Gene-editing systems for modifying SCN9a or SCN10a gene, and methods of use thereof

Abstract

To provide gene-editing systems which comprise RNA-guided DNA endonuclease and specific guide RNAs; and gene-editing systems to modify a target gene, thereby alleviating pain.SOLUTION: Disclosed herein are highly efficient gene-editing systems for editing a voltage-gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A), either in vitro or in vivo.SELECTED DRAWING: Figure 1A

Description

[Technical Field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 62 / 833,523, filed April 12, 2019, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] Gene editing (including genome editing) is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) are inserted, deleted, and / or replaced in a DNA sequence, such as the genome, of a target cell. Recent gene editing strategies utilizing RNA-guided endonucleases, such as Cas9, enable site-specific DNA modification. However, it has been found that not all RNA-guided endonucleases and guide RNA pairs result in highly efficient editing. Therefore, there remains a significant need to identify effective RNA-guided endonucleases and guide RNA pairs that effectively modify genes of interest. Summary of the Invention

[0003] The present disclosure is based, at least in part, on the development of an efficient gene editing system for modifying voltage-gated sodium channel genes, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). In some embodiments, the gene editing system relies on the identification of effective RNA-guided endonuclease and guide RNA pairs (e.g., as disclosed herein) for the effective modification of voltage-gated sodium channel genes with low off-target occurrence.

[0004] Thus, in some embodiments, the present disclosure relates to a gene editing system for modifying a voltage-gated sodium channel gene, such as SCN9A or SCN10A. Such a gene editing system may include (a) a first polynucleotide portion comprising an RNA-guided DNA endonuclease or a first nucleotide sequence encoding the RNA-guided DNA endonuclease, and (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA).

[0005] In some embodiments, the gene editing system can modify the SCN9A gene and can include (a) a first polynucleotide portion including an RNA-guided DNA endonuclease or a first nucleotide sequence encoding the RNA-guided DNA endonuclease, and (b) a second polynucleotide portion including a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA includes the nucleotide sequence of any one of SEQ ID NOs: 1-20. As used herein, a polynucleotide portion can be an independent nucleic acid molecule. Alternatively, a polynucleotide portion can be part of a nucleic acid molecule that can include one or more additional polynucleotide portions.

[0006] The RNA-guided endonuclease of such a gene editing system may be that of Staphylococcus pyogenes (SpCas9), which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1-10. Alternatively, or additionally, the RNA-guided endonuclease of such a gene editing system may be that of Staphylococcus aureus Cas9 (SaCas9), which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 11-20.

[0007] In some embodiments, the gene editing system can modify the SCN10A gene and can include (a) a first polynucleotide portion comprising an RNA-guided DNA endonuclease or a first nucleotide sequence encoding the RNA-guided DNA endonuclease; and (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 21-40. The RNA-guided endonuclease of such a gene editing system can be SpCas9, which can be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 21-30. Alternatively, or additionally, the RNA-guided endonuclease of such a gene editing system can be SaCas9, which can be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 31-40.

[0008] In some embodiments, the first nucleotide sequence encoding the RNA-guided DNA endonuclease of (a) may further comprise a nucleotide sequence encoding a nuclear localization signal (NLS) fused in-frame to the RNA-guided DNA endonuclease. In some embodiments, the NLS is an SV40 NLS.

[0009] In some embodiments, the second nucleotide sequence of (b) may further comprise a scaffold sequence. In some examples, the scaffold sequence may be recognized by SaCas9. Such a scaffold sequence may comprise the nucleotide sequence GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). In other examples, the scaffold sequence may be recognized by SpCas9. Because the second nucleotide sequence encoding the gRNA may be either a DNA sequence or an RNA sequence, it should be understood that any uracil (U) in this sequence may be replaced with a thymine (T).

[0010] In some embodiments, the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different polynucleotides, at least one of which may be a vector. The vector may be a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different AAV vectors.

[0011] In some embodiments, the single polynucleotide comprises a first polynucleotide portion of (a) and a second polynucleotide portion of (b). The single polynucleotide can be a vector, which can be a viral vector, such as an AAV vector. In some embodiments, the AAV is AAV1.

[0012] Also within the scope of the present disclosure are nucleic acids and viral particles or sets of viral particles that collectively comprise any of the gene editing systems disclosed herein. In some embodiments, the viral particle or set of viral particles is an AAV particle.

[0013] In yet another aspect, the present disclosure relates to a method of editing a voltage-gated sodium channel gene, such as SCN9A or SCN10A, comprising contacting a cell with (i) any of the gene editing systems disclosed herein; (ii) a nucleic acid comprising the gene editing system; or (iii) a viral particle or set of viral particles that collectively comprise the gene editing system.

[0014] In some embodiments, the contacting step is carried out by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof. In some embodiments, the subject is a human patient suffering from pain.

[0015] In some embodiments, the cells are autologous cells. Alternatively, the cells can be heterologous cells. In some embodiments, the cells are stem cells, such as iPSC cells or mesenchymal stem cells. In some examples, the method can further include administering the cells with the edited gene to a subject in need thereof (e.g., a human patient with pain).

[0016] Also included within the scope of the present disclosure is the use of the gene editing system described herein, or any of its components, to treat pain, and its use for the manufacture of a medicament for the intended treatment.

[0017] The details of one or more embodiments of the disclosure are set forth in the description below. Other features and advantages of the disclosure will be apparent from the detailed description of some embodiments, and from the appended claims.

[0018] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, and may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It should be understood that the data shown in the drawings in no way limit the scope of the disclosure. [Brief explanation of the drawings]

[0019] [Figure 1A] The target editing efficiency of 40 prioritized gRNAs in various cell models is shown. The prioritized gRNAs included 10 gRNAs for SpCas9 targeting SCN9A. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and iPSC-derived sensory neurons. Values represent the mean ± standard deviation. [Figure 1B]The target editing efficiency of 40 prioritized gRNAs in various cell models is shown. The prioritized gRNAs included 10 gRNAs for SpCas9 targeting SCN10A. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and iPSC-derived sensory neurons. Values represent the mean ± standard deviation. [Figure 1C] The target editing efficiency of 40 prioritized gRNAs in various cell models is shown. The prioritized gRNAs included 10 gRNAs for SaCas9 targeting SCN9A. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and iPSC-derived sensory neurons. Values represent the mean ± standard deviation. [Figure 1D] The target editing efficiency of 40 prioritized gRNAs in various cell models is shown. The prioritized gRNAs included 10 gRNAs for SaCas9 targeting SCN10A. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and iPSC-derived sensory neurons. Values represent the mean ± standard deviation. DETAILED DESCRIPTION OF THE INVENTION

[0020] Gene editing (including genome editing) is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) are inserted, deleted, and / or replaced in a DNA sequence, such as the genome of a target cell. Targeted gene editing allows for insertion, deletion, and / or replacement at a preselected site in the genome of a target cell (e.g., a target gene or targeted DNA sequence). When the sequence of an endogenous gene is edited, for example, by deleting, inserting, or substituting nucleotide(s) / nucleic acid(s), the endogenous gene containing the affected sequence can be knocked out or knocked down due to its sequence modification. Thus, targeted editing can be used to disrupt endogenous gene expression. Alternatively, or in addition, a desired nucleic acid can be inserted into a target site in a DNA sequence (e.g., an endogenous gene), which is known as targeted integration. "Targeted integration" refers to a process involving the insertion of one or more exogenous sequences, with or without deletion of the endogenous sequence at the insertion site. If a donor template containing the exogenous sequence is present, targeted integration can result from targeted gene editing.

[0021] The present disclosure is based, at least in part, on the development of an efficient gene editing system for modifying voltage-gated sodium channel genes, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). Sodium channels are integral membrane proteins that form ion channels through cell membranes. Voltage-gated sodium channels are sodium channels that "open" (i.e., allow the flow of sodium ions through the channel) in response to voltage changes. The alpha subunit of a sodium channel forms the core of the channel and functions by itself (i.e., in the absence of a corresponding beta subunit or other accessory proteins). There are nine members in the sodium voltage-gated channel family. The alpha subunits of these channels are the Na α subunits, encoded by SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN8A, SCN9A, SCN10A, and SCN11A, respectively.v 1.1, Na v 1.2, Na v 1.3, Na v 1.4, Na v 1.5, Na v 1.6, Na v 1.7, Na v 1.8, and Na v It is 1.9.

[0022] Na v 1.7 (encoded by SCN9A) is expressed, for example, in dorsal root ganglia, trigeminal ganglia, and sympathetic ganglion neurons. v 1.8 (encoded by SCN10A) is expressed, for example, in the dorsal root ganglia, in unmyelinated small-diameter sensory neurons called C fibers. v 1.7 and Na v 1.8 are both involved in nociception (i.e., the sensory mechanisms that provide the signals that result in the sensation of pain).

[0023] Editing the SCN9A and / or SCN10A genes using any of the methods described herein may be effective in treating conditions such as congenital pain insensitivity, anosmia, smear-like personality, borderline personality disorder, malignant neoplasia of the breast, non-small cell lung cancer, cold intolerance, heat convulsions, diabetes, diabetes mellitus, dissociative disorders, epilepsy, erythromelalgia, primary scarlet fever, facial pain, herpesvirus infections, hereditary sensory and autonomic neuropathy type 5, hyperplasia, neuralgia, hereditary sensory and autonomic neuropathy, degenerative polyarthritis, pain, pain in the extremities, post-operative pain, Parkinson's disease, post-herpetic neuralgia, prostate neoplasm, pruritus, seizures, somatoform disorder, tobacco use disorder, trigeminal neuralgia, synovial cyst, chronic pain, acute onset pain, congenital paramyotonia, fatigue, sensory discomfort, burning pain, indifference to pain, inflammatory The compounds may be used to treat, prevent, and / or alleviate the symptoms of diseases and injuries such as, but not limited to, muscular pain, mechanical pain, scalp pain, hereditary motor and sensory neuropathy type II, common migraine, loss of pain sensation, malignant neoplasm of the prostate, pain disorders, knee osteoarthritis, neuropathy, complex regional pain syndrome, tonic-clonic seizures, hereditary neuropathies, prostate cancer, breast cancer, severe myoclonic epilepsy of infancy, mucous cysts, channelopathies, paroxysmal acute pain disorders, painful neuropathy, compression neuropathy, congenital indifference to pain autosomal recessive, generalized epilepsy with febrile seizures plus type 2, generalized epilepsy with febrile seizures plus type 7, febrile seizures familial type 3B, and small fiber neuropathy (adult onset is called small fiber neuropathy).

[0024] Mutations in the SCN9A gene are known to cause pain perception disorders such as primary erythroderma, paroxysmal pain disorder, congenital insensitivity to pain, and small fiber neuropathy. Gain-of-function mutations in the SCN9A gene cause spontaneous pain, as observed in primary erythroderma and paroxysmal pain disorder. Therefore, knockout or knockdown of the SCN9A gene in patients with primary erythroderma or paroxysmal pain disorder can be used to treat, prevent, and / or alleviate the associated symptoms.

[0025] Primary erythromelalgia is a rare autosomal dominant disorder characterized by the onset of burning pain in the feet and hands in response to heat and movement. Affected individuals typically develop signs and symptoms during early childhood, although milder cases may present later in life. Management of the condition is primarily symptomatic. In addition to avoidance of pain triggers (e.g., heat, exercise, alcohol), treatment options include cooling and elevation of the extremities, the use of anesthetics such as lidocaine and mexiletine, and the use of opioid medications in extreme cases.

[0026] Paroxysmal acute pain disorder is another rare disorder characterized by severe, episodic pain and skin redness in the rectum, eyeball, and jaw area. Symptoms of this condition often begin in the neonatal or early childhood period and can persist throughout life. Medications to treat chronic neuropathic pain disorders are often used to alleviate episodes of pain caused by the disease. Carbamazepine, a sodium channel blocker, has proven to be the most effective of these treatments.

[0027] Mutations in the SCN10A gene are also known to cause pain perception disorders such as familial episodic pain syndrome type 2 and small fiber neuropathy. Therefore, knockout or knockdown of the SCN10A gene in patients with familial episodic pain syndrome type 2 or small fiber neuropathy can be used to treat, prevent, and / or alleviate the associated symptoms.

[0028] Familial episodic pain syndrome type 2 is a rare autosomal dominant neurological disorder characterized by adult-onset paroxysmal pain in the feet. Episodes are usually triggered by heat, cold, chemicals, and certain surfaces. Patients may also develop hypersensitivity to touch and an increased response to painful stimuli. Currently, there is no cure for this condition. Warmth has been shown to relieve pain episodes.

[0029] Small fiber neuropathy is a condition characterized by attacks of severe pain and insensitivity to pain. The attacks of pain are usually described as abnormal skin sensations such as numbness, tingling, burning, or tingling or itching. Currently, there is no cure for small fiber neuropathy. Treatment options include intravenous immunoglobulin (IVIG) and plasma exchange.

[0030] As described herein, indel rates and indel patterns have been determined for gene editing systems comprising pairs of RNA-guided endonucleases (e.g., SpCas9 or SaCas9) and specific guide RNAs. The gene editing systems described herein rely on the identification of effective RNA-guided endonuclease and guide RNA pairs (e.g., as disclosed herein) that promote effective modification of voltage-gated sodium channel genes, such as SCN9A or SCN10A, with low off-target occurrence.

[0031]

[0003] Accordingly, provided herein is a gene editing system for the efficient modification of voltage-gated sodium channel genes and uses thereof. Components of the gene editing system and genetically modified cells resulting from application of the gene editing system are also within the scope of this disclosure.

[0032] I. Gene editing system for genetic modification of voltage-gated sodium channel genes In some embodiments, the present disclosure relates to a gene editing system for modifying a voltage-gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). A "gene editing system" refers to a combination of components for editing a target gene (e.g., SCN9A or SCN10A), or one or more agents for generating such components. For example, a gene editing system may include (a) a nuclease or an agent for producing such (e.g., a nucleic acid encoding a nuclease), and / or (b) a guide RNA (gRNA) or an agent for producing such (e.g., a vector capable of expressing a gRNA).

[0033] The gene editing systems described herein may exhibit one or more advantages in modifying voltage-gated sodium channel genes, such as SCN9A or SCN10A. For example, achieving a high gene editing rate, such as a frameshift-causing indel rate (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% as assessed by methods described herein or known in the art) or a total indel rate (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% as assessed by methods described herein or known in the art). Additionally, cells edited by the gene editing systems disclosed herein can have increased viability (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%) compared to unedited controls.

[0034] In one exemplary embodiment, the gene editing system described herein may include (a) an endonuclease (e.g., an RNA-guided DNA endonuclease) or an agent that produces such (e.g., a polynucleotide encoding the endonuclease), and (b) a gRNA or an agent that produces such (e.g., a vector for expressing the gRNA). Additionally, any of the gene editing systems described herein may further include a polynucleotide sequence encoding a donor template. In some examples, the gene editing system described herein includes an endonuclease, a gRNA, and optionally a donor template. Such a gene editing system may include one polynucleotide that provides the donor template and generates the gRNA. Alternatively, the gene editing system may include a donor template and separate nucleic acids, which may be the gRNA itself or a polynucleotide that produces the gRNA. In other examples, the gene editing system may include one or more polynucleotides that collectively generate the endonuclease, the gRNA, and optionally the donor template. In some examples, the gene editing system may include a polynucleotide comprising a first polynucleotide sequence encoding an endonuclease and a second polynucleotide sequence encoding a gRNA. Alternatively, the gene editing system may include two polynucleotides, the first polynucleotide comprising the first polynucleotide sequence encoding the endonuclease and the second polynucleotide comprising the second polynucleotide sequence encoding a gRNA.

[0035] A. RNA-guided endonucleases RNA-guided endonuclease is an enzyme that utilizes RNA:DNA base pairing to target and cut polynucleotide.RNA-guided endonuclease can cut at least one strand of single-stranded polynucleic acid or double-stranded polynucleotide.Genetic editing system can comprise one RNA-guided endonuclease.Alternatively, genetic editing system can comprise at least two (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) RNA-guided endonuclease.

[0036] The CRISPR-Cas9 system, a naturally occurring defense mechanism in prokaryotes, has been repurposed as an RNA-guided DNA targeting platform for gene editing. It relies on the DNA nuclease Cas9 and two non-coding RNAs, crisprRNA (crRNA) and trans-acting RNA (tracrRNA), to target DNA cleavage. The crRNA typically facilitates sequence recognition and specificity of the CRISPR-Cas9 complex by Watson-Crick base pairing with a 20-nucleotide (nt) sequence in the target DNA. Altering the sequence of the 5' 20 nt of the crRNA allows the CRISPR-Cas9 complex to target specific loci. The CRISPR-Cas9 complex binds to DNA sequences containing a sequence matching the first 20 nt of the crRNA only if the target sequence is followed by a specific short DNA motif (containing the sequence NGG) called a protospacer adjacent motif (PAM). TracrRNA hybridizes to the 3' end of crRNA to form an RNA duplex structure, to which Cas9 endonuclease binds to form a catalytically active CRISPR-Cas9 complex, which then cleaves the target DNA.

[0037] When the CRISPR-Cas9 complex binds to DNA at the target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-stranded break (DSB) where both strands of DNA terminate in base pairs (blunt ends).

[0038] The gene editing system may include a CRISPR endonuclease (e.g., CRISPR-associated protein 9 or Cas9 nuclease). In some embodiments, the endonuclease is derived from Streptococcus aureus (e.g., saCas9) or Streptococcus pyogenes (e.g., spCas9), although other CRISPR homologs can be used. It should be understood that Cas9 can be replaced with another RNA-guided endonuclease known in the art, such as Cpf1. Finally, it should be understood that a wild-type RNA-guided endonuclease or a modified version (e.g., an evolved version of Cas9, a Cas9 orthologue, a Cas9 chimeric / fusion protein, or another Cas9 functional variant) can be used. For example, in some embodiments, the RNA-guided endonuclease is modified to include a nuclear localization signal (NLS), such as the SV40 NLS or the nucleoplasmin NLS. Other examples of nuclear localization signals are known to those skilled in the art. In some embodiments, the NLS comprises an SV40 NLS and a nucleoplasmin NLS.

[0039] B. Guide RNA The present disclosure provides genome-targeting nucleic acids, or agents that produce such (e.g., polynucleotides comprising a nucleotide sequence encoding a gRNA), that can direct the activity of an associated polypeptide (e.g., an RNA-guided endonuclease) to a specific target sequence in a target nucleic acid. The genome-targeting nucleic acid can be RNA. The genome-targeting RNA is referred to herein as a "guide RNA" or "gRNA." In some embodiments, the gene editing system comprises one gRNA. In other embodiments, the gene editing system comprises at least two gRNAs (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 gRNAs).

[0040] The gRNA of the gene editing system can be provided in a synthetic form. For example, the guide RNA can be synthesized by chemical means, as shown below and described in the art. Although chemical synthesis procedures are continually expanding, purification of such RNAs by procedures such as high performance liquid chromatography (which avoids the use of gels such as PAGE) tends to become more difficult as the length of the polynucleotide significantly exceeds 100 nucleotides or so. One approach used to produce longer RNAs is to generate two or more molecules linked together. Even longer RNAs are more easily produced enzymatically. Various types of RNA modifications, such as those that improve stability, reduce the likelihood or severity of innate immune responses, and / or improve other properties as described in the art, can be introduced during or after chemical synthesis and / or enzymatic production of the RNA.

[0041] Alternatively, the gene editing system may include agents for the production of the gRNA. For example, the gene editing system may include a nucleotide sequence encoding the nucleotide sequence of the gRNA and an additional nucleotide sequence that promotes the expression / production of the gRNA.

[0042] The gRNA may be a dual-molecule guide RNA. The dual-molecule guide RNA comprises two strands of RNA. The first strand may comprise, from 5' to 3', an optional spacer extension sequence, a spacer sequence, and a scaffold sequence comprising a minimal CRISPR repeat sequence. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3' tracrRNA sequence, and an optional tracrRNA extension sequence.

[0043] Alternatively, the gRNA may be a single-molecule guide RNA (sgRNA) comprising a spacer sequence and a scaffold sequence. The scaffold sequence may comprise a tracrRNA sequence as described herein. The sgRNA (e.g., in a Type II system) may comprise, from 5' to 3', an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that provide additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimal CRISPR repeat sequence and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins. Alternatively, the sgRNA (e.g., in a Type V system) may comprise, from 5' to 3', a minimal CRISPR repeat sequence and a spacer sequence.

[0044] The single-molecule gRNA may not contain uracil at the 3' end of the gRNA sequence. Alternatively, the gRNA may contain one or more uracils at the 3' end of the gRNA sequence. For example, the gRNA may contain one uracil (U) at the 3' end of the gRNA sequence. The gRNA may contain two uracils (UU) at the 3' end of the gRNA sequence. The gRNA may contain three uracils (UUU) at the 3' end of the gRNA sequence. The gRNA may contain four uracils (UUUU) at the 3' end of the gRNA sequence. The gRNA may contain five uracils (UUUUU) at the 3' end of the gRNA sequence. The gRNA may contain six uracils (UUUUUU) at the 3' end of the gRNA sequence. The gRNA may contain seven uracils (UUUUUUU) at the 3' end of the gRNA sequence. The gRNA may contain eight uracils (UUUUUUUU) at the 3' end of the gRNA sequence.

[0045] It is further understood that the nucleotides of the gRNA described above can contain modified nucleic acids at any nucleotide position. Thus, the gRNA can be unmodified or modified. For example, a modified gRNA can contain one or more 2'-O-methyl phosphorothioate nucleotides. Additional examples of modified nucleic acids are known to those skilled in the art. See, for example, WO2018007976 and WO2018007980, the relevant disclosures of each of which are incorporated by reference for the purposes and / or subject matter referenced herein.

[0046] (i) gRNA spacer As will be understood by those skilled in the art, each gRNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011). The spacer sequence is a nucleotide sequence that defines the target sequence of a target nucleic acid of interest (e.g., a DNA target sequence, such as a genomic target sequence). The gRNA can include a spacer sequence of variable length, from 17 to 30 nucleotides, at the 5' end of the gRNA sequence. In some embodiments, the spacer sequence is 15 to 30 nucleotides. In some embodiments, the spacer sequence is 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the spacer sequence is 20 nucleotides.

[0047] A "target sequence" is a sequence adjacent to a PAM sequence and is modified by an RNA-guided nuclease (e.g., Cas9). A "target nucleic acid" is a double-stranded molecule, one strand of which contains the target sequence and is referred to as the "PAM strand," and the other, complementary strand is referred to as the "non-PAM strand." Those skilled in the art will recognize that a gRNA spacer sequence hybridizes to the reverse complement of the target sequence located in the non-PAM strand of a target nucleic acid of interest. Thus, a gRNA spacer sequence is an RNA equivalent of a target sequence. For example, if the target sequence is 5'-AGAGCAACAGTGCTGTGGCC-3' (SEQ ID NO: 498), the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC-3' (SEQ ID NO: 499). The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner through hybridization (i.e., base pairing). The nucleotide sequence of the spacer can vary depending on the sequence of the target nucleic acid of interest.

[0048] The spacer sequence is designed to hybridize to a region of the target nucleic acid located 5' to the PAM of the Cas9 enzyme used in the system. The spacer may be a perfect match to the target sequence or may have a mismatch. Each Cas9 enzyme has a specific PAM sequence that it recognizes within the target DNA. For example, S. pyogenes recognizes a PAM within the target nucleic acid containing the sequence 5'-NRG-3' (where R contains either A or G, and N is any nucleotide, and N is located immediately 3' of the target nucleic acid sequence targeted by the spacer sequence). The standard PAM for S. pyogenes Cas9 is 5'-NGG-3'; however, as noted in the previous sentence, S. pyogenes Cas9 can also recognize the non-standard PAM 5'-NAG-3'. Similarly, for S. aureus Cas9, the PAM contains the sequence 5'-NNGRRT-3'.

[0049] In some embodiments, the target nucleic acid sequence comprises 20-22 nucleotides. In some embodiments, the target nucleic acid comprises fewer than 20 nucleotides. In some embodiments, the target nucleic acid comprises more than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, or more nucleotides. In some embodiments, the target nucleic acid sequence comprises up to: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20-22 bases immediately 5' to the first nucleotide of the PAM. For example, [ka] In a sequence comprising: the target nucleic acid comprises a sequence corresponding to N lacking an underscore, where N is any nucleotide, and the underlined NRG and NNGRRT sequences are the S. pyogenes PAM and S. aureus PAM, respectively.

[0050] In some embodiments, the gRNA used herein may comprise a 20-nucleotide spacer sequence. In some embodiments, such a gRNA is used with SpCas9. In other embodiments, the gRNA used herein may comprise a 22-nucleotide spacer sequence. In some embodiments, such a gRNA is used with SaCas9.

[0051] In some embodiments, gRNAs used herein may comprise a spacer sequence listed in Tables 1-4. In some examples, gRNAs used herein may comprise a spacer sequence listed in Table 1 in combination with SpCas9 to edit SCN9A. In some examples, gRNAs used herein may comprise a spacer sequence listed in Table 2 in combination with SaCas9 to edit SCN9A. In some examples, gRNAs used herein may comprise a spacer sequence listed in Table 3 in combination with SpCas9 to edit SCN10A. In some examples, gRNAs used herein may comprise a spacer sequence listed in Table 4 in combination with SaCas9 to edit SCN10A. Any of these gRNAs comprise a spacer sequence listed in any of Tables 1 and 3 (in combination with SpCas9 enzyme) with an average total indel percentage of greater than 40% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, or more), and / or an average indel percentage that causes frameshifts of greater than 40% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, or more). Alternatively, any of these gRNAs comprise a spacer sequence listed in either of Tables 2 and 4 (in combination with SaCas9 enzyme) with an average total indel percentage of greater than 15% (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or more), and / or an average indel percentage that causes frameshifts of greater than 40% (e.g., 20%, 25%, 30%, 35%, 40%, 45%, or more).

[0052] Exemplary gRNAs may include one of the following spacer sequences: CAAUUUGGGUGGUACCUGAU (SEQ ID NO: 1); GCUUCGCCUUGCAGAAAACA (SEQ ID NO: 2); GCCUAUGCCCUUCGACACCA (SEQ ID NO: 3); AUAGGCGAGCACAUGAAAAG (SEQ ID NO: 4); CGGCUGAAUAUACAAGUAUU (SEQ ID NO: 5); GGAACACCACCCAAUGACUG (SEQ ID NO: 6); CAGGCCUGAAGACAAUUGUA (SEQ ID NO: 7); GGAAUGUCCCCAUAGAUGAA (SEQ ID NO: 8); CCACCAAUGCUGCCGGUGAA (SEQ ID NO: 9); CAGUCACCACUCAGCAUUCG (SEQ ID NO: 10); AAGCAGAAUUAUGGGCCUCUCA (SEQ ID NO: 11); GCCUUGCAGAAAACAAGGAGCC (SEQ ID NO: 12); ACGACAAAAUCCAGCCAGUUCC (SEQ ID NO: 13); CUGGGAAAACCUUUACCAACAG (SEQ ID NO: 14); UCCCAACCUCAGACAGAGAGCA (SEQ ID NO: 15); GAUGUUACUGCUGCGUCGCUCC (SEQ ID NO: 16); CAUGAUCCUGACUGUGUUCUGU (SEQ ID NO: 17); CUCGUGUGUAGUCAGUGUCCAG (SEQ ID NO: 18); AAACUGAUUGCCAUGGAUCCAU (SEQ ID NO: 19); AGAAAACAAGGAGCCACGAAUG (SEQ ID NO: 20); GCUCCCCGAUCAGUUCUGCU (SEQ ID NO: 21); UGUAGUCACCAUGGCGUAUG (SEQ ID NO: 22); GGAAGCUCCGCAGCACAGAC (SEQ ID NO: 23); UCCUUACAACCAGCGCAGGA (SEQ ID NO: 24); ACUUCUGACCCCUUACUGUG (SEQ ID NO: 25); GAGCUCCCAGCAGAACUGAU (SEQ ID NO: 26); CCGAGACAUCGACAGCUCCA (SEQ ID NO: 27); AUCCGUUCUACAGCACACAC (SEQ ID NO: 28); UCACGUACCUGAGAGAUCCU (SEQ ID NO: 29); CGCAGGUGCUAGCAGCACUA (SEQ ID NO: 30); CCCUGGAGCUGUCGAUGUCUCG (SEQ ID NO: 31); UAGAUCCGUUCUACAGCACACA (SEQ ID NO: 32); AGUGAGAGGAAAGCCCAAGCAA (SEQ ID NO: 33); ACCUUUCCGGGCCCAAAGGGCA (SEQ ID NO: 34); CUUUGACUGCAUCAUCGUCACU (SEQ ID NO: 35); CACUUCUUCUGGAAAUAAUAGU (SEQ ID NO: 36); AUUUUAGCGUCAUUACCCUGGC (SEQ ID NO: 37); AACAACUUCCGUCGCUUUACUC (SEQ ID NO: 38); GCCGAGAUAUCUCACUCCCUGA (SEQ ID NO: 39); UGGUGUUCAUCUUCUCCAUGCC (SEQ ID NO: 40).

[0053] (ii) gRNA scaffold In some embodiments, the gRNA further comprises a scaffold sequence. The scaffold sequence may comprise a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and / or an optional tracrRNA extension sequence. Exemplary scaffold sequences for various CRISPR proteins are known to those skilled in the art.

[0054] The selection of scaffold sequence may depend on the RNA-guided DNA endonuclease used in the gene editing system used herein, for example, SaCas9 or SpCas9, which are known to those skilled in the art. For example, when SpCas9 is used, a scaffold sequence that can be recognized by SpCas9 can be selected. Examples of SpCas9 scaffold sequences are known in the art. For example, see Zhang et al., Plant Mol Biol. 2018;96(4):445-456; www.addgene.org. One exemplary scaffold sequence in the single-molecule guide RNA may include the nucleotide sequence of GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 42).

[0055] Alternatively, when using SaCas9 endonuclease, a scaffold sequence that can be recognized by SaCas9 can be selected. The scaffold sequence of the SaCas9 single-molecule guide RNA can include the nucleic acid sequence GUUUUAGUACUCUGGAAACAGAAUCUACUAAA ACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). The single-molecule guide RNA can further include an optional sequence extension.

[0056] Because the nucleotide sequence encoding a gRNA can be either a DNA sequence or an RNA sequence, it should be understood that any uracil (U) in a sequence describing a gRNA can be replaced with thymine (T). Similarly, T (thymine) in a sequence referencing a gRNA refers to U (or uracil) in the context of an RNA molecule. As used herein, a sequence containing T (thymine) will encompass both DNA and RNA molecules (where T refers to U).

[0057] (iii) Exemplary RNA-guided endonuclease-gRNA pairs In some embodiments, for effective modification of voltage-gated sodium channel genes, the gene editing system relies on the identification of effective RNA-guided endonuclease, guide RNA pairs (e.g., as disclosed herein).

[0058] For example, a gene editing system for modifying the sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may include Staphylococcus pyogenes (SpCas9) and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1 to 10. Alternatively, or additionally, a gene editing system for modifying the sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may include Staphylococcus aureus (SaCas9) and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 11 to 20.

[0059] In another example, a gene editing system for modifying the sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may include SpCas9 and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 21 to 30. Alternatively, or additionally, a gene editing system for modifying the sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may include SpCas9 and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 31 to 40.

[0060] (iv) ribonucleoprotein complexes In some examples, the gene editing system disclosed herein may include a ribonucleoprotein complex (RNP) in which the gRNA and a nuclease (e.g., as described above) form a complex. As used herein, the term "ribonucleoprotein" or "RNP" refers to a protein that is structurally associated with nucleic acid (either DNA or RNA). For example, in some embodiments, the Cas9 RNA-guided endonuclease and gRNA of the gene editing system are in the form of an RNP.

[0061] C. Donor Template The donor template comprises a nucleic acid sequence to be inserted into a target site of a DNA sequence (e.g., an endogenous gene). The donor template of the gene editing system may be provided in a synthetic form. Alternatively, the gene editing system may comprise an agent (e.g., a nucleic acid such as a vector) for generating the donor template. For example, the gene editing system may comprise a nucleic acid (e.g., a vector) for generating the donor template.

[0062] The donor template can comprise one or more homologous arms to enable efficient homology-dependent recombination (HDR) at the desired genomic location.The length of the homologous arm can vary.For example, the homologous arm can be at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 nucleotides long. Similarly, the homologous arms are 50-100, 50-200, 50-300, 50-400, 50-500, 50-600, 50-700, 50-800, 50-900, 50-1000, 100-200, 100-300, 100-400, 100-500, 100-600, 100-700, 100-800, 100-900, 100-1000, 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 200-900, 200-1000, 300-400, 300-500 The homology arms may be 00, 300-600, 300-700, 300-800, 300-900, 300-1000, 400-500, 400-600, 400-700, 400-800, 400-900, 400-1000, 500-600, 500-700, 500-800, 500-900, 500-1000, 600-700, 600-800, 600-900, 600-1000, 700-800, 700-900, 700-1000, 800-900, 800-1000, or 900-1000 nucleotides in length. In particular, the homology arms may be 500 nucleotides in length.

[0063] For example, in some embodiments, the donor template comprises a 5' homology arm (i.e., located upstream of the first nucleotide sequence) and a 3' homology arm (i.e., located downstream of the first nucleotide sequence), wherein the 5' homology arm comprises a nucleic acid sequence that is homologous to a region upstream of the genomic location of interest, and the 3' homology arm comprises a nucleic acid sequence that is homologous to a region downstream of the genomic location of interest.

[0064] In other embodiments, the donor template may include a 5' homology arm and lack a 3' homology arm. In yet other embodiments, the donor template may include a 3' homology arm and lack a 5' homology arm.

[0065] Alternatively, the donor template may lack homologous arms. For example, in some cases, the donor template may be incorporated by cleavage at the target site followed by NHEJ-dependent end joining.

[0066] The donor template can also include a polynucleotide sequence encoding a gene of interest or a portion thereof (e.g., SCN9A, SCN10A, or a portion thereof). Alternatively, or additionally, the donor template can include a polynucleotide sequence encoding a regulatory element (e.g., a regulatory element of SCN9A or SCN10A).

[0067] The donor template may be single-stranded and / or double-stranded DNA or RNA, and may be introduced into cells in linear or circular form. When introduced in linear form, the ends of the donor sequence may be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues may be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides may be linked to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al., (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding terminal amino group(s) and using modified internucleotide linkages, such as phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.

[0068] The donor template can be introduced into a cell as part of a vector molecule that contains additional sequences, such as an origin of replication, a promoter, and a gene encoding antibiotic resistance. Additionally, the donor template can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or delivered by a virus (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0069] In some embodiments, the donor template is inserted such that its expression is driven by an endogenous promoter, such as the promoter that drives expression of the endogenous gene into which the donor is inserted.

[0070] In addition, the exogenous sequence may include transcriptional or translational regulatory sequences, such as sequences encoding promoters, enhancers, insulators, internal ribosome entry sites, 2A peptides, and / or polyadenylation signals.

[0071] It is understood that the nucleotides of the donor template described above can include modified nucleic acids at any nucleotide position.

[0072] D. Viral Vector / Virus Particle-Based Gene Editing Systems In some embodiments, the gene editing systems disclosed herein can include polynucleic acids (e.g., vectors such as viral vectors) or viral particles containing the same. The polynucleic acid(s) generate components (e.g., nucleases and gRNAs) for editing the voltage-gated sodium channel gene described herein.

[0073] In some instances, the gene editing system comprises one polynucleic acid capable of producing all components of the gene editing system, including the nuclease and the gRNA, hi other instances, the gene editing system comprises two polynucleic acids, one encoding the nuclease and the other encoding the gRNA.

[0074] The nucleic acid (or at least one nucleic acid in the set of nucleic acids) can be a vector, such as a viral vector, such as a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, and a herpes simplex viral (HSV) vector.

[0075] In some examples, a gene editing system may include one or more viral particles carrying genetic material for generating components of a gene editing system as disclosed herein. A viral particle (e.g., an AAV particle) may include one or more components (or agents for generating one or more components) of a gene editing system (e.g., as described herein). A viral particle (or virion) includes nucleic acid encoding the viral genome and a protein coat (i.e., capsid). In some cases, the viral particle further includes a lipid envelope surrounding the protein coat.

[0076] In some examples, the viral particle comprises a polynucleic acid capable of producing all components of the gene editing system, including a nuclease and a gRNA. In other examples, the viral particle comprises a polynucleic acid capable of producing one or more components of the gene editing system. For example, the viral particle may comprise a polynucleic acid capable of producing a nuclease. Alternatively, the viral particle may comprise a polynucleic acid capable of producing a gRNA.

[0077] The viral particle described herein can be derived from any viral particle known in the art, including but not limited to retroviral particle, adenoviral particle, adeno-associated virus (AAV) particle or herpes simplex virus (HSV) particle.In some embodiments, the viral particle is AAV particle.In some embodiments, the AAV particle is AAV1 particle.

[0078] In some embodiments, the set of viral particles comprises more than one gene editing system. In some embodiments, each viral particle in the set of viral particles is an AAV particle. In other embodiments, the set of viral particles comprises more than one type of viral particle (e.g., retroviral particle, adenoviral particle, adeno-associated virus (AAV) particle, or herpes simplex virus (HSV) particle).

[0079] E. Additional Exemplary Gene Editing Systems Furthermore, the gene editing system disclosed herein may include a nuclease (e.g., Cas9 enzyme) as disclosed herein. Such a gene editing system may further include a gRNA. The nuclease and gRNA may form an RNP for delivery. Furthermore, the gene editing system may further include a gRNA and a polynucleic acid (e.g., a vector as described herein) for generating a donor template. The nuclease and gRNA may form an RNP complex. Alternatively, the gene editing system may further include a gRNA and one or more polynucleic acids for producing a donor template.

[0080] Alternatively, the gene editing system disclosed herein may include an agent for producing a nuclease, for example, an expression vector such as a viral vector as disclosed herein that can express a nuclease. Such a gene editing system may further include an agent for producing a gRNA or the like.

[0081] Other formats of gene editing systems comprising components as disclosed herein to modify voltage-gated sodium channel genes or agents that produce such are within the scope of this disclosure.

[0082] II. Methods for editing voltage-gated sodium channel genes In some embodiments, the present disclosure relates to methods of editing a voltage-gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A), using any of the gene editing systems disclosed herein. The editing event can introduce a mutation or correct a mutation in a sodium voltage-gated channel (e.g., SCN9A or SCN10A). One or more copies (i.e., alleles) of the gene (e.g., SCN9A or SCN10A) can be corrected and / or mutated.

[0083] Methods for editing a voltage-gated sodium channel gene can include contacting a cell with a gene editing system described herein, a viral particle or set of viral particles comprising a gene editing system described herein, and / or a nucleic acid or set of nucleic acids comprising a gene editing system described herein. These methods can be performed, for example, on one or more cells present in a living subject (e.g., in vivo). Alternatively, or additionally, these methods can be performed on one or more cells present in culture (e.g., ex vivo). In some cases, the edited cells in culture are then administered to a subject (classified herein as "cell-based therapy").

[0084] A. Delivery method Contacting a cell (or subject) with a gene editing system, a viral particle or set of viral particles, and / or a nucleic acid or set of nucleic acids can be achieved via various delivery methods. For example, the nuclease and / or gRNA can be delivered using a vector system, including, but not limited to, a plasmid vector, a DNA minicircle, a retroviral vector, a lentiviral vector, an adenoviral vector, a poxvirus vector, a herpesvirus vector, and an adeno-associated virus vector, and combinations thereof.

[0085] Nucleic acids encoding nucleases and gRNAs can be introduced into cells using conventional viral and non-viral gene transfer methods. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. Viral vector delivery systems include DNA and RNA viruses, which are episomal or genomicly integrated after delivery to cells.

[0086] Non-viral nucleic acid delivery methods include, but are not limited to, lipofection, microinjection, gene gun, virosome, liposome, immunoliposome, polycation or lipid:nucleic acid conjugate, naked DNA, naked RNA, capped RNA, artificial virion, and drug-enhanced DNA uptake.Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids.

[0087] Methods for delivery of proteins (eg, RNA-guided endonucleases) include, but are not limited to, the use of cell-penetrating peptides and nanovehicles.

[0088] (i) Adeno-associated virus delivery One or more components of the gene editing system can be delivered to cells using adeno-associated viruses (AAVs). AAVs are small viruses that integrate site-specifically into the host genome, allowing them to deliver transgenes. Inverted terminal repeats (ITRs) flank the AAV genome and / or the transgene of interest and serve as origins of replication. The AAV genome also contains rep and cap proteins, which, when transcribed, form a capsid that encapsulates the AAV genome for delivery to target cells. These capsid surface receptors confer the AAV serotype, determining the target organ to which the capsid primarily binds and, therefore, the cells that AAV most efficiently infects. There are currently 12 known human AAV serotypes. In some embodiments, the AAV is AAV serotype 6 (AAV6). In some embodiments, the AAV is AAV serotype 1 (AAV1).

[0089] Adeno-associated viruses are one of the most frequently used viruses for gene therapy for several reasons. First, AAVs do not provoke an immune response when administered to mammals, including humans. Second, AAVs can be effectively delivered to target cells, especially when the appropriate AAV serotype is selected. Finally, AAVs have the ability to infect both dividing and non-dividing cells. This is because they can persist in host cells without integrating their genomes. This trait makes them ideal candidates for gene therapy.

[0090] (ii) Homologous recombination repair (HDR) One or more components of the gene editing system can be inserted into the target genomic region of an edited cell by homology-directed repair (HDR). Both strands of DNA in the target genomic region are cleaved by the CRISPR Cas9 enzyme. HDR then occurs to repair the double-strand break (DSB) and insert the donor DNA. To ensure this occurs correctly, the donor sequence is designed with flanking residues (hereafter referred to as "homologous arms") that are complementary to the sequence surrounding the DSB site in the target gene. These homologous arms act as templates for DSB repair, making HDR an essentially error-free mechanism. Because the rate of homology-directed repair (HDR) is a function of the distance between the mutation and the break site, it is important to select overlapping or nearby target sites. The template can contain extra sequences flanking the homologous region or may contain sequences that differ from the genomic sequence, thus enabling sequence editing.

[0091] (iii) Non-homologous end joining (NHEJ) The NHEJ pathway can also, at very low frequency, generate inserts that include exons 11 to 27. Such repair should correct expression if the insert is in the sense strand orientation.

[0092] III. Therapeutic uses The gene editing methods disclosed herein can be applied to treat patients with pain. In some embodiments, provided herein are ex vivo cell-based therapies. In other embodiments, provided herein are in vivo gene therapies.

[0093] (i) Cell-based therapy Genetically edited cells can be generated using any of the methods described herein. In some embodiments, one or more gene edits in the population of edited cells result in a phenotype associated with altered voltage-gated sodium channel function.

[0094] In some embodiments, the gene-edited cells of the present disclosure exhibit a decrease in voltage-gated sodium channel activity (e.g., at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease) compared to an unedited control. V 1.7 and / or Na V The level of 1.8 activity may be reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% compared to control, unedited cells. v 1.7 and / or Na v 1.8 The level of activity compared to control T cells was 5%-10%, 5%-20%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-80%, 5%-90%, 10%-20%, 10%-30%, 10%-40%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 20%-30%, 20%-40%, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 2 ...90%, 20%-10%, 20%-12%, 20%-14%, 20%-16%, 20%-18%, 20%-19%, 20%-21%, 20%-22%, 20%-23%, 20%-24%, 20%-25%, 20%-26%, 20%-27%, 20%-28%, 20%-31%, 20%-32%, 20%-33%, 20%-34%, 20%-35%, 20%-36%, 20%-37%, 20%-38%, 20%-41%, 20%-42%, 20%-43%, 20%-44%, 20%-45%, 20%-46%, 20%-47%, 20%-50%, 20%-60%, 2 It may decrease by 0% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 30% to 40%, 30% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 40% to 50%, 40% to 60%, 40% to 70%, 40% to 80%, 40% to 90%, 50% to 50%, 50% to 70%, 50% to 80%, or 50% to 90%.

[0095] In other embodiments, the gene-edited cells of the present disclosure exhibit increased voltage-gated sodium channel activity (e.g., at least 30%, 50%, 100%, 2-fold, 5-fold, or 10-fold) compared to unedited controls. For example, Na V 1.7 and / or sodium V The level of 1.8 activity may be increased by at least 30%, at least 50%, at least 100%, at least 200%, at least 500%, or at least 1000% compared to control, unedited cells. v 1.7 and / or Na v1.8 The level of activity may be increased by 30%-50%, 30%-100%, 30%-200%, 30%-500%, 30%-1000%, 50%-100%, 50%-200%, 50%-500%, 50%-1000%, 100%-200%, 100%-500%, 100%-1000%, 200%-500%, 200%-1000%, or 500%-1000% compared to control unedited cells.

[0096] In some embodiments, a biopsy of a patient's peripheral nerve can be performed. Nerve tissue can be isolated from the patient's skin or leg. Cells of the peripheral nervous system (e.g., neurons or glial cells such as neural Schwann cells or ganglionic satellite glial cells) are then isolated from the biopsied material. The chromosomal DNA of the cells of the peripheral nervous system (e.g., neurons or glial cells such as neural Schwann cells or ganglionic satellite glial cells) can then be edited using the materials and methods described herein. Finally, the edited cells of the peripheral nervous system (e.g., neurons or glial cells such as neural Schwann cells or ganglionic satellite glial cells) are transplanted into the patient. Cells of any source or type can be used as progenitor cells.

[0097] For example, patient-specific induced pluripotent stem cells (iPSCs) can be created. The chromosomal DNA of these iPS cells can then be edited using the materials and methods described herein. The genome-edited iPSCs can then be differentiated into cells of the peripheral nervous system (e.g., neurons or glial cells, such as neural Schwann cells or ganglionic satellite glial cells). Finally, the differentiated cells of the peripheral nervous system (e.g., neurons or glial cells, such as neural Schwann cells or ganglionic satellite glial cells) are transplanted into the patient.

[0098] Alternatively, mesenchymal stem cells can be isolated from the patient, and these mesenchymal stem cells can be isolated from the patient's bone marrow or peripheral blood. The chromosomal DNA of these mesenchymal stem cells can then be edited using the materials and methods described herein. The genome-edited mesenchymal stem cells can then be differentiated into cells of the peripheral nervous system (e.g., neurons or glial cells, such as neural Schwann cells or ganglionic satellite glial cells). Finally, the differentiated cells of the peripheral nervous system (e.g., neurons or glial cells, such as neural Schwann cells or ganglionic satellite glial cells) are transplanted into the patient.

[0099] Any of the genetically edited cells can be administered to a subject. The administering step can include placing (e.g., transplanting) the genetically engineered cells into a subject by a method or route that results in at least partial localization of the introduced cells at a desired site so that the desired effect(s) occur, resulting in the desired effect(s) occurring, and in which at least some of the transplanted cells or cellular components remain viable. The survival period of the cells after administration to a subject can be as short as a few hours, or can be as long as, for example, 24 hours to days, or even years, or even for the life of the patient, i.e., long-term transplantation. In some embodiments, the administration is to the respiratory tract of the subject.

[0100] Modes of administration include injection, infusion, infusion, or ingestion. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous.

[0101] In some embodiments, the genetically engineered cells are administered systemically, which refers to administering the cell population not directly to a target site, tissue, or organ, so that instead the cell population enters the subject's circulatory system, where it is subjected to metabolic and other similar processes.

[0102] For use in the various embodiments described herein, an effective amount of genetically engineered cells is at least 10 2 cells, at least 5 x 10 2 cells, at least 10 3 cells, at least 5 x 10 3 cells, at least 10 4 cells, at least 5 x 10 4 cells, at least 10 5 cells, at least 2 x 10 5 cells, at least 3 x 10 5 cells, at least 4 x 10 5 cells, at least 5 x 10 5 cells, at least 6 x 10 5 cells, at least 7 x 10 5 cells, at least 8 x 10 5 cells, at least 9 x 10 5 cells, at least 1 x 10 6 cells, at least 2x 6 cells, at least 3 x 10 6 cells, at least 4 x 10 6 cells, at least 5 x 10 6 cells, at least 6 x 10 6 cells, at least 7 x 10 6 cells, at least 8 x 10 6 cells, at least 9 x 10 6 In some examples described herein, the cells are expanded in culture before being administered to a subject in need thereof.

[0103] (ii) In vivo gene therapy Alternatively, the gene editing methods and materials disclosed herein can be applied to genetically modify target genes (SCN9A or SCN10A) in vivo. Chromosomal DNA of cells within a patient can be edited using the materials and methods described herein. In some embodiments, target cells in in vivo-based therapy can be neurons of the peripheral nervous system.

[0104] Certain cells present attractive targets for ex vivo treatment and therapy, and increasing the efficacy of delivery may allow for direct in vivo delivery to such cells. Ideally, targeting and editing are directed to the appropriate cells. Cleavage in other cells can also be prevented by targeted delivery and / or using promoters that are active only in certain cells or developmental stages. Additional promoters are inducible, allowing for temporal control when nucleases are delivered as plasmids. The time that delivered RNA and proteins remain within the cells can also be tailored using additional treatments or domains to alter their half-life. While in vivo treatment reduces the number of processing steps, low delivery rates may necessitate higher editing rates. In vivo treatment can eliminate issues and losses resulting from ex vivo treatment and engraftment, as well as the proper integration of neurons and glial cells into existing brain circuits after engraftment.

[0105] In some aspects, the present disclosure relates to methods of administering an effective amount of a gene editing system described herein, a viral particle or set of viral particles comprising a gene editing system described herein, a nucleic acid or set of nucleic acids comprising a gene editing system described herein, or a composition of edited cells described herein to a subject in need thereof.

[0106] The subject can be any subject for whom diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a human patient with pain. In some embodiments, the human patient is a child.

[0107] An effective amount refers to the amount of a gene editing system, a viral particle or set of viral particles containing a gene editing system, a nucleic acid or set of nucleic acids containing a gene editing system, or a genetically engineered cell population required to prevent or alleviate at least one or more signs or symptoms of a disease state (i.e., pain), and relates to a composition in an amount sufficient to provide the desired effect (i.e., to treat a subject suffering from pain). An effective amount also includes an amount sufficient to prevent or delay the onset of disease symptoms, alter the course of disease symptoms (for example, but not limited to, slow the progression of disease symptoms), or reverse disease symptoms. It is understood that for any given case, the appropriate "effective amount" can be determined by one skilled in the art using routine experimentation.

[0108] The effectiveness of a treatment, including a composition for treating a disease state, can be determined by a skilled clinician. However, as an example, a treatment is considered "effective treatment" if any one or all signs or symptoms of a functional target level are beneficially altered (e.g., increased by at least 10%) or if other clinically accepted symptoms or markers of the disease (e.g., pain) are improved or alleviated. Efficacy can also be measured by an individual not worsening or requiring medical intervention as assessed in an inpatient setting (e.g., disease progression is halted or at least slowed). Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment in a subject, including (1) suppressing the disease, e.g., arresting or slowing the progression of the disease, or (2) alleviating the disease, e.g., causing regression of the disease, and (3) preventing or reducing the likelihood of symptoms occurring.

[0109] IV. Kits for Therapeutic Use The present disclosure also provides kits for use of the compositions described herein. For example, the present disclosure provides kits comprising a gene editing system described herein; a viral particle or set of viral particles comprising a gene editing system described herein; a nucleic acid or set of nucleic acids comprising a gene editing system described herein; and / or a population of gene-edited cells described herein.

[0110] In some embodiments, the kit can further include instructions for use in any of the methods described herein. The included instructions can include instructions for: (i) delivery of a gene editing system described herein; a viral particle or set of viral particles comprising a gene editing system described herein; and / or a nucleic acid or set of nucleic acids comprising a gene editing system described herein; and / or (ii) administration of a population of gene-edited cells described herein.

[0111] The kit may further include instructions for selecting a suitable subject for treatment based on identifying whether the subject is in need of treatment. The instructions may include information regarding the dosage, administration schedule, and route of administration for the intended treatment. The container may be a unit dose, bulk package (e.g., multi-dose package), or sub-unit dose. The instructions provided with the kit of the present disclosure are typically written on a label or package insert. The label or package insert indicates that the pharmaceutical composition is used for treating, delaying the onset of, and / or alleviating a disease or disorder in a subject.

[0112] The kits provided herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, etc. Packages for use in combination with specific devices, such as inhalers, nasal administration devices, or infusion devices, are also contemplated. The kits may have a sterile access port (for example, the container may be an intravenous solution bag or a vial with a stopper that can be pierced by a hypodermic injection needle). The container may also have a sterile access port.

[0113] Kits may optionally provide additional components such as buffers and interpretive information. Typically, kits include a container and a label or package insert(s) on or attached to the container. In some embodiments, the disclosure provides an article of manufacture comprising the contents of the kit described above.

[0114] General Technology The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press;Oligonucleotide Synthesis (MJ Gait, ed. 1984);Methods in Molecular Biology, Humana Press;Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1989) Academic Press;Animal Cell Culture (RI Freshney, ed. 1987);Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press;Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds. 1993-8) J. Wiley and Sons;Methods in Enzymology (Academic Press, Inc.);Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987);Current Protocols in Molecular Biology (FM Ausubel, et al. eds. 1987);PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994);Current Protocols in Immunology (J.It is fully described in the literature such as E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985); Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984); Animal Cell Culture (R.I. Freshney, ed. (1986); Immobilized Cells and Enzymes (lRL Press, (1986); and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).

[0115] Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purpose or subject matter referenced herein. [Example]

[0116] Example 1. Efficacy screening of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPS cells.

[0117] method Guide RNA design and synthesis In silico guide RNA design was completed by CRISPR Therapeutics. SpCas9 and SaCas9 guide RNAs targeting exons 2-15 of SCN9A and exons 1-14 of SCN10A were designed in silico and evaluated using off-target prediction algorithms. Guide RNAs with favorable off-target profiles were selected for synthesis and further on-target evaluation. The selected gRNAs included 99 SpCas9 gRNAs (Table 1) and 68 SaCas9 gRNAs (Table 2) targeting SCN9A, and 166 SpCas9 gRNAs (Table 3) and 73 SaCas9 gRNAs (Table 4) targeting SCN10A.

[0118] Guide RNAs were custom-ordered for synthesis by Synthego Corporation. Guide RNAs were ordered with standard chemical modifications, including 2'-O-methyl 3' phosphorothioate modifications at the first and last three nucleotides. For SpCas9 gRNAs, the 20-nucleotide genomic targeting sequence is shown in Tables 1 and 3, and a standard 80-mer SpCas9 scaffold sequence was added to create the guide RNA. For SaCas9 gRNAs, the 22-nucleotide genomic targeting sequence is shown in Tables 2 and 4 and was used for synthesis with the following SaCas9 scaffold sequence to generate the guide RNA: GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAA. GGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41).

[0119] Nucleofection of iPS cells using the 4D-Nucleofector® System Wild-type iPSCs and engineered iPSCs stably expressing Cas9 were used for various steps of the gRNA screening. iPSCs expressing SpCas9 or SaCas9 under the control of doxycycline were generated from wild-type iPSCs by inserting a targeting construct into the AAVS-1 locus. In this construct, two cassettes are expressed in opposite directions, separated by an IS2 insulator element. The first expression cassette is TetOn3G protein-2A-Puro under the control of the CASI promoter, and the second expression cassette is either SpCas9 or SaCas9 under the control of the TRE3G promoter.

[0120] iPSCs were electroporated using the Lonza 4D-Nucleofector® System with the P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, catalog: V4SP-3096) and program CM137. iPSCs were cultured in mTeSR1 (Stemcell Technologies, catalog: 85850). Prior to nucleofection, cells were dissociated using Accutase (Stemcell Technologies, catalog: 07920) and resuspended in P3 Nucleofection solution. For the 96-well format, 180,000 cells per well were electroporated with 400 ng of Cas9 mRNA (TriLink) and 400 ng of synthetic gRNA (Synthego) per well according to the manufacturer's instructions. After nucleofection, iPSCs were maintained in mTeSR1 medium supplemented with 10 μM Y27632 (Stemcell Technologies, catalog: 72308) in Matrigel-precoated 96-well cell culture plates for 72 hours before being subjected to DNA extraction and next-generation sequencing (NGS)-based insertion / deletion (indel) detection. Each electroporation experiment contained two replicates, and two independent experiments were performed. For stable SpCas9 and SaCas9 cell line experiments, cells were treated with 1 μg / ul doxycycline for 72 hours prior to Amaxa nucleofection.

[0121] Nucleofection of iPSC-derived sensory neurons using the Lonza 4D-Nucleofector® Y unit To generate iPSC-derived sensory neuron cultures (iSNs), iPSC cells were differentiated in Matrigel-coated flasks in the presence of a cocktail of small molecule developmental pathway inhibitors. At DIV 11, cells were detached, plated onto 384-well plates, and maintained in maturation medium containing a cocktail of growth factors until DIV 26-28. These neurons express canonical markers of nociceptors, including TRPV1, Brn3A, and peripheral markers Isl1, neuN, and SCN9A (NaV1.7), recapitulating the functional properties of physiologically relevant neuronal subtypes.

[0122] iPSC-derived sensory neurons (iSNs) were electroporated using the Lonza 4D-Nucleofector® Y unit and the AD1 4D-Nucleofector™ Y Kit (Lonza, catalog: V4YP-1A24) with program EH158. In a 24-well format, cells were electroporated with ribonucleoprotein complexes (RNPs) according to the manufacturer's instructions. RNP complexes were generated by incubating 425 pmol of SpCas9 or SaCas9 protein (Aldevron) with 531 pmol of synthetic gRNA (Synthego) for 20 minutes at room temperature. After nucleofection, iSNs were maintained in culture for 72 hours and then subjected to DNA extraction and next-generation sequencing (NGS)-based insertion / deletion (Indel) detection. Each electroporation experiment contained two replicates, and two independent experiments were performed.

[0123] Transduction of iPSC-derived sensory neurons with AAV In a 384-well format, approximately 12,000 iSNs per well were transduced with an AAV-1 vector expressing SaCas9 and SaCas9 gRNA in a single vector. iSNs were transduced with the AAV vector at a multiplicity of infection (MOI) of 750,000. After transduction, iSNs were maintained in culture for 7 days and then subjected to DNA extraction and NGS-based insertion / deletion (indel) detection. Each transduction experiment contained two replicates, and two independent experiments were performed.

[0124] Next-generation sequencing (NGS)-based insertion / deletion (Indel) detection Seventy-two hours after electroporation, DNA was extracted from iPSCs using Lucigen Quick Extract 2x DNA Extraction Solution (Lucigen, catalog: QE09050) according to the manufacturer's instructions. Next, a two-step PCR approach using KAPA2G Robust HotStart ReadyMix (Sigma-Aldrich, catalog: KK5702) was used to generate NGS libraries. The first PCR was used to generate amplicons, and the second PCR was used to add Nextera DNA Index (i7 / i5) adapter sequences. PCR #1 reaction consisted of 1 uL of extracted gDNA, 1x KAPA2G Robust HotStart ReadyMix, 0.5 uM forward primer, and 0.5 uM reverse primer. Primer sequences are listed in Tables 5 and 6. The PCR #2 reaction consisted of 1 µL of PCR #1 product, 1x KAPA2G Robust HotStart ReadyMix, 0.5 µM Index 1N7xx adapter, and 0.5 µM Index 2N5xx adapter. The cycling conditions for both PCR #1 and PCR #2 were as follows: (1) 95°C for 3 min, (2) 95°C for 15 s, (3) 60°C for 15 s, (4) 72°C for 15 s, (5) repeat steps (2)–(4) 20 times, (6) 72°C for 1 min, and (7) hold at 4°C indefinitely. Samples were then pooled and purified using the Zymo DNA Clean and Concentrator Kit (Zymo, D4034) and quantified on an Agilent 2100 Bioanalyzer (Agilent, catalog: G2939BA). Libraries were then run on an Illumina MiSeq to obtain paired-end reads (2 x 150).

[0125] For each sample, reads were then filtered to obtain a minimum Phred33 quality score of 30. Paired-end reads were then merged using FLASH (Fast Length Alignment of Short Reads), which required at least 1 bp overlap. The resulting merged reads were then optimally aligned to the corresponding reference amplicon sequence using the Needleman-Wunsch algorithm. Reads aligned with indels within 3 bp of the expected cleavage site were counted, and only frameshift indels whose indel length was not a multiple of 3 were filtered. For each sample, an estimate of total editing was calculated as the percentage of reads with indels proximal to the cleavage site, and productive editing was calculated as the percentage of reads with frameshift indel reads proximal to the cleavage site.

[0126] Once each sample was analyzed, sample quality control was performed by requiring each sample to have at least 90% of the sequenced reads successfully merged and 70% of the sequenced reads successfully aligned. Additionally, samples were required to have at least 1,000 successfully aligned reads. Finally, quality control was performed in a batch-by-batch manner, discarding all samples whose final aligned read count exceeded two standard deviations from the mean of the corresponding batch of samples. Passing samples were averaged by the calculated standard deviation. Positive and negative controls were included; negative controls were required to demonstrate an indel rate of less than 2%, indicating low levels of background noise, while positive control samples were required to demonstrate editing levels above background. Furthermore, reproducibility was confirmed by comparing corresponding samples between two technical replicates; a strong linear fit was demonstrated, with a high R of 0.85. 2 was observed.

[0127] Off-target evaluation of SpCas9 gRNAs targeting SCN9A and SCN10A in iPS cells For the initial off-target assessment, an in silico nomination step was performed to predict candidate off-target sequences based on sequence similarity, and these sites were then directly assessed via targeted next-generation sequencing to identify any sites that showed evidence of CRISPR-Cas-induced off-target editing.

[0128] a) Computational prediction of off-target sites Off-target sites were predicted based on sequence similarity using three computational algorithms. Specifically, CCTop and COSMID were used to identify candidate off-target sites with up to three mismatches or up to two mismatches and one DNA or RNA bulge from the on-target sequence, respectively. The PAM sequences used to identify off-target sites were NRG for SpCas9 guides and NNGRRT for SaCas9 guides. The guides identified from the two algorithms were then merged, which included de-duplication of sites with identical genomic coordinates. A total list of 1,471 putative off-target sites predicted across the 40 guides is shown in Table 7.

[0129] b) Hybrid capture of iPS cells iPSC transfections using two different wild-type donors were performed using the Lonza conditions described above. Two biological replicates were used, and genomic DNA was pooled to obtain the amount required for hybrid capture. DNA was extracted from iPSCs 72 hours after electroporation using the DNeasy 96 Blood and Tissue Kit (Qiagen, catalog: 69581). Samples were quantified using the Qubit 1x dsDNA HS Assay (ThermoFisher, catalog: Q33231) and an EnVision plate reader with 4PL calculations. A minimum of 200 ng of each sample was obtained and processed for hybrid capture using the SureSelect XT Reagent Kit (Aglient, catalog: G9704A). Briefly, samples were fragmented to 150-200 bp using a Covaris LE220, end-repaired, dA tails were added, and adapters were ligated. The library was then amplified using Herculase II Fusion DNA polymerase using the following cycling conditions: (1) 98°C for 2 minutes, (2) 98°C for 30 seconds, (3) 65°C for 30 seconds, (4) 72°C for 1 minute, (5) repeat steps (2)–(4) 10 times, (6) 72°C for 5 minutes, and (7) hold at 4°C indefinitely. The library was purified using a bead-based cleanup using AMPure XP (Beckman Coulter, catalog: A63881). The library was hybridized to a target-specific capture library, and the target molecules were captured with streptavidin-coated magnetic beads. The captured library was then amplified and purified using the same conditions described above. Samples were QCed using the DNA High Sensitivity kit on the TapeStation (Agilent, Catalog: 5067-5584) and / or Bioanalyer (Aglient, Catalog: 5067-1504) and sequenced on the Illumina HiSeq platform to a median sequencing coverage of 2,272x per candidate off-target site.

[0130] c) Computational analysis of targeted next-generation sequencing For each putative off-target site included in this study, the following analysis was performed to determine the strength of evidence for off-target editing induced by CRISPR-Cas treatment. First, next-generation sequencing reads were aligned to the hg38 human reference genome using the alignment tool bwa in mem mode with default parameters. Subsequently, read deduplication was performed using samtools to convert and sort SAM and BAM files. The Python package pysam was then used to stack reads containing indels within 3 bp of the predicted cut site and measure the indel formation rate by dividing the number of indel reads by the total number of reads covering that site.

[0131] The measured indel rates at each predicted off-target site were then compared between the treated samples from each iPSC donor and untreated (electroporation only) negative control samples matched to the same iPSC donor. If the indel rate at a site was observed to be greater than 0.2% greater than the negative control sample, the data for that candidate site were included in statistical testing. The only exceptions were candidate sites observed to harbor germline indel genetic variants, where an indel rate of approximately 50% or approximately 100% was observed in both matched untreated and treated samples from one or more donors. For sites that participated in statistical testing, a paired t-test was performed across both donors for the treated and untreated indel rates at that site. Tested sites with a p-value of less than .05 were considered to have confirmed off-target editing. Substantial on-target editing (average indel rates of 9.35%–52.25%) was confirmed across the guides as a positive control for this study.

[0132] [Table 1-1] [Table 1-2] [Table 1-3]

Table 1-4

[0133]

Table 2-1

Table 2-2

[0134]

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

[0135]

Table 4-1

Table 4-2

[0136]

Table 5-1

Table 5-2

Table 5-3

[0137]

Table 6-1

Table 6-2

Table 6-3

[0138]

Table 7-1

Table 7-2

Table 7-3

Table 7-4

Table 7-5

Table 7-6

Table 7-7

Table 7-8

Table 7-9

Table 7-10

Table 7-11

Table 7-12

Table 7-13

[0139] result Screening of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPS cells Following two rounds of gRNA screening and sequencing analysis in iPSCs, the average mean cleavage efficiency was calculated based on four replicates for each sample, looking at the total percentage of insertions and deletions (indels) at the predicted cleavage site for each gRNA. For the purposes of knocking out the SCN9A and SCN10A genes, the average percentage of indels resulting in frameshift mutations was also calculated. Guide RNAs were ranked by both the average total indel percentage and the average indel percentage resulting in frameshifts. Guide RNAs were listed in rank order based on the average indel percentage resulting in frameshifts; a scrambled non-targeting gRNA and untreated cells were included as negative controls (Tables 8-11).

[0140] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6]

[0141]

Table 9-1

Table 9-2

[0142]

Table 10-1

Table 10-2

Table 10-3

Table 10-4

Table 10-5

Table 10-6

Table 10-7

Table 10-8

Table 10-9

Table 10-10

[0143]

Table 11-1

Table 11-2

Table 11-3

[0144] Screening of top-ranked gRNAs targeting SCN9A and SCN10A in iPSCs stably expressing SpCas9 or SaCas9 and iPSC-derived sensory neurons Based on the on-target efficacy in the initial gRNA screening of iPSCs, 40 guides were prioritized for further on-target editing studies in additional cell models, such as iPSCs stably expressing Cas9 and iPSC-derived sensory neurons (iSNs) (Figures 1A-1D). Specifically, 10 guides were selected from each of four categories: 1) 10 gRNAs for SpCas9 targeting SCN9A, 2) 10 gRNAs for SpCas9 targeting SCN10a, 3) 10 gRNAs for SaCas9 targeting SCN9A, and 4) 10 gRNAs for SaCas9 targeting SCN10a (Tables 12 and 13).

[0145] These 40 prioritized gRNAs were screened in engineered iPSCs stably expressing either SpCas9 or SaCas9. Synthetic gRNAs were electroporated into the corresponding cell lines. These 40 gRNAs were previously screened for on-target editing efficiency in iSNs. For iSNs, RNP complexes of all 40 gRNAs were electroporated into adherent neuronal cultures. Additionally, 20 SaCas9 gRNAs were also delivered into iSNs using an all-in-one AAV vector expressing SaCas9 and gRNAs. Genomic DNA was purified from the processed cells for sequencing analysis, as described in the methods section.

[0146] For each model, two independent experiments were performed. The average mean cleavage efficiency was calculated based on four replicates for each sample, looking at the combined percentage of insertions and deletions (indels) at each gRNA's predicted cleavage site. For the purposes of knocking out the SCN9A and SCN10A genes, the average percentage of indels resulting in frameshift mutations was also calculated. Guide RNAs were ranked by the average percentage of indels that caused frameshifts. A summary of the on-target editing efficiency of these 40 prioritized gRNAs across different cell models can be found in Figures 1A-1D and Tables 12 and 13.

[0147] [Table 12-1] [Table 12-2]

[0148] [Table 13-1] [Table 13-2]

[0149] Off-target evaluation of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPS cells Based on their on-target efficacy in the initial gRNA screen in iPS cells, 40 guides were also prioritized for off-target evaluation. Specifically, 10 guides were selected from each of four categories: 1) 10 gRNAs for SpCas9 targeting SCN9A, 2) 10 gRNAs for SpCas9 targeting SCN10a, 3) 10 gRNAs for SaCas9 targeting SCN9A, and 4) 10 gRNAs for SaCas9 targeting SCN10a.

[0150] Of the 40 gRNAs included in the study, 29 gRNAs were classified as "Tier 1" (Table 14), where the off-target sites included in the study did not enter statistical testing. These 29 gRNAs included four gRNAs for which no off-target sites were predicted by sequence similarity criteria. Based on this study, these 29 gRNAs were deemed to have no evidence of off-target editing. Additionally, seven gRNAs were classified as "Tier 2" (Table 15), where at least one off-target site associated with the gRNA entered statistical testing but was not found to be statistically significant. These off-target profiles of these gRNAs were deemed inconclusive from this study. Additionally, four gRNAs were classified as "Tier 3" (Table 16), where at least one off-target site was found to have statistically significant off-target editing. These gRNAs were significantly deprioritized based on these off-target editing results. Every combination of target gene (SCN9A or SCN10A) and enzyme (SpCas9 or SaCas9) was found to have at least five Tier 1 guides.

[0151] [Table 14-1] [Table 14-2]

[0152] [Table 15]

[0153] [Table 16]

[0154] Other embodiments All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only one example of a generic series of equivalent or similar features.

[0155] From the foregoing description, those skilled in the art will be able to ascertain the essential features of the present disclosure, and will be able to make various changes and modifications to the present disclosure to adapt it to various uses and situations without departing from the spirit and scope thereof. Accordingly, other embodiments are within the scope of the following claims.

[0156] equivalent While several embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein. Each such variation and / or modification is deemed to be within the scope of the embodiments of the present invention described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application or uses for which the teachings of the present invention are / will be used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Accordingly, the foregoing embodiments are presented by way of example only, and it should be understood that, within the scope of the appended claims and their equivalents, embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. Furthermore, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0157] All definitions defined and used herein should be understood to supersede dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0158] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, and in some cases may include the entire document.

[0159] As used herein in the specification and claims, the indefinite articles "a" and "an" should be understood to mean "at least one," unless clearly indicated to the contrary.

[0160] As used herein in the specification and claims, the term "and / or" should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be construed in the same manner, i.e., "one or more" of the elements so conjoined. Other elements other than the elements specifically identified by the "and / or" clause may optionally be present, whether related to the elements specifically identified or not. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising," a reference to "A and / or B" may refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements), etc.

[0161] As used herein in the specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., the inclusion of at least one, but more than one, of a number or list of elements, and, optionally, additional unlisted items. When used only in terms clearly indicated to the contrary, such as "only one of" or "exactly one," or in the claims, "consisting of" refers to the inclusion of exactly one element of a number or list of elements. Generally, as used herein, the term "or" should only be interpreted as indicating exclusive alternatives (i.e., "both, but not one or the other") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0162] As used in the specification and claims herein, the phrase "at least one" in connection with a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements of the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements, and not excluding combinations of elements in the list of elements. This definition also allows for elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related to the specifically identified elements or not, may optionally be present. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer in one embodiment to including at least one, optionally more than one, A, i.e., A in the absence of B (and optionally including elements other than B); in another embodiment to including at least one, optionally more than one, B, i.e., A in the absence of A (and optionally including elements other than A); in yet another embodiment to including at least one, optionally more than one, A, and at least one, optionally more than one, B (and optionally including other elements); and so forth.

[0163] It is also to be understood that, unless expressly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are described.

Claims

1. 1. A gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene, the gene editing system comprising: (a) a first polynucleotide portion comprising an RNA-guided DNA endonuclease or a first nucleotide sequence encoding said RNA-guided DNA endonuclease; (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 1-20.

2. (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus pyogenes Cas9 (SpCas9), and (ii) the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 1 to 10. The gene editing system of claim 1.

3. The gene editing system of claim 2, wherein the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 1, 3 to 5, and 9.

4. (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus aureus Cas9 (SaCas9), and (ii) the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 11 to 20. The gene editing system of claim 1.

5. The gene editing system of claim 4, wherein the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 11 to 16 and 18 to 20.

6. The gene editing system of any one of claims 1 to 5, wherein the gRNA of (b) further comprises a scaffold sequence.

7. The gene editing system of any one of claims 4 to 6, wherein the gRNA of (b) comprises a nucleotide sequence of any one of SEQ ID NOs: 11 to 20, and the scaffold sequence comprises a nucleotide sequence of SEQ ID NO:

41.

8. 8. The gene editing system of any one of claims 1 to 7, wherein the first nucleotide sequence encoding the RNA-guided endonuclease of (a) further comprises a nucleotide sequence encoding a nuclear localization signal (NLS) fused in-frame to the RNA-guided endonuclease.

9. The gene editing system of claim 8, wherein the NLS is an SV40 NLS.

10. The gene editing system of any one of claims 1 to 9, wherein the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different polynucleotides.

11. The gene editing system of claim 10, wherein at least one of the different polynucleotides is a viral vector.

12. 12. The gene editing system of claim 11, wherein the viral vector(s) are adeno-associated viral (AAV) vector(s).

13. The gene editing system of any one of claims 1 to 12, wherein a single polynucleotide comprises the first polynucleotide portion of (a) and the second polynucleotide portion of (b).

14. The gene editing system of claim 13, wherein the single polynucleotide is a viral vector.

15. The gene editing system of claim 14, wherein the viral vector is an adeno-associated viral (AAV) vector.

16. A nucleic acid comprising the single polynucleotide of claim 14.

17. A viral particle or set of viral particles collectively comprising the gene editing system of any one of claims 1 to 15.

18. 18. The viral particle or set of viral particles of claim 17, which is an adeno-associated viral (AAV) particle(s).

19. 1. A method for editing the sodium voltage-gated channel alpha subunit 9 (SCN9A) gene, comprising: (a) a gene editing system according to any one of claims 1 to 15; (b) a nucleic acid according to claim 16, or (c) contacting the virus particle or set of virus particles of claim 17 or claim 18.

20. 20. The method of Claim 19, wherein the contacting step is carried out by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.

21. 21. The method of claim 20, wherein the subject is a human patient suffering from pain.

22. 22. The method of claim 21, wherein the cell is a neuron of the peripheral nervous system.

23. 20. The method of claim 19, wherein the cells are autologous cells.

24. 20. The method of claim 19, wherein the cell is a heterologous cell.

25. 25. The cell of claim 23 or 24, wherein the cell is a stem cell.

26. 26. The method of claim 25, wherein the stem cells are iPSC cells or mesenchymal stem cells.

27. The method of any one of claims 23 to 26, further comprising administering the cells to a subject in need thereof.

28. 28. The method of claim 27, wherein the subject is a human patient suffering from pain.

29. 1. A gene editing system for modifying a sodium voltage-gated channel alpha subunit 10 (SCN10A) gene, the gene editing system comprising: (a) a first polynucleotide portion comprising an RNA-guided DNA endonuclease or a first nucleotide sequence encoding said RNA-guided DNA endonuclease; (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 21-40.

30. (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus pyogenes Cas9 (SpCas9), and (ii) the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 21 to 30. The gene editing system of claim 29.

31. The gene editing system of claim 30, wherein the gRNA of (b) comprises a nucleotide sequence of any one of SEQ ID NOs: 22 to 25, and 30.

32. (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus aureus Cas9 (SaCas9), and (iii) the gRNA of (b) comprises any one of the nucleotide sequences of SEQ ID NOs: 31 to 40. The gene editing system of claim 29.

33. The gene editing system of any one of claims 29 to 32, wherein the gRNA of (b) further comprises a scaffold sequence.

34. The gene editing system of claim 32 or 33, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 31 to 40, and the scaffold sequence comprises the nucleotide sequence of SEQ ID NO:

41.

35. 35. The gene editing system of any one of claims 29 to 34, wherein the first nucleotide sequence encoding the RNA-guided endonuclease of (a) further comprises a nucleotide sequence encoding a nuclear localization signal (NLS) fused in-frame to the RNA-guided endonuclease.

36. 36. The gene editing system of claim 35, wherein the NLS is an SV40 NLS.

37. The gene editing system of any one of claims 29 to 36, wherein the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different polynucleotides.

38. 38. The gene editing system of claim 37, wherein at least one of the different polynucleotides is a viral vector.

39. 39. The gene editing system of Claim 38, wherein the viral vector(s) are adeno-associated viral (AAV) vector(s).

40. The gene editing system of any one of claims 29 to 39, wherein a single polynucleotide comprises the first polynucleotide portion of (a) and the second polynucleotide portion of (b).

41. 41. The gene editing system of Claim 40, wherein the single polynucleotide is a viral vector.

42. 42. The gene editing system of claim 41, wherein the viral vector is an adeno-associated viral (AAV) vector.

43. A nucleic acid comprising the single polynucleotide of claim 41.

44. A viral particle or set of viral particles collectively comprising the gene editing system of any one of claims 29 to 42.

45. 45. The viral particle or set of viral particles of claim 44, which is an adeno-associated viral (AAV) particle(s).

46. 1. A method for editing a target gene, comprising: (a) a gene editing system according to any one of claims 29 to 42; (b) a nucleic acid according to claim 43, or (c) contacting the virus particle or set of virus particles of claim 44 or claim 45.

47. 47. The method of Claim 46, wherein the contacting step is carried out by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.

48. 48. The method of claim 47, wherein the subject is a human patient suffering from pain.

49. 49. The method of claim 48, wherein the cell is a neuron of the peripheral nervous system.

50. 47. The method of claim 46, wherein the cells are autologous cells.

51. 47. The method of claim 46, wherein the cell is a heterologous cell.

52. 52. The method of claim 50 or 51, wherein the cell is a stem cell.

53. 53. The method of claim 52, wherein the stem cells are iPSC cells or mesenchymal stem cells.

54. 54. The method of any one of claims 50 to 53, further comprising administering said cells to a subject in need thereof.

55. 55. The method of claim 54, wherein the subject is a human patient suffering from pain.

56. 1. A method of treating a subject having pain, said method comprising: (a) a gene editing system according to any one of claims 1 to 15 and 29 to 42; (b) a nucleic acid according to claim 16 or claim 43, or (c) administering to the subject a viral particle or set of viral particles according to any one of claims 17, 18, 44, and 45.

57. 57. The method of Claim 56, wherein the administering step is carried out by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.

Images