.

[0107] Thus, in one embodiment, the present disclosure is a cationic carrier unit of Scheme I or Scheme II, [WP]-L1-[CC]-L2-[AM] (Scheme I) [WP]-L1-[AM]-L2-[CC] (Scheme II) wherein, WP is a water-soluble biopolymer moiety (e.g., PEG), CC is a cationic carrier moiety, e.g., polylysine, AM is an adjuvant moiety, e.g., a vitamin, e.g., vitamin B3, L1 and L2 are independently optionally selected linkers, providing a cationic carrier unit.

[0108] The present disclosure is an anionic carrier unit of Scheme III or Scheme IV, [WP]-L1-[AC]-L2-[AM] (Scheme III) [WP]-L1-[AM]-L2-[AC] (Scheme IV) wherein, WP is a water-soluble biopolymer moiety (e.g., PEG), AC is an anionic carrier moiety, AM is an adjuvant moiety, L1 and L2 independently provide a cationic carrier unit that is an optionally selected linker.

[0109] The present disclosure is of the cationic and anionic carrier units of Schemes V-VIII, [WP]-L1-[AC]-L2-[AM]-L3-[P] (Scheme V) [WP]-L1-[AM]-L2-[AC]-L3-[P] (Scheme VI) [WP]-L1-[AC]-L2-[AM]-L3-[P] (Scheme VII) [WP]-L1-[AM]-L2-[AC]-L3-[P] (Scheme VIII) wherein, WP is a water-soluble biopolymer moiety (e.g., PEG), AC is an anionic carrier moiety, CC is a cationic carrier moiety, AM is an adjuvant moiety, L1 and L2 are independently optionally selected linkers, L3 is an optionally selected linker that may be cleavable, P is a payload, and also provides cationic and anionic carrier units.

[0110] In some embodiments of the constructs of Schemes I-VIII above, the [WP] component may be linked to at least one targeting moiety, i.e., [T] n -[WP]-…, where n is an integer, e.g., 1, 2, or 3.

[0111] Figure 3 shows a schematic view of the cationic carrier unit of the present disclosure. For simplicity, the unit in Figure 3 is shown linearly. However, in some embodiments, the carrier unit may comprise branched scaffold arrangements (see Figures 4 and 5) having, for example, a polymer CC portion comprising a positively charged unit and an AM bonded at one or more positions along the CC portion, the CC and AM portions being configured. In other embodiments, the CC and AM may be bonded to the scaffold portion as shown in Figure 5.

[0112] In some embodiments, the carrier unit of the present disclosure comprises the following formula: [Chemical formula] A is a targeting moiety, for example, a molecule that targets the LAT1 transporter, B is a cationic polymer block in the cationic carrier moiety, wherein (i) l is an integer from about 1 to about 200, such as about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer from 1 to 150, such as about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150; (iii) n is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200, X is an adjuvant moiety, such as a vitamin, such as [Chemical formula] and Y1 is C, N, O, or S, Y2 is C, N, O, or S, and n is 1 or 2. In some embodiments, X can be -SH (such as a sulfanyl group, an alkanethiol, or an alkylthiol). In some embodiments, the micelles of the present disclosure include a first type of cationic carrier unit conjugated to a vitamin, such as vitamin B3, and a second type of cationic carrier unit conjugated to a sulfanyl group (such as an alkanethiol or an alkylthiol). In some embodiments, the micelles of the present disclosure include a first type of cationic carrier unit conjugated to a vitamin, such as vitamin B3, a second type of cationic carrier unit conjugated to a sulfanyl group (such as an alkanethiol or an alkylthiol), and a third type of cationic carrier unit that is a free base.

[0113] When the cationic carrier unit of the present disclosure is mixed with an anionic payload (e.g., nucleic acid) at an ionic ratio of about 1:about 1, i.e., when the number of negative charges in the anionic payload and the number of positive charges in the cationic carrier moiety are substantially the same, neutralization of the negative charges in the anionic payload by the positive charges in the cationic carrier moiety mainly via electrostatic interactions results in the formation of a cationic carrier unit:anionic payload complex having an invariant hydrophilic moiety (including the WP moiety) and a substantially more hydrophobic moiety (resulting from the association between the cationic carrier moiety + adjuvant moiety and the anionic payload).

[0114] In some embodiments, the adjuvant moiety can provide its positive charge to the positive charge of the cationic carrier moiety that interacts with the negative charge of the anionic payload. It should be understood that reference to the interaction (e.g., electrostatic interaction) between the cationic carrier moiety and the anionic payload also encompasses the interaction between the charge of the adjuvant moiety + cationic carrier moiety and the charge of the anionic payload.

[0115] The increase in the hydrophobicity of the cationic carrier moiety of the cationic carrier unit due to the neutralization of the positive charge by the electrostatic interaction with the negative charge of the anionic payload results in an amphiphilic complex. Such amphiphilic complexes can self-organize into micelles either alone or in combination with other amphiphilic components. The resulting micelles contain the WP moiety facing the solvent (i.e., the WP moiety faces the outer surface of the micelle), but the CC and AM moieties as well as the associated payload (e.g., nucleotide sequences, e.g., oligonucleotides, siRNA, shRNA, "antimiR", or any combination thereof) are present in the center of the micelle.

[0116] In some specific embodiments, the cationic carrier unit is (a) The WP part, where the water-soluble biopolymer is polyethylene glycol (PEG) of formula III (see below), and n is from about 120 to about 130 (for example, PEG is PEG5000 or PEG6000), the WP part, and (b) The CC part, where the cationic carrier part includes, for example, about 30 to about 40 lysines (for example, linear poly(L-lysine) n where n is from about 30 to about 40), polyethyleneimine (PEI), or chitosan, the CC part, and (c) The AM part, where the adjuvant part has from about 5 to about 10 vitamin B3 units (for example, from about 5 to about 10 linked vitamin B3 units), the AM part, and includes.

[0117] In some specific embodiments, the cationic carrier unit is (a) The WP part, where the water-soluble biopolymer is polyethylene glycol (PEG) of formula III (see below), and n is from about 120 to about 130 (for example, PEG is PEG5000 or PEG6000), the WP part, and (b) The CC part, where the cationic carrier part includes, for example, about 60 to about 100 lysines (for example, linear poly(L-lysine) n where n is from about 60 to about 100), for example, about 70 to 90 lysines, about 80 lysines, polyethyleneimine (PEI), or chitosan, the CC part, and (c) The AM part, where the adjuvant part has from about 10 to about 50 vitamin B3 units (for example, from about 10 to about 50 linked vitamin B3 units, for example, from about 20 to 40 units, for example, about 30 units), the AM part, and includes.

[0118] In some embodiments, the cationic carrier unit further comprises at least one targeting moiety attached to the WP portion of the cationic carrier unit. In some embodiments, the number and / or density of targeting moieties presented on the surface of the micelle can be adjusted by using a specific ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties. In some embodiments, the ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.

[0119] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) (e.g., phenylalanine) that targets the transporter LAT1, (ii) a water-soluble polymer that is PEG, (iii) a cationic carrier portion comprising a cationic polymer block that is lysine, and (iv) two or more adjuvant portions that are vitamin B3.

[0120] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) (e.g., phenylalanine) that targets the transporter LAT1, (ii) a water-soluble polymer that is PEG and has n = 100 - 200, e.g., 100 - 150, e.g., 120 - 130, (iii) A cationic carrier moiety containing a cationic polymer block, such as polylysine, and (iv) Two or more adjuvant moieties, such as vitamin B3, are included.

[0121] In some embodiments, the cationic carrier unit is (i) A targeting moiety (A) that targets transporter LAT1 (e.g., phenylalanine), and (ii) a water-soluble polymer that is PEG, where n = 100 to 200, such as 100 to 150, such as 120 to 130, water-soluble polymer, and (iii) A cationic carrier moiety containing a cationic polymer block, such as 10 to 100 lysines, such as 10 to 50 lysines, such as 30 to 40 lysines, such as 70 to 80 lysines, and (iv) Two or more adjuvant moieties, such as vitamin B3, such as 25 to 30 vitamin B3, are included.

[0122] In some embodiments, the cationic carrier unit is (i) A targeting moiety (A) that targets transporter LAT1 (e.g., phenylalanine), and (ii) a water-soluble polymer that is PEG, where n = 100 to 200, such as 100 to 150, such as 120 to 130, water-soluble polymer, and (iii) A cationic carrier moiety containing a cationic polymer block, such as 10 to 100 lysines, such as 10 to 50 lysines, such as 30 to 40 lysines, such as 70 to 80 lysines, and (iv) Two or more adjuvant moieties, such as 5 to 50 vitamin B3, such as 5 to 30 vitamin B3, such as 5 to 20 vitamin B3, such as 5 to 15 vitamin B3, such as 5 to 10 vitamin B3, such as 25 to 30 vitamin B3, are included.

[0123] As illustrated in Scheme I, the CC moiety can be a polymer containing several B units (where each B unit can be, for example, lysine), and the AM moiety can be a discrete molecular entity containing several X units (e.g., vitamin units) covalently attached to the side chain attachment points on the CC moiety. Thus, in certain embodiments, the cationic carrier unit is (i) a targeting moiety (A) (e.g., phenylalanine) targeting the transporter LAT1, and (ii) a water-soluble polymer that is PEG, where n = 120 - 130, (iii) a cationic carrier moiety containing a cationic polymer block of 30 - 40, 40 - 50, 50 - 60, or 70 - 80 B units that are lysine, (iv) an adjuvant moiety of 5 - 10, 10 - 20, 20 - 25, or 25 - 30 X units that are vitamin B3.

[0124] In some embodiments, the cationic carrier unit of the present disclosure interacts with an antisense oligonucleotide payload targeting miR - 485 - 3p, e.g., AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18). In some embodiments, the carrier unit complexed with the payload forms micelles.

[0125] In some embodiments, the vitamin B3 units are introduced into the side chain of the CC moiety by a coupling reaction, for example, between the NH2 group of lysine and the COOH group of vitamin B3, in the presence of suitable conjugation reagents such as 1 - ethyl - 3 - (3 - dimethylaminopropyl) - carbodiimide (EDC) and N - hydroxysuccinimide (NHS).

[0126] The present disclosure provides a composition comprising a carrier unit of the present disclosure (e.g., a cationic carrier unit). In other aspects, the present disclosure provides a complex comprising a carrier unit of the present disclosure (e.g., a cationic carrier unit) non-covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, “antimiR”, or any combination thereof), wherein the carrier unit and the payload interact electrostatically. In other aspects, the present disclosure provides a conjugate comprising a carrier unit of the present disclosure (e.g., a cationic carrier unit) covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, “antimiR”, or any combination thereof), wherein the carrier unit and the payload interact electrostatically. In some aspects, the carrier unit and the payload can be linked by a cleavable linker. In some aspects, in addition to interacting electrostatically, the carrier unit and the payload can interact covalently (e.g., after electrostatic interaction, the carrier unit and the payload can be “locked” by a disulfide bond or a cleavable bond).

[0127] In some particular aspects, the cationic carrier unit comprises a water-soluble polymer comprising PEG having from about 120 to about 130 units, a cationic carrier moiety comprising polylysine having from about 30 to about lysine units, and an adjuvant moiety comprising from about 5 to about 10 vitamin B3 units.

[0128] In some aspects, the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, e.g., an oligonucleotide (e.g., an antisense oligonucleotide), siRNA, shRNA, “antimiR”, or any combination thereof) that interacts with the cationic carrier unit by at least one ionic bond (i.e., by electrostatic interaction with the cationic carrier moiety of the cationic carrier unit).

[0129] In some embodiments, the micelles of the present disclosure can be constructed based on the formula shown in FIG. 6. In some embodiments, the mB / (nA + mB) of the micelles is greater than 0 and less than 1, for example, about 0.25 to about 1, about 0.3 to about 1, about 0.4 to about 1, about 0.5 to about 1, about 0.25 to about 0.9, about 0.3 to about 0.9, about 0.4 to about 0.9, about 0.5 to about 0.9, about 0.25 to about 0.8, about 0.3 to about 0.8, about 0.4 to about 0.8, about 0.5 to about 0.8, about 0.25 to about 0.75, about 0.3 to about 0.75, about 0.4 to about 0.75, about 0.5 to about 0.75, about 0.25 to about 0.7, about 0.3 to about 0.7, about 0.4 to about 0.7, about 0.5 to about 0.7, about 0.25 to about 0.6, about 0.3 to about 0.6, about 0.4 to about 0.6, about 0.5 to about 0.6, about 0.45 to about 0.55, about 0.4 to about 0.65, or about 0.5 to about 0.65, where nA is,

Number

Number

[0130] In some embodiments, the mB / (nA + mB) of the micelles is about 0.4 to about 0.6, about 0.5 to about 0.6, or about 0.4 to about 0.5, where nA is,

Number

Number

Number

Number

[0131] Specific components of the cationic carrier unit of the present disclosure are disclosed in detail below.

[0132] a. Water-soluble biopolymer In some embodiments, the cationic carrier unit of the present disclosure includes at least one water-soluble biopolymer. As used herein, the term "water-soluble biopolymer" refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, such as PEG.

[0133] In some embodiments, the water-soluble polymer includes poly(alkylene glycol), poly(oxyethylated polyol), poly(olefin alcohol), poly(vinyl pyrrolidone), poly(hydroxyalkyl methacrylamide), poly(hydroxyalkyl methacrylate), poly(saccharide), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazoline ("POZ"), poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water-soluble biopolymer is linear, branched, or dendritic.

[0134] In some embodiments, the water-soluble biopolymer includes polyethylene glycol ("PEG"), polyglycerol ("PG"), or poly(propylene glycol) ("PPG"). Since PPG is less toxic than PEG, many current biological formulations are manufactured with PPG instead of PEG.

[0135] In some embodiments, the water-soluble biopolymer has the formula: R 3 -(O-CH2-CH2) n - or R 3 -(0-CH2-CH2) n -O- (wherein R 3is hydrogen, methyl, or ethyl, and n has a value of 2 to 200). It includes PEG characterized by this. In some embodiments, PEG has the following formula, [Chemical formula] wherein n is from 1 to 1000.

[0136] In some embodiments, n of PEG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0137] In some embodiments, n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 570, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,Or about 1000.

[0138] In some embodiments, n is from about 50 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 to about 550, about 550 to about 600, about 600 to about 650, about 650 to about 700, about 700 to about 750, about 750 to about 800, about 800 to about 850, about 850 to about 900, about 900 to about 950, or about 950 to about 1000.

[0139] In some embodiments, n is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0140] In some embodiments, n is from about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0141] In some embodiments, n is from about 100 to about 150. In some embodiments, n is from about 100 to about 140. In some embodiments, n is from about 100 to about 130. In some embodiments, n is from about 110 to about 150. In some embodiments, n is from about 110 to about 140. In some embodiments, n is from about 110 to about 130. In some embodiments, n is from about 110 to about 120. In some embodiments, n is from about 120 to about 150. In some embodiments, n is from about 120 to about 140. In some embodiments, n is from about 120 to about 130. In some embodiments, n is from about 130 to about 150. In some embodiments, n is from about 130 to about 140.

[0142] Thus, in some embodiments, the PEG is branched PEG. Branched PEG has 3 to 10 PEG chains extending from a central core group. In certain embodiments, the PEG moiety is monodisperse polyethylene glycol. In the context of the present disclosure, monodisperse polyethylene glycol (mdPEG) is PEG having a single defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PEG moiety is assigned the abbreviation mdPEG.

[0143] In some embodiments, the PEG is Star PEG. Star PEG has 10 to 100 PEG chains extending from a central core group. In some embodiments, the PEG is Comb PEG. Comb PEG typically has multiple PEG chains grafted onto a polymer backbone.

[0144] In certain embodiments, the PEG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0145] In some embodiments, the PEG is PEG 100 , PEG 200 , PEG 300 , PEG 400 , PEG 500 , PEG 600 , PEG 700 , PEG 800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500, PEG 2600 , PEG 2700 , PEG 2800 , PEG 2900 , PEG 3000 , PEG 3100 , PEG 3200 , PEG 3300 , PEG 3400 , PEG 3500 , PEG 3600 , PEG 3700 , PEG 3800 , PEG 3900 , PEG 4000 , PEG 4100 , PEG 4200 , PEG 4300 , PEG 4400 , PEG 4500 , PEG 4600 , PEG 4700 , PEG 4800 , PEG 4900 , PEG 5000 , PEG 5100 , PEG 5200 , PEG 5300 , PEG 5400 , PEG 5500 , PEG 5600 , PEG 5700 , PEG 5800 , PEG 5900 , PEG 6000 , PEG 6100 , PEG 6200 , PEG 6300 , PEG 6400 , PEG 6500 , PEG 6600 , PEG 6700 , PEG 6800 , PEG 6900 , PEG 7000 , PEG 7100 , PEG 7200 , PEG 7300 , PEG 7400 , PEG 7500 , PEG 7600 , PEG 7700 , PEG 7800 , PEG 7900 , or PEG 8000 is. In some embodiments, PEG is PEG 5000 is. In some embodiments, PEG is PEG6000 It is. In some embodiments, PEG is PEG 4000 is.

[0146] In some embodiments, PEG is monodisperse, for example, mPEG 100 , mPEG 200 , mPEG 300 , mPEG 400 , mPEG 500 , mPEG 600 , mPEG 700 , mPEG 800 , mPEG 900 , mPEG 1000 , mPEG 1100 , mPEG 1200 , mPEG 1300 , mPEG 1400 , mPEG 1500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 2600 , mPEG 2700 , mPEG 2800 , mPEG 2900 , mPEG 3000 , mPEG 3100 , mPEG 3200 , mPEG 3300 , mPEG 3400 , mPEG 3500 , mPEG 3600 , mPEG 3700 , mPEG 3800 , mPEG 3900 , mPEG4000 , mPEG 4100 , mPEG 4200 , mPEG 4300 , mPEG 4400 , mPEG 4500 , mPEG 4600 , mPEG 4700 , mPEG 4800 , mPEG 4900 , mPEG 5000 , mPEG 5100 , mPEG 5200 , mPEG 5300 , mPEG 5400 , mPEG 5500 , mPEG 5600 , mPEG 5700 , mPEG 5800 , mPEG 5900 , mPEG 6000 , mPEG 6100 , mPEG 6200 , mPEG 6300 , mPEG 6400 , mPEG 6500 , mPEG 6600 , mPEG 6700 , mPEG 6800 , mPEG 6900 , mPEG 7000 , mPEG 7100 , mPEG 7200 , mPEG 7300 , mPEG 7400 , mPEG 7500 , mPEG 7600 , mPEG 7700 , mPEG 7800 , mPEG 7900 , or mPEG 8000 is. In some embodiments, mPEG is mPEG 5000 is. In some embodiments, mPEG is mPEG 6000 is. In some embodiments, mPEG is mPEG 4000 is.

[0147] In some embodiments, the water-soluble biopolymer moiety has the formula ((R 3 -O-(CH2-CHOH-CH2O) n-) represented by polyglycerol (PG), where R3 is hydrogen, methyl, or ethyl, and n has a value from 3 to 200. In some embodiments, the water-soluble biopolymer moiety has the formula (R 3 -O-(CH2-CHOR 5 -CH2-O) n -), where R 5 is hydrogen, a branched polyglycerol or a linear glycerol chain represented by the formula (R 3 -O-(CH2-CHOH-CH 2 -O) n -), where R 3 is hydrogen, methyl, or ethyl. In some embodiments, the water-soluble biopolymer moiety has the formula (R 3 -O-(CH2-CHOR 5 -CH2-O) n -), where R 5 is hydrogen, a hyperbranched polyglycerol or a glycerol chain represented by the formula (R 3 -O-(CH2-CHOR 6 -CH2-O) n -), where R 6 is hydrogen, a glycerol chain or a linear glycerol chain represented by the formula (R 3 -O-(CH2-CHOR 7 -CH2-O) n -), where R 7 is hydrogen, a glycerol chain or a linear glycerol chain represented by the formula (R 3 -O-(CH2-CHOH-CH2-O) n -), where R 3 is hydrogen, methyl, or ethyl. Hyperbranched glycerols and methods for their synthesis are described in Oudshorn et al. (2006) Biomaterials 27:5471-5479; Wilms et al. (2010) Acc. Chem. Res. 43, 129-41, and references cited therein.

[0148] In certain embodiments, PG has a molar mass of from about 1000 g / mol to about 2000 g / mol, from about 2000 g / mol to about 3000 g / mol, from about 3000 g / mol to about 4000 g / mol, from about 4000 g / mol to about 5000 g / mol, from about 5000 g / mol to about 6000 g / mol, from about 6000 g / mol to about 7000 g / mol, or from 7000 g / mol to about 8000 g / mol.

[0149] In some embodiments, PG is PG 100 PG 200 PG 300 PG 400 PG 500 PG 600 PG 700 PG 800 PG 900 PG 1000 PG 1100 PG 1200 PG 1300 PG 1400 PG 1500 PG 1600 PG 1700 PG 1800 PG 1900 PG 2000 PG 2100 PG 2200 PG 2300 PG 2400 PG 2500 PG 1600 PG 1700 PG 1800 PG 1900 PG 2000 PG 2100 PG 2200 PG 2300 PG 2400 PG 2500 PG 2600 PG 2700 PG 2800 PG 2900 PG 3000 PG 3100 PG 3200 PG 3300 PG 3400 PG 3500 PG 3600 PG 3700 PG 3800, PG 3900 , PG 4000 , PG 4100 , PG 4200 , PG 4300 , PG 4400 , PG 4500 , PG 4600 , PG 4700 , PG 4800 , PG 4900 , PG 5000 , PG 5100 , PG 5200 , PG 5300 , PG 5400 , PG 5500 , PG 5600 , PG 5700 , PG 5800 , PG 5900 , PG 6000 , PG 6100 , PG 6200 , PG 6300 , PG 6400 , PG 6500 , PG 6600 , PG 6700 , PG 6800 , PG 6900 , PG 7000 , PG 7100 , PG 7200 , PG 7300 , PG 7400 , PG 7500 , PG 7600 , PG 7700 , PG 7800 , PG 7900 , or PG 8000 is. In some embodiments, PG is PG 5000 is. In some embodiments, PG is PG 6000 is. In some embodiments, PG is PG 4000 is.

[0150] In some embodiments, PG is monodisperse, e.g., mPG 100 , mPG 200 , mPG 300 , mPG 400 , mPG 500 , mPG 600 , mPG 700 , mPG 800 , mPG 900 , mPG1000 , mPG 1100 , mPG 1200 , mPG 1300 , mPG 1400 , mPG 1500 , mPG 1600 , mPG 1700 , mPG 1800 , mPG 1900 , mPG 2000 , mPG 2100 , mPG 2200 , mPG 2300 , mPG 2400 , mPG 2500 , mPG 1600 , mPG 1700 , mPG 1800 , mPG 1900 , mPG 2000 , mPG 2100 , mPG 2200 , mPG 2300 , mPG 2400 , mPG 2500 , mPG 2600 , mPG 2700 , mPG 2800 , mPG 2900 , mPG 3000 , mPG 3100 , mPG 3200 , mPG 3300 , mPG 3400 , mPG 3500 , mPG 3600 , mPG 3700 , mPG 3800 , mPG 3900 , mPG 4000 , mPG 4100 , mPG 4200 , mPG 4300 , mPG 4400 , mPG 4500 , mPG 4600 , mPG 4700 , mPG 4800 , mPG 4900 , mPG 5000 , mPG 5100 , mPG 5200 , mPG 5300 , mPG 5400 , mPG 5500 , mPG 5600 , mPG 5700 , mPG 5800 , mPG5900 , mPG 6000 , mPG 6100 , mPG 6200 , mPG 6300 , mPG 6400 , mPG 6500 , mPG 6600 , mPG 6700 , mPG 6800 , mPG 6900 , mPG 7000 , mPG 7100 , mPG 7200 , mPG 7300 , mPG 7400 , mPG 7500 , mPG 7600 , mPG 7700 , mPG 7800 , mPG 7900 , or mPG 8000 is.

[0151] In some embodiments, the water-soluble biopolymer comprises poly(propylene glycol) ("PPG"). In some embodiments, PPG is characterized by the following formula, where n has a value from 1 to 1000: [Chemical formula]

[0152] In some embodiments, n of the PPG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0153] In some embodiments, n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,or about 1000.

[0154] In some embodiments, n of the PPG is from about 50 to about 100, from about 100 to about 150, from about 150 to about 200, from about 200 to about 250, from about 250 to about 300, from about 300 to about 350, from about 350 to about 400, from about 400 to about 450, from about 450 to about 500, from about 500 to about 550, from about 550 to about 600, from about 600 to about 650, from about 650 to about 700, from about 700 to about 750, from about 750 to about 800, from about 800 to about 850, from about 850 to about 900, from about 900 to about 950, or from about 950 to about 1000.

[0155] In some embodiments, n of the PPG is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0156] In some embodiments, the n of the PPG is from about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0157] Thus, in some embodiments, the PPG is a branched PPG. The branched PPG has 3 to 10 PPG chains extending from a central core group. In certain embodiments, the PPG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, monodisperse polyethylene glycol (mdPPG) is a PPG having a single defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PPG moiety is assigned the abbreviation mdPPG.

[0158] In some embodiments, the PPG is a Star PPG. The Star PPG has 10 to 100 PPG chains extending from a central core group. In some embodiments, the PPG is a Comb PPG. The Comb PPG typically has multiple PPG chains grafted onto a polymer backbone.

[0159] In certain embodiments, the PPG has a molar mass of from about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0160] In some embodiments, the PPG is PPG 100 、PPG200 、PPG 300 、PPG 400 、PPG 500 、PPG 600 、PPG 700 、PPG 800 、PPG 900 、PPG 1000 、PPG 1100 、PPG 1200 、PPG 1300 、PPG 1400 、PPG 1500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 2600 、PPG 2700 、PPG 2800 、PPG 2900 、PPG 3000 、PPG 3100 、PPG 3200 、PPG 3300 、PPG 3400 、PPG 3500 、PPG 3600 、PPG 3700 、PPG 3800 、PPG 3900 、PPG 4000 、PPG 4100 、PPG 4200 、PPG 4300 、PPG 4400 、PPG 4500 、PPG 4600 、PPG 4700 、PPG 4800 、PPG 4900 、PPG 5000 、PPG5100 , PPG 5200 , PPG 5300 , PPG 5400 , PPG 5500 , PPG 5600 , PPG 5700 , PPG 5800 , PPG 5900 , PPG 6000 , PPG 6100 , PPG 6200 , PPG 6300 , PPG 6400 , PPG 6500 , PPG 6600 , PPG 6700 , PPG 6800 , PPG 6900 , PPG 7000 , PPG 7100 , PPG 7200 , PPG 7300 , PPG 7400 , PPG 7500 , PPG 7600 , PPG 7700 , PPG 7800 , PPG 7900 , or PPG 8000 is. In some embodiments, PPG is PPG 5000 is. In some embodiments, PPG is PPG 6000 is. In some embodiments, PPG is PPG 4000 is.

[0161] In some embodiments, PPG is monodisperse, for example, mPPG 100 , mPPG 200 , mPPG 300 , mPPG 400 , mPPG 500 , mPPG 600 , mPPG 700 , mPPG 800 , mPPG 900 , mPPG 1000 , mPPG 1100 , mPPG 1200 , mPPG 1300 , mPPG 1400 , mPPG 1500 , mPPG 1600 , mPPG 1700 , mPPG 1800, mPPG 1900 , mPPG 2000 , mPPG 2100 , mPPG 2200 , mPPG 2300 , mPPG 2400 , mPPG 2500 , mPPG 1600 , mPPG 1700 , mPPG 1800 , mPPG 1900 , mPPG 2000 , mPPG 2100 , mPPG 2200 , mPPG 2300 , mPPG 2400 , mPPG 2500 , mPPG 2600 , mPPG 2700 , mPPG 2800 , mPPG 2900 , mPPG 3000 , mPPG 3100 , mPPG 3200 , mPPG 3300 , mPPG 3400 , mPPG 3500 , mPPG 3600 , mPPG 3700 , mPPG 3800 , mPPG 3900 , mPPG 4000 , mPPG 4100 , mPPG 4200 , mPPG 4300 , mPPG 4400 , mPPG 4500 , mPPG 4600 , mPPG 4700 , mPPG 4800 , mPPG 4900 , mPPG 5000 , mPPG 5100 , mPPG 5200 , mPPG 5300 , mPPG 5400 , mPPG 5500 , mPPG 5600 , mPPG 5700 , mPPG 5800 , mPPG 5900 , mPPG 6000 , mPPG 6100 , mPPG 6200 , mPPG 6300 , mPPG6400 , mPPG 6500 , mPPG 6600 , mPPG 6700 , mPPG 6800 , mPPG 6900 , mPPG 7000 , mPPG 7100 , mPPG 7200 , mPPG 7300 , mPPG 7400 , mPPG 7500 , mPPG 7600 , mPPG 7700 , mPPG 7800 , mPPG 7900 , or mPPG 8000 is. In some embodiments, mPPG is mPPG 5000 is. In some embodiments, mPPG is mPPG 6000 is. In some embodiments, mPPG is mPPG 4000 is.

[0162] b. Cationic carrier In some embodiments, the cationic carrier unit of the present disclosure comprises at least one cationic carrier moiety. The term "cationic carrier" refers to a part or portion of the cationic carrier unit of the present disclosure that contains a plurality of positive charges capable of electrostatically interacting with and binding to an anionic payload (or anionic carrier bound to the payload). In some embodiments, the number of positive charges or positively charged groups of the cationic carrier is comparable to the number of negative charges or negatively charged groups of the anionic payload (or anionic carrier bound to the payload). In some embodiments, the cationic carrier comprises a biopolymer, such as a peptide (e.g., polylysine).

[0163] In some embodiments, the cationic carrier comprises one or more basic amino acids (e.g., lysine, arginine, histidine, or combinations thereof). In some embodiments, the cationic carrier comprises at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about 74, at least about 75, at least about 76, at least about 77, at least about 78, at least about 79, at least about 80 basic amino acids, e.g., lysine, arginine, or combinations thereof.

[0164] In some embodiments, the cationic carrier unit comprises at least about 40 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 45 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 50 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 55 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 60 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 65 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 70 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 75 basic amino acids, such as lysine. In some embodiments, the cationic carrier unit comprises at least about 80 basic amino acids, such as lysine.

[0165] In some embodiments, the cationic carrier unit comprises from about 30 to about 1000, from about 30 to about 900, from about 30 to about 800, from about 30 to about 700, from about 30 to about 600, from about 30 to about 500, from about 30 to about 400, from about 30 to about 300, from about 30 to about 200, from about 30 to about 100, from about 40 to about 1000, from about 40 to about 900, from about 40 to about 800, from about 40 to about 700, from about 40 to about 600, from about 40 to about 500, from about 40 to about 400, from about 40 to about 300, from about 40 to about 200, or from about 40 to about 100 basic amino acids, such as lysine.

[0166] In some embodiments, the cationic carrier unit comprises from about 30 to about 100, from about 30 to about 90, from about 30 to about 80, from about 30 to about 70, from about 30 to about 60, from about 30 to about 50, from about 30 to about 40, from about 40 to about 100, from about 40 to about 90, from about 40 to about 80, from about 40 to about 70, from about 40 to about 60, from about 70 to about 80, from about 75 to about 85, from about 65 to about 75, from about 65 to about 80, from about 60 to about 85, or from about 40 to about 500 basic amino acids, such as lysine.

[0167] In some embodiments, the cationic carrier unit comprises a basic amino acid, such as lysine, having from about 100 to about 1000, from about 100 to about 900, from about 100 to about 800, from about 100 to about 700, from about 100 to about 600, from about 100 to about 500, from about 100 to about 400, from about 100 to about 300, from about 100 to about 200, from about 200 to about 1000, from about 200 to about 900, from about 200 to about 800, from about 200 to about 700, from about 200 to about 600, from about 200 to about 500, from about 200 to about 400, from about 200 to about 300, from about 300 to about 1000, from about 300 to about 900, from about 300 to about 800, from about 300 to about 700, from about 300 to about 600, from about 300 to about 500, from about 300 to about 400, from about 400 to about 1000, from about 400 to about 900, from about 400 to about 800, from about 400 to about 700, from about 400 to about 600, from about 400 to about 500, from about 500 to about 1000, from about 500 to about 900, from about 500 to about 800, from about 500 to about 700, from about 500 to about 600, from about 600 to about 1000, from about 600 to about 900, from about 600 to about 800, from about 600 to about 700, from about 700 to about 1000, from about 700 to about 900, from about 700 to about 800, from about 800 to about 1000, from about 800 to about 900, or from about 900 to about 1000 basic amino acid units.

[0168] In some embodiments, the number of basic amino acids, such as lysine, arginine, histidine, or combinations thereof, can be adjusted based on the length of the anionic payload. For example, an anionic payload having a longer sequence can be combined with a greater number of basic amino acids (e.g., lysine). In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to phosphate in the anionic payload, such as an oligonucleotide, such as an antimiR, is about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3. In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to phosphate in the anionic payload, such as an oligonucleotide, such as an antimiR, is about 1.3 to about 1.7, such as about 1.5. In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to phosphate in the anionic payload, such as an oligonucleotide, such as an antimiR, is about 1.4. In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to phosphate in the anionic payload, such as an oligonucleotide, such as an antimiR, is about 1.6. In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to phosphate in the anionic payload, such as an oligonucleotide, such as an antimiR, is about 1.3.In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit is calculated such that the molar ratio (N / P) of protonated amines in the polymer to anionic payloads, such as oligonucleotides, such as antimiRs, is about 1.7.

[0169] One of ordinary skill in the art will understand that in some embodiments (e.g., when the payload is a nucleic acid such as an antimiR), the role of the cationic carrier moiety is to neutralize the negative charge of the payload (e.g., the negative charge in the phosphate backbone of an antisense oligonucleotide) by electrostatic interaction, and thus the length of the cationic carrier, the number of positively charged groups of the cationic carrier, as well as the distribution and arrangement of the charges present in the cationic carrier, depend on the length and charge distribution of the payload molecule.

[0170] In other embodiments, for example, when the payload is a plurality of small molecules (e.g., anionic small molecule drugs), the length of the cationic carrier and the number of positively charged groups of the cationic carrier correlate with the desired payload. For example, the number of small molecule drugs transported by the cationic carrier unit of the present disclosure will depend on the number of charges in the cationic carrier moiety.

[0171] In some embodiments, the cationic carrier comprises from about 5 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, or about 75 to about 80 basic amino acids. In some particular embodiments, the positively charged carrier comprises from about 30 to about 50 basic amino acids. In some particular embodiments, the positively charged carrier comprises from about 70 to about 80 basic amino acids.

[0172] In some embodiments, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some embodiments, the basic amino acid is a D-amino acid. In some embodiments, the basic amino acid is an L-amino acid. In some embodiments, the positively charged carrier comprises D-amino acids and L-amino acids. In some embodiments, the basic amino acid comprises at least one non-natural amino acid or a derivative thereof. In some embodiments, the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidino-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4-aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4-guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolidine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof. In certain embodiments, the positively charged carrier comprises about 40 lysines. In certain embodiments, the positively charged carrier comprises about 50 lysines. In certain embodiments, the positively charged carrier comprises about 60 lysines. In certain embodiments, the positively charged carrier comprises about 70 lysines. In certain embodiments, the positively charged carrier comprises about 80 lysines.

[0173] In other embodiments, the cationic carrier is an alkyl chain containing at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 67, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups), for example, C3-C 50 comprises. In some embodiments, the cationic carrier is an alkyl chain containing about 5 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, or about 75 to about 80 cationic groups (e.g., amino groups), for example, C3-C 50 comprises. In some specific embodiments, the cationic carrier is an alkyl chain containing 30 to about 50 cationic groups (e.g., amino groups), for example, C3-C 50It includes. In some specific embodiments, the cationic carrier is an alkyl chain containing 70 to about 80 cationic groups (e.g., amino groups), such as C3 to C 50 It includes.

[0174] In other embodiments, the cationic carrier comprises a polymer or copolymer comprising at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups). In some embodiments, the cationic carrier comprises a polymer or copolymer comprising from about 5 to about 10 cationic groups, from about 10 to about 15 cationic groups, from about 15 to about 20 cationic groups, from about 20 to about 25 cationic groups, from about 25 to about 30 cationic groups, from about 30 to about 35 cationic groups, from about 35 to about 40 cationic groups, from about 40 to about 45 cationic groups, from about 45 to about 50 cationic groups, from about 50 to about 55 cationic groups, from about 55 to about 60 cationic groups, from about 60 to about 65 cationic groups, from about 65 to about 70 cationic groups, from about 70 to about 75 cationic groups, or from about 45 to about 50 cationic groups (e.g., amino groups).In some specific embodiments, the cationic carrier comprises a polymer or copolymer containing 30 to about 50 cationic groups (e.g., amino groups). In some specific embodiments, the cationic carrier comprises a polymer or copolymer containing 70 to about 80 cationic groups (e.g., amino groups). In some embodiments, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide.

[0175] In some embodiments, the cationic carrier moiety binds to a single payload molecule. In other embodiments, the cationic carrier moiety can bind to a plurality of payload molecules, which can be the same or different.

[0176] In some embodiments, the positive charge of the cationic carrier moiety and the negative charge of the nucleic acid payload are in an ionic ratio of about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, or about 1:3. In some embodiments, the positive charge of the cationic carrier moiety and the negative charge of the nucleic acid payload are in a charge ratio of 1:1. In some embodiments, the positive charge of the cationic carrier moiety and the negative charge of the nucleic acid payload are in a charge ratio of 3:2. In some embodiments, the positive charge of the cationic carrier moiety and the negative charge of the nucleic acid payload are in a charge ratio of 2:3.

[0177] In some embodiments, the carrier unit of the present disclosure comprises the following formula:

Chemical formula

Chemical formula

[0178] In some embodiments, the carrier unit of the present disclosure includes the following formula:

Chemical formula

[0179] In some embodiments, the cationic carrier moiety has a free end, where the end group is a reactive group. In some embodiments, the cationic carrier moiety has a free end (e.g., the C-terminus in a polylysine cationic carrier moiety), where the end group is an amino (-NH2) group. In some embodiments, the cationic carrier moiety has a free end, where the end group is a sulfhydryl group. In some embodiments, the reactive group of the cationic carrier moiety is bound to an adjuvant moiety, such as a vitamin B3 adjuvant moiety.

[0180] c. Adjuvant moiety In some embodiments, the cationic carrier unit of the present disclosure includes at least one adjuvant moiety. As used herein, the term "adjuvant moiety" refers to a molecular entity that can, for example, (i) supplement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and / or prophylactic agent in a target tissue or target cell, (iv) facilitate the transport of the cationic carrier unit across physiological barriers such as the BBB and / or the plasma membrane, (v) improve the homeostasis of the target tissue or target cell, (vi) provide a positively charged group to the cationic carrier moiety, or (vii) be any combination thereof.

[0181] In some embodiments, the adjuvant moiety can modulate, for example, an immune response, an inflammatory response, or the tissue microenvironment.

[0182] In some embodiments, the adjuvant moiety that can modulate an immune response can include, for example, tyrosine or dopamine. Tyrosine can be converted to L-DOPA and then to dopamine by a two-step enzymatic reaction. Typically, dopamine levels are low in patients with Parkinson's disease. Thus, in some embodiments, tyrosine is an adjuvant moiety in the cationic carrier unit used for the treatment of Parkinson's disease. Tryptophan can be converted to serotonin, a neurotransmitter thought to play a role in appetite, mood, as well as motor, cognitive, and autonomic functions. Thus, in some embodiments, the cationic carrier unit of the present disclosure used for the treatment of a disease or condition associated with low serotonin levels includes tryptophan as an adjuvant moiety.

[0183] In some embodiments, the adjuvant moiety can modulate the tumor microenvironment in a subject having a tumor, for example, by inhibiting or reducing the hypoxic state in the tumor microenvironment.

[0184] In some embodiments, the adjuvant moiety includes, for example, an imidazole derivative, an amino acid, a vitamin, or any combination thereof.

[0185] In some embodiments, the adjuvant moiety is an imidazole derivative including the following formula,

Chemical formula

[0186] In some embodiments, the adjuvant moiety includes nitroimidazole. Nitroimidazole functions as an antibiotic. The nitroheterocycle in nitroimidazole can be reductively activated in hypoxic cells and then undergo redox cycling or decompose into cytotoxic products. Since reduction usually occurs only in anaerobic bacteria or anoxic tissues, its effect on those human cells or aerobic bacteria is relatively small. In some embodiments, the adjuvant moiety includes metronidazole, tinidazole, nimorazole, dimetridazole, pretramide, ornidazole, megazol, azanidazole, benznidazole, nitroimidazole, or any combination thereof.

[0187] In some embodiments, the adjuvant moiety includes an amino acid. In some embodiments, the adjuvant moiety includes the following formula,

Chemical formula

Chemical formula

[0188] In some embodiments, the adjuvant moiety can inhibit or reduce an inflammatory response.

[0189] In some embodiments, the adjuvant moiety is a vitamin. In some embodiments, the vitamin comprises a cyclic ring or a cyclic hetero atom ring and a carboxyl group or a hydroxyl group. In some embodiments, the vitamin comprises the following formula: [Chemical formula] wherein each of Y1 and Y2 is C, N, O, or S, and n is 1 or 2.

[0190] In some embodiments, the vitamin is selected from the group consisting of vitamin A (retinol), vitamin B1 (thiamine chloride), vitamin B2 (riboflavin), vitamin B3 (niacinamide), vitamin B6 (pyridoxal), vitamin B7 (biotin), vitamin B9 (folic acid), vitamin B12 (cobalamin), vitamin C (ascorbic acid), vitamin D2, vitamin D3, vitamin E (tocopherol), vitamin M, vitamin H, derivatives thereof, and any combination thereof.

[0191] In some embodiments, the vitamin is the following vitamin B3 (also known as niacin or nicotinic acid). [Chemical formula]

[0192] In some embodiments, the adjuvant moiety comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 vitamin B3. In some embodiments, the adjuvant moiety comprises about 10 vitamin B3. In some embodiments, the adjuvant moiety comprises about 7 vitamin B3. In some embodiments, the adjuvant moiety comprises about 8 vitamin B3. In some embodiments, the adjuvant moiety comprises about 9 vitamin B3. In some embodiments, the adjuvant moiety comprises about 10 vitamin B3. In some embodiments, the adjuvant moiety comprises about 11 vitamin B3. In some embodiments, the adjuvant moiety comprises about 12 vitamin B3. In some embodiments, the adjuvant moiety comprises about 13 vitamin B3. In some embodiments, the adjuvant moiety comprises about 14 vitamin B3. In some embodiments, the adjuvant moiety comprises about 15 vitamin B3. In some embodiments, the adjuvant moiety comprises about 20 vitamin B3. In some embodiments, the adjuvant moiety comprises about 25 vitamin B3. In some embodiments, the adjuvant moiety comprises about 30 vitamin B3.

[0193] In some embodiments, the adjuvant moiety comprises from about 5 to about 10 vitamin B3, from about 10 to about 15 vitamin B3, from about 15 to about 20 vitamin B3, from about 20 to about 25 vitamin B3, from about 25 to about 30 vitamin B3, from about 30 to about 35 vitamin B3, from about 35 to about 40 vitamin B3, from about 40 to about 45 vitamin B3, from about 45 to about 50 vitamin B3. In some embodiments, the adjuvant moiety comprises from about 10 to about 20 vitamin B3, from about 20 to about 30 vitamin B3, from about 30 to about 40 vitamin B3, from about 40 to about 50 vitamin B3, from about 5 to about 15 vitamin B3, from about 15 to about 25 vitamin B3, from about 25 to about 35 vitamin B3, from about 35 to about 45 vitamin B3, from about 45 to about 55 vitamin B3.

[0194] Niacin is a precursor of the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) in vivo. NAD is converted to NADP by phosphorylation in the presence of the enzyme NAD+ kinase. NADP and NAD are coenzymes for numerous dehydrogenases involved in a number of hydrogen transfer processes. NAD is important for the catabolism of fats, carbohydrates, proteins, and alcohol, as well as cell signaling and DNA repair, and NADP is important mainly for anabolic reactions, such as fatty acid and cholesterol synthesis. Organs with high energy requirements (brain) or high metabolic turnover rates (gastrointestinal tract, skin) are usually the most sensitive to their deficiencies.

[0195] Niacin produces a significant anti-inflammatory effect through the activation of NIACR1 in various tissues, including brain, gastrointestinal tract, skin, and vascular tissue. Niacin has been shown to attenuate neuroinflammation and may be effective in the treatment of neuroimmune disorders such as multiple sclerosis and Parkinson's disease. Offermanns & Schwaninger (2015) Trends in Molecular Medicine 21:245-266; Chai et al(2013)Current Atherosclerosis Reports 15:325; Graff et al. (2016) Metabolism 65:102-13; and Wakade & Chong(2014)Journal of the Neurological Sciences 347:34-8 (which are hereby incorporated by reference in their entirety).

[0196] In some embodiments, the carrier unit of the present disclosure includes the following formula, [Chemical formula] wherein X is vitamin B3, A is a targeting moiety, B is a cationic carrier moiety, such as lysine, wherein, (i) l is an integer from about 1 to about 200, such as about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200, (ii) m is an integer from 1 to 150, such as about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, (iii) n is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200.

[0197] In some embodiments, the carrier unit of the present disclosure includes the following formula: [Chemical formula] wherein X is vitamin B3, A is a targeting moiety, B is a cationic carrier moiety, such as lysine, wherein, (i) l is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200; (ii) m is an integer from 1 to 150, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, or from about 140 to about 150; (iii) k is an integer from 1 to 150, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, or from about 140 to about 150. (iii) n is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200, and X1 is

Chemical formula

Chemical formula

[0198] d. Targeting moiety In some embodiments, the cationic carrier unit comprises a targeting moiety optionally linked to a water-soluble polymer by a linker. As used herein, the term "targeting moiety" refers to a biorecognition molecule that binds to a specific biomolecule or site. In some embodiments, the targeting moiety is specific for a particular target molecule (e.g., a ligand targeting a receptor or an antibody targeting a surface protein), specific for a tissue (e.g., a molecule that preferentially transports micelles to a specific organ or tissue, such as the liver, brain, or endothelium), or promotes transport through a physiological barrier (e.g., a peptide or other molecule that can promote transport through the blood-brain barrier or the plasma membrane).

[0199] To target a payload (e.g., a nucleotide molecule, e.g., an antisense oligonucleotide that binds to a microRNA) according to the present disclosure, the targeting moiety can be linked to a cationic carrier unit, whereby it can be linked to the outer surface of the micelle, while the micelle has a payload encapsulated within its core.

[0200] In some embodiments, the targeting moiety is a targeting moiety that can target the micelles of the present disclosure to a tissue. In some embodiments, the tissue is the liver, brain, kidney, lung, ovary, pancreas, thyroid, chest, stomach, or any combination thereof. In some embodiments, the tissue is a cancerous tissue, e.g., liver cancer, brain cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.

[0201] In certain embodiments, the tissue is the liver. In certain embodiments, the targeting moiety that targets the liver is cholesterol. In other embodiments, the targeting moiety that targets the liver is a ligand that binds to an asialoglycoprotein receptor targeting moiety. In some embodiments, the asialoglycoprotein receptor targeting moiety comprises a GalNAc cluster. In some embodiments, the GalNAc cluster is a monovalent, divalent, trivalent, or tetravalent GalNAc cluster.

[0202] In another embodiment, the tissue is the pancreas. In some embodiments, the targeting moiety that targets the pancreas comprises a ligand that targets the αvβ3 integrin receptor on pancreatic cells. In some embodiments, the targeting moiety comprises an arginylglycylaspartic acid (RGD) peptide sequence (L-arginyl-glycyl-L-aspartic acid, Arg-Gly-Asp).

[0203] In some embodiments, the tissue is tissue of the central nervous system, such as neural tissue. In some embodiments, the targeted moiety that targets the central nervous system can be transported by the large neutral amino acid transporter 1 (LAT1). LAT1 (SLC7A5) is a transporter for the uptake of both large neutral amino acids and some pharmaceuticals. LAT1 can transport drugs such as L-dopa or gabapentin.

[0204] In some embodiments, the targeted moiety can bind to the glucose transporter 1 (or GLUT1) and includes glucose, such as D-glucose, that can pass through the BBB. GLUT1, also known as solute carrier family 2 facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein encoded by the SLC2A1 gene in humans. GLUT1 facilitates the transport of glucose across the plasma membrane of mammalian cells. This gene encodes the major glucose transporter at the blood-brain barrier of mammals.

[0205] In some embodiments, the targeted moiety includes galactose (such as D-galactose) that can bind to the GLUT1 transporter and pass through the BBB. In some embodiments, the targeted moiety includes glutamate that can bind to an acetylcholinesterase inhibitor (AChEI) and / or an EAAT inhibitor and pass through the BBB. Acetylcholinesterase is an enzyme that is a major member of the cholinesterase enzyme family. An acetylcholinesterase inhibitor (AChEI) is an inhibitor that inhibits acetylcholinesterase from degrading acetylcholine into choline and acetic acid, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia, and neuromuscular junctions, where acetylcholine receptors are abundant. Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors, the other being butyrylcholinesterase inhibitors.

[0206] In some embodiments, the targeting moiety is GABA, which can bind to a GABA receptor and cross the BBB. The GABA receptor is a class of receptors that respond to the neurotransmitter γ-aminobutyric acid (GABA), which is the major inhibitory compound in the central nervous system of mature vertebrates. There are two classes of GABA receptors, namely GABAA and GABAB. The GABAA receptor is a ligand-gated ion channel (also known as an ion channel-type receptor), while the GABAB receptor is a G-protein coupled receptor, also referred to as a metabotropic receptor.

[0207] In some embodiments, the targeting moiety contains tyrosine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety contains lysine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety contains glutamine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety contains phenylalanine that can bind to a GABA receptor, LAT1, a CNS reverse transcriptase inhibitor, and / or a dopamine (DA) receptor and cross the BBB. The dopamine receptor is a class of G-protein coupled receptors that are prominent in the vertebrate central nervous system (CNS). The dopamine receptor activates different effectors not only by G-protein coupling but also by signal transduction through interactions with different proteins (dopamine receptor-interacting proteins). The neurotransmitter dopamine is the major endogenous ligand of the dopamine receptor.

[0208] Dopamine receptors are thought to be involved in a number of neural processes, including motivation, pleasure, cognition, memory, learning, and fine motor control, as well as the regulation of neuroendocrine signaling. Abnormal dopamine receptor signaling and dopaminergic neural function have been associated with several neuropsychiatric disorders. Thus, dopamine receptors are a common target for neuropharmacological agents, with antipsychotics often being dopamine receptor antagonists, while psychostimulants are typically indirect agonists of dopamine receptors.

[0209] In some embodiments, the targeting moiety comprises valine, which can bind to a CNS reverse transcriptase inhibitor and can cross the BBB. In some embodiments, the targeting moiety comprises tryptophan, which can bind to a GABA receptor and / or a CNS reverse transcriptase inhibitor and can cross the BBB. In some embodiments, the targeting moiety comprises leucine, which can bind to a GABA receptor and / or a CNS reverse transcriptase inhibitor and can cross the BBB. In some embodiments, the targeting moiety comprises methionine, which can bind to a GABA receptor and / or a CNS reverse transcriptase inhibitor and can cross the BBB. In some embodiments, the targeting moiety comprises histidine, which can bind to a GABA receptor and can cross the BBB. In some embodiments, the targeting moiety comprises isoleucine, which can bind to a CNS reverse transcriptase inhibitor and can cross the BBB. In some embodiments, the targeting moiety comprises glutathione, which can bind to a GSH transporter and can cross the BBB. In some embodiments, the targeting moiety comprises glutathione-Met, which can bind to a GSH transporter and can cross the BBB. In some embodiments, the targeting moiety comprises urea / thiourea, which can bind to nitric oxide synthase (NOS) and can bind to the BBB. In some embodiments, the targeting moiety comprises NAD+ / NADH, which can cross the BBB by a redox mechanism. In some embodiments, the targeting moiety comprises purine and can cross the BBB. Additional examples of targeting moieties for CNS targeting are shown in Sutera et al. (2016): Small endogenous molecules as moiety to improve targeting of CNS drugs, Expert Opinion on Drug Delivery, DOI: 10.1080 / 17425247.2016.1208651, which is hereby incorporated by reference in its entirety.

[0210] In some embodiments, the tissue targeted by the targeting moiety is skeletal muscle. In some embodiments, the targeting moiety targeting skeletal muscle can be transported by the large neutral amino acid transporter 1 (LAT1).

[0211] LAT1 is expressed in a number of cell types including T cells, cancer cells, and brain endothelial cells. LAT1 is constitutively expressed at high levels in brain microvascular endothelial cells. Since solute transporters are mainly present in the BBB, targeting of the micelles of the present disclosure to LAT1 enables delivery through the BBB. In some embodiments, the targeting moiety that targets the micelles of the present disclosure to the LAT1 transporter is an amino acid, for example, a branched-chain or aromatic amino acid. In some embodiments, the amino acid is valine, leucine, and / or isoleucine. In some embodiments, the amino acid is tryptophan and / or tyrosine. In some embodiments, the amino acid is tryptophan. In other embodiments, the amino acid is tyrosine.

[0212] In some embodiments, the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-dopa, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, asybin, leucine, BCH, methionine, histidine, valine, or any combination thereof.

[0213] In some embodiments, the LAT1 ligand is, as shown below, [1] l-phenylalanine, [2] o-sarcosine, [3] m-sarcosine, [4] melphalan, [5] 2-amino-2-norbornanecarboxylic acid (BCH), [6] (±)-2-amino-1,2,3,4-tetrahydro-2-naphthoic acid, [7] dl-2-NAM-5, [8] dl-2-NAM-6, [9] dl-2-NAM-7,

[10] dl-2-NAM-8,

[11] dl-dechloro NAM,

[12] dl-1-NAM-7,

[13] (±)-2-aminoindane-2-carboxylic acid,

[14] (±)-2-aminobenzobicyclo-[2.2.1]heptane-2'-exo-carboxylic acid,

[15] (±)-2-amino-(bis-2-chloroethyl)-5-aminoindane-2-carboxylic acid,

[16] (±)-2-end-amino-bis(2-chloroethyl)-7'-aminobenzobicyclo[2.2.1]heptane-2-exo-carboxylic acid,

[17] l-6-diazo-5-oxo-norleucine (l-DON),

[18] acivicin,

[19] azaserine,

[20] buthionine sulfoximine (BSO),

[21] l-1-naphthylalanine,

[22] o-benzyl-l-tyrosine,

[23] l-2-aminononanoic acid,

[24] l-tyrosine,

[25] α-methyltyrosine,

[26] l-DOPA,

[27] α-methyldopa,

[28] 3-o-methyldopa,

[29] droxidopa,

[30] carbidopa,

[31] dopamine,

[32] tyramine,

[33] α-methylphenylalanine,

[34] N-methylphenylalanine,

[35] phenylalanine methyl ester,

[36] gabapentin,

[37] 3,3'-diiodothyronine,

[38] l-T3,

[39] 3',5',3-triiodothyronine (reverse l-T3), or

[40] l-T4, or any combination thereof.

Chemical formula

Chemical formula

[0214] In some embodiments, the LAT1 ligand is an LAT1-targeted prodrug as shown below. [Chemical formula] Or any combination thereof.

[0215] Singh & Ecker (2018) “Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1,” Int. J. Mol. Sci. 19:1278; Geier et al. (2013) “Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1,” Proc. Natl. Acad. Sci. USA 110:5480-85; and Chien et al. (2018) “Reevaluating the Substrate Specificity of the L-type Amino Acid Transporter (LAT1),” J. Med. Chem. 61:7358-73 (which are hereby incorporated by reference in their entireties).

[0216] In some embodiments, the carrier unit of the present disclosure includes the following formula, [Chemical formula] wherein A is tryptophan or phenylalanine, and B is a cationic carrier moiety, for example, lysine, wherein, (i) l is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200, (ii) m is an integer from 1 to 150, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, (iii) n is an integer from about 1 to about 200, such as from about 2 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200, X is

Chemical formula

[0217] In some embodiments, the carrier unit of the present disclosure includes the following formula,

Chemical formula

Chem.

Chem.

[0218] Non-limiting examples of the targeting moiety are described below.

[0219] i. Ligand A ligand functions as a type of targeting moiety defined as a selectively bindable substance having a selective (or specific) affinity for another substance. A ligand is usually, but not necessarily, recognized and bound by a larger specifically binding object or "binding partner" or "receptor". Examples of ligands suitable for targeting are, inter alia, antigens, haptens, biotin, biotin derivatives, lectins, galactosamine and fucosylamine moieties, receptors, substrates, coenzymes, and cofactors.

[0220] When applied to the micelles of the present disclosure, ligands include the corresponding antibodies or fragments thereof, or antigens or haptens that can be bound thereto. Viral antigens or hemagglutinin and neuraminidase and nucleocapsid derived from any DNA and RNA virus, AIDS, HIV, and hepatitis virus, adenovirus, alphavirus, arenavirus, coronavirus, flavivirus, herpes virus, myxovirus, oncornavirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, reovirus, rhabdovirus, rhinovirus, togavirus, and viroid; any bacterial antigen including those of Gram-negative bacteria and Gram-positive bacteria, Acinetobacter, Achromobacter, Bacteroides, Clostridium, Chlamydia, Enterobacteriaceae, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptoccocus; any fungal antigen including those of Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeast; any mycoplasma antigen; any rickettsia antigen; any protozoan antigen; any parasite antigen; any human antigen including blood cells, virus-infected cells, genetic markers, heart disease, tumor proteins, plasma proteins, complement factors, and rheumatoid factors. Cancer and tumor antigens, for example, among others, alpha-fetoprotein, prostate-specific antigen (PSA) and CEA, cancer markers, and tumor proteins are also included.

[0221] Other substances that can function as ligands for targeting the micelles of the present disclosure are certain vitamins (i.e., folic acid, B 12 )), steroids, prostaglandins, carbohydrates, lipids, antibiotics, drugs, digoxin, insecticides, anesthetics, neurotransmitters, and substances that are used or modified to function as ligands.

[0222] In some embodiments, the targeting moiety includes a protein or protein fragment having cell affinity (e.g., a hormone, a toxin) and a synthetic or natural polypeptide. Ligands also include various substances having a selective affinity for a ligator, which are produced by recombinant DNA, genetic engineering, and molecular engineering. Unless otherwise specified, the ligands of the present disclosure also include the ligands defined in U.S. Patent No. 3,817,837, which is incorporated herein by reference in its entirety.

[0223] ii. Ligator The ligator, although not necessarily, typically functions as a specifically binding object or "partner" or "receptor" that is larger than the ligand that can bind and as a type of targeting moiety defined in the present disclosure. For the purposes of the present disclosure, the ligator can be a specific substance or material or chemical or "reactant" that can selectively and specifically bind to a specific ligand. The ligator can be a protein such as an antibody, a non-protein binding object, or a "substance showing specific reaction".

[0224] When applied to the present disclosure, a ligator is defined to include antibodies of all classes, monoclonal antibodies, chimeric antibodies, Fab fragments, fragments and derivatives thereof. The term "antibody" encompasses immunoglobulins and fragments thereof, whether natural or produced in whole or in part synthetically. This term also encompasses any protein having a binding domain that is homologous to an immunoglobulin binding domain. "Antibody" further includes polypeptides containing framework regions derived from immunoglobulin genes or fragments thereof that specifically bind and recognize an antigen. The use of the term antibody includes full-length antibodies, polyclonal, monoclonal, and recombinant antibodies, fragments thereof, including single-chain antibodies, humanized antibodies, mouse antibodies, chimeric, mouse / human, mouse / primate, primate / human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments, e.g., scFv, scFab, (scFab)2, (scFv)2, Fab, Fab’, and F(ab’)2, F(ab1)2, Fv, dAb, and Fd fragments, diabodies, and antibody-related polypeptides. Antibodies include bispecific and multispecific antibodies as long as they exhibit or function with the desired biological activity. In some aspects of the present disclosure, the targeting moiety is an antibody or molecule that includes an antigen-binding fragment thereof. In some aspects, the antibody is a nanobody. In some aspects, the antibody is an ADC. The terms "antibody-drug conjugate" and "ADC" are used interchangeably and refer, for example, to an antibody conjugated to a therapeutic agent (optionally referred to herein as an agent, drug, or active pharmaceutical ingredient) or agent by a covalent bond. In some aspects of the present disclosure, the targeting moiety is an antibody-drug conjugate.

[0225] In certain circumstances, the present disclosure is also applicable to use as a ligator of other substances. For example, other ligators suitable for targeting include naturally occurring receptors that specifically bind to hormones, vitamins, drugs, antibiotics, cancer markers, genetic markers, viruses, and histocompatibility markers, any hemagglutinin, and derivatives of cell membranes and nuclei. Another class of ligators includes any RNA and DNA binding substances, such as polyethyleneimine (PEI), and polypeptides or proteins, such as histones and protamines.

[0226] Other ligators include enzymes, particularly cell surface enzymes such as neuraminidase, plasma proteins, avidin, streptavidin, chelons, cavitands, thyroglobulin, intrinsic factor, globulins, chelating agents, surfactants, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.

[0227] Targeting moieties include various substances, such as any protein, protein fragment, or polypeptide having an affinity for the surface of any cell, tissue, or microorganism produced by recombinant DNA, genetic engineering, and molecular engineering. Thus, in some embodiments, the targeting moiety directs the micelles of the present disclosure to a specific tissue (i.e., liver tissue or brain tissue), a specific type of cell (e.g., a specific type of cancer cell), or a physiological compartment or physiological barrier (e.g., the BBB).

[0228] e. Linker As described above, the cationic carrier unit disclosed herein may include one or more linkers, for example, as shown in FIG. 3. As used herein, the term "linker" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) or a non-peptide linker whose main function is to connect two parts in the cationic carrier unit disclosed herein. In some embodiments, the cationic carrier unit of the present disclosure includes at least one linker that connects a tissue-specific targeting moiety (TM) to a water-soluble polymer (WS), at least one linker that connects a water-soluble biopolymer (WP) to a cationic carrier (CC) or an adjuvant moiety (AM), at least one linker that connects a cationic carrier (CC) to an adjuvant moiety (AM), or any combination thereof. In some embodiments, two or more linkers may be connected in series.

[0229] When multiple linkers are present in the cationic carrier unit disclosed herein, each of the linkers may be the same or different. Generally, the linker provides flexibility to the cationic carrier unit. The linker is not normally cleaved, although in certain embodiments such cleavage may be desirable. Thus, in some embodiments, the linker may include a site cleavable by one or more proteases that may be present within the linker sequence or adjacent to the linker at either end of the linker sequence.

[0230] In one aspect, the linker is a peptide linker. In some aspects, the peptide linker can comprise at least about 2, at least about 3, at least about 4, at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 amino acids.

[0231] In some aspects, the peptide linker can comprise at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 amino acids.

[0232] In other aspects, the peptide linker can comprise at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1,000 amino acids.

[0233] The peptide linker can comprise from 1 to about 5 amino acids, from 1 to about 10 amino acids, from 1 to about 20 amino acids, from about 10 to about 50 amino acids, from about 50 to about 100 amino acids, from about 100 to about 200 amino acids, from about 200 to about 300 amino acids, from about 300 to about 400 amino acids, from about 400 to about 500 amino acids, from about 500 to about 600 amino acids, from about 600 to about 700 amino acids, from about 700 to about 800 amino acids, from about 800 to about 900 amino acids, or from about 900 to about 1000 amino acids.

[0234] Examples of peptide linkers are well known in the art. In some embodiments, the linker is a glycine / serine linker. In some embodiments, the peptide linker is a glycine / serine linker according to the formula [(Gly)n-Ser]m, where n is any integer from 1 to 100 and m is any integer from 1 to 100. In other embodiments, the glycine / serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 1), where x is an integer from 1 to 4, y is 0 or 1, and z is an integer from 1 to 50. In one embodiment, the peptide linker comprises the sequence Gn, where n can be an integer from 1 to 100. In a particular embodiment, the sequence of the peptide linker is GGGG (SEQ ID NO: 2).

[0235] In some embodiments, the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO: 3), where n is an integer from 1 to 100. In other embodiments, the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO: 4), where n is an integer from 1 to 100.

[0236] In other embodiments, the peptide linker comprises the sequence (GGGS)n (SEQ ID NO: 5). In still other embodiments, the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO: 6). In these examples, n can be an integer from 1 to 100. In other examples, n can be an integer from 1 to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0237] Examples of linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO: 7), GGSGGSGGSGGSGGG (SEQ ID NO: 8), GGSGGSGGGGSGGGGS (SEQ ID NO: 9), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 10), or GGGGSGGGGSGGGGS (SEQ ID NO: 11). In other embodiments, the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 12), where n can be an integer from 1 to 100.

[0238] In one aspect, the peptide linker is synthetic, i.e., non-natural. In one aspect, the peptide linker comprises a peptide (or polypeptide) (e.g., natural or non-natural peptide) having an amino acid sequence that links or genetically fuses a first linear amino acid sequence to a second linear amino acid sequence that is not naturally linked or genetically fused in nature. For example, in one aspect, the peptide linker may comprise a non-natural polypeptide that is a modified form of a naturally occurring polypeptide (e.g., including mutations such as addition, substitution, or deletion). In another aspect, the peptide linker may comprise non-natural amino acids. In another aspect, the peptide linker may comprise naturally occurring amino acids that occur in a linear sequence that does not occur naturally. In yet another aspect, the peptide linker may comprise a naturally occurring polypeptide sequence.

[0239] In some aspects, the linker comprises a non-peptide linker. In other aspects, the linker consists of a non-peptide linker. In some aspects, the non-peptide linker can be, for example, maleimidocaproyl (MC), maleimidopropanoyl (MP), methoxypolyethylene glycol (MPEG), 4-(N-maleimidomethyl)-cyclohexane-1-carboxylic acid succinimidyl ester (SMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), 4-(p-maleimidophenyl)butyric acid succinimidyl ester (SMPB), (4-iodoacetyl)aminobenzoic acid N-succinimidyl ester (SIAB), 6-[3-(2-pyridyldithio)-propionamide]hexanoic acid succinimidyl ester (LC-SPDP), 4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (SMPT), etc. (see U.S. Patent No. 7,375,078).

[0240] Linkers can be introduced into the polypeptide sequence using techniques known in the art (e.g., chemical conjugation, recombinant techniques, or peptide synthesis). Modifications can be confirmed by DNA sequence analysis. In some embodiments, linkers can be introduced using recombinant techniques. In other embodiments, linkers can be introduced using solid-phase peptide synthesis. In certain embodiments, the cationic carrier units disclosed herein can simultaneously contain one or more linkers introduced using recombinant techniques and one or more linkers introduced using solid-phase peptide synthesis or chemical conjugation methods known in the art. In some embodiments, the linker contains a cleavage site.

[0241] III. Payload As used herein, the term "payload" refers to a bioactive molecule, e.g., a therapeutic agent, or something that can interact with the cationic carrier units of the present disclosure, either by itself or via an adapter, and can be contained within the core of the micelles of the present disclosure. Payloads contemplated in the present disclosure include, but are not limited to, therapeutic agents such as prodrugs, anti-cancer drugs, anti-neoplastic drugs, anti-fungal drugs, antibacterial drugs, anti-viral drugs, cardiac drugs, neurological drugs, and addictive drugs; alkaloids, antibiotics, bioactive peptides, steroids, steroid hormones, polypeptide hormones, interferons, interleukins, anesthetics, nucleic acids including antisense oligonucleotides, insecticides, and prostaglandins. Bioactive molecules include, inter alia, any toxin such as aflatoxin, ricin, bungarotoxin, irinotecan, ganciclovir, furosemide, indomethacin, chlorpromazine, methotrexate, sevine derivatives and analogs such as sevin, desatryn, and veratridine.

[0242] Bioactive molecules include, but are not limited to, various flavone derivatives and analogs such as dihydroxyflavone (chrysin), trihydroxyflavone (apigenin), pentahydroxyflavone (morin), hexahydroxyflavone (myricetin), flavillium, quercetin, fisetin; derivatives and analogs, for example, penicillin antibiotics (i.e., ampicillin), anthracyclines (i.e., doxorubicin, daunorubicin, mitoxantrone), butoconazole, camptothecin, calcimycin, chartreusin, chromomycin (V and M), chloramphenicol, chlortetracycline, chromocycline, cyclosporine, ellipticine, filipin, fungichromin, gliotoxin, glioviridin, guamecycline, macrolides (i.e., amphotericin, clotrimycin), methicillin, nystatin, crimastatin, elsamicin, gilvocarcin, labidomycin, lancacidin antibiotics (i.e., lancamycin), mitomycin, terramycin, tetracycline, wortmannin; various antibiotics; various antibacterial substances including reserpine, spironolactone, sulfacetamide sodium, sulfonamides, thiamphenicol, thioridazine; various purine and pyrimidine derivatives and analogs including 5'-fluorouracil, 5'-fluoro-2'-deoxyuridine, and allopurinol; various photosensitizing substances including mesochlorin e6 monoethylenediamine (Mce6), phthalocyanines, porphyrins, and their derivatives and analogs, especially those used for singlet oxygen and triplet oxygen formation useful in photodynamic therapy (van Lier, J.E. In “Photodynamic Therapy of Neoplastic Disease”; Kessel, D., Ed., CRC Press, Boca Raton, FL, 1990, Vol.1); various steroid compounds such as cortisone, estradiol, hydrocortisone, testosterone, prednisolone, progesterone, dexamethasone, beclomethasone, and other methasone derivatives, cholesterol, digitoxin, digoxin, other steroid derivatives and analogs including digoxigenin; various coumarin derivatives and analogs including dihydroxycoumarin (esculetin), dicumarol, chrysarobin, chrysophanic acid, emodin, secalonic acid; various dopa, derivatives, and analogs including dopa, dopamine, epinephrine, and norepinephrine (noradrenaline); various antitumor agents or cell growth inhibitors such as cisplatin and taxanes including paclitaxel and docetaxel; various barbituric acids including phenobarbital, amobarbital, allobarbital, pentobarbital, and other barbiturate derivatives; various benzene derivatives including aminobenzoic acid, bromobenzoic acid, benzocaine, benzodiazepine, benzothiazide, butyl p-aminobenzoate; various polypeptide derivatives; various carboxylic acid derivatives such as bromoisovaleryl urea, phenylbutyric acid, phenylvaleric acid, or any combination thereof are also included.

[0243] Other bioactive molecules include, but are not limited to, diphenylhydantoin, adiphenine, anethole, aspirin, azapropazone, benzcyclane, chloral hydrate, chlorambucil, chlorpromazine, chlorogenic acid, cinnamic acid, clofibrate, coenzyme A, cyclohexyl anthranilate, diazepam, flufenamic acid, fluocinolone acetonide, flurbiprofen, guaiazulene, ibuprofen, indican, indomethacin, iodine, ketoprofen, mefenamic acid, menadione, metronidazole, nitrazepam, phenytoin, propylparaben, procymidone, quinolone, thalidomide, thiamine lauryl sulfate, thiopental, triamcinolone, vitamin A, D3, E, K3, warfarin, or any combination thereof.

[0244] Other bioactive molecules include, inter alia, antiviral drugs, nucleic acids, and other antiviral substances against any DNA and RNA viruses, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, members of the genus Orthomyxovirus, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses, and viroids; antibacterial drugs, nucleic acids, and other antibacterial substances against Gram-negative and Gram-positive bacteria, Acinetobacter, Achromobacter, Bacteroides, Clostridium, Chlamydia, enterobacteria, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptococcus; antifungal drugs, nucleic acids, and other antifungal substances against Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeasts; any drugs, nucleic acids, and other substances against mycoplasma and rickettsia; any antiprotozoal drugs, nucleic acids, and other substances; any antiparasitic drugs, nucleic acids, and other substances; any drugs, nucleic acids, and other substances against heart diseases, tumors, and virus-infected cells.

[0245] (a) Nucleic acid In some embodiments, the bioactive molecule (payload) is a nucleic acid, e.g., RNA or DNA. Nucleic acid active agents suitable for delivery using the micelles of the present disclosure include all types of RNA and all types of DNA, including oligonucleotides, e.g., probes and primers used in polymerase chain reaction (PCR), hybridization, or DNA sequencing. In some embodiments, the nucleic acid is mRNA, miRNA, miRNA sponge, tough decoy miRNA (TD), antimiR, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.

[0246] In some embodiments, the bioactive molecule (payload) includes small interfering RNA (siRNA), a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby reducing or even inhibiting gene expression. For example, siRNA can cause specific degradation of homologous RNA molecules such as mRNA within regions where the sequences between the siRNA and the target RNA are homologous. Non-limiting exemplary siRNAs are disclosed in WO02 / 44321, which is incorporated herein by reference in its entirety.

[0247] In some embodiments, the bioactive molecule (payload) includes short hairpin RNA (shRNA). In some embodiments, the bioactive molecule includes miRNA or miRNA inhibitor (antimiR). In some embodiments, the bioactive molecule (payload) can be 10 to 30 nucleotides in length, e.g., 14 to 25 nucleotides in length. In some embodiments, the bioactive molecule (payload) has a length of 16 to 30 nucleotides, 18 to 25 nucleotides, particularly 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0248] The sequences of miRNAs are publicly available, for example, through the miRBase registry (Griffiths-Jones, et al., Nucleic Acids Res., 36 (Database Issue): D154-D158 (2008), Griffiths-Jones, et al., Nucleic Acids Res., 36 (Database Special Issue): D140-D144 (2008), Griffiths-Jones, et al., Nucleic Acids Res., 36 (Database Special Issue): D109-D111 (2008)) and other publicly accessible databases.

[0249] In some embodiments, the miRNA inhibitor is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modified forms thereof. In some embodiments, the miRNA antagonist is an antimiR. An antimiR is a specific class of miRNA inhibitor described, for example, in US2007 / 0213292 belonging to Stoffel et al. An antimiR is an RNA-like oligonucleotide containing various modifications for RNase protection and pharmacological properties, such as enhancement of tissue and cell uptake. An antimiR typically differs from normal RNA in having complete 2'-O-methylation of the sugar, a phosphorothioate backbone, and a cholesterol moiety at the 3' end.

[0250] Non-limiting examples of antimiRs and other miRNA inhibitors are described in WO2009 / 020771, WO2008 / 091703, WO2008 / 046911, WO2008 / 074328, WO2007 / 090073, WO2007 / 027775, WO2007 / 027894, WO2007 / 021896, WO2006 / 093526, WO2006 / 112872, WO2007 / 112753, WO2007 / 112754, WO2005 / 023986, or WO2005 / 013901, all of which are incorporated herein by reference.

[0251] In some embodiments, the nucleic acid is a phosphodiester antisense oligonucleotide, and the sugar phosphate "backbone" is either derivatized or replaced with a "backbone analog", such as phosphorothioate, phosphorodithioate, phosphoramidate, alkyl phosphotriester, or methylphosphonate linkages. In some embodiments, the nucleic acid active agent is an antisense oligonucleotide and any oligonucleotide or oligodeoxynucleotide having a non-phosphorus backbone analog, such as sulfamate, 3'-thioformacetal, methylene(methylimino)(MMI), 3'-N-carbamate, or morpholinocarbamate.

[0252] In some embodiments, the bioactive molecule (payload) is an antimiR. As used herein, the terms "antimiR", "anti-microRNA", "anti-miRNA", and variations thereof refer to molecules (e.g., synthetically produced molecules) used to disable microRNA (miRNA) function in a cell for a desired response. miRNA is a sequence (about 20-22 bp) complementary to an mRNA involved in RNA cleavage or translational repression. By controlling the miRNA that regulates mRNA in a cell, an antimiR (also referred to as an anti-miRNA oligonucleotide, AMO, or antagomiR) can be used for further regulation and for therapeutic purposes in certain cell disorders. This regulation can occur by a steric block mechanism as well as hybridization with miRNA.

[0253] These in vivo interactions between antimiR and miRNA can be for the treatment of disorders where over / underexpression occurs or where abnormalities in miRNA result in problems in coding. Some of the disorders associated with miRNAs that humans encounter include cancer, muscle diseases, autoimmune disorders, and viruses.

[0254] The various components of an antimiR can be engineered to affect the binding affinity and potency of the antimiR. The 2'-sugar of an antimiR can be modified to be substituted with fluorine and various methyl groups, and in almost all cases, the binding affinity increases. However, some of these modified 2'-sugar antimiRs have an adverse effect on cell proliferation. Modifying the 5'-3' phosphodiester backbone linkage to a phosphorothioate (P-S) backbone linkage is also known to have an effect on target affinity. The use of P-S mutations has been shown to decrease the Tm of the oligonucleotide, which results in lower target affinity. The final requirements for an antimiR are mismatch specificity and length limitations. Due to sharing the "seed" (shared) sequence and only 2 or 3 additional nucleotides being different, one antimiR can potentially target multiple miRNA sequences, which are from the same family of miRNAs. One or more examples of antimiR or miRNA sequences are shown in the table below.

Table 1

[0255] In some embodiments, the payload is a polynucleotide comprising a nucleotide sequence having a length of 5 to 30 nucleotides. In some embodiments, the polynucleotide has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the nucleotide sequence has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides.

[0256] In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that targets hsa-miR-485, such as hsa-miR-485-3p. In some embodiments, hsa-miR-485-3p has the sequence GUCAUACACGGCUCUCCUCUCU (SEQ ID NO: 17). In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where U can optionally be T. In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has 1 mismatch, 2 mismatches, 3 mismatches, or 4 mismatches. In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has 1 or 2 mismatches. In other embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that targets the seed sequence of has-miR-485-3p (UCAUACA; SEQ ID NO: 19). In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that comprises UCAUACA (SEQ ID NO: 19), where U can optionally be T (the complement of the seed), and the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length. In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence that comprises UGUAUGA (SEQ ID NO: 20), where U can optionally be T (the complement of the seed), where the nucleotide sequence is 1, 2 at the 5' end of the complement of the seed sequence It comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3'-end of the complement of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids and / or seed sequences.

[0257] In some embodiments, the payload is a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 23), 5'-GUGUAUGA-3' (SEQ ID NO: 24), 5'-CGUGUAUGA-3' (SEQ ID NO: 25), 5'-CCGUGUAUGA-3' (SEQ ID NO: 26), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 27), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 28), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 29), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 30), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 31), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 32), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 33), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 34), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 35), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 36); 5'-UGUAUGAC-3' (SEQ ID NO: 37), 5'-GUGUAUGAC-3' (SEQ ID NO: 38), 5'-CGUGUAUGAC-3' (SEQ ID NO: 39), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 40), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 41), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 42), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 43), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 44), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 45), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 46), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 47), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 48), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 49), or 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 50).

[0258] In some embodiments, the payload is a nucleotide sequence comprising 5’-TGTATGA-3’ (SEQ ID NO: 51), 5’-GTGTATGA-3’ (SEQ ID NO: 52), 5’-CGTGTATGA-3’ (SEQ ID NO: 53), 5’-CCGTGTATGA-3’ (SEQ ID NO: 54), 5’-GCCGTGTATGA-3’ (SEQ ID NO: 55), 5’-AGCCGTGTATGA-3’ (SEQ ID NO: 56), 5’-GAGCCGTGTATGA-3’ (SEQ ID NO: 57), 5’-AGAGCCGTGTATGA-3’ (SEQ ID NO: 58), 5’-GAGAGCCGTGTATGA-3’ (SEQ ID NO: 59), 5’-GGAGAGCCGTGTATGA-3’ (SEQ ID NO: 60), 5’-AGGAGAGCCGTGTATGA-3’ (SEQ ID NO: 61), 5’-GAGGAGAGCCGTGTATGA-3’ (SEQ ID NO: 62), 5’-AGAGGAGAGCCGTGTATGA-3’ (SEQ ID NO: 63), 5’-GAGAGGAGAGCCGTGTATGA-3’ (SEQ ID NO: 64); 5’-TGTATGAC-3’ (SEQ ID NO: 65), 5’-GTGTATGAC-3’ (SEQ ID NO: 66), 5’-CGTGTATGAC-3’ (SEQ ID NO: 67), 5’-CCGTGTATGAC-3’ (SEQ ID NO: 68), 5’-GCCGTGTATGAC-3’ (SEQ ID NO: 69), 5’-AGCCGTGTATGAC-3’ (SEQ ID NO: 70), 5’-GAGCCGTGTATGAC-3’ (SEQ ID NO: 71), 5’-AGAGCCGTGTATGAC-3’ (SEQ ID NO: 72), 5’-GAGAGCCGTGTATGAC-3’ (SEQ ID NO: 73), 5’-GGAGAGCCGTGTATGAC-3’ (SEQ ID NO: 74), 5’-AGGAGAGCCGTGTATGAC-3’ (SEQ ID NO: 75), 5’-GAGGAGAGCCGTGTATGAC-3’ (SEQ ID NO: 76), 5’-AGAGGAGAGCCGTGTATGAC-3’ (SEQ ID NO: 77), or 5’-GAGAGGAGAGCCGTGTATGAC-3’ (SEQ ID NO: 78).

[0259] In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence targeting hsa-miR-204, e.g., has-miR-204-5p. Has-miR-204-5p is shown in Table 1 as UUCCCUUUGUCAUCCUAUGCCU (SEQ ID NO: 13). In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can optionally be T. In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can optionally be T, and the nucleotide sequence has 1, 2, 3, or 4 mismatches. In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can optionally be T, and the nucleotide sequence has 1 or 2 mismatches. In other embodiments, the payload (e.g., an antimiR) is a nucleotide sequence targeting the seed sequence of has-miR-204-5p (UCCCUUU; SEQ ID NO: 21). In some embodiments, the payload (e.g., an antimiR) is a nucleotide sequence comprising AAAGGGGA (SEQ ID NO: 22) (complement of the seed), wherein U can optionally be T (complement of the seed), and the nucleotide sequence is about 10 to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length.In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that includes AAAGGGA (SEQ ID NO: 22) (the complement of the seed), where the nucleotide sequence includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' end of the complement of the seed sequence and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' end of the complement of the seed sequence.

[0260] i. Chemically modified polynucleotide In some embodiments, the polynucleotides of the disclosure (e.g., antimiR, e.g., miR485 antimiR) include at least one chemically modified nucleoside and / or nucleotide. When the polynucleotide of the disclosure is chemically modified, the polynucleotide may be referred to as a "modified polynucleotide."

[0261] "Nucleoside" refers to a compound that contains a sugar molecule (e.g., pentose or ribose) or a derivative thereof, together with an organic base (e.g., purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleic acid base").

[0262] "Nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized by any useful method, e.g., chemically, enzymatically, or recombinantly, such that they include one or more modified non-natural nucleosides.

[0263] A polynucleotide can include a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkage can be a standard phosphodiester linkage, in which case the polynucleotide includes regions of nucleotides.

[0264] The modified polynucleotides disclosed herein can include a variety of different modifications. In some embodiments, the modified polynucleotide contains one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, the modified polynucleotide exhibits one or more desired properties, such as improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to target microRNA, and reduced non-specific binding to other microRNAs or other molecules, compared to the unmodified polynucleotide.

[0265] In some embodiments, the polynucleotides of the present disclosure are chemically modified. As used herein, the term "chemical modification" or, if necessary, "chemically modified" with respect to a polynucleotide refers to a modification in one or more of their positions, patterns, percentages, or populations of their nucleobases, sugars, backbones, or any combination thereof, including, but not limited to, those for adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C) ribonucleosides or deoxyribonucleosides.

[0266] In some embodiments, the polynucleotides of the present disclosure (e.g., antimiR) can have a homogeneous chemical modification of all or any of the same nucleoside species, or a group of modifications generated by downward titration of the same starting modification in all or any of the same nucleoside species, or a measured percentage of chemical modification of all or any of the same nucleoside species, except with random incorporation. In another embodiment, the polynucleotides of the present disclosure (e.g., antimiR) can have two, three, or four homogeneous chemical modifications of the same nucleoside species throughout the polynucleotide (e.g., all uridines and all cytidines are modified in the same manner).

[0267] Base pairing of modified nucleotides includes not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides that include nucleotides and / or non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors enables hydrogen bonding between non-standard bases and standard bases or between two complementary non-standard base structures. One example of such non-standard base pairing is base pairing between the modified nucleobase inosine and adenine, cytosine, or uracil. Any combination of bases / sugars or linkers can be incorporated into the polynucleotides of the present disclosure.

[0268] Those skilled in the art will understand that, unless otherwise noted, the polynucleotide sequences described in this application list "T" in a representative DNA sequence, but when the sequence represents RNA, "T" is replaced by "U". For example, the TD of the present disclosure can be administered as RNA, as DNA, or as a hybrid molecule containing both RNA and DNA units.

[0269] In some embodiments, a polynucleotide (e.g., an antimiR, e.g., miR485 antimiR) comprises a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.

[0270] In some embodiments, the nucleobases, sugars, backbone linkages, or any combination thereof in a polynucleotide (e.g., an antimiR, e.g., miR485 antimiR) are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100%.

[0271] 1. Base modification In certain embodiments, the chemical modification is present in the nucleobases of the polynucleotides of the present disclosure (e.g., an antimiR, e.g., miR485 antimiR). In some embodiments, at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (ψ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methylcytidine (m5C)), a modified adenosine (e.g., 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyladenine (m2A)), a modified guanosine (e.g., 7-methylguanosine (m7G) or 1-methylguanosine (m1G)), or a combination thereof.

[0272] In some embodiments, the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) are uniformly modified (e.g., fully modified, modified throughout the sequence) with respect to a particular modification. For example, the polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methylcytidine (m5C), which means that all cytosine residues in the polynucleotide sequence are replaced with 5-methylcytidine (m5C). Similarly, the polynucleotide can be uniformly modified by substitution of any type of nucleoside residue present in the sequence with a modified nucleoside, e.g., any of those described above.

[0273] In some embodiments, the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) contain combinations of at least two (e.g., two, three, four, or more) modified nucleobases. In some embodiments, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of one type of nucleobase in the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) are modified nucleobases.

[0274] 2. Backbone modification In some embodiments, the payload may include "the polynucleotides of the present disclosure" (e.g., antimiRs, e.g., including miR485 antimiR), where the polynucleotides include any useful modifications to the linkage between nucleosides. Such linkages including backbone modifications useful in the compositions of the present disclosure include, but are not limited to: 3'-alkylene phosphonate, 3'-aminophosphoramidate, alkene-containing backbone, aminoalkyl phosphoramidate, aminoalkyl phosphotriester, boranophosphate, -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, -CH2-NH-CH2-, chiral phosphonate, chiral phosphorothionate, formacetyl and thioformacetyl backbones, methylene(methylimino), methyleneformacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkage, -N(CH3)-CH2-CH2-, oligonucleosides having heteroatom internucleoside linkages, phosphinate, phosphoramidate, phosphorodithioate, phosphorothioate internucleoside linkage, phosphorothionate, phosphotriester, PNA, siloxane backbone, sulfamate backbone, sulfide, sulfoxide, and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkyl phosphonate, thionoalkyl phosphotriester, and thionophosphoramidate.

Chemical formula

[0275] In some embodiments, the presence of the backbone linkages disclosed above increases the stability (e.g., thermal stability) and / or resistance to degradation (e.g., enzymatic degradation) of the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR). In some embodiments, the stability and / or resistance to degradation in the modified polynucleotide is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% increased compared to the corresponding unmodified polynucleotide (reference or control polynucleotide).

[0276] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the backbone linkages in the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) are modified (e.g., all of them are phosphorothioates).

[0277] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 backbone linkages in the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) are modified (e.g., phosphorothioates).

[0278] In some embodiments, the backbone comprises a bond selected from the group consisting of phosphodiester bonds, phosphotriester bonds, methylphosphonic acid bonds, phosphoramidate bonds, phosphorothioate bonds, and combinations thereof.

[0279] 3. Sugar Modification The modified nucleosides and nucleotides that can be incorporated into the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) can be modified with respect to the sugar of the nucleic acid. Thus, in some embodiments, the payload comprises a nucleic acid, wherein the nucleic acid comprises at least one nucleoside analog (e.g., a nucleoside having a sugar modification).

[0280] In some embodiments, the sugar modification increases the affinity of the polynucleotide for its target miRNA. Incorporating nucleotide analogs that enhance affinity for the polynucleotide, such as LNA or 2'-substituted sugars, can allow for a reduction in the length of the polynucleotide and can also relax the upper limit on polynucleotide size at which non-specific or aberrant binding occurs.

[0281] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the nucleotides in the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) contain a sugar modification (e.g., LNA).

[0282] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotide units in the polynucleotides of the present disclosure (e.g., antimiR, e.g., miR485 antimiR) are sugar-modified (e.g., LNA).

[0283] Generally, RNA contains the sugar ribose, which is a five-membered ring with oxygen. Non-limiting exemplary modified nucleotides include substitution of oxygen in ribose (e.g., with S, Se, or an alkylene, e.g., methylene or ethylene); addition of a double bond (e.g., substitution of ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., formation of a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., having an additional carbon or heteroatom and forming a six- or seven-membered ring, e.g., anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino which also has a phosphoramidate backbone); polycyclic forms (e.g., tricyclo); and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced with a glycol unit linked by a phosphodiester bond), threose nucleic acid (TNA, where ribose is replaced with α-L-threofuranosyl-(3’→2’)), and peptide nucleic acid (PNA, where a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone). The sugar group may also contain one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, a polynucleotide molecule may include nucleotides containing, for example, arabinose as the sugar.

[0284] The 2'-hydroxy group (OH) of ribose can be modified or substituted with several different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1~6 alkyl; optionally substituted C 1~6 alkoxy; optionally substituted C6~10 Aryloxy; optionally substituted C 3~8 Cycloalkyl; optionally substituted C 3~8 Cycloalkoxy; optionally substituted C 6~10 Aryloxy; optionally substituted C 6~10 Aryl-C 1~6 Alkoxy, optionally substituted C 1~12 (Heterocyclyl)oxy; sugar (e.g., ribose, pentose, or any as described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR (wherein R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20)); “locked” nucleic acid (LNA) (wherein the 2'-hydroxy is 1~6 linked to the 4'-carbon of the same ribose sugar by an alkylene or C 1~6 heteroalkylene bridge, and exemplary bridges include methylene, propylene, ether, amino bridge, aminoalkyl, aminoalkoxy, amino, and amino acid).

[0285] In some embodiments, the nucleoside analogs present in the polynucleotides of the present disclosure (e.g., antimiR, e.g., miR485 antimiR) include, for example, 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabinonucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof. In some embodiments, the LNA is, for example, oxy-LNA (e.g., β-D-oxy-LNA or α-L-oxy-LNA), amino-LNA (e.g., β-D-amino-LNA or α-L-amino-LNA), thio-LNA (e.g., β-D-thio-LNA or α-L-thio-LNA), ENA (e.g., β-D-ENA or α-L-ENA), or any combination thereof.

[0286] In some embodiments, the nucleoside analogs present in the polynucleotides of the present disclosure include locked nucleic acid (LNA); 2'-O-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabinonucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-O-methyl nucleic acid (2'-OMe), 2'-O-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0287] In some aspects, the polynucleotides of the present disclosure (e.g., antimiRs, e.g., miR485 antimiR) can include both modified RNA nucleotide analogs (e.g., LNA) and DNA units. In some aspects, the polynucleotides of the present disclosure are gapmers. See, e.g., U.S. Pat. Nos. 8,404,649, 8,580,756, 8,163,708, 9,034,837, all of which are incorporated herein by reference in their entirety. In some aspects, the polynucleotides of the present disclosure are micro-miRs. See U.S. Patent Application Publication No. US20180201928, which is incorporated herein by reference in its entirety.

[0288] IV. Micelles The present disclosure also provides micelles comprising the cationic carrier units of the present disclosure. The micelles of the present disclosure comprise the cationic carrier units of the present disclosure and a negatively charged payload, wherein the negatively charged payload and the cationic carrier units are associated with each other. In some aspects, the association includes a covalent bond (see FIG. 1). In other aspects, the association does not include a covalent bond (see FIG. 1). In other aspects, the association is by an ionic bond, i.e., electrostatic interaction. In some aspects, the negatively charged payload (e.g., DNA and / or RNA) is not conjugated to the cationic carrier units by a covalent bond and / or the negatively charged payload interacts with the cationic carrier moiety of the cationic carrier units only by ionic interaction.

[0289] In some embodiments, the cationic carrier units and micelles of the present disclosure protect payloads (e.g., DNA and / or RNA) from degradation (e.g., by DNases and / or RNases). First, the cationic carrier units can protect the payloads through electrostatic interactions. Second, the micelles isolate the payloads within the core of the micelles, i.e., outside the reach of DNases and / or RNases. In some embodiments, the protection of the payloads from circulating enzymes (e.g., nucleases) can increase the half-life of the negatively charged payloads (e.g., DNA and / or RNA) compared to the free payloads. In some embodiments, the encapsulation of the payloads into the micelles of the present disclosure can increase the plasma half-life of the payloads by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payloads.

[0290] In some embodiments, the positive charge of the cationic carrier unit, and in particular the charge of the cationic carrier moiety, is sufficient to form micelles when mixed with a negatively charged payload (e.g., nucleic acid) in solution, where the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is about 1:1. In some embodiments, the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is greater than 1:1, i.e., an excess of cationic carrier units is used. In some embodiments, the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is less than 1:1, i.e., an excess of negatively charged payload is used.

[0291] In some embodiments, when combined with a suitable buffer (e.g., PBS), the complex formed between the cationic carrier unit of the present disclosure and a payload (e.g., an antisense oligonucleotide such as an antimiR) self-organizes to yield micelles. See Figure 5.

[0292] A micelle is a water-soluble or colloidal structure or aggregate composed of one or more amphiphilic molecules. Amphiphilic molecules are molecules that contain at least one hydrophilic (polar) moiety and at least one hydrophobic (non-polar) moiety. A "typical micelle" has a single, central, and predominantly hydrophobic compartment or "core" surrounded by a hydrophilic layer or "shell". In an aqueous solution, a micelle forms an aggregate in which the hydrophilic "head" regions of the amphiphilic molecules are in contact with the surrounding solvent, isolating the hydrophobic single-tail regions of the amphiphilic molecules into the micelle core. The shape of the micelle is approximately spherical. Other shapes, such as ellipsoids, cylinders, rod-like structures, or polymersomes are also possible. The shape and size of the disclosed micelles, and thus the loading capacity, can be modified by varying the ratio between a water-soluble biopolymer (e.g., PEG) and a cationic carrier (e.g., polylysine). Depending on the ratio, the carrier units can organize as small particles, small micelles, micelles, rod-like structures, or polymersomes (see Figure 6). Thus, the term "micelles of the present disclosure" encompasses not only typical micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes.

[0293] The micelles of the present disclosure can be composed of either a single unimolecular polymer containing hydrophobic and hydrophilic moieties or a mixture of aggregates containing a number of amphiphilic (i.e., surfactant) molecules formed above the critical micelle concentration (CMC) in a polar solution (i.e., an aqueous solution). The micelles self-organize from one or more amphiphilic molecules, where the moieties are oriented to result in a predominantly hydrophobic inner core and a predominantly hydrophilic outer side.

[0294] The micelles of the present disclosure can be in the size range of 5 to about 2000 nanometers. In some embodiments, the diameter of the micelles is from about 10 nm to about 200 nm. In some embodiments, the diameter of the micelles is from about 1 nm to about 100 nm, from about 10 nm to about 100 nm, from about 10 nm to about 90 nm, from about 10 nm to about 80 nm, from about 10 nm to about 70 nm, from about 20 nm to about 100 nm, from about 20 nm to about 90 nm, from about 20 nm to about 80 nm, from about 20 nm to about 70 nm, from about 30 nm to about 100 nm, from about 30 nm to about 90 nm, from about 30 nm to about 80 nm, from about 30 nm to about 70 nm, from about 40 nm to about 100 nm, from about 40 nm to about 90 nm, from about 40 nm to about 80 nm, or from about 40 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 30 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 15 nm to about 90 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 15 nm to about 80 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 15 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 15 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 15 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 20 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 20 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 20 nm to about 40 nm. In some embodiments, the diameter of the micelles of the present disclosure is from about 25 nm to about 35 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 32 nm. An exemplary distribution of micelle sizes is shown in FIG. 9.

[0295] In some embodiments, the micelles can contain a single type of antimiR (e.g., miR485 antimiR). In other embodiments, the micelles can contain two or more antimiRs, such as (i) antimiRs having different structures targeting the same miRNA, (ii) antimiRs having different structures targeting different miRNAs, (iii) antimiRs having the same structure targeting the same miRNA, or (iv) combinations thereof.

[0296] In some embodiments, the micelles of the present disclosure include a single type of cationic carrier unit. In other embodiments, the micelles of the present disclosure include two or more types of cationic carrier units (e.g., targeting different receptors on the surface of target cells). In some embodiments, the micelles of the present disclosure may include different targeting moieties, different cationic carrier moieties (e.g., for accommodating different payloads), and / or cationic carrier units having different adjuvant units.

[0297] To form micelles together with a payload, different types of cationic or anionic carrier units can be combined together. For example, to target the blood-brain barrier, the micelles of the present disclosure can include a cationic (or anionic) carrier unit linked to a targeting moiety and a cationic (or anionic) carrier unit not linked to the targeting moiety. In some embodiments, the micelles include from about 50 to about 200 cationic or anionic carrier units. In other embodiments, the micelles include from about 50 to about 150, from about 50 to about 140, from about 50 to about 130, from about 50 to about 120, from about 50 to about 110, or from about 50 to about 100 cationic or anionic carrier units. In some embodiments, the micelles include from about 60 to about 200 cationic or anionic carrier units. In other embodiments, the micelles include from about 60 to about 150, from about 60 to about 140, from about 60 to about 130, from about 60 to about 120, from about 60 to about 110, from about 60 to about 100, from about 60 to about 90, from about 60 to about 80, or from about 60 to about 70 cationic or anionic carrier units. In some embodiments, the micelles include from about 70 to about 200 cationic or anionic carrier units. In other embodiments, the micelles include from about 70 to about 150, from about 70 to about 140, from about 70 to about 130, from about 70 to about 120, from about 70 to about 110, from about 70 to about 100, from about 70 to about 90, or from about 70 to about 80 cationic or anionic carrier units. In some embodiments, the micelles include from about 80 to about 200 cationic or anionic carrier units. In other embodiments, the micelles include from about 80 to about 150, from about 80 to about 140, from about 80 to about 130, from about 80 to about 120, from about 80 to about 110, from about 80 to about 100, or from about 80 to about 90 cationic or anionic carrier units. In some embodiments, the micelles include from about 90 to about 200 cationic or anionic carrier units. In other embodiments, the micelles include from about 90 to about 150, from about 90 to about 140, from about 90 to about 130, from about 90 to about 120, from about 90 to about 110, or from about 90 to about 100 cationic or anionic carrier units. In some embodiments, the micelles include from about 100 to about 200 cationic or anionic carrier units.In other embodiments, the micelles comprise from about 100 to about 150, from about 100 to about 140, from about 100 to about 130, from about 100 to about 120, from about 100 to about 110, or from about 100 to about 100 cationic or anionic carrier units.

[0298] The present disclosure also includes micelles comprising (i) a nucleotide sequence (e.g., an oligonucleotide from about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) a cationic carrier unit as described herein. In some embodiments, the present disclosure is directed to micelles comprising (i) a nucleotide sequence, e.g., a miRNA or miRNA inhibitor (e.g., an oligonucleotide from about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) from about 80 to about 120 (e.g., from about 85 to about 115, from about 90 to about 110, from about 95 to about 105) cationic carrier units as described herein, e.g., TM-WP-CC-AM, WP-CC-AM, or combinations thereof (see Figure 3). In some embodiments, the micelles comprise (i) a nucleotide sequence, e.g., a miRNA or miRNA inhibitor (e.g., an oligonucleotide from about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) from about 80 to about 120 (e.g., about 80, about 85, about 90, about 95, about 100, about 105, or about 110) cationic carrier units as described herein, e.g., optionally TM-WP-CC-AM (see Figure 3). In some embodiments, the micelles comprise (i) a nucleotide sequence, e.g., a miRNA or miRNA inhibitor (e.g., an oligonucleotide from about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) from about 90 to about 110, e.g., about 100 cationic carrier units, wherein (a) from about 45 to about 55, e.g., about 50 cationic carrier units comprise TM-WP-CC-AM, and (b) from about 45 to about 55, e.g., about 50 cationic carrier units comprise WP-CC-CM, where TM is phenylalanine and WP is (PEG) 5000and CC is from about 40 to about 50 lysines, such as about 45, about 46, about 47, about 48, about 49, or about 50 lysines, and each of about 5 to about 15 lysines, about 10 lysines, is fused to vitamin B3 (nicotinamide).

[0299] In some embodiments, the micelles of the present disclosure comprise (i) a nucleotide sequence, such as an miR485-3p inhibitor, such as 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 18), and (ii) about 100 cationic carrier units, where (a) about 50 cationic carrier units comprise TM-WP-CC-AM, (b) about 50 cationic carrier units comprise WP-CC-CM, where TM is phenylalanine and WP is (PEG) 5000 and CC is about 47 lysines, and each of about 10 lysines is fused to vitamin B3 (nicotinamide).

[0300] In some embodiments, the micelle can comprise a single payload (e.g., a single oligonucleotide, e.g., an antimiR). In other embodiments, the micelle can comprise two or more payloads (e.g., multiple oligonucleotides, e.g., multiple antimiRs).

[0301] V. Manufacturing Method The present disclosure also provides a method for preparing a cationic carrier unit and micelles of the present disclosure. Generally, the present disclosure provides a method for preparing a cationic carrier unit of the present disclosure, including, for example, synthesizing the cationic carrier unit as described in the Examples section. As used herein, the term "synthesize" refers to constructing a cationic carrier unit using methods known in the art. For example, protein components (such as antibody targeting portions) can be prepared recombinantly and then conjugated to other components of the cationic carrier unit. In some embodiments, each of the components of the cationic carrier unit can be prepared using methods known in the art, such as recombinant protein production, solid-phase peptide or nucleic acid synthesis, chemical synthesis, enzymatic synthesis, or any combination thereof, and the resulting components can be conjugated using chemical and / or enzymatic methods known in the art.

[0302] The cationic carrier unit of the present disclosure can be purified to remove impurities. In some embodiments, the cationic carrier unit comprises a homogeneous population of cationic carrier units. However, in other embodiments, the cationic carrier unit can comprise multiple types (e.g., some of them contain a targeting portion, some contain the remaining portion but do not have a targeting portion). In some embodiments, the production of the cationic carrier unit of the present disclosure includes lyophilization or any other type of dry preservation suitable for reconstitution. In some embodiments, after combining the cationic carrier unit with a payload (such as nucleic acid), a dry form of the cationic carrier unit is prepared.

[0303] In some embodiments, a method of preparing the micelles of the present disclosure includes mixing a cationic carrier unit with a negatively charged payload (e.g., a nucleic acid such as an antisense oligonucleotide, e.g., an antimiR) at a 1:1 ion ratio. In some embodiments, the cationic carrier unit and the negatively charged payload are combined in solution. In some embodiments, after combining the cationic carrier and the negatively charged payload in solution, the resulting solution is lyophilized or dried. In some embodiments, the combination of the cationic carrier and the negatively charged payload is carried out in dry form.

[0304] As shown in FIG. 6, the ratio of the number n of monomer units in the water-soluble polymer (A, e.g., PEG) to the number m of monomer units in the cationic carrier moiety (B, e.g., polylysine) (in either case, the number of units n or m can be up to 1,000 units) affects the size and shape of the resulting micelles. At an mB / (nA + mB) ratio of 0.5, the resulting micelles are classical micelles. When mB / (nA + mB) is greater than 0.5, the resulting micelles are rod-shaped micelles or polymersomes. When mB / (nA + mB) is less than 0.5, the resulting micelles are small micelles or small particles.

[0305] The micelles of the present disclosure can be generated using any of the techniques known in the art, e.g., vortexing, extrusion, or sonication. The formation of micelles depends on applying conditions that exceed the critical micelle concentration (CMC) of a solution containing the cationic carrier unit of the present disclosure. After they reach a certain concentration value, the surfactants begin to associate and self-organize into more complex units, e.g., micelles. The CMC of a solution containing the cationic carrier of the present disclosure can be determined by any physical property (e.g., surface tension) that exhibits an obvious transition around the CMC.

[0306] According to the well-known Smith-Ewart theory, the number of nuclei generated that cause micelle formation at concentrations above the CMC is predicted to be proportional to the 0.6 power of the surfactant (in the present disclosure, a cationic carrier unit complexed or associated with an anionic payload) concentration. This is because for a given surfactant, the number of micelles formed generally increases with increasing surfactant concentration.

[0307] In some embodiments, the micelles of the present disclosure can be purified, for example, to remove contaminants and / or to generate a population of uniform micelles (e.g., micelles having the same size, or micelles having the same payload or the same targeting moiety).

[0308] VI. Pharmaceutical Compositions The present disclosure also provides a pharmaceutical composition comprising the cationic carrier unit and / or micelles of the present disclosure (i.e., micelles comprising the cationic carrier unit of the present disclosure) that are suitable for administration to a subject. As described above, the micelles of the present disclosure can be uniform (i.e., all micelles contain the same type of cationic carrier unit, together with the same targeting moiety and the same payload). However, in other embodiments, the micelles can contain multiple targeting moieties, multiple payloads, and the like.

[0309] A pharmaceutical composition generally comprises the cationic carrier unit and / or micelles of the present disclosure, and a pharmaceutically acceptable excipient or carrier, in a form suitable for administration to a subject. The pharmaceutically acceptable excipient or carrier is partially determined by the particular composition being administered and the particular method used to administer the composition.

[0310] There are a variety of suitable formulations of the pharmaceutical compositions containing the micelles of the present disclosure (see, for example, Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). Pharmaceutical compositions are generally formulated to be sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations for pharmaceuticals by the U.S. Food and Drug Administration. In some embodiments, the pharmaceutical composition comprises one or more micelles described herein.

[0311] In certain embodiments, the micelles described herein are co-administered with one or more additional therapeutic agents in a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition containing the micelles described herein is administered prior to the administration of the additional therapeutic agent(s). In other embodiments, the pharmaceutical composition containing the micelles described herein is administered after the administration of the additional therapeutic agent(s). In further embodiments, the pharmaceutical composition containing the micelles described herein is administered simultaneously with the additional therapeutic agent(s).

[0312] In some embodiments, the pharmaceutical carrier is added after micelle formation. In other embodiments, the pharmaceutical carrier is added before micelle formation.

[0313] Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient (e.g., animal or human) at the dosages and concentrations employed, and include buffers such as phosphoric, citric, and other organic acids; antioxidants such as ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzetonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight polypeptides (less than about 10 residues); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates such as glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0314] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for a pharmaceutically active substance is well known in the art. Their use in the compositions is intended, except in cases where any conventional media or compounds are incompatible with the cationic carrier units or micelles disclosed herein.

[0315] Adjuvant therapeutic agents can also be incorporated into the compositions of the present disclosure. Typically, pharmaceutical compositions are formulated to be compatible with their intended route of administration. The micelles described herein can be administered by parenteral, topical, intravenous, oral, subcutaneous, intra-arterial, intradermal, transdermal, rectal, intracranial, intraperitoneal, intranasal, intratumoral, intramuscular routes, or as an inhalant. In certain embodiments, the micelles of the pharmaceutical compositions described herein are administered intravenously, for example, by injection. The micelles described herein can optionally be administered in combination with other therapeutic agents that are at least partially effective in treating the disease, disorder, or condition targeted by the micelles described herein.

[0316] Solutions or suspensions can contain the following components: a sterile diluent, such as water, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial compounds, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating compounds, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetate, citrate or phosphate, and compounds for adjustment of tonicity, such as sodium chloride or dextrose. The pH can be adjusted with an acid or a base, such as hydrochloric acid or sodium hydroxide. The preparation can be placed in an ampoule, disposable syringe, or multi-dose vial made of glass or plastic.

[0317] Pharmaceutical compositions suitable for injection use include sterile aqueous solutions (when water-soluble), dispersions, and sterile powders. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, Cremophor EL (trademark) (BASF, Parsippany, N.J.), or phosphate-buffered saline (PBS). The composition is generally sterile and fluid to the extent that it is easy to pass through a hypodermic needle. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal compounds, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. Optionally, isotonic compounds, such as sugars, polyhydric alcohols, such as mannitol, sorbitol, and sodium chloride, can be added to the composition. Prolongation of the absorption of injectable compositions can be caused by incorporating into the composition compounds that delay absorption, such as aluminum monostearate and gelatin.

[0318] The pharmaceutical compositions of the present disclosure can be sterilized by conventional well-known sterilization techniques. The aqueous solution can be packaged for use or filtered under aseptic conditions, lyophilized, and the lyophilized preparation is combined with a sterile aqueous solution before administration.

[0319] Sterile injectable formulations can be prepared, if desired, by incorporating into a suitable solvent, in an effective amount, the micelles described herein, with one or a combination of the ingredients enumerated herein. Generally, the dispersion is prepared by incorporating the micelles described herein into a sterile vehicle containing a basic dispersion medium and any other desired ingredients. In the case of sterile powders for preparing sterile injectable formulations, the methods of preparation are vacuum drying and freeze drying which yield a powder of the active ingredient and any additional desired ingredients from a previously sterile filtered solution. The micelles described herein can be formulated in a manner that enables sustained release or pulsed release of the micelles described herein and can be administered in the form of depot injections or implant formulations.

[0320] Systemic administration of a composition containing the micelles described herein can be by transmucosal means. For transmucosal administration, a penetration enhancer suitable for the barrier to be permeated is used in the formulation. Such penetration enhancers are generally known in the art and include, for example, surfactants, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved, for example, by using intranasal sprays.

[0321] In certain embodiments, a pharmaceutical composition containing the micelles described herein is administered intravenously to a subject in need thereof. In certain embodiments, the composition is administered to the lymphatic system, for example, by intralymphatic injection or intranodal injection (see, e.g., Senti et al., PNAS 105(46):17908 (2008)), or by intramuscular injection, subcutaneous administration, intratumoral injection, or direct injection into the thymus or liver.

[0322] In certain embodiments, a pharmaceutical composition containing the micelles described herein is administered as a suspension. In certain embodiments, the pharmaceutical composition is administered as a formulation capable of forming a depot after administration. In certain preferred embodiments, the depot slowly releases the micelles described herein into the bloodstream or remains in depot form.

[0323] Typically, a pharmaceutically acceptable composition is highly purified to be free of contaminants, is biocompatible and not toxic, and is suitable for administration to a subject. When water is a component of the carrier, the water is highly purified and treated to be free of contaminants (e.g., endotoxins).

[0324] Pharmaceutically acceptable carriers can include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and / or mineral oil. The pharmaceutical compositions can further include lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, anti - precipitating agents, and / or preservatives.

[0325] The pharmaceutical compositions described herein include the micelles described herein and optionally a pharmaceutically active agent or therapeutic agent. The therapeutic agent can be a biological agent, a small - molecule agent, or a nucleic acid agent.

[0326] Dosage forms comprising the micelles described herein are provided. In some embodiments, the dosage form is formulated as a suspension for intravenous injection.

[0327] The micelles or pharmaceutical compositions comprising micelles disclosed herein can be used concomitantly with other drugs. Specifically, the micelles or pharmaceutical compositions of the present disclosure can be used together with agents such as, for example, hormonal therapeutic agents, chemotherapeutic agents, immunotherapeutic agents, agents that inhibit the action of cell growth factors or cell growth factor receptors.

[0328] VII. Methods of Treatment and Use The present disclosure also provides a method for treating a disease or condition of a subject in need thereof, the method comprising administering to the subject, such as a mammalian subject, e.g., a human subject, the micelles of the present disclosure or a combination thereof. In some embodiments, the present disclosure also provides a method for treating a neurodegenerative disorder or cancer of a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the micelles of the present disclosure or a pharmaceutical composition of the present disclosure.

[0329] In some embodiments, the micelles of the present disclosure can be administered by intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injection and infusion.

[0330] In some embodiments, the micelles of the present disclosure can be used concomitantly with other agents or treatments suitable for the treatment of the diseases and conditions disclosed herein.

[0331] The present disclosure also provides a method for encapsulating a payload for delivery, the method comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into the micelles of the present disclosure.

[0332] The present disclosure also provides a method for increasing resistance to payload degradation (e.g., nuclease-mediated degradation), the method comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into the micelles of the present disclosure.

[0333] In some aspects, the present disclosure provides a method of crossing the blood-brain barrier (BBB), the method comprising administering a micelle disclosed herein, for example, a micelle comprising tryptophan and / or tyrosine as targeting moieties. As illustrated in FIG. 7, the micelles of the present disclosure loaded with anti-miRNA can be targeted to a BBB receptor, such as LAT1, as disclosed above. Once the micelle is transported across the BBB by receptor-mediated transcytosis and undergoes intracellular uptake by brain cells (e.g., neurons, astrocytes, or microglia), the payload (e.g., anti-miR) is released and interacts with intracellular targets (e.g., anti-miR can bind to target microRNA and cause RNase H-mediated degradation).

[0334] In some aspects, encapsulation of the payload in the micelles of the present disclosure can increase the resistance of the payload to degradation by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% as compared to free payload (i.e., payload that is not within the micelle, e.g., free in solution).

[0335] In some embodiments, encapsulation of the payload in the micelles of the present disclosure can increase the resistance of the payload to degradation by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.

[0336] The present disclosure also provides a method of increasing the stability of a payload during administration (e.g., while present in the bloodstream of a subject), the method comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into the micelles of the present disclosure.

[0337] In some embodiments, encapsulation of the payload in the micelles of the present disclosure can increase the stability of the payload by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload (e.g., increasing resistance to nucleases).

[0338] In some embodiments, encapsulation of the payload into the micelles of the present disclosure can increase the stability of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload (e.g., increasing resistance to nucleases).

[0339] The present disclosure also provides a method of increasing the plasma half-life of a payload, the method comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into the micelles of the present disclosure.

[0340] In some embodiments, encapsulation of the payload into the micelles of the present disclosure can increase the plasma half-life of the payload by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, or at least about 2000% as compared to the free payload.

[0341] In some embodiments, encapsulation of the payload into the micelles of the present disclosure can increase the plasma half-life of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0342] In some embodiments, the encapsulated payload is an antimiR disclosed herein, such as the antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), wherein encapsulation of the antimiR into the micelles of the present disclosure increases the plasma half-life of the antimiR by at least about 10-fold, at least about 12-fold, at least about 14-fold, at least about 16-fold, at least about 18-fold, or at least about 20-fold compared to the plasma half-life of the free antimiR. In a particular embodiment, the encapsulated payload is an antimiR disclosed herein, such as the antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), wherein encapsulation of the antimiR into the micelles of the present disclosure increases the plasma half-life of the antimiR by about 20-fold compared to the plasma half-life of the free antimiR. In some embodiments, the plasma half-life of the antimiR encapsulated in the micelles of the present disclosure is at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 60 minutes, at least about 70 minutes, at least about 80 minutes, at least about 90 minutes, at least about 100 minutes, or at least about 120 minutes. In a particular embodiment, the plasma half-life of the antimiR (e.g., the antisense oligonucleotide of SEQ ID NO: 18) encapsulated in the micelles of the present disclosure is at least about 90 minutes.

[0343] The present disclosure also provides a method of increasing the permeation, delivery, movement, or transport of a payload, such as an anionic payload (e.g., an antimiR) such as a nucleic acid, through a physiological barrier, such as the BBB or the plasma membrane, the method comprising incorporating the payload into the micelles of the present disclosure.

[0344] In some embodiments, encapsulation of the payload into the micelles of the present disclosure can increase the permeation, delivery, movement, or transport of the payload through physiological barriers, such as the BBB or the plasma membrane, by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.

[0345] In some embodiments, encapsulation of the payload into the micelles of the present disclosure can increase the permeation, delivery, movement, or transport of the payload through physiological barriers, such as the BBB or the plasma membrane, by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.

[0346] In some embodiments, the micelles of the present disclosure can be used to target stem cells or to deliver, for example, a therapeutic molecule (e.g., a therapeutic polynucleotide) or a gene therapy component. In other embodiments, the micelles of the present disclosure can be used to treat cancer. For example, the micelles of the present disclosure can target markers specific to a particular type of cancer, such as glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer, and can carry a therapeutic molecule (e.g., a therapeutic polynucleotide, a peptide, or a small molecule) as a payload.

[0347] In certain embodiments, the micelles of the present disclosure can be used to treat pancreatic cancer. In some embodiments, the targeting moiety that directs the micelles of the present disclosure to pancreatic tissue is a cyclic RGD peptide. In other embodiments, the targeting moiety that directs the micelles of the present disclosure to pancreatic tissue is a biomarker that is predominantly or exclusively expressed on the surface of normal or cancerous pancreatic cells. In some embodiments, the payload of the micelles of the present disclosure is an oligonucleotide that targets K-Ras, wherein delivery of the payload to pancreatic tissue effectively reduces the expression of K-Ras.

[0348] In some embodiments, the micelles of the present disclosure can be used to treat or ameliorate the symptoms of neurodegenerative diseases such as Alzheimer's disease. In some embodiments, the micelles of the present disclosure contain a payload (e.g., an antimiR) that targets a molecule that is overexpressed in Alzheimer's disease neural tissue, such as miRNA-485-3p. In some embodiments, accordingly, administration of the micelles of the present disclosure (e.g., micelles containing an LAT1 targeting moiety for effectively transporting the micelles and the antimiR payload targeting miRNA-485-3p across the BBB) to a patient with Alzheimer's disease can prevent or ameliorate the symptoms of Alzheimer's disease, such as apoptosis, loss of mitochondrial function, or inflammation. See Figure 24.

[0349] In some embodiments, the present disclosure provides a method of reducing inflammation (e.g., neuroinflammation) in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of the micelles of the present disclosure, the micelles containing a therapeutic agent capable of effectively reducing inflammation (e.g., neuroinflammation) in the subject. In some embodiments, the neuroinflammation is cortical inflammation. In some embodiments, the neuroinflammation is hippocampal inflammation. In some embodiments, the therapeutic agent is an antimiR that targets miRNA-485-3p (e.g., the antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR is capable of reducing the level of miRNA-485-3p in the subject.

[0350] In some embodiments, administration of the micelles of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) reduces the level of neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neuroinflammation observed in a subject or population of subjects not treated with the micelles of the present disclosure.

[0351] In some embodiments, the present disclosure provides a method of reducing amyloid plaque burden in a subject suffering from Alzheimer's disease, the method comprising administering to the subject a therapeutically effective amount of the micelles of the present disclosure, the micelles comprising a therapeutic agent capable of effectively reducing amyloid plaque burden in the subject. In some embodiments, the therapeutic agent is an antimiR targeting miRNA-485-3p (e.g., the antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR is capable of reducing the level of miRNA-485-3p in the subject.

[0352] In some embodiments, administration of the micelles of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) reduces amyloid plaque burden in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amyloid plaque burden observed in a subject or population of subjects not treated with the micelles of the present disclosure.

[0353] In some embodiments, the present disclosure provides a method of restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of the micelles of the present disclosure, the micelles comprising a therapeutic agent capable of effectively restoring and / or inducing neurogenesis in the subject. In some embodiments, the therapeutic agent is an antimiR targeting miRNA-485-3p (e.g., the antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR is capable of reducing the level of miRNA-485-3p in the subject.

[0354] In some embodiments, administration of the micelles of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) restores and / or can induce neurogenesis in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neurogenesis observed in a subject or population of subjects not treated with the micelles of the present disclosure.

[0355] In some embodiments, the present disclosure provides a method of improving the cognitive function of a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of the micelles of the present disclosure, the micelles comprising a therapeutic agent capable of effectively improving the cognitive function of the subject. In some embodiments, the therapeutic agent is an antimiR targeting miRNA-485-3p (e.g., the antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR is capable of reducing the level of miRNA-485-3p in the subject.

[0356] In some embodiments, administration of the micelles of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) increases the cognitive function of the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the cognitive function observed in a subject or population of subjects not treated with the micelles of the present disclosure.

[0357] VIII. Kit The present disclosure also provides a kit or a manufactured article comprising the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and optionally instructions for use. In some embodiments, the kit or manufactured article comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure in one or more containers. In some embodiments, the kit or manufactured article comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and a pamphlet. In some embodiments, the kit or manufactured article comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and instructions for use. One of ordinary skill in the art will readily understand that the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, or combinations thereof, can be readily incorporated into one of the established kit formats well known in the art.

[0358] In some embodiments, the kit or manufactured article comprises the cationic carrier unit of the present disclosure in a dry form within a container (e.g., a glass vial), and optionally a vial having a solvent suitable for hydrating the dried cationic carrier unit, and optionally instructions for hydrating the cationic carrier unit and forming micelles. In some embodiments, the kit or manufactured article further comprises at least one additional container (e.g., a glass vial) having an anionic payload of the micelle (e.g., an antisense oligonucleotide). In some embodiments, the kit or manufactured article comprises the cationic carrier unit of the present disclosure in a dry form and the anionic payload of the micelle in a dry form in the same container or in different containers. In some embodiments, the kit or manufactured article comprises the cationic carrier unit of the present disclosure in solution and the anionic payload of the micelle in solution in the same container or in different containers. In some embodiments, the kit or manufactured article comprises the micelle of the present disclosure in solution and instructions for use. In some embodiments, the kit or manufactured article comprises the micelle of the present disclosure in a dry form and instructions for use (e.g., instructions for reconstitution and administration).

[0359] The practice of the present disclosure, unless otherwise specified, will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained in detail in the literature. For example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press), Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY), D.N. Glover ed., (1985) DNA Cloning, Volumes I and II, Gait, ed. (1984) Oligonucleotide Synthesis, Mullis et al. U.S. Patent No. 4,683,195, Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation, Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.), Immobilized Cells And Enzymes (IRL Press) (1986), Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.), Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory), Wu et al., eds., Methods In Enzymology, Vols. 154 and 155, Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London), Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986), Crooke, Antisense drug Technology: Principles, Strategies and Applications, 2nd Ed. CRC Press (2007), and Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.). See also.

[0360] All of the references cited above and all references cited herein are hereby incorporated by reference in their entirety.

[0361] The following examples are provided by way of illustration and not by way of limitation.

Example

[0362] Example 1 (a) Synthesis of alkyne-modified tyrosine: Alkyne-modified tyrosine was prepared as an intermediate for the synthesis of the tissue-specific targeting moiety (TM, see Figure 3) of the cationic carrier unit for inducing the micelles of the present disclosure to the LAT1 transporter of the BBB.

[0363] A mixture of N-(tert-butoxycarbonyl)-L-tyrosine methyl ester (Boc-Tyr-OMe) (0.5 g, 1.69 mmol) and K2CO3 (1.5 equivalents, 2.54 mmol) in acetonitrile (4.0 ml) was added dropwise to propargyl bromide (1.2 equivalents, 2.03 mmol). The reaction mixture was heated at 60 °C overnight. After the reaction, the reaction mixture was extracted using water:ethyl acetate (EA). Then, the organic layer was washed using a brine solution. The crude product was purified by flash column (10% EA in hexane). Next, the obtained product was dissolved in 1,4-dioxane (1.0 ml) and 6.0 M HCl (1.0 ml). The reaction mixture was heated at 100 °C overnight. Next, the dioxane was removed and extracted with EA. An aqueous NaOH solution (0.5 M) was added to the mixture until the pH value reached 7. The reaction was concentrated by an evaporator and centrifuged at 12,000 rpm at 0 °C. The precipitate was washed with deionized water and lyophilized.

[0364] (b) Synthesis of poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL): This synthesis step produced the water-soluble biopolymer (WP) and cationic carrier (CC) of the cationic carrier unit of the present disclosure (see Figure 3).

[0365] Poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring-opening polymerization of Lys(TFA)-NCA using monomethoxy PEG (MeO-PEG) as a polymer initiator. Briefly, MeO-PEG (600 mg, 0.12 mmol) and Lys(TFA)-NCA (2574 mg, 9.6 mmol) were separately dissolved in DMF and DMF (or NMP) containing 1 M thiourea. The Lys(TFA)-NCA solution was added dropwise to the MeO-PEG solution using a microsyringe, and the reaction mixture was stirred at 37 °C for 4 days. The reaction bottle was purged with argon and vacuum. All reactions were carried out under an argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was redissolved in methanol and reprecipitated into cold diethyl ether. Then, it was filtered and dried under reduced pressure to obtain a white powder. This was followed by the next step for the deprotection of the TFA groups of PEG-PLL(TFA).

[0366] MeO-PEG-PLL(TFA) (500 mg) was dissolved in methanol (60 mL), and 1 N NaOH (6 mL) was added dropwise to the polymer solution with stirring. The mixture was maintained at 37 °C for 1 day with stirring. The reaction mixture was dialyzed four times against 10 mM HEPES and then against distilled water. A white powder of PEG-PLL was obtained after lyophilization.

[0367] (b) Synthesis of azido-poly(ethylene glycol)-b-poly(L-lysine) (N3-PEG-PLL): This synthetic step produced the water-soluble biopolymer (WP) and cationic carrier (CC) of the cationic carrier unit of the present disclosure (see Figure 3).

[0368] Azido-poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring-opening polymerization of Lys(TFA)-NCA using azido-PEG (N3-PEG). Briefly, N3-PEG (300 mg, 0.06 mmol) and Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF and DMF (or NMP) containing 1 M thiourea. The Lys(TFA)-NCA solution was added dropwise to the N3-PEG solution by a microsyringe, and the reaction mixture was stirred at 37 °C for 4 days. The reaction bottle was purged with argon and vacuum. All reactions were carried out under an argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was redissolved in methanol and reprecipitated into cold diethyl ether. Then it was filtered and dried under reduced pressure to obtain a white powder. This was followed by the next step for deprotection of the TFA groups of PEG-PLL(TFA).

[0369] N3-PEG-PLL (500 mg) was dissolved in methanol (60 mL), and 1 N NaOH (6 mL) was added dropwise to the polymer solution with stirring. The mixture was maintained at 37 °C for 1 day with stirring. The reaction mixture was dialyzed 4 times against 10 mM HEPES and then against distilled water. A white powder of N3-PEG-PLL was obtained after lyophilization.

[0370] (c) Synthesis of (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercapto propanamide) (N3-PEG-PLL(Nic / SH)): In this step, the tissue-specific adjuvant moiety (AM, see Figure 3) was attached to the WP-CC component of the cationic carrier unit of the present disclosure. The tissue-specific adjuvant moiety (AM) used for the cationic carrier unit was nicotinamide (vitamin B3). This step gave the WP-CC-AM component of the cationic carrier unit shown in Figure 3.

[0371] Azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (N3-PEG-PLL(Nic / SH)) was synthesized by chemical modification in the presence of EDC / NHS of N3-PEG-PLL and nicotinic acid. N3-PEG-PLL (372 mg, 25.8 μmol) and nicotinic acid (556.7 mg, 1.02 equivalents relative to the NH2 of PEG-PLL) were separately dissolved in a mixture of deionized water and methanol (1:1). EDC·HCl (556.7 mg, 1.5 equivalents relative to the NH2 of N3-PEG-PLL) was added to the nicotinic acid solution, and NHS (334.2 mg, 1.5 equivalents relative to the NH2 of PEG-PLL) was added stepwise to the mixture.

[0372] The reaction mixture was added to the N3-PEG-PLL solution. The reaction mixture was maintained at 37 °C for 16 h with stirring. After 16 h, 3,3'-dithiodipropionic acid (36.8 mg, 0.1 equivalent) was dissolved in methanol, and EDC·HCl (40.3 mg, 0.15 equivalent) and NHS (24.2 mg, 0.15 equivalent) were each dissolved in deionized water. Then, NHS and EDC·HCl were sequentially added to the 3,3'-dithiodipropionic acid solution. After adding the crude N3-PEG-PLL(Nic) solution, the mixture solution was stirred at 37 °C for 4 h.

[0373] For purification, the mixture was dialyzed against methanol for 2 h, DL-dithiothreitol (DTT, 40.6 mg, 0.15 equivalent) was added, and then it was activated for 30 min.

[0374] To remove DTT, the mixture was sequentially dialyzed against methanol, 50% methanol in deionized water, and deionized water.

[0375] (d) Synthesis of Phenylalanine-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercapto propanamide) (Phe-PEG-PLL(Nic / SH)): In this step, the tissue-specific targeting moiety (TM) was conjugated to the WP-CC-AM component synthesized in the previous step. The TM component (phenylalanine) was generated by the reaction of the intermediate generated in step (a) with the product of step (c).

[0376] To target the vascular endothelial tissue of the brain, phenylalanine, an amino acid targeting LAT1, was introduced by a click reaction between N3-PEG-PLL(Nic / SH) and alkyne-modified tyrosine in the presence of a copper catalyst. Briefly, N3-PEG-PLL(Nic / SH) (130 mg, 6.5 μmol) and alkyne-modified phenylalanine (5.7 mg, 4.0 equivalents) were dissolved in deionized water (or 50 mM sodium phosphate buffer). Then, CuSO4·H2O (0.4 mg, 25 mol%) and Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 3.4 mg, 1.2 equivalents) were dissolved in deionized water, and the N3-PEG-PLL(Nic / SH) solution was added. Then, sodium ascorbate (3.2 mg, 2.5 equivalents) was added to the mixture solution. The reaction mixture was maintained with stirring at room temperature for 16 h. After the reaction, the mixture was transferred to a dialysis membrane (MWCO = 7,000) and dialyzed against deionized water for 1 day. The final product was obtained after lyophilization. Figure 4 shows the 1 characterization by 1H-NMR of the carrier unit.

[0377] Example 2 Preparation of Polyion Complex (PIC) Micelles Once the cationic carrier unit of the present disclosure was prepared as described in Example 1, micelles were prepared. The micelles described in the examples of the present invention included a cationic carrier unit combined with an antisense oligonucleotide payload.

[0378] Nanoscale PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA. PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at a concentration of 0.5 mg / mL. Then, the miRNA solution (22.5 μM) in RNase-free water was mixed with the polymer solution at a miRNA-to-polymer ratio of 2:1 (v / v).

[0379] The mixing ratio of polymer to anti-miRNA was determined by optimizing the micelle formation conditions, i.e., the ratio of amine in the polymer (the carrier of the present disclosure) to phosphate in the anti-miRNA (the payload). The mixture of the polymer (carrier) and anti-miRNA (payload) was vigorously mixed by multi-vortex at 3000 rpm for 90 seconds and maintained at room temperature for 30 minutes to stabilize the micelles.

[0380] The particle size distribution and scattered light intensity (SLI) were measured by a Zeta-sizer at a wavelength of 634 nm. Figure 9 shows the particle size distribution of polyion complex micelles loaded with miRNA in PBS. The micelles loaded with anti-miRNA showed a particle size of less than 60 nm with a low PDI distribution, indicating that the complexes are uniform particles. As shown in Figure 9, the peak of the distribution was 32 nm.

[0381] The micelles (anti-miRNA concentration of 10 μM) were stored at 4 °C before use. MeO- or Phe-micelles were prepared using the same method, and micelles containing different amounts of Phe (25% - 75%) were also prepared by mixing both polymers during micelle preparation.

[0382] Example 3 Brain targeting using LAT1 and phenylalanine To deliver the micelles of the present disclosure across the BBB, LAT1 was selected as the target molecule. As shown in Figure 10, in humans, LAT1 was preferentially expressed in the brain. Figure 11 shows that LAT1 was also preferentially expressed in brain tissue in mice.

[0383] To investigate the feasibility of realizing the passage of the blood-brain barrier using the LAT1 protein, Cy5.5 dye or Cy5.5-labeled phenylalanine was intraventricularly administered to mice (n = 3), and the fluorescence intensity of brain solubilizates was analyzed 1 hour after injection. For measurement, Cy5.5 was labeled by a click reaction using alkyne-modified tyrosine and N3-Cy5.5.

[0384] Cy5.5-labeled phenylalanine or N3-Cy5.5 (Cy5.5 concentration of 20 μg) was separately administered by intraventricular injection, and the same volume of PBS was also injected as a control. 1 hour after injection, all mice (n = 3) were sacrificed, and the remaining blood for perfusion was washed with 5 mL of PBS. The brains of the mice were removed and homogenized with lysis buffer using a probe-type sonicator. The solubilizate samples were transferred to a 96-well plate, and the fluorescence intensity was measured at Ex / Em = 650 / 690 using a multiplate reader.

[0385] The fluorescence-labeled (Cy5.5) carrier unit targeted to the brain was actually able to bind to LAT1 expressed in the brain parenchyma and showed a higher accumulation level than non-targeted Cy5.5 molecules. See Figure 12.

[0386] The polyion complex micelles loaded with anti-miRNA targeted to LAT1 (i.e., the micelles of the present disclosure) were able to pass through the BBB and were significantly accumulated in the brain compared to non-targeted micelles.

[0387] Example 4 In vivo stability of the micelles of the present disclosure The in vivo stability of the micelles disclosed in this specification was evaluated by measuring the circulating blood behavior after systemic injection of the micelles. Micelles loaded with Cy5.5-labeled miRNA and naked Cy5.5-labeled miRNA (miRNA concentration of 20 μg) were systemically injected into mice, and 120 μL of blood was collected from the tail vein at the desired time points. The blood samples were centrifuged at 2,500 rpm, and the supernatant plasma samples were transferred to 96-well plates. The residual fluorescence intensity of the plasma was analyzed at Ex / Em = 650 / 690 using a multiplate reader.

[0388] Encapsulation of the anti-microRNA payload into the micelles of the present disclosure resulted in increased stability. See Figure 8. Under control conditions, the anti-microRNA (antimiR) had a plasma half-life of less than 5 minutes. However, after the incorporation of the anti-miRNA into the micelles of the present disclosure, the plasma half-life increased to 80 - 120 minutes. The stability of the micelles was not affected by the loading of different anti-miRNAs. The micelles without the carrier unit containing antimiR were as stable as those having carrier units forming complexes with 25% or 50% antimiR.

[0389] Example 5 Experiment in Alzheimer's disease model (i) Materials and methods (a) Mice: 5XFAD APP transgenic mice (stock number: 34840-JAX) were purchased from the Jackson Laboratory. TG and age-matched wild-type (WT) littermates were used in the experiments. All animals were housed individually in cages under a 12 / 12-hour light / dark cycle, with temperature, humidity, diet, and water controlled. 5xFAD mice, also known as APP / PS1, Tg6799, or Tg-5xFAD, are an animal model system for Alzheimer's disease. 5xFAD mice express human APP and PSEN1 transgenes with a total of five AD-related mutations as follows: the Swedish (K670N / M671L), Florida (I716V), and London (V717I) mutations in APP, and the M146L and L286V mutations in PSEN1. Originally, three lines, Tg6799, Tg7031, and Tg7092, were generated. The Tg6799 line, which expresses the highest level of mutant APP, has been the most studied of the three. These widely used mice reproduce many AD-related phenotypes and have relatively early and active symptoms.

[0390] Amyloid plaques associated with gliosis are observed in young mice at 2 months of age. Amyloid pathology is more severe in females than in males. Neuronal loss occurs in multiple brain regions and begins at approximately 6 months in the regions with the most prominent amyloidosis. The mice exhibit various cognitive and motor impairments.

[0391] Three human transgenes, APP(Swe), PS1(M146V), and tau(P301L), were purchased from the Jackson Laboratory. The 3xTg-AD mice were generated on a C57BL6 / 129SvJ hybrid background. Mice were housed at 4 - 5 per cage and maintained on a 12-hour light / dark cycle, and mice had free access to food and water. The translation of the overexpressed transgenes appears to be restricted to regions associated with Alzheimer's disease, including the central nervous system, particularly the hippocampus and cerebral cortex. The initial characterization of this mouse strain demonstrated a progressive increase in amyloid-β peptide deposition, with intracellular immunoreactivity detected in some brain regions as early as 3 - 4 months. Synaptic transmission and long-term potentiation are clearly impaired in 6-month-old mice. Between 12 - 15 months, higher-order structures change and aggregates of hyperphosphorylated tau are detected in the hippocampus. This mutant mouse shows plaque and tangle pathologies associated with synaptic dysfunction, similar to those observed in Alzheimer's disease patients.

[0392] (b) ASO-MDS treatment (intravenous injection): For intravenous (IV) injection, miR-485-3p antagomiR (antimiR) or negative control (miR and micelles only) within the micelles (ASO-MDS) of the present disclosure was prepared. All treatments of 8-month-old 5XFAD mice were achieved by intravenous injection of 1.5 mg / kg of ASO-MDS on days 7, 14, 21, and 28. See Figure 17.

[0393] (c) Immunohistochemistry: For immunohistochemistry, the brains were removed, post-fixed, and embedded in paraffin. Coronal sections (10 μm thick) passing through the infarct were prepared using a microtome and mounted on glass slides. Paraffin was removed, and the sections were washed with PBS-T and blocked with 10% bovine serum albumin for 2 h. Then, the following primary antibodies were added: rabbit anti-β-amyloid (1–42) (Cell Signaling Technology, Cat#14974), mouse anti-GFAP (Merck, Cat#MAB360), rabbit anti-IL-1β (Abcam, Cat#9722), mouse anti-TNF-α (Santa Cruz, Cat#sc-52746), anti-actin (Santa Cruz, Cat#sc-47778). After the behavioral tests, the hippocampal and cortical regions were dissected from the H / I mice, and the brain tissues were homogenized in ice-cold RIPA buffer containing protease inhibitors. The homogenate was centrifuged at 12,000 rpm for 30 min at 4 °C, and the supernatant was collected. The results were visualized using an enhanced chemiluminescence system and quantified by densitometric analysis (Image J software, NIH). All experiments were performed independently at least three times.

[0394] (d) Behavioral tests (Y maze and passive avoidance): The Y maze consisted of three black opaque plastic arms (30 cm × 8 cm × 15 cm) that were 120° apart from each other. The 5XFAD mice were placed in the center, and all three arms were explored. The number of arm entries and the number of trials (the criterion for alternation behavior was three different arm entries 10 cm from the center) were recorded to calculate the alternation rate. An entry was defined as all three outer limbs being inside the arms of the Y maze. Alternation behavior was defined as the number of trials divided by the number of arm entries minus 2 and multiplied by 100. The chamber for the passive avoidance test was divided into a white (light) compartment and a black (dark) compartment (41 cm × 21 cm × 30 cm). The light compartment was equipped with a 60-W light bulb. The floor (of the dark chamber) was equipped with a number of (2 mm) stainless steel rods arranged at 5-mm intervals. The tests were conducted for 3 days.

[0395] On the first day, the mice were acclimated in the light compartment for 5 minutes. The second day consisted of a two-step training phase. In the first step, each mouse was placed in the light compartment and moved to the dark compartment twice. One hour after the first step, each mouse was placed in the light compartment. The door separating the two compartments was opened after 30 seconds. When the mouse entered the dark compartment, the door was closed and an electric shock to the foot (0.3 mA / 10 g) was applied through the grid floor for 3 seconds. If the mouse did not enter the dark compartment for more than 5 minutes, it was considered learned, and the training was performed up to 5 times. Twenty-four hours after the training test, the mice were placed in the light chamber for the test. Latency was defined as the time it took for the mouse to enter the dark chamber after the door separating the two compartments was opened. The time it took for the mouse to enter the dark compartment and exit the light compartment was defined as TDC (time required in the dark compartment).

[0396] (e) Data analysis: All data were expressed as mean ± standard deviation. Post hoc comparisons (Student-Newman-Keuls test) were performed using Prism 8. Behavioral tests were evaluated by nonparametric statistical procedures. Comparisons between three groups (control (miR only and micelle only) vs. HI-485-3p) were analyzed by the Mann-Whitney U test.

[0397] (ii) Results miRNA-485-3p can be increased in patients with Alzheimer's disease and cause, for example, inflammation, changes in mitochondrial function, and apoptosis. See FIG. 23. Accordingly, the micelles of the present disclosure loaded with an antimiR targeting miRNA-485-3p were administered to a mouse model of Alzheimer's disease. These micelles containing antimiR-485-3p are referred to in the figures and throughout the present application as "ASO-MDS" (antisense oligonucleotide-micelle delivery system) or "micelle + antimiR-485-3p".

[0398] After ASO-MDS micelles were injected weekly for four weeks into 8-month-old 5XFAD transgenic mice, it was observed that neuroinflammation was reduced in the cortex and hippocampus of the 5XFAD mice after injection. See Figures 19A, 19B, 20A, and 20B. Furthermore, administration of ASO-MDS micelles caused a decrease in amyloid plaque burden. See Figures 21A and 21B. Treatment with ASO-MDS also resulted in the restoration of neurogenesis. See Figures 22A and 22B. In addition to the improvements in inflammation, amyloid plaque burden, and neurogenesis, treatment with ASO-MDS also improved cognitive function as shown by the Y-maze and passive avoidance tests. See Figures 23A and 23B.

[0399] ASO-MDS showed a significantly higher percentage of alternation, namely, approximately 80% alternation, while the negative control showed approximately 50% in the Y-maze test. See Figure 23A. ASO-MDS also showed a significantly shorter dark compartment residence time (seconds) compared to the negative control.

[0400] Example 6 K-Ras Silencing in Pancreatic Cancer To determine whether the micelles of the present disclosure can be used to effectively deliver anti-cancer therapy (see Figure 25), the micelles of the present disclosure were targeted to human pancreatic cells using (i) conventional cRGD tumor targeting with a peptide ligand or (ii) an alternative targeting strategy (X-target). The payload of the micelles was an antisense oligonucleotide targeting K-Ras.

[0401] Ten days after injection of Panc1 cells into mice, pancreatic tumor mice (n = 3) were established. Panc1 is a human cell line used as a pancreatic cancer model. This cell line was established from ductal-derived pancreatic adenocarcinoma (epidermoid carcinoma). The cells have B-type phenotype G6PD. Lieber M, et al. “Establishment of a continuous tumor-cell line (panc-1) from a human carcinoma of the exocrine pancreas.” Int. J. Cancer 15:741-747, 1975. The above two kinds of micelles were intravenously injected three times once a day. Refer to Figure 26A. After removing the tumor, the gene silencing effect was evaluated by RT-PCR.

[0402] Administration of micelles with a conventional cRGD tumor-targeting peptide ligand resulted in approximately 20% knockdown of K-Ras. In contrast, administration of micelles using an alternative X-target system resulted in an approximately 50% gene knockdown effect. Refer to Figure 26B.

[0403] Example 7 Intracellular uptake behavior of ASO-MDS in human brain cells Human primary microglia, astrocytes, hepatocytes, and SH-5Y cells were seeded in 6-well plates overnight. The cells were treated with 100 nM Cy5.5-labeled ASO-MDS. The uptake of ASO-MDS in the cells was measured every hour for a total of 48 hours. The uptake ability was calculated by tracking the percent culture density of the wells using an Incucyte S3 instrument.

[0404] To investigate the uptake ability according to cell type, Cy5.5-labeled ASO-MDS was prepared and the ASO-MDS stock solution was diluted with PBS. The uptake of ASO-MDS increased in human primary microglia, astrocytes, and SH-5Y cells, but not in human primary hepatocytes (Figure 13). This indicated that ASO-MDS can be specifically delivered to brain cells.

[0405] Example 8 In vitro LAT1 targeting of micelles loaded with anti-microRNA To evaluate the targeting of LAT1 by ASO-MDS micelles, GL-26 cells were used. GL-26 cells were seeded in 96-well plates with DMEM containing 10% FBS and 1% P / S. The following four types of samples were used: (i) cells incubated with ASO-MDS targeted to LAT1 (“targeted micelles”), (ii) cells incubated with ASO-MDS not targeted to LAT1 (“non-targeted micelles”), (iii) a sample similar to (i) but with LAT1 in the cells inhibited by pre-incubation with phenylalanine (“targeted micelles / inhibitor”), and (iv) a sample similar to (ii) but with LAT1 activity in the cells inhibited by pre-incubation with phenylalanine (“non-targeted micelles / inhibitor”).

[0406] After a 24-hour incubation at 37 °C for 1 day, the medium was replaced with fresh medium, and 1 mM free phenylalanine was added to samples (iii) and (iv) to inhibit LAT1. The cells were then incubated for an additional 1 hour, and micelles (ASO-MDS) loaded with Cy5.5-labeled anti-microRNA were added at an RNA concentration of 300 nM. The medium was removed, the cells were washed twice with PBS, and 100 μL of PBS was added to each well. The remaining fluorescence intensity of the cells was measured using a microplate reader at an excitation wavelength of 650 / emission wavelength of 690.

[0407] The remaining fluorescence intensity of the cells treated with the targeted micelles was approximately 3-fold higher than the fluorescence of the cells treated with the non-targeted micelles. This indicates that the uptake of Cy5.5-labeled anti-microRNA increased when the ASO-MDS micelles were targeted to LAT1.

[0408] When cells treated with either targeted or non-targeted ASO-MDS were pre-incubated with the LAT1 inhibitor, there was no significant difference in the intracellular uptake of Cy5.5-labeled anti-microRNA (Figure 14). This indicated that when LAT1 was inhibited by phenylalanine, the targeting of ASO-MDS micelles to LAT1 was not sufficient to increase the uptake of Cy5.5-labeled anti-microRNA by cells. In other words, the LAT1-mediated uptake of the payload encapsulated in the micelles of the present disclosure, where the micelles are targeted to LAT1, is dependent on the functional state of LAT1.

[0409] Example 9 In vivo distribution of micelles loaded with anti-microRNA The in vivo distribution of anti-microRNA was measured using an IVIS live animal imaging station. For naked anti-microRNA and micelles loaded with anti-microRNA (ASO-MDS), both samples (RNA concentration of 25 μg) were administered to mice by tail vein injection to compare the temporal differences in anti-microRNA distribution. Fluorescent images of the mice were acquired at the desired time points using an IVIS live animal imaging station and observed for 16 hours.

[0410] The remaining fluorescence intensity of mice treated with naked anti-microRNA showed rapid localization to the kidneys, and the signal almost disappeared within 4 hours. In the case of micelles loaded with anti-microRNA (ASO-MDS), the fluorescence intensity was mainly localized in the brain, liver, and kidneys. The fluorescence increased gradually in the kidneys until 6 hours and decreased over time. These results indicated that naked anti-microRNA was excreted quickly (within 4 hours) by urine due to its small molecular size. On the other hand, micelles loaded with anti-microRNA (ASO-MDS) showed prolonged circulation, accumulated in the brain region until 16 hours, and the remaining anti-microRNA was excreted by urine. See Figure 15.

[0411] Example 10 In Vitro Phagocytosis Assay (ELISA and Immunocytostaining) Primary mixed glial cells (2×10 5 cells) or human primary microglial cells (2×10 5 cells) were cultured overnight in 6-well plates. The cells were treated with ASO-MDS for 4 hours together with fAβ at a final concentration of 1 μM. The level of human Aβ (1-42) in the supernatant was measured using a human Aβ42 ELISA kit (Invitrogen, Cat#KHB3441) according to the manufacturer's instructions.

[0412] In addition, phagocytosis of human primary microglial cell...

Claims

【Claim 1】 The invention described in the specification.

Citation Information

Patent Citations

  • Improved hybrid telodendrimers

    WO2018053316A1