Anti-type i allergy agent, Anti-type i allergy composition, method for producing Anti-type i allergy agent, method for producing composition for Anti-type i allergy, and method for use in Anti-type i allergy

Combining lactic acid bacteria NITE P-755 with daidzein creates a synergistic anti-type I allergy agent that effectively suppresses IgE receptor and Dock5 expression, addressing the rising incidence of type I allergies.

JP2025118040APending Publication Date: 2025-08-13LAB BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024013112
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-01-31
Publication Date
2025-08-13

AI Technical Summary

Technical Problem

The increasing prevalence of type I allergies, such as hay fever and atopic dermatitis, necessitates the development of effective anti-type I allergy agents and compositions.

Method used

Combining lactic acid bacteria identified by accession number NITE P-755 with daidzein, a type of polyphenol, to create an anti-type I allergy agent and composition that synergistically reduces IgE receptor expression and Dock5 activity in mast cells.

Benefits of technology

The combination of lactic acid bacteria NITE P-755 and daidzein significantly suppresses IgE receptor and Dock5 expression, demonstrating a potent anti-type I allergy effect without cytotoxicity, offering a novel and effective treatment for allergic symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025118040000002
    Figure 2025118040000002
  • Figure 2025118040000003
    Figure 2025118040000003
  • Figure 2025118040000004
    Figure 2025118040000004
Patent Text Reader

Abstract

To provide an anti-type I allergy agent, an anti-type I allergy composition, a method for producing an anti-type I allergy agent, a method for producing an anti-type I allergy composition, and a method for use in anti-type I allergy, which exhibit synergistic and pronounced anti-type I allergic effects through the combination of lactic acid bacteria and daidzein, one kind of polyphenol.SOLUTION: An anti-type I allergy agent has, as active ingredients, lactic acid bacteria specified by deposit number NITE P-755 and daidzein or a salt thereof.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to an anti-type I allergy agent, a composition for anti-type I allergy, a method for producing an anti-type I allergy agent, a method for producing a composition for anti-type I allergy, and a method for using the composition for anti-type I allergy. [Background technology]

[0002] In Japan, type I allergies such as hay fever, atopic dermatitis, and food allergies have been increasing rapidly in recent years, and according to a survey by the Ministry of Health, Labor and Welfare, half of the population is reported to suffer from some form of allergic symptoms.

[0003] Mast cells, which play a major role in causing type I allergies, are stem cells derived from bone marrow and are distributed throughout most tissues of the body. IgE, which recognizes allergens such as pollen, activates mast cells by binding to IgE receptors on their surface, causing degranulation and the release of inflammatory cytokines such as histamine, which leads to allergic symptoms such as itching and swelling.

[0004] In recent years, the suppressive effects of various food ingredients on allergic symptoms have been reported. Among these, the effectiveness of probiotics such as lactic acid bacteria and food ingredients with anti-inflammatory properties such as polyphenols has been particularly evident.

[0005] Non-Patent Document 1 discloses the suppression of allergies associated with human mast cells by four types of probiotic bacteria, including Lactobacillus rhamnosus. Non-Patent Document 2 discloses that the polyphenols quercetin and resveratrol inhibit human and mouse mast cells. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Probiotic Lactobacillus rhamnosus downregulates FCER1 and HRH4expression in human mast cells.World J Gaatroenterol.2011 Feb 14;17(6):750-759. [Non-patent document 2] Quercetin and Resveratrol Differentially Decrease Expression of the High-Affinity IgE Receptor(FcεRI) by Human and Mouse Mast Cells.Molecules.2022 Oct;27(19):6704. Summary of the Invention [Problem to be solved by the invention]

[0007] As the number of people suffering from type I allergies increases year by year, there has been a demand for the development of new anti-type I allergy agents and anti-type I allergy compositions.

[0008] The present invention has been made in view of the above circumstances, and aims to provide an anti-type I allergy agent that has a synergistic and significant anti-type I allergy effect by combining lactic acid bacteria with daidzein, a type of polyphenol, an anti-type I allergy composition, a method for producing an anti-type I allergy agent, a method for producing an anti-type I allergy composition, and a method for using the composition for anti-type I allergy. [Means for solving the problem]

[0009] In order to achieve the above object, the anti-type I allergy agent according to the first aspect of the present invention comprises: The active ingredients are lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof.

[0010] The anti-type I allergy composition according to the second aspect of the present invention comprises: The active ingredients are lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof.

[0011] A method for producing an anti-type I allergy agent according to a third aspect of the present invention comprises: The method includes a step of adding lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof.

[0012] A method for producing an anti-type I allergy composition according to a fourth aspect of the present invention comprises: The method includes a step of adding lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof.

[0013] The method for anti-type I allergy according to the fifth aspect of the present invention comprises: This method uses lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof for the purpose of preventing type I allergy. [Effects of the Invention]

[0014] According to the present invention, it is possible to provide an anti-type I allergy agent having a synergistic and significant anti-type I allergy effect by combining lactic acid bacteria with daidzein, a type of polyphenol, an anti-type I allergy composition, a method for producing an anti-type I allergy agent, a method for producing an anti-type I allergy composition, and a method for using the composition for anti-type I allergy. [Brief explanation of the drawings]

[0015] [Figure 1] FIG. 1 is a graph showing the amount of IgE receptor α-chain mRNA expression measured in each test group. [Figure 2] FIG. 1 is a graph showing the mRNA expression level of the IgE receptor γ chain in each test group. [Figure 3] FIG. 1 is a graph showing the measurement of the expression level of Dock5 mRNA in each test group. [Figure 4] FIG. 1 is a graph showing the results of measuring the survival rate of KU812 cells in each test group. DETAILED DESCRIPTION OF THE INVENTION

[0016] (1. Anti-type I allergy agent / composition for anti-type I allergy) The anti-type I allergy agent or anti-type I allergy composition of the present invention (hereinafter referred to as the anti-type I allergy agent / composition of the present invention) contains, as active ingredients, a lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof.

[0017] The "lactic acid bacterium identified by accession number NITE P-755" contained in the anti-type I allergy agent / composition of the present invention was deposited under accession number NITE P-755 at the Patent Microorganisms Depositary Center of the National Institute of Technology and Evaluation, located at 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, on May 14, 2009. In this specification, the lactic acid bacterium identified by accession number NITE P-755 may be referred to as "Pediococcus sp. KB1" or "KB1." For details of the culture conditions, bacteriological properties, and other aspects of the lactic acid bacterium of the present invention, see Japanese Patent Application Laid-Open No. 2011-41499.

[0018] As a result of intensive research, the present inventors have discovered that "lactic acid bacteria identified by Accession No. NITE P-755," which have immunostimulatory activity and resistance to gastric juice, have a novel use in that they exert an anti-type I allergy effect, and furthermore, that when used in combination with daidzein, a type of polyphenol, the anti-type I allergy effect is surprisingly synergistically enhanced, leading to the present invention. It is particularly noteworthy that, among the many polyphenols that exist, only daidzein can exert a remarkable anti-type I allergy effect when combined with "lactic acid bacteria identified by Accession No. NITE P-755."

[0019] In the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" may be live cells, killed cells, treated cells, or a mixture thereof. It may also be a part of the cell, such as the cell membrane or cytoplasm. Here, live cells refer to live lactic acid bacteria, and include culture solutions of lactic acid bacteria, suspensions of the culture solutions, crude products, purified products, and cell powders obtained by drying live lactic acid bacteria by freeze-drying, spray-drying, or the like, without limitation, as long as they are live. Furthermore, killed cells refer to lactic acid bacteria that have been sterilized by subjecting live lactic acid bacteria to physical or chemical treatment, such as heat treatment or radiation treatment, and include cell powders obtained by drying sterilized lactic acid bacteria by freeze-drying, spray-drying, or the like, without limitation, as long as they are killed. The treated bacterial cells refer to disrupted bacterial cells obtained by homogenizing, enzymatically treating, ultrasonicating, etc., and also include powder of disrupted bacterial cells obtained by drying the disrupted bacterial cells by freeze-drying, spray-drying, etc. The "lactic acid bacteria identified by Accession No. NITE P-755" contained in the anti-type I allergy agent / composition of the present invention is preferably in the form of live bacterial cells, killed bacterial cells, treated bacterial cells, or a mixture thereof.

[0020] In the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" can be cultured under the culture conditions described in JP 2011-41499 A. The lactic acid bacteria can be grown by culturing them in any medium suitable for the growth of the lactic acid bacteria strain (e.g., MRS medium, LBS medium, Rogosa medium, etc.) at a predetermined temperature for a predetermined period of time. After culturing, the bacterial cells can be harvested, for example, by centrifuging the culture (culture solution) under predetermined conditions. The "lactic acid bacteria identified by Accession No. NITE P-755" used in the present invention may also be cultured (fermented) in the presence of ingredients such as milk, vegetables, fruits, soy milk, etc. As described above, the bacterial cells can be harvested by centrifugation after culturing. In the present invention, the culture (fermented product) obtained in this manner, the harvested bacterial cells, a suspension or concentrate of the culture or bacterial cells, or a powder obtained by drying the culture, bacterial cells, suspension, or concentrate by freeze-drying, spray-drying, or the like can also be used. These preparations can be carried out according to methods known in the art.

[0021] Daidzein contained in the anti-type I allergy agent / composition of the present invention is a compound having the following structural formula: Daidzein may be synthesized, commercially available, or extracted from any plant. [ka]

[0022] In this specification, salts of daidzein include, for example, inorganic salts with sodium, magnesium, potassium, calcium, aluminum, etc.; salts with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts with basic amino acids such as lysine, ornithine, arginine, etc.; and ammonium salts. The salts may be acid addition salts, and specific examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, ethanesulfonic acid, etc.; and acidic amino acids such as aspartic acid, glutamic acid, etc.

[0023] As used herein, the term "anti-type I allergy" refers to the exertion of preventive or therapeutic effects against various diseases or symptoms caused by type I allergy. As used herein, "prevention" of a disease or symptom includes suppressing or delaying the onset of the disease or symptom, and suppressing its recurrence, while "treatment" of a disease or symptom includes not only complete treatment of the disease or symptom, but also alleviating symptoms and suppressing its progression.

[0024] Diseases or symptoms to which the anti-type I allergy agent or composition of the present invention is applicable include, but are not limited to, atopic dermatitis, allergic rhinitis, hay fever, allergic dermatitis, bronchial asthma, hives, allergic conjunctivitis, anaphylactic shock, discomfort caused by allergens (runny nose, stuffy nose, itchy feeling, sneezing, itchy eyes, etc.), etc. In the present specification, allergens include, but are not limited to, house dust, dirt, pollen (cedar, cypress, alder, white birch, Japanese sawara, ragweed, mugwort, Chinese knotweed, grass plants, etc.), dust mites, mold, bacteria, and animal dander.

[0025] The anti-type I allergy agent / composition of the present invention may exert its anti-type I allergy effect, for example, by acting on the IgE receptor, which is the receptor for immunoglobulin E (IgE), the cause of allergies. In mast cells, the IgE receptor is composed of an α chain, a β chain, and a dimerized γ chain. The α chain binds to the Fc region of the IgE antibody in the extracellular domain, the β chain affects the strength of intracellular transmission of IgE antibody-mediated stimuli, and the γ chain is responsible for intracellular signal transduction. The anti-type I allergy agent / composition of the present invention may exert its anti-type I allergy effect, for example, by reducing the expression level and / or number of IgE receptors. For example, it may exert its anti-type I allergy effect by reducing the expression level of the α chain of the IgE receptor, or it may exert its anti-type I allergy effect by reducing the expression level of the γ chain of the IgE receptor. Therefore, this specification also discloses an IgE receptor inhibitor for mast cells, an inhibitor of the α-chain expression of the IgE receptor for mast cells, or an inhibitor of the γ-chain expression of the IgE receptor for mast cells, which contain, as active ingredients, the lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof, and these can also exert a high anti-type I allergy effect.

[0026] The anti-type I allergy agent or composition of the present invention may exert its anti-type I allergy effect by, for example, acting on Dock5 (Dedicator of cytokinesis 5), a factor that controls degranulation via Akt phosphorylation in response to signal transduction from IgE receptors. It has been shown that Dock5-deficient mast cell lines and knockout mice produce very little histamine even when antigens are added. The anti-type I allergy agent or composition of the present invention may exert its anti-type I allergy effect by, for example, reducing the expression level of Dock5. Therefore, the present specification also discloses an inhibitor of Dock5 expression in mast cells, which contains as active ingredients lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof, and which can similarly exert a strong anti-type I allergy effect.

[0027] The anti-type I allergy agent / composition according to the present invention is administered to a subject requiring the therapeutic or preventive effect of anti-type I allergy, for example, mammals such as rodents including mice, rats, hamsters, and guinea pigs, primates including humans, chimpanzees, and rhesus monkeys, livestock including pigs, cows, goats, horses, and sheep, and pets including dogs and cats. The preferred subject is humans.

[0028] The method of administration of the anti-type I allergy agent / composition of the present invention can be appropriately selected from oral administration, external application, topical administration, intravenous administration, intraperitoneal administration, intradermal administration, sublingual administration, etc. The dosage form may also be any, and an appropriate drug delivery system (DDS) may be used. These dosage forms are produced by formulating the active ingredient using conventional methods. Furthermore, various pharmaceutically acceptable pharmaceutical substances can be blended as needed for the formulation. Pharmaceutical substances can be appropriately selected depending on the dosage form of the formulation, and examples include buffering agents, surfactants, stabilizers, preservatives, excipients, diluents, additives, disintegrants, binders, coating agents, lubricants, glidants, flavoring agents, sweeteners, solubilizers, etc.

[0029] The anti-type I allergy agent / composition of the present invention can be prepared into various formulations by mixing it with a base or carrier commonly used in pharmaceuticals or quasi-drugs, and, if necessary, with additives commonly used in pharmaceuticals or quasi-drugs (e.g., surfactants, stabilizers, antioxidants, colorants, dispersants, chelating agents, pH adjusters, preservatives, thickeners, irritation reducers, etc.) according to conventional methods, followed by emulsification or solubilization as necessary. In addition to the essential components of the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" and daidzein or a salt thereof, optional components (e.g., other anti-allergy agents, anti-inflammatory agents, cooling agents, disinfectants, vitamins, organic acids, moisturizing ingredients, polyhydric alcohols, scrubbing agents, UV-absorbing ingredients, UV-scattering ingredients, astringent ingredients, peptides or derivatives thereof, amino acids or derivatives thereof, cleansing ingredients, keratin softening ingredients, cell activating ingredients, blood circulation promoting ingredients, powders, etc.) within the scope of the present invention.

[0030] The dosage and frequency of administration of the anti-type I allergy agent / composition of the present invention can be appropriately determined by a person skilled in the art depending on the type of disease or symptom, the patient's health condition, age, weight, administration route, administration form, etc., so that an effective amount is administered to the patient.

[0031] The anti-type I allergy agent or composition according to the present invention may be ingested, for example, as a food or drink. Specific examples of foods and drinks include soft drinks, energy drinks, health foods, foods for specified health uses, functional foods, functionally active foods, nutritional supplements, supplements, and health foods or supplementary foods including beverages. By orally ingesting the anti-type I allergy agent or composition according to the present invention, for example, on a daily basis, an effective anti-type I allergy effect can be obtained.

[0032] (2. Method for producing an anti-type I allergy agent or anti-type I allergy composition) The method for producing the anti-type I allergy agent or anti-type I allergy composition of the present invention comprises the step of adding lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof. Details of the lactic acid bacteria, daidzein or a salt thereof, and "anti-type I allergy" according to the present invention are the same as those described above.

[0033] The production method of the present invention will be described below by way of an example. A predetermined amount of killed lactic acid bacteria identified by accession number NITE P-755 and a predetermined amount of daidzein are added to, for example, a predetermined solution, semi-solid, or solid (e.g., powder, granules, etc.) and mixed to obtain an anti-type I allergy agent or anti-type I allergy composition.

[0034] The present invention also includes an anti-type I allergy agent or anti-type I allergy composition obtained by the above-mentioned production method.

[0035] (3. Methods Used for Anti-Type I Allergy) The method according to the present invention is a method for using lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof for anti-type I allergy. Details of the lactic acid bacteria, daidzein or a salt thereof, and "anti-type I allergy" according to the present invention are the same as those described above.

[0036] In the method according to the present invention, for example, an agent or composition containing as active ingredients the lactic acid bacterium identified by Accession No. NITE P-755 and daidzein or a salt thereof can be used for, for example, atopic dermatitis, allergic rhinitis, hay fever, allergic dermatitis, bronchial asthma, urticaria, allergic conjunctivitis, anaphylactic shock, and discomfort caused by allergens (runny nose, stuffy nose, itchy feeling, sneezing, itchy eyes, etc.). The method according to the present invention can achieve a high anti-type I allergy effect, and can provide a high therapeutic or preventive effect for the above allergic symptoms or allergic diseases.

[0037] (4. Conclusion) As described above, the present invention provides an anti-type I allergy agent, anti-type I allergy composition, method for producing an anti-type I allergy agent, method for producing an anti-type I allergy composition, and method for using the agent for anti-type I allergy, which exhibit a synergistic anti-type I allergy effect by combining lactic acid bacteria and daidzein. While lactic acid bacteria alone or polyphenols alone have not previously been effective against type I allergies, the inventors of the present invention have discovered through extensive research that combining daidzein with "lactic acid bacteria identified by accession number NITE P-755" exhibits a synergistic and significant anti-type I allergy effect, leading to the present invention. It is noteworthy that, among the many polyphenols available, only daidzein exhibits a high anti-type I allergy effect when combined with "lactic acid bacteria identified by accession number NITE P-755." Given the increasing number of people suffering from type I allergy symptoms or diseases, the present invention is expected to be useful as a novel and effective anti-type I allergy agent or composition. [Example]

[0038] The present invention will be specifically described below with reference to examples, although the present invention is not limited to these examples.

[0039] (A. Effect on IgE receptor mRNA expression level) The anti-type I allergy effect of the combination of lactic acid bacteria Pediococcus sp. KB1 (NITE P-755) and daidzein was examined by measuring the mRNA expression level of IgE receptor (FcεRI).

[0040] The IgE receptor is a receptor for immunoglobulin E (IgE), which causes allergies. In mast cells, the IgE receptor is composed of an α chain, a β chain, and a dimeric γ chain. The α chain binds to the Fc region of IgE antibodies in the extracellular domain, the β chain affects the strength of intracellular transmission of IgE-mediated stimuli, and the γ chain is responsible for intracellular signal transduction.

[0041] The mRNA expression levels of the IgE receptor α-chain and γ-chain were measured by real-time PCR as follows.

[0042] (culture) As a mast cell model, KU812 cells (human leukemia cell line) (obtained from the JCRB Cell Bank, National Institutes of Biomedical Innovation, Health and Nutrition), which are highly IgE-expressing cells, were cultured in serum-free medium at 2 × 10 5Cells were seeded at 0.1 cells / mL and cultured with killed cells of the lactic acid bacterium Pediococcus sp. KB1 (NITE P-755) (hereafter referred to as KB1) and / or various polyphenols in each of the following test groups. Specifically, in each of the following test groups, 500 mL of RPMI medium (containing L-glutamine and phenol red, Fujifilm Wako Pure Chemical Industries, Ltd.) was supplemented with 50 mL of inactivated bovine serum (Gibco) and 5 mL of penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd.), and KB1 was added to 100 μg / mL and various polyphenols were added to 100 μM. The culture was then cultured at 37°C and 5% CO2 for 24 hours. The control group received PBS(-) (pH 7.4, 1x phosphate-buffered saline, Nacalai Tesque, Inc.) and DMSO (1 μL).

[0043] (Test area) ·control Control (serum-free) KB1 only Rosmarinic acid only Luteolin only Hesperidin only Ellagic acid only Daidzein only KB1 + Rosmarinic Acid ·KB1+Luteolin KB1 + Hesperidin KB1 + ellagic acid KB1+daidzein

[0044] Details of the various polyphenols are as follows: - Rosmarinic acid: Fujifilm Wako Pure Chemical Industries, Ltd., 95.0+% (HPLC) - Luteolin: Luteolin Cayman Chemical Co., ≥98% - Hesperidin: Fujifilm Wako Pure Chemical Industries, Ltd., 95.0+% (HPLC) - Ellagic acid dihydrate: Fujifilm Wako Pure Chemical Industries, Ltd., 99.0+% (HPLC) - Daidzein: Fujifilm Wako Pure Chemical Industries, Ltd., 96.0+% (HPLC)

[0045] (Real-time PCR) Twenty-four hours after the start of culture, cells were harvested using TRISOL reagent (Invitrogen). After allowing the cells to stand at room temperature for 5 minutes, 200 μL of chloroform was added. After vortexing for 15 seconds, the cells were centrifuged at 12,000 g for 15 minutes at 4°C. 500 μL of 2-propanol was added to 500 μL of the aqueous layer and allowed to stand at room temperature for 10 minutes. After centrifugation at 12,000 g for 10 minutes at 4°C, the supernatant was removed. 1 mL of 75% ethanol (25% DEPC-treated water) was added, and the cells were centrifuged at 12,000 g for 5 minutes at 4°C. After removing the supernatant, the cells were dried in a centrifugal evaporator. After dissolving the cells in 30 μL of DEPC-treated water, the RNA concentration was determined using a BioSpec-nano spectrophotometer (Shimadzu Biotech).

[0046] To prepare cDNA, 20 μL of reaction solution (Oligo dT Primer 1 μL, dNTP Mixture 1 μL, 5x PrimeScript Buffer 4 μL, RNA Inhibitor 0.5 μL, PrimeScript RTase 1 μL, total RNA + RNase-free dH2O 12.5 μL) was prepared, and the enzymatic reaction was carried out under the following conditions: 30°C → 10 minutes, 42°C → 10 minutes, 95°C → 5 minutes, and 4°C → infinity.

[0047] The mRNA expression levels of the IgE receptor α-chain and γ-chain were quantified using the Step One Plus Real-time PCR system (Life Technologies) with TAKARA TB Green Premix Ex Taq™ II (Tli RNase H Plus) and the primers shown below. GAPDH was used as an internal control. FcεRIα Forward: GCAAAGTGTGGCAGCTGGACTA (SEQ ID NO: 1) FcεRIα Reverse: CTGTGTCCACAGCAAACAGAATCA (SEQ ID NO: 2) FcεRIγ Forward: CTCCAGCCCAAGATGATTCCA (SEQ ID NO: 3) FcεRIγ Reverse: GCATCCAGGATATAGCAGAGCTGA (SEQ ID NO: 4) GAPDH Forward: GTCTCTCTGACTTCAACAGCG (SEQ ID NO: 5) GAPDH Reverse: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 6)

[0048] The results of measuring the mRNA expression level of the IgE receptor α-chain are shown in Figure 1. Measurements were made after 24 hours of incubation with the addition of KB1 and / or various polyphenols. Compared to the control (serum-free medium alone), KB1 + rosmarinic acid, KB1 + luteolin, KB1 + hesperidin, and KB1 + daidzein showed a decrease in α-chain mRNA expression. However, only KB1 + daidzein showed a significant decrease, and the degree of decrease was the greatest among the combinations of KB1 and polyphenols. Thus, the synergistic effect of KB1 + daidzein significantly suppressed the expression of the IgE receptor α-chain, demonstrating its strong anti-type I allergy effect.

[0049] The results of measuring the mRNA expression level of the IgE receptor γ-chain are shown in Figure 2. Measurements were made after 24 hours of incubation with KB1 and / or various polyphenols. Compared to the control (serum-free medium alone), KB1 alone, rosmarinic acid alone, luteolin alone, ellagic acid alone, daidzein alone, KB1 + rosmarinic acid, KB1 + ellagic acid, and KB1 + daidzein showed a decrease in γ-chain mRNA expression. However, only KB1 + daidzein showed a significant decrease, and the degree of decrease was the greatest among the combinations of KB1 and polyphenols. Thus, the synergistic effect of KB1 + daidzein significantly suppressed IgE receptor γ-chain expression, demonstrating its potent anti-type I allergy effect.

[0050] (B. Effect on Dock5 mRNA expression level) Next, the anti-type I allergy effect of the combination of KB1 and daidzein was examined by measuring the expression level of Dock5 mRNA.

[0051] Dock5 is a factor that regulates degranulation through the phosphorylation of Akt in response to signaling from the IgE receptor. It has been shown that Dock5-deficient mast cell lines and knockout mice produce very little histamine even when antigen is added.

[0052] The expression level of Dock5 mRNA was measured by real-time PCR as follows.

[0053] As described above, KU812 cells were used as a mast cell model and cultured in the same test group as above, with the addition of killed KB1 cells and / or various polyphenols. The amounts added and culture conditions were also the same as described above.

[0054] Real-time PCR was performed in the same manner as described above, except that the following primers were used, to measure the mRNA expression level of Dock5 γ chain. Dock5 Forward: CCCGACCAAGAGGCAGAAG (SEQ ID NO: 7) Dock5 Reverse: CTGTGTCACCGATCTGCAAG (SEQ ID NO: 8)

[0055] The results of measuring Dock5 mRNA expression are shown in Figure 3. Measurements were made after 24 hours of incubation with the addition of KB1 and / or various polyphenols. Compared to the control (serum-free medium alone), Dock5 mRNA expression levels were reduced in the combinations containing luteolin alone, ellagic acid alone, daidzein alone, KB1 + ellagic acid, and KB1 + daidzein. However, a significant reduction was observed only with KB1 + daidzein, and the degree of reduction was the greatest among the combinations of KB1 and polyphenols. Thus, the synergistic effect of KB1 + daidzein significantly suppressed Dock5 expression, demonstrating its potent anti-type I allergy effect.

[0056] (C. Effects on cell viability) The effect of adding KB1 and / or various polyphenols on the viability of KU812 cells was examined.

[0057] The viability of KU812 cells in each test group was measured after 24 hours of culture in the same manner as above using Cell Counting Kit-8 (Dojindo Laboratories). After culture, 1 × 10 KU812 cells were 5 The solution was adjusted to cells / mL, and 100 μL was seeded into a 96-well microplate. 10 μL of Cell Counting Kit-8 kit solution was then added, and the plate was left in an incubator at 37°C and 5% CO2 for 1 hour for the color reaction to occur. After the reaction was complete, the absorbance was measured at 450 nm using a microplate reader.

[0058] The results are shown in Figure 4. The cell viability was measured after 24 hours of incubation with KB1 and / or various polyphenols. Cell viability was not affected in any of the test groups, and even the combination of KB1 and daidzein did not reduce cell viability. Thus, it was demonstrated that the combination of KB1 and daidzein exhibited a significant anti-type I allergy effect without exhibiting cytotoxicity.

[0059] These findings demonstrate that the combination of KB1 and daidzein exerts a significant anti-type I allergy effect through a synergistic effect. Anti-type I allergy agents and compositions combining KB1 and daidzein are expected to be highly useful in clinical settings.

Claims

1. An anti-type I allergy agent containing as active ingredients a lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof.

2. An anti-type I allergy composition containing as active ingredients a lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof.

3. A method for producing an anti-type I allergy agent, comprising the step of adding a lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof.

4. A method for producing an anti-type I allergy composition, comprising the step of adding lactic acid bacteria identified by accession number NITE P-755 and daidzein or a salt thereof.

5. A method for preventing type I allergy, comprising using a lactic acid bacterium identified by accession number NITE P-755 and daidzein or a salt thereof.