Methods and compositions for sensitization of tumor cells to immune therapy

Abstract

To provide methods and compositions for sensitization of tumor cells to immune therapy.SOLUTION: Provided herein are methods and compositions related to the treatment or prevention of cancer (e.g., by targeting a tumor in a subject having cancer) by administering to the subject an agent that inhibits autophagy. In certain aspects, provided herein are methods of composition related to methods of sensitizing a cancer cell to tumor necrosis factor alpha (TNF-α)- mediated killing by contacting the cancer cell or administering an agent that inhibits autophagy. Provided herein are methods and compositions for increasing the sensitivity of cancer cells to T cell killing (e.g., tumor necrosis factor-α (TNF -α)- mediated killing) by inhibiting autophagy and / or the NF-κB pathway.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the following U.S. Provisional Patent Application No. 62 / 985,004, filed March 4, 2020, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy created on March 3, 2021 is named RPB-02025_SL.txt and is 14,383 bytes in size. [Background technology]

[0003] Cancer is the second leading cause of death in the United States. Immunotherapy has revolutionized cancer treatment, but tumor cell resistance to these therapies remains a major challenge. For example, loss-of-function mutations in beta2-microglobulin (B2M) or JAK1 / JAK2 in tumor cells are associated with clinical resistance to checkpoint blockade. Importantly, the molecular mechanisms regulating tumor cell sensitivity to T-cell killing have yet to be fully characterized. Therefore, there remains a need for novel and effective cancer treatments, including therapies that sensitize cancer cells to T-cell killing. Summary of the Invention [Means for solving the problem]

[0004] Provided herein are methods and compositions for increasing the sensitivity of cancer cells to T cell killing (e.g., tumor necrosis factor-α (TNF-α)-mediated killing) by inhibiting autophagy and / or the NF-κB pathway. Also provided herein are methods and compositions for treating and / or preventing cancer in a subject (e.g., a subject in need thereof) by inhibiting autophagy and / or the NF-κB pathway in cancer cells, thereby increasing the sensitivity of cancer cells in the subject to T cell killing (e.g., TNF-α-mediated killing). In some embodiments, the methods provided herein further include administering a cancer treatment (e.g., cancer immunotherapy) to the subject.

[0005] In some embodiments, provided herein are methods of sensitizing cancer cells to TNF-α-mediated killing by contacting the cancer cells with an agent (e.g., at least one agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the cancer cells. In certain embodiments, provided herein are methods of increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the cancer cells. In some embodiments, the cancer cells are within the subject. In some embodiments, the cancer cells are within a tumor (e.g., a solid tumor in the subject). In certain embodiments, the method further includes administering a cancer treatment (e.g., cancer immunotherapy) to the subject.

[0006] In some embodiments, the agent inhibits autophagy by inhibiting the expression or activity of an autophagy gene (i.e., a gene encoding a product whose inhibition results in a decrease in the level of autophagy in a cell). In some embodiments, the agent targets the autophagy gene (e.g., the agent modifies the sequence of the autophagy gene). In certain embodiments, the agent targets an autophagy gene product (e.g., an RNA or protein encoded by the autophagy gene). In some embodiments, the autophagy gene can be selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10.

[0007] In some embodiments, the agent inhibits the NF-κB pathway by inhibiting the expression or activity of an NF-κB pathway gene. In some embodiments, the agent targets the NF-κB pathway gene itself (e.g., the agent modifies the sequence of the NF-κB pathway gene). In certain embodiments, the agent targets an NF-κB pathway gene product (e.g., an RNA or protein encoded by an NF-κB pathway gene). In certain embodiments, the NF-κB gene may be selected from CFLAR, UBE2L3, RNF31, IKBKB, MAP3K7, TAB1, RELA, IKKBKG, CHUK, TAB2, TBK1, MAPKAPK2, RBCK1, TRAF2, SHARPIN, and TNFAIP3.

[0008] Thus, in certain embodiments, the agent can modify at least one autophagy gene or NF-κB gene, where the modification of at least one autophagy gene and / or NF-κB gene results in decreased expression and / or activity of the autophagy gene product and / or NF-κB gene product. In certain embodiments, the modification of the autophagy gene or NF-κB gene can include deletion, insertion, substitution, or a combination thereof. In certain embodiments, the agent can be a CRISPR / Cas agent, a TALEN nuclease, or a zinc finger nuclease.

[0009] In certain embodiments, the agent inhibits the activity and / or reduces the level of RNA or protein encoded by autophagy genes or NF-κB genes. In some embodiments, the agent can be an interfering nucleic acid (e.g., siRNA, shRNA, miRNA, or antisense oligonucleotide) that targets RNA (e.g., mRNA) encoded by autophagy genes or NF-κB genes. In some embodiments, the agent is a small molecule inhibitor of the autophagy or NF-κB pathway.

[0010] In certain embodiments, the methods provided herein further include administering an additional anti-cancer therapy to the subject. In some embodiments, the additional anti-cancer therapy is cancer immunotherapy. In some embodiments, the cancer immunotherapy includes administering autologous or allogeneic T cell therapy to the subject, administering autologous or allogeneic CAR T cell therapy to the subject, administering a cancer vaccine to the subject, administering TNF-α to the subject, and / or administering an immune checkpoint inhibitor to the subject. In some embodiments, the additional anti-cancer therapy includes administering a Smac mimetic (e.g., LCL-161, APG-1387, TL32711, GDC-0917, HGS1029, AT-406) to the subject.

[0011] In certain embodiments, provided herein are agents that inhibit autophagy in cancer cells for use in sensitizing a subject's cancer cells to TNF-α-mediated killing. Further, in some embodiments, provided herein are agents that inhibit autophagy in cancer cells for use in increasing TNF-α-mediated killing of a subject's cancer cells. In some embodiments, provided herein are combination therapies comprising an agent that inhibits autophagy in cancer cells and a cancer immunotherapy for use in treating cancer. In an embodiment of the present invention, for example, the following items are provided: (Item 1) 1. A method of sensitizing cancer cells to tumor necrosis factor alpha (TNF-α)-mediated killing, the method comprising contacting the cancer cells with an agent that inhibits autophagy of the cancer cells. (Item 2) 2. The method of claim 1, wherein the agent inhibits the expression or activity of an autophagy gene. (Item 3) 3. The method according to item 2, wherein the autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. (Item 4) Item 4. The method of Item 2 or Item 3, wherein the agent modifies at least one autophagy gene, and the modification of the at least one autophagy gene reduces the expression or activity of the autophagy gene. (Item 5) 5. The method of item 4, wherein the modification of the autophagy gene comprises a deletion, insertion, substitution, or a combination thereof. (Item 6) 6. The method of any one of Items 1 to 5, wherein the agent is a composition comprising a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence in the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 7) 7. The method of claim 6, wherein the guide RNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break in the autophagy gene. (Item 8) 8. The method of claim 6 or 7, wherein the guide RNA target sequence comprises or is adjacent to the start codon of the autophagy gene. (Item 9) 9. The method of item 8, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 10) 10. The method of any one of items 6 to 9, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 11) 11. The method of claim 10, wherein the guide RNA is a modular guide RNA in which the crRNA and tracrRNA are separate molecules that hybridize to each other. (Item 12) 12. The method of any one of items 6 to 11, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 13) 13. The method of claim 12, wherein the Cas protein is a nuclease-active Cas protein. (Item 14) 13. The method of claim 12, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 15) 15. The method of claim 13 or 14, wherein the Cas protein is a Cas9 protein. (Item 16) The Cas9 molecule may be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a 16. The method of item 15, wherein the Cas9 protein is a Cas9 protein or a N. meningitidis Cas9 protein. (Item 17) 6. The method of any one of Items 1 to 5, wherein the agent is a composition comprising a nucleic acid including a first nucleotide sequence encoding a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence in the autophagy gene, and the guide RNA includes a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 18) 18. The method of claim 17, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 19) 19. The method of item 18, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 20) 18. The method of item 17, wherein the guide RNA target sequence is in exon 1 or exon 2 of the autophagy gene. (Item 21) 21. The method of any one of items 17 to 20, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 22) 22. The method of any one of items 17 to 21, wherein the guide RNA is a modular guide RNA, in which the crRNA and the tracrRNA are separate molecules that hybridize to each other. (Item 23) 23. The method of claim 22, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 24) 24. The method of claim 23, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 25) 25. The method of claim 23 or 24, wherein the Cas protein is a Cas9 protein. (Item 26) 26. The method of claim 25, wherein the Cas9 protein is a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein. (Item 27) 6. The method of any one of items 1 to 5, wherein the agent is a TALEN nuclease or a zinc finger nuclease. (Item 28) 4. The method according to any one of items 1 to 3, wherein the agent inhibits the activity of an RNA or a protein. (Item 29) 29. The method of claim 28, wherein the agent is an interfering nucleic acid. (Item 30) 30. The method of claim 29, wherein the interfering nucleic acid is an siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 31) The drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wortmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and vaccinia. The method of item 1, wherein the small molecule autophagy inhibitor is selected from Olin-1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lucanthone, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071. (Item 32) 32. The method according to any one of items 1 to 31, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, renal cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, blood cancer cells, nerve tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 33) 33. The method of claim 32, wherein the cancer cells are breast cancer cells. (Item 34) 33. The method of claim 32, wherein the cancer cells are colon cancer cells. (Item 35) 33. The method of claim 32, wherein the cancer cells are lung cancer cells. (Item 36) 33. The method of claim 32, wherein the cancer cells are ovarian cancer cells. (Item 37) 33. The method of claim 32, wherein the cancer cells are cervical cancer cells. (Item 38) 33. The method of claim 32, wherein the cancer cells are bladder cancer cells. (Item 39) 33. The method of claim 32, wherein the cancer cells are renal cancer cells. (Item 40) 40. The method according to any one of items 1 to 39, wherein the cancer cells are in a subject, and the agent that inhibits autophagy of the cancer cells is administered to the subject. (Item 41) 41. The method of claim 40, wherein the subject is a human subject. (Item 42) 1. A method of sensitizing cancer cells in a subject to tumor necrosis factor alpha (TNF-α)-mediated killing, the method comprising administering to the subject an agent that inhibits autophagy of the cancer cells. (Item 43) 1. A method for increasing tumor necrosis factor alpha (TNF-α)-mediated killing of cancer cells in a subject, the method comprising administering to the subject at least one agent that inhibits autophagy of the cancer cells. (Item 44) 44. The method of claim 42 or 43, wherein the agent inhibits the expression or activity of an autophagy gene. (Item 45) 45. The method of item 44, wherein the autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. (Item 46) 46. ​​The method of claim 44 or 45, wherein the agent modifies at least one autophagy gene, and modifying the at least one autophagy gene reduces the expression or activity of the autophagy gene. (Item 47) 47. The method of claim 46, wherein the modification of the autophagy gene comprises deletion, insertion, substitution, a combination thereof, or binding of a Cas protein. (Item 48) 48. The method of any one of Items 42 to 47, wherein the agent is a composition comprising a guide RNA (gRNA) effective to induce a Cas enzyme to cleave or bind to a sequence of the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 49) 49. The method of claim 48, wherein the guide RNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break in the autophagy gene. (Item 50) 50. The method of claim 48 or 49, wherein the guide RNA target sequence comprises or is adjacent to the start codon of the autophagy gene. (Item 51) 51. The method of item 50, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 52) 50. The method of item 48 or 49, wherein the guide RNA target sequence is in exon 1 or exon 2 of the autophagy gene. (Item 53) 53. The method of any one of Items 48 to 52, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 54) 54. The method of claim 53, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA are separate molecules that hybridize to each other. (Item 55) 55. The method of any one of items 48 to 54, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 56) 56. The method of claim 55, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 57) 57. The method of any one of items 54 to 56, wherein the Cas protein is a Cas9 protein. (Item 58) The Cas9 molecule may be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a 58. The method of item 57, wherein the Cas9 protein is a N. meningitidis Cas9 protein. (Item 59) 48. The method of any one of Items 42 to 47, wherein the agent is a composition comprising a nucleic acid including a first nucleotide sequence encoding a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence of the autophagy gene, and the guide RNA includes a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 60) 60. The method of claim 59, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 61) 61. The method of item 60, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 62) 60. The method of item 59, wherein the guide RNA target sequence is in exon 1 or exon 2 of the autophagy gene. (Item 63) 63. The method of any one of Items 59 to 62, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 64) 4. The method of claim 3, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA are separate molecules that hybridize to each other. (Item 65) 65. The method of claim 63 or 64, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 66) 66. The method of item 65, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 67) 67. The method of any one of items 64 to 66, wherein the Cas protein is a Cas9 protein. (Item 68) 68. The method of claim 67, wherein the Cas9 protein is a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein. (Item 69) 47. The method of any one of items 42 to 46, wherein the agent is a TALEN nuclease or a zinc finger nuclease. (Item 70) 46. ​​The method according to any one of items 42 to 45, wherein the agent inhibits the activity of an RNA or a protein. (Item 71) 71. The method of claim 70, wherein the agent is an interfering nucleic acid. (Item 72) 72. The method of claim 71, wherein the interfering nucleic acid is an siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 73) The drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wortmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and vacuolin- 44. The method of claim 42 or 43, wherein the small molecule autophagy inhibitor is selected from the group consisting of 1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lucanthone, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071. (Item 74) 74. The method according to any one of Items 42 to 73, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, renal cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, blood cancer cells, neural tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 75) 75. The method of item 74, wherein the cancer cells are breast cancer cells. (Item 76) 75. The method of claim 74, wherein the cancer cells are colon cancer cells. (Item 77) 75. The method of item 74, wherein the cancer cells are lung cancer cells. (Item 78) 75. The method of item 74, wherein the cancer cells are ovarian cancer cells. (Item 79) 75. The method of item 74, wherein the cancer cells are cervical cancer cells. (Item 80) 75. The method of claim 74, wherein the cancer cells are bladder cancer cells. (Item 81) 75. The method of item 74, wherein the cancer cells are renal cancer cells. (Item 82) 1. A method of sensitizing a tumor in a subject to tumor necrosis factor alpha (TNF-α)-mediated killing, the method comprising administering to the subject an agent that inhibits autophagy of the tumor. (Item 83) 1. A method for increasing tumor necrosis factor alpha (TNF-α)-mediated killing of a tumor in a subject, the method comprising administering to the subject at least one agent that inhibits autophagy of the tumor. (Item 84) 84. The method of claim 82 or 83, wherein the agent inhibits the expression or activity of an autophagy gene. (Item 85) 85. The method of Item 84, wherein the autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. (Item 86) 86. The method of claim 84 or 85, wherein the agent modifies at least one autophagy gene, and modifying the at least one autophagy gene reduces the expression or activity of the autophagy gene. (Item 87) 87. The method of item 86, wherein the modification of the autophagy gene comprises deletion, insertion, substitution, a combination thereof, or binding of a Cas protein. (Item 88) 88. The method of any one of Items 82 to 87, wherein the agent is a composition comprising a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence of the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 89) 90. The method of claim 88, wherein the gRNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within the autophagy gene. (Item 90) 90. The method of claim 88 or 89, wherein the guide RNA target sequence comprises or is adjacent to the start codon of the autophagy gene. (Item 91) 91. The method of item 90, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 92) 90. The method of claim 88 or 89, wherein the guide RNA target sequence is in exon 1 or exon 2 of the autophagy gene. (Item 93) 93. The method of any one of items 88 to 92, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 94) 94. The method of claim 93, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA are separate molecules that hybridize to each other. (Item 95) 95. The method of any one of items 88 to 94, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 96) 96. The method of item 95, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 97) 97. The method of any one of items 94 to 96, wherein the Cas protein is a Cas9 protein. (Item 98) The Cas9 molecule may be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a 98. The method of claim 97, wherein the Cas9 protein is a N. meningitidis Cas9 protein. (Item 99) 99. The method of claim 98, wherein the Cas9 molecule is a S. aureus Cas9 protein. (Item 100) 88. The method of any one of Items 82 to 87, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a gRNA effective to induce a Cas enzyme to cleave or bind to a sequence of the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 101) 101. The method of claim 100, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 102) 102. The method of item 100 or 101, wherein the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10 or 5 nucleotides of the start codon. (Item 103) 101. The method of claim 100, wherein the guide RNA target sequence is in exon 1 or exon 2 of the autophagy gene. (Item 104) 104. The method of any one of items 100 to 103, wherein the guide RNA comprises a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising the DNA targeting segment and a trans-activating CRISPR RNA (tracrRNA). (Item 105) 105. The method of claim 104, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA are separate molecules that hybridize to each other. (Item 106) 106. The method of any one of items 100 to 105, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 107) 107. The method of claim 106, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 108) 108. The method of any one of items 105 to 107, wherein the Cas protein is a Cas9 protein. (Item 109) 109. The method of claim 108, wherein the Cas9 protein is a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein. (Item 110) 87. The method of any one of items 82 to 86, wherein the agent is a TALEN nuclease or a zinc finger nuclease. (Item 111) 86. Any of items 82 to 85, wherein the agent inhibits the activity of RNA or protein. 10. The method according to claim 1. (Item 112) 112. The method of claim 111, wherein the agent is an interfering nucleic acid. (Item 113) 113. The method of claim 112, wherein the interfering nucleic acid is an siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 114) The drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wortmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and vacuolin- 1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lucanthone, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071. (Item 115) 115. The method of any one of paragraphs 82 to 114, wherein the tumor is an adenocarcinoma, an adrenal tumor, anal tumor, bile duct tumor, bladder tumor, bone tumor, brain / CNS tumor, breast tumor, cervical tumor, colorectal tumor, endometrial tumor, esophageal tumor, Ewing's tumor, eye tumor, gallbladder tumor, gastrointestinal tumor, kidney tumor, laryngeal or hypopharyngeal tumor, liver tumor, lung tumor, mesothelioma, multiple myeloma, muscle tumor, nasopharyngeal tumor, neuroblastoma, oral cavity tumor, osteosarcoma, ovarian tumor, pancreatic tumor, penile tumor, pituitary tumor, primary tumor, prostate tumor, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, soft tissue sarcoma, melanoma, metastatic tumor, basal cell carcinoma, Merkel cell tumor, testicular tumor, thymus tumor, thyroid tumor, uterine tumor, vaginal tumor, vulvar tumor, or Wilms' tumor. (Item 116) Item 116. The method of item 115, wherein the tumor is a breast tumor. (Item 117) 116. The method of claim 115, wherein the tumor is a colorectal tumor. (Item 118) 116. The method of claim 115, wherein the tumor is a lung tumor. (Item 119) Item 116. The method of item 115, wherein the tumor is an ovarian tumor. (Item 120) Item 116. The method of item 115, wherein the tumor is a cervical tumor. (Item 121) Item 116. The method of item 115, wherein the tumor is a bladder tumor. (Item 122) 116. The method of claim 115, wherein the tumor is a renal tumor. (Item 123) 123. The method of any one of items 115 to 122, wherein the tumor is a primary tumor. (Item 124) 123. The method according to any one of items 115 to 122, wherein the tumor is a metastatic tumor. (Item 125) The method of any one of items 42 to 124, wherein the subject has been administered a chemotherapy drug prior to administration of the drug. 10. The method according to any one of claims 1 to 9. (Item 126) 126. The method of claim 125, wherein the subject is resistant to the chemotherapy agent. (Item 127) 127. The method of any one of items 42 to 126, wherein the agent is administered systemically. (Item 128) Item 128. The method of item 127, wherein the agent is administered intravenously. (Item 129) 127. The method of any one of items 42 to 126, wherein the agent is administered subcutaneously. (Item 130) 127. The method of any one of items 42 to 126, wherein the agent is administered intramuscularly. (Item 131) 127. The method according to any one of items 42 to 126, wherein the agent is administered orally. (Item 132) 127. The method of any one of items 42 to 126, wherein the agent is administered topically. (Item 133) 133. The method of claim 132, wherein the subject has a tumor and the at least one agent is administered locally to the tumor or tumor microenvironment. (Item 134) 134. The method according to any one of items 42 to 133, further comprising administering an additional anti-cancer therapy to the subject. (Item 135) Item 135. The method of item 134, wherein the additional anticancer therapy is a cancer immunotherapy. (Item 136) 136. The method of claim 134 or 135, wherein the cancer immunotherapy comprises autologous or allogeneic T cell therapy, or autologous or allogeneic CAR T cell therapy. (Item 137) Item 136. The method of item 135, wherein the cancer immunotherapy comprises administering TNF-α to the subject. (Item 138) 136. The method of claim 135, wherein the cancer immunotherapy comprises administering to the subject an immune checkpoint inhibitor. (Item 139) 139. The method of claim 138, wherein the immune checkpoint inhibitor comprises an antibody specific for an immune checkpoint protein selected from CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilin, and A2aR. (Item 140) The immune checkpoint inhibitors include cemiplimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, sintilimab (IBI308), and spartan-1111. Pidilizumab (PDR001), tislelizumab (BGB-A317), pidilizumab, BCD-100, toripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG404, BCD-100, BI754091, F520, HLX10, HX008, JTX-4014, LZM009, MEDI0680, MGA012, Sym021, TSR-042, PSB205, MGD019, MGD013, AK104, XmAb20717, RO712 1661, CX-188, INCB086550, FS118, BCD-135, BGB-A333, CBT-502, CK-301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311, SHR-1316, TG-1501, ZKAB001, INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550, CA-170, CX-072, ADU-1604, AGEN1181, AGEN1884, MK-1308, REGN4659, XmA 140. The method of claim 139, wherein the antibody is b22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, tremelimumab, BMS-986258, BGB-A425, INCAGN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, leratolimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022. (Item 141) Item 136. The method of item 135, wherein the cancer immunotherapy comprises administering a cancer vaccine to the subject. (Item 142) A method of treating cancer in a subject, the method comprising administering to the subject an agent that inhibits autophagy in cancer cells of the subject and a cancer immunotherapy. (Item 143) 143. The method of claim 142, wherein the cancer immunotherapy comprises autologous or allogeneic T cell therapy, or autologous or allogeneic CAR T cell therapy. (Item 144) Item 143. The method of item 142, wherein the cancer immunotherapy comprises administering TNF-α to the subject. (Item 145) 143. The method of claim 142, wherein the cancer immunotherapy comprises administering to the subject an immune checkpoint inhibitor. (Item 146) 146. The method of claim 145, wherein the immune checkpoint inhibitor comprises an antibody specific for an immune checkpoint protein selected from CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilin, and A2aR. (Item 147) The immune checkpoint inhibitors include cemiplimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, sintilimab (IBI308), and spartan-1111. Pidilizumab (PDR001), tislelizumab (BGB-A317), pidilizumab, BCD-100, toripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG404, BCD-100, BI754091, F520, HLX10, HX008, JTX-4014, LZM009, MEDI0680, MGA012, Sym021, TSR-042, PSB205, MGD019, MGD013, AK104, XmAb20717, RO712 1661, CX-188, INCB086550, FS118, BCD-135, BGB-A333, CBT-502, CK-301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311, SHR-1316, TG-1501, ZKAB001, INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550, CA-170, CX-072, ADU-1604, AGEN1181, AGEN1884, MK-1308, REGN4659, XmA 146. The method of claim 145, wherein the antibody is b22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, tremelimumab, BMS-986258, BGB-A425, INCAGN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, leratolimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022. (Item 148) Item 143. The method of item 142, wherein the cancer immunotherapy comprises administering to the subject a cancer vaccine. (Item 149) 149. The method according to any one of items 142 to 148, wherein the agent inhibits the expression or activity of an autophagy gene. (Item 150) 150. The method of claim 149, wherein the autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. (Item 151) 151. The method of claim 149 or 150, wherein the agent modifies at least one autophagy gene, and modifying the at least one autophagy gene reduces the expression or activity of the autophagy gene. (Item 152) 152. The method of claim 151, wherein the modification of the autophagy gene comprises deletion, insertion, substitution, a combination thereof, or binding of a Cas protein. (Item 153) 153. The method of any one of Items 142 to 152, wherein the agent is a composition comprising a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence in the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 154) 154. The method of claim 153, wherein the gRNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within the autophagy gene. (Item 155) 155. The method of claim 153 or 154, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 156) 156. The method of claim 155, wherein the Cas protein is a nuclease-active Cas protein. (Item 157) 156. The method of claim 155, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 158) 158. The method of any one of items 155 to 157, wherein the Cas protein is a Cas9 protein. (Item 159) The Cas9 molecule may be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a 159. The method of claim 158, wherein the Cas9 protein is a N. meningitidis Cas9 protein. (Item 160) 153. The method of any one of Items 142 to 152, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a guide RNA effective to induce a Cas enzyme to cleave or bind to a sequence in the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene. (Item 161) 161. The method of claim 160, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 162) 162. The method of claim 161, wherein the Cas protein is a nuclease-active Cas protein. (Item 163) 163. The method of claim 162, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 164) 164. The method of any one of items 161 to 163, wherein the Cas protein is a Cas9 protein. (Item 165) 165. The method of claim 164, wherein the Cas9 protein is a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein. (Item 166) 153. The method of any one of items 142 to 152, wherein the agent is a TALEN nuclease or a zinc finger nuclease. (Item 167) 151. The method of any one of items 142 to 150, wherein the agent inhibits the activity of an RNA or a protein. (Item 168) 168. The method of claim 167, wherein the agent is an interfering nucleic acid. (Item 169) 169. The method of claim 168, wherein the interfering nucleic acid is an siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 170) The drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wortmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, vacuolin-1, and bilephrine. 149. The method of any one of items 142 to 148, wherein the small molecule autophagy inhibitor is selected from the group consisting of thrombustine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lucanthone, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071. (Item 171) 171. The method according to any one of items 142 to 170, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, renal cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, blood cancer cells, neural tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 172) Item 172. The method of item 171, wherein the cancer cells are breast cancer cells. (Item 173) Item 172. The method of item 171, wherein the cancer cells are colon cancer cells. (Item 174) Item 172. The method of item 171, wherein the cancer cells are lung cancer cells. (Item 175) Item 172. The method of item 171, wherein the cancer cells are ovarian cancer cells. (Item 176) Item 172. The method of item 171, wherein the cancer cells are cervical cancer cells. (Item 177) Item 172. The method of item 171, wherein the cancer cells are bladder cancer cells. (Item 178) Item 172. The method of item 171, wherein the cancer cells are renal cancer cells. (Item 179) 179. The method according to any one of items 42 to 178, wherein the subject is a human. (Item 180) An agent that inhibits autophagy in cancer cells for use in sensitizing a subject's cancer cells to tumor necrosis factor alpha (TNF-α)-mediated killing. (Item 181) An agent that inhibits autophagy in cancer cells for use in increasing tumor necrosis factor alpha (TNF-α) mediated killing of cancer cells in a subject. (Item 182) A combination therapy comprising an agent that inhibits autophagy in cancer cells and a cancer immunotherapy for use in the treatment of cancer. [Brief explanation of the drawings]

[0012] [Figure 1-1] This figure, consisting of seven sections (A–G), shows that a genome-wide CRISPR KO screen identifies tumor cell genes that regulate cytotoxic T cell killing. A shows a schematic of the pooled CRISPR screen. MC38 cancer cells modified with a mouse GeCKO sgRNA library were intermittently administered Ova or a scrambled control peptide and then cultured with activated Ova-specific cytotoxic T cells. After T cell killing, sgRNA expression in surviving tumor cells was assessed by Illumina sequencing. Biological triplicates were performed (B, D, F). Volcano plots show genes that either promote (enriched sgRNAs) or restrict (depleted sgRNAs) tumor cell killing. Genes of interest that promote killing are highlighted in B (e.g., antigen presentation, TNFα signaling, mTOR signaling). Genes of interest that restrict killing are highlighted in D and F (e.g., NF-κB pathway, autophagy). The X-axis shows the Z-score (calculated from the average log2 fold change of six sgRNAs targeting each gene in cells treated with Ova intermittently compared to cells treated with scrambled peptide intermittently). The Y-axis shows the P-value calculated by MAGeCK (C, E, G). Distribution (frequency histogram) of the log2 fold change of all 129,209 sgRNAs in the library. Individual sgRNAs targeting genes of interest are indicated by a diagonal line in C and by a diagonal line in E and G. [Figure 1-2] Same as above. [Figure 1-3] Same as above. [Figure 1-4] Same as above. [Figure 1-5] Same as above. [Figure 1-6] Same as above. [Figure 1-7] Same as above.

[0013] [Figure 2-1]This figure has seven sections (A–G) and shows that TNFα-mediated apoptosis is a key component of tumor cell killing by T cells. A shows a simplified model of TNFα / NF-κB signaling. B shows control (MC38-mGeCKO) or B2mKO cells were intermittently treated with Ova peptide and incubated with T cells from OT-1 mice in the presence of 10 μg / ml of TNFα-blocking antibody or isotype control. Cell viability was measured 24 hours later. Bar graphs show relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, versus MC38-mGeCKO + control Ab; one-way ANOVA with Tukey's multiple comparison test. +P<0.05, versus MC38-B2mKO + control Ab. C shows the effect of caspase inhibition (25 μM z-VAD-FMK), Tnfrsf1a KO, Fadd KO, or Ripk1 KO on the viability of MC38 cells treated with 10 ng / ml TNFα for 24 hours. Bar graphs show relative cell viability ± SD (n=3). Western blots confirming target protein depletion are shown below the graph. * indicates Ripk1 KO used in the assay. D shows that the indicated concentrations of TNFα were added to tumor cell lines and cell viability was measured 24 hours later (n=3). E shows Western blots showing the levels of the indicated proteins 24 hours after the addition of 10 ng / ml TNFα to each cell line. F and G show Western blots showing the levels of the indicated proteins in MC38 or B16F10 cells treated with 10 ng / ml TNFα for the indicated times. [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 2-4] Same as above.

[0014] [Figure 3-1]The seven panels (A–G) show that NF-κB signaling restricts tumor cell killing by T cells. (A) Western blots showing Map3k7 (also known as Tak1) and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing a Map3k7-targeting sgRNA (sg5 and sg3 were the most significantly depleted in the screening, while sg1 was the least depleted). (B) Control or Map3k7 KO cells were intermittently treated with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test, versus parental MC38 cells. ++P<0.005, ++++P<0.0001, vs. Map3k7 sg5. C, T cell killing of the indicated cell lines was performed in the presence of 20 μg / ml of TNFα-blocking antibody. D, Cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. n=3. E, Western blot showing the levels of the indicated proteins 2 hours after treatment with 10 ng / ml of TNFα. F and G, Cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 3-2] Same as above.

[0015] [Figure 4-1]This figure has six sections (A–F) and shows that autophagy limits tumor cell killing by T cells. (A) Western blots showing Rb1cc1 and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing an Rb1cc1-targeting sgRNA (sg4 and sg5 were the most significantly depleted in the screening, while sg3 was the least depleted). (B) Control or Rb1cc1 KO cells were intermittently administered with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test, versus parental MC38 cells. ++++P<0.0001 vs. Rb1cc1 sg4. C: T cell killing of the indicated cell line was performed in the presence of 20 μg / ml of TNFα-blocking antibody. *P<0.05, ***P<0.0005 vs. parental MC38 cells. D: Cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. E and F: Cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 4-2] Same as above.

[0016] [Figure 5-1]This figure, consisting of nine sections (A–I), shows that inhibition of autophagy promotes TNFα-mediated caspase-8 activation, independent of its effects on NF-βB signaling. A shows Western blots depicting the levels of the indicated proteins in control or Rb1cc1 KO MC38 cells 4 hours after treatment with 10 ng / ml TNFα. B shows Western blots depicting the levels of the indicated proteins in control or Rb1cc1 KO cells 30 minutes (Ik-Bα) or 4 hours (A20) after treatment with 10 ng / ml TNFα. C shows Western blots depicting the levels of the indicated proteins in control or Map3k7 (Tak1) KO cells. D shows the addition of soluble TNFα to Rb1cc1 KO cells for 24 hours in the presence or absence of 25 μM z-VAD-FMK (a caspase inhibitor). Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (no TNFα, no caspase inhibitors). Groups were compared by one-way ANOVA with Tukey's multiple comparison test. E shows MC38 cells untreated or treated with 10 ng / ml TNFα for 16 hours in the absence or presence of 5 μM autofinib. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (no TNFα, no autofinib). F shows Western blots showing the levels of the indicated proteins in cells untreated or treated with 10 ng / ml TNFα for 30 minutes (Ik-Bα) or 4 hours (caspase-8, p62) in the absence or presence of 5 μM autofinib. (G) Control, Tnfrsf1a KO, Fadd KO, or Ripk1 KO cells were untreated or treated with 10 ng / ml TNFα for 24 hours in the absence or presence of 5 μM autofluorescence inhibitor or 1 μM LCL-161 (a Smac mimetic). Bar graphs show relative cell viability ± SD (n=3) compared to control cells (TNFα or empty vector cells without inhibitors). ****P<0.0001 vs. TNFα-treated empty vector cells. (H) TNFα was added to Rb1cc1 KO cells for 24 hours in the absence or presence of 50 μM Nec-1 (a necroptosis inhibitor).Bar graphs show relative cell viability ± SD (n=3) compared to control cells (no TNFα, no caspase inhibitors). (I) Western blots showing phospho-MLKL, total MLKL, and β-actin levels in L929 mouse fibroblast cell line and MC38 parental cells (mock), MC38-Cas9 cells transduced with empty vector, or cells expressing Rb1cc1-targeting sgRNA. Cells were treated for 30 minutes with or without 10 ng / ml TNFα, 50 μM Nec-1s, and 20 μM Z-VAD-FMK. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 5-5] Same as above.

[0017] [Figure 6-1]The seven panels (A–G) show that mTOR signaling in tumor cells is required for maximal TNFα- and T cell-mediated killing. (A) Western blot showing the levels of the indicated proteins in MC38 cells transduced with empty vector or cells expressing Mlst8-targeting sgRNAs (sg4 and sg1 were most significantly enriched in the screen, while sg3 was least enriched). (B) Control or Mlst8 KO cells were untreated or treated with 10 ng / ml TNFα for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to control cells (no TNFα). *P<0.05, **P<0.005, one-way ANOVA with Tukey's multiple comparison test vs. empty vector cells treated with TNFα. (C) Control or Mlst8 KO cells were intermittently treated with Ova peptide and incubated with OT-1 T cells for 24 hours. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (no T cells). *P < 0.05, **P < 0.005 vs. empty vector cells incubated with T cells. D shows Western blots showing the levels of the indicated proteins in MC38 cells treated with 200 nM rapamycin for the indicated times. E shows wells pretreated with vehicle or 200 nM rapamycin, then untreated or treated with 10 ng / ml TNFα for 24 hours. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (vehicle, no TNFα). F shows cells pretreated with vehicle or rapamycin were intermittently dosed with either scrambled control peptide or Ova peptide and incubated with OT-1 T cells for 24 hours. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (no T cells, scrambled peptide). G shows a flow diagram depicting tumor cell pathways that regulate killing by T cells. [Figure 6-2] Same as above. [Figure 6-3] Same as above.

[0018] [Figure 7-1]Figure 1 has six sections, A–F, showing that autophagy limits CD3 bispecific antibody-induced killing of human cancer cells. (A) Human ZR-75-1 breast cancer cells were untreated or treated with 10 ng / ml TNFα for 24 hours in the absence or presence of 5 μM autofenib or SAR-405. Bar graphs show relative cell viability ± SD (n=3) compared to control cells (vehicle, no TNFα). Groups were compared by one-way ANOVA with Tukey's multiple comparison test. (B) Western blots showing the levels of the indicated proteins after 16 hours of treatment of ZR-75-1 cells with 5 μM autofenib or SAR-405 in the absence or presence of 10 ng / ml TNF****. (D) ZR-75-1 cells were incubated with activated human T cells at the indicated E:T ratio in the presence of 12 ng / ml of control or breast tumor antigen x CD3 (TAAxCD3 (shown in C)) bispecific antibody in the absence or presence of 5 μM SAR-405 for 24 hours. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells (no T cells, control bispecific antibody). (E) Western blots showing the levels of the indicated proteins in ZR-75-1 control or Rb1cc1 KO cells. (F) ZR-75-1 control or Rb1cc1 KO cells were incubated with T cells plus bispecific antibody as described above. Bar graphs show relative cell viability ± SD (n = 3) compared to control cells + control bsAb. **P < 0.005 vs. control cells. ****P < 0.0001 vs. control cells + CD3 bsAb. ++++P<0.0001 vs. Rb1cc1 KO+CD3bsAb. [Figure 7-2] Same as above. [Figure 7-3] Same as above.

[0019] [Figure 8-1]This figure has seven sections (A–G) and shows that inactivation of autophagy sensitizes tumors to immunotherapy. A shows Western blots showing the levels of the indicated proteins in EMT6 control (non-targeting sgRNA) or Rb1cc1 KO cells. B shows EMT6 control or Rb1cc1 KO cells were treated with 10 ng / ml TNFα and viability was measured 24 hours later. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (control, no TNFα). Groups were compared by one-way ANOVA with Tukey's multiple comparison test. C shows EMT-6 cells (control or Rb1cc1 KO) were implanted into Balb / c mice. Three days after implantation, mice were treated with either an isotype control or a PD-1 plus CTLA-4 blocking antibody as described in the methods (n=10 mice per group). The line graph shows the mean tumor volume ± SEM for each group. Groups were compared by two-way ANOVA with Tukey's multiple comparison test. D shows individual tumor growth curves for each mouse. E shows Western blots demonstrating the levels of the indicated proteins in MC38 control (non-targeting sgRNA) or Rb1cc1 KO cells. F shows MC38 cells (control or Rb1cc1 KO) were implanted into C57 / BL6 mice. Mice were randomized (7–12 mice per group) when tumors were approximately 70 mm3 and treated with either an isotype control or a PD-1 plus CTLA-4 blocking antibody. Line graphs show the mean tumor volume ± SEM for each group. Groups were compared by two-way ANOVA with Tukey's multiple comparison test. G shows individual tumor growth curves for each mouse. [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 8-4] Same as above.

[0020] [Figure 9]This figure has three parts, A–C, and relates to the use of B2M knockout cells used to optimize CRISPR KO screening conditions. A shows a Western blot demonstrating B2M protein levels in MC38 cells infected with pLenti-Cas9-Blast and pLenti-guide-puro, which target B2M. B shows FACS analysis of H2-Kb cell surface expression in MC38 cells engineered to express the mGeCKO library or b2M KO cells untreated or treated with + / - 10 ng / ml IFNg for 24 hours. C shows T cell killing assays of MC38-Cas9-mGeCKO cells intermittently treated with Ova or scrambled peptide, and MC38-Cas9-B2M knockout cells intermittently treated with Ova peptide. CD8+ T cells isolated from OT-1 mice were incubated with cells at the indicated E:T ratio, and viability was measured after 24 hours.

[0021] [Figure 10] Library representation is well maintained throughout the CRISPR KO screen, allowing for detection of depleted and abundant sgRNAs. Log2-normalized sgRNA counts in scrambled tumor cells versus tumor cells treated with intermittent Ova after T-cell killing. R2=0.95.

[0022] [Figure 11]This figure, shown in two parts (A and B), shows that a CRISPR KO screen for growth modifiers in MC38 cells identifies a high proportion of core-essential genes. Log2-normalized sgRNA counts of MC38-mGeCKO cells passaged for 12 doublings compared to reference control cells (taken immediately after selection of library-infected cells). A shows non-targeting sgRNAs. Only 5 / 1000 of the non-targeting sgRNAs were significantly enriched or depleted by more than 2-fold compared to the reference control. B shows sgRNAs targeting core-essential genes, shown in red. 96% (102 / 106) of the core-essential genes were identified as hits (defined as at least two sgRNAs depleted by more than 2-fold). At least four sgRNAs depleted more than 85% of the core-essential genes.

[0023] [Figure 12] Figure 1 shows that gene knockout of autophagy genes does not inhibit MC38 cell proliferation. Viability assays after 12 population doublings in MC38 parental cells, cells expressing an empty vector, or cells expressing multiple sgRNAs targeting the indicated autophagy genes.

[0024] [Figure 13] These results demonstrate that TNFα blockade does not limit the cytotoxic function of preactivated T cells. MC38 (TNFα-sensitive) or B16F10 (TNFα-resistant) cells were intermittently treated with Ova peptide and incubated with T cells from OT-1 mice at the indicated E:T ratios in the presence of 20 μg / ml of TNFα-blocking antibody or isotype control antibody at the indicated temperatures. Cell viability was measured 24 hours later. Bar graphs show relative cell viability ± SD (n=3) compared to tumor cells incubated without T cells. *P<0.05, ***P<0.0005 vs. MC38 cells with control antibody, one-way ANOVA with Tukey's multiple comparison test.

[0025] [Figure 14]Figure 1 shows that the NF-κB signaling pathway is active in cell lines resistant to TNFα-mediated killing. Western blots showing the levels of the indicated proteins in EMT6 or 4T1 cells after treatment with 10 ng / ml TNFα for the indicated times.

[0026] [Figure 15-1] Figure 7 shows that Rbck1 KO increases tumor cell killing by T cells. (A) Western blots showing Rbck1 and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rbck1-targeting sgRNAs (sg5 and sg1 were the most significantly depleted in the screening, while sg3 was the least depleted). (B) Control or Rbck1 KO cells were intermittently treated with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to cells incubated in the absence of T cells. ****P<0.0001 vs. parental MC38 cells, one-way ANOVA with Tukey's multiple comparison test. ++++P<0.0001 vs. Rbck1 sg5. C shows T cell killing of the indicated cell lines in the presence of 20 μg / ml of TNFα-blocking antibody. *P<0.05 vs. parental MC38 cells. D shows cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. n=3. E shows Western blots showing the levels of the indicated proteins 2 hours after treatment with 10 ng / ml of TNFα. F and G show cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 15-2] Same as above.

[0027] [Figure 16-1]Figure 7 shows that Rbla KO increases tumor cell killing by T cells. (A) Western blots showing Rela and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing a Rela-targeting sgRNA (sg2 and sg3 were the most significantly depleted in the screening, while sg6 was the least depleted). (B) Control or Rela KO cells were intermittently administered with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n = 3) compared to cells cultured in the absence of T cells. **P < 0.005, ****P < 0.0001, versus parental MC38 cells; one-way ANOVA with Tukey's multiple comparison test. ++P < 0.005, +++P < 0.0005, versus Rela sg2. C shows T cell killing of the indicated cell lines in the presence of 20 μg / ml of TNFα-blocking antibody. D shows cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. n=3. E shows Western blots showing the levels of the indicated proteins 2 hours after treatment with 10 ng / ml of TNFα. F and G show cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 16-2] Same as above.

[0028] [Figure 17-1]Figure 7 shows that Atg9a KO increases tumor cell killing by T cells. (A) Western blots showing Atg9a and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Atg9a-targeting sgRNAs (sg2 and sg1 were the most significantly depleted in the screening, while sg4 was the least depleted). (B) Control or Atg9a KO cells were intermittently treated with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test, versus parental MC38 cells. +P<0.05, ++++P<0.0001, vs. Atg9a sg2. C: T cell killing of the indicated cell lines was performed in the presence of 20 μg / ml of TNFα-blocking antibody. *P<0.05, **P<0.005, ***P<0.0005, vs. parental MC38 cells. +P<0.05, vs. Atg9a sg2. D: Cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. n=3. E: Western blot showing the levels of the indicated proteins 8 hours after treatment with 10 ng / ml TNFα. F: Cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 17-2] Same as above.

[0029] [Figure 18-1]Figure 7 shows that Atg12 KO increases tumor cell killing by T cells. (A) Western blots showing Atg12 and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing an Atg12-targeting sgRNA (sg3 and sg5 were the most significantly depleted in the screening, while sg6 was the least depleted). (B) Control or Atg12 KO cells were intermittently treated with Ova peptide and incubated with OT-1 T cells at the indicated E:T ratio for 24 hours. Bar graphs show relative cell viability ± SD (n=3) compared to cells incubated in the absence of T cells. ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test, versus parental MC38 cells. (C) T cell killing of the indicated cell lines was performed in the presence of 20 μg / ml of a TNFα-blocking antibody. **P<0.005, ***P<0.0005 vs. parental MC38 cells. D: Cells were treated with the indicated concentrations of TNFα and cell viability was measured 24 hours later. n=3. E: Western blot showing the levels of the indicated proteins 8 hours after treatment with 10 ng / ml TNFα. F and G: Cells were treated with the indicated amounts of doxorubicin or paclitaxel and cell viability was measured 24 hours later. n=3. [Figure 18-2] Same as above.

[0030] [Figure 19]This figure has two parts, A and B, and shows that Rb1cc1 and Atg12 KO cells exhibit impaired autophagy activity. (A) Western blots showing LC3B and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or MC38-Cas9 cells expressing an Rb1cc1-targeting sgRNA. (Rb1cc1 sg3 was less effective at depleting Rb1cc1 protein than sg4 or sg5—see Figure 4). (B) Western blots showing LC3B and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or MC38-Cas9 cells expressing an Atg12-targeting sgRNA. Cells were treated for 4 hours with 10 μg / ml pepstatin A and 10 μg / ml E-64-D to inhibit lysosomal proteases, which, unless autophagy is inhibited upstream, leads to the accumulation of LC3B-II, the lipidated form of the protein (linked to phosphatidylethanolamine).

[0031] [Figure 20] We demonstrate that inactivation of autophagy does not impair TNFα-mediated induction of NF-βB target genes. Control or Rb1cc1 KO MC38 cells were untreated or treated with 10 ng / ml TNFα for 4 hours. Cell lysates were then assayed on a mouse cytokine array to measure the levels of 40 mouse cytokines. Cytokines increased by TNFα were labeled.

[0032] [Figure 21-1]This figure has three parts, A–C, and shows that pharmacological blockade of autophagy sensitizes human cancer cells to TNFα- and TRAIL-mediated killing. (A) HCT-116 human colon cancer cells were untreated or treated with 10 ng / ml TNFα or 10 ng / ml TRAIL in the absence or presence of 5 μM autophagy. Cell viability was measured after 24 h. (B) HeLa human cervical cancer cells were untreated or treated with 50 ng / ml TRAIL in the absence or presence of 5 μM autophagy. Cell viability was measured after 24 h. Bar graphs show relative cell viability ± SD (n=3). Treatment groups were compared by one-way ANOVA with Tukey's multiple comparison test. (C) Western blot showing the levels of the indicated proteins in HCT-116 cells 24 hours after treatment with 10 ng / ml TNFα or 10 ng / ml Trail in the absence or presence of 5 mM autofinib. (D) Western blot showing the levels of the indicated proteins in HeLa cells 24 hours after treatment with 50 ng / ml TRAIL in the absence or presence of 5 μM autofinib. (E) Graph summarizing the results observed in MC38 cells untreated or treated with 10 ng / ml TNFα or 10 ng / ml TRAIL in the absence or presence of 5 μM SAR405 or autofinib. Cell viability was measured after 24 hours. (F) Graph summarizing the results observed in EMT6 cells untreated or treated with 10 ng / ml TNFα or 10 ng / ml TRAIL in the absence or presence of 5 μM SAR405 or autofinib. Cell viability was measured after 24 hours. Bar graphs show relative cell viability ± SD (n=3). ****P<0.0001 vs. untreated cells, one-way ANOVA with Tukey's multiple comparison test. [Figure 21-2] Same as above.

[0033] [Figure 22-1]This figure has two parts, A and B, and shows that pharmacological blockade of autophagy sensitizes multiple mouse and human cancer cell lines to TNFα-mediated killing. (A) Mouse tumor cell lines (EMT6, LL / 2, CT26, Colon26) were untreated or treated with 10 ng / ml TNFα in the absence or presence of 5 μM autofinib, and cell viability was measured 24 hours later. (B) Human tumor cell lines (BT-20, Me-180, MDA-MB-361) were untreated or treated with 10 ng / ml TNFα in the absence or presence of 5 μM autofinib or 5 μM SAR-405, and cell viability was measured 24 hours later. Bar graphs show relative cell viability ± SD (n = 3). Treatment groups were compared by one-way ANOVA with Tukey's multiple comparison test. [Figure 22-2] Same as above.

[0034] [Figure 23-1] This figure has two parts, A and B, and shows that knockout of autophagy genes in MC38 cells does not affect cell surface MHC-I levels or OVA peptide presentation. (A) Flow cytometry histograms showing MHC-I (H2-kb) cell surface expression in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing sgRNAs targeting Rb1cc1, Atg9a, or Atg12. (B) Flow cytometry histograms showing MHC-I (H2-kb)-Ova(SIINFEKL) cell surface expression in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing sgRNAs targeting Rb1cc1. Cells were intermittently treated with Ova(SIINFEKL) peptide or scrambled peptide before staining, as indicated. [Figure 23-2] Same as above.

[0035] [Figure 24]Figure 1 shows that activation of autophagy does not increase levels of key TNFα pathway components. Western blot showing levels of the indicated proteins in MC38 parental cells (mock), MC38-Cas9 cells transduced with empty vector, or cells expressing Rb1cc1-targeting sgRNA 30 minutes after treatment with 10 ng / ml TNFα.

[0036] [Figure 25] This shows that early treatment of MC38 tumors with PD-1 / CTLA-4 antibodies results in complete tumor regression. MC38 cells were implanted into C57 / BL6 mice. Three days after implantation, mice were treated with either an isotype control or a PD-1 plus CTLA-4 blocking antibody. Individual tumor growth curves for each mouse are shown. n=15.

[0037] [Figure 26-1] Genetic inactivation of tumor autophagy affects leukocyte infiltration. Flow cytometry analysis of CD45+, CD3+, CD4+, and CD8+ cells in MC38 and EMT6 parental or Rb1cc1 KO tumors is shown. Graphs show individual tumors with median values ​​indicated (n=4). Groups were compared by one-way ANOVA with Tukey's multiple comparison test. [Figure 26-2] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0038] overview The disclosure herein is based, in part, on the discovery that inhibition of the autophagy pathway, including inhibition of autophagy initiation, membrane material translocation, or autophagosome expansion, sensitized cancer cells to TNFα-mediated killing (e.g., by T cells). Furthermore, Applicants have shown herein that inhibition of the NF-κB pathway sensitizes cancer cells to TNFα-mediated killing. In particular, as shown herein, genetic inhibition of autophagy sensitizes tumor cells to T cell-mediated killing in vivo. Applicants have shown herein that the autophagy and NF-κB pathways are important regulators of immunotherapy responsiveness, and that inhibition of these pathways enhances the efficacy of cancer treatments, particularly T cell-directed treatments.

[0039] Thus, in certain embodiments, provided herein are methods of sensitizing cancer cells to TNF-α-mediated killing by contacting the cancer cells with an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway in the cancer cells. In some embodiments, provided herein are methods of sensitizing cancer cells in a subject to TNF-α-mediated killing by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway in the cancer cells.

[0040] In other aspects, provided herein are methods of increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the cancer cells.

[0041] In further aspects, the methods described herein include methods of sensitizing a tumor in a subject to TNF-α-mediated killing or increasing TNF-α-mediated killing of a tumor in a subject by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the tumor. Also provided herein are methods of treating cancer in a subject by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the subject's cancer cells, and by administering to the subject a second agent that induces TNF-α-mediated killing, such as a cancer immunotherapy.

[0042] definition The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0043] The term "agent" is used herein to refer to a chemical compound, a small molecule, a mixture of chemical compounds, a biological macromolecule (such as a nucleic acid (e.g., an interfering nucleic acid), an antibody, an antibody fragment, a protein, a peptide, etc.), a mixture of biopolymers, and / or combinations thereof. In certain embodiments, an agent herein is a composition comprising components of a CRISPR / Cas system. The activity of such agents may qualify them as "therapeutic agents," which are biologically, physiologically, or pharmacologically active substances that act locally or systemically in a subject.

[0044] As used herein, an "autophagy gene" is a gene that encodes a product that, when inhibited, results in a decrease in the level of autophagy in a cell.

[0045] As used herein, the term "cancer" includes, but is not limited to, solid tumors and blood-borne tumors. The term cancer includes diseases of the skin, tissues, organs, bone, cartilage, blood, and vasculature. The term "cancer" further encompasses primary and metastatic cancers.

[0046] "Codon optimization" involves modifying a nucleic acid sequence to enhance expression in a particular host cell by taking advantage of codon degeneracy, as indicated by the diversity of three-base pair codon combinations that specify an amino acid, generally by replacing at least one codon of the native sequence with a codon that is more or most frequently used in the host cell's genes while maintaining the native amino acid sequence. For example, a polynucleotide encoding a Cas9 protein can be modified to replace a codon that has a higher frequency of usage relative to the nucleic acid sequence naturally occurring in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell of interest. Codon usage tables are readily available, for example, from the "Codon Usage Database." These tables can be adapted in a variety of ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, incorporated herein by reference in its entirety for all purposes. Computer algorithms for codon optimization of a particular sequence for expression in a particular host are also available (e.g., Gene Forge).

[0047] "Complementarity" of nucleic acids means that a nucleotide sequence in one strand of a nucleic acid will form hydrogen bonds with another sequence in the opposite strand due to the orientation of the nucleobase groups. In DNA, complementary bases are typically A and T and C and G. In RNA, they are typically C and G and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a duplex in which all bases in the duplex are bound to complementary bases by Watson-Crick pairing. "Substantial" or "sufficient" complementarity means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but sufficient binding occurs between the bases of the two strands to form a stable hybrid complex under a set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using the sequences and standard mathematical calculations, or by empirically determining the Tm using routine methods. Tm comprises the temperature at which the population of hybridization complexes formed between two nucleic acid strands is 50% denatured (i.e., the population of double-stranded nucleic acid molecules is half-dissociated into single strands). Temperatures below Tm promote the formation of hybridization complexes, while temperatures above Tm promote the melting or separation of strands in the hybridization complexes. Tm can be estimated for a nucleic acid with a known G+C content in 1 M aqueous NaCl solution, for example, using Tm = 81.5 + 0.41 (G+C%), although other known Tm calculations take into account the structural properties of nucleic acids.

[0048] As used herein, the phrase "co-administration" refers to any form of administration of two or more different therapeutic agents in which a previously administered agent is administered while the second agent is still effective in the body (e.g., the two agents are effective in a subject at the same time, which may involve a synergistic effect of the two agents).

[0049] The term "gene" refers to a DNA sequence within a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product), and includes the coding region, any non-coding introns that interrupt the coding region, and sequences located adjacent to the coding region at both the 5' and 3' ends, such that the gene corresponds to the full-length mRNA (including 5' and 3' untranslated sequences). The term "gene" also includes other non-coding sequences, including regulatory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions. These sequences may be close to (e.g., within 10 kb) or distant from the coding region of a gene and affect the level or rate of transcription and translation of the gene.

[0050] A "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., a Cas9 protein) and targets the Cas protein to a specific location within a target DNA. A guide RNA may contain two segments: a "DNA targeting segment" and a "protein binding segment." A "segment" includes a section or region of a molecule, such as a continuous stretch of nucleotides in an RNA. Some gRNAs, such as the gRNA for Cas9, may contain two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeter RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides) and may also be referred to as "single-molecule gRNA," "single guide RNA," or "sgRNA." See, e.g., International Patent Nos. WO2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO2014 / 093622, WO2014 / 099750, WO2013 / 142578, and WO2014 / 131833, each of which is incorporated by reference in its entirety for all purposes. For example, in the case of Cas9, a single guide RNA may comprise a crRNA fused to a tracrRNA (e.g., via a linker). For example, in the case of Cpfl, only the crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs.

[0051] As used herein, the term "guide RNA target sequence" specifically refers to a sequence on a non-complementary strand that corresponds to the sequence to which the guide RNA hybridizes on the complementary strand (i.e., the reverse complement of the sequence). That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence corresponds to the DNA targeting segment of the guide RNA, but contains thymine instead of uracil. As an example, the guide RNA target sequence of the SpCas9 enzyme can refer to the sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand.

[0052] The term "lipid particle" includes lipid formulations that can be used to deliver a therapeutic nucleic acid (e.g., gRNA) to a target site of interest (e.g., a cell, tissue, organ, etc.).

[0053] The term "lipid conjugate" refers to a conjugated lipid that inhibits lipid particle aggregation.Such lipid conjugates include, but are not limited to, PEG-lipid conjugates, such as dialkyloxypropyl-linked PEG (e.g., PEG-DAA conjugate), diacylglycerol-linked PEG (e.g., PEG-DAG conjugate), cholesterol-linked PEG, phosphatidylethanolamine-linked PEG, and ceramide-linked PEG (see, e.g., U.S. Pat. No. 5,885,613), cationic PEG lipid, polyoxazoline (POZ)-lipid conjugate (e.g., POZ-DAA conjugate), polyamide oligomer (e.g., ATTA lipid conjugate), and mixtures thereof.Further examples of POZ-lipid conjugates are described in PCT Publication No. WO2010 / 006282.PEG or POZ can be directly conjugated to lipid, or can be linked to lipid via a linker moiety. For example, any linker moiety suitable for attaching PEG or POZ to a lipid can be used, including non-ester-containing linker moieties and ester-containing linker moieties, In certain embodiments, non-ester-containing linker moieties such as amides or carbamates are used.

[0054] As used herein, an "NF-κB gene" is a gene that encodes a product that, when inhibited, results in a decrease in the level of NF-κB signaling in a cell.

[0055] As used herein, a "non-naturally occurring" system includes any that exhibits the hand of man, such as one or more components of a system that are altered or mutated from a naturally occurring state, or that are at least substantially free of at least one other component with which they are naturally associated, or that are associated with at least one other component that is not naturally associated. For example, some CRISPR / Cas systems use non-naturally occurring CRISPR complexes that include gRNAs and Cas proteins that do not occur together in nature, use Cas proteins that do not occur in nature, or use gRNAs that do not occur in nature.

[0056] As used herein, the phrase "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in carrying or transporting the subject compound from one organ or part of the body to another organ or part of the body.

[0057] The terms "polynucleotide" and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. Non-limiting examples of polynucleotides are: coding or non-coding regions of a gene or gene fragment, locus(s) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified, such as by conjugation with a labeling component. The term "recombinant" polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin that is not found in nature or that is linked to another polynucleotide in a non-natural arrangement.

[0058] Nucleic acids are said to have a "5' end" and a "3' end." This is because mononucleotides react to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is unidirectionally linked to the 3' oxygen of the next via a phosphodiester bond. An end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is referred to as the "3' end" if its 3' oxygen is not linked to the 5' phosphate of another mononucleotide pentose ring. A nucleic acid sequence can be said to have a 5' end and a 3' end even if it is internal to a larger oligonucleotide. In either a linear or circular DNA molecule, distinct elements are referred to as being "upstream" or 5' of the "downstream" or 3' element.

[0059] The terms "prevent," "preventing," "prevention," and the like refer to reducing the likelihood of developing a disease, disorder, or condition in a subject who does not have the disease, disorder, or condition, but who is at risk of developing or may develop the disease, disorder, or condition.

[0060] The term "small molecule" is a term of art and includes molecules with a molecular weight of less than about 1000 or less than about 500. In one embodiment, a small molecule does not contain only peptide bonds. In another embodiment, a small molecule is not an oligomer. Exemplary small molecule compounds that can be screened for activity include, but are not limited to, peptides, peptidomimetics, nucleic acids, carbohydrates, small organic molecules (e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries.

[0061] "Small hairpin RNA" or "short hairpin RNA" or "shRNA" includes small RNA sequences that create a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNAs provided herein can be chemically synthesized or transcribed from a transcription cassette in a DNA plasmid. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which then binds to the RNA-induced silencing complex (RISC).

[0062] As used herein, the term "subject" refers to a human or non-human animal selected for treatment or therapy. In certain embodiments provided herein, the subject is a human subject. In some embodiments provided herein, the subject is a subject in need of the methods provided herein, such as a subject with cancer.

[0063] The term "target sequence of a nuclease agent" includes a DNA sequence at which a nick or double-strand break is induced by a nuclease agent. Similarly, the term "target sequence of a DNA-binding protein" includes a DNA sequence to which a DNA-binding protein binds. The target sequence can be endogenous (or native) to the cell, or the target sequence can be exogenous to the cell.

[0064] As used herein, the phrases "therapeutically effective amount" and "effective amount" mean an amount of an agent effective to produce a desired therapeutic effect in at least a subpopulation of cells of a subject, at a reasonable benefit / risk ratio applicable to any medical treatment.

[0065] "Treating" a subject for a disease or a subject with a disease refers to administering a medical therapy, e.g., a drug, to a subject so that at least one symptom of the disease is alleviated or prevented from worsening.

[0066] Autophagy and the NF-κB pathway As noted above, the disclosure herein is based, in part, on the discovery that inhibition of autophagy pathways, including inhibition of autophagy initiation, translocation of membrane material, or autophagosome expansion, sensitized cancer cells to TNFα-mediated killing (e.g., by T cells). Applicants demonstrate herein that the autophagy and NF-κB pathways are important regulators of immunotherapy responsiveness, and that inhibition of these pathways enhances the efficacy of cancer treatments, particularly T cell-directed treatments.

[0067] Thus, provided herein are methods for sensitizing cancer cells to TNF-α-mediated killing by administering to a subject or contacting the cancer cells with an agent (e.g., at least one agent disclosed herein) that inhibits the autophagy and / or NF-κB pathways of the cancer cells. In some embodiments, the agent inhibits the expression or activity of an autophagy gene and / or an NF-κB gene. As used herein, "autophagy gene" includes, but is not limited to, a gene encoding a product whose inhibition results in a decrease in the level of autophagy in a cell. Autophagy genes can be, for example, ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. Exemplary NCBI sequence references to the mRNA, protein, and genomic (GRCh38.p13 primary assembly) sequences of these exemplary autophagy genes are provided in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0068] In some embodiments, the agent inhibits the expression or activity of an NF-κB gene. As used herein, "NF-κB gene" includes, but is not limited to, a gene encoding a product whose inhibition results in a decrease in the level of NF-κB signaling in a cell. The NF-κB gene can be, for example, CFLAR, UBE2L3, RNF31, IKBKB, MAP3K7, TAB1, RELA, IKKBKG, CHUK, TAB2, TBK1, MAPKAPK2, RBCK1, TRAF2, SHARPIN, or TNFAIP3. Exemplary NCBI sequence references to the mRNA, protein, and genomic (GRCh38.p13 primary assembly) sequences of these exemplary NF-κB genes are provided in Table 2. [Table 2-1] [Table 2-2] [Table 2-3]

[0069] In other aspects, provided herein are methods of increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent that inhibits autophagy and / or the NF-κB pathway in cancer cells (e.g., at least one agent disclosed herein, such as an agent that modifies at least one autophagy gene, such as a gene in Table 1 or Table 2, or at least one NF-κB gene). Also disclosed herein are methods of sensitizing a tumor in a subject to TNF-α-mediated killing or increasing TNF-α-mediated killing of a tumor in a subject by administering to the subject an agent that inhibits autophagy and / or the NF-κB pathway in a tumor (e.g., at least one agent disclosed herein, such as an agent that modifies at least one autophagy gene, such as a gene in Table 1 or Table 2, or at least one NF-κB gene). Also provided herein are methods of treating cancer in a subject by administering to the subject an agent that inhibits the autophagy and / or NF-κB pathway (e.g., at least one agent disclosed herein, such as an agent that modifies at least one autophagy gene, such as a gene in Table 1 or Table 2, or at least one NF-κB gene) in the subject's cancer cells and a cancer therapy (e.g., cancer immunotherapy). In some embodiments, modifying at least one autophagy gene and / or NF-κB gene results in decreased gene expression or activity. In some embodiments, modifying at least one autophagy gene and / or NF-κB gene results in abolishing gene expression or activity.

[0070] Regulators of autophagy and the NF-κB pathway CRISPR / Cas system In some embodiments, provided herein are agents that inhibit the expression or activity of autophagy genes (e.g., autophagy genes in Table 1) or NF-κB genes (e.g., NF-κB genes in Table 2), and uses thereof. In certain embodiments, the agent can be an agent that modifies at least one autophagy gene or NF-κB gene (e.g., modifying at least one gene results in reduced and / or eliminated gene expression or activity). In some embodiments, gene modification comprises deletion, insertion, substitution, or a combination thereof. In some embodiments, the modification process comprises binding of a Cas protein to the gene.

[0071] In certain embodiments, the agent that inhibits the expression or activity of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2) is a composition comprising a guide RNA. In some embodiments, the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding the guide RNA. The guide RNA may be effective to direct a Cas enzyme to cleave or bind to a sequence within the gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence within the gene. In some embodiments, the guide RNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within the gene. In some embodiments, the guide RNA target sequence includes or is proximal to the start codon of the gene. The guide RNA target sequence may be within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. In some embodiments, the gRNA target sequence is present in exon 1 of the targeted gene. In some embodiments, the gRNA target sequence is present in exon 2 of the targeted gene. In some embodiments, the agent that inhibits the expression or activity of an autophagy gene is a composition comprising multiple guide RNAs. For example, in some embodiments, the composition comprises a first guide RNA that targets the 5' end of the targeted gene and a second guide RNA that targets the 3' end of the targeted gene (e.g., to induce decay). In some embodiments, the composition comprises a dual gRNA designed to modify or delete a functional domain of the targeted gene.

[0072] In certain embodiments, the guide RNA comprises at least 15 contiguous nucleotides that hybridize to an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2). By way of example, the at least 15 contiguous nucleotides can hybridize to a segment of an autophagy gene listed in Table 1 or an NF-κB gene listed in Table 2 that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the gene sequence provided in Table 1 or Table 2, respectively. Optionally, the guide RNA comprises a sequence that can hybridize to at least 15 contiguous nucleotides of a gene sequence provided in Table 1 or Table 2.

[0073] For example, in certain embodiments, targeted genetic modifications to autophagy genes (e.g., autophagy genes listed in Table 1) or NF-κB genes (e.g., NF-κB genes listed in Table 2) in the genome of a cell can be made by contacting the cell or the genome of the cell with a Cas protein and one or more guide RNAs that hybridize to one or more guide RNA recognition sequences within a target genomic locus of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2). That is, targeted genetic modifications to autophagy genes (e.g., autophagy genes listed in Table 1) or NF-κB genes (e.g., NF-κB genes listed in Table 2) in the genome of a cell can be made by contacting the cell or the genome of the cell with a Cas protein and one or more guide RNAs that target one or more guide RNA target sequences within a target genomic locus of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2). For example, such methods can include contacting a cell with a Cas protein and guide RNA that target a guide RNA target sequence within an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2). For example, the guide RNA target sequence can include or be adjacent to the start codon of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., one listed in Table 2), or the stop codon of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., one listed in Table 2). For example, the guide RNA target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start or stop codon. In some embodiments, the gRNA target sequence is within exon 1 of the targeted gene. In some embodiments, the gRNA target sequence is present in exon 2 of the targeted gene.In some embodiments, the agent that inhibits the expression or activity of an autophagy gene is a composition comprising multiple guide RNAs. For example, in some embodiments, the composition comprises a first guide RNA that targets the 5' end of the target gene and a second guide RNA that targets the 3' end of the target gene (e.g., to induce decay). In some embodiments, the composition comprises a dual gRNA designed to modify or delete a functional domain of the target gene.

[0074] In some methods, two or more nuclease agents can be used.For example, two or more nuclease agents can be used, each of which targets the nuclease target sequence that includes or is adjacent to start codon.As another example, two nuclease agents can be used, one of which targets the nuclease target sequence that includes or is adjacent to start codon, and one of which targets the nuclease target sequence that includes or is adjacent to stop codon, and the coding region between the two nuclease target sequences can be deleted by cleavage with nuclease agents. As yet another example, three or more nuclease agents can be used, one or more (e.g., two) targeting a nuclease target sequence containing or adjacent to the start codon and one or more (e.g., two) targeting a nuclease target sequence containing or adjacent to the stop codon, and cleavage by the nuclease agents can delete the coding region between the nuclease target sequence containing or adjacent to the start codon and the nuclease target sequence containing or adjacent to the stop codon.

[0075] Exemplary sgRNA sequences (gene name, sgRNA ID, sgRNA number and sequence, if applicable) useful for targeting exemplary autophagy genes include: Rb1cc1, MGLibA_44688, 1, AGAGTGTGTACTTACAGCGC (SEQ ID NO: 38); Rb1cc1, MGLibA_44689, 2, CTGAACGTGGCAAAGAACTT (SEQ ID NO: 39); Rb1cc1, MGLibA_44690, 3, TCAAGATAGACCCAATGATG (SEQ ID NO: 40); Rb1cc1, MGLibB_44675, 4, CTCCATTGACCACCAGAACC (SEQ ID NO: 41); Rb1cc1, M GLibB_44676, 5, ATTTGAACAGTCCTCCAGAT (SEQ ID NO: 42); Rb1cc1, MGLibB_44677, 6, CTTTAGGAATAGCAGGTGCA (SEQ ID NO: 43); Atg9a, MGLibA_05661, 1, CATAGTCCACACAGCTAACC (SEQ ID NO: 44); Atg9a, MGLibA_05662, 2, TTGGGATCCGAAGAGCATGT (SEQ ID NO: 45); Atg9a, MGLibA05663, 3, CTGCCCAAGTCTGTAGTGCC (SEQ ID NO: 46) sequence number 46); Atg9a, MGLibB_05661, 4, TCTATAACATTTGCTGCTAT (SEQ ID NO: 47); Atg9a, MGLibB_05662, 5, TACATGTGAAGCCATTCTTC (SEQ ID NO: 48); Atg9a, MGLibB_05663, 6, AGGATATTCGAGAGAAGAAG (SEQ ID NO: 49); Atg12, MGLibA_05619, 1, TGCAGTTTCGCCCGGAACGG (SEQ ID NO: 50); Atg12, MGLibA_05620, 2, CTCTGGAAGG Atg12, MGLibA_05621,3, GAGCGAACCCGGACCATCCA (SEQ ID NO: 52); Atg12, MGLibB_05619,4, TCATCATACCAACTGTTCCG (SEQ ID NO: 53); Atg12, MGLibB_05620,5, CCTGCATTACTGCAAATCCC (SEQ ID NO: 54) and Atg12, MGLibB_05621,6, TTCTGGCTCATCCCCATGCC (SEQ ID NO: 55).

[0076] Exemplary sgRNA sequences (gene name, sgRNA ID, sgRNA number and sequence, if applicable) useful for targeting exemplary NF-κB genes include: Map3k7, MGLibA_30286, 1, GATGATCGAAGCGCCGTCGC (SEQ ID NO: 16); Map3k7, MGLibA_30287, 2, CGGCGCTTCGATCATCTCAC (SEQ ID NO: 17); Map3k7, MGLibA_30288, 3, GGGACTTACTGGATTCAGGC (SEQ ID NO: 18); Map3k7, MGLibB_30277, 4, GAGTAGTTTGCAAAGCTAAG (SEQ ID NO: 19); Map3k7, MGLibB_30278, 5, TTAACTCAGGTTGTCGGAAG (SEQ ID NO: 20); Map3k7, MGLibB_30279, 6, GAGGGGGGCTCATTGTATAA (SEQ ID NO: 21); Rbck1, MGLibA_44718, 1, AGTACGCCCGGATATGACAG (SEQ ID NO: 22); Rbck1, MGLibA_44719, 2, ACGTGTTGCGGGCTGACAGC (SEQ ID NO: 23); Rbck1, MGLibA_44720, 3, CAGCTTACCGGTGGTGACTC (SEQ ID NO: 24); Rbck1, MGLibB_44705, 4, AACCTGTCCTTCCGAAGCCC (SEQ ID NO: 25); Rbck1, MGLibB_44706, 5, CGGGCGTACTGTGAGCCAAA (SEQ ID NO: 26); Rbck1, MGLibB_44707, 6, CTGCTATCAAGTATGCCACC (SEQ ID NO: 27); Rela, MGLibA_45072, 1, GCGATTCCGCTATAAATGCG (SEQ ID NO: 28); Rela, MGLibA_45073, 2, TCATCGA Rela, MGLibA_45074,3, GCCCAGACCGCAGTATCCAT (SEQ ID NO: 30); Rela, MGLibB_45059,4, CTGCCGGGATGGCTACTATG (SEQ ID NO: 31); Rela, MGLibB_45060,5, ACCGTGAAAGGGGTTATTGT (SEQ ID NO: 32) and Rela, MGLibB_45061,6, ACTTACCTGAGGGAAAGATG (SEQ ID NO: 33).

[0077] In some embodiments, the guide RNA may comprise a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) comprising a DNA targeting segment and a transactivating CRISPR RNA (tracrRNA). The guide RNA may be a modular guide RNA, where the crRNA and tracrRNA are separate molecules that hybridize to each other.

[0078] In some embodiments, the composition further comprises a Cas protein or a nucleic acid sequence encoding a Cas protein (e.g., a nuclease-active or nuclease-inactive Cas protein fused to a transcriptional repressor domain). The Cas protein can be a Cas9 protein. The Cas9 molecule can be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein.

[0079] In certain embodiments, the methods and compositions disclosed herein can utilize clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems or components of such systems to modify the genome in a cell. CRISPR / Cas systems include transcripts and other elements that are involved in the expression of or direct the activity of Cas genes. CRISPR / Cas systems can be, for example, Type I, Type II, Type III, or Type V systems (e.g., subtype VA or VB). The methods and compositions disclosed herein can employ CRISPR / Cas systems by utilizing CRISPR complexes (including guide RNAs (gRNAs) complexed with Cas proteins) for site-specific binding or cleavage of nucleic acids. In some embodiments, the CRISPR / Cas systems used in the compositions and methods disclosed herein can be non-naturally occurring.

[0080] A. Cas proteins In some embodiments, Cas proteins generally contain at least one RNA recognition or binding domain capable of interacting with a guide RNA. Cas proteins may also contain a nuclease domain (e.g., a DNase or RNase domain), a DNA-binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Some such domains (e.g., a DNase domain) may be derived from naturally occurring Cas proteins. Other such domains can be added to create engineered Cas proteins. The nuclease domain possesses catalytic activity for nucleic acid cleavage, including covalent cleavage of nucleic acid molecules. Cleavage can generate blunt or staggered ends, which can be single-stranded or double-stranded. For example, wild-type Cas9 proteins typically generate blunt cleavage products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) may result in cleavage products with a 5-nucleotide 5' overhang, where cleavage occurs after the 18th base pair from the PAM sequence on the non-target strand and after the 23rd base on the target strand. The Cas protein may have full cleavage activity, generating a double-stranded break (e.g., a double-stranded break with a blunt end) at the target genomic locus, or may be a nickase, generating a single-stranded break at the target genomic locus.

[0081] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Casl0d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), and Cse3 (Ca sE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, and homologs or variants thereof.

[0082] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. Cas9 proteins are derived from type II CRISPR / Cas systems and generally share four important motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif.Exemplary Cas9 proteins include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus species, Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas species, Crocosphaera watsonii, Cyanothece species, Microcystis aeruginosa, Synechococcus species, Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter species, Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas. haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc species, Arthrospira maxima, Arthrospira platensis, Arthrospira species, Lyngbya species, Microcoleus chthonoplastes, Oscillatoria species, Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in International Patent Publication WO2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 from S. pyogenes (SpCas9) (assigned SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Cas9 from S. aureus (SaCas9) (UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 from SaCas9 (CjCas9) (UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al. (2017) Nat. Commun. 8:14500, incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9.

[0083] Another example of a Cas protein is the Cpf1 (CRISPR from Prevotella and Francisella 1) protein. Cpf1 is a large protein (approximately 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain in Cas9 and a counterpart of Cas9's characteristic arginine-rich cluster. However, Cpf1 lacks the HNH nuclease domain present in Cas9 proteins, and the RuvC-like domain is continuous within the Cpf1 sequence, in contrast to Cas9, which contains long inserts containing the HNH domain. See, e.g., Zetsche et al. (2015) Cell 163(3):759-771, incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are Francisella tularensis 1, Francisella tularensis subspecies novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella species SCADC, Acidaminococcus species BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0084] The Cas protein can be a wild-type protein (i.e., one occurring in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. The Cas protein can also be a catalytically active variant or fragment of a wild-type or modified Cas protein. A catalytically active variant or fragment can comprise 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a wild-type or modified Cas protein or portion thereof, and an active variant retains the ability to cleave at the desired cleavage site and thus retains nick-inducing or double-strand break-inducing activity. Assays for nick-inducing or double-strand break-inducing activity are known and generally measure the overall activity and specificity of a Cas protein on a DNA substrate containing a cleavage site.

[0085] One example of a modified Cas protein is the modified SpCas9-HF1 protein, a high-fidelity variant of Streptococcus pyogenes Cas9 that possesses modifications (N497A / R661A / Q695A / Q926A) designed to reduce nonspecific DNA contacts. See, e.g., Kleinstiver et al. (2016) Nature 529(7587):490-495, incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce nonspecific effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84-88, incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A.

[0086] Cas proteins can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to alter any other activity or property of the protein, such as stability. For example, one or more nuclease domains of a Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are not essential for protein function, or to optimize (e.g., enhance or reduce) an activity or property of the Cas protein.

[0087] Cas proteins may contain at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 proteins typically contain a RuvC-like domain, likely in a dimeric configuration, that cleaves both strands of target DNA. Cas proteins may also contain at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 proteins typically contain a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cleave different strands of double-stranded DNA, resulting in double-stranded breaks in DNA. For example, Jinek et al. al. (2012) Science 337(6096):816-821, which is incorporated by reference in its entirety for all purposes.

[0088] One or more or all of the nuclease domains can be deleted or mutated so that the nuclease domains no longer function or have reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in a Cas9 protein, the resulting Cas9 protein can be called a nickase and can generate single-strand breaks in double-stranded target DNA but not double-strand breaks (i.e., it can cleave either the complementary strand or the non-complementary strand, but not both). If both nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) will have a reduced ability to cleave both strands of double-stranded DNA (e.g., a nuclease-free or nuclease-inactive Cas protein, or a Cas protein without catalytic activity (dCas)). An example of a mutation that converts Cas9 into a nickase is the D10A (aspartic acid to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include corresponding mutations in Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and International Patent Publication No. WO 2013 / 141680, each of which is incorporated by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of nickase-generating mutations can be found, for example, in International Patent Nos. WO2013 / 176772 and WO2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes.When all nuclease domains are deleted or mutated in a Cas protein (e.g., when both nuclease domains are deleted or mutated in a Cas9 protein), the resulting Cas protein (e.g., Cas9) has a reduced ability to cleave both strands of double-stranded DNA (e.g., a nuclease-free or nuclease-inactive Cas protein). One specific example is D10A / H840A. The S. pyogenes Cas9 double mutant, or the corresponding double mutant of another species' Cas9 when optimally aligned with S. pyogenes Cas9. Another specific example is the D10A / N863A S. pyogenes Cas9 double mutant, or the corresponding double mutant of another species' Cas9 when optimally aligned with S. pyogenes Cas9.

[0089] Examples of inactivating mutations in the catalytic domain of the Staphylococcus aureus Cas9 protein are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) can include a substitution at position N580 (e.g., an N580A substitution) and a substitution at position D10 (e.g., a D10A substitution) to generate a nuclease-inactive Cas protein. See, e.g., International Patent Publication No. WO2016 / 106236, incorporated herein by reference in its entirety for all purposes.

[0090] Examples of inactivating mutations in the catalytic domain of the Cpf1 protein are also known. In the context of the Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1, or at corresponding positions in Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1, or at corresponding positions in Cpf1 orthologs. Such mutations can include, for example, one or more of the mutations D908A, E993A, and D1263A in AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A in LbCpf1 or corresponding mutations in Cpf1 orthologs. See, e.g., U.S. Patent No. 2016 / 0208243, incorporated herein by reference in its entirety for all purposes.

[0091] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, Cas proteins can be fused to cleavage domains, epigenetic modification domains, transcriptional activation domains, or transcriptional repressor domains. See, for example, International Patent Publication No. WO2014 / 089290, the entire contents of which are incorporated herein by reference for all purposes. Examples of transcriptional activation domains include the herpes simplex virus VP16 activation domain, VP64 (a tetrameric derivative of VP16), the NFκB p65 activation domain, p53 activation domains 1 and 2, the CREB (cAMP response element binding protein) activation domain, the E2A activation domain, and the NFAT (nuclear factor of activated T cells) activation domain. Other examples include activation domains from Oct1, Oct-2A, SP1, AP-2, CTF1, P300, CBP, PCAF, SRC1, PvALF, ERF-2, OsGAI, HALF-1, C1, AP1, ARF-5, ARF-6, ARF-7, ARF-8, CPRF1, CPRF4, MYC-RP / GP, TRAB1PC4, and HSF1. See, for example, U.S. Patent No. 2016 / 0237456, European Patent No. 3045537, and International Patent No. WO2011 / 146121, which are incorporated by reference in their entireties for all purposes. In some cases, a transcription activation system comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 can be used. The guide RNA for such a system can be designed to append an aptamer sequence to the sgRNA tetraloop and bind stem-loop 2 to the dimerized MS2 bacteriophage coat protein. See, e.g., Konermann et al. (2015) Nature 517(7536):583-588, incorporated herein by reference in its entirety for all purposes. Examples of transcriptional repressor domains include the inducible cAMP early repressor (ICER) domain, the Kruppel-associated box A (KRAB-A) repressor domain, the YY1 glycine-rich repressor domain, the Sp1-like repressor, the E(spl) repressor, the IκB repressor, and MeCP2.Other examples include transcriptional repression domains derived from A / B, KOX, TGF-β-inducible early genes (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A, DNMT3B, Rb, and ROM2. See, e.g., European Patent No. 3045537 and International Patent No. WO2011 / 146121, each of which is incorporated herein by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides that provide increased or decreased stability. The fusion domain or heterologous polypeptide can be positioned at the N-terminus, C-terminus, or internally of the Cas protein.

[0092] For example, Cas proteins can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLSs), such as a mono- or bi-articular SV40 NLS and / or a bi-articular α-importin NLS for targeting the nucleus, a mitochondrial localization signal for targeting the mitochondria, an ER retention signal, etc. (See, e.g., Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, incorporated herein by reference in its entirety for all purposes.) Such subcellular localization signals can be located at the N-terminus, C-terminus, or anywhere within the Cas protein. The NLS can include a stretch of basic amino acids and can be a mono- or bi-articular sequence. Optionally, the Cas protein can include two or more NLSs, including an N-terminal NLS (e.g., an α-importin NLS or a mono-articular NLS) and a C-terminal NLS (e.g., an SV40 NLS or a bi-articular NLS). The Cas protein may also contain two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0093] The Cas protein can also be operably linked to a cell penetration domain or protein transduction domain. For example, the cell penetration domain can be derived from the HIV-1 TAT protein, the TLM cell penetration motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell penetration peptide from herpes simplex virus, or a polyarginine peptide sequence. See, for example, International Patent Nos. WO2014 / 089290 and WO2013 / 176772, each of which is incorporated herein by reference in its entirety for all purposes. The cell penetration domain can be located at the N-terminus, C-terminus, or anywhere within the Cas protein.

[0094] The Cas protein can also be operably linked to a heterologous polypeptide, such as a fluorescent protein, purification tag, or epitope tag, to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-Sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKat e2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent protein (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0095] The Cas protein can also be tethered to a labeled nucleic acid. Such tethering (i.e., physical linkage) can be achieved through covalent or non-covalent interactions, and the tethering can be direct (e.g., by direct fusion or by chemical linkage, which can be achieved by modification of cysteine ​​or lysine residues of the protein or by intein modification) or can be achieved through one or more intervening linker or adapter molecules, such as streptavidin or aptamers. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include the biotin-streptavidin method and the nickel-histidine method. Covalent protein-nucleic acid conjugates can be synthesized by linking appropriately functionalized nucleic acids and proteins using a wide variety of chemistries. Some of these chemistries involve the direct addition of oligonucleotides to amino acid residues on the protein surface (e.g., lysine amines or cysteine ​​thiols), while other, more complex schemes require post-translational modification of the protein or the involvement of catalytic or reactive domains of the protein. Methods for covalently linking proteins to nucleic acids can include, for example, chemical cross-linking of oligonucleotides to lysine or cysteine ​​residues of the protein, ligation of expressed proteins, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminus, N-terminus, or internal regions within the Cas protein.In one example, the labeled nucleic acid is tethered to the C-terminus or N-terminus of the Cas protein. Similarly, the Cas protein can be tethered to the 5'-terminus, 3'-terminus, or an internal region within the labeled nucleic acid. That is, the labeled nucleic acid can be tethered in any orientation and polarity. For example, the Cas protein can be tethered to the 5'-terminus or 3'-terminus of the labeled nucleic acid.

[0096] The Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon-optimized to efficiently translate it into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to substitute codons with higher usage frequencies compared to the native polynucleotide sequence in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest. When the nucleic acid encoding the Cas protein is introduced into a cell, the Cas protein is expressed transiently, conditionally, or constitutively within the cell.

[0097] Cas proteins provided as mRNA can be modified to improve stability and / or immunogenicity. Modifications can be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, capped and polyadenylated Cas mRNA containing N1-methylpseudouridine can be used. Similarly, Cas mRNA can be modified by removing uridine using synonymous codons.

[0098] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid construct capable of inducing expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and transferring such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector containing DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid separate from the vector containing DNA encoding the gRNA. Promoters that can be used in expression constructs include, for example, promoters active in one or more of eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives expression of both the Cas protein in one direction and the guide RNA in the other. Such a bidirectional promoter can consist of 1) a complete, conventional, unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and 2) a second, basic Pol III promoter containing a TATA box fused in reverse orientation to the 5' end of the PSE and DSE. For example, in the H1 promoter, the DSE is adjacent to the PSE and TATA box; a promoter can be made bidirectional by adding a PSE and TATA box from the U6 promoter to create a hybrid promoter that controls transcription in the opposite direction. See, e.g., U.S. Patent No. 2016 / 0074535, incorporated herein by reference in its entirety for all purposes.The use of a bidirectional promoter allows simultaneous expression of genes encoding Cas proteins and guide RNAs, generating compact expression cassettes to facilitate delivery.

[0099] B. Guide RNA A guide RNA is an RNA molecule that binds to a Cas protein (e.g., a Cas9 protein) and targets the Cas protein to a specific location within the target DNA. Exemplary bimolecular gRNAs include crRNA-like ("CRISPR RNA" or "targeter RNA" or "crRNA" or "crRNA repeat") molecules and corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator RNA" or "tracrRNA") molecules. A crRNA contains both the DNA-targeting segment (single strand) of the gRNA and a series of nucleotides that form one half of the dsRNA duplex of the protein-binding segment of the gRNA. An example of a crRNA tail positioned downstream (3') of the DNA-targeting segment comprises, consists essentially of, or consists of GUUUUAGAGCUAUGCU (SEQ ID NO: 1). Any of the DNA-targeting segments disclosed herein can be attached to the 5' end of SEQ ID NO: 2 to form a crRNA.

[0100] The corresponding tracrRNA (activator RNA) contains a set of nucleotides that form the other half of the dsRNA duplex of the protein-binding segment of the gRNA. The set of nucleotides in the crRNA is complementary to the set of nucleotides in the tracrRNA and hybridizes with the set of nucleotides in the tracrRNA to form the dsRNA duplex of the protein-binding domain of the gRNA. Thus, each crRNA can be said to have a corresponding tracrRNA. Exemplary tracrRNA sequences comprise, consist essentially of, or consist of any one of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO: 3), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 4), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 5).

[0101] In systems requiring both a crRNA and a tracrRNA, the crRNA and the corresponding tracrRNA hybridize to form a gRNA. In systems requiring only a crRNA, the crRNA can be the gRNA. The crRNA also provides a single-stranded DNA targeting segment that hybridizes to the complementary strand of the target DNA. When used for intracellular modification, the precise sequence of a particular crRNA or tracrRNA molecule can be designed to be specific for the species in which the RNA molecule is used. See, for example, Mali et al. (2013) Science 339(6121):823-826; Jinek et al. (2012) Science 337(6096):816-821; Hwang et al. (2013) Nat. Biotechnol. 31(3):227-229; Jiang et al. (2013) Nat. Biotechnol. 31(3):233-239 and Cong et al. (2013) Science 339(6121):819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0102] The DNA targeting segment (crRNA) of a particular gRNA contains a nucleotide sequence complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of a gRNA interacts with the target DNA in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting segment can vary, determining the location within the target DNA where the gRNA and target DNA interact. The DNA targeting segment of a given gRNA can be engineered to hybridize to any desired sequence within the target DNA. Natural crRNAs vary depending on the CRISPR / Cas system and organism, but often contain a targeting segment of 21 to 72 nucleotides in length flanked by two direct repeats (DRs) of between 21 and 46 nucleotides in length (see International Patent Publication No. WO 2014 / 131833, incorporated herein by reference in its entirety for all purposes). In S. pyogenes, the DRs are 36 nucleotides in length, and the targeting segment is 30 nucleotides in length. The 3'-located DR is complementary to the corresponding tracrRNA, hybridizes with the corresponding tracrRNA, and then binds to the Cas protein.

[0103] The DNA targeting segment can be, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35, or 40 nucleotides in length. Such DNA targeting segments can be, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides in length. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides, or about 17, about 18, about 19, or about 20 nucleotides). See, for example, U.S. Patent No. 2016 / 0024523, incorporated herein by reference in its entirety for all purposes. For Cas9 derived from S. pyogenes, a typical DNA targeting segment is between 16 and 20 nucleotides in length or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA targeting segment is between 21 and 23 nucleotides in length. For Cpf1, a typical DNA targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.

[0104] TracrRNA can be in any form (e.g., full-length tracrRNA or active portion tracrRNA) and can vary in length. They can include primary transcripts or processed forms. For example, tracrRNA (as part of a single guide RNA or as a separate molecule as part of a bimolecular gRNA) can comprise, consist essentially of, or consist of all or a portion of the wild-type tracrRNA sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, e.g., Deltcheva et al. (2011) Nature 471(7340):602-607; International Patent Publication No. WO2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNAs within a single guide RNA (sgRNA) include those found within the +48, ​​+54, +67, and +85 versions of the sgRNA, where "+n" indicates that up to +n nucleotides of the wild-type tracrRNA are included in the sgRNA. See, e.g., U.S. Patent No. 8,697,359, incorporated herein by reference in its entirety for all purposes.

[0105] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percentage of complementarity between the DNA targeting segment of the target DNA and the complementary strand can be at least 60% over about 20 consecutive nucleotides. For example, the percentage of complementarity between the DNA targeting segment of the target DNA and the complementary strand can be about 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% over the remainder. In such a case, the DNA targeting segment can be considered to be 14 nucleotides in length. As another example, the complementarity between the DNA targeting segment and the complementary strand of the target DNA may be about 100% over the 7 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and may be as low as 0% over the remaining portion.In such a case, the DNA targeting segment can be considered to be 7 nucleotides long.In some guide RNAs, at least about 17 nucleotides in the DNA targeting segment are complementary to the complementary strand of the target DNA.For example, the DNA targeting sequence may be about 20 nucleotides long and may contain one, two, or three mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand that corresponds to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand that corresponds to the PAM sequence).

[0106] The protein-binding segment of a gRNA can contain two sequences of nucleotides that are complementary to each other. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of the target gRNA interacts with a Cas protein, and the gRNA guides the bound Cas protein to a specific nucleotide sequence within the target DNA via the DNA-targeting segment.

[0107] A single guide RNA can include a DNA targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA can have a 5' DNA targeting segment attached to a 3' scaffold sequence. Exemplary scaffold sequences are GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (version 1, SEQ ID NO: 6); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2, SEQ ID NO: 7); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 3, SEQ ID NO: 8) and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGC (version 4, SEQ ID NO: 9); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5, SEQ ID NO: 10); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGUGCUUUU (version 6, SEQ ID NO: 11) or GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7, SEQ ID NO: 12). A guide RNA that targets any of the guide RNA target sequences disclosed herein may include, for example, a DNA targeting segment on the 5' end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3' end of the guide RNA.That is, any of the DNA targeting segments disclosed herein can be attached to the 5' end of any one of the above scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0108] Guide RNAs may include modifications or sequences that provide additional desirable characteristics (e.g., altered or regulated stability, intracellular targeting, tracking with fluorescent labels, binding sites for proteins or protein complexes, etc.). Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate cap (m7G)), a 3' polyadenylation tail (i.e., a 3' poly(A) tail), a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and / or protein complexes), a stability control sequence, a sequence that forms a dsRNA duplex (i.e., a hairpin), a modification or sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.), a modification or sequence that provides tracking (e.g., direct attachment to a fluorescent molecule, attachment to a moiety that facilitates fluorescent detection, a sequence that allows fluorescent detection, etc.), a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including a transcriptional activator, a transcriptional repressor, a DNA methyltransferase, a DNA demethylase, a histone acetyltransferase, a histone deacetylase, etc.), and combinations thereof. Other examples of modifications include an engineered stem-loop duplex structure, an engineered bulge region, an engineered hairpin 3' of a stem-loop duplex structure, or any combination thereof. See, e.g., U.S. Patent No. 2015 / 0376586, incorporated herein by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within a duplex comprised of a crRNA-like region and a minimal tracrRNA-like region. A bulge can comprise an unpaired 5'-XXXY-3' (wherein X is any purine and Y comprises a nucleotide that can form a wobble pair with a nucleotide on the opposing strand) on one side of the duplex and an unpaired nucleotide region on the other side of the duplex.

[0109] In some cases, a transcription activation system comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 can be used. The guide RNA for such a system can be designed with an aptamer sequence attached to the sgRNA tetraloop and stem-loop 2 designed to bind the dimerized MS2 bacteriophage coat protein. See, for example, Konermann et al. (2015) Nature 517(7536):583-588, the entire contents of which are incorporated herein by reference for all purposes.

[0110] Unmodified nucleic acids may be prone to degradation. Exogenous nucleic acids can also induce innate immune responses. Modifications can help introduce stability and reduce immunogenicity. Guide RNAs can contain modified nucleosides and nucleotides, including, for example, one or more of the following: (1) modification or substitution of one or both of the unlinked phosphate oxygens and / or the linked phosphate oxygens in the phosphodiester backbone linkage; (2) modification or substitution of components of the ribose sugar, such as modification or substitution of the 2' hydroxyl of the ribose sugar; (3) replacement of the phosphate moiety with a dephosphorylation linker; (4) modification or substitution of a natural nucleobase; (5) substitution or modification of the ribose-phosphate backbone; (6) modification of the 3' or 5' end of the oligonucleotide (e.g., removal, modification, or substitution of a terminal phosphate group, or conjugation of a site); and (7) sugar modification. Other possible guide RNA modifications include modification or substitution of uracil or polyuracil tracts. See, for example, International Patent No. 2015 / 048577 and US Patent No. 2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes. Similar modifications can be made to Cas This can be done on a nucleic acid encoding Cas, such as an mRNA.

[0111] As one example, the nucleotides at the 5' or 3' end of the guide RNA can comprise phosphorothioate linkages (e.g., the bases can have modified phosphate groups that are phosphorothioate groups). For example, the guide RNA can comprise phosphorothioate linkages between the 2, 3, or 4 terminal nucleotides at the 5' or 3' end of the guide RNA. As another example, the nucleotides at the 5' and / or 3' end of the guide RNA can have 2'-O-methyl modifications. For example, the guide RNA can comprise 2'-O-methyl modifications at the 2, 3, or 4 terminal nucleotides at the 5' and / or 3' end (e.g., the 5' end) of the guide RNA. See, for example, International Patent No. WO2017 / 173054A1 and Finn et al. (2018) Cell Rep. 22(9):2227-2235, each of which is incorporated herein by reference in its entirety for all purposes.

[0112] The guide RNA can be provided in any form. For example, the gRNA can be provided in the form of RNA, either two molecules (separate crRNA and tracrRNA) or one molecule (sgRNA), and optionally in the form of a complex with a Cas protein. The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as a single DNA molecule or as separate DNA molecules encoding the crRNA and tracrRNA, respectively.

[0113] When the gRNA is provided in the form of DNA, the gRNA can be expressed transiently, conditionally, or constitutively in the cell. The DNA encoding the gRNA can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the DNA encoding the gRNA can be operably linked to a promoter of an expression construct. For example, the DNA encoding the gRNA can be within a vector containing a heterologous nucleic acid, such as a nucleic acid encoding a Cas protein. Alternatively, it can be within a vector or plasmid separate from the vector containing the nucleic acid encoding the Cas protein. Promoters that can be used in such expression constructs include, for example, promoters active in one or more of eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters, such as the human U6 promoter, the rat U6 polymerase III promoter, or the mouse U6 polymerase III promoter.

[0114] Alternatively, gRNA can be prepared by various other methods. For example, gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, International Patent Nos. WO2014 / 089290 and WO2014 / 065596, each of which is incorporated herein by reference in its entirety for all purposes). Guide RNA can also be a synthetically produced molecule prepared by chemical synthesis.

[0115] The guide RNA (or nucleic acid encoding the guide RNA) can be within a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4, or more guide RNAs) and a carrier that enhances the stability of the guide RNA (e.g., extending the period during which degradation products remain below a threshold value (e.g., less than 0.5% by weight of the starting nucleic acid or protein) at a given storage condition (e.g., −20° C., 4° C., or ambient temperature) or increasing stability in vivo). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein.

[0116] C. Guide RNA target sequence The target DNA of the guide RNA includes a nucleic acid sequence present in the DNA to which the DNA targeting segment of the gRNA binds when conditions sufficient for binding exist. Suitable DNA / RNA binding conditions include physiological conditions normally present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, for example, Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), incorporated herein by reference in its entirety for all purposes). The strand of the target DNA that is complementary to and hybridizes with the gRNA can be referred to as the "complementary strand," and the strand of the target DNA that is complementary to the "complementary strand" (and therefore not complementary to the Cas protein or gRNA) can be referred to as the "non-complementary strand" or "template strand."

[0117] The target DNA includes both the sequence on the complementary strand to which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to a protospacer adjacent motif (PAM)). The guide RNA is designed to have complementarity to the complementary strand of the target DNA, and hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of a CRISPR complex. Perfect complementarity is not necessarily required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex. When a guide RNA is referred to herein as targeting a guide RNA target sequence, what is meant is that the guide RNA hybridizes to a complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0118] Target DNA or guide RNA target sequence can comprise any polynucleotide, for example, can be located in the nucleus or cytoplasm of a cell, or in a cell organelle such as mitochondria or chloroplast.Target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or foreign to a cell.Guide RNA target sequence can be a sequence that codes for a gene product (e.g., protein) or a non-coding sequence (e.g., regulatory sequence), or can comprise both.

[0119] The target sequence of the DNA-binding protein (e.g., a guide RNA target sequence) can be located anywhere within an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2) that is suitable for altering expression of the target gene. In one example, the target sequence can be within or adjacent to a regulatory element, such as an enhancer or promoter. For example, the target sequence can include or be adjacent to the start codon of an autophagy gene (e.g., an autophagy gene listed in Table 1) or an NF-κB gene (e.g., an NF-κB gene listed in Table 2). For example, the target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon.

[0120] Site-specific binding and cleavage of target DNA by a Cas protein can occur at a location within the non-complementary strand of the target DNA determined by both i) base pair complementarity between the guide RNA and the corresponding complementary strand of the target DNA and ii) a short motif called a protospacer adjacent motif (PAM). The PAM can be adjacent to the guide RNA target sequence. Optionally, the guide RNA target sequence can be adjacent to the 3' end by a PAM (e.g., in the case of Cas9). Alternatively, the guide RNA target sequence can be adjacent to the 5' end by a PAM (e.g., in the case of Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10, or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide, and the PAM is immediately 3' to the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complementary strand) is 5'-CCN2-3', where N2 is any DNA nucleotide and is immediately 5' to the sequence to which the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1 = C and N2 = G, N1 = G and N2 = C, N1 = A and N2 = T, or N1 = T and N2 = A). In the case of S. aureus-derived Cas9, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In the case of C. jejuni-derived Cas9, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (eg, in the case of FnCpf1), the PAM sequence may be 5' upstream and have the sequence 5'-TTN-3'.

[0121] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of a guide RNA target sequence + PAM are GN 19 NGG (SEQ ID NO: 13) or N 20 NGG (SEQ ID NO: 14). See, for example, International Patent Publication No. WO2014 / 165825, the entirety of which is incorporated herein by reference for all purposes. A guanine at the 5' end can promote transcription by RNA polymerase in cells. Another example of a guide RNA target sequence + PAM is a guide RNA target sequence + PAM that has two guanine nucleotides (e.g., GGN 20 NGG, SEQ ID NO: 15). See, for example, International Patent Publication WO2014 / 065596, incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences plus PAM may have a length between 4 and 22 nucleotides, including a 5' G or GG and a 3' GG or NGG. Still other guide RNA target sequences plus PAM may have a length between 14 and 20 nucleotides. Exemplary sgRNA sequences include, but are not limited to, SEQ ID NOs: 17-38, 40-41, 43, 48, and 50-55.

[0122] Formation of a CRISPR complex hybridized to the target DNA can result in cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guide RNA hybridizes). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a defined position relative to the PAM sequence). A "cleavage site" includes the location in the target DNA where the Cas protein creates a single-stranded or double-stranded break. The cleavage site can be on only one strand of the double-stranded DNA (e.g., when using a nickase) or on both strands. The cleavage sites can be at the same position on both strands (creating a blunt end, e.g., Cas9) or at different sites on each strand (creating a staggered end (i.e., an overhang), e.g., Cpf1). Staggered ends can be generated, for example, by using two Cas proteins, each creating a single-stranded break at a different cleavage site on a different strand, thereby creating a double-stranded break. For example, a first nickase can create a single-stranded break on a first strand of double-stranded DNA (dsDNA), and a second nickase can create a single-stranded break on a second strand of the dsDNA such that an overhang sequence is created. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is separated from the guide RNA target sequence or cleavage site of the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0123] Additional Genetic Modifiers In some embodiments, the agents disclosed herein are agents for genome editing other than the CRISPR / Cas system. DNA deletion can be achieved using gene therapy to knock out or disrupt a target gene. Knockout can be gene knockdown, or the gene can be knocked out by mutation using techniques known in the art, such as point mutation, insertion, deletion, frameshift, or missense mutation, including, but not limited to, retroviral gene transfer. In some embodiments, the agent is a nuclease (e.g., zinc finger nuclease or TALEN) effective in binding and modifying at least one of the genes disclosed herein (e.g., an autophagy gene, such as an autophagy gene disclosed herein, or an NF-κB gene, such as an NF-κB gene disclosed herein).

[0124] Any nuclease agent that induces a nick or double-strand break in a desired target sequence or any DNA-binding protein that binds to a desired target sequence can be used in the methods and compositions disclosed herein. Natural or native nuclease agents can be used as long as the nuclease agent induces a nick or double-strand break in the desired target sequence. Similarly, natural or native DNA-binding proteins can be used as long as the DNA-binding protein binds to the desired target sequence. Alternatively, modified or altered nuclease agents or DNA-binding proteins can be used. "Altered nuclease agents or DNA-binding proteins" include nuclease agents or DNA-binding proteins that have been altered (modified or derived) from their native form to specifically recognize a desired target sequence. Thus, modified nuclease agents or DNA-binding proteins can be derived from native, naturally occurring nuclease agents or DNA-binding proteins, or can be artificially created or synthesized. The modified nuclease agent or DNA-binding protein can recognize a target sequence, for example, where the target sequence is not a sequence that would be recognized by a native (unmodified or unmodified) nuclease agent or DNA-binding protein. The modification of the nuclease agent or DNA-binding protein can be as little as one amino acid in a protein cleavage agent or as little as one nucleotide in a nucleic acid cleavage agent. Generating a nick or double-strand break in a target sequence or other DNA can be referred to herein as "cutting" or "cutting" the target sequence or other DNA.

[0125] Active variants and fragments of nuclease agents or DNA-binding proteins (i.e., modified nuclease agents or DNA-binding proteins) are also provided. Such active variants have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a native nuclease agent or DNA-binding protein, and the active variant retains the ability to cleave at a desired target sequence and thus retains nick or double-strand break-inducing activity or retains the ability to bind a desired target sequence. For example, any of the nuclease agents described herein can be modified from its native endonuclease sequence and designed to recognize and induce a nick or double-strand break at a target sequence not recognized by the native nuclease agent. Thus, some modified nucleases have the specificity to induce a nick or double-strand break at a target sequence that is different from the corresponding native nuclease agent target sequence. Assays for nick or double-strand break-inducing activity are known and generally measure the overall activity and specificity of an endonuclease on a DNA substrate containing a target sequence. The target sequence can be endogenous (or native) to the cell, or the target sequence can be exogenous to the cell. A target sequence that is exogenous to the cell does not naturally occur in the genome of the cell. The target sequence can also be exogenous to a polynucleotide of interest that is desired to be placed at the target locus. In some cases, the target sequence is present in only one location in the genome of the host cell.

[0126] Active variants and fragments of exemplary target sequences are also provided. Such active variants have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with a given target sequence, and the active variants retain biological activity and can therefore be recognized and cleaved in a sequence-specific manner by nuclease agents. Assays for measuring double-stranded cleavage of target sequences by nuclease agents are known (e.g., TAQMAN® qPCR assay, Frendewey et al. (2010) Methods in Enzymology 476:295-307, incorporated herein by reference in its entirety for all purposes).

[0127] The length of the target sequence can vary, but examples include, for example, about 30-36 bp for a zinc finger protein or zinc finger nuclease (ZFN) pair (i.e., about 15-18 bp for each ZFN), about 36 bp for a transcription activator-like effector (TALE) protein or transcription activator-like effector nuclease (TALEN), or about 20 bp for a CRISPR / Cas9 guide RNA.

[0128] The target sequence of the DNA-binding protein or nuclease agent can be located anywhere within or near the target genomic locus. The target sequence can be located within the coding region of the gene or within a regulatory region that affects gene expression. The target sequence of the DNA-binding protein or nuclease agent can be located in an intron, exon, promoter, enhancer, regulatory region, or any non-protein-coding region.

[0129] One type of DNA-binding protein that can be used in the various methods and compositions disclosed herein is a transcription activator-like effector (TALE). TALEs can be fused or linked to, for example, an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. Examples of such domains are described below with respect to Cas proteins and can also be found, for example, in International Patent Publication No. WO 2011 / 145121, incorporated herein by reference in its entirety for all purposes. Correspondingly, one type of nuclease agent that can be used in the various methods and compositions disclosed herein is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to create double-strand breaks at specific target sequences in prokaryotic or eukaryotic genomes. TAL effector nucleases are generated by fusing a native or modified transcription activator-like (TAL) effector, or a functional portion thereof, to the catalytic domain of an endonuclease, such as FokI. The unique modular TAL effector DNA-binding domain allows for the design of proteins with potentially arbitrary DNA recognition specificities. Thus, the DNA-binding domain of a TAL effector nuclease can be designed to recognize a specific DNA target site and thus used to create a double-strand break at the desired target sequence. International Patent No. WO 2010 / 079430; Morbitzer et al. (2010) Proc. Natl. Acad. Sci. USA 107(50:21617-21622; Scholze & Boch (2010) Virulence 1:428-432; Christian et al. (2010) Genetics 186:757-761; Li et al. (2011) Nucleic Acids Res. 39(1):359-372; and Miller et al. (2011) Nature Biotechnology 29:143-148, each of which is incorporated herein by reference in its entirety for all purposes.

[0130] A nonspecific DNA cleavage domain from the end of the FokI endonuclease can be used to construct hybrid nucleases active in yeast assays. These reagents are also active in plant and animal cells. The FokI domain functions as a dimer, requiring two constructs with specific DNA binding domains at the target genome site in the appropriate orientation and spacing. Both the number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain and the number of bases between the two individual TALEN binding sites are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain can be modified by introducing a spacer (different from the spacer sequence) between the multiple TAL effector repeats and the FokI endonuclease domain. The spacer sequence can be 12 to 30 nucleotides.

[0131] The relationship between amino acid sequence and DNA recognition of TALEN binding domains allows for designable proteins. In this case, artificial gene synthesis is problematic due to improper annealing of repetitive sequences found in TALE binding domains. One solution to this is to use a publicly available software program (DNAWorks) to calculate suitable oligonucleotides for assembly in a two-step PCR, oligonucleotide assembly followed by whole-gene amplification. Numerous modular assembly schemes for generating engineered TALE constructs have also been reported. Both methods provide a systematic approach to engineering DNA-binding domains, conceptually similar to the modular assembly method for generating zinc finger DNA recognition domains.

[0132] Once TALEN genes are assembled, they are inserted into a plasmid. The plasmid is then used to transfect target cells where the gene product is expressed and enters the nucleus to access the genome. TALENs can be used to edit the genome by inducing double-strand breaks (DSBs), to which the cell responds with repair mechanisms.

[0133] For examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases, see, e.g., U.S. Patent Nos. 2011 / 0239315A1, 2011 / 0269234A1, 2011 / 0145940A1, 2003 / 0232410A1, 2005 / 0208489A1, 2005 / 0026157A1, 2005 / 0064474A1, 2006 / 0188987A1, and 2006 / 0063231A1, each of which is incorporated by reference in its entirety for all purposes. In various embodiments, the TAL effector nuclease is designed to cleave at or near a target nucleic acid sequence, for example, at a genomic locus of interest, where the target nucleic acid sequence is at or near the sequence to be modified.

[0134] In some TALENs, each TALEN monomer contains 33-35 TAL repeats that recognize a single base pair through two hypervariable residues. In some TALENs, the nuclease agent is a chimeric protein containing a TAL repeat-based DNA-binding domain operably linked to an independent nuclease, such as a FokI endonuclease. For example, the nuclease agent can include a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, each of which is operably linked to a FokI nuclease, and the first and second TAL repeat-based DNA-binding domains recognize two adjacent target DNA sequences in each strand of the target DNA sequence, separated by spacer sequences of various lengths (12-20 bp), and the FokI nuclease subunits dimerize to generate an active nuclease that makes a double-stranded break in the target sequence.

[0135] Transcription activator-like effector nucleases (TALENs) are artificial restriction enzymes generated by fusing a TAL effector DNA-binding domain to a DNA cleavage domain. These reagents enable efficient, programmable, and specific DNA cleavage, making them powerful tools for in situ genome editing. Transcription activator-like effectors (TALEs) can be rapidly engineered to bind to virtually any DNA sequence. As used herein, the term TALEN is broad and includes monomeric TALENs that can cleave double-stranded DNA without the assistance of another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs engineered to cooperate to cleave DNA at the same site. TALENs that function together are sometimes referred to as left- and right-handed TALENs, which refers to their DNA handedness. See U.S. Patent Nos. 12 / 965,590, 13 / 426,991 (U.S. Patent No. 8,450,471), 13 / 427,040 (U.S. Patent No. 8,440,431), 13 / 427,137 (U.S. Patent No. 8,440,432), and 13 / 738,381, all of which are incorporated herein by reference in their entirety.

[0136] Another example of a DNA-binding protein is a zinc finger protein. Such a zinc finger protein can be linked to or fused to, for example, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of such domains are described below with respect to Cas proteins and can also be found, for example, in International Patent Publication No. WO2011 / 145121, incorporated herein by reference in its entirety for all purposes. Correspondingly, another example of a nuclease agent that can be used in the various methods and compositions disclosed herein is a zinc finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN contains three or more zinc finger-based DNA-binding domains, and each zinc finger-based DNA-binding domain binds to a 3-bp subsite. In other ZFNs, the ZFN is a chimeric protein containing a zinc finger-based DNA-binding domain operably linked to an independent nuclease, such as FokI endonuclease. For example, the nuclease agent can include a first ZFN and a second ZFN, each of which is operably linked to a FokI nuclease subunit, which recognize two adjacent target DNA sequences on each strand of the target DNA sequence separated by a spacer of about 5-7 bp, and which dimerize to generate an active nuclease that makes a double-stranded cleavage. See, e.g., U.S. Patent Nos. 2006 / 0246567, 2008 / 0182332, 2002 / 0081614, 2003 / 0021776, International Patent No. WO2002 / 057308A2, U.S. Patent Nos. 2013 / 0123484, 2010 / 0291048, International Patent No. WO2011 / 017293A2, and Gaj et al. (2013) Trends in Biotechnology 31(7):397-405, each of which is incorporated herein by reference in its entirety for all purposes.

[0137] Interfering nucleic acid agents In certain embodiments, interfering nucleic acid molecules that selectively target and inhibit the activity or expression of a product (e.g., an mRNA product) of an autophagy or NF-κB gene (e.g., a gene listed in Table 1 or Table 2) are provided herein and / or used in the methods described herein. In some embodiments, the interfering nucleic acid induces cytotoxicity in cells expressing a product of at least one autophagy gene or at least one NF-κB gene (e.g., a gene listed in Table 1 or Table 2). The agent may inhibit the expression or activity of a product (e.g., an mRNA product) of at least one autophagy gene or at least one NF-κB gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. The agents disclosed herein can comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementarity to the product (e.g., mRNA product) of at least one autophagy gene or at least one NF-κB gene.

[0138] In some embodiments, interfering nucleic acid is siRNA, shRNA, PNA or miRNA molecule.Interfering nucleic acid generally comprises a sequence of circular subunits, each of which has a base pairing portion, and the base pairing portion is connected by intersubunit bonds, which allows the base pairing portion to hybridize with the target sequence in nucleic acid (usually RNA) by Watson-Crick base pairing, forming nucleic acid oligomer heteroduplex within the target sequence.Interfering RNA molecule includes but is not limited to antisense molecule, siRNA molecule, single-stranded siRNA molecule, miRNA molecule and shRNA molecule.

[0139] Typically, at least 17, 18, 19, 20, 21, 22, or 23 nucleotides of the complement of the target mRNA sequence are sufficient to mediate the inhibition of the target transcript. Perfect complementarity is not required. In some embodiments, the interfering nucleic acid molecule is a double-stranded RNA. The double-stranded RNA molecule may have a 2-nucleotide 3' overhang. In some embodiments, the two RNA strands are linked via a hairpin structure to form an shRNA molecule. The shRNA molecule may contain a hairpin derived from a microRNA molecule. For example, an RNAi vector can be constructed by cloning an interfering RNA sequence into a pCAG-miR30 construct containing a hairpin derived from miR30 miRNA. The RNA interference molecule may contain both RNA and DNA residues.

[0140] The interfering nucleic acid molecule provided herein can comprise RNA base, non-RNA base, or the mixture of RNA base and non-RNA base.For example, the interfering nucleic acid molecule provided herein can be mainly composed of RNA base, but can also comprise DNA base or non-naturally occurring nucleotide.

[0141] Interfering nucleic acids can utilize various oligonucleotide chemistries. Examples of oligonucleotide chemistries include, but are not limited to, peptide nucleic acid (PNA), linked nucleic acid (LNA), phosphorothioate, 2'O-Me modified oligonucleotide, and morpholino chemistries (including any combination of the above). Generally, PNA and LNA chemistries have relatively higher target binding strength than 2'O-Me oligonucleotides, allowing for the use of shorter targeting sequences. Phosphorothioate and 2'O-Me modified chemistries are often combined to produce 2'O-Me modified oligonucleotides with phosphorothioate backbones. See, for example, PCT Publication Nos. WO / 2013 / 112053 and WO / 2009 / 008725, which are incorporated by reference in their entirety.

[0142] Peptide nucleic acids (PNAs) are analogs of DNA, consisting of N-(2-aminoethyl)glycine units linked to pyrimidine or purine bases, structurally homologous to the deoxyribose backbone. PNAs containing natural pyrimidine and purine bases hybridize to complementary oligonucleotides according to Watson-Crick base-pairing rules, mimicking DNA with respect to base pair recognition (Egholm, Buchardt et al. 1993). Because the PNA backbone is formed by peptide bonds rather than phosphodiester bonds, it is suitable for antisense applications (see structure below). The backbone is uncharged, resulting in PNA / DNA or PNA / RNA duplexes that exhibit superior thermal stability. PNAs are not recognized by nucleases or proteases.

[0143] Despite their radical structural changes relative to their native structure, PNAs are capable of helical, sequence-specific binding to DNA or RNA. PNA features include high binding affinity to complementary DNA or RNA, destabilizing effects caused by single-base mismatches, resistance to nucleases and proteases, salt-independent hybridization with DNA or RNA, and triplex formation with homopurine DNA. PANAGENE™ has developed a proprietary BtsPNA monomer (Bts, benzothiazole-2-sulfonyl group) and a proprietary oligomerization process. PNA oligomerization using the BtsPNA monomer consists of repeated cycles of deprotection, coupling, and capping. PNAs can be synthetically produced using any technique known in the art. See, e.g., U.S. Patent Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006, and 7,179,896. For the preparation of PNAs, see also U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Further teachings of PNA compounds can be found in Nielsen et al., Science, 254:1497-1500, 1991. Each of the foregoing is incorporated by reference in its entirety.

[0144] Interfering nucleic acids may also contain "locked nucleic acid" subunits (LNA). "LNA" is a type of modification called bridged nucleic acid (BNA). BNA is characterized by a covalent bond that locks the structure of the ribose ring to a C30-endo (northern) sugar pucker. In the case of LNA, the bridge consists of a methylene between the 2'-O and 4'-C positions. LNA enhances backbone preorganization and base stacking, improving hybridization and thermal stability.

[0145] Structures of LNAs can be found, for example, in Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54:3607, and Accounts of Chem. Research (1999) 32:301; Obika, et al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401 and Bioorganic Medicinal Chemistry (2008) 16:9230. The compounds provided herein can incorporate one or more LNAs, and in some cases, the compounds can consist entirely of LNAs. Methods for synthesizing individual LNA nucleoside subunits and incorporating them into oligonucleotides are described, for example, in U.S. Patent Nos. 7,572,582, 7,569,575, 7,084,125, 7,060,809, 7,053,207, 7,034,133, 6,794,499, and 6,670,461, each of which is incorporated by reference in its entirety. Typical intersubunit linkers include phosphodiester and phosphorothioate moieties. Alternatively, non-phosphorus-containing linkers can be used. One embodiment is an LNA-containing compound in which each LNA subunit is separated by a DNA subunit. Certain compounds are composed of alternating LNA and DNA subunits in which the intersubunit linker is phosphorothioate.

[0146] "Phosphorothioates" (or S-oligos) are variants of normal DNA in which one of the non-bridging oxygens is replaced by sulfur. Sulfuration of the internucleotide bond reduces the action of endonucleases and exonucleases, including 5' to 3' and 3' to 5' DNA POL1 exonuclease, nucleases S1 and P1, RNases, serum nucleases, and snake venom phosphodiesterases. Phosphorothioates are generated by two major routes: by the action of hydrogen phosphonate in a solution of elemental sulfur in carbon disulfide, or by sulfurization of a phosphite triester with tetraethylthiuram disulfide (TETD) or 3H-1,2-benzodithiol-3-one 1,1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55, 4693-4699, 1990). The latter method avoids the problem of elemental sulfur being insoluble in most organic solvents and the toxicity of carbon disulfide. The TETD and BDTD methods also yield phosphorothioates of higher purity.

[0147] A "2'O-Me oligonucleotide" molecule has a methyl group at the 2'-OH residue of the ribose molecule. 2'-O-Me-RNA behaves the same as (or similar to) DNA, but is protected from nuclease degradation. 2'-O-Me-RNA can also be combined with phosphothioate oligonucleotides (PTO) for further stabilization. 2'O-Me oligonucleotides (phosphodiester or phosphothioate) can be synthesized according to conventional techniques in the art (see, for example, Yoo et al., Nucleic Acids Res. 32:2008-16, 2004).

[0148] The interfering nucleic acids described herein can be contacted with cells or administered to organisms (e.g., humans). Alternatively, constructs and / or vectors encoding interfering RNA molecules can be contacted with or introduced into cells or organisms. In certain embodiments, viral, retroviral, or lentiviral vectors are used. In some embodiments, the vector has tropism for cardiac tissue. In some embodiments, the vector is an adeno-associated virus.

[0149] In one embodiment, the interfering nucleic acid molecule is an siRNA molecule.Such siRNA molecule should comprise a region with sufficient homology to target region, and be of sufficient length in terms of nucleotide, so that siRNA molecule can down-regulate target RNA.The term "ribonucleotide" or "nucleotide" can also refer to modified nucleotide or alternative substitution site at one or more positions in the case of modified RNA or nucleotide substitute.There does not need to be perfect complementarity between siRNA molecule and target, but there must be sufficient correspondence so that siRNA molecule can induce sequence-specific silencing, such as by RNAi cleavage of target RNA.In some embodiments, the sense strand only needs to be sufficiently complementary to the antisense strand to maintain the overall double-stranded nature of the molecule.

[0150] Furthermore, siRNA molecules can be modified or contain nucleoside substitutes. The single-stranded regions of siRNA molecules can be modified or contain nucleoside substitutes, for example, unpaired regions or regions of hairpin structures, such as regions connecting two complementary regions, can have modifications or nucleoside substitutes. Modifications to stabilize one or more 3' or 5' ends of siRNA molecules against exonucleases, or to facilitate the entry of antisense siRNA agents into RISC, are also useful. Modifications can include C3 (or C6, C7, C12) amino linkers, thiol linkers, carboxyl linkers, non-nucleotide spacers (C3, C6, C9, C12, abasic, triethylene glycol, hexaethylene glycol), and special biotin or fluorescein reagents with separate DMT-protected hydroxyl groups as phosphoramidites, allowing multiple couplings during RNA synthesis.

[0151] Non-limiting examples of shRNAs include double-stranded polynucleotide molecules assembled from single-stranded molecules in which the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker, and double-stranded polynucleotide molecules comprising a hairpin secondary structure with self-complementary sense and antisense regions. In some embodiments, the sense and antisense strands of the shRNA are linked by a loop structure comprising about 1 to about 25 nucleotides, about 2 to about 20 nucleotides, about 4 to about 15 nucleotides, about 5 to about 12 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides.

[0152] Further embodiments of shRNAs, as well as methods for designing and synthesizing such shRNAs, are described in U.S. Patent Application Publication No. 2011 / 0071208, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0153] In some embodiments, microRNAs (miRNAs) are provided herein. miRNAs represent a large group of small RNAs naturally produced in organisms, some of which regulate the expression of target genes. miRNAs are formed by Dicer from single-stranded hairpin precursor transcripts of approximately 70 nucleotides. miRNAs are not translated into proteins, but instead bind to specific messenger RNAs, thereby blocking translation. In some cases, miRNAs form incorrect base pairs with their targets and inhibit translation.

[0154] In certain embodiments, antisense oligonucleotides can be 100% complementary to target sequence, or can contain mismatches, for example, to improve the selective targeting of alleles containing disease-related mutations, as long as the heteroduplex formed between oligonucleotide and target sequence is stable enough to withstand the action of cellular nucleases and other degradation modes that may occur in vivo.Therefore, certain oligonucleotides can have about or at least about 70% sequence complementarity between oligonucleotide and target sequence, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity. Described herein are oligonucleotide backbones that are less susceptible to nuclease cleavage. When present, mismatches are typically less destabilizing toward the terminal regions of the hybrid duplex than toward the middle region. The number of mismatches tolerated depends on the length of the oligonucleotide, the ratio of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, according to well-understood principles of duplex stability.

[0155] Interfering nucleic acid molecules can be prepared, for example, by chemical synthesis, in vitro transcription, or by digesting long dsRNA with RNase III or Dicer.They can be introduced into cells by transfection, electroporation, or other methods known in the art.Hannon, GJ, 2002, RNA Interference, Nature 418:244-251; Bernstein E et al.,2002,The rest is silence.RNA7:1509-1521;Hutvagner G et al.,RNAi:Nature abhors a double-strand. Curr.Opin. Genetics&Development12:225-232;Brummelkamp,2002,A system for stable expression of short interfering RNAs in mammalian cells. Science296:550-553;Lee NS, Dohjima T, Bauer G, Li H, Li MJ, Ehsani A, Salvaterra P, and Rossi J. (2002). Expression of small interfering RNAs targeted against HIV-1 rev 人类细胞中的转录本。《自然生物技术》20:500 - 505;宫岸正和平田健(2002年)。具有四个尿苷3'突出端的U6启动子驱动的小干扰RNA有效抑制哺乳动物细胞中的靶向基因表达。《自然生物技术》20:497 - 500;帕迪森PJ、考迪AA、伯恩斯坦E、汉农GJ和康克林DS(2002年)。短发夹RNA(shRNA)在哺乳动物细胞中诱导序列特异性沉默。《基因与发育》16:948 - 958;保罗CP、古德PD、维纳I和恩格尔克DR(2002年)。小干扰RNA在人类细胞中的有效表达。《自然生物技术》20:505 - 508;隋G、苏胡C、阿法尔E - B、盖伊F、施Y、福雷斯特WC和施Y(2002年)。基于DNA载体的RNAi技术抑制哺乳动物细胞中的基因表达。《美国国家科学院院刊》99(6):5515 - 5520;于J - Y、德鲁伊特SL和特纳DL(2002年)。通过表达 短干扰RNA和发夹RNA在哺乳动物细胞中进行RNA干扰。参见《美国国家科学院院刊》99(9):6047 - 6052。

[0156] In this method, an interfering nucleic acid molecule or an interfering nucleic acid encoding a polynucleotide can be administered to a subject, for example, as naked nucleic acid, in combination with a delivery reagent and / or as a nucleic acid containing a sequence that expresses the interfering nucleic acid molecule. In some embodiments, the interfering nucleic acid is administered directly to the subject's tumor. In some embodiments, the nucleic acid containing a sequence that expresses the interfering nucleic acid molecule is delivered within a vector, such as a plasmid, a viral vector, or a bacterial vector. Any nucleic acid delivery method known in the art can be used in the methods described herein. Suitable delivery reagents include, but are not limited to, Mirus Transit TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, polycations (e.g., polylysine), atelocollagen, nanoplexes, and liposomes. The use of atelocollagen as a delivery vehicle for nucleic acid molecules has been described by Minakuchi et al. Nucleic Acids Res., 32(13):e109 (2004); Hanai et al. Ann NY Acad Sci., 1082:9-17 (2006); and Kawata et al. Mol Cancer Ther., 7(9):2904-12 (2008), each of which is incorporated herein in its entirety. Exemplary interfering nucleic acid delivery systems are provided in U.S. Patent Nos. 8,283,461, 8,313,772, 8,501,930, 8,426,554, 8,268,798, and 8,324,366, each of which is incorporated herein by reference in its entirety.

[0157] In some embodiments of the methods described herein, liposomes are used to deliver inhibitory oligonucleotides to a subject. Liposomes suitable for use in the methods described herein can be formed from standard vesicle-forming lipids, generally including neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired size of the liposomes and the half-life of the liposomes in the bloodstream. Various methods for preparing liposomes are known, as described, for example, in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467, and U.S. Patent Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are incorporated herein by reference.

[0158] Liposomes used in the present methods can also be modified to avoid clearance by the mononuclear macrophage system ("MMS") and reticuloendothelial system ("RES"). Such modified liposomes have opsonization-inhibition moieties on their surface or incorporated into the liposome structure.

[0159] Small molecule agents Certain embodiments of the methods and compositions disclosed herein relate to the use of small molecule agents, e.g., small molecule agents that inhibit the expression or activity of the product of an autophagy gene (e.g., an autophagy gene disclosed herein) or an NF-κB gene (e.g., an NF-κB gene disclosed herein) in cancer cells. In some embodiments, the small molecule induces cytotoxicity in cells expressing the product of an autophagy gene (e.g., an autophagy gene disclosed herein) or an NF-κB gene (e.g., an NF-κB gene disclosed herein). Such agents include those known in the art and those identified using the screening assays described herein. The small molecules provided herein can have at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% specificity for the product of an autophagy gene (e.g., an autophagy gene disclosed herein) or an NF-κB gene (e.g., an NF-κB gene disclosed herein).

[0160] In certain embodiments, the agent is selected from the group consisting of a PI3 kinase inhibitor, a phosphoinositide 3 kinase (PI3) inhibitor, an Unc-51-like kinase 1 (ULK1) inhibitor, a vacuolar protein sorting protein 18 (Vps18) inhibitor, a vacuolar protein sorting protein 34 (Vps34) inhibitor, a ubiquitin-specific peptidase (USP10 or USP13) inhibitor, a thioxanthone-based autophagy inhibitor, an ATG4 inhibitor, autofinib, 3-methyladenine, wortmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, The inhibitor may be a small molecule autophagy inhibitor such as thapsigargin, vacuolin-1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, Compound 31, VPS34-IN1, PIK-III, Compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lucanthone, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, Compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071. For more information on additional autophagy inhibitors and their potential applications, see Waleska K. Martins and Mauricio S. Baptista (November 10, 2016). Autophagy Modulation for Organelle-Targeting Therapy, Autophagy in Current Trends in Cellular Physiology and Pathology, Nikolai V. Gorbunov and Marion Schneider, IntechOpen, DOI: 10.5772 / 63976 (available at https: / / www.intechopen.com / books / autophagy-in-current-trends-in-cellular-physiology-and-pathology / autophagy-modulation-for-organelle-targeting-therapy); Pasquier, Benoit. “Autophagy inhibitors.” Cellular and Molecular Life Sciences 73 (2015): 985-1001; U.S. Patent Nos. 8,524,762 and 9,926,326; and WIPO Publication No. WO2011011522, each of which is incorporated herein by reference in its entirety.

[0161] In some embodiments, the agent may be an inhibitor of the NF-κB pathway. Small molecule autophagy inhibitors include IKK and IκB phosphorylation inhibitors, IκB degradation inhibitors, proteasome and protease inhibitors, IκBα upregulation, NF-κB nuclear translocation, and NF-κB expression inhibitors, NF-κB DNA binding inhibitors, NF-κB transcription activation inhibitors, antioxidants, or upstream target inhibitors. A list of NF-κB inhibitors can be found in Gilmore, T., Herscovitch, M. "Inhibitors of NF-κB signaling: 785 and counting," Oncogene 25, 6887-6899 (2006), which is incorporated herein by reference in its entirety.

[0162] Agents useful in the methods disclosed herein can be obtained from any available source, including systematic libraries of natural and / or synthetic compounds. Agents can also be obtained by any of a number of approaches to combinatorial library technology known in the art, including biological libraries; peptoid libraries (libraries of molecules with peptide functionality but with novel non-peptide backbones that are resistant to enzymatic degradation and yet retain biological activity; see, e.g., Zuckermann et al., 1994, J. Med. Chem. 37:2678-85); spatially addressable parallel solid-phase or solution-phase libraries; synthetic library methods requiring deconvolution; "one bead, one compound" library methods; and synthetic library methods using affinity chromatography selection. While the biological library and peptoid library approaches are limited to peptide libraries, the other four approaches can be applied to peptide, non-peptide oligomer, or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12:145).

[0163] Examples of methods for the synthesis of molecular libraries are described in the art, for example, in DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061 and Gallop et al. (1994) J. Med. Chem. 37:1233.

[0164] Drug libraries have been developed in solution (e.g., Houghten, 1992, Biotechniques 13:412-421), on beads (Lam, 1991, Nature 354:82-84), on chips (Fodor, 1993, Nature 364:555-556), on bacteria and / or spores (Ladner, USP 5,223,409), on plasmids (Cull et al., 1992, Proc Natl Acad Sci USA 89:1865-1869), or on phages (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al. al, 1990, Proc. Natl. Acad. Sci. 87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301-310; Ladner, supra.

[0165] Agents useful in the methods disclosed herein can be identified, for example, using assays to screen candidate or test agents, e.g., agents that decrease the activity or expression of a product of an autophagy gene (e.g., an autophagy gene disclosed herein) or an NF-κB gene (e.g., an NF-κB gene disclosed herein).

[0166] Drug delivery The nucleic acid and protein agents disclosed herein (e.g., CRISPR / Cas agents, TALEN agents, ZFN agents, interfering nucleic acid agents) can be introduced into cells (e.g., cancer cells) by any available means. "Introducing" includes presenting a nucleic acid or protein to a cell in a manner that allows the sequence to be accessible to the interior of the cell. Introduction can be accomplished by any means, and one or more components (e.g., two components, or all components) can be introduced into a cell simultaneously or sequentially in any combination. Contacting the genome of a cell with a nuclease agent can include introducing into the cell one or more nuclease agents or nucleic acids encoding nuclease agents (e.g., one or more Cas proteins or nucleic acids encoding one or more Cas proteins, and one or more guide RNAs or nucleic acids encoding one or more guide RNAs (i.e., one or more CRISPR RNAs and one or more tracrRNAs)). Contacting the genome of a cell (i.e., contacting the cell) can include introducing into the cell only one, more than one, or all of the above components.

[0167] In some embodiments, suitable delivery methods for nucleic acid and protein drugs provided herein include, but are not limited to, electroporation, iTOP, lipid nanoparticles, polymer nanoparticles, CPP delivery, DNA nanostructures, or gold nanoparticles.

[0168] Suitable delivery methods for the nucleic acid agents disclosed herein (e.g., plasmid-based gRNA-Cas, Ca9 mRNA, sgRNA, interfering nucleic acid agents) include, but are not limited to, electroporation, hydrodynamic injection, microinjection, mechanical cell deformation, lipid nanoparticles, AAV, or lentivirus.

[0169] The nuclease agent can be introduced into cells in the form of a protein or in the form of a nucleic acid encoding the nuclease agent, such as RNA (e.g., messenger RNA (mRNA)) or DNA. When introduced in the form of DNA, the DNA can be operably linked to a promoter active in the cell. Such DNA can be present in one or more expression constructs.

[0170] For example, a Cas protein can be introduced into a cell in the form of a protein, e.g., a Cas protein complexed with a gRNA, or in the form of a nucleic acid encoding the Cas protein, e.g., RNA (e.g., messenger RNA (mRNA)) or DNA. A guide RNA can be introduced into a cell in the form of RNA or in the form of DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the Cas protein and / or guide RNA can be operably linked to a promoter active in the cell. Such DNA can be present in one or more expression constructs. For example, such an expression construct can be components of a single nucleic acid molecule. Alternatively, they can be separated in any combination among two or more nucleic acid molecules (i.e., DNA encoding one or more CRISPR RNAs, DNA encoding one or more tracrRNAs, and DNA encoding the Cas protein can be components of separate nucleic acid molecules).

[0171] The disclosure herein also provides pharmaceutical compositions comprising one or a cocktail of gRNA molecules that target autophagy or NF-kB gene expression and a pharmaceutically acceptable carrier. For example, the present invention provides pharmaceutical compositions comprising one, two, three, or more gRNA molecules, each of which targets autophagy or NF-kB genes.

[0172] The agents provided herein may include gRNAs encapsulated within lipid particles. For formulations containing a cocktail of gRNAs encapsulated within lipid particles, different gRNA molecules may be co-encapsulated within the same lipid particle, or each gRNA species present in the cocktail may be encapsulated in a separate particle, or some gRNA species may be co-encapsulated within the same particle, while other gRNA species are encapsulated in different particles within the formulation. In certain embodiments, the lipid particles contain both gRNAs and mRNAs encoding Cas proteins. In certain embodiments, one population of lipid particles contains gRNAs, and another population of lipid particles contains Cas protein(s) or mRNAs encoding Cas protein(s), and these lipid particles may be of the same or different compositions and may be administered simultaneously or sequentially.

[0173] In some embodiments, lipid particles are formed from cationic lipids, non-cationic lipids, and optionally conjugated lipids that prevent particle aggregation. Lipid particles containing nucleic acid molecules (e.g., gRNA molecules) are referred to as nucleic acid-lipid particles. The nucleic acid may be fully encapsulated within the lipid particle, thereby protecting the nucleic acid from enzymatic degradation. In some embodiments, nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 5:1 to about 15:1. In certain embodiments, nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1, or any subrange or range thereof. In certain embodiments, the nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug ratio of 8.5:1 to 10:1, or 8.9:1 to 10:1, or 9:1 to 9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1). Administration of the nucleic acid-lipid particles can be by any route known in the art, such as oral, intranasal, intravenous, intraperitoneal, intramuscular, intraarticular, intralesional, intratracheal, subcutaneous, or intradermal. In certain embodiments, the nucleic acid-lipid particles are administered systemically, for example, via enteral or parenteral administration routes. The nucleic acid can be complexed with a condensing agent and encapsulated within the lipid particles as described in PCT Publication No. WO 00 / 03683, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0174] The lipid particles provided herein can have an average diameter of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, up to about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Patent Publication Nos. 20040142025 and 20070042031, the disclosures of which are incorporated herein by reference in their entireties for all purposes.

[0175] Nucleic acid-lipid particles can contain lipid conjugates.Such lipid conjugates include, but are not limited to, PEG-lipid conjugates such as dialkyloxypropyl-coupled PEG (for example, PEG-DAA conjugates), diacylglycerol-coupled PEG (for example, PEG-DAG conjugates), cholesterol-coupled PEG, phosphatidylethanolamine-coupled PEG, and ceramide-coupled PEG (see, for example, U.S. Patent No. 5,885,613), cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates (for example, POZ-DAA conjugates), polyamide oligomers (for example, ATTA-lipid conjugates), and mixtures thereof.More examples of POZ-lipid conjugates are described in PCT Publication No. WO2010 / 006282.PEG or POZ can be directly conjugated to lipid, or can be linked to lipid via a linker moiety. For example, any linker moiety suitable for coupling PEG or POZ to a lipid can be used, including non-ester-containing linker moieties and ester-containing linker moieties. In certain embodiments, non-ester-containing linker moieties, such as amides or carbamates, are used.

[0176] In some embodiments, the lipid conjugate in the nucleic acid-lipid particle inhibits particle aggregation and may, for example, comprise one or more of the lipid conjugates described herein. In one particular embodiment, the lipid conjugate comprises a PEG-lipid conjugate. Examples of PEG-lipid conjugates include, but are not limited to, PEG-DAG conjugates, PEG-DAA conjugates, and mixtures thereof. In certain embodiments, the PEG-lipid conjugate is selected from PEG-diacylglycerol (PEG-DAG) conjugates, PEG-dialkyloxypropyl (PEG-DAA) conjugates, PEG-phospholipid conjugates, PEG-ceramide (PEG-Cer) conjugates, and mixtures thereof. In certain embodiments, the PEG-lipid conjugate is a PEG-DAA conjugate. In certain embodiments, the PEG-DAA conjugate in the lipid particle may comprise a PEG-didecyloxypropyl (C10) conjugate, a PEG-dilauryloxypropyl (C12) conjugate, a PEG-dimyristyloxypropyl (C14) conjugate, a PEG-dipalmityloxypropyl (C16) conjugate, a PEG-distearyloxypropyl (C18) conjugate, or a mixture thereof. In certain embodiments, the PEG-DAA conjugate is a PEG-dimyristyloxypropyl (C14) conjugate. In another embodiment, the PEG-DAA conjugate is compound (66) (PEG-C-DMA) conjugate. In another embodiment, the lipid conjugate comprises a POZ-lipid conjugate, such as a POZ-DAA conjugate.

[0177] In certain embodiments, the conjugated lipid that inhibits particle aggregation comprises from about 0.5 mol % to about 3 mol % of the total lipid present in the particle.

[0178] Additional embodiments of useful formulations are described in published U.S. Patent Application Publication Nos. 2011 / 0076335A1 and 2018 / 0245074A1, the disclosures of which are incorporated herein by reference in their entireties for all purposes.

[0179] In certain embodiments, a nucleic acid agent provided herein (e.g., DNA encoding a Cas protein and / or encoding a gRNA) is delivered by a vector (e.g., a viral vector / virus or a plasmid).

[0180] The vector can include sequences encoding a Cas protein and / or gRNA molecule, and / or a donor template with high homology to the targeted region (e.g., target sequence). In certain embodiments, the donor template includes all or a portion of the target sequence. Exemplary donor templates are repair templates, e.g., gene correction templates, or gene mutation templates, e.g., point mutation (e.g., single nucleotide (nt) substitution) templates. The vector can also include sequences encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, or mitochondrial localization), e.g., fused to the Cas molecule sequence. For example, the vector can include a nuclear localization sequence (e.g., from SV40) fused to the Cas molecule-encoding sequence.

[0181] One or more regulatory / control elements, such as a promoter, enhancer, intron, polyadenylation signal, Kozak consensus sequence, internal ribosome entry site (IRES), 2A sequence, and splice acceptor or donor, can be included in the vector. In certain embodiments, the promoter is recognized by RNA polymerase II. In other embodiments, the promoter is recognized by RNA polymerase III (e.g., the U6 promoter). In certain embodiments, the promoter is a regulatable promoter (e.g., an inducible promoter). In certain embodiments, the promoter is a constitutive promoter. In certain embodiments, the promoter is a tissue-specific promoter. In certain embodiments, the promoter is a viral promoter. In certain embodiments, the promoter is a non-viral promoter.

[0182] In certain embodiments, the vector or delivery vehicle is a viral vector (e.g., for generating recombinant viruses). In certain embodiments, the virus is a DNA virus (e.g., a dsDNA or ssDNA virus). In certain embodiments, the virus is an RNA virus (e.g., an ssRNA virus). In certain embodiments, the virus infects dividing cells. In other embodiments, the virus infects non-dividing cells. Exemplary viral vectors / viruses include, for example, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses.

[0183] In certain embodiments, the virus infects dividing cells. In other embodiments, the virus infects non-dividing cells. In certain embodiments, the virus infects both dividing and non-dividing cells. In certain embodiments, the virus can integrate into the host genome. In certain embodiments, the virus is engineered to be immunocompromised, for example, in humans. In certain embodiments, the virus is replication competent. In other embodiments, the virus is replication deficient, e.g., it packages one or more coding regions of genes required for additional rounds of virion replication and / or replaced or deleted with other genes. In certain embodiments, the virus provides transient expression of Cas molecule(s) and / or gRNA molecule(s). In other embodiments, the virus provides sustained expression of Cas molecule(s) and / or gRNA molecule(s), e.g., for at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 9 months, 1 year, 2 years, or permanently. The packaging capacity of the virus can vary, for example, from at least about 4 kb to at least about 30 kb, for example, at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb or 50 kb.

[0184] In certain embodiments, viral vectors recognize specific cell types or tissues. For example, viral vectors can be pseudotyped with different / alternative viral envelope glycoproteins; engineered with cell-type-specific receptors (e.g., genetic modification(s) of one or more viral envelope glycoproteins to incorporate targeting ligands such as peptide ligands, single-chain antibodies, or growth factors); and / or engineered to have bispecific molecular bridges that recognize a viral glycoprotein at one end and a site on the target cell surface at the other end (e.g., ligand-receptor, monoclonal antibody, avidin-biotin, and chemical linkages).

[0185] Exemplary viral vectors / viruses include, for example, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses.

[0186] In certain embodiments, the Cas and / or gRNA encoding sequences are delivered by a recombinant retrovirus. In certain embodiments, the retrovirus (e.g., Moloney Murine Leukemia Virus) contains, for example, a reverse transcriptase enzyme that allows integration into the host genome. In certain embodiments, the retrovirus is replication competent.

[0187] In certain embodiments, the retrovirus is replication-deficient, e.g., it packages one of more coding regions for a gene required for an additional round of virion replication and has the other gene replaced or deleted.

[0188] In certain embodiments, the nucleic acid sequences encoding the Cas and / or gRNA (optionally the donor template nucleic acid) are delivered by a recombinant lentivirus, e.g., the lentivirus is replication-deficient, e.g., does not contain one or more genes necessary for viral replication.

[0189] In certain embodiments, nucleic acid sequences encoding Cas and / or gRNA (optionally a donor template nucleic acid) are delivered by recombinant adenovirus.

[0190] In certain embodiments, the adenovirus is engineered to reduce immunity in humans. In certain embodiments, the nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered by recombinant AAV. In certain embodiments, the AAV does not integrate its genome into the genome of a host cell, such as a target cell described herein. In certain embodiments, the AAV can integrate at least a portion of its genome into the genome of a host cell, such as a target cell described herein. In certain embodiments, the AAV is a self-complementary adeno-associated virus (scAAV), for example, an scAAV that packages both strands that anneal together to form double-stranded DNA. AAV serotypes that can be used in the disclosed methods include AAV1, AAV2, modified AAV2 (e.g., modified with Y444F, Y500F, Y730F and / or S662V), AAV3, modified AAV3 (e.g., modified with Y705F, Y73IF and / or T492V), AAV4, AAV5, AAV6, modified AAV6 (e.g., modified with S663V and / or T492V), AAV8, AAV8.2, AAV9, AAVrhlO, and pseudotyped AAVs such as AAV2 / 8, AAV2 / 5 and AAV2 / 6 can also be used in the disclosed methods. In certain embodiments, the AAV capsid that can be used in the methods described herein is a capsid sequence from serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, AAV.rh64R1, or AAV7m8.

[0191] In certain embodiments, the nucleic acid sequences encoding the Cas and / or gRNA (optionally the donor template nucleic acid) are delivered in a re-engineered AAV capsid that has, e.g., about 50% or more, e.g., about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more sequence identity to the capsid sequence from serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, or AAV.rh64R1.

[0192] In certain embodiments, the nucleic acid sequences encoding the Cas and / or gRNA (optionally the donor template nucleic acid) are delivered by a chimeric AAV capsid. Exemplary chimeric AAV capsids include, but are not limited to, AAV9i1, AAV2i8, AAV-DJ, AAV2G9, AAV2i8G9, or AAV8G9.

[0193] In certain embodiments, the AAV is a self-complementary adeno-associated virus (scAAV), eg, an scAAV that packages both strands that anneal together to form double-stranded DNA.

[0194] In certain embodiments, DNA encoding Cas9 and / or gRNA (and optionally a donor template nucleic acid) is delivered by a hybrid virus, e.g., a hybrid of one or more of the viruses described herein. In certain embodiments, the hybrid virus is a hybrid of AAV (e.g., any AAV serotype) with bocavirus, B19 virus, porcine AAV, goose AAV, feline AAV, canine AAV, or MVM. Additional information regarding viral vector delivery of agents is provided in WIPO Publication No. WO2018081504A1, which is incorporated by reference in its entirety.

[0195] In certain embodiments, the delivery vehicle is a non-viral vector. In certain embodiments, the non-viral vector is an inorganic nanoparticle. Exemplary inorganic nanoparticles include, for example, magnetic nanoparticles (e.g., Fe3MnO2) and silica. The outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethyleneimine, polylysine, polyserine) that allows for the attachment (e.g., binding or capture) of a payload.

[0196] In some methods, DNA encoding nuclease agents (e.g., Cas proteins and guide RNAs) can be introduced into cells via DNA minicircles. See, for example, International Patent Publication No. WO2014 / 182700, the entire contents of which are incorporated herein by reference for all purposes. DNA minicircles are supercoiled DNA molecules that do not have a replication origin or antibiotic selection marker and can be used for non-viral gene transfer. Therefore, DNA minicircles are usually smaller in size than plasmid vectors. These DNAs lack bacterial DNA and therefore lack the unmethylated CpG motifs found in bacterial DNA.

[0197] The methods provided herein do not rely on a particular method for introducing a nucleic acid or protein into a cell, only that the nucleic acid or protein gain access to the interior of at least one cell. Methods for introducing nucleic acids and proteins into various cell types are known, including, for example, stable gene transfer methods, transient gene transfer methods, and virus-mediated methods.

[0198] Gene transfer protocols and protocols for introducing nucleic acids or proteins into cells can vary. Non-limiting gene transfer methods include chemical-based gene transfer methods using liposomes, nanoparticles, calcium phosphate (Graham et al. (1973) Virology 52(2):456-67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74(4):1590-4 and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: W.H. Freeman and Company. pp.96-97), dendrimers, or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and phototransfection. Particle-based gene transfer methods include the use of a gene gun or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277-28). Viral methods can also be used for gene transfer.

[0199] Introduction of nucleic acids or proteins into cells can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improved electroporation method that allows nucleic acid substrates to be delivered not only into the cytoplasm but also through the nuclear membrane into the nucleus. Furthermore, the use of nucleofection in the methods disclosed herein typically requires far fewer cells than conventional electroporation (e.g., approximately 2 million cells compared to 7 million cells for conventional electroporation). In one example, nucleofection is performed using the LONZA® NUCLEOFECTOR™ system.

[0200] Introduction of nucleic acids or proteins into cells can also be achieved by microinjection. Microinjection of mRNA is preferably performed in the cytoplasm (e.g., to deliver mRNA directly to the translation machinery), while microinjection of DNA encoding proteins or Cas proteins is preferably performed in the nucleus. Alternatively, microinjection can be performed by injection into both the nucleus and the cytoplasm: a needle can be first introduced into the nucleus, a first amount can be injected, and a second amount can be injected into the cytoplasm while the needle is removed from the cell. When injecting a nuclease agent protein into the cytoplasm, a nuclear localization signal is preferably included in the protein to ensure delivery to the nucleus / pronucleus. Methods for performing microinjection are known. See, for example, Nagy et al. al.(Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022-15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354-9359.

[0201] Other methods for introducing nucleic acids or proteins into cells include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable device delivery. Methods for administering nucleic acids or proteins to a subject to modify cells in vivo are disclosed elsewhere herein.

[0202] Introduction of nucleic acids and proteins into cells can also be achieved by hydrodynamic delivery (HDD). Hydrodynamic delivery has emerged as a method for intracellular DNA delivery in vivo. Gene delivery to parenchymal cells requires the injection of only essential DNA sequences through selected blood vessels, eliminating safety concerns associated with current viral and synthetic vectors. Once injected into the bloodstream, DNA can reach cells of various tissues accessible to blood. Hydrodynamic delivery utilizes the force generated by rapidly injecting a large volume of solution into the incompressible circulating blood to overcome the physical barriers of the endothelium and cell membranes that prevent large, membrane-impermeable compounds from entering parenchymal cells. In addition to DNA delivery, this method is useful for the efficient intracellular delivery of RNA, proteins, and other small molecule compounds in vivo. See, for example, Bonamassa et al. (2011) Pharm. Res. 28(4):694-701, incorporated herein by reference in its entirety for all purposes.

[0203] Other methods for introducing nucleic acid or protein into cells include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable device-mediated delivery.Specific examples include nucleic acid or protein can be introduced into cells in carriers such as poly(lactic acid) (PLA) microspheres, poly(D,L-lactic acid-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, or lipid microtubules.

[0204] In some cases, cells used in the methods and compositions have the DNA construct stably integrated into their genome. In such cases, contacting can include providing a cell that already has the construct stably integrated into its genome. For example, a cell used in the methods disclosed herein can have an existing Cas-encoding gene stably integrated into its genome (i.e., a Cas-operable cell). "Stably integrated" or "stably introduced" or "stably integrated" includes introducing a polynucleotide into a cell such that the nucleotide sequence is integrated into the genome of the cell and can be inherited by its progeny. Any protocol can be used for stable integration of the DNA construct or various components of the targeted genome integration system.

[0205] The DNA-binding protein or nuclease agent may be introduced into cells by any known means. A polypeptide encoding the DNA-binding protein or nuclease agent may be directly introduced into cells. Alternatively, a polynucleotide encoding the DNA-binding protein or nuclease agent may be introduced into cells. When a polynucleotide encoding the DNA-binding protein or nuclease agent is introduced into cells, the DNA-binding protein or nuclease agent can be expressed transiently, conditionally, or constitutively in the cells. For example, the polynucleotide encoding the DNA-binding protein or nuclease agent can be included in an expression cassette and operably linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters are discussed in more detail elsewhere herein. Alternatively, the DNA-binding protein or nuclease agent can be introduced into cells as mRNA encoding the DNA-binding protein or nuclease agent.

[0206] The polynucleotide encoding the DNA-binding protein or nuclease agent can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the polynucleotide encoding the DNA-binding protein or nuclease agent can be present in a targeting vector or in a vector or plasmid separate from the targeting vector containing the insert polynucleotide.

[0207] When a DNA-binding protein or nuclease agent is provided to a cell via the introduction of a polynucleotide encoding the DNA-binding protein or nuclease agent, the polynucleotide encoding the DNA-binding protein or nuclease agent can be modified to substitute codons that are more frequently used in the target cell compared to the native polynucleotide sequence encoding the DNA-binding protein or nuclease agent. For example, the polynucleotide encoding the DNA-binding protein or nuclease agent can be modified to substitute codons that are more frequently used in the target prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other target host cell.

[0208] Treatment method In some embodiments, provided herein are methods of sensitizing cancer cells in a subject to TNF-α-mediated killing by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the cancer cells. In other embodiments, provided herein are methods of increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the cancer cells. In further embodiments, the methods described herein include methods of sensitizing a tumor in a subject to TNF-α-mediated killing or increasing TNF-α-mediated killing of a tumor in a subject by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the tumor.

[0209] Also provided herein are methods of treating cancer in a subject by administering to the subject an agent (e.g., an agent disclosed herein) that inhibits autophagy and / or the NF-κB pathway in the subject's cancer cells, and by an additional cancer therapy. In some embodiments, the additional cancer therapy is cancer immunotherapy. In certain embodiments, the additional therapy is a therapy that induces TNF-α-mediated killing of cancer cells. In some embodiments, the additional therapy is a therapy that induces T cell killing of cancer cells (e.g., cytotoxic T cell killing of cancer cells). In some embodiments, the additional cancer therapy comprises immune checkpoint inhibition, TNF-α administration, T cell immunotherapy (e.g., CAR-T cell immunotherapy), and / or a cancer vaccine.

[0210] Therefore, in certain embodiments, the agent of the present invention can be used alone or can be administered in combination with other therapeutic agents.For example, different therapeutic agents can be administered simultaneously or sequentially in the same formulation or in separate formulations.In certain embodiments, different therapeutic agents can be administered within about 1 hour, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, or about 1 week from each other.Therefore, the subject who receives such treatment can benefit from the combined effect of different therapeutic agents.

[0211] In certain embodiments, compositions are provided, such as pharmaceutical compositions, containing at least one agent described herein together with a pharmaceutically acceptable carrier. In one embodiment, the composition comprises a combination of multiple (e.g., two or more, three or more, four or more, or five or more) agents described herein.

[0212] In some embodiments, the pharmaceutical composition is administered locally or systemically. In some embodiments, the pharmaceutical composition can be administered locally to the tumor or tumor microenvironment present in the subject. In some embodiments, the agent or pharmaceutical composition is administered together with a second cancer therapeutic agent.

[0213] The agents described herein can be administered in combination with any other cancer therapy, including immunotherapy. Additional cancer therapies include immune checkpoint inhibition. In some embodiments, the immune checkpoint inhibitor inhibits immune checkpoint proteins. Immune checkpoint inhibition broadly refers to inhibiting checkpoints that cancer cells can produce to prevent or downregulate immune responses. Examples of immune checkpoint proteins are CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilin, A2aR, and combinations thereof.Immune checkpoint inhibitors include cemiplimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, sintilimab (IBI308), and sparza. Talizumab (PDR001), tislelizumab (BGB-A317), pidilizumab, BCD-100, toripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG404, BCD-100, BI754091, F520, HLX10, HX008, JTX-4014, LZM009, MEDI0680, MGA012, Sym021, TSR-042, PSB205, MGD019, MGD013, AK104, XmAb20717, R O7121661, CX-188, INCB086550, FS118, BCD-135, BGB-A333, CBT-502, CK-301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311, SHR-1316, TG -1501, ZKAB001, INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550, CA-170, CX-072, ADU-1604, AGEN1181, AGEN1884, MK-1308, REGN4 659, XmAb22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, tremelimumab, BMS-986258, BGB-A425, INCAGN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, leratolimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022.

[0214] Additional cancer immunotherapies include adoptive immunotherapy, such as autologous or allogeneic T cell therapy or autologous or allogeneic CAR T cell therapy. Adoptive immunotherapy is a treatment designed to enhance a patient's immune response against tumor or cancer cells. This method involves removing immune cells from an individual, generating effector cells ex vivo, expanding the cells to a clinically relevant number, and reinfusing the cells into the patient. Provided herein are methods comprising co-administering the agents disclosed herein with allogeneic or autologous CTLs expressing a T cell receptor that specifically binds to a peptide (e.g., a cancer peptide or a subject-specific peptide) presented on class I MHC. In some embodiments, the CTLs are derived from a cell bank or from the subject to whom the CTLs are administered. In some embodiments, the MHC is class I MHC. In some embodiments, the class II MHC has an alpha chain polypeptide that is HLA-DMA, HLA-DOA, HLA-DPA, HLA-DQA, or HLA-DRA. In some embodiments, the class II MHC has a β chain polypeptide that is HLA-DMB, HLA-DOB, HLA-DPB, HLA-DQB, or HLA-DRB. In some embodiments, the CTLs are stored in a cell library or bank before being administered to a subject.

[0215] In some embodiments, T cells are contacted with antigen-presenting cells (APCs) that present peptides specific to the target cancer or tumor. In some embodiments, the APCs are B cells, antigen-presenting T cells, dendritic cells, or artificial antigen-presenting cells (e.g., aK562 cells). Dendritic cells used in this process can be prepared by collecting PBMCs from a patient sample and adhering them to plastic. Generally, the monocyte population is allowed to adhere, while all other cells are washed away. The adherent population is then differentiated with IL-4 and GM-CSF to produce monocyte-derived dendritic cells. These cells can be matured by the addition of IL-1β, IL-6, PGE-1, and TNF-α (which upregulates key costimulatory molecules on the surface of dendritic cells) and then transduced with one or more peptides provided herein. In some embodiments, the APCs are artificial antigen-presenting cells, such as aK562 cells. In some embodiments, the artificial antigen-presenting cells are engineered to express CD80, CD83, 41BB-L, and / or CD86. Exemplary artificial antigen-presenting cells, including aK562 cells, are described in U.S. Patent No. 2003 / 0147869, which is incorporated herein by reference. Exemplary methods for producing antigen-presenting cells can be found in International Patent No. WO2013088114, which is incorporated herein in its entirety.

[0216] Another exemplary adoptive immunotherapy protocol involves the administration of autologous tumor-infiltrating lymphocytes (TILs). TIL cells have high killing potential. TIL cells are effector cells differentiated in vivo in solid tumors (see U.S. Pat. No. 5,126,132, which describes a method for generating TIL cells for adoptive immunotherapy of cancer). TIL cells can be produced, for example, by collecting a tumor sample from a patient, isolating lymphocytes that infiltrated the tumor sample, expanding these TIL cells ex vivo in the presence of IL-2, and reinfusing the cells together with IL-2 into the patient.

[0217] An additional cancer treatment may be CAR-T cell therapy. Chimeric antigen receptors (CARs) are molecules that combine antibody-based specificity for tumor-associated surface antigens with a T cell receptor activation intracellular domain that possesses specific antitumor cell immune activity (Eshhar, 1997, Cancer Immunol Immunother 45(3-4)131-136; Eshhar et al., 1993, Proc Natl Acad Sci USA 90(2):720-724; Brocker and Karjalainen, 1998, Adv Immunol 68:257-269). These CARs enable T cells to achieve MHC-independent primary activation via a single-chain Fv (scFv) antigen-specific extracellular domain fused to an intracellular domain that provides T cell activation and costimulatory signals. Second- and third-generation CARs also provide appropriate costimulatory signals via CD28 and / or CD137 (4-1BB) intracellular activation motifs, enhancing cytokine secretion and antitumor activity in various solid tumor and leukemia models (Pinthus, et al., 2004, J Clin Invest 114(12):1774-1781; Milone, et al., 2009, Mol Ther 17(8):1453-1464; Sadelain, et al., 2009, Curr Opin Immunol 21(2):215-223). Chimeric antigen receptor (CAR) T-cell therapy involves genetically modifying a patient's autologous T cells to express a CAR specific for a tumor antigen, followed by ex vivo expansion and reinfusion of the cells into the patient. CARs are fusion proteins of selected single-chain fragments variable from a specific monoclonal antibody with one or more T-cell receptor intracellular signaling domains. This genetic modification of T cells can occur via either viral-based gene transfer methods or non-viral methods, such as direct introduction of DNA-based transposons, CRISPR / Cas9 technology, or in vitro-transcribed mRNA via electroporation.

[0218] Also provided herein are methods for treating cancer in a subject by obtaining a sample containing T cells from the subject, isolating cytotoxic T lymphocytes (CTLs) from the sample, expanding the CTLs ex vivo, and administering the expanded CTLs to the subject in combination with at least one agent (e.g., any agent disclosed herein). The cytotoxic T cells may be tumor-infiltrating lymphocytes. Expanding the CTLs may include contacting the CTLs with antigen-presenting cells (APCs) expressing a cancer-specific or tumor-specific antigen to generate antigen-specific CTLs. In some embodiments, the sample containing the T cells or isolated CTLs is stimulated before administration to the subject. The method may further include contacting the CTLs with an anti-CD3 monoclonal antibody (OKT3) before administration to the subject. In other embodiments, the method further includes contacting the CTLs with human interleukin (IL)-2 before administration to the subject.

[0219] In some embodiments, the subject has been administered a chemotherapy agent prior to administration of the agent. The subject may be resistant to the chemotherapy agent. The subject may be administered the chemotherapy agent subsequent to or concurrently with administration of the additional cancer therapeutic agent disclosed herein. Chemotherapeutic agents include alkylating agents (e.g., thiotepa and cyclophosphamide (Cytoxan™)), alkylsulfonates (e.g., busulfan, improsulfan, and piposulfan), aziridines (e.g., benzodopa, carboquone, meturedopa, and uredopa), emylermine and memilamelamine (including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphaolamide, and trimerolomelamine), acetogenins (particularly bullatacin and blatacinone), camptothecin (including the synthetic analog topotecan), bryostatin, kallistatin, CC-1065 (including its synthetic analogs adozelesin, carzelesin, and biceresin), cryptophycin (artificial cryptophycin 1 and cryptophycin 8), dolastatin, duocarmycin (including synthetic analogs KW-2189 and CBI-TMI), eleutherobin, pancratistatin, sarcodictyin, spongistatin, nitrogen mustards (e.g., chlorambucil, chlornaphazine, colofosfamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nobuenbiquinone, fenesterine, prednimustine, trofosfamide, uracil, mustard), nitrosoureas (e.g., carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine), antibiotics such as enediyne antibiotics (e.g., calicheamicin, particularly calicheamicin gamma 1 and affinity calicheamicin), dynemycins (including dynemycin A), bisphosphonates (e.g., clodronate), esperamicin, and neocarzinostatin chromophore and related chromoprotein enediyne antibacterial chromophores, aclacinomycin, actinomycin, ausramycin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin,6-diazo-5-oxo-L-norleucine, doxorubicin (Adramycin™) (including morpholinodoxorubicin, cyanomorpholinodoxorubicin, 2-pyrrolinodoxorubicin, and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycin, peplomycin, potfilomycin, puromycin, queramycin, rhodrubicin, streptonigrin, streptozocin, tubercidin, ube Nimex, zinostatin, zorubicin, antimetabolites (e.g., methotrexate and 5-fluorouracil (5-FU)), folic acid analogs (e.g., demopterin, methotrexate, pteropterin, trimetrexate), purine analogs (e.g., fludarabine, 6-mercaptopurine, thiamiprine, thioguanine), pyrimidine analogs (e.g., ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine), androgens (e.g., calsterone, progesterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone), antiadrenal agents (e.g., aminoglutethimide, mitotane, trilostane), folic acid supplements (e.g., folinic acid), aceglatone, aldophosphamide glycoside, aminolevulinic acid, eniluracil, amsacrine, hestravcil, bisantrene, edatraxate, defofamine, demecolcine, diaziquone, elformitin, elliptinium acetate, epothilone, etoglucide, gallium nitrate, hydroxyurea, lentinan, lonidamine, maytansinoid antihistamines (e.g., maytansine and ansamitocin), mitoguazone, mitoxantrone, mopidamol, nitracrine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyllic acid, 2-ethylhydrazide, procarbazine, PSK™, razoxane, rhizoxin, sizofiran, spirogermanium, tenuazonic acid, triazicon, 2,2',2"-triquorotriemylamine, trichothecenes (especially T-2 toxin, veracrine A, roridin A, and anguidine), urethane, vindesine, dacarbazine, mannomustine,Mitobronitrile, mitolactol, pipobroman, gacil arabinoside ("Ara-C"), cyclophosphamide, thiophene, taxoids (e.g., paclitaxel (Taxol®, Bristol Meyers Squibb Oncology, Princeton, NJ) and docetaxel (Taxoteret™, Rhone-Poulenc Rorer, Antony, France), chlorambucil, gemcitabine (Gemzar™), 6-thioguanine, mercaptopurine, methotrexate, platinum analogs (e.g., cisplatin and carboplatin), vinblastine, platinum, etoposide (VP-16), ifosfamide, mitoxantrone, vincristine, vinorelbine (Navelbine™), novantrone, teniposide, edatrexate, daunomycin, aminopterin, xeoroda, ibandronate, CPT-11, the topoisomerase inhibitor RFS2000, difluoromethylornithine (DMFO), retinoin (e.g., retinoic acid), capecitabine, and pharmaceutically acceptable salts, acids, or derivatives of any of the above. antihormonal agents that act to regulate or inhibit hormone action on tumors (e.g., antiestrogens and selective estrogen receptor modulators (SERMs) including tamoxifen (including NOLVADEX™), raloxifene, droloxifene, 4-droxytamoxifen, trioxifene, ketoxifene, LY117018, onapristone, and toremifene (Fareston™)); aromatase inhibitors, an enzyme that regulates estrogen production in the adrenal gland (e.g., 4(5) Also included within the definition of "chemotherapeutic agent" are benzodiazepines, benzodiazepines, benzocaine, benzodiazepines (BPA), benzodiazepines (BPA), benzocaine, ...

[0220] As described in detail below, the pharmaceutical compositions and / or medicaments disclosed herein can be specially formulated for administration in solid or liquid form, including (1) oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those intended for oral mucosal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue, or (2) parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, intrathecal, intracerebral, or epidural injection, e.g., those adapted for sterile solutions or suspensions, or sustained-release formulations. Methods of preparing pharmaceutical formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients. Generally, the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0221] efficacy In some embodiments, the methods described herein can be used to treat any cancer, including any cancerous or precancerous tumor. Cancers that can be treated by the methods and compositions provided herein include, but are not limited to, bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal, gingival, head, kidney, liver, lung, nasopharynx, neck, ovarian, prostate, skin, stomach, testicle, tongue, or uterine cancer. Furthermore, the cancer can be specifically of the following histological types, but is not limited to: malignant neoplasms; cell carcinoma; undifferentiated cell carcinoma; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; fibroadenocarcinoma; adenoid cystic carcinoma; adenocarcinoma of adenomatous polyps; familial polyposis coli adenocarcinoma; solid tumors; malignant carcinoid tumors; Bronchoalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; Adenocarcinoma; auditory canal adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; squamous cell carcinoma Live adenocarcinoma; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant neuroblastoma; Sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipocytoma; malignant paraganglioma; malignant extramammary paraganglioma; pheochromocytoma; hemangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma of giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; fetal Rhabdomyosarcoma; Alveolar rhabdomyosarcoma; Stromal sarcoma; Malignant mixed tumor; Müllerian mixed tumor; Nephroblastoma; Hepatoblastoma; Carcinosarcoma; Malignant mesenchymoma; Malignant Brenner tumor; Malignant phyllodes tumor; Synovial sarcoma; Malignant mesothelioma; Dysgerminoma; Embryonic carcinoma; Malignant teratoma; Malignant ovarian goiter; Choriocarcinoma; Malignant mesonephroma; Angiosarcoma; Malignant hemangioendothelioma; Kaposi's sarcoma; Malignant hemangiopericytoma; Lymphangiosarcoma; Osteosarcoma; Parosteal osteosarcoma; Chondrosarcoma; Malignant chondroblastoma; Mesenchymal chondrosarcoma; Giant cell tumor of bone; Ewing's sarcoma;Malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma; primitive neuroectodermal tumor; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease ;Hodgkin's lymphoma;lateral granuloma;small lymphocytic lymphoma;diffuse large cell lymphoma;follicular lymphoma;mycosis fungoides;other specified non-Hodgkin's lymphoma;malignant histiocytosis;multiple myeloma;mast cell sarcoma;immunoproliferative small intestinal disease;leukemia;lymphocytic leukemia;plasma cell leukemia;erythroleukemia;lymphocytic leukemia;myeloid leukemia;basophilic leukemia;eosinophilic leukemia;monocytic leukemia;mast cell leukemia;megakaryoblastic leukemia;myeloid sarcoma;and hairy cell leukemia.;

[0222] In some embodiments, the cancer comprises a solid tumor. In some embodiments, the tumor is an adenocarcinoma, an adrenal tumor, anal tumor, bile duct tumor, bladder tumor, bone tumor, blood-borne tumor, brain / CNS tumor, breast tumor, cervical tumor, colorectal tumor, endometrial tumor, esophageal tumor, Ewing's tumor, eye tumor, gallbladder tumor, gastrointestinal tumor, kidney tumor, laryngeal or hypopharyngeal tumor, liver tumor, lung tumor, mesothelioma, multiple myeloma, muscle tumor, nasopharyngeal tumor, neuroblastoma, oral cavity tumor, osteosarcoma, ovarian tumor, pancreatic tumor, penile tumor, pituitary tumor, primary tumor, prostate tumor, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, soft tissue sarcoma, melanoma, metastatic tumor, basal cell carcinoma, Merkel cell tumor, testicular tumor, thymus tumor, thyroid tumor, uterine tumor, vaginal tumor, vulvar tumor, or Wilms' tumor.

[0223] In certain embodiments, the cancer is selected from colon cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, or cervical cancer.

[0224] Additional methods In certain embodiments, provided herein is a method of determining whether an agent (e.g., a test agent) is an anti-cancer therapeutic agent, comprising determining whether the test agent inhibits the expression or activity of a product of at least one autophagy gene or NF-κB gene (e.g., a gene listed in Table 1 or Table 2), wherein the test agent is determined to be an anti-cancer therapeutic agent if it inhibits the expression or activity of a product of at least one autophagy gene or NF-κB gene (e.g., a gene listed in Table 1 or Table 2). Also provided herein is a method of determining whether a guide RNA test agent is an anti-cancer therapeutic agent, comprising determining whether the guide RNA test agent is effective in inducing a Cas enzyme to cleave or bind to a sequence in an autophagy gene or NF-κB gene (e.g., a gene listed in Table 1 or Table 2), wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in the autophagy gene or NF-κB gene, and wherein the test agent is effective in inducing the Cas enzyme to cleave or bind to a sequence in the gene, wherein the test agent is an anti-cancer therapeutic agent. A test agent disclosed herein may reduce expression of the product of at least one gene disclosed herein by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the cell population.

[0225] In some embodiments, the test agent is a member of a library of test agents.The test agent can be any agent disclosed herein, including gRNA, TALEN or zinc finger endonuclease, interfering nucleic acid or small molecule.The test agent disclosed herein can inhibit the expression or activity of at least one autophagy gene or NF-κB gene product by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. A test agent disclosed herein may inhibit the expression or activity of a product of at least one gene in Table 1 or Table 2 by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0226] Also provided herein are methods for determining whether a patient is a candidate for the cancer treatments provided herein. In some embodiments, expression of the products of the genes listed in Table 1 or Table 2 by cells in the subject's tumor indicates that the subject is a candidate for the treatment. In some embodiments, the gene products are mRNA products. In some embodiments, the gene products are protein products. Protein products can be detected by IHC or flow cytometry (e.g., FACS) using antibodies specific for the protein products. Gene products (e.g., mRNA products) can be detected by nucleic acid amplification, nucleic acid probes, or sequencing.

[0227] In some embodiments, provided herein are methods for targeting and killing cancer or tumor cells by first measuring the expression level of at least one autophagy or NF-κB gene (e.g., at least one gene listed in Table 1 or Table 2), and if the expression level exceeds a determined threshold, administering an agent(s) disclosed herein targets and kills the cancer or tumor cells. The threshold for a gene (e.g., a gene in Table 1 or Table 2) can be determined by a number of techniques, including, but not limited to, determining the expression of the gene or gene product in diseased tissue (e.g., tumor or cancerous tissue) versus healthy tissue (e.g., tissue not associated with a tumor or cancer). The threshold for a gene (e.g., a gene in Table 1 or Table 2) can be determined by comparing the expression of the gene product in cancer cells or tumors at one time point with a later time point. The healthy and diseased tissues can be obtained from the subject or from different individuals. In other embodiments, the expression threshold for a gene or gene product is determined by testing the expression of the gene or gene product in tissue from a tissue bank or third-party source. For example, if tumor or cancer cells from diseased tissue from the subject or a third party show higher expression of the gene product, the subject is a candidate for treatment. If tumor or cancer cells from a later time point show higher expression of the gene product, the subject is a candidate for treatment. [Example]

[0228] Immune checkpoint inhibitors have revolutionized cancer therapy, but the molecular determinants of tumor cell susceptibility to T cell-mediated killing remain incompletely understood. Herein, we describe a genome-wide CRISPR knockout screen to identify tumor cell genes and pathways that regulate T cell-mediated killing. The screen identified tumor cell antigen presentation and TNFα signaling as requirements for killing, and conversely, NF-κB signaling and autophagy as key protective mechanisms. Knockout of individual autophagy genes or pharmacological inhibition of autophagy sensitized tumor cells of various lineages to killing by T cells and / or TNFα. Conversely, inhibition of mTOR signaling, which leads to increased autophagy activity, protected tumor cells from T cell killing. Mechanistically, enhanced T cell / TNFα-mediated killing in the setting of impaired autophagy was associated with increased caspase-8 activation rather than defective NF-κB signaling, suggesting a role for autophagy at a relatively early stage in the TNFα signaling pathway. Finally, genetic inactivation of tumor cell autophagy enhances the efficacy of T cell checkpoint inhibitors in tumor models, suggesting that autophagy is a key regulator of antitumor immunity. These findings suggest that targeting protective NF-κB or autophagy pathways may sensitize tumors to T cell-directed immunotherapy.

[0229] To systematically uncover genes and pathways that regulate tumor cell susceptibility to T cell killing, multiple groups have utilized pooled CRISPR / Cas9 screens. These screens confirmed the critical roles of antigen presentation and IFNγ signaling in tumor cell killing. Furthermore, these screens identified novel regulators of killing, such as the tyrosine phosphatase Ptpn2, the apelin receptor APLNR, Pbrm1, and the SWI / SNF chromatin remodeling complex. Interestingly, some of these screens also suggested a critical role for tumor cell TNFα or TRAIL signaling in the T cell killing process. While successful, in most cases, these screens identified tumor cell genes required for T cell killing (i.e., single guide RNAs (sgRNAs) enriched in surviving tumor cells).

[0230] A pooled genome-wide CRISPR / Cas9 knockout (KO) screen performed under carefully optimized conditions enabled the efficient identification of tumor cell genes that limit T cell killing. In addition to demonstrating the critical role of TNFα / NF-κB signaling in regulating T cell-mediated tumor cell killing, the results reveal a previously unrecognized role for autophagy in protecting tumor cells from T cell-induced apoptosis. Herein, we show that autophagy limits TNFα-dependent caspase 8 activation without modulating NF-κB pathway activity, and genetic inhibition of autophagy sensitizes tumors to T cell checkpoint inhibitors. Thus, the autophagy pathway appears to be a critical regulator of immunotherapy responses, suggesting that inhibition of this pathway may enhance the efficacy of T cell-directed therapies.

[0231] Identification of tumor cell genes that regulate susceptibility to T cell killing To identify genes that regulate tumor cell susceptibility to killing by cytotoxic T cells, we performed a genome-wide CRISPR / Cas9 screen of MC38 colon adenocarcinoma cells. Tumor cells transduced with a mouse single-guide RNA (sgRNA) KO library were intermittently administered with an MHC class I-restricted Ova peptide or a scrambled control peptide, and then expressed activated CD8 T cells isolated from OT-1 transgenic mice (expressing a T cell receptor that recognizes the Ova peptide). + The tumor cells were incubated with T cells (Figure 1A). B2m KO cells (protected from T cell killing) were used as a positive control to optimize and validate the screening conditions. The goal was to achieve approximately 90% tumor cell killing in the screen (Figure 9). After 24 hours of exposure to T cells, surviving tumor cells were harvested and sgRNA expression in tumor cells treated with intermittent Ova versus control tumor cells was assessed by NGS. Due to the high initial representation of the library (approximately 2000x coverage), sgRNA representation was maintained in tumor cells even after killing, allowing efficient detection of depleted and enriched sgRNAs (R). 2 = 0.95, Ova vs. control peptide intermittently administered cells) (Table 3, Figure 10). To identify genes that regulate tumor cell proliferation / survival independently of T cell killing, a parallel screen was performed using library-modified tumor cells passaged for 12 population doublings without the addition of T cells. A significant proportion of sgRNAs targeting known core essential genes were depleted in this parallel growth screen, while the representation of non-targeting sgRNAs remained largely unchanged (Figure 11), confirming the efficacy and specificity of CRISPR / Cas9-mediated gene modification in MC38 cells.

[0232] Analysis of enriched sgRNAs identified antigen presentation and TNFα-induced apoptotic signaling as critical pathways required for T cell-mediated tumor cell killing (Figure 1B). As expected, multiple sgRNAs targeting B2m and the MHC class I molecule H2-K1 were significantly enriched, confirming that T cell killing is dependent on cell surface presentation of the Ova peptide. The recovery of all six sgRNAs targeting H2-K1 and B2m further highlights the efficacy of CRISPR / Cas9-mediated genetic modification of cells. Interestingly, multiple sgRNAs targeting Tnfrsf1a (TNF receptor 1, TNFR1), caspase-8 (required for TNFα-induced apoptosis), and Tradd (a key adaptor molecule in the TNFα signaling pathway) were also enriched (Figure 1B and C), suggesting that T cell-derived TNFα plays an important role in tumor cell killing. Finally, sgRNAs targeting several genes in the mTOR signaling pathway were enriched (e.g., Mtor, Mlst8, Rictor, Mapkap1, Tti2, Telo2, Tti1). As shown below, inactivation of mTOR signaling protects tumor cells from T cell killing by increasing autophagy activity.

[0233] Analysis of depleted sgRNAs identified NF-κB signaling and autophagy as two key pathways limiting tumor cell killing by T cells. Multiple sgRNAs targeting genes involved in NF-κB signaling, including members of LUBAC (Sharpin, Rbck1, and Rnf31), TAK1 (Map3k7 / Tak1, Tab1, and Tab2), and the Nemo complex (Chuk, Ikbkb, and Ikbkg), were significantly depleted. Furthermore, sgRNAs targeting additional NF-κB pathway or NF-κB target genes (Traf2, Tbk1, Mapkapk2, Rela, Cflar, and Tnfaip3) were also depleted (Figure 1D and E). These findings are consistent with a critical role for TNFα in T cell-mediated killing, as the NF-κB pathway has a well-established role in limiting TNFα-dependent apoptosis through the transcriptional induction of survival genes such as Cflar (c-Flip).

[0234] Interestingly, multiple sgRNAs targeting genes in the autophagy pathway (Rb1cc1, Pik3c3, Nrbf2, Atg13, Atg14), membrane material trafficking (Atg9a, Atg2a, Tax1bp1), or autophagosome proliferation (Atg5, Atg12, Atg10) were significantly depleted (Figure 1F and G). These data indicate that autophagic activity in tumor cells plays a protective role in relation to T cell killing. Although autophagy is known to limit cell death in other environments (e.g., nutrient deprivation), this is the first to demonstrate a critical role for autophagy in T cell-induced tumor cell apoptosis. Importantly, sgRNAs targeting NF-κB pathway genes or autophagy genes were not depleted in parallel cell proliferation screens, and follow-up experiments confirmed that KO of autophagy genes in MC38 cells does not impair cell proliferation (Figure ​(Figure12),12), indicating that KO of these genes reduces cell fitness, particularly in T cell-mediated killing. Because mTOR signaling has an established role in inhibiting autophagy, a protective role for autophagy is consistent with the observation that sgRNAs targeting multiple genes in the mTOR pathway were enriched in our screens (Figure 1B).

[0235] TNFα-induced apoptotic signaling plays an important role in tumor cell killing by T cells. CRISPR screening demonstrated a critical role for T cell-derived TNFα in tumor cell killing. Cytotoxic T cell killing is thought to result primarily from the release of perforin and granzymes from T cell granules, but a role for TNFα (and other death receptor ligands) in this process has previously been proposed. While TNFα can promote cell death by either apoptosis (caspase-8-dependent) or necroptosis, several molecular checkpoints (including NF-κB activation) function to inhibit TNFα-induced cell death. Therefore, the default response of most cells to TNFα is thought to be the induction of pro-survival and pro-inflammatory genes. See Figure 2A for a simplified model of TNFα / NF-κB signaling.

[0236] As shown in Figure 2B, adding a TNFα-blocking antibody to the T cell killing assay significantly reduced MC38 cell death (CRISPR / Cas9-mediated inactivation of B2m), confirming the role of TNFα signaling. It is important to note that the effect of TNFα blockade on tumor cell killing in the assay (using pre-activated T cells) is not due to inhibition of T cell function, as TNFα blockade does not limit killing of TNFα-insensitive tumor cells (Figure 13). Consistent with a significant contribution of TNFα to T cell killing of MC38 cells, soluble TNFα promoted MC38 cell death via an apoptotic mechanism (i.e., killing was blocked by the caspase inhibitor z-VAD-FMK) (Figure 2C). Furthermore, generation of KO cell lines using CRISPR / Cas9 confirmed that TNFα-mediated killing of MC38 cells is completely dependent on TNFR1 and partially dependent on FADD (an adaptor protein important for assembly of the caspase-8 activation complex) and RIPK1 (a kinase that interacts with caspase-8 to promote apoptosis) (Figure 2C).

[0237] The ability of TNFα to induce caspase-8 activation and apoptosis was assessed in a panel of tumor cell lines. While most of these cell lines (CT26, B16F10, and 4T1) were not killed by TNFα, EMT6 cells (along with MC38) exhibited TNFα-induced caspase-8 activation and apoptosis (Figure 2D and E). (See Figure 22 for examples of human cancer cell lines sensitive to TNFα killing.) As mentioned above, NF-κB signaling appears to play an important role in limiting TNFα-dependent apoptosis. However, no clear differences in NF-κB activation were observed between TNFα-sensitive and -resistant cell lines. TNFα-sensitive MC38 and EMT6 cells exhibited efficient degradation of IκBα (which inhibits NF-κB by sequestering it in the cytoplasm) and phosphorylation of the NF-κB subunit p65 / Rela, similar to that observed in TNFα-resistant B16F10 and 4T1 cells (Figure 2F, Figure 14). Furthermore, MC38 cells showed strong TNFα-induced expression of two NF-κB target genes, A20 and ICAM-1 (Figure 2G). Thus, although the NF-κB pathway clearly limits TNFα dependence, susceptibility to TNFα-induced killing can clearly be attributed to factors other than defective NF-κB activation.

[0238] NF-κB signaling limits tumor cell killing by T cells and TNFα. To confirm the screening data demonstrating the role of the NF-κB pathway in limiting T cell-mediated killing of MC38 cells, three key NF-κB pathway genes (Map3k7 / Tak1, Rbck1, and Rela) were inactivated using depleting sgRNAs in the screen. Inactivation of Map3k7 with multiple sgRNAs sensitized MC38 cells to T cell killing, and the degree of Map3k7 protein depletion by different sgRNAs correlated with the degree of sensitization, demonstrating that these effects were as expected (Figure 3A and B). Map3k7 KO significantly inhibited the induction of the NF-κB target genes A20 and ICAM-1 by TNFα, confirming that Map3k7 KO abrogated the NF-κB pathway (Figure 3E). Similar effects on T cell killing were observed upon knockout of Rbck1 (Figure 15) and the NF-κB subunit p65(Rela) (Figure 16), further validating the protective effect of NF-κB signaling.

[0239] Importantly, in the presence of saturating doses of TNFα-blocking antibodies, Map3k7 KO (as well as Rbck1 and Rela KO) no longer enhanced T cell-mediated killing of MC38 cells (Figure 3C, and Figures S15 and S16). This indicates that the protective effect of the NF-κB pathway reflects inhibition of TNFα-mediated apoptosis (rather than perforin / granzyme-mediated killing). Consistent with this hypothesis, Map3k7, Rbck1, and Rela KO significantly increased TNFα-induced caspase-8 activation and cell death (Figures 3D and S16). In contrast to the effect on TNFα-dependent apoptosis, Map3k7 KO (as well as Rbck1 and Rela KO) did not affect killing of MC38 cells by the chemotherapeutic drugs doxorubicin and paclitaxel, indicating that NF-κB did not broadly protect these cells from any apoptosis-inducing stimuli (Figure 3F, Figures S15 and S16).

[0240] Autophagy limits tumor cell killing by T cells and TNFα. To examine the role of autophagy in limiting tumor cell killing by T cells, we inactivated three essential autophagy genes (Rb1cc1, Atg9a, and Atg12) using depleting sgRNAs in our screen. Inactivation of Rb1cc1 (also known as FIP200) with multiple sgRNAs sensitized MC38 cells to T cell killing, and the degree of Rb1cc1 protein depletion correlated with the degree of sensitization, confirming these expected effects (Figure 4A and B). Similar results were observed with knockout of Atg9a (Figure 17) and Atg12 (Figure 18), further validating the protective role of autophagy. Importantly, knockout of these three key autophagy components actually impairs autophagy activity in MC38 cells, as indicated by a significant increase in the levels of the autophagy cargo receptor p62 (also known as sequestosome 1, sqstm1) (Figure 5A, Figures 17 and 18) and a decrease in the levels of LC3-II, the lipidated form of the autophagosomal protein LC3 (Figure 18). p62 levels increase when autophagy is inhibited because it binds ubiquitinated proteins to autophagosomes and is itself degraded by autophagy. LC3-I is converted to LC3-II via conjugation to phosphatidylethanolamine, initiating autophagosome formation and elongation. Therefore, inhibiting autophagy upstream of this conversion inhibits the formation of LC3-II (Deretic, 2008).

[0241] Autophagy has been proposed to inhibit apoptosis by multiple mechanisms, including mitophagy—particularly through permeabilization of the outer membrane and removal of damaged mitochondria, which can trigger the apoptotic cascade. A series of experiments aimed at gaining insight into the mechanisms by which autophagy limits tumor cell killing by T cells were performed. Genetic inactivation of autophagy had little or no effect on cell surface MHC-I expression or presentation of the Ova peptide in MC38 cells (Figure 23).

[0242] As shown in Figure 4C, Rb1cc1 KO had only a minor effect on MC38 cell killing in the presence of a TNFα-blocking antibody, indicating that the protective effect of autophagy on T cell killing is primarily mediated by inhibition of TNFα-dependent apoptosis. Similar results were observed in Atg9a and Atg12 KO cells (Figures 17 and 18). Consistent with these observations, KO of Rb1cc1, Atg9a, or Atg12 significantly increased TNFα-dependent caspase-8 activation and apoptosis (Figure 4D, Figure 5A, and Figures 17 and 18). Thus, autophagy appears to regulate an early step in the TNFα signaling cascade at the level of caspase-8 activation (upstream of any mitochondrial involvement). Consistent with a specific signaling function of autophagy in this setting, KO of autophagy genes did not sensitize MC38 cells to killing by the chemotherapeutic drugs doxorubicin or paclitaxel (Figure 4E, Figures S17 and S18).

[0243] Given that both the NF-κB and autophagy pathways limit tumor cell killing by T cells, we investigated the possible mechanistic connection between these pathways. One possibility is that inactivation of autophagy somehow leads to aberrant NF-κB signaling, thereby sensitizing cells to TNFα-mediated apoptosis. However, knockout of the autophagy gene Rb1cc1 did not affect TNFα-mediated degradation of IκBα, induction of the NF-κB target gene A20, or induction of several chemokines (e.g., CXCL10 and CCL2) that require NF-κB for expression (Figure 5B, Figure 2C). Thus, autophagy does not limit TNFα-mediated apoptosis in MC38 cells as a result of its required role in NF-κB activation. Conversely, levels of the autophagy receptor p62 were not affected by Map3k7 knockout (Figure 5C), suggesting that an intact NF-κB pathway is not required for autophagy activity.

[0244] Next, we investigated the mechanism by which TNFα kills cells when autophagy is inhibited. The observation that inactivation of Rb1cc1 increases TNFα-induced caspase 8 activation suggests that, in situations where the autophagy pathway is impaired, TNFα kills cells through apoptosis rather than necroptosis. Supporting this assertion, a pan-caspase inhibitor blocked TNFα-mediated killing in Rb1cc1 KO cells (Figure 5D), whereas a necroptosis inhibitor had no effect (Figure 5H). Consistent with these observations, TNFα did not induce phosphorylation of mixed kinase domain-like protein (MLKL), a mediator of necroptosis, in Rb1cc1 KO cells (Figure 5I).

[0245] TNFα-induced apoptosis can occur through multiple molecular mechanisms, distinguished by the involvement of the kinase RIPK1. To enable genetic analysis of TNFα signaling in relation to autophagy inhibition, we employed a selective small-molecule inhibitor of the lipid kinase Vps34, which is essential for autophagosome formation. Treatment of MC38 cells with autofinib increased TNFα-mediated caspase-8 activation and killing (and significantly increased p62 levels, confirming autophagy blockade) (Figure 5E and F). Importantly, autofinib did not affect TNFα-mediated IκBα degradation (Figure 5F), indicating that impaired autophagy does not lead to defects in the NF-κB pathway (consistent with the Rb1cc1 KO data described above).

[0246] It is well established that one of the key mechanisms by which cells limit TNFα-induced killing is the inhibition of the apoptotic activity of RIPK1. Among the molecular events that contribute to this "early checkpoint" in the TNFR1 signaling pathway is the ubiquitination of RIPK1 by cIAPs. Thus, inhibition of cIAP function by Smac mimetics promotes FADD / RIPK1 / caspase-8-dependent apoptosis (see model in Figure 2A). Consistent with this model, CRISPR-mediated inactivation of Ripk1, Fadd, or Tnfrsf1a significantly reduced TNFα-induced killing in the presence of Smac mimetics (Figure 5G). However, inactivation of Ripk1, Tnfrsf1a, or Fadd also significantly reduced TNFα-induced killing in the presence of autofluorescence, whereas inactivation of Ripk1 had no effect (Figure 5G). Thus, in cells with impaired autophagy, TNFα-induced apoptosis is FADD / caspase-8-dependent, but not RIPK1-dependent, suggesting that the early checkpoint in the TNFR1 signaling pathway remains functional. Thus, autophagy appears to inhibit TNFα-induced apoptosis by limiting the formation and / or activity of the FADD / caspase-8 complex and not by limiting RIPK1 activity. Inactivation of autophagy did not affect the total protein levels of TNFR1, TRADD (TNFR1-associated death domain protein), or FADD, indicating that enhanced TNFα-induced apoptosis is not simply caused by elevated levels of these key pathway components (Figure 24).

[0247] Given that both the NF-κB and autophagy pathways limit tumor cell killing by T cells, we investigated the possible mechanistic connection between these pathways. One possibility is that inactivation of autophagy leads to aberrant NF-κB signaling, thereby sensitizing cells to TNFα-mediated apoptosis. However, Rb1cc1 knockout did not affect TNFα-mediated degradation of IκBα, induction of the NF-κB target gene A20, or induction of several chemokines (e.g., CXCL10 and CCL2) that require NF-κB for expression (Figure 4G and Figure 2C). Thus, impaired autophagy does not impair NF-κB activation. Conversely, levels of the autophagy receptor p62 were not affected by Map3k7 knockout (Figure 4H), suggesting that an intact NF-κB pathway is not required for autophagy activity.

[0248] TRAIL promotes apoptosis through activation of two TNFRSF family receptors, TRAIL-R1 and TRAIL-R2. To determine whether autophagy can also limit apoptotic signaling downstream of TRAIL-R, cancer cells were challenged with TRAIL in the absence or presence of autofinib. As shown in Figure 21A-C, blocking autophagy increased caspase-8 activation and TRAIL-induced apoptosis in human cancer cells, suggesting that autophagy can limit apoptotic signaling by multiple death receptors (perhaps through the effect on the activity of the FADD / caspase-8 complex, which is essential for the induction of apoptosis by both TNFα and TRAIL). Although autophagy inhibition sensitized MC38 cells to TRAIL, these cells were more effectively killed by TNFα (Figure 21A-F).

[0249] Tumor cell mTOR signaling enhances susceptibility to T cell / TNFα-mediated killing. The screen enriched multiple sgRNAs targeting genes in the mTOR pathway (e.g., Mlst8, Mtor, Rictor, and Mapkap1), suggesting that mTOR signaling is required for efficient tumor cell killing. The mTOR pathway is a key regulator of cellular metabolism, linking nutrient levels and growth factors to cell growth and proliferation. Consistent with its role in promoting cell proliferation, mTOR signaling inhibits autophagy activity through multiple mechanisms. Given findings regarding the protective role of autophagy, it appears that mTOR may sensitize tumor cells to T cell-mediated killing through the inhibition of autophagy.

[0250] To confirm the screening results, Mlst8 (an essential component of both mTOR signaling complexes, mTORC1 and mTORC2) was inactivated using sgRNAs enriched in the screen. Mlst8 inactivation inhibited both mTORC1 and mTORC2 activity, as evidenced by a decrease in phospho-S6 (mTORC1-dependent) and phospho-Akt levels (mTORC2-dependent) (Figure 6A). Consistent with the inhibition of autophagy by mTOR signaling, Mlst8 KO cells exhibited reduced p62 levels, confirming increased autophagy activity (Figure 6A). Increased autophagy in Mlst8 KO cells was associated with reduced sensitivity to both TNFα and T cell-mediated killing (Figure 6B and C). Importantly, the magnitude of the effect of each Mlst8 sgRNA on tumor cell killing correlated with the degree of Mlst8 protein depletion (Figure 6A), confirming these effects were as expected. To further illustrate the impact of the mTOR pathway on tumor cell killing, blocking mTORC1 signaling with rapamycin reduced phospho-S6 and p62 levels, confirming increased autophagy activity (Figure 6D). Similar to Mlst8 KO, inhibition of mTORC1 with rapamycin significantly reduced both TNFα- and T cell-mediated killing (Figure 6E and F).

[0251] These findings regarding the effects of mTOR modulation further support the importance of autophagy as a protective mechanism for tumor cells. A diagram illustrating the regulation of T cell-mediated tumor cell killing by various signaling pathways identified in the screen is shown in Figure 6G.

[0252] Autophagy protects cancer cells of various lineages from T cell- and TNFα-mediated killing. To expand our understanding of the protective role of autophagy, we evaluated the effects of autophagy inhibition in a panel of cancer cell lines using autofinib and another Vps34 blocker, SAR405. Although both autofinib and SAR405 target Vps34, these inhibitors are structurally distinct and may therefore have distinct off-target effects. Both autophagy inhibitors significantly increased TNFα-induced killing in multiple mouse and human cancer cell lines of different lineages (e.g., colon, breast, and lung), including cell lines insensitive to TNFα at baseline (Figure 7A, Figure 22). The autophagy inhibitors significantly increased p62 levels (confirming autophagy blockade) and enhanced TNFα-induced caspase-8 activation in human breast cancer cells (Figure 7B). Thus, the protective role of autophagy in the context of TNFα treatment appears broadly relevant.

[0253] Previous studies have shown that TNFα contributes to tumor cell killing when T cells are activated through T cell receptor engagement by MHC class I / peptide complexes on target cells. Under these conditions, tumor cell autophagy has been shown to play a substantial protective role. To further support the potential clinical relevance of these findings, we sought to determine whether autophagy also regulates tumor cell killing by T cells after stimulation with CD3 bispecific antibodies. These antibodies, a new and promising therapeutic class, bind tumor antigens with one arm and CD3 on T cells with the other, thereby bridging tumor cells with cytotoxic T cells and enabling tumor cell killing (Figure 7C). We used a breast tumor antigen x CD3 bispecific antibody (produced at Regeneron) to promote human T cell killing of ZR-75-1 human breast cancer cells. As shown in Figure 7C, inhibition of autophagy with SAR-405 significantly increased tumor cell killing. Consistent with the effects of pharmacological blockade of autophagy, genetic inactivation of autophagy by Rb1cc1 KO enhanced CD3 bispecific antibody-induced killing (Figure 7D and E). Together, these findings confirm the protective role of autophagy in CD3 bispecific antibody-induced T cell killing and in human breast cancer cells.

[0254] Genetic inactivation of autophagy sensitizes tumors to immunotherapy. To further assess the clinical relevance of our findings, we investigated whether genetic inactivation of autophagy enhances tumor responsiveness to T cell checkpoint inhibitors. KO of Rb1cc1 in EMT6 mouse breast cancer cells resulted in a significant increase in p62 protein levels, confirming reduced autophagy activity (Figure 8A), and increased the susceptibility of EMT6 cells to TNFα-induced apoptosis (Figure 8B). Control or Rb1cc1 KO cells were implanted into mice, and 3 days after implantation, the mice were treated with a control antibody or a combination of PD-1 and CTLA4-blocking antibodies. As shown in Figure 8C, combined blockade of PD-1 and CTLA4 had only a modest growth inhibitory effect on control EMT6 tumors, while promoting complete regression of Rb1cc1 KO tumors. Individual tumor growth curves show that 10 / 10 Rb1cc1 KO tumors regressed compared to 0 / 10 control tumors (Figure 8D).

[0255] Next, we performed similar experiments using MC38 tumors. As shown in Figure 8E, KO of Rb1cc1 in MC38 cells resulted in impaired autophagy, as evidenced by a significant increase in p62 protein levels. While combined PD-1 and CTLA4 blockade reduced the growth of control MC38 tumors, the effect of checkpoint blockade on Rb1cc1 KO tumors was significantly greater (Figure 8F). The delayed growth of Rb1cc1 KO tumors versus control tumors in response to immunotherapy is readily apparent from the individual tumor growth curves shown in Figure 8G. Collectively, these findings indicate that tumors with impaired autophagy exhibit increased responsiveness to clinically relevant T cell checkpoint inhibitors.

[0256] We examined the effects of Tnfrsf1a (encoding TNFR1) KO in the context of Rb1cc1 KO tumors. As disclosed herein, the increased TNFα-mediated apoptosis observed in Rb1cc1 KO cells was reversed in Rb1cc1 / Tnfrsf1a double KO EMT6 cells (Figure 8A and B). In vivo genetic inactivation of Tnfrsf1a limited the sensitization to immunotherapy observed in Rb1cc1 KO tumors (Figure 8C and D). Thus, in the context of autophagy-impaired tumors, Tnfrsf1a KO is protective. In control tumors with intact autophagy, Tnfrsf1a KO does not protect tumors from immune checkpoint blockade but actually sensitizes them to therapy (Figure 8C). It is clear that Tnfrsf1a KO affects tumors in a context-dependent manner. Nevertheless, the data indicate that in situations where tumor cell autophagy is impaired, TNFα-induced apoptosis is an important component of antitumor immunity.

[0257] Leukocyte infiltration into Rb1cc1 KO tumors was assessed. In both the EMT6 and MC38 models, Rb1cc1 KO tumors contained increased numbers of CD45+ leukocytes compared with control tumors (Figure 26). However, although overall leukocyte infiltration was increased, preferential infiltration of CD4+ or CD8+ T cells was not observed. Nevertheless, both increased leukocyte infiltration and increased susceptibility to T cell-mediated killing may contribute to the enhanced response to immunotherapy observed in autophagy-impaired tumor models.

[0258] Using a genome-wide CRISPR screen, we identified TNFα signaling in tumor cells as a critical component of T cell-mediated killing and, conversely, identified a protective role for both the NF-κB and autophagy pathways. The data presented herein demonstrate that autophagy limits tumor cell killing by TNFα through inhibition of caspase-8 activation upstream of mitochondrial engagement. More specifically, autophagy appears to inhibit the formation and / or activity of the FADD / caspase-8 complex, consistent with the observation that autophagy can limit tumor cell killing by TRAIL, which also induces FADD / caspase-8-mediated cytotoxicity.

[0259] These in vivo experiments demonstrate that genetic inactivation of autophagy in tumor cells enhances the efficacy of T cell checkpoint inhibitors, suggesting that pharmacological inhibition of autophagy may also enhance the efficacy of such treatments. Although the role of autophagy in cancer has been widely studied, the importance of this process for tumor cell proliferation / survival remains unclear. Nevertheless, the data presented herein demonstrate that autophagy inhibitors, apart from their potential regulation of tumor cell proliferation, may sensitize cancer cells to TNFα-induced apoptosis.

[0260] In summary, the analyses presented herein reveal a role for autophagy in limiting tumor cell susceptibility to T cell-mediated killing. The identification of autophagy as a potential mechanism of tumor immune escape suggests that autophagy inhibitors may enhance the efficacy of T cell-mediated immunotherapy. Furthermore, the data provided herein demonstrate that autophagy limits tumor cell killing by T cells and TNFα via inhibition of caspase-8 activation upstream of mitochondrial engagement. Furthermore, inhibition of autophagy does not sensitize tumor cells to chemotherapy-induced apoptosis, suggesting a relatively specific role for autophagy in regulating TNFα signaling rather than a more general anti-apoptotic function (e.g., mitophagy). Thus, the data provided herein suggest a novel therapeutic use for autophagy inhibitors: making cancer cells susceptible to T cell killing, even when these cells do not rely on autophagy for proliferation / survival.

[0261] Materials and Methods Cancer cell lines MC38 mouse colon cancer cells were obtained from the National Institutes of Health (NIH) repository. 4T1, B16F10, CT26, EMT6, and L929 mouse cancer cells, as well as ZR75-1, HCT-116, HeLa, BT-20, Me-180, and MDA-MB-361 human cancer cells, and human embryonic kidney (HEK) 293T human cells were from the American Type Culture Collection (ATCC). Colon26 mouse cancer cells were from the Division of Cancer Treatment and Diagnosis at the National Cancer Institute (operated by Charles River Laboratories). All cells were cultured in the manufacturer's recommended medium. All cell lines were authenticated by short tandem repeat profiling (IDEXX BioResearch) in 2016.

[0262] mouse OT-1 C57BL / 6-Tg(TcraTcrb)1100Mjb / J mice (003831), C57BL / 6 mice (000664), and Balb / c mice (000651) were from the Jackson Laboratory.

[0263] CRISPR knockout sgRNA library and genome-wide screening Mouse sgRNA libraries (GeCKO A and B; approximately 130,000 sgRNAs total) and pLentiCas9-Blast plasmid were purchased from GenScript. Genome-wide CRISPR / Cas9 screening was performed using MC38 cells engineered to express Cas9 nuclease by lentiviral infection (pLentiCas9-Blast) and selection with blasticidin (12 μg / ml). MC38-Cas9 cells were infected with the mouse GeCKO library (A and B combined) at a multiplicity of infection of 0.3, such that each sgRNA was introduced into approximately 200 cells. Cells were selected with 12 μg / ml puromycin for 3 days, and approximately 130 million cells were set aside as a reference control sample. Seven days after infection, T cell killing assays were performed in triplicate. Library-engineered cells at approximately 2000x library representation were pulsed with Ova peptide, and cells at approximately 200x library representation were pulsed with control peptide. After pulsed peptide administration, cells were activated with CD8 +Tumor cells were co-cultured with T cells (isolated from OT-1 mice) at an E:T ratio of 1:3. After 24 hours of co-culture, when approximately 90% of the tumor cells had been killed, non-adherent cells were washed away with PBS, and live tumor cells were harvested. Genomic DNA extraction was then performed using the DNeasy Blood & Tissue Kit (Qiagen), and an NGS library was prepared as previously described. The NGS library was then multiplexed and run on a NextSeq500 (Illumina) to generate 80 base pair (bp) single-end reads. After demultiplexing with bcl2fastq software (Illumina), reads were screened for 16-bp vector sequences flanking the sgRNA, and downstream 20-bp sgRNA reads were extracted for sgRNA counting. Reads were then counted using MAGeCK, and gene / sgRNA enrichment and statistical analysis were performed. MC38 cells grown without T cells were harvested 1 week post-infection to compare sgRNA expression with that of reference control cells.

[0264] The sgRNA sequences (gene name, sgRNA ID, sgRNA number and sequence, if applicable) used in the validation experiments are as follows (individual sgRNAs were cloned into either the pLenti-Guide-Puro or pLentiCRISPR v2 plasmids): Map3k7, MGLibA_30286, 1, GATGATCGAAGCGCCGTCGC (SEQ ID NO: 16); Map3k7, MGLibA_30288, 3, GGGACTTACTGGATTCAGGC (SEQ ID NO: 18); Map3k7, MGLibB_30278, 5, TTAACTCAGGTTGTCGGAAG (SEQ ID NO: 20); Rbck1, MGLibA_44718, 1, AGTACGCCCGGATATGACAG ( SEQ ID NO: 22); Rbck1, MGLibA_44720, 3, CAGCTTACCGGTGGTGACTC (SEQ ID NO: 24); Rbck1, MGLibB_44706, 5, CGGGCGTACTGTGAGCCAAA (SEQ ID NO: 26); Rela, MGLibA_45073, 2, TCATCGAACAGCCGAAGCAA (SEQ ID NO: 29); Rela, MGLibA_45074, 3, GCCCAGACCGCAGTATCCAT (SEQ ID NO: 30); Rela, MGLibB_4 5061, 6, ACTTACCTGAGGGAAAGATG (SEQ ID NO: 33); Rb1cc1, MGLibA_44690, 3, TCAAGATAGACCCAATGATG (SEQ ID NO: 36); Rb1cc1, MGLibB_44675, 4, CTCCATTGACCACCAGAACC (SEQ ID NO: 37); Rb1cc1, MGLibB_44676, 5, ATTTGAACAGTCCTCCAGAT (SEQ ID NO: 38); Atg9a, MGLibA_05661, 1, CATAGTCCA CACAGCTAACC (SEQ ID NO: 40); Atg9a, MGLibA_05662, 2, TTGGGATCCGAAGAGCATGT (SEQ ID NO: 41); Atg9a, MGLibB_05661, 4, TCTATAACATTTGCTGCTAT (SEQ ID NO: 43); Atg12, MGLibA_05621, 3, GAGCGAACCCGGACCATCCA (SEQ ID NO: 48); Atg12, MGLibB_05620, 5, CCTGCATTACTGCAAATCCC (SEQ ID NO: 50);Atg12, MGLibB_05621, 6, TTCTGGCTCATCCCCATGCC (SEQ ID NO: 51); Tnfrsf1a, MGLibA_55116, GTGTCTCACTCAGGTAGCGT (SEQ ID NO: 52); Ripk1, MGLibA_45635, 3, GTACACGTCCGACTTCTCCG (SEQ ID NO: 53); Fadd, MGLibA_16988, 2, TAGATCGTGTCGGCGCAGCG (SEQ ID NO: 54); B2M, MGLibA_06111, 1, AGTAT ACTCACGCCACCCAC (SEQ ID NO: 55); Rb1cc1, HGLibB_40366, 6, GGCTGCAATCATGGCCAACC (SEQ ID NO: 56); Mlst8, MGLibA_31480, 1, GACTCCGTCATAACTGATGA (SEQ ID NO: 57); Mlst8, MGLibA_31482, 3, CGAAGCATGATTGCTGCTGC (SEQ ID NO: 58); Mlst8, MGLibB_31471, 4, AGCACTCACGGCACTATTGA (SEQ ID NO: 59).

[0265] Lentiviral packaging / transduction and CRISPR-mediated gene knockout For validation experiments, sgRNAs targeting the gene of interest were cloned into pLenti-Guide-Puro or pLentiCrispr v2 (GenScript). HEK293T cells were transfected with pLenti-Cas9-Blast, pLenti-Guide-Puro, or pLentiCrispr v2, along with the packaging plasmids psPAX and pMD2.G, using Lipofectamine 2000. After 6 hours, the medium was replaced with complete growth medium. After 72 hours, the lentivirus-containing supernatant was collected, filtered, concentrated by ultracentrifugation, and stored at -80°C. For lentiviral transduction, tumor cells were seeded at an MOI of 0.3 in complete medium containing 5µg / ml polybrene and lentivirus. Using a sufficient number of HEK293T cells to maintain library expression, the mouse GeCKO A and B plasmid libraries were pooled and packaged into lentivirus using the same method. After 24 hours, the medium was changed to complete growth medium containing DNase, and the lentivirus was concentrated as described above.

[0266] Isolation and activation of CD8+ T cells CD8 +T cells were isolated from the spleens and lymph nodes of 6- to 8-week-old male OT-1 mice. These mice contained transgenic inserts of the mouse Tcra-V2 and Tcrb-V5 genes. The transgenic T cell receptor was engineered to recognize ovalbumin peptide residues 257-264 in the context of the H-2Kb MHC class I protein. In some experiments, human CD8+ T cells were isolated from PBMCs. T cells were activated in vitro with CD3 / CD28 beads at a 1:2 bead:cell ratio for 2-3 days. T cells were activated in RPMI-1640 medium containing 20 ng / ml mouse IL-2, 10% heat-inactivated fetal bovine serum, 20 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.05 mM 2-mercaptoethanol, and 50 U / ml penicillin / streptomycin. For human tumor cell killing experiments using CD3 bispecific antibodies, human T cells were isolated from peripheral blood mononuclear cells (PBMCs) (ReachBio) using the Dynabeads Untouched Human T Cell Kit (Thermo Fisher Scientific).

[0267] In vitro cytotoxicity assay MC38 cells were seeded at 34,000 cells per 24-well plate and 24 hours after seeding, were intermittently treated with 1 ng / ml of Ova or scrambled peptide. The intermittently treated cells were then transduced into activated CD8 + T cells (isolated from OT-1 mice) were cultured. After 24 hours, non-adherent tumor cells were washed away with PBS, and cell viability was assessed. Where indicated, neutralizing TNFα antibodies or isotype control antibodies were added at concentrations of 10 or 20 μg / ml.

[0268] Human ZR-75-1 cells were seeded at 100,000 cells per 24-well plate. After 24 hours, cells were incubated with activated CD8+ cells in the presence of 12 ng / ml of breast tumor antigen xCD3 or control (non-binding) bispecific antibody in the absence or presence of 5 μM of the autophagy inhibitor SAR-405. +T cells (isolated from human PBMCs) were incubated at the indicated E:T ratios for 24 hours.

[0269] The effects of TNFα, TRAIL, doxorubicin, or paclitaxel on cell viability were assessed after 24 hours of incubation at the indicated concentrations. The effects of 5 μM autofluorescence or SAR-405 on TNFα (10 ng / ml) or TRAIL (10 ng / ml or 50 ng / ml)-induced killing were assessed after 24 hours of incubation, unless otherwise noted. In all cases, cell viability was measured using the CCK8 Cell Counting Kit-8 (CCK-8) reagent, which is reduced by cellular dehydrogenase activity and produces a yellow formazan dye (Dojindo). Absorbance was measured using a SpectraMax M3 microplate reader (Molecular Devices).

[0270] Xenograft experiments For EMT6 xenograft experiments, 5 × 10 6 Cells were injected subcutaneously into the right flank of 6-8 week-old female BALB / c mice. Three days after implantation, mice were treated with either CTLA-4 plus PD-1 blocking antibody or isotype control (n = 10 mice per group). On the first day of treatment, CTLA-4 plus PD-1 blocking antibody (5 mg / kg) was administered intraperitoneally. On days 3 and 6 of treatment, CTLA-4 antibody (2.5 mg / kg) was administered. On days 4, 8, 11, and 15, 5 mg / kg of PD-1 antibody was administered. Tumor growth was monitored three times weekly with a vernier caliper, and tumor volume (mm3) was calculated using the following formula: 1 / 2 x length x width. 2 was estimated using

[0271] In MC38 xenograft experiments, 3 × 10 5Cells were injected subcutaneously into the right flank of 6-8 week-old female C57BL / 6 mice. Ten days after implantation, when tumor volume reached approximately 70 mm3, mice were randomized and treated with either CTLA-4 plus PD-1 blocking antibodies or isotype control as described above (n = 7-12 mice per group). For tumor experiments using CRISPR-engineered cells, Cas9 protein and sgRNA were delivered to cells via transient ribonucleoprotein transduction to overcome the increased immunogenicity associated with lentiviral modification. The sgRNA sequences were as follows: CUCCAUUGACCACCAGAACC for Rb1cc1 KO, UUCUCCCGGUCACCAAG for Tnfrsf1a KO, and AAAUGUGAGAGAUCAGAGUAAU for non-targeting. After transduction, clones were isolated and tested for gene KO. For MC38 cells, a pool of eight KO clones was used for tumor experiments, and for EMT6 cells, a pool of four KO clones was used.

[0272] Antibodies and reagents The PD-1 blocking antibody (clone RMP1-14) and rat IgG2a isotype control antibody were from BioXCell. An in-house version of the CTLA4 blocking antibody (clone 9D9) with isotype IgG2a was generated using the published primary sequence. The CD3 bispecific antibody was generated at Regeneron using previously described methods (Murphy et al., 2014; Smith et al., 2015). The mouse-reactive TNFα neutralizing antibody (clone MP6-XT22) and rat IgG1 isotype control antibody were from Biolegend. The human-reactive TNFα neutralizing antibody (clone MAB1) and mouse IgG1 isotype control antibody were from Biolegend. Recombinant mouse and human TNFα and IFNγ were from PeproTech. Recombinant human TRAIL was from Enzo. Z-VAD-FMK pan-caspase inhibitor was from InvivoGen. Ova SIINFEKL(257-264) peptide and scrambled control peptide FILKSINE(257-264) were from AnaSpec. EasySep Mouse CD8+ T cell isolation kit was from Stemcell. Dynabeads Mouse T-activating factor CD3 / CD28 beads were from ThermoFisher. Dynabeads Untouched Human CD8 T Cell Kit was from ThermoFisher. Human PBMCs were purchased from ReachBio. Mouse cytokine array panel A was from R&D Systems. Protease / phosphatase inhibitors and BCA reagent were from ThermoFisher. Autofinib was from Biovision, SAR-405 was from MedChemExpress, and LCL-161 (Smac mimetic) was from Selleckchem. Nec-1s was from BioVision. Cas9 protein and trueguide synthetic gRNA were from ThermoFisher. Doxorubicin and paclitaxel were from Selleckchem.

[0273] Immunoblotting Whole cell lysates were prepared in Tris-glycine SDS sample buffer (ThermoFisher) containing 5% 2-mercaptoethanol. Western blotting was performed conventionally using Tris-glycine polyacrylamide SDS gels (ThermoFisher) and PVDF membranes (BioRad). Blots were blocked with 5% milk powder and 0.5% Tween®-20 in TBS and incubated overnight with primary antibodies. After addition of secondary antibodies, membranes were incubated with SuperSignal West Pico Plus or Femto substrate (ThermoFisher), and luminescence was captured on a C300 imager (Azure Biosystems). Primary antibodies used were against TAK1, Rbck1, RelA p65, Rb1cc1, Atg12, cleaved caspase-8, procaspase-8, RIPK1, RIPK1 phospho-Ser321, RIPK1 phospho-Ser166, Iκ-Bα, A20, p62, phospho-p65, LC3B, TNFR1 (CST), Atg9a (Novus), cIAP1 (Enzo), β2M (ThermoFisher), FADD, and ICAM (Abcam). Horseradish peroxidase-conjugated β-actin antibody and secondary antibodies against mouse IgG, rabbit IgG, and goat IgG were from Santa Cruz Biotechnology.

[0274] Xenograft experiments. To overcome the increased immunogenicity associated with lentiviral vector-mediated cell modification, Cas9 protein and sgRNA were delivered to cells via transient ribonucleoprotein transfection. The sgRNA sequence used for Rb1cc1 KO was CUCCAUUGACCACCAGAACC, and the non-targeting sgRNA sequence was AAAUGUGAGAUCAGAGUAAU. After transfection, clones were isolated and tested for gene knockout. For MC38 cells, a pool of eight KO clones was used for tumor experiments, and for EMT6 cells, a pool of four KO clones was used.

[0275] Mouse cytokine array Rb1cc1KO MC38 cells expressing control or Rb1cc1-targeting sgRNA were treated with 10 ng / ml mouse TNFα for 4 hours. After treatment, cells were washed twice with ice-cold PBS and lysed in 1 mL of 1% IGEPAL CA-630, 20 mM Tris-HCl pH 8.0, 137 mM NaCl, 10% glycerol, 2 mM EDTA, plus 1X Halt protease / phosphatase inhibitor cocktail. After rotating at 4°C for 30 minutes, the lysate was clarified by centrifugation at 14,000 g for 5 minutes, and protein concentration was measured by standard BCA assay. Cytokine production was assessed using the Proteome Profiler Mouse Cytokine Array Panel A (R&D Systems). 300 μg of cell lysate was used, following the standard kit protocol.

[0276] Tumor immunophenotyping and flow cytometry analysis Tumors were harvested and mechanically disaggregated into fragments (>4 mm), followed by enzymatic digestion at 37°C for 45 minutes using a mouse tumor dissociation kit (Miltenyi Biotec). Single-cell suspensions were prepared, and red blood cells were lysed with ACK buffer (Lonza). Cells were counted, blocked with Fc block (BioLegend) for 30 minutes on ice, and stained with viability dyes and CD45, CD3, CD4, and CD8 antibodies (BioLegend) as indicated. MC38 parental and autophagy KO cells were stained with MHC-I (H2-kb) or isotype control (Invitrogen) antibodies, or MHC-I (H2-kb)-Ova (SIINFEKL) or isotype control (BioLegend) antibodies.

[0277] Quantification and statistical analysis For analysis of pooled CRISPR screens, data were first normalized by multiplying each sample by a scaling factor so that all samples had the same total read count. To compare groups, the normalized read count table was used as input into MAGeCK (version 0.5.8), with one group assigned as treatment and the other as control (58). To compare data from cell-based assays across multiple treatment groups, one-way ANOVA with Tukey's multiple comparison test was used. To compare tumor growth following different treatments, one-way ANOVA with Tukey's multiple comparison test was used. A P value of less than 0.05 was considered significant. Statistical comparisons were performed using GraphPad Prism.

[0278] Incorporation by Reference All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the case of conflict, the present application, including any definitions herein, will control.

[0279] Any polynucleotide and polypeptide sequences that reference an accession number that correlates to an entry in a public database, such as those maintained by The Institute for Genomic Research (TIGR) on the World Wide Web and / or the National Center for Biotechnology Information (NCBI) on the World Wide Web, are also incorporated by reference in their entirety.

[0280] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following claims.

Claims

1. A composition for use in a method of sensitizing cancer cells to T cell-mediated killing, comprising an agent that inhibits autophagy of the cancer cells, the method comprising contacting the agent with the cancer cells in the presence of T cells.

2. The composition described in claim 1, wherein the drug inhibits the expression or activity of autophagy genes.

3. The composition described in claim 2, wherein the autophagy genes are selected from ATG12, ATG9A, WIPI2, PIK3C3, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1 and ATG10.

4. The composition described in claim 2, wherein the drug modifies at least one autophagy gene, and by modifying the at least one autophagy gene, the expression or activity of the autophagy gene is reduced.

5. The composition described in any one of claims 1 to 4, wherein the drug is a composition comprising a guide RNA or a nucleic acid encoding a guide RNA, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene, and is effective in inducing a Cas enzyme to cleave or bind to a sequence in the autophagy gene.

6. The composition described in claim 5, wherein the guide RNA target sequence includes or is within approximately 100 nucleotides of the start codon of the autophagy gene.

7. The composition described in claim 5, further comprising a Cas protein or a nucleic acid sequence encoding the Cas protein.

8. The composition described in any one of claims 1 to 4, wherein the agent is an interfering nucleic acid selected from siRNA, shRNA, miRNA, or antisense oligonucleotide.

9. The composition of any one of claims 1 to 8, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, renal cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, blood cancer cells, neural tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells.

10. A composition for use in a method of treating cancer in a subject, comprising an agent that inhibits autophagy in cancer cells of the subject, the method comprising administering to the subject the composition and a cancer immunotherapy that induces T-cell mediated killing of the cancer.

11. The composition described in claim 10, wherein the cancer immunotherapy includes T cell therapy and / or the method does not include administration of isolated tumor necrosis factor alpha (TNF-α).

12. The composition of claim 10 or 11, wherein the cancer immunotherapy comprises autologous or allogeneic T-cell therapy, autologous or allogeneic CAR T-cell therapy, or administering to the subject TNF-α, an immune checkpoint inhibitor, a bispecific antibody, or a cancer vaccine.

13. A composition described in any one of claims 10 to 12, wherein the drug inhibits the expression or activity of an autophagy gene.

14. The composition described in claim 13, wherein the autophagy genes are selected from RB1CC1, ATG12, ATG9A, WIPI2, PIK3C3, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1 and ATG10.

15. The composition described in claim 13, wherein the drug modifies at least one autophagy gene, and by modifying the at least one autophagy gene, the expression or activity of the autophagy gene is reduced.

16. The composition described in any one of claims 10 to 15, wherein the drug is a composition comprising a guide RNA or a nucleic acid encoding a guide RNA, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene, and is effective in inducing a Cas enzyme to cleave or bind to a sequence in the autophagy gene.

17. The composition described in Claim 16, further comprising a Cas protein or a nucleic acid sequence encoding the Cas protein.

18. The composition described in any one of claims 10 to 15, wherein the agent is an interfering nucleic acid selected from siRNA, shRNA, miRNA, or antisense oligonucleotide.

19. The composition of any one of claims 10 to 18, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, renal cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, blood cancer cells, neural tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells.

20. A composition for use in combination therapy comprising an agent that inhibits autophagy in cancer cells, the combination therapy comprising the agent and a cancer immunotherapy that induces T cell-mediated killing of cancer cells for use in the treatment of cancer.

21. The composition described in claim 20, wherein the cancer immunotherapy includes T cell therapy and / or the combination therapy does not include isolated tumor necrosis factor alpha (TNF-α).

22. The composition of claim 20 or 21, wherein the cancer immunotherapy comprises autologous or allogeneic T-cell therapy, autologous or allogeneic CAR T-cell therapy, or administering to the subject TNF-α, an immune checkpoint inhibitor, a bispecific antibody, or a cancer vaccine.

Images