Compositions and methods for growth factor modulation

Abstract

To provide agents for modulating cell signaling and / or cellular activities.SOLUTION: Provided herein are proteins, antibodies, assays and methods useful for modulating growth factor levels and / or activities. In some embodiments, such growth factors are members of the TGF-β superfamily of proteins.SELECTED DRAWING: Figure 3

Description

[Technical Field]

[0001] Embodiments of the present invention include recombinant proteins and antibodies directed against such proteins. In some embodiments, such proteins and antibodies may include TGF-β It may be relevant to the field of family member biology. [Background technology]

[0002] Cell signaling molecules stimulate a variety of cellular activities. In many cases, other biomolecules, extracellular matrix, and / or cellular matrix These proteins are tightly regulated through interactions with other proteins or within specific cellular environments or niches. Such interactions can be direct or indirect.

[0003] Cell signaling cascades are a number of diverse biological pathways, including but not limited to: However, it is not only the modulation of cell growth, modulation of tissue homeostasis, Extracellular matrix (ECM) dynamics Involved in the modulation of cell migration, invasion and immune modulation / suppression. In some cases, proteins involved in cell signaling are synthesized in a latent form. and / or are blocked and require some kind of stimulus to participate in the signaling events do. Summary of the Invention [Problem to be solved by the invention]

[0004] Agents, tools and methods for modulating cell signaling and / or cell activity There remains a need in the art. [Means for solving the problem]

[0005] In some embodiments, the present invention provides growth factor prodomain complexes (GPCs). th factor prodomain complex), latent-associated peptide (L AP: latency associated peptide), LAP-like domain, Straight jacket region, growth factor domain, zipper region, furin cleavage site region , arm region, finger region, N-terminal region for extracellular association, cryptic loop, α1 helical region, α2 helical region, RGD sequence region, trigger loop region and bowtie region one or more TGF- In some embodiments, the present invention provides a recombinant protein comprising a β-associated protein. The recombinant protein may comprise one or more protein modules from a vertebrate species. In some embodiments, the recombinant protein of the present invention comprises one or more mutations. In some embodiments, the recombinant proteins of the present invention may comprise one or more protein modules. The protein may contain one or more mutations involving one or more furin cleavage site regions. In certain embodiments, such mutations prevent enzymatic cleavage of the recombinant protein of the invention. In some embodiments, the recombinant protein of the present invention comprises the amino acid sequence RX Some embodiments may contain one or more mutations, including a mutation to the amino acid sequence XR to RXG. In an embodiment, the recombinant protein of the present invention comprises the amino acid sequence A of the amino acid sequence RXXR. In some embodiments, the present invention may include one or more mutations, including a mutation to XXA. The recombinant protein of the invention contains one or more mutations in the N-terminal region for extracellular association. In some embodiments, the recombinant protein of the present invention may comprise about the first 4, 5, 6 or substitution of at least one cysteine ​​residue present within the seven N-terminal amino acid residues and / or may contain one or more mutations, including deletions. The recombinant protein of the invention comprises at least one serine substituted with at least one cysteine ​​residue. It may contain one or more substitutions by residues.

[0006] In some embodiments, the recombinant protein of the present invention is LTBP1, LTBP1S, LTBP2, LTBP3, LTBP4, fibrillin-1, fibrillin-2, fibrin lin-3, fibrillin-4, GARP, LRRC33 and combinations or fragments thereof In some embodiments, the compound may be conjugated to a protein selected from the group consisting of: In this regard, the recombinant protein of the present invention may contain one or more detectable labels. Suitable detectable labels include biotin labels, polyhistidine tags and / or flags. ag) tags.

[0007] In some embodiments, the present invention provides a method for the preparation of a TGF-β-related protein comprising the steps of: A chimeric protein comprising one or more protein modules of the The module contains the growth factor prodomain complex (GPC), latent associated peptide (LAP), LAP-like domain, straight jacket region, growth factor domain, zipper region, The amino acid sequence includes the phosphodiesterase cleavage site region, the arm region, the finger region, the N-terminal region for extracellular association, and the latent region. Conserved loop, α1 helical region, RGD sequence region, trigger loop region, bowtie region, and chimeras that may be selected from the group consisting of any of those listed in Tables 2, 3, and 11. In some embodiments, the chimeric proteins of the present invention comprise one or more The protein may comprise one or more protein modules selected from the above vertebrate species. In some embodiments, the chimeric protein of the present invention may comprise a GPC. Therefore, such GPCs contain at least one LAP from the TGF-β family members. or a LAP-like domain and at least one component from a TGF-β family member The LAP or LAP-like domain and the growth factor domain may be different. In some embodiments, the present invention provides a method for the treatment of TGF-β. The chimeric protein comprises at least one LAP or LAP-like domain and at least Each of them may contain one or more growth factor domains, such as TGF-β1, TGF-β2, , TGF-β3, GDF-8, GDF-11 and inhibin βA. In some embodiments, the chimeric proteins of the invention comprise one or more GPCs. wherein at least one N-terminal region is from a TGF-β family member; At least one C-terminal region is from a TGF-β family member, and the N-terminal The C-terminal and D-terminal regions are from different TGF-β family members. In some embodiments, the chimeric protein of the invention comprises a TGF-β1 terminal region, ... β2 terminal region, TGF-β3 terminal region, GDF-8 terminal region, GDF-11 terminal region and and at least one N-terminal region selected from the group consisting of an inhibin βA-terminal region and at least In some embodiments, the chimeric protein of the present invention may comprise one C-terminal region. At least one arm region from a different TGF-β family member In some embodiments, the GPC may include a GPC from one or more TGF-β family members. Therefore, the chimeric proteins of the present invention contain at least two TGF-β family members from different TGF-β family members. and at least one TGF-β family member containing at least one trigger loop region. In some embodiments, the chimeric protein of the present invention may comprise a GPC containing a GPC as listed in Table 12. It may contain any of the listed protein module combinations.

[0008] In some embodiments, the chimeric protein of the present invention is a chimeric protein of LTBP1, LTBP1S, LTBP2, LTBP3, LTBP4, fibrillin-1, fibrillin-2, fibrin lin-3, fibrillin-4, GARP and LRRC33, and combinations thereof can be conjugated to a protein selected from the group consisting of fragments of In some embodiments, the chimeric proteins of the present invention may include one or more detectable labels. In some embodiments, such detectable labels include at least one biotin label, It may contain a polyhistidine tag and / or a flag tag.

[0009] In some embodiments, the present invention provides recombinant proteins and / or provides antibodies directed to any of the chimeric proteins. Such antibodies include monoclonal antibodies. In some embodiments, the antibodies of the present invention In some embodiments, the monoclonal antibodies of the present invention are In some embodiments, the stabilized antibodies of the invention comprise one or more GP C reduces the level of free growth factors relative to the level of growth factors associated with some In embodiments, the stabilizing antibody may reduce growth factor-dependent cell signaling. In some embodiments, the monoclonal antibodies of the present invention may include shed antibodies. Such antibodies may be used to quantify the levels of free growth factors relative to the levels of growth factors associated with one or more GPCs. In some embodiments, the released antibodies of the present invention may increase the activity of growth factor-dependent cells. It may increase cell signaling.

[0010] In some embodiments, the present invention provides a method for producing a recombinant protein comprising administering to a subject a subject the steps of: one or more of any one of the chimeric proteins and / or any one of the antibodies Compositions comprising the above in combination with at least one excipient are provided.

[0011] In some embodiments, the present invention includes the use of one or more of the compositions described herein. The present invention provides a method for modulating the levels of free growth factors in a subject or a cell niche. In some such methods, the level of growth factor signaling is modulated.

[0012] In some embodiments, the present invention provides a method for selecting a desired antibody that involves the use of one or more assays. and methods of selecting such assays, wherein such assays include one or more recombinant proteins of the present invention. Some such methods include the steps of: 1) providing an antibody binding assay; 2) contacting a binding assay with one or more candidate antibodies; and 3) contacting one or more recombinant antibodies. 3) obtaining binding data regarding the affinity of the candidate antibody for the protein; and The method further includes a step of selecting a desired antibody based on the combined data. The assay used was enzyme-linked immunosorbent assay (ELISA). immunosorbent assay) and / or fluorescence-associated cell sorting (FACS:fluorescence-associated cell sorti ng)-based assays. In some cases, such assays The recombinant protein is selected from the group consisting of SEQ ID NOs: 153-161 and 286-292. It can be complexed with a protein of choice, or LTBP1, LTBP1S, L TBP2, LTBP3, LTBP4, fibrillin-1, fibrillin-2, fibrillin phosphodiesterase-3, fibrillin-4, GARP, LRRC33, perlecan, decorin, elastin The compound can be complexed with a protein selected from the group consisting of methacrylate and collagen. In some cases, the recombinant protein is selected from the group consisting of SEQ ID NOS: 199-236 and 273. The chimeric protein may comprise an amino acid sequence selected from the group consisting of:

[0013] Another method for selecting a desired antibody involves the steps of: 1) providing a growth factor activity assay; 2) contacting a growth factor activity assay with one or more candidate antibodies; and 4) selecting a desired antibody based on the growth factor activity data. The growth factor activity assay by such a method may include the steps of: The assay may include a cell-based assay selected from the group consisting of a cell-based assay and a proliferation assay. Such cell-based assays may involve the use of one or more recombinant proteins of the invention or Such assays may include one or more expressing cells that express the complex. The assay may further include one or more responder cells that generate the data and / or survival data.

[0014] In some embodiments, the present invention provides a method for producing a recombinant protein comprising administering to a subject a subject the steps of: one or more of any of the chimeric proteins described herein and / or A pharmaceutical comprising any one or more of the antibodies described herein and at least one pharmaceutical excipient. A composition is provided.

[0015] Some methods of the invention involve contacting a subject with a composition of the invention. This includes the treatment of TGF-β-associated indications, such as fibrotic indications (e.g., pulmonary fibrosis, renal fibrosis, liver fibrosis, cardiovascular fibrosis, skin fibrosis, and bone marrow fibrosis), bone Myelofibrosis, cancer or cancer-related conditions (e.g., colon cancer, renal cancer, breast cancer, malignant melanoma, and glioblastoma) cysts) and muscle disorders and / or damage [e.g., cachexia, muscular dystrophy, chronic Chronic obstructive pulmonary disease (COPD) y disease), motor neuron disease, trauma, neurodegenerative diseases, infection, rheumatoid arthritis , immobility syndrome, sarcopenia, inclusion body myositis and diabetes].

[0016] In some embodiments, the present invention provides a kit comprising the composition of the present invention and instructions for its use. Provide a These and other objects, features and advantages are realized in accordance with the following invention as illustrated in the accompanying drawings. The drawings are not necessarily to scale and are not to scale. Instead, emphasis is placed on illustrating the principles of various embodiments of the present invention. [Brief explanation of the drawings]

[0017] [Figure 1] A phylogenetic tree of the TGF-β superfamily. Diversity is proportional to branch length. [Figure 2] Schematic diagram of one embodiment of a linear representation of a translated growth factor monomer. In such an embodiment, the translated growth factor may include a secretory signal peptide, a prodomain, and a growth factor domain. In an embodiment according to the embodiment shown in this figure, the translated growth factor may also include a cleavage site between the prodomain and the growth factor domain. [Figure 3] Schematic diagram of one embodiment of a growth factor prodomain complex (GPC), as well as one embodiment of a free growth factor dimer and a free latency-associated peptide (LAP) dimer. Arrows indicate the ability of proteins according to this embodiment to switch between free and complexed forms. [Figure 4] Schematic of one embodiment of free LAP dimers and free growth factor dimers with labeling features and / or protein modules. [Figure 5] Schematic diagram of one embodiment of recombinant GPC. [Figure 6] Schematic diagram of one embodiment of a mutated recombinant GPC. [Figure 7] Diagram showing a schematic representation of the five recombinant proteins alone or in complex with LTBP or GARP. [Figure 8-1]Diagram showing structure-based alignment among TGF-β family member proteins [Source: Shi et al. (Shi, M. et al., "Latent TGF-β structure and activation," Nature, June 15, 2011, Vol. 474 (No. 7351), pp. 343-349, the contents of which are incorporated herein by reference in their entirety)]. Cysteine ​​residues required for interaction with LTBP and / or GARP are boxed. Residues mutated in Kamuracchi-Engelman syndrome are indicated by asterisks. Protease cleavage sites are indicated by upward arrows. Protein modules and secondary structure elements are indicated by black bars. The underlined residues at the N-terminus of GDF-8 alternatively correspond to the predicted signal peptide processing site. "Chimeric module breakpoints" indicate regions where structural features are conserved and provide modules for chimeric protein construction (module exchange between family members) in all family members. The N-terminal region is shown in (A), the internal region is shown in (B), and the C-terminal region is shown in (C). [Figure 8-2]Diagram showing structure-based alignment among TGF-β family member proteins. [Source: Shi et al. (Shi, M. et al., "Latent TGF-β structure and activation," Nature, June 15, 2011, Vol. 474 (No. 7351), pp. 343-349, the contents of which are incorporated herein by reference in their entirety.)] Cysteine ​​residues required for interaction with LTBP and / or GARP are boxed. Residues mutated in Kamuracchi-Engelman syndrome are indicated by asterisks. Protease cleavage sites are indicated by upward arrows. Protein modules and secondary structure elements are indicated by black bars. The underlined residues at the N-terminus of GDF-8 alternatively correspond to the predicted signal peptide processing site. "Chimeric module breakpoints" indicate regions where structural features are conserved and provide modules for chimeric protein construction (module exchange between family members) in all family members. The N-terminal region is shown in (A), the internal region is shown in (B), and the C-terminal region is shown in (C). [Figure 8-3]Diagram showing structure-based alignment among TGF-β family member proteins. [Source: Shi et al. (Shi, M. et al., "Latent TGF-β structure and activation," Nature, June 15, 2011, Vol. 474 (No. 7351), pp. 343-349, the contents of which are incorporated herein by reference in their entirety.)] Cysteine ​​residues required for interaction with LTBP and / or GARP are boxed. Residues mutated in Kamuracchi-Engelman syndrome are indicated by asterisks. Protease cleavage sites are indicated by upward arrows. Protein modules and secondary structure elements are indicated by black bars. The underlined residues at the N-terminus of GDF-8 alternatively correspond to the predicted signal peptide processing site. "Chimeric module breakpoints" indicate regions where structural features are conserved and provide modules for chimeric protein construction (module exchange between family members) in all family members. The N-terminal region is shown in (A), the internal region is shown in (B), and the C-terminal region is shown in (C). [Figure 8-4]Diagram showing structure-based alignment among TGF-β family member proteins. [Source: Shi et al. (Shi, M. et al., "Latent TGF-β structure and activation," Nature, June 15, 2011, Vol. 474 (No. 7351), pp. 343-349, the contents of which are incorporated herein by reference in their entirety.)] Cysteine ​​residues required for interaction with LTBP and / or GARP are boxed. Residues mutated in Kamuracchi-Engelman syndrome are indicated by asterisks. Protease cleavage sites are indicated by upward arrows. Protein modules and secondary structure elements are indicated by black bars. The underlined residues at the N-terminus of GDF-8 alternatively correspond to the predicted signal peptide processing site. "Chimeric module breakpoints" indicate regions where structural features are conserved and provide modules for chimeric protein construction (module exchange between family members) in all family members. The N-terminal region is shown in (A), the internal region is shown in (B), and the C-terminal region is shown in (C). [Figure 8-5]Diagram showing structure-based alignment among TGF-β family member proteins. [Source: Shi et al. (Shi, M. et al., "Latent TGF-β structure and activation," Nature, June 15, 2011, Vol. 474 (No. 7351), pp. 343-349, the contents of which are incorporated herein by reference in their entirety.)] Cysteine ​​residues required for interaction with LTBP and / or GARP are boxed. Residues mutated in Kamuracchi-Engelman syndrome are indicated by asterisks. Protease cleavage sites are indicated by upward arrows. Protein modules and secondary structure elements are indicated by black bars. The underlined residues at the N-terminus of GDF-8 alternatively correspond to the predicted signal peptide processing site. "Chimeric module breakpoints" indicate regions where structural features are conserved and provide modules for chimeric protein construction (module exchange between family members) in all family members. The N-terminal region is shown in (A), the internal region is shown in (B), and the C-terminal region is shown in (C). [Figure 9A] 9A-9C present tables showing the percent identity between amino acid sequences found in the TGF-β family, with FIG. 9A demonstrating the percent identity between the proprotein (prodomain and growth factor). [Figure 9B] A figure presenting a table showing the percent identity between amino acid sequences found in the TGF-β family, where the percent identity between growth factor domains is presented in Figure 9B, while the percent identity between pro domains is presented in Figure 9C. [Figure 9C] A figure presenting a table showing the percent identity between amino acid sequences found in the TGF-β family, where the percent identity between growth factor domains is presented in Figure 9B, while the percent identity between pro domains is presented in Figure 9C. [Figure 10-1]Diagram presenting the alignment performed between GDF-8 (myostatin), GDF-11, inhibin A, and the GDF-8 dimer. Arrows indicate cleavage sites. Regions involved in internal interactions are boxed. Black rectangles appear over residues predicted to be involved in steric clashes in the chimeric construct. Asterisks indicate critical breakpoints in the protein modules. [Figure 10-2] Diagram presenting the alignment performed between GDF-8 (myostatin), GDF-11, inhibin A, and the GDF-8 dimer. Arrows indicate cleavage sites. Regions involved in internal interactions are boxed. Black rectangles appear over residues predicted to be involved in steric clashes in the chimeric construct. Asterisks indicate critical breakpoints in the protein modules. [Figure 11] Expression and purification of recombinant antigen and antibody complexes (Coomassie blue stained SDS-PAGE). [Figure 12-1] Figure 1 presents results from the analysis of cell lines stably expressing the TGF-β1 / GARP complex. 300.19 cells stably transfected with an empty vector control (A), proTGF-β1-GARP (B), or TGF-β1LAP-GARP (C) were fluorescently labeled with antibodies directed against the expressed proteins and examined for fluorescence intensity by flow cytometry. Luciferase assay data are presented in (D) and show TGF-β signaling activity obtained from coculture of these cells with cells expressing αvβ6 integrin. [Figure 12-2] Figure 1 presents results from the analysis of cell lines stably expressing the TGF-β1 / GARP complex. 300.19 cells stably transfected with an empty vector control (A), proTGF-β1-GARP (B), or TGF-β1LAP-GARP (C) were fluorescently labeled with antibodies directed against the expressed proteins and examined for fluorescence intensity by flow cytometry. Luciferase assay data are presented in (D) and show TGF-β signaling activity obtained from coculture of these cells with cells expressing αvβ6 integrin. [Figure 13]FIG. 1 shows recombinant histidine-tagged pro-GDF-8 separated by SDS-PAGE under reducing and non-reducing conditions, visualized by Coomassie staining. DETAILED DESCRIPTION OF THE INVENTION

[0018] Growth factors are cell signaling molecules that stimulate a variety of cellular activities. Due to their wide range of influences, growth factor signaling is often linked to other biomolecules, cells, and through interactions with the extracellular matrix and / or the cellular matrix; These interactions are tightly regulated within specific cellular environments or niches. can be indirect.

[0019] The transforming growth factor-β (TGF-β) family of growth factors is involved in the growth of various cells. Growth factor binding to the type II receptor induces type I receptor phosphorylation and activation. Transformation (Denicourt, C. et al., Transformation Another twist in the chronicle of mitochondrial growth factor beta-induced cell cycle arrest t in the transforming growth factor β-in induced cell-cycle arrest chronicle, American Academy of Sciences Academy Bulletin (PNAS), 2003, Volume 100 (No. 26): p.15290~1 Activated type I receptors then phosphorylate receptor-associated SMADs (R-SMADs). promotes consensus SMAD (e.g., SMAD4) dimer / trimer formation and nuclear translocation SMAD complexes cooperate with cofactors to promote the activation of TGF-β family member target genes. Modulates the expression of

[0020] TGF-β family member signaling cascades mediate numerous and diverse biological pathways Examples include, but are not limited to, inhibition of cell growth, tissue homeostasis, extracellular Epithelial-mesenchymal transition (EMT) in extracellular matrix (ECM) remodeling, cell migration and invasion T:endothelial to mesenchymal transition) and involved in immune modulation / suppression and mesenchymal-epithelial transition. Growth inhibition and TGF-β signaling, which is related to tissue homeostasis, is mediated by p21 and p15 INK of It mediates cell cycle arrest in epithelial, endothelial, hematopoietic, and immune cells through activation of my In relation to ECM remodeling, TGF-β signaling can suppress fibroblast growth factor (EFG) production. Increases cell population and ECM deposition (e.g., collagen). The associated TGF-β signaling can affect epithelial and / or endothelial cells, resulting in stem cell-like This aspect of signaling is essential for vascular surgery and / or stent implantation. It may play a role in postoperative smooth muscle cell proliferation. In the immune system, TGF-β ligands , required for T regulatory cell function and maintenance of immune progenitor cell development and homeostasis Nearly all immune cells contain receptors for TGF-β, and TGF-β knockout Mice die after birth, partly due to inflammatory lesions. Finally, TGF-β is a natural Inhibits interferon gamma-induced activation of IL-12 cells (contents are available in their entirety by reference) Wi, J. et al., 2011, Hepatology, Hepatology, Vol. 53 (No. 4), pp. 1342-51.

[0021] The recent elucidation of the crystal structure of the latent form of TGF-β has provided insight into the entire TGF-β family. This is the first study to provide deep insight into these complexes (Shi, M. et al., "Latent TGF-β structure and activation" e and activation,” Nature, June 2011 15th, Vol. 474 (No. 7351), pp. 343-349). Nearly all signaling occurs via heterozygotes containing two type I and two type II receptors. The dimeric ligands are recognized by the dimeric receptor complex through a common pathway. Each receptor has a serine-threonine kinase domain. Type II receptors are similar to type I receptors. phosphorylates the receptor, which then phosphorylates receptor-regulated Smads, which translocate into the nucleus It accumulates in the nucleus and regulates transcription.

[0022] There are 33 different members of the TGF-β family in humans (Figure 1). As a member, bone morphogenetic protein (BMP) protein), inhibin, activin, growth differentiation factor (GDF), nd differential factor), myostatin, nodal, anti-mylolytic TGF-β family members include vasculitic hormones and lefty proteins. , an overview of related signaling molecules and their relationships, the contents of which are incorporated by reference in their entirety. Massague, 2000, Nature Ref., incorporated herein by reference. Views · Molecular Cell Biology (Nature Reviews Mol Cell Biology, Vol. 1, pp. 169-78. In some embodiments, mature growth factors can be synthesized singly with their pro domains. (See FIG. 2.) In some embodiments, such The polypeptide chain may contain a cleavage site for separation of the pro domain from the mature growth factor. In some embodiments, such cleavage sites are recognized by proprotein convertases. and the furin cleavage site that is cleaved.

[0023] In general, the homology between TGF-β family member growth factor domains is relatively high. Interestingly, the prodomain homology is quite low. This lack of homology is due to the family This may be an important factor in altering growth factor regulation between members. The pro domain is responsible for the proper folding and / or dimerization of the growth factor domain. The pro domain can, in some cases, induce growth factor release from the latent form. extracellular matrix (ECM) and / or They have an important function in directing (post-secretion) growth factors to defined locations in the cell matrix. It has only recently been recognized that release from the latent form allows growth factors to travel short distances (e.g., About 1 cell diameter to about a few cell diameters, about 2 cell diameters to about 100 cell diameters, and / or about 10 cell diameters They can act across a cell diameter (approximately 10,000 cell diameters) and clear once they reach the circulation. Some growth factor-prodomain complexes may occur in highly localized environments where they are translocated. In some embodiments, the prodomain-growth factor is secreted as a homodimer. The product complex can be secreted as a heterodimer.

[0024] As used herein, the term "TGF-β related protein" refers to a protein that is a TGF-β isoform, TGF-β family member, or TGF-β family member-related TGF-β family members include, but are not limited to, may include any of those shown in Figure 1 and / or listed in Table 1. These include, but are not limited to, TGF-β proteins, BMPs, myoglobin, and ATP. In some embodiments, the present invention provides a method for treating rheumatoid arthritis, including administering to a patient a therapeutically effective amount of rheumatoid arthritis, including statins, GDFs, and inhibins. To isolate, characterize, and / or modulate TGF-β-related proteins Embodiments of the present invention provide tools and / or methods for detecting TGF-β-associated proteins. Characterizing and / or modulating cellular activities associated with protein signaling In another embodiment, the present invention provides tools and / or methods for The tool includes an antigen comprising one or more components of one or more TGF-β-related proteins. Some tools may include antibodies directed against the antigens of the present invention. In this regard, the tool of the present invention is useful for at least the detection and characterization of TGF-β-related proteins. On the other hand, at least one of the detection and characterization of antibodies directed against TGF-β-related proteins and / or cellular activity associated with TGF-β-related proteins and / or The present invention may include assays for detecting and / or characterizing cell signaling. do.

[0025] Target protein TGF-β-related proteins are involved in numerous cellular processes. Thirty-three members of the TGF-β family of proteins are involved in key developmental processes and many It is involved in the detailed regulation of organ formation. Most of this regulation occurs before birth, but this Millipore is involved in many postnatal processes, including but not limited to immune response, wound healing, and TGF-β-related proteins continue to regulate healing, bone growth, endocrine function, and muscle mass. on November 6, 2012, the contents of each of which are incorporated herein by reference in their entirety. U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, 2012 No. 61 / 722,969 filed on May 15, 2013. Listed and described in filed U.S. Provisional Patent Application No. 61 / 823,552 .

[0026] Exemplary TGF-β family proproteins, i.e., after removal of the secretory signal sequence, A list of proteins is shown in Table 1. Proproteins contain a prodomain and a growth factor. The table below lists the names and precursors of the TGF-β family members from which they are derived. The proprotein sequence is shown. In addition, proprotein convertase cleavage sites are marked in "bold" and " Upon cleavage, the resulting prodomain retains this site while The mature growth factor begins next to the cleavage site. Lefty 1 and Lefty 2 are the mature growth factors. Note that it is not cleaved by a proprotein convertase immediately prior to the initiation of proliferation.

[0027] [Table 1] JPEG2025179097000003.jpg209170 JPEG2025179097000004.jpg217170 JPEG2025179097000005.jpg238170 JPEG2025179097000006.jpg218170 JPEG2025179097000007.jpg231170 JPEG2025179097000008.jpg235170 It was noted that some prodomains can be cleaved by proprotein convertases. As used herein, the term "proprotein convertase" is translated as It refers to an enzyme that cleaves the prodomain from a protein and promotes protein maturation. Some proprotein convertases include subtilisin-like proprotein convertases (SPs). C:subtilisin-like proprotein convertase) The SPC family includes calcium-dependent serine enzymes. and proteases, including but not limited to furin / PAC E, PC1 / 3, PC2, PC4, PC5 / 6, PACE4 and PC7 ( Fuller et al., 2010, the contents of which are incorporated herein by reference in their entirety. 2009, Investigative Ophthalmology and Visual Science (Invest Ophthalmol Vis Sci), Volume 50 (No. 12), p. GDF-11 is in some cases cleaved by PC5 / 6. In some cases, the proprotein convertase may contain additional proprotein convertases other than those shown in Table 1. In some embodiments, the proprotein may be cleaved at the site can be cleaved at the first cleavage site (the first site being the site closest to the N-terminus) In other embodiments, the proprotein is cleaved at a cleavage site other than the first cleavage site. In some cases, proprotein convertase cleavage can occur intracellularly. In some cases, proprotein convertase cleavage can occur extracellularly.

[0028] Many TGF-β family members are synthesized with a prodomain Some of the prodomain may remain associated with the growth factor after cleavage. The association results in latent formation of the nuclei that modulate the availability of growth factors for cell signaling. Growth factors can bind to one or more extracellular domains to form a growth factor-prodomain complex (GPC). It can be released from its latent form in GPC via association with proteins. Long-term factor release may depend on the force applied to the GPC via extracellular protein interactions. Such forces may attract the C-terminal and / or N-terminal regions of GPC, resulting in associated growth factors This results in the release of

[0029] In some TGF-β family members, the prodomain of GPC binds to the growth factor receptor. Responsible for the retention of molecules and blocking the interaction of the retained growth factors with their receptors. The prodomain portion of GPC that functions as a phospholipase C receptor is called the latency-associated peptide (LAP). TGF-β1, 2, and 3 are known to contain LAP. As used herein, the term "LAP-like domain" may refer to a "Lysin" may be structurally similar to LAP or may be synthesized in a similar manner to it, but does not contain growth factors. The prodomain portion of GPC and / or its receptors that cannot function to prevent the molecule / receptor interaction. or the free prodomain. GDF-8 and GDF-11 contain a LAP-like domain. nothing.

[0030] Depending on various factors, growth factors may be free or bound to one or more LAP or LAP-like domains. FIG. 3 shows an example in which a growth factor dimer can associate with a LAP dimer. 1 is a schematic diagram showing morphology. In some embodiments, GPCs inhibit growth factor signaling, Protein models required for different modes of secretion, latent and / or release from latent GPC As used herein, the term "protein module" includes: Refers to any component, region and / or feature of a protein. Protein module can vary in length and contain one or more amino acids. A protein module is approximately 2 amino acids long. Length of about 50 amino acid residues, length of about 5 amino acid residues to about 75 amino acid residues, length of about 10 Length of amino acid residues: up to approximately 100 amino acid residues, length of approximately 25 amino acid residues: up to approximately 150 amino acid residues Base length: about 125 amino acid residues to about 250 amino acid residues; about 175 amino acid residues to about 400 amino acid residues in length, approximately 200 to approximately 500 amino acid residues in length, and / or may be at least 500 amino acid residues in length.

[0031] In some embodiments, a protein module comprises one or more proteins with known functional features. Upper regions (e.g., protein-binding domains, nucleic acid-binding domains, hydrophobic pockets, etc.) The protein modules include growth factor signaling, secretion, latent and / or It may contain functional protein domains required for different modes of release from the latent conformation.

[0032] In some embodiments, the protein module is derived from a TGF-β related protein. Such protein modules include, but are not limited to, latent LAP-associated peptide (LAP), LAP-like domain, growth factor domain, zipper region, a protein convertase cleavage site (e.g., furin cleavage site), a B / TP cleavage site, domain, finger domain, extracellular protein [e.g., latent TGF-β binding protein (LTBP:latent TGF-β binding protein), fibril Glycoprotein A repeat dominant (GARP) A repetition predominant) residues for protein association (e.g., cysteine ​​residues), cryptic loops (referred to herein as cryptic lasso loops), tency lasso), α1 helical region, α2 helical region, RG The D sequence and bowtie region are included in Figure 4. FIG. 1 is a schematic diagram of an embodiment showing LAP and growth factor dimers.

[0033] In some embodiments, the protein module comprises one or more TGF-β isoforms. TGF-β1, TGF-β2, and / or TGF-β3 Such protein modules include the protein modules listed in Table 2 and / or Some protein modules of the present invention may comprise amino acid sequences similar to those in Table 2. However, it may include amino acid sequences that contain additional or fewer amino acids than those listed. An amino acid sequence such as about three more or fewer amino acids; about four more or fewer amino acids; About 5 more or less amino acids, about 6 more or less amino acids, about 7 more About 8 more or fewer amino acids, about 9 more or fewer amino acids Amino acids, about 10 more or fewer amino acids or more or fewer than 10 amino acids The amino acid may be included on the N-terminal and / or C-terminal ends.

[0034] [Table 2] JPEG2025179097000010.jpg226170 JPEG2025179097000011.jpg120170 In some embodiments, the LAP or LAP-like domain is a TGF-β related protein. Contains the prodomain portion of proteins and / or GPC. Some LAP or LAP-like domains Some LAPs can associate with growth factors in the GPC. The LAP or LAP-like domain may sterically prevent long factor association. Some LAP or LAP-like domains may contain a straight jacket region or a straight jacket region. Some LAPs or C-terminal regions may be included, which are referred to herein as "bow-tie regions." In the dimer, the bowtie region of each monomer associates with and Such associations may be involved in the modeling of the TGF-β isoform LAP. This may involve disulfide bond formation such as that found between monomers.

[0035] In some embodiments, the arm region may include a trigger loop region. The group may contain a region that associates with an integrin. Such a region may be RGD (Arg- The region containing the RGD sequence may comprise an amino acid sequence containing Gly-Asp. In some embodiments, the LAP or LAP-like domain The loop contains a latent loop (also referred to herein as a latent lasso). The cryptic loop is a region between the LAP or LAP-like domain and the growth factor receptor within the GPC. The LAP or LAP-like domain may also contain a fastener region. Such fastener regions are present within LAP or LAP-like domains and GPCs. Some fastener regions may be LAP or ATP-like molecules that facilitate growth factor retention. or may maintain a LAP-like domain conformation.

[0036] In some cases, GPC may require enzymatic cleavage for release of bound growth factors. Such cleavage may occur in some cases due to BMP-1 / thrombin-like proteinase (BMP-1 / BMP-1). / TP: BMP-1 / Tolloid-like proteinase) family may be performed by members of the Muir et al., 2011, Journal of Biological Chemistry ( J Biol Chem, Vol. 286 (No. 49), pp. 41905-11). Metalloproteinases include, but are not limited to, BMP-1, mammalian T cells, and the like. mammalia tolloid protein (mTLD), mammalian tolloid-like 1 (mTLLl) n tolloid-like 1) and mammalian tolloid-like 2 (mTLL2:mam malian tolloid-like 2) is an example of such a meta. Exemplary GPCs that can be cleaved by proteinases include, but are not limited to, However, GDF-8 and GDF-11 may be mentioned. -8 can be cleaved by mTLL2. In some cases, tolloid cleavage occurs intracellularly. In some cases, toroid cleavage can occur extracellularly.

[0037] The straight jacket region may include an α1 helical region. The α1 helical region may be located between growth factor monomers. , which contains the N-terminal region of the LAP or LAP-like domain. The α1 helical region is involved in extracellular association. Such extracellular associations may also include N-terminal regions for extracellular matrix proteins. It may contain proteins associated with the extracellular matrix and / or extracellular matrix. Examples of exogenous associations include, but are not limited to, LTBPs (e.g., LTBP1, LTBP2, LTBP3, LTBP4, LTBP5, LTBP6, LTBP7, LTBP8, LTBP9, LTBP10, LTBP11, LTBP12, LTBP13, LTBP14, LTBP15, LTBP16, LTBP17, LTBP18, LTBP BP2, LTBP3 and / or LTBP4), fibrillin (e.g., fibrillin -1, fibrillin-2, fibrillin-3 and / or fibrillin-4), pearl Can, decorin and / or GARP (e.g., GARP and / or LRRC33 N-terminal extracellular associations may include association with proteins such as cysteine. In some cases, the extracellular matrix protein may contain disulfide bonds between amino acid residues. Proteins associated with proteins and / or extracellular matrix contain regions other than the N-terminal region. The binding may involve binding to one or more regions of the LAP / LAP-like domain of

[0038] In some embodiments, the growth factor domain comprises one or more growth factor monomers. Some growth factor domains include growth factor dimers. Such growth factor domains include: Growth factor homodimers or heterodimers (composed of different TGF-β-related proteins) Some growth factor domains may contain finger regions. Such finger regions may comprise β-pleated sheets. Some finger regions may associate with LAP or LAP-like domains. The protein may maintain the association between the ATP and the LAP or LAP-like domain.

[0039] In some embodiments, the recombinant protein of the present invention is a growth differentiation factor (GDF) protein. Such GDF protein modules may include protein modules from proteins. may contain protein modules and / or amino acid sequences listed in Table 3. In an embodiment, the protein modules of the invention are similar to those in Table 3, but with the following listed: Some such sequences may include amino acid sequences containing additional or fewer amino acids than those listed. A suitable amino acid sequence may have about one more or fewer amino acids, about two more or fewer amino acids, or Acids, about 3 more or less amino acids, about 4 more or less amino acids, about 5 more Few or fewer amino acids, about 6 more or fewer amino acids, about 7 more or fewer amino acids No amino acids, about 8 more or less amino acids, about 9 more or less amino acids , about 10 more or fewer amino acids or more or fewer than 10 amino acids It may be included on the terminus and / or C-terminus.

[0040] [Table 3] JPEG2025179097000013.jpg163170 Some recombinant proteins of the present invention are related to GDF-15, the GDF-15 signaling pathway, It may include associated proteins and / or modules and / or portions thereof. DF-15 is a TGF-β family protein that is highly expressed in the liver. Expression of -15 is significantly upregulated after liver injury (Hsiao et al., 200 2010, Molecular and Cellular Biology (Mol Cell Biol) 20 (No. 10), pp. 3742-51). Furthermore, its expression in macrophages provides a protective function against atherosclerosis, possibly through regulating adhesion molecule expression. (Preusch et al., 2013, European Journal of of Medical Research (Eur J Med Res, Vol. 18, p. 19) GDF-15, a member of the TGF-β family, shares less than 30% homology with other members. While including the above, it makes it the most diverse member of the family (the contents of which are entirely incorporated by reference). Tanno et al., 2010, Current Opinion, incorporated herein by reference. Curr Opin Hematol, Vol. 17 (3rd The mature form is soluble and can be found in the bloodstream. Interestingly, circulating GDF-15 levels were negatively correlated with hepcidin levels. This suggests a role for GDF-15 in iron loading and / or metabolism. suggested (Finkenstedt et al., 2008, British British Journal of Haematology Haematology, Vol. 144, pp. 789-93). The increase may be due to, for example, ineffectiveness in subjects with β-thalassemia or dyserythropoietic anemia. It is also associated with inflammatory and / or apoptotic erythropoiesis.

[0041] In some embodiments, the recombinant proteins of the present invention are derived from activin subunits. Such protein modules may include the protein modules listed in Table 4. Protein modules and / or amino acids of the activin subunit inhibin βA In some embodiments, the protein module of the invention may comprise a sequence of includes amino acid sequences similar to those listed, but containing additional or fewer amino acids than those listed. Some such amino acid sequences may have about one more or fewer amino acids, about two more or two less. More or fewer amino acids, about 3 more or fewer amino acids, about 4 more or Fewer amino acids, about 5 more or fewer amino acids, about 6 more or fewer amino acids Acids, about 7 more or less amino acids, about 8 more or less amino acids, about 9 more Few or few amino acids, about 10 more or fewer amino acids, or more than 10 more The amino acid sequence may contain more or fewer amino acids on the N- and / or C-terminal ends.

[0042] [Table 4] The growth factor domains among TGF-β family members are more highly conserved. On the other hand, the pro domain contains a much lower percent identity between family members (Figure 9 Table 5 demonstrates this trend among TGF-β isoforms.

[0043] [Table 5] The pro domain may be about 50 to about 200, about 100 to about 400, or about 300 to about 500 in length. In some embodiments, the pro domain can vary from about 169 to 200 amino acid residues. The pro domain spans approximately 433 residues. The pro domain is unrelated and / or homologous in sequence. Some prodomains have similar folds and / or three-dimensional structures. The pro domain of a TGF-β family member may contain a cryptic loop. Such loops can be proline-rich. The length of the cryptic loop is determined by the length of the growth factor receptor. The ability of such loops to surround a ring region can be determined.

[0044] In some embodiments, protein molecules from some TGF-β family members The module shares low sequence identity with protein modules from other TGF-β family members. Such low sequence identity is indicative of distinct protein modules. Specialized roles for such family members may be indicated.

[0045] Association of GPC with extracellular proteins can enhance prodomain-growth factor interactions In some embodiments, such extracellular proteins include, but are not limited to, However, some examples include LTBP, fibrillin, and / or GARP. In some cases, extracellular protein associations keep growth factors in their latent form in GPC. It is required to do so.

[0046] GARP expression has been shown to be required for the surface expression of GPC on the surface of cells of hematopoietic origin. (Tran, DQ et al., "GARP (LRRC32) The surface expression of latent TGF-β on platelets and activated FOXP3+ regulatory T cells was impaired. GARP (LRRC32) is essential for the surface expression of latent TGF-β on pla telets and activated FOXP3+ regulatory T Proceedings of the National Academy of Sciences (PNAS), June 2, 2009, No. 10 6 (No. 32), pp. 13445-50). GARP is a type of cell that Although not defined, localizing GPC on the surface of regulatory T cells and / or platelets The tether may act as a tether to hold the device in place.

[0047] In some embodiments, the recombinant protein of the present invention is a TGF-β related protein. Proteins containing sequences from the BMP family may include bone morphogenetic proteins (BMPs). The quality module may include sequences from any of the BMP modules disclosed in FIG. While related to other TGF-β family member proteins, BMPs are generally Signaling through SMAD1, 5, and 8 proteins, while TGF-β isoforms Forms (e.g., TGF-β1, TGF-β2, and TGF-β3) interact with SMAD2 and and signals through SMAD3.

[0048] Some BMP receptors and / or co-receptors also interact with other TGF-β family members. Among these, there is a secreted guidance molecule (RGM) protein. ) family. RGM-like proteins act as co-receptors for BMP signaling. Three RGM family members, RGMA, RGMB, and RGMC [hemoglobin] Also known as Jubelin (Hjv). The recombinant proteins of the invention, including the nucleotide sequence, were tested for BMP interaction with RGM-like proteins, Useful for developing antibodies and / or assays to enhance and / or perturb could be.

[0049] Another family of GDF / BMP interacting proteins is the C-terminal cysteine ​​knot-like ( CTCK) domain-containing proteins. In some cases, CTCK domain-containing The protein may act antagonistically with respect to GDF / BMP signaling. TCK domain-containing proteins include, but are not limited to, Cerberus (Ce rberus), connective tissue growth factor (CTGF), DAN domain family member 5 (DAND5), Gremlin-1 (GREM1), Gremlin-2 (GREM2), Whip Mucin-19 (MUC19), mucin-2 (MUC2), mucin-5AC (MUC5AC), Mucin-5B (MUC5B), mucin-6 (MUC6), oncogenic neuroblastoma suppressors -(neuroblastoma suppressor of tumorigenesis) city)1(NBL1), Norrin(NDP), Otog elin) (OTOG), otogelin-like protein (OTOGL), protein CYR6 1 (CYR61), protein NOV homolog (NOV), sclerostin (SOST) , sclerostin domain-containing protein 1 (SOSTDC1), SCO-spondin ( SSPO), Slit homolog 1 protein (SLITl), Slit homolog 2 protein Slit homolog 3 protein (SLIT2), von Willeb Wnt1-inducible signaling pathway protein 1 (WISP1) and and WNT1-inducible signaling pathway protein 3 (WISP3).

[0050] Recombinant proteins In some embodiments, the present invention provides recombinant proteins. When used, the term "recombinant protein" refers to a protein derived from a man-made gene and / or process (e.g., Recombinant proteins are proteins produced by genetic engineering (e.g., recombinant proteins). may comprise one or more protein modules from one or more TGF-β-related proteins. Some of the recombinant proteins disclosed herein may be useful as recombinant antigens. As used herein, the term "recombinant antigen" refers to the antigen present on such a recombinant antigen. Immunizing one or more hosts for the production of antibodies directed against one or more epitopes. Some recombinant antigens are cell-based. As used herein, the term "cell-based antigen" refers to an antigen that is expressed on a cell surface. refers to recombinant antigens expressed in cells for presentation of such antigens on a surface. Such cells are used to immunize a host for the production of antibodies directed against cell-based antigens. can be used.

[0051] In some embodiments, the recombinant proteins disclosed herein are used as therapeutic agents. The recombinant proteins disclosed herein can be used to express one or more of the following: Growth factors (e.g., TGF-β-related proteins) may be administered and / or introduced into the niche. and / or signaling) of growth factors, including ATP. do.

[0052] In some embodiments, the recombinant proteins disclosed herein are growth factors (e.g., Growth factors, including TGF-β-related proteins) levels and / or activity (e.g., signaling Some recombinant tags disclosed herein can be used to assay for the presence of ribosomal proteins. The protein can be used in isolating antibodies directed against TGF-β related proteins. The recombinant proteins of the present invention can be stabilized [dissociation between two active substances (e.g., GP C, GPC release from one or more protein interactions) or prevent] and / or release [dissociation between two agents (e.g., from GPC of antibodies that enhance growth factor release, GPC release from one or more protein interactions The recombinant proteins of the present invention can also be used as recombinant antigens in T GF-β family member proteins and their components and / or proteins Some recombinant proteins of the present invention may contain modules that do not have associated growth factors. Rhododomain, furin cleavage-deficient mutants, and mutants defective in extracellular protein association and / or combinations thereof.

[0053] In some embodiments, the recombinant protein may include a detectable label. Suitable labels may be used to allow detection and / or isolation of the recombinant protein. Some detectable labels include biotin labels, polyhistidine tags and / or Such tags may include a flag tag, which can be used to isolate the tagged protein. The protein produced contains one or more 3C protease cleavage sites. Such sites may contain additional amino acids that act as cleavage sites for 3C proteases, e.g., limiting Although not intended to be used as a therapeutic agent, the 3C protease produced by treatment with rhinovirus 3C protease Such cleavage sites allow cleavage at the enzyme cleavage site. The detectable label is introduced to allow removal of the detectable label from the substrate.

[0054] Recombinant GPC Figure 5 is a schematic diagram showing an embodiment of recombinant GPC. TGF-β family members Recombinant proteins according to FIG. 5, including proteins, may include, but are not limited to, However, the C-terminal region of the mature growth factor, the N-terminal region of the prodomain and / or the prota The proprotein cleavage site of the recombinant TGF-βGPC may be, for example, For example, it may contain the furin consensus sequence RXXR, where R is arginine and X is T. The amino acid residues that may vary among TGF-β family members are shown. Furin cleavage site sequences for family members (including but not limited to Furin (including cleavage by phosphodiesterase alone and cleavage by other proprotein convertases) The recombinant GPC according to the embodiment shown in Figure 5 contains the N-terminal region of the pro domain. It may also contain one or more cysteine ​​residues in and / or near such a region. The residues are about 1 to about 10 amino acids, about 4 to about 15 amino acids, about 5 amino acids, or about 6 amino acids from the N-terminus of the prodomain. The recombinant GPC may consist of about 20 to about 20 amino acids and / or about 7 to about 50 amino acids. It may also contain a detectable label. Such a detectable label may be used for detecting and / or labeling the recombinant GPC. The detectable label may be a label containing two or more histidine (His) residues. Such detectable labels are referred to herein as polyhistidine tags. A polyhistidine tag can also be a hexameric tag containing a chain of six histidine residues. Histidine tag or HIS-TAG™ (EMD Biosciences) iosciences, Darmstadt, Germany). A histidine tag may be present at the N-terminus of the recombinant proteins disclosed herein. The polyhistidine tag at the C-terminus of the recombinant protein disclosed herein is The protein produced contains an additional gene encoding one or more 3C protease cleavage sites. Such sites may include amino acids such as 3C proteases, including but not limited to: but not the 3C protease cleavage site upon treatment with rhinovirus 3C protease. Some cleavage sites allow for the release of detectable labels from the recombinant protein. can be introduced to allow removal of

[0055] In some embodiments of the invention, the recombinant GPC has one or more amino acids that are different from the wild-type sequence. In some cases, the mutation may include a mutation in one or more amino acids involved in proteolytic processing. One or more regions can be mutated. Such regions are involved in the proprotein conversion. It may contain an enzyme cleavage site. The difference is to prevent enzymatic cleavage at that site and / or to block the activity of those prodrugs of growth factors. Some proproteins containing the RXXR sequence prevent enzymatic cleavage from the main chain (see Figure 6). The protein convertase cleavage site is RXG (X indicates a site where the amino acid residue can be varied). ) such mutations are referred to herein as "D2G" In some embodiments, R The furin cleavage site containing the XXR sequence is mutated to AXXA. The A sequence may also be resistant to enzymatic cleavage.

[0056] In some embodiments, protein synthesis by toroid and / or toroid-like proteins The proteolytic processing region is designed to prevent such proteolytic processing. In some embodiments, GDF-8 and / or G The toroid processing region on DF-11 can be mutated. In this configuration, the aspartic acid residue in the toroid processing region is replaced by an alanine residue. The GDF-8 (myostatin) proprotein is a ubiquitous protein that inhibits myostatin processing. Mutation of asparagine residue 76 (D76) in the protein inhibits proteolysis of latent GDF-8. It has been shown to prevent activation of M. et al., Proceedings of the National Academy of Sciences (PNAS), October 6, 2003, Vol. 100 (No. 26), pp. 15842-15846). In some embodiments, As in GDF-11 p120 (D120, residue number counted from the translated protein, p120 of SEQ ID NO: 4) D98 from the rRNA protein is mutated to prevent rRNA processing (Ge et al., 2005, Molecular and Cellular Biol. Mol Cell Biol, Vol. 25 (No. 14), pp. 5846-588. the contents of which are incorporated herein by reference in their entireties).

[0057] In some embodiments, one or more recombinant GPCs are used to form a recombinant GPC with reduced latency. Amino acids can be mutated. Such mutations are referred to herein as "active These mutations are called "activating mutations." These mutations affect the complex prodomain and growth factor domain. As used herein, one or more areas of steric clash between domains may be introduced. The term "steric clash" refers to a clash between two proteins or between two domains and domains within the same protein. When referring to interactions between epitopes and / or epitopes, this refers to interactions resulting from overlapping positions in three-dimensional space. This refers to repulsive interactions between proteins, domains and / or epitopes such as G Steric clashes in PC may reduce the affinity between the prodomain and growth factor domain, leading to reduced activity. In some embodiments, the ratio of isolated growth factors to latent growth factors is increased. One or more amino acids can be mutated to form improved recombinant GPC. Such mutations are referred to herein as "stabilizing mutations." Mutations in the α-terminal region of the α-terminal region of the β ... This results in a decrease in the ratio of free growth factors to growth factors.

[0058] In some embodiments, the recombinant protein of the present invention comprises a sequence listed in Table 6 or a sequence thereof. The fragment may include any of these fragments.

[0059] [Table 6] JPEG2025179097000017.jpg196170 JPEG2025179097000018.jpg213170 JPEG2025179097000019.jpg158170 In some embodiments, the activating mutation is a LAP or LAP-like protein dimer. Some activating mutations may involve residues important for activation of TGF-β isoforms (T activating mutations in TGF-β1, TGF-β2, and / or TGF-β3. Mutational GPC is a common cause of Kamurati-Engelman disease (CED). containing mutations corresponding to those identified in Germann disease Subjects suffering from CED typically have a genetic abnormality in TGF-β1. Mutations identified in such subjects include, but are not limited to, residue Y Mutations at residues C2, C3, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C225, C24, C25, C26, C27, C28, C29, C21, C22, C23, 23 and C225 are required for disulfide bond formation in LAP dimerization. Mutations at R218, H222, C223 and / or C225 result in disulfide bonds This may result in the attenuation or disruption of the formation and dimerization of LAP. CED mutations also result in increased TGF-β release and / or increased TGF-β activity. In some embodiments, a recombinant GTPase comprising TGF-β1 with a CED mutation is provided. The PCs contain the sequences listed in Table 7. The amino acid substitutions shown in these proteins are Residue number counted from the start of the translated protein (before removal of the secretory signal sequence) Reflects.

[0060] [Table 7] JPEG2025179097000021.jpg129170 Some GPCs containing CED mutations can be used in the context of the present invention. In certain embodiments, such GPCs comprise LAP or LAP complexed with GARP. It can be used to produce recombinant proteins containing AP-like domains. Co-expression of C with GARP in some embodiments ensures proper assembly and folding. Through expression of GPC containing CED mutations, growth factors may be required for the desired The Y81H mutation is useful in this regard. The Y81H mutation results in growth factor release, but the C223 and C225 residues The disulfide bond between the LAP monomers in the Y81H group is not disrupted. The GARP-LAP complex formed through the expression of GPC mutants is dissociated when growth factors are released. In some embodiments, the LAP dimer may contain intact LAP dimers that have been purified during the production process. Additional co-expression of furin or addition of excess furin similarly improved growth factor dissociation. obtain.

[0061] GPCs containing CED mutations are expressed in a manner that allows for the production and release of mature growth factors. Some of the GPC-free growth factors expressed by this method can be expressed, for example, Used to assess antibody reactivity in enzyme-linked immunosorbent assays (ELISAs) Some GPCs containing CED mutations may inhibit the production and function of GPC-binding growth factors. GPCs containing CED mutations can be expressed to allow for release. TGs expressed with one or more protein modules from TGF-β family members Chimeric proteins containing F-β1LAP (or protein modules or fragments thereof) Such chimeric proteins can be expressed to allow for the production and release of proteins. Proteins bind to TGF-β1LAP and TGF-β2 or TGF-β3 growth factor domains. may include:

[0062] Furin cleavage of the recombinant protein of the present invention may occur intracellularly in some cases. In some cases, furin cleavage of the recombinant protein of the invention may occur extracellularly. .

[0063] In some embodiments, the recombinant GPC of the present invention comprises one or more N As used herein, the term "extracellular association" may include mutations in the terminal region. "N-terminal region for extracellular association" refers to a protein that may be required for extracellular association with one or more N-terminal regions. This refers to a region at or near the N-terminus of a protein. at least the first 5 N-terminal residues, at least the first 10 N-terminal residues a nucleotide sequence, at least the first 20 amino acid residues and / or at least the first 50 amino acid residues Some mutations may involve about 1 amino acid residue to about 30 amino acid residues. residues, about 5 amino acid residues to about 40 amino acid residues and / or about 10 amino acid residues The protein may contain from about 50 amino acid residues to about 50 amino acid residues at or near the N-terminus of the protein. Such regions provide residues for LTBP, fibrillin, and / or GARP association. In some cases, the amino acid sequence may include a group within the N-terminal region and / or One or more cysteine ​​residues in the vicinity of the cysteine ​​residue may be required for such association. In this embodiment, the presence of a nucleotide sequence within and / or near the N-terminal region for extracellular association The cysteine ​​residues present are approximately the first two N-terminal residues, approximately the first three N-terminal residues, and approximately the first 4 N-terminal residues, approximately the first 5 N-terminal residues, approximately the first 6 N-terminal residues, approximately the first 7 within the first 30 N-terminal residues and / or at least the first 30 N-terminal residues. Some mutations in one or more N-terminal regions for exoprotein assembly may be cysteine ​​residues, such as Such mutations include substitutions and / or deletions of GPC and / or prodromes. and one or more extracellular proteins, for example, but not limited to, LTB These interactions may modulate the association of ATP with ATP, fibrillin, and / or GARP. Mutations may also include substitution of one or more cysteines with another amino acid. The substitution is abbreviated herein as "C#X," where # is the residue number of the original cysteine ​​residue [ [counting from the N-terminus of the proprotein (without signal peptide)], and X represents The single letter amino acid code for the amino acid used in the substitution is shown. Any amino acid can be used. In some cases, a cysteine ​​residue can be substituted. A non-limiting example of such a mutation is the C4 Examples of N-terminal promoters from TGF-β1 include C5S, C5S, and / or C7S. In the recombinant GPC containing the domain region, the remaining systemic amino acid residue at amino acid position 4 was The amino acid residues can be mutated by cloning the N-terminal prodomain region from TGF-β2. In the recombinant GPC containing The recombinant GP containing the N-terminal prodomain region from TGF-β3 can be mutated. In C, the cysteine ​​residue at position 7 can be mutated.

[0064] In some cases, one or more cysteines in one or more other regions of the GPC are substituted In some embodiments, such GPC modifications can be In some cases, such synaptic domains may facilitate the release of mature growth factors from the synaptic domain. Stains include mature growth factors, α2 helix, zipper, latent lasso and / or Or, it may be present in one or more of the bowtie regions.

[0065] In some embodiments, the recombinant proteins of the present invention are derived from one or more species, e.g., mammals. Mammalian animals, including but not limited to mice, rats, rabbits, pigs, monkeys, and The recombinant protein may comprise protein modules of human and / or human origin. 8. One or more amino acid sequences derived from one or more non-human protein sequences. In some cases, the recombinant proteins of the present invention may contain one or more amino acids. It may contain such sequences with or without a signal peptide.

[0066] [Table 8] JPEG2025179097000023.jpg208170 JPEG2025179097000024.jpg236170 JPEG2025179097000025.jpg209170 JPEG2025179097000026.jpg209170 JPEG2025179097000027.jpg215170 JPEG2025179097000028.jpg153170 JPEG2025179097000029.jpg201170 JPEG2025179097000030.jpg235170 JPEG2025179097000031.jpg225170 JPEG2025179097000032.jpg159170 In some embodiments, the recombinant protein is combined with one or more additional recombinant components. Such components may be combined and / or complexed with: Extracellular proteins known to associate with GPC, including but not limited to , LTBP, fibrillin, perlecan, GASP1 / 2 protein, follistatin, Follistatin-related genes (FLRG), decorin and / or GARP (e.g., Examples include, but are not limited to, recombinant forms of such proteins. Some recombinant GPCs of the present invention require their own specificity for proper expression and / or folding. The protein must be co-expressed with one or more extracellular proteins such as

[0067] In some embodiments, the conjugated LTBP includes, but is not limited to, L Examples include TBP1, LTBP2, LTBP3 and / or LTBP4. The combined LTBP may contain LTBP fragments and / or mutations. Some recombinant forms of LTBP that incorporate the LTBP gene are also expressed by alternative splicing of LTBP. Some such variants of LTBP1 may contain a short amino acid sequence at the N-terminus. Some recombinant proteins of the present invention The substance may comprise an LTBP, a fragment or mutant thereof, comprising an amino acid sequence listed in Table 9. .

[0068] [Table 9] JPEG2025179097000034.jpg157170 JPEG2025179097000035.jpg145170 In some embodiments, the LTBP may comprise a detectable label. , used to enable the detection and / or isolation of recombinant proteins, including LTBP. Some detectable labels include biotin labels, polyhistidine tags and / or or a Flag tag. Such tags can be used to isolate the tagged protein. The protein produced may contain one or more 3C protease cleavage sites. Such sites may include additional amino acids encoding 3C proteases, e.g. rhinovirus 3C protease upon treatment with, but not limited to, rhinovirus 3C protease. Such cleavage sites allow cleavage at the enzyme cleavage site of the recombinant protein. A detectable label can be introduced to allow removal of the detectable label from the sample.

[0069] In some embodiments, GARP, for example, but not limited to, GARP The recombinant GPC of the present invention can be complexed with recombinant GPC. C can be co-expressed with GARP to ensure proper folding and / or expression. In another embodiment, a GARP homolog, a leucine-rich repeat-containing leucine rich repeat containing)33(LRRC3 3), or fragments and / or mutants thereof, can be used instead of the nucleotide sequence of the amino acid ... Such LRRC33 fragments and / or mutants include those listed in Table 10 below. The recombinant GARP may contain one or more regions from the RRC33 sequence. Some recombinant GARPs may be soluble (see the specification). (referred to in the document as sGARP).

[0070] In some embodiments, the recombinant GARP has one or more amino acid sequences listed in Table 10. Some recombinant GARPs used herein may contain the N-terminal residues AQ. The expressed GARP may contain a detectable label. Such detectable labels can be used to allow detection and / or isolation. Some detectable labels include biotin labels, polyhistidine tags and / or flash tags. Such tags can be used to isolate the tagged protein. The protein produced encodes one or more 3C protease cleavage sites. Such sites may include additional amino acids. Although not a rhinovirus 3C protease cleavage site, it is cleaved by rhinovirus 3C protease upon treatment with the rhinovirus 3C protease. The 3C protease cleavage site allows cleavage at the site from the recombinant protein. A detectable label can be introduced to allow for its removal.

[0071] [Table 10] JPEG2025179097000037.jpg81170 GPC bound to LTBP binds to GARP or other matrix proteins can adopt a three-dimensional conformation distinct from that found for GPC This may be due to the lack of available disulfide bond formation on GARPs. Disulfide bond formation with GPC containing cysteines at different distances from each other than the corresponding This may be due to the presence of an available cysteine ​​on LTBP. The differences may provide unique conformation-dependent epitopes on the GPC. Thus, the antibodies of the present invention are directed against such conformation-dependent epitopes. Such antibodies may be directed to the identity of the binding protein (e.g., LTBP or GARP). They can selectively function to activate or inhibit growth factor activity depending on the In this study, different conformational epitopes were identified on the proteins bound to LTBP or GARP. It may be present on the N-terminal α-helix of TGF-β.

[0072] The recombinant protein of the present invention is a GDF-associated serum protein (GASP). Co-expressed with GASP-1 and / or GASP-2 Such recombinant proteins include, but are not limited to, GASPs can include GDF-1, GDF-2, and / or GDF-3. 8 and GDF-11, a circulating protein that binds to them and prevents their activity (Hill, J. J. (Hill, JJ) et al., 2003, Molecular Endocrinology (M ol Endocrinology), Vol. 17 (No. 6), pp. 1144-54 and Hill, JJ et al., 2002, Journal of Biochemistry Journal of Chemical Chemistry (JBC), Vol. 277 (No. 43), pp. 40735-41, (The contents of each of which are incorporated herein by reference in their entirety.) In contrast, GDF-8 and GDF-11 growth factors are not found free in serum. is present in the GPC, and the remaining 30% is GASP and other proteins (e.g., follistatin It associates with GASP-1 and Studies using mice lacking expression of myostatin and / or GASP-2 have shown that or GDF-11 hyperactivity phenotype (Lee et al., 2013, USA) Proceedings of the National Academy of Sciences (PNAS), Volume 110 (No. 39), pp. E3713-22. GASP-bound GDF-8 and / or GDF-11 do not bind to type II receptors and are related It cannot transmit cell signals.

[0073] Some recombinant proteins can be co-expressed with perlecan. Examples of proteins include, but are not limited to, GDF-8. Sengle et al. (Sengle et al., 2011, Journal J Biol Chem, Vol. 286 (No. 7) No. 5, pp. 5087-99, the contents of which are incorporated herein by reference in their entirety. A study by et al. found that the GDF-8 prodomain associates with perlecan. A study showed that perlecan knockout resulted in muscle hypertrophy, which was associated with GDF These results suggest that the interaction between GDF-8 and perlecan may contribute to GDF-8 activity (Schwartz et al., 2011). Xu et al., 2010, Matrix Biol. , Vol. 29 (No. 6), pp. 461-70).

[0074] In some cases, the recombinant protein of the present invention comprises follistatin and / or F Such recombinant proteins can be co-expressed with LRG. Although not the only known factor, GDF-8 can be mentioned. On the other hand, some TGF-β family member proteins, including but not limited to Although it is not known to inhibit GDF-8, it is known to antagonize GDF-8 (Lee, SJ. SJ. et al., 2010, Molecular Endocrinology Rinol), Vol. 24 (No. 10), pp. 1998-2008, Takehara-Kasamatsu, Y. (Takehara-Kasamatsu, Y.) et al., 2007, Journal J Med Invest, Vol. 54 ( Nos. 3-4, pp. 276-88, the contents of each of which are incorporated herein by reference in their entirety. (Incorporated herein). Follistatin binds to free growth factors and prevents receptor binding. Follistatin and FL have been shown to block GDF-8 activity by inhibiting Both RGs are involved in modulating growth factor activity during development.

[0075] In some embodiments, the recombinant proteins of the present invention are co-expressed with decorin. Such recombinant proteins include, but are not limited to, TGF- Decorin is a known antagonist of TGF-β activity. Zhu, J. et al., 2007, Journal of J Biol Chem, Vol. 282, p. 2585 2-63, the contents of which are incorporated herein by reference in their entirety), other TGF-β Family members, including but not limited to, GDF-8, also act as antagonists. Decorin-dependent inhibition of TGF-β and GDF-8 activity can be used to detect fibroblast growth factor-1 (FGF-β) and GDF-8 activity in various tissues. Decorin expression has been shown to reduce fibrosis, a known inhibitor of free GDF-8. It has also been shown to increase the expression of follistatin in bitters.

[0076] In some embodiments, the recombinant protein of the present invention may include that shown in FIG. Some recombinant proteins of the present invention are derived from the protein modules from the embodiment shown in FIG. The present invention may include one or more features and / or combinations of the following modules:

[0077] Recombinant growth differentiation factors (GDFs), activins and inhibins Growth differentiation factors (GDFs), activins and inhibins mediate the proliferation of many cells and / or It is a TGF-β family member protein involved in developmental activity. In embodiments, the recombinant protein is one or more of GDF, activin and / or inflammatory cytokines. In a further embodiment, the protein may comprise one or more protein modules from rhinhibin. The GDF protein module may be a GDF-8 and / or GDF-11 protein module. It may include a module.

[0078] GDF-8 and GDF-11 (Sengl) are secreted as latent complexes. e) et al., 2011, Journal of Biological Chemistry (J Bio Chem, Vol. 286 (No. 7), pp. 5087-99; Ge et al., 200 5 years, Molecular and Cellular Biology (Mol Cell Biol) , Vol. 25 (No. 14), pp. 5846-58) shows the conservation of zipper residues (TG Lys27 and Tyr75 of F-β1; see Figure 8). Ostatin) is involved in the regulation of muscle mass, and its deficiency can lead to the development of several diseases, e.g. Increases muscle mass in humans (Rodino-Klapak, LR (Rodino-K Lapac, LR et al., 2009, Muscle and Nerve Nerve, Vol. 39 (No. 3), pp. 283-96). GDF-8 is a latent form of It can be found in the circulation, bound to LTBP3 (Andersson et al. n et al., 2007, Journal of Biological Chemistry (J Bio Chem), Vol. 283 (No. 11), pp. 7027-7035), or perlecan (Sengle et al., 2011, Journal of Biology) J Biol Chem, Vol. 286 (No. 7), p. 5087 ~99) and can also be stored in the extracellular matrix. GDF-8 is a ubiquitous cytosolic steroid. While complexed with the type II receptor ActRIIB, it cannot participate in receptor binding (Se Sengle et al., 2008, Journal of Molecular Biology G. (J Mol Biol., Vol. 381 (No. 4), pp. 1025-39.) GDF-8 is expressed primarily in muscle, whereas GDF-11 expression is more systemic. Its activity is thought to be involved in multiple processes (Lee et al., 2013 Proceedings of the National Academy of Sciences (PNAS), Vol. 110 (No. 39), p.E3713~ 22) This has been shown to be effective in multiple tissues, including but not limited to the retina, kidney, and pancreas. It is thought to be involved in the development of the olfactory system and is a circulating factor in the blood. (Sinha, M. et al., 2014, Science Exchange Science Express, Vol. 10, 1126 / science. 1251152, pp. 2-6 and Katsimpardi, L. ) et al., 2014, Science Express, Vol. 10, 1126 / science.1251141, their respective contents are referred to (Incorporated herein in its entirety by reference thereto).

[0079] GDF-8 and GDF-11 also share considerable homology: the prodomain is 48% While they share only a small homology with the GDF-8 and GDF-11 growth factor domains, The prodomains share 90% homology (60% homology when the prodomain and growth factor domains are combined). Same sex).

[0080] The release of GDF-8 and GDF-11 from latent GPCs is mediated by BMP1 / thrombin. BMP / Thoroid cleavage sites (Arg75 and A in GDF-8) by phosphoproteinases between Gly97 and Asp98 in GDF-11) This requires a domain cleavage between the α2 helix and the zipper. Therefore, there are at least two different ways to untie a straightjacket: force and tension. Protein degradation can release family members from the latent form.

[0081] In some embodiments, the recombinant protein of the present invention comprising a GDF is selected from the group consisting of: It may comprise the sequence or a fragment thereof.

[0082] [Table 11] JPEG2025179097000039.jpg204170 JPEG2025179097000040.jpg74170 Activins and inhibins are TGF-β family member proteins. Their respective activities often result in opposite functions (Bilezikjian Kjian et al., 2012). As with other family members, these proteins Activins and inhibins occur physiologically as dimers. Inhibin-βA, inhibin-βB, inhibin-βC and inhibin-βE (as described herein) β-subunits A, B, C, and E, respectively, may be included in the Activins and inhibins are constructed from β-subunits. Activins are β-subunit dimers, while inhibins are heterodimers The second subunit is inhibin-α. Activin A is named after the two A subunit pairs. and activin AB comprises a dimer of A and B subunits, B contains a dimer of B subunits, etc. (Muenster Activins are known to regulate, by way of example but not limitation, cell growth, differentiation, and differentiation. These include various functions such as oxidization, programmed cell death, endocrine function, cell metabolism, and bone growth. These are particularly recognized for their control of the reproductive hormone cycle. Activin and inhibin signaling function antagonistically in this regard This is often the case.

[0083] In some embodiments, the recombinant protein of the present invention may comprise an integrin. Integrin is a cell surface heterodimer formed by α and β subunits. Each of these has a transmembrane domain and is joined together in the N-terminal portion of the extracellular domain. The recombinant protein of the present invention binds to integrins and / or Such integrins and / or integrin subunits may be included. Tegrin subunits are described in detail in Japanese Patent Application Publication No. 2012-201344, the contents of which are incorporated herein by reference in their entirety. Disclosed in U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, It may include any of the following.

[0084] The recombinant protein of the present invention includes intercellular adhesion molecule 1 (ICAM-1). cellular adhesion molecule 1). In some cases, the ICAM-1 protein of the present invention may be used for antibody generation and / or antibody testing. In some cases, ICAM-1 can be used as a control protein between can be used as a control during the selection of binding molecules using phage display technology. In some cases, the ICAM-1 proteins of the present invention can be used to detect one or more Detectable labels include, for example, histidine tags. Cut.

[0085] Chimeric proteins In some embodiments, the recombinant proteins of the present invention may include chimeric proteins. As used herein, the term "chimeric protein" refers to a protein that is composed of at least two different Proteins from the same gene (e.g., barriers arising from alternative splicing) one or more protein modules from a single gene (or from different genes) A chimeric protein refers to a protein that contains two or more TGF-β family members. Such chimeric proteins may contain protein modules from the Bar protein. , protein modules from TGF-β1, TGF-β2 and / or TGF-β3 Some chimeric proteins of the present invention may comprise protein modules, e.g., Although not limited to the above, Table 12 (residue numbers correspond to the proprotein sequences listed in Table 1) The present invention may include the protein modules and / or amino acid sequences listed in the table below. Some chimeric proteins contain amino acid sequences similar to those in Table 12, but may contain more amino acid sequences than those listed. Such modules may include protein modules that contain additional or fewer amino acids than the original protein. A modulus is about one more or less amino acid, about two more or less amino acids, About 3 more or less amino acids, about 4 more or less amino acids, about 5 more or fewer amino acids, about 6 more or fewer amino acids, about 7 more or fewer amino acids Amino acids, about 8 more or less amino acids, about 9 more or less amino acids, about 10 more or fewer amino acids or more or fewer than 10 amino acids at the N-terminus and / or on the C-terminal end.

[0086] [Table 12] JPEG2025179097000042.jpg201170 JPEG2025179097000043.jpg206170 JPEG2025179097000044.jpg217170 In some embodiments, the chimeric protein of the invention comprises a protein molecule listed in Table 12. Some chimeric proteins containing GPC may contain any combination of the following modules: 2. A protein module replaced by any of the protein modules listed in It can be seen.

[0087] In some embodiments, the chimeric protein comprises a GDF and / or an inhibin. Such GDFs may include GDF-11 and / or GDF-2. or GDF-8. Some such chimeric proteins may be GDF- Such an embodiment may include the prodomain from GDF-11 and the growth factor from GDF-8. In this form, the chimeric protein has a replacement N-terminal region between GDF-11 and GDF-8. In other embodiments, the chimeric protein may comprise a prodomain from GDF-8. Such chimeric proteins may contain growth factors from GDF-11 and GDF-12. Amino acid residues 1 to 108 from F-11 and the amino acid residues of the protein from GDF-8 Some chimeric proteins may contain arm regions from GDF-11. may include:

[0088] Some chimeras of the present invention may comprise GDF-8 containing the arm regions of GDF-11. Such chimeras bind to residue F95 from the GDF-11 arm and the α2 helix of the chimeric GPC. It may be unstable due to steric clashes between the G The GDF8 / GDF11 / activin chimeras are characterized by the fact that the arm regions of such chimeric proteins It can be designed to contain an α2 helix. Furthermore, F95 binds to GDF11 This residue may be important in conferring the latent form of TGF-β1. It is located in a position similar to the Kamurati-Engelman mutation Y81H (see Figure 8). Therefore, mutation of this residue to a smaller amino acid, e.g., alanine, This can be done to promote the dissociation of mature GDF11 growth factor from the GPC. Such mutations are important in the design of assays to screen for GDF11-activating antibodies. These molecules may be useful as positive control molecules in the

[0089] In some embodiments, the chimeric proteins of the present invention comprise a combination of protein modules. By way of example and not limitation, the protein modules and / or proteins listed in Table 13 or a combination of amino acid sequences. Some chimeric proteins of the present invention may comprise any of the amino acid sequences listed in Table 13. Contains an amino acid sequence similar to those listed, but containing additional or fewer amino acids than those listed. Such an amino acid sequence may comprise a protein module comprising about one more or Less amino acids, about 2 more or less amino acids, about 3 more or less amino acids Acids, about 4 more or less amino acids, about 5 more or less amino acids, about 6 more about 7 more or less amino acids; about 8 more or less amino acids No amino acids, about 9 more or less amino acids, about 10 more or less amino acids or 10 more or fewer amino acids at the N- and / or C-terminus It may include.

[0090] [Table 13] JPEG2025179097000046.jpg202170 JPEG2025179097000047.jpg226170 JPEG2025179097000048.jpg197170 JPEG2025179097000049.jpg236170 JPEG2025179097000050.jpg213170 JPEG2025179097000051.jpg204170 The chimeric protein characterizes and / or maps the epitope associated with the GPC. As used herein, the term "mapping" "Pying" or "mapping" refers to the identification of one or more functional regions of one or more proteins. Such characterization refers to the determination, characterization, and / or identification of one or more proteins. The module and another agent (e.g., another protein and / or protein module) Some chimeric proteins may contain more than one used to characterize functions associated with proteins and / or protein modules It can be used.

[0091] In some embodiments, the chimeric proteins of the invention comprise a sequence listed in Table 14 or a sequence thereof. It may contain these fragments.

[0092] [Table 14] JPEG2025179097000053.jpg41170 In some embodiments, the chimeric protein comprises one or more proteins from TGF-β2. The crystal structure of the TGF-β2 growth factor has been solved. Daopin, S. et al., "Transforming Growth Factor-β Crystal structure of 2: A unique fold for the superfamily structure of transforming growth factor-β2 :an unusual fold for the superfamily)”, Science, 1992, Vol. 257 (No. 5068), p. 369 73), the activation mechanism still needs to be fully understood. This may depend on one or more interactions between the TGF-G loop and the α9β1 integrin. The β2 trigger loop contains similar structural and / or functional features related to the RGD sequence. The TGF-β2 trigger loop can be seen in integrins, including but not limited to integrins. However, it can bind to α9β1 integrin.

[0093] Mouse tissue staining revealed that the integrin subunit α9 is expressed in skeletal and cardiac muscles, as well as in visceral organs. It is widely expressed in smooth muscle, hepatocytes, airway epithelium, squamous epithelium, choroid plexus epithelium, and on neutrophils. (Palmer, EL et al., "Widely Infected in Epithelium and Muscle") Sequence and tissue distribution of the integrin α9 subunit, a novel partner of the β1 (Seq uence and tissue distribution of the int. egrin α9subunit, a novel partner of β1 t hat is widely distributed in epithelia a nd muscle,” Journal of Cell Biology f Cell Biology), 1993, Volume 123 (No. 5), p.1289~ 97) Expression of α9 was not detected earlier than E12.5, suggesting that it This suggests that it does not play a major role in tissue morphogenesis (Wang, A. .) et al., "Expression of Integrin Subunit α9 in Murine Embryos" of the integrin subunit α9in the murin "The embryo" and Developmental Dynamics Dynamics), 1995, Vol. 204, pp. 421-31). The phenotype observed in knockout mice is related to lymphatic valve dysfunction. Suggesting a role in development (Bazigou, E. et al., "Intelligent Glycine-α9 is involved in fibronectin matrix assembly during lymphatic valve morphogenesis Integrin-α9 is required for fibron ectin matrix assembly during lymphatic v "Alve Morphogenesis" and Developmental Cell ll), August 2009, Vol. 17 (No. 2), pp. 175-86). Interacting partners of glin α9β1 include VCAM-1 and the third FnIII of tenascin-C. domain, osteopontin, polydom / SVEP1, VEGF-A and NGF (Yokasaki, Y. et al., "Tenay Ligand for integrin α9β1 in the fibronectin type III repeats of synC Identification of the ligand binding site nding site for the integrin α9β1in the third fibronectin type III repeat of ten ascin C,” The Journal of Biological Chemistry Journal of Biological Chemistry), 1998, No. Vol. 273 (No. 19), pp. 11423-11428; Marcinkiewicz, C. Kiewicz, C. et al., "Inhibition of MLDG-containing heterodimeric disintegrins" The effect was observed in integrin α9β1, VCAM-1, tenascin-C, and osteopontin. reveal distinct structural requirements for the interaction with thiamin effects of MLDG-containing heterodimeri c disintegrins reveal distinct structura l requirements for interaction of the in tegrin α9β1with VCAM-1,tenascin-C,and o steopontin,” Journal of Biological Chemistry (JBC ), 2000, Vol. 275 (No. 41), pp. 31930-7; Oomen, S. (Oo mmen, S. et al., "Vascular endothelial growth factor A (VEGF-A) binds to integrin α9β Induces endothelial and cancer cell migration via direct binding to 1 (Vaccine endothelial cell line) helial growth factor A (VEGF-A) induces e ndothelial and cancer cell migration thr "ough direct binding to integrin α9β1)", Journal of Biological Chemistry (JBC), 2011, Vol. 286 ( No. 2), pp. 1083-92; Sato-Nishiuch, R. i, R. et al., "Polydom / SVEP1 is a ligand for integrin α9β1" "Polydom / SVEP1 is a ligand for integration in α9β1), Journal of Biological Chemistry (JBC), 2 287(30), pp.25615-30;Staniszewska, I. (Staniszewska, I.) et al., "Integrin α9β1 is involved in the regulation of nerve growth factor and and other neurotrophins (Integrin α9β1is a receptor for nerve growth factor and other neurotrophins,” Journal of Cell Science ( Journal of Cell Science), 2007, Volume 121 (Part 4) ), pp.504-13; Yokosaki, Y. et al., "Integrity The α9β1 domain is a novel recognition sequence (S) in the thrombin-cleaved amino-terminal fragment of osteopontin. The integrin α9β1 binds to VVYGLR a novel recognition sequence(SVVYGLR)in the thrombin-cleaved amino-terminal frag ment of osteopontin,” Journal of Biological Chemistry Mistry (JBC), 1999, Vol. 274 (No. 51), pp. 36328-34) .

[0094] The binding site on the protein that interacts with α9β1 was mapped using linear peptides. These sites include tenascin-C (AEIDGIEL; SEQ ID NO: 23 7), osteopontin (SVVYGLR; SEQ ID NO: 238), polydom / SVEP1 ( EDDMMEVPY; SEQ ID NO: 239) and the binding site on VEGF-A (EYP) Unlike α4β1 and α5β1, α9β1 has a canonical RGD sequence motif. Some, but not all, reported targets require acidic / hydrophobic residues. / proline motif. Some also contain tyrosine residues.

[0095] The trigger loops of TGF-β1 and TGF-β3 carry the RGD sequence and v β6 and / or α v β8 binds and enables growth factor release. The loop region differs from those of TGF-β1 and TGF-β3 and contains the sequence FAGIDGTSTY TSGDQKTIKSTRKKNSGKTP (SEQ ID NO: 65), and an RGD trimer Within this region, residues AGIDGTST (SEQ ID NO: 240) are involved in α9β1 binding. Peptides and amino acids in the third FnIII domain of tenascin-C mapped as sites Furthermore, the tyrosine following this region may play a role in potential α9β1 binding. Therefore, α9β1 binding to TGF-β2 may be physiologically relevant. In some embodiments, the chimeric protein of the invention comprises any of the sequences listed in Table 15. The trigger loop arrangement may include a trigger loop arrangement including:

[0096] [Table 15] In some embodiments, the chimeric proteins of the present invention comprise one or more TGF-β2 transactivators. Such chimeric proteins may contain a guar loop similar to that of TGF-β2. Some chimeric proteins of the present invention may exhibit expression-regulated activation (e.g., growth factor release). The protein may comprise a TGF-β related protein, and one or more protein modules may comprise one or more replaced by one or more protein modules containing one or more TGF-β2 trigger loops Some chimeric proteins contain TGF-β-related proteins and at least One or more protein modules containing one RGD sequence are linked to one or more TGF-β2 transcription factors. The modified protein module is replaced by one or more protein modules containing a ligand loop. In some embodiments, the chimeric protein is a TGF-β1 and / or TGF-β3 protein. and one or more protein modules comprising at least one RGD sequence may comprise one replaced by one or more protein modules containing the TGF-β2 trigger loop Such chimeric proteins may exhibit TGF-β1 activity.

[0097] In some embodiments, the chimeric proteins of the invention comprise one or more proteins from a BMP. Protein modules containing sequences from BMPs can be found in Figure 8. It may contain sequences from any of the BMP modules disclosed. The chimeric proteins of the invention containing a protein module may be used in combination with other proteins, e.g., BMPs. and testing and improving interactions with, but not limited to, RGM-like proteins, and / or may be useful in developing antibodies and / or assays to perturb the expression of the nucleotides.

[0098] The chimeric protein may include a detectable label. Such detection can be used to enable the detection and / or isolation of a substance. Possible labels may include biotin labels, polyhistidine tags and / or flag tags. The tag can be used to identify and / or isolate the tagged protein. The protein produced contains additional amino acids encoding one or more 3C protease cleavage sites. Such sites may include amino acids. However, there is no cleavage site of rhinovirus 3C protease during treatment with rhinovirus 3C protease. The 3C protease cleavage site allows for the detection of the chimeric protein. A suitable label can be introduced to allow for removal of the label.

[0099] Protein expression In some embodiments, the synthesis of the recombinant proteins of the present invention is carried out using methods known in the art. Some protein synthesis can be performed in vitro. Some protein synthesis can be carried out using cells. Such cells may be bacterial and / or eukaryotic cells. Eukaryotic cells can be used for protein synthesis. Some such cells are mammalian. Some mammalian cells used for protein expression include Although not specific to the human body, mouse cells, rabbit cells, rat cells, monkey cells, hamster cells, and Examples of suitable cells include human and human cells. Such cells may be derived from cell lines. In a further embodiment, human cells can be used as cell lines. Examples of such cells include, but are not limited to, HEK293 cells, CHO cells, HeLa cells, Sw -480 cells, EL4T lymphoma cells, TMLC cells, 293T / 17 cells, Hs68 cells Cells, CCD1112sk cells, HFF-1 cells, keloid fibroblasts, A204 cells, L I7RIB cells and C2C 12 Examples include cells.

[0100] In some embodiments, 293 cells are used to synthesize recombinant proteins of the invention. These cells post-translationally modify proteins with human-like structures (e.g., glycans). Human cells. Such cells are easily transfectable, scalable, and 293 cells can be grown to high densities in suspension culture. Examples of 293 cells include 293E cells. 293E cells stably express EBNA1 (Epstein-Barr virus nuclear antigen 1). In some cases, 293E cells are serum-free. In some cases, the 293 HT-6E cells (National Research Council of Canada, Ottawa, Canada) can be used. The cells express truncated EBNA1 (EBNA1t) and show improved production of recombinant EBNA1. Proteins may be present and are optimal for growth and / or protein expression in serum-free media. In some cases, the recombinant proteins of the present invention can be purified to simplify downstream purification. Insect cells can be used to express proteins. Cellular expression was performed using Spodoptera frugiperda cells, e.g. and may be performed using, but not limited to, Sf9 and / or Sf-21 cells. In some cases, insect cell cultures can be cultured using Triticum aestivum (Tri choplusia ni) cells, including but not limited to Tn-368 and / or HIGH-FIVE™ BTI-TN-5B1- 4 cells. A further list of exemplary insect cell lines is provided in the United States Patent No. 5,629,663, the contents of which are incorporated herein by reference in their entirety. No. 5,024,947, which is incorporated herein by reference. .

[0101] In some embodiments, the recombinant proteins of the present invention create Fc fusion proteins. The recombinant proteins may contain an antibody Fc domain for binding to any of the recombinant proteins described herein. The formation of the Fc fusion protein can be carried out by any method known in the art, for example, by Czajkowsky, DM et al., 2012, EMB EMBO Mol Med, Vol. 4 (No. 10), p. 1015-28 and U.S. Pat. Nos. 5,116,964 and 5,541 ,087 and U.S. Pat. No. 8,637,637 (those the contents of each of which are incorporated herein by reference in their entirety. The Fc fusion proteins of the present invention can be linked to I via a cysteine ​​residue in the Fc hinge region. The resulting Fc fusion protein can be used as an antibody against IgG Fc. It may contain a body-like structure, but C HI In some cases, the Fc fusion domain does not have a light chain. The fusion protein may have a pharmacokinetic profile comparable to that of a natural antibody. Thus, the Fc fusion proteins of the present invention have extended circulatory half-lives and / or altered circulatory functions. In some cases, the Fc fusion proteins of the present invention may comprise a biological activity other than that of the present invention. Any of the TGF-β family proteins or TGF-β related proteins described in the specification In some cases, the Fc fusion protein can be prepared using TG It may contain F-beta, GDF-8 and / or GDF-11.

[0102] The sequences encoding the recombinant proteins of the present invention can be prepared using any of the methods known in the art for expression. The vector can be inserted into a number of DNA vectors. In some embodiments, the recombinant proteins of the present invention can be co-produced with sucrose. The loading sequence was prepared from the pTT5 vector (National Research Council Biotechnology Institute, Canada (NRC) RC Biotechnology Research Institute, Montreal In another embodiment, the vector is cloned into pTT22, pTT 28, pYD5, pYD7, and pYD11 (National Research Council of Canada Biotechnology Institute) (NRC Biotechnology Research Institute), Intl., Quebec) and / or pMA vector (Life Technologies (L) ife Technologies, Carlsbad, California) The vector can modulate the expression of the sequence encoding the recombinant protein of the present invention. Such promoters may contain promoter sequences for initiating transcription. and / or can be regulated by exogenous and / or endogenous factors Some exogenous factors enhance expression of the sequence encoding the recombinant protein of the present invention, Some vectors can be used to express or inhibit the expression of recombinant proteins of the present invention. Some vectors may encode a nuclear localization signal that can be incorporated into proteins during translation. The modified pTT5 vector (pT The RNA transcribed from T5-WPRE contains elements that facilitate the nuclear export of the transcript. Some vectors contain one or more ligation-independent cloning (LIC) ) cassette insertion to provide easier cloning.

[0103] The vector encoding the recombinant protein of the present invention can be any vector known in the art. Methods, including but not limited to, transfection, electroporation, and In some embodiments, the vector can be delivered to the cell by transduction. The vector may contain one or more elements to enhance vector replication in a host cell. In some embodiments, the vector is capable of episomal replication in cells that express EBNA-1. It may contain an oriP site for

[0104] In some cases, cells are stably transfected to produce the recombinant proteins of the invention. Stably transfected cells transfer the transfected gene to daughter cells during cell division and Thus, eliminating the need for repeated transfections. The gene is stably integrated into the genome of the transfected cells. The transfected gene is then used for cell selection. genes, e.g., genes that confer resistance to one or more toxic or inhibitory compounds. Such genes may be expressed by one or more of such toxic or inhibitory compounds (e.g., When grown in the presence of erythromycin, kenomycin, etc. , used to support the growth of only cells with stable integration of the transfected gene. Cell selection can be performed by selecting cells based on the total recombinant protein expression level. Measurement of such levels may also include, for example, Western blot and / or E This can be done by LISA.

[0105] In some embodiments, the nucleotide sequence encoding the recombinant protein of the present invention is , may contain one or more woodchuck hepatitis virus post-transcriptional regulatory elements (WPREs) An RNA nucleic acid containing such an element has the sequence GCCACGGCGGAACUCAU CGCCGCCUGCCUUGCCCGCUGCUGGACAGGGGCUCGGCUG UUGGGCACUGACAAUUCCGUGGU (SEQ ID NO: 255). RNA containing a RE has the sequence AATCAACCTCTGGATTACAAAATTTGTG AAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCT ATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATA AATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGT TGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGAC GCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGC TCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCAC GGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACA GGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGT CGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGT TGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTC CCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCC TGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCG CCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCG It can be transcribed from DNA containing CCTG (SEQ ID NO: 256). The translation of a nucleic acid containing a PRE can be improved. Such improved translation can be achieved by increasing the number of newly transcribed nucleic acids. This may be due to increased cytoplasmic translocation of RNA.

[0106] In some embodiments, the recombinant protein may include one or more secretory signal sequences. As used herein, the term "secretory signal sequence" refers to a part of a protein. If so, an amino acid that modulates the secretion of such a protein from the cell (also refers to the chain of nucleotides that encodes them at the nucleic acid level. The chain sequence can be located at the protein terminus. The secretory signal sequence may be the N-terminal amino acid sequence. Other secretory signal sequences include the IgA signal sequence. Such an Ig kappa chain may be a human Ig kappa chain. In some embodiments, the secretory signal sequence is the amino acid sequence MDMRVPAQLL GLLLLWFSGVLG (SEQ ID NO: 257).

[0107] In some embodiments, the recombinant proteins of the present invention are properly expressed, folded, and Requires co-expression with one or more other proteins for binding, secretion, activity and / or function Some recombinant GPCs of the present invention may contain LTBP, fibrillin and / or GAR. It can be co-expressed with P.

[0108] In some embodiments, the recombinant proteins of the present invention can be biotinylated. As used herein, the term "biotinylation" refers to the addition of one or more biotin-labeled Such biotin labeling refers to the attachment of a biotinylated recombinant protein to avidin. Interaction with ATP- and / or streptavidin-coated surfaces and / or proteins As used herein, a "biotin label" refers to one or more biotin-labeled molecules. The term "biotinylated" refers to a detectable label that contains one or more biotin molecules. Biotin refers to a molecule or protein that contains a biotin label. Biotin molecules are capable of binding to avidin and streptavidin. This property is due to the fact that the avidin and / or streptavidin molecules bind with high affinity. Avidin-coated materials can be used to capture biotinylated proteins. Some recombinant GPCs of the present invention can be biotinylated near the N-terminus. Recombinant GPC such as avidin and / or streptavidin coated cell cultures The LTBP of GPC can be introduced onto the surface, and the orientation and bonding of such GPC can be improved. , surfaces fashioned to mimic orientation and binding to fibrillin and / or GARP. This allows the attachment of biotinylated recombinant GPC to the surface.

[0109] In some embodiments, the recombinant protein produced is analyzed for quality control purposes. Both biophysical and bioactivity properties can be assessed using biophysical methods. Characterization included protein migration patterns after reducing and / or non-reducing SDS PAGE. Biophysical characterization includes gel filtration, mass spectrometry, and and / or analysis of the association / dissociation of LAP or LAP-like domains and growth factor domains. The biologically active properties may include reactivity with antibodies and / or dissociated growth factors and / or Alternatively, it can be analyzed by assessing the signaling activity of latent GPC.

[0110] Some proteins produced may be labeled with one or more detectable labels for purification [e.g., poly(A)-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 Some embodiments may contain additional amino acids encoding a polyhistidine tag, a flag tag, etc. In some embodiments, the protein is N-terminally labeled. In some embodiments, the protein is C-terminally labeled. In some embodiments, the recombinant proteins of the present invention are N-terminally biotinylated. It has been done.

[0111] The protein produced contains additional amino acids encoding one or more 3C protease cleavage sites. Such sites may include 3C proteases, including but not limited to 3C proteases. However, when treated with rhinovirus 3C protease, residues of the 3C protease cleavage site are formed. This allows for cleavage between groups Q and G. In some embodiments, such cleavage sites are The detectable label is introduced to allow removal from the recombinant protein.

[0112] In some embodiments, the modification of the expressed growth factor proprotein is by enzymatic cleavage. In some cases, proprotein convertases can be used. Such proprotein convertases include, but are not limited to: Furin / PACE3, PCl / 3, PC2, PC4, PC5 / 6, PACE4 and P C7. Cleavage of proprotein convertases is achieved in solution or in tissue culture. In some cases, the proprotein convertase can be cleaved. In some cases, the proprotein is expressed in a cell that expresses the proprotein. Protein converting enzymes are added to tissue cultures of cells expressing the proprotein to be cleaved. .

[0113] antibody In some embodiments, the compounds and / or compositions of the invention comprise an antibody or fragment thereof. As used herein, the term "antibody" is used in the broadest sense. Specifically, various embodiments, for example and without limitation, include monoclonal antibodies. monoclonal, polyclonal, multispecific (e.g., at least two intact antibodies) and antibody fragments, e.g., diabodies, It covers all antibodies as long as they exhibit the desired biological activity. Antibodies are primarily amino acid-based molecules. may contain one or more modifications (for example, but not limited to, sugar moieties, fluorescent moieties, chemical It may also include the addition of tags, etc.

[0114] Use of Recombinant and Chimeric Proteins in Antibody Generation In some embodiments, the recombinant and / or chimeric proteins described herein are and using the protein as an antigen (referred to herein as an antigenic protein) to generate antibodies. Such antigenic proteins can be used to generate antibodies against similar wild-type proteins. The antigenic proteins of the present invention may contain epitopes that may not be available in the target region. Some antibodies modulate the release of one or more growth factors from one or more GPCs. Some such antibodies are capable of stabilizing [dissociation between two agents (e.g., from GPC]. growth factor release, GPC release from one or more protein interactions, or prevent] and / or release [dissociation between two agents (e.g., growth factor from GPC)

[0013] antibodies that enhance GPC release (e.g., GPC release from one or more protein interactions). The antigenic proteins of the present invention are TGF-β-related proteins and their components and In some cases, the antigenic proteins of the present invention may contain a protein module. The quality of the protein is determined by the prodomain lacking associated growth factors, furin cleavage-defective mutants, and extracellular proteins. The present invention may include mutants defective in protein association and / or combinations thereof.

[0115] In some embodiments, the antigenic protein is a TGF-β related protein and / or Such antigenic proteins may contain the modules of the growth factor. It may contain epitopes from regions associated with or sterically adjacent to it. The antibodies of the present invention directed to a mitochondrial peptide bind to the overlapping region between the growth factor and prodomains. Such antibodies may sterically inhibit the dissociation of growth factors from GPC.

[0116] In some embodiments, the antigenic protein comprises only the prodomain from a particular GPC. The epitopes present on such antigenic proteins are intercalated. Some antibodies of the present invention may be shielded or unexposed in the target GPC. Such antibodies can be directed against epitopes such as: The additional antibody may be a releasing antibody that promotes dissociation. These proteins may compete with growth factors, thereby promoting growth factor dissociation from GPCs.

[0117] In some embodiments, the antigenic protein is a proprotein convertase (e.g., a proprotein convertase). Such mutations may involve a mutation in the prodomain of the growth factor. Some antibodies of the present invention can prevent enzymatic cleavage from such mutant proteins. Such antibodies can be directed against epitopes present on the prodomain. In some embodiments, the furin cleavage site may be located at the nucleus of the growth factor receptor. Natural variants include the D2G mutants described herein.

[0118] In some embodiments, the antigenic protein comprising a prodomain is LTBP and / or or may contain N-terminal mutations that result in reduced prodomain association with GARP, and thus and provide epitopes in the N-terminal region that would otherwise be shielded by their association. Some antibodies of the present invention can be directed against such epitopes. Some antigenic proteins containing the GF-β1 prodomain may contain a C4S mutation. Such mutations prevent the association of antigen proteins with LTBP and / or GARP. C4S proteins can be expressed in various ways, making them useful for presenting N-terminal epitopes. Antibodies directed against the wild-type mutants prevent GPC association with LTBP and / or GARP. Some antibodies directed against C4S mutants inhibit growth factor signaling in specific niches. Some such antibodies may reduce G protein binding, which is tightly associated with the extracellular matrix. Blocking the ability of PCs to reduce or prevent growth factor release may be achieved.

[0119] In some embodiments, the antigenic protein may include one or more recombinant LTBPs. Such recombinant LTBPs include LTBP1, LTBP2, LTBP3, LTBP4, and Alternatively spliced ​​variants and / or fragments of the recombinant L. TBP can also be modified to contain one or more detectable labels. Isolable labels include, but are not limited to, biotin labels, polyhistidine tags, , myc tag, HA tag and / or fluorescent tag.

[0120] In some embodiments, the antigenic protein is complexed with one or more recombinant LTBPs. The recombinant protein may contain one or more recombinant and / or chimeric proteins. The antigenic protein is a proprotein convertase complexed with one or more recombinant LTBPs. The polypeptide may include a cleavage site mutant (e.g., D2G mutant, AXXA mutant). Some such recombinant LTBPs may include LTBP1S. , one or more detectable labels, for example, but not limited to, biotin labels, poly(Asp-2, Asp-3, Asp-4, Asp-5, Asp-6, Asp-7, Asp-8, Asp-9, Asp-10, Asp-11, Asp-12, Asp-13, Asp-14, Asp-15, Asp-16, Asp-17, Asp-18, Asp-19, Asp-2 It may contain a low histidine tag and / or a flag tag.

[0121] In some embodiments, the antigenic protein is GARP (or a homolog thereof, e.g., Such GARPs may include, but are not limited to, LRRCs. Some recombinant GARPs may be recombinant, referred to herein as recombinant GARPs. , one or more alterations, truncations and / or mutations compared to wild-type GARP The recombinant GARP can be modified to be soluble. In some embodiments, the recombinant GARP is modified to include one or more detectable labels. In certain embodiments, such detectable labels include, but are not limited to, , biotin tag, polyhistidine tag, flag tag, myc tag, HA tag and / or In some embodiments, the antigen protein may include one or more of: one or more recombinant proteins and / or kinases complexed with the recombinant GARP; In some embodiments, the antigen protein may comprise a recombinant GAR LAP (e.g., TGF-β LAP) complexed with P and / or LAP-like domains In some embodiments, the antigenic protein is complexed with a recombinant GARP. In some embodiments, the present invention includes a D2G mutant (e.g., a TGF-β D2G mutant) that is In this state, the complexed recombinant GARP is a soluble form of GARP (sGARP). In some embodiments, sGARP can be one or more biotin-labeled, polyhybridized, or Contains a stigmine tag and / or a Flag tag.

[0122] In some embodiments, complexed with LAP and / or LAP-like domains GARP is desirable as an antigen in assays and / or for antibody development. In such an embodiment, the LAP and / or LAP-like domains are CED mutants. Such LAP and / or LAP-like domains may be expressed as GPCs. to facilitate proper protein folding, conformation and / or expression. However, the CED mutations present may enhance growth factor release, resulting in the desired GARP -LAP (or LAP-like domain) complexes. The P-like domain complex plays a key role in the generation of release antibodies that specifically target GARP-associated GPCs. These may be useful as antigens in

[0123] In some embodiments, the GPC comprising a CED mutation has reduced growth factor association (synaptic cleavage). LAP or LAP-like domains, and / or GARP and / or LTB The natural product of LAP (or LAP-like domain) characterized as both a phosphodiesterase (P) and a P / LAP complex This may act to stabilize a conformation concentrated at the Such mutations expose epitopes that are rarely used. The conformational equilibrium of the -like domain can be shifted to facilitate the generation of activating antibodies.

[0124] In some embodiments, the antigenic protein of the present invention is a GDF (e.g., GDF-11 and / or GDF-8). In an embodiment, the antibody of the present invention is an antibody that binds to an antigen protein comprising a GDF-8 protein module. In some embodiments, such antibodies can be directed against one or more proteins. In some embodiments, the level and / or activity of GDF-8 in the niche of the tumor may be modulated. In one embodiment, the antibodies of the present invention can prevent the release of GDF-8 growth factor from GPC. In some embodiments, the antibodies of the invention are used to repair and / or improve muscle tissue. It can be used for

[0125] In some embodiments, the recombinant proteins described herein (including, by way of example only) Although not a chimeric protein, it is possible that the chimeric protein may be an important target for antibody development. Such tests can be used to identify and map gene groups. Studies identify epitopes that may promote growth factor release or stabilization of GPC upon antibody binding can be used to

[0126] released antibody As used herein, the term "released antibodies" refers to antibodies released from GPCs, cells, niches, natural Upon introduction of antibodies into the reservoir, or any other site of growth factor sequestration, inactive growth factors and Active growth factors and / or free growth factors versus prodomain-associated growth factors In this regard, releasing antibodies are characterized as agonists. As used herein, the term "natural reservoir" refers to an increased level of refers to the location within a cell, tissue, or organ where a biological molecule or ion is stored. For example, The extracellular matrix can act as a natural reservoir for one or more growth factors.

[0127] The contact required for growth factor release is the ability of GPC or its components to release growth factors. It can be defined as the direct or indirect contact of an antibody with a cell or with a cellular structure. Such cellular structures include, for example, extracellular and / or cellular matrix proteins. , extracellular and / or cellular matrix-associated proteins [e.g., LTB P (e.g., LTBP1, LTBP2, LTBP3 and / or LTBP4), fibrinogen fibrillin (e.g., fibrillin-1, fibrillin-2, fibrillin-3 and / or fibrillin-4), perlecan, decorin, elastin, collagen and / or GARP (e.g., GARP and / or LRRC33)]. At least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 9% 0% or greater release is sufficient to characterize an antibody of the invention as a releasing antibody. Growth factor release after administration can be localized and can occur over a sustained period, with peak release or It is understood that the antibodies of the present invention may contain several spikes or fragments of one or more growth factors. It may be operative to release over minutes, hours, days or longer.

[0128] The release profile is within about 4 hours to about 7 days of in vivo exposure or shorter in vitro exposure. For example, the initial peak or burst may be , about 4 hours to about 5 hours, or about 4 hours to about 6 hours, or about 4 hours to about 7 hours, or About 4 hours to about 8 hours, or about 4 hours to about 9 hours, or about 4 hours to about 10 hours, or Approximately 4 hours to approximately 11 hours, or approximately 4 hours to approximately 12 hours, or approximately 4 hours to approximately 24 hours, or or about 4 hours to about 36 hours, or about 4 hours to about 48 hours, or about 1 day to about 7 days, or About 1 to 2 days, or about 1 to 3 days, or about 1 to 4 days, or about 4 to 5 days The compound of the present invention and / or its derivatives may be administered within 1 day, or within 4 to 6 days, or within 4 to 7 days. Alternatively, the composition may stimulate the release of 5-100% of the growth factors present. The percentage of child release is about 5% to about 10%, or about 5% to about 15%, or about 5% to about 20%, or about 5% to about 25%, or about 10% to about 30%, or about 10% to about 40 %, or about 10% to about 50%, or about 10% to about 60%, or about 20% to about 70% , or about 20% to about 80%, or about 40% to about 90%, or about 40% to about 100% It could be.

[0129] The released antibodies produced by the methods described herein may be derived from any of the proproteins listed in Table 1. GPC containing either of these can be engineered to release growth factors. In the present invention, the releasing antibody is a TGF-β isoform and / or a In some cases, the released antibodies are directed to a GPC that contains one or more modules of the , directed to a GDF and / or a GPC comprising one or more modules from a GDF.

[0130] stabilizing antibody As used herein, the term "stabilized antibody" refers to a stabilizing antibody that is ... to at least one of a niche, a natural reservoir, and any other site of growth factor sequestration. Upon introduction of the antibody, activity against inactive growth factors and / or prodomain-associated growth factors It refers to an antibody that reduces the ratio of growth factors and / or free growth factors. can be characterized as an antagonist. An "antagonist" is something that interferes with or inhibits the physiological action of another. Agonism can also result in stimulation or activation of downstream signaling, thus It can agonize a pathway separate from the one it antagonizes. , are interrelated, and thus, in one non-limiting example, a TGF-β antagonist It can act as a BMP agonist and vice versa. As used herein, the term "downstream" refers to the process by which the compounds and / or compositions of the present invention The term "antibody" refers to any signaling or cellular events that occur after the action, binding, or targeting of a molecule.

[0131] The contact required for inhibition or stabilization may be between the antibody and the GPC or a component thereof, or This can be a direct or indirect contact between the cell structure and the growth factor release. Such cellular structures include, for example, extracellular and / or cell matrix structures. Proteins, extracellular and / or cell matrix-associated proteins [e.g. LTBP (e.g., LTBP1, LTBP2, LTBP3 and / or LTBP4), Fibrillins (e.g., fibrillin-1, fibrillin-2, fibrillin-3 and / or fibrillin-4), perlecan, decorin, elastin, collagen and / or GARP (e.g., GARP and / or LRRC33)]. At least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% of children %, 90% or more inhibition of release may in some cases inhibit or stabilize the antibodies of the invention. Inhibitory antibodies stabilize GPC and bind it to hemoglobin. It can be captured as a telodimer.

[0132] Inhibition of growth factor release following contact with one or more antibodies of the invention can be local and / or prolonged. It should be understood that the time period may occur over a wide range and may include peaks, troughs, or spikes. Inhibitory antibodies that also function to stabilize GPC are defined by their release kinetics The release of growth factors and the corresponding release kinetics were localized. However, it can be measured directly or inferred from downstream signaling events. In some embodiments, the change in protein or nucleic acid concentration or phenotypic response is The effects of the compounds and / or compositions may be demonstrated.

[0133] The antibodies of the present invention are designed to inhibit growth factor release for minutes, hours, or days. The inhibition and / or stabilization profile can be observed from about 4 hours to about 1 hour after in vivo administration. The inhibitor may have an initial trough within 7 days or a shorter period in vitro. The initial stabilization trough lasts from about 4 hours to about 5 hours, or from about 4 hours to about 6 hours, or from about 4 hours to about 6 hours. Hours to about 7 hours, or about 4 hours to about 8 hours, or about 4 hours to about 9 hours, or about 4 hours 10 hours, or 4 hours to 11 hours, or 4 hours to 12 hours, or 4 hours to about 24 hours, or about 4 hours to about 36 hours, or about 4 hours to about 48 hours, or About 1 to 7 days, or about 1 to 2 days, or about 1 to 3 days, or about 1 to 4 days It may occur in about 4 to about 5 days, or about 4 to about 6 days, or about 4 to about 7 days. The introduction of the compounds and / or compositions of the present invention inhibits 5% to 100% of the growth factors present. For example, the percentage of growth factor inhibition or stabilization Approximately 5% to approximately 10%, approximately 5% to approximately 15%, approximately 5% to approximately 20%, approximately 5% to approximately 25%, approximately 10% to approximately 30%, approximately 10% to approximately 40%, approximately 10% to approximately 50%, approximately 10% to approximately 60%, approximately 20% to approximately 70%, approximately 20% to approximately 80%, approximately 40% to approximately 90%, or approximately 40% to approximately 100% % can be.

[0134] The stabilized antibodies produced by the methods described herein may be synthesized from any of the proproteins listed in Table 1. It can be produced to block the release of growth factors from GPC containing either Such antibodies physically interact with and / or bind to the GPC protease cleavage site. In some cases, this can block the interaction of proteolytic enzymes that can target such cleavage sites. In this case, the stabilizing antibody is a TGF-β isoform and / or a In some cases, stable GPCs containing one or more modules of the form The antibody is directed against a GDF and / or a GPC containing one or more modules from a GDF. will be done.

[0135] Stabilizing antibodies directed against GPCs, including GDF-8, inhibit the metalloproteinases of such complexes. Such agents can block enzyme cleavage. GDF-8 acts to physically prevent interactions between metalloproteinases that target C. Drugs that actually target the metalloproteinases themselves are already available. (U.S. Pat. Nos. 7,525,565, 7,575,585, the contents of which are incorporated herein by reference in their entirety). 72,599).

[0136] Antibody selection The desired antibody is identified based on the ability of the desired antibody to associate with the desired antigen and / or epitope. Based on this, it is possible to select from a larger pool of two or more candidate antibodies. and / or epitopes, including but not limited to those described herein Any of the following, for example but not limited to, recombinant proteins, chimeric proteins Protein, GPC, prodomain (e.g., LAP or LAP-like domain), growth factor, Protein modules, LTBP, fibrillin, GARP, TGF-β-related proteins and and / or their mutants and / or variants and / or complexes and Selection of the desired antibody can be performed using antibody binding assays, e.g., , surface plasmon resonance-based assay, enzyme-linked immunosorbent assay (ELISA) or Can be performed using a fluorescence-associated cell sorting (FACS)-based assay Such assays utilize a desired antigen to bind to a desired antibody, followed by one or more Binding can be detected using the detection methods described above.

[0137] In some embodiments, an antibody of the invention is isolated from a larger pool of two or more candidate antibodies. based on their ability to associate with desired antigens and / or epitopes from multiple species. The cells can be selected for (referred to herein as "positive selection").

[0138] In some embodiments, such species may include vertebrate species. In some embodiments, such species may include mammalian species. Species include, but are not limited to, mice, rats, rabbits, goats, sheep, and pigs. , horses, cattle and / or humans.

[0139] In some embodiments, antibodies are removed from a larger pool of two or more candidate antibodies. As used herein, the term "negative selection" refers to the selection of a population. binds to one or more undesired antigens and / or epitopes of one or more agents from In some embodiments, the removal of unwanted antigens and / or Epitopes include, but are not limited to, any of those described herein, Examples include, but are not limited to, recombinant proteins, chimeric proteins, GPCs, prodomains (e.g., LAP or LAP-like domains), growth factors, protein modules ol, LTBP, fibrillin, GARP, TGF-β related protein and / or These mutants and / or variants and / or combinations and / or complexes Examples include:

[0140] In some embodiments, the antibodies of the invention inhibit growth factor signaling and and / or levels (e.g., TGF-β growth factor signaling and / or levels) A prodomain that reduces the In some embodiments, the present invention can be directed to a target domain (e.g., a P or LAP-like domain). The antibodies of the invention increase growth factor signaling and / or levels in a given niche. In some embodiments, the polypeptide may be directed to a LAP or LAP-like domain. The antibodies of the present invention bind to LTBP, fibrillin and / or GARP when complexed with the antibodies. only in this case, a prodomain (e.g., a LAP or LAP-like domain) and / or a GPC can be directed to.

[0141] In some embodiments, an antibody of the invention is isolated from a larger pool of two or more candidate antibodies. and selecting from the group of compounds based on their ability to modulate growth factor levels and / or activity. In some cases, the ability of a candidate antibody to modulate growth factor activity can be assessed. Growth factor activity assays can be used to test for growth factor activity. Examples of cell-based assays include those described below. Additional assays that can be used to determine the efficacy of candidate antibodies include, but are not limited to: Although not widely used, enzyme-linked immunosorbent assay (ELISA), Western blot reporter assays (e.g., luciferase-based reporter assays or other enzyme-linked a native - based reporter assay), PCR analysis, RT - PCR analysis, and / or other methods known in the art, such as, for example, each of the methods described in U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, 2012, and U.S. Provisional Patent Application No. 61 / 722,969, filed November 6, 2012, the entire contents of which are incorporated herein by reference in their entirety. One or more of the recombinant proteins or antibodies disclosed herein can be used in assays for testing, generating, and / or selecting antibodies. One or more antibodies can be assayed for release and / or stabilization of recombinant GPC. In some embodiments, the recombinant protein can be expressed as a positive or negative control component of an assay. In some embodiments, multiple recombinant proteins can be expressed simultaneously to modulate growth factor release and / or activity, and such recombinant proteins can act synergistically or antagonistically in such modulation. In some embodiments, GPCs containing CED mutations can provide a baseline level of growth factor activity in an assay designed to test release antibodies. This is because these mutant proteins are sufficient to produce a biological effect in humans. In some embodiments, GPCs containing CED mutations can be used as a positive control in an activity assay for screening release antibodies.

[0142] <0002,033>In some embodiments, one or more of the recombinant proteins or antibodies disclosed herein can be used in assays for testing, generating, and / or selecting antibodies. <00,02034>One or more antibodies can be assayed for release and / or stabilization of recombinant GPC. [[ID=,15]] In some embodiments, the recombinant protein can be expressed as a positive or negative control component of an assay. In some embodiments, multiple recombinant proteins can be expressed simultaneously to modulate growth factor release and / or activity, and such recombinant proteins can act synergistically or antagonistically in such modulation. In some embodiments, GPCs containing CED mutations can provide a baseline level of growth factor activity in an assay designed to test release antibodies. [[ID=,22]]This is because these mutant proteins are sufficient to produce a biological effect in humans. In some embodiments, GPCs containing CED mutations can be used as a positive control in an activity assay for screening release antibodies.

[0143] In some embodiments, GPCs containing CED mutations can provide a baseline level of growth factor activity in an assay designed to test release antibodies. This is because these mutant proteins are sufficient to produce a biological effect in humans. In some embodiments, GPCs containing CED mutations can be used as a positive control in an activity assay for screening release antibodies. In some embodiments, the GPC comprising the CED mutation is used as a screen for stabilized antibody activity. They can be used for cleaning because they are In such assays, CED may be suddenly activated. GPCs containing mutations can be expressed in cell lines (e.g., 293 cells) and grown. Growth factor activity and / or release can be assessed in the presence or absence of the antibody being tested. In some embodiments, a GPC comprising a CED mutation and a wild-type GPC (e.g., including, but not limited to, TGF-β1, TGF-β2, or TGF-β3 ) can also be used to regulate free growth factor levels. In this state, modulation of free growth factor levels occurs at different ratios of wild-type and mutant Co-transfection of different GPCs (e.g., 1:1, 1:2, 1:3, 1:4, 1:5, 1:10) In some embodiments, one or more additional levels of play may be achieved. LTBP, fibrillin, or GARP to add growth factor modulation Further co-expression can be performed.

[0144] antibody development In some embodiments, the above antibodies, antibody fragments, variants or derivatives thereof are The compounds and / or compositions of the present invention comprise an antigen specific for the antigenic proteins described herein. It is immunoreactive with

[0145] The antibodies of the present invention, by virtue of their target molecule, are directed against the antigens used to generate them. Therefore, their functions (agonist, antagonist, growth factor release, GPC stabilization, activity and / or as inhibitory antibodies) and / or the cellular niches in which they function. It can be characterized by:

[0146] As used herein, the term "antibody fragment" refers to any portion of an intact antibody. In some embodiments, an antibody fragment comprises the antigen-binding region from an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab' ) 2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and antibodies formed from antibody fragments. Examples of multispecific antibodies include those produced by papain digestion of antibodies, which are then purified to produce single antibodies. It produces two identical antigen-binding fragments called "Fab" fragments that contain the original binding site. A residual "Fc" fragment is also produced, reflecting its ability to readily crystallize. yields an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen. The compounds and / or compositions of the invention may include one or more of these fragments. For purposes herein, an "antibody" refers to a human antibody having heavy and light chain variable domains and an Fc region. It may include a region.

[0147] As used herein, the term "natural antibody" refers to a group of antibodies that typically consist of two identical light (L) A 150,000 dalton heterotetramer consisting of a single chain and two identical heavy (H) chains Each light chain is connected to a heavy chain by one covalent disulfide bond. While the number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes, Each heavy and light chain has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V H ) and the following Each light chain has at one end a variable domain (V L ) and a constant domain at its other end; the constant domain of the light chain is the first constant domain of the heavy chain. The light chain variable domain is aligned with the heavy chain variable domain, and the light chain variable domain is aligned with the heavy chain variable domain. There are.

[0148] As used herein, the term "variable domain" refers to amino acids that differ extensively in sequence among antibodies. and is used in the binding and specificity of each particular antibody for its particular antigen. It refers to a defined antibody domain that is

[0149] As used herein, the term "Fv" refers to a complete antigen-recognition and antigen-binding site. These regions refer to antibody fragments comprising one heavy chain and one light chain in tight, non-covalent association. It consists of a dimer of chain variable domains.

[0150] As used herein, the term "light chain" refers to a light chain based on the amino acid sequence of the constant domain. Based on the Antibodies refer to the components of antibodies from any vertebrate species. Antibodies are composed of the constant domains of their heavy chains. Depending on the amino acid sequence, they can be assigned to different classes. There are several major classes: IgA, IgD, IgE, IgG, and IgM. or subclass (isotype), e.g., IgG1, IgG2, IgG3, IgG4 IgA can be further divided into IgA, IgA, and IgA2. In this case, the term "single chain Fv" or "scFv" refers to a V H and V L Antibody domain fusion proteins The term refers to proteins whose domains are joined together in a single polypeptide chain. In embodiments, the Fv polypeptide linker provides the scFv with the desired binding site for antigen binding. It is possible to form a structure.

[0151] As used herein, the term "bispecific antibody" refers to an antibody that binds to two different antigens. Such antibodies are typically composed of at least two different antibodies. As bispecific antibodies, the contents of each of which are incorporated herein by reference in their entirety. Riethmuller, G., 2012, Ki Cancer Immunity, Vol. 12, p. 12-1 8, Marvin, JS et al., 2005, Acta -Acta Pharmacologica Sinica, 26(No.6), pp.649-58 and Schaefer, W. ) et al., 2011, Proceedings of the National Academy of Sciences (PNAS), Vol. 108 (No. 27), Examples include any of those described on pages 11187-92.

[0152] As used herein, the term "diabody" refers to a diabody having two antigen-binding sites. Diabodies are small antibody fragments that contain a light chain variable domain in the same polypeptide chain. V L heavy chain variable domain V linked to H too short to allow for separation between two domains on the same chain By using a linker that does not allow pairing of the domains, the domains can be linked to complementary domains on different strands. Diabodies, for example, force pairing with the antigen, creating two antigen-binding sites. European Patent No. 404,097, the contents of which are incorporated herein by reference in their entirety. WO 93 / 11161; and Hollinger Hollinger, P. et al., "Diabodies" "Diabodies": Small bivalent and bispecific antibody fragments alent and bispecific antibody fragments) ,” Proceedings of the National Academy of Sciences (PNAS), 1993, Vol. 90, pp. 6444-6448) is described in more detail in

[0153] As used herein, the term "monoclonal antibody" refers to a antibody produced by a cell of substantially the same species. It refers to antibodies obtained from a population of cells (or clones), i.e., the individual cells that make up the population The antibodies are identical and / or bind to the same epitope, provided that they are monoclonal antibodies. Possible variants that may arise during the body's production, e.g., variants that are generally present in small amounts Typically, different antibodies are directed against different antigenic determinants (epitopes). In contrast to polyclonal antibody preparations containing It is directed against a single antigenic determinant on the

[0154] The modifier "monoclonal" indicates the character of the antibody as being obtained from a population of substantially homogeneous antibodies. However, it should not be construed as requiring production of antibodies by any particular method. Monoclonal antibodies in this specification include "chimeric" antibodies (immunoglobulins) and In a "chimeric" antibody, at least one of the heavy and light chains is a fragment of the antibody. A portion may be present in antibodies derived from a particular species or belonging to a particular antibody class or subclass. The remaining chains are identical or homologous to the corresponding sequences in the antibody of interest, while the remaining chains are derived from another species. corresponding sequences in the antibody to be isolated, or in an antibody belonging to another antibody class or subclass is identical or homologous to.

[0155] As used herein, the term "humanized antibody" refers to an antibody that has been modified with one or more non-human (e.g., (murine) antibody source, with the remainder being one or more human immunoglobulin sources. For the most part, humanized antibodies refer to chimeric antibodies derived from human immunoglobulins. the recipient antibody, and residues from the hypervariable region from the recipient antibody are Non-human species, e.g., mouse, rat, Substituted by residues from hypervariable regions from rabbit or non-human primate antibodies (donor antibodies) It has been replaced.

[0156] As used herein, the term "hypervariable region" refers to the amino acid residues responsible for antigen binding. The term "hypervariable region" refers to the region within the antigen-binding domain of an antibody that contains the amino acid sequence. Complementarity determining region (CDR) As used herein, the term "CDR" refers to a region that determines the structure of a CDR. , refers to the region of an antibody that contains the structure complementary to the target antigen or epitope.

[0157] In some embodiments, the compounds and / or compositions of the invention are antibody mimetics. As used herein, the term "antibody mimetic" refers to a compound that mimics the function or effect of an antibody. It refers to any molecule that mimics a target and binds specifically and with high affinity to its molecular target. In some embodiments, the antibody mimic comprises a fibronectin type III domain (Fn3). as a protein scaffold (U.S. Patent No. 6,449,296). Nos. 6,673,901; 6,348,584). In the present specification, antibody mimetics include those known in the art, including, but not limited to, Although there is no known mechanism for the production of affibody molecules, affilins, and Phytin, anticalin, avimer mer), Centyrin, DARPIN™, Fy Nomer and Kunitz and domain peptides In other embodiments, the antibody mimic may include one or more non-peptide regions. .

[0158] As used herein, the term "antibody variant" refers to an antibody that has been modified in a manner similar to that of a native antibody. The structure and / or function of the antibody may differ from that of the antibody itself, including some differences in amino acid sequence, composition, or structure. Refers to similar biomolecules.

[0159] The preparation of antibodies, whether monoclonal or polyclonal, is well known in the art. Techniques for producing antibodies are well known in the art, and are described, for example, in Harlow et al. Arlow and Lane, "Antibodies, a Laboratory Manual" ies, A Laboratory Manual,” Cold Spring Harbor Cold Spring Harbor Laboratory Press ry Press, 1988; Harlow and Lane Using Antibodies: A Laboratory Manual "Cold Spring Harbor Laboratory Manual" Press (Cold Spring Harbor Laboratory Press) , 1999 and "Therapeutic Antibody Engineering: Current Trends Driving the Strongest Growth Area in the Pharmaceutical Industry" Current and Future Advances in Therapeutic Antibody Engineering ng:Current and Future Advances Driving t he Strongest Growth Area in the Pharmace "European Industrial Industry," Woodhead Publishing d Publishing), 2012.

[0160] Standard monoclonal antibody generation In some embodiments, the antibody is derived from a knockout clone lacking the gene encoding the desired target antigen. These mice are not tolerized and target antigens, so For the production of antibodies against antigens that can cross-react with human and mouse forms of the antigen, For the production of monoclonal antibodies, host mice can be transfected with recombinant proteins. It is possible to induce lymphocytes that specifically bind to such proteins by immunizing the patient with the protein. The resulting lymphocytes can be harvested and fused with an immortalized cell line. Hybridoma cells are cultured in a suitable culture medium containing a selective agent to allow proliferation of only fused cells. It can support reproduction.

[0161] The desired hybridoma cell line is subjected to analysis of the binding specificity of the secreted antibody for the target peptide. and subcloning such cell clones via limiting dilution procedures. The subcloned hives can be cloned and propagated by standard methods. Antibodies produced by the idioblastoma cells are purified from the culture medium by standard immunoglobulin purification procedures. It can be isolated and purified from the

[0162] Recombinant antibodies The recombinant antibodies of the present invention are also disclosed in US Pat. No. 6,49 ... the contents of each of which are incorporated herein by reference in their entirety. U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, 2012, and U.S. Provisional Patent Application No. 61 / 722,969, filed November 6, 2012. In some embodiments, the recombinant vector can be produced by any of the methods disclosed herein. The antibodies may be produced using hybridoma cells produced by the methods described herein. The antibody heavy and light chain variable region cDNA sequences can be isolated using standard biochemical techniques. Total RNA can be extracted from antibody-producing hybridoma cells. The reverse transcriptase (RT) polymerase chain reaction cDNA by PCR (polymerase chain reaction) PCR amplification can be performed on the resulting cDNA to convert the variable region genes Such amplification can be performed using a method specific for amplification of heavy and light chain sequences. The resulting PCR product may then be subjected to sequencing analysis using primers. Once sequenced, the antibody code can be subcloned into an expression vector. For humanization, the code sequence can be placed in place of the homologous murine sequence. Coding sequences for human heavy and light chain constant domains can then be used. The resulting construct can be transfected into mammalian cells for large-scale translation.

[0163] Generation of cytotoxic antibodies In some embodiments, the antibodies of the invention are capable of activating antibody-dependent cell-mediated cytotoxicity (ADCC). antibody-dependent cell-mediated cytotox icity), complement-dependent cytotoxicity (CDC) cytotoxicity) and / or antibody-dependent cellular phagocytosis (ADCP) It can induce immune-dependent cell phagocytosis. ADCC is an immune mechanism in which cells are lysed as a result of immune cell attack. The immune cells involved are CD56+ cells, CD3- natural killer (NK) cells, and leukocytes, monocytes and neutrophils (the contents of which are fully incorporated by reference). Strohl, WR, incorporated herein by reference in its entirety. “Therapeutic Antibody Engineering” ), Woodhead Publishing, Philadelphia, Pennsylvania, 2012, Chapter 8, p. 186).

[0164] In some cases, the antibodies of the invention may be used in combination with other antibodies, such as those described herein, in which ADCC or ADCP is desired upon antibody binding. These can be engineered to contain a given isotype depending on whether or not they are present. Antibodies can be prepared, for example, as described in Alderson, KL et al., J. Journal of Biomedicine and Biotechnology (J Biomed Bi Methods disclosed in (Technol., 2011, Vol. 2011, p. 379-123) In the case of murine antibodies, different isotypes can be engineered. Antibodies of this type are more effective in promoting ADCC. IgG2a, for example, The murine IgG2b antibody is more effective than IgG2b in inducing C. Some antibodies can be re-engineered to include IgG2a antibodies. (Re-engineered) antibodies are more effective in inducing ADCC upon binding cell-associated antigens. It can be effective.

[0165] In some embodiments, the antibody variable region generated by the methods of the present invention is encoded by The gene can be cloned into a mammalian expression vector encoding a human Fc region. Such an Fc region may comprise an Fc region from human IgG1κ. The Fc region enhances Fc receptor binding and antibody-dependent cell-mediated cytotoxicity (ADCC). and may contain known amino acid mutations.

[0166] In some cases, antibodies can be engineered to reduce ADCC. Antibodies that do not activate ADCC or are associated with low levels of ADCC may be Therefore, this invention is not affected by immune-mediated clearance or by limited immune-mediated clearance. It may be desirable for the antibody embodiment to have a longer half-life in circulation.

[0167] Antibody fragment display library screening technology In some embodiments, the antibodies of the invention are produced and assayed using high-throughput discovery methods. This can be done by revising and / or optimizing the content of each No. 6,201,229, filed on November 6, 2012, which is incorporated herein in its entirety. Application No. 61 / 722,919, and U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, 2012. Display technology (e.g., display) disclosed in U.S. Patent Application No. 61 / 722,969. Some embodiments may include any of the following: In the method, the synthetic antibody is generated using a display technology (e.g., a phage display technology). can be designed, selected or optimized by screening target antigens using Phage display libraries display unique antibody fragments on the viral coat. In some cases, each phage particle may contain millions to billions of phage particles expressing the same phage. The cDNA encoding the fragment of the complementarity-determining region (CDR) encodes the variable loop. The V of the CDR may contain the same sequence except for the nucleotide sequence. H The chains are viral coat proteins (e.g., the N-terminus of the viral pIII coat protein) It can be expressed as V L The chains are then attached to the ribosomal membrane prior to incorporation of the complex into the viral coat. V in the periplasm H The strands can be expressed separately for assembly.

[0168] For selection, the target antigen is subjected to in vitro phage display for precipitation of positive binding partners. The prey particles can be incubated with the prey library particles. This process is described herein. In some cases, phage enrichment is performed using solid-phase phage. Such enrichment involves attaching the target antigen to a substrate (e.g., by passive adsorption). The target antigen is bound to the target antigen and contacted with one or more solutions containing phage particles. Phage particles with affinity for the target are precipitated from the solution. Phage enrichment is a liquid-phase phage enrichment technique in which the target antigen is combined with the phage solution. According to such a method, the target antigen is recovered from the solution and the bound phage are collected. The antibody may contain a detectable label (e.g., a biotin label) to facilitate detection.

[0169] After selection, the cDNA encoding the CDRs of the precipitated library members is then ligated to the binding fragment. Such sequences can be used to sequence antibody sequences for recombinant antibody production. Direct incorporation into cells or mutagenized for further optimization via in vitro affinity maturation can be differentiated and utilized.

[0170] In some cases, phage display is used to generate a broad and diverse panel of antibodies. Such diversity can be achieved by screening for antibody sequence diversity and and / or can be measured by the diversity of epitopes targeted.

[0171] Affinity maturation technology The affinity maturation techniques of the present invention are described in detail in the accompanying drawings, the contents of each of which are incorporated herein by reference in their entirety. U.S. Provisional Patent Application No. 61 / 722,919, filed November 6, 2012, includes: and U.S. Provisional Patent Application No. 61 / 722,969, filed November 6, 2012. After identifying an antibody fragment capable of binding to the target antigen (e.g., a fragment of an antibody fragment capable of binding to the target antigen), the fragment may be any of those disclosed in the specification. Affinity maturation processes (e.g., via the use of phage display libraries as described above) High affinity mutants can be obtained from them through the process. used to identify the CDR-encoding sequences with the greatest affinity for the target antigen. Using such techniques, selection C is performed to generate millions to billions of variants. The DR sequences (e.g., isolated or produced by the methods described herein) as a whole are Mutations can be made at random or at defined residues. Ants may be affinity screened (e.g., de-antigenized) for their ability to bind to a target antigen. The selection can be subjected to repeated rounds of screening (display library screening). These repeated rounds of selection, mutation and expression result in the greatest degree of affinity for the target antigen. This can be performed to identify antibody fragment sequences that have similarity to the sequence of the fragment. It can be incorporated directly into an antibody sequence for recombinant antibody production.

[0172] Antibody characterization The compounds and / or compositions of the present invention, including antibodies, are capable of phagocytic, pinocytic, or other clearance. via inhibition of assembly in the extracellular matrix and / or the cell matrix The compounds of the present invention may act to reduce the local concentration of one or more GPCs. The introduction of the composition results in the removal of 5% to 100% of the growth factors present in a given area. For example, the percentage of growth factor removal may be about 5% to about 10%, about 5% to about 15%, ~About 5%~About 20%, About 5%~About 25%, About 10%~About 30%, About 10%~About 40%, About 10% to 50%, 10% to 60%, 20% to 70%, 20% to 80%, It can be 40% to about 90% or about 40% to about 100%.

[0173] Measurement of the release, inhibition, or removal of one or more growth factors is performed under standard or normal physiological conditions. The natural release or activity of the growth factors listed below can be measured in vitro or in vivo. Measurements can also be made in the presence or absence of antibodies. Growth factor levels, Such methods for measuring release, inhibition, or elimination include those for tissues and / or body fluids (e.g., standard measurements in serum or blood, e.g., Western blot, enzyme-linked immunosorbent assay, Binding assay (ELISA), activity assay, reporter assay, luciferase assay , polymerase chain reaction (PCR) array, gene array, real-time reverse transcriptase (R T) PCR, etc.

[0174] The antibodies of the present invention target multiple epitopes on or along GPCs or their related structures. Binds to or interacts with the peptide to enhance or inhibit growth factor signaling Such epitopes may include those that alter, enhance, or inhibit GPC function. Any and all possible sites for Such epitopes include, but are not limited to, growth factors, regulatory elements, and the like. GPC, GPC-modulating factor, growth factor receptor cell or receptor, LAP or LAP-like domain, zipper region, furin cleavage site, arm region, finger region region, LTBP-binding domain, fibrillin-binding domain, glycoprotein A repeat-dominant (G ARP) binding domain, latent lasso, α1 region, RGD sequence, bowtie region, extracellular matrix metalloproteinase (EMT) epitopes on or within cytoplasm and / or cell matrix components; and / or an epitope formed by combining any of the above regions or portions Examples include:

[0175] The compounds and / or compositions of the present invention may be directed to one or more epitopes of antibody recognition and / or They exert their effects through binding (reversible or irreversible) to a substance or region. Without being limited thereto, such binding sites for antibodies may be proteins, proteins Most often, the binding site is formed by a protein domain or region. , biomolecules, such as sugars, lipids, nucleic acid molecules or any other form of binding epitope. obtain.

[0176] In some embodiments, the antagonist antibodies of the invention target the TGF-β prodomain. can bind to the RGD site, for example, by blocking the RGD site or by stabilizing the structure. These antibodies stabilize and prevent integrin-mediated release. In the treatment of Kamuracchi-Engelman disease, where mutations in Such antibodies are useful in detecting mutations in fibrillin or LTBP that inhibit TGF- It is also useful in Marfan syndrome, where it alters β- and BMP activation.

[0177] In some embodiments, the antibodies of the present invention inhibit TG from GPC associated with LTBP. Selectively inhibits F-β release but not release from those associated with GARP Such antibodies function as anti-fibrotic therapeutic agents but exhibit minimal inflammatory effects. In this embodiment, the GPC-LTBP complex-binding antibody binds to the GPC-GARP complex. In some embodiments, such antibodies do not bind to a particular LTBP or GPC. Binds to GPCs that are close to or overlap with the GARP binding site, although this may not be specific Thus, binding is prevented by GARP but not by LTBP. In some embodiments, one or more combinatorial interactions between GARP and pro-TGF-β are In some embodiments of the present invention, antibodies are provided that selectively bind to an all-epitope. , compounds that induce the release of TGF-β from the GARP-proTGF-β complex and / or Such antibodies or compositions are provided that bind to the GARP prodomain binary complex. However, neither the GARP-proTGF-β ternary complex nor GARP alone nor the prodomain alone The nucleotide sequences can be selected for their ability to not bind to either nucleotides.

[0178] Alternatively, or in addition, the antibodies of the invention may be used in combination with ligand mimetics that induce internalization of GPC. Such antibodies can act as unconventional payload carriers, binding or deliver conjugated drug payloads to defined GPC and / or GPC-associated sites. Acts to deliver and / or transport.

[0179] The changes induced by the antibodies of the present invention may result in neomorphological changes of cells. As used herein, the term "neomorphism" refers to a new or different change or modification. For example, one or more growth factors not typically associated with the particular GPC targeted by the antibody. Antibodies that induce the release or stabilization of factors are neoantibodies, and release is a neoantibody. do.

[0180] In some embodiments, the compounds and / or compositions of the present invention are In some embodiments, this may act to modify and / or control the vent. Such proteolytic events can be intracellular or extracellular events. In morphology, such proteolytic events include furin cleavage and / or may include alterations of other proteolytic processing events. In some cases, such proteolytic events may lead to the degradation of proteins of growth factor signaling molecules. downstream cascades initiated by protein degradation processing or growth factor signaling molecules may include:

[0181] In some embodiments, the compounds and / or compositions of the present invention comprise growth factors (ligands) It can induce or inhibit the dimerization or multimerization of the receptors thereof. In some embodiments, such activity is achieved by the addition of monomeric, dimeric, or multimeric forms. via stabilization of the dimer or disruption of the dimeric or multimeric complex. It is possible.

[0182] In some embodiments, the compounds and / or compositions of the present invention are directed to receptors of the G Monomeric units containing either PC or other signaling molecule pairs can act on heterodimers.

[0183] The antibodies of the present invention can be internalized into cells prior to binding of the target antigen. Such antibodies may increase or decrease one or more signaling events, leading to one or more release or stabilize GPC, block or facilitate growth factor release, and / or may act to alter one or more cellular niches.

[0184] In some embodiments, the compounds and / or compositions of the present invention comprise one or more GPC It also alters the residence time of one or more growth factors in the extracellular matrix and / or The residence time of one or more GPCs in the cell matrix may also be altered. Such alterations may result in irreversible and / or transient localization.

[0185] The antibodies of the present invention can be designed, produced and / or selected using any method known to those of skill in the art. In some embodiments, the antibodies and / or antibody-producing cells of the invention on November 6, 2012, the contents of each of which are incorporated herein by reference in their entirety. No. 61 / 722,919 filed on November 1, 2012. Any of the methods listed in U.S. Provisional Patent Application No. 61 / 722,969, filed on the 6th. It is produced by

[0186] Antibody production in knockout mice In some embodiments, the antibodies of the present invention comprise a gene encoding one or more desired antigens. Such mice can be generated in knockout mice lacking such Antibodies that are not tolerized to the antigen and therefore cross-react with human and mouse forms of the antigen For the production of monoclonal antibodies, the host mice are transfected with the target peptide. Immunization with a peptide induces lymphocytes that specifically bind to the peptide. The resulting hybridoma cells are then harvested and fused with an immortalized cell line. The cells are cultured in a suitable culture medium to support the growth of only the fused cells.

[0187] In some embodiments, the knockout of one or more growth factor genes is lethal. and / or may produce a non-viable fetus or newborn. The newborn animals may survive for only a few weeks (e.g., 1, 2, 3, 4, or 5 weeks). In such an embodiment, immunization may be performed in newborn animals shortly after birth. Oida et al. (Oida, T. et al., "TGF- β induces surface LAP expression on murine CD4 T cells independently of FoxP3 induction ( TGF-β induces surface LAP expression on Murine CD4 T cells independent of FoxP3 "Induction," PLOS One, 2010, Vol. 5 (No. No. 11, p. e15523) prolongs survival (typically in the 3rd to 4th year of life of these mice). Neonatal TGF-β knockout via the use of galectin-1 injections to induce 4-week survival We have demonstrated that immunization of mice with cells expressing murine TGF-β resulted in the development of inflammatory cytokines from day 8 of life. Mice were immunized every other day for 10 days starting from day 1, and splenocytes were harvested on day 22 of age. The collected spleen cells were fused with myeloma cells, and the resulting hybridoma cells were mostly antibody-positive. In some embodiments of the present invention, it has been found that the LAP antibody is successfully produced. These methods can be used to generate antibodies. In some embodiments, Such methods may involve the use of human antigens. In some embodiments, the antigens used for immunization The cells to be transfected may express TGF-β and GARP. ARP is expressed with its native transmembrane domain and used to immunize GARP-TGF-β complexes. This allows the transfected cells to remain tethered to the cell surface. Some antigens are pro-TG tethered to LTBP (e.g., LTBP1S). In some cases, the antigen may include other TGF-β family members. Recombinant proteins related to the

[0188] The method of the present invention may comprise the steps of: The method may also include one or more steps of the immunization method described by Oida et al. Steps include, but are not limited to, the use of alternative cell types for fusion, performing fusion, pooling of varying numbers of splenocytes when administering the treatment, changing injection regimens, changing the date of splenocyte collection, These may include changing the immunogen and / or changing the immunogen dose. Examples include the collection of other tissues (e.g., lymph nodes) from immunized mice. can.

[0189] Activating and Inhibitory Antibodies Antibodies of the present invention can include activating and inhibitory antibodies. The term "activating antibody" refers to an antibody that enhances growth factor activity. This includes antibodies targeting any epitope that enhances activity. domains (e.g., LAP and LAP-like domains), growth factors, or antibodies The activating antibodies of the present invention may be present on other epitopes that, when activated, confer growth factor activity. Examples include, but are not limited to, TGF-β activating antibodies, GDF-8 activating antibodies, G DF-11 activating antibodies and BMP activating antibodies can be mentioned.

[0190] As used herein, the term "inhibitory antibody" refers to an antibody that reduces growth factor activity. Inhibitory antibodies refer to any antibody that reduces growth factor activity when associated with such an antibody. Such epitopes include antibodies targeting epitopes in the prodomain (e.g., , LAP and LAP-like domains), growth factors, or antibodies that bind to them to inhibit growth factor activity. The inhibitory antibodies of the present invention may be present on other epitopes that result in reduced activity. Although not commonly used, TGF-β inhibitory antibodies, GDF-8 inhibitory antibodies, and GDF-11 inhibitory antibodies and BMP-inhibiting antibodies.

[0191] Embodiments of the present invention include methods for producing soluble ... and modifying growth factor signaling using activating and / or inhibitory antibodies. This includes methods for:

[0192] Anti-LAP and anti-LAP-like domain antibodies In some embodiments, the compounds and / or compositions of the invention comprise a prodomain, e.g. As an antibody against LAP, one or more antibodies targeting LAP and / or LAP-like domains may be included. Such antibodies may be used to identify specific LAP or LAP-like domains that are bound by such antibodies. Depending on the gene and / or the defined epitope being targeted, growth factor signaling The anti-LAP and / or anti-LAP-like proteins of the present invention may reduce or increase the binding of the LAP-like proteins to the LAP-like proteins. Antibodies can promote the dissociation of free growth factors from GPCs. Such dissociation can promote the release of free growth factors from GPCs. Antibody binding can be induced upon or dissociation occurs between free growth factor and LAP or LAP This can be facilitated by preventing reassociation with other proteins. The anti-TGF-βLAP antibody inhibits TGF-β activity. Such antibodies may in some cases be used to convert latent GPC to TGF- Releasing free TGF-β growth factors and / or reassociating free TGF-β growth factors with LAP In some cases, anti-TGFβ inhibitors may increase TGF-β activity by preventing the binding of The -βLAP antibody is more effective in inhibiting TGF-β when pro-TGF-β is associated with LTBP. In some cases, anti-TGF-β LAP may increase pro-TGF-β activity. When associated with GARP, TGF-β activity may be increased more favorably. In this case, the anti-TGF-β LAP antibody inhibits other TGF-β activators (e.g., α v β6 and / or α v β8) to increase TGF-β activity.

[0193] Variations The compounds and / or compositions of the present invention may be directed to one or more nucleic acids, multiple nucleic acids, or fragments of nucleic acids. A whole polypeptide, a plurality of polypeptides, or a set of polypeptides that can be encoded more independently. It may be present as a fragment or a variant of any of the above. In this context, the term "polypeptide" refers to an amino acid sequence most often joined together by peptide bonds. As used herein, the term refers to a polymer of amino acid residues (natural or non-natural). Proteins, polypeptides, and peptides of any size, structure, or function may be used if In some cases, the encoded polypeptide is smaller than about 50 amino acids. In this case, the polypeptide is called a peptide. If present, it is at least about 2, 3, 4, or at least 5 amino acid residues in length. Therefore, polypeptides include the above gene products, naturally occurring polypeptides, synthetic polypeptides, and the like. polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants and Polypeptides can be single molecules or multi-molecular complexes, For example, they may be dimers, trimers, or tetramers. It may also include multi-chain polypeptides, which may be associated or linked. Amino acids in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids This may also be true for polymers.

[0194] As used herein, the term "polypeptide variant" refers to a polypeptide having an amino acid sequence An amino acid sequence variant refers to a molecule in which the amino acid sequence differs from the naturally occurring or reference sequence. have substitutions, deletions, and / or insertions at certain positions in the amino acid sequence compared to the sequence Typically, a variant will have at least about 50% identity to the native or reference sequence. (homology), preferably they have at least about 8 to the native or reference sequence. 0%, more preferably at least about 90% identical (homologous).

[0195] In some embodiments, "variant mimetics" are provided. When used herein, the term "variant mimetic" refers to a variant that contains one or more amino acids that mimic the activation sequence. For example, glutamic acid may be substituted with phospho-threonine and / or can function as a mimetic for phospho-serine. Alternatively, the variant mimetic can be This can result in inactivation or inactivation of products containing mimetics, for example, phenylalanine can act as an inactivating substitution for tyrosine; or alanine can act as an inactivating substitution for serine. The amino acid sequences of the compounds and / or compositions of the present invention may act as activating substitutions. It may contain naturally occurring amino acids and may itself be a protein, peptide, polypeptide, or the like. Alternatively, the compounds and / or compositions may be considered to be fragments of natural products. and non-naturally occurring amino acids.

[0196] As used herein, the term "amino acid sequence variant" refers to a naturally occurring or It refers to a molecule that has some difference in its amino acid sequence compared to the original sequence. The ant may have substitutions, deletions, and / or insertions at certain positions within the amino acid sequence. As used herein, the terms "native" or "starting" when referring to a sequence A natural or starting sequence is a relative term that refers to the original molecule to which it can be compared. A native sequence or molecule is a wild-type sequence (i.e., a sequence that is found in nature). The sequence may represent a sequence other than the wild-type sequence, but need not be identical to the wild-type sequence.

[0197] Typically, variants will have at least about 70% homology to the native sequence, and preferably Preferably, they are at least about 80% identical to the native sequence, more preferably at least about 90% identical. 0% homologous.

[0198] As used herein, the term "homology" is used when applied to amino acid sequences. If so, align the sequences and introduce gaps, if necessary, to achieve the maximum percent homology. The residues in the candidate amino acid sequence that are identical to the residues in the amino acid sequence of the second sequence after synthesis are The method and computer program for alignment are Homology is based on percent identity calculations, but the calculations It is understood that values ​​may vary due to gaps and penalties introduced in sea ​​bream.

[0199] As used herein, the term "homolog" refers to a homologue of a given amino acid sequence. If the second sequence of the second species is a corresponding sequence of the other species that has substantial identity to the second sequence of the second species, means.

[0200] As used herein, the term "analog" refers to a polypeptide that retains the properties of a parent polypeptide. one or more amino acid alterations, e.g., substitution, addition, or deletion of an amino acid residue, to maintain the The term "polypeptide variant" is intended to encompass polypeptide variants that differ only by the sequence.

[0201] As used herein, the term "derivative" is used synonymously with the term "variant." A molecule that is used and has been modified or changed in any way relative to the reference or starting molecule Refers to...

[0202] The present invention provides several types of compounds that are amino acid based, including variants and derivatives. Compounds and / or compositions are contemplated. These include substitutions, insertions, deletions and covalent modifications. Therefore, substitutions, insertions, additions, deletions and derivatives are included within the scope of the present invention. and / or covalent modifications. Adding tags or amino acids, e.g., one or more lysines, to the peptide sequences of the invention Sequence tags can be used for peptide purification or It can be used for localization or to increase peptide solubility or to allow biotinylation. Alternatively, lysines can be used to enhance the activity of peptides or proteins. The amino acid residues located in the carboxy and amino terminal regions of the amino acid sequence are Alternatively, certain amino acids can be deleted to provide a truncated sequence. (e.g., C-terminal or N-terminal residues) are, for example, soluble or bound to a solid support Deletions may be made depending on the use of the sequence as part of a larger sequence or expression of the sequence. can.

[0203] "Substitutional variant," when referring to a protein, refers to at least one amino acid sequence in the native or starting sequence. One amino acid residue was removed and a different amino acid was inserted in its place at the same position. The substitutions may be single substitutions, where only one amino acid in the molecule has been substituted, or They may be polysubstituted, where more than one amino acid has been substituted in the same molecule.

[0204] As used herein, the term "conservative amino acid substitution" refers to a substitution that is not normally present in a sequence. Replace an existing amino acid with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include substitutions of non-polar (hydrophobic) residues, e.g., isoleucine, Examples include substitution of cysteine, valine, and leucine for another non-polar residue. An example of a conservative substitution is the substitution of one polar (hydrophilic) residue for another, e.g. between arginine and lysine, between glutamine and asparagine, and between glycine and Furthermore, substitutions between basic residues, e.g., lysine, arginine, or Substitution of one acidic residue, e.g., histidine, for another, or substitution of one acidic residue, e.g., asparagine, Substitution of a carboxylic acid or glutamic acid for another acidic residue is an additional example of a conservative substitution. Examples of non-conservative substitutions include substitutions of non-polar (hydrophobic) amino acid residues, e.g., isoleucine polar (hydrophilic) residues, e.g., cysteine, valine, leucine, alanine, methionine; substitutions for glutamine, glutamic acid or lysine, and / or polar residues Substitutions for non-polar residues of groups are included.

[0205] As used herein, the term "insertion variant" refers to a protein , one or more amino acids immediately adjacent to an amino acid at a particular position in the native or starting sequence As used herein, the term "directly adjacent" means that the linked to either the α-carboxy or α-amino functional group of the starting or reference amino acid Refers to adjacent amino acids.

[0206] As used herein, the term "deletion variant" refers to a protein , in which one or more amino acids in the native or starting amino acid sequence have been removed. Deletion variants have one or more amino acids deleted in a particular region of the molecule.

[0207] As used herein, the term "derivative" refers to , one or more modifications by organic proteinaceous or non-proteinaceous derivatizing agents, and post-translational modifications. Covalent modifications include variants of the native or starting protein that contain modifications. , organic derivatization capable of reacting targeted amino acid residues of proteins with selected side chains or terminal residues. a post-translational modification mechanism that functions by reacting with a methylating agent or in a selected recombinant host cell. The resulting covalent derivatives are introduced into the hydroxyl groups of the hydroxyl groups, and the residues important for biological activity are then introduced. in immunoassays or recombinant glycoproteins in programs aimed at identifying These modifications are useful for preparing anti-protein antibodies for immunoaffinity purification. is within the skill of the practitioner and is carried out without undue experimentation.

[0208] Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently deamidated post-translationally. Alternatively, these residues can be gently converted to the corresponding glutamyl and aspartyl residues. Either form of these residues is suitable for use in the present invention. It may be present in the protein used.

[0209] Other post-translational modifications include proline and lysine hydroxylation, seryl or threonine hydroxylation, phosphorylation of the hydroxyl groups of hydroxyl residues, lysine, arginine, and histidine side chains Methylation of the α-amino group (TECreighton) "Proteins: Structure and Molecular Properties" by and Molecular Properties," W.H. Freeman Co. H. Freeman & Co., San Francisco, pp. 79-86 (1983).

[0210] Covalent derivatives include those in which the proteins of the invention are covalently linked to non-proteinaceous polymers. Non-proteinaceous polymers are typically hydrophilic compounds. Synthetic polymers are polymers that are not otherwise found in nature. Polymers that are naturally occurring, recombinant, or produced by in vitro methods are those that are isolated from nature. Hydrophilic polyvinyl polymers, e.g., polyvinyl Polyvinyl alcohol and polyvinylpyrrolidone are within the scope of the present invention. Alkylene ethers, such as polyethylene glycol and polypropylene glycol, are useful. Proteins can be bound to various non-proteinaceous polymers, such as polyethylene glycols. Polyol, polypropylene glycol or polyoxyalkylene, as disclosed in U.S. Pat. No. 4,640 ,835; U.S. Pat. No. 4,496,689; U.S. Pat. No. 4,301,1 No. 44; U.S. Pat. No. 4,670,417; U.S. Pat. No. 4,791,192 or U.S. Pat. No. 4,179,337. can.

[0211] As used herein, the term "feature" when referring to a protein refers to a feature of a molecule. The proteins of the present invention are defined as distinct amino acid sequence-based entities. These include surface expression, local conformational shape, fold, loop, half-loop, and domain. , half-domains, sites, termini or any combination thereof.

[0212] As used herein, the term "surface expression" when referring to a protein is most Refers to the polypeptide-based components of a protein that appear on the outer surface. As used herein, the term "local conformational shape" refers to a protein In this case, a polypeptide-based structural expression of a protein localized within a limited space of the protein is Point.

[0213] As used herein, the term "fold" when referring to a protein The fold refers to the three-dimensional structure of an amino acid sequence obtained during energy minimization. They can occur at the second or third level of the folding process. Examples of second level folds are Examples of tertiary folds include beta sheets and alpha helices. These include domains and regions formed due to the aggregation or separation of energy forces. Such formed regions include hydrophobic and hydrophilic pockets.

[0214] As used herein, the term "turn" refers to the fact that it relates to a protein conformation. When doing so, the orientation of the peptide or polypeptide backbone can be changed to 1, 2, 3, or It refers to a bend that may contain more amino acid residues.

[0215] As used herein, the term "loop" when referring to a protein refers to a peptide Reverse the orientation of the backbone of a peptide or polypeptide to form a peptide containing four or more amino acid residues. or structural features of a polypeptide. Oliva et al. have identified a class of protein loops (Oliva, B. et al., "An automated classificatory analysis of protein loop structures" ation of the structure of protein loops) ,” Journal of Molecular Biology (J Mol Biol), 199 7, Vol. 266 (No. 4), pp. 814-30).

[0216] As used herein, the term "half-loop" when referring to a protein The term refers to a portion of an identified loop that has at least half the amino acid residues of the loop from which it is derived. It should be understood that a loop may not always contain an even number of amino acid residues. When a loop contains or is identified as containing an odd number of amino acids, the half loop of the odd loop The loop is an integer part of the loop or the next integer part (number of amino acids in the loop / 2 + / - 0.5 For example, the loop identified as the seven amino acid loop contains three amino acids. Half loop of acid or 4 amino acids (7 / 2=3.5+ / -0.5 gives 3 or 4) can be produced.

[0217] As used herein, the term "domain" when referring to a protein means one Any identifiable structural or functional feature or characteristic (e.g., binding ability, protein-protein interaction) refers to a polypeptide motif having a nucleotide sequence that functions as a site for protein interaction .

[0218] As used herein, the term "half-domain" when referring to a protein A portion of an identified domain having at least half the amino acid residues of the domain from which it is derived. It is understood that a domain may not always contain an even number of amino acid residues. , if the domain contains or is identified as containing an odd number of amino acids In the odd domain, the half domain is the integer part of the domain or the next integer part (domain (number of amino acids in the domain / 2 + / - 0.5 amino acids). For example, a 7 amino acid domain The identified domains are separated by three or four amino acids (7 / 2 = 3.5 + / - 0.5 to 3 or 4 half-domains. Within the half-domains, these subdomains can be identified, and these subdomains can be identified within the domain or domains from which they were derived. possessing less than all of the structural or functional properties identified in the half-domains. It should also be understood that the amino acids comprising any of the domain types herein are The amino acids do not have to be adjacent along the backbone of the amino acid sequence (i.e., non-adjacent amino acids can be structurally It is also understood that the fragments may be combined to produce domains, half-domains, or subdomains. .

[0219] As used herein, the term "site" refers to an amino acid-based embodiment of When referring to a site, the terms "amino acid residue" and "amino acid side chain" are used interchangeably. may be modified, engineered, altered, derivatized, or varied within the polypeptide-based molecules of the present invention. Represents a position within a peptide or polypeptide.

[0220] As used herein, the term "terminus" or "terminus" refers to a inus), when referring to a protein, refers to the end of a peptide or polypeptide. Such ends are limited to only the first or last portion of a peptide or polypeptide. The polypeptide-based molecules of the present invention may also include additional amino acids in the terminal regions rather than N-terminus (terminated by an amino acid with a free amino group (NH2)) and C-terminus (free It is characterized as having both a carboxyl group (COOH) and an amino acid (terminated by an amino acid with a carboxyl group). The proteins of the present invention may in some cases be formed by disulfide bonds or Multiple polypeptides held together by covalent or non-covalent forces (multimers, oligomers) These types of proteins have multiple N- and C-termini. Alternatively, the termini of the polypeptide may optionally be joined by a non-polypeptide-based moiety, For example, they can be modified to start or end with organic conjugates. Cut.

[0221] Once any of these features have been identified or defined as being components of the molecules of the invention, , any manipulation and / or modification of some of these features, including moving, exchanging, inverting, This can be done by deletion, randomization or duplication. Furthermore, the manipulation of features can be It should be understood that modifications to the molecule of interest may achieve the same results. For example, modifications to the domain Manipulations involving deletions result in alterations to the length of the molecule as well as modifications that cause the nucleic acid to encode less than the full-length molecule. Brings about change.

[0222] Modifications and manipulations can be performed by methods known in the art, for example, by site-directed mutagenesis. The resulting modified molecules can then be subjected to in vitro or in vivo assays. For example, those described herein or any other suitable polymers known in the art. Various screening assays can be used to test for activity.

[0223] In some embodiments, the compounds and / or compositions of the present invention comprise one isotopic As used herein, the term "isotope" refers to one or more atoms. In some embodiments, the compounds of the present invention are As used herein, the term "deuterated" means refers to the process of replacing one or more hydrogen atoms in a substance with a deuterium isotope. Isotopes are isotopes of hydrogen. A hydrogen nucleus contains one proton, while a deuterium nucleus contains one proton. The compounds and / or compositions of the present invention contain both deuterated and neutron-containing atoms. to alter one or more physical properties, e.g., stability, or to provide diagnostic and / or experimental The compounds and / or compositions may be enabled for use in applications.

[0224] Conjugates and Combinations The compounds and / or compositions of the present invention may be complexed with one or more homologous or heterologous molecules. It is contemplated by the present invention that the As used herein, the term "homologous molecule" refers to a molecule that is structurally or structurally different from the starting molecule. refers to a molecule that is similar in at least one function, whereas a "heterologous molecule" refers to a molecule that is similar in at least one function to the starting molecule. At least one of the structure or function differs. Thus, structural homologs are A homolog is a molecule that may be substantially structurally similar. can be identical. Functional homologs are molecules that can be substantially functionally similar. In embodiments, such homologs may be identical.

[0225] The compounds and / or compositions of the present invention may include conjugates. Such conjugates include naturally occurring substances or ligands, such as proteins (e.g., For example, human serum albumin (HSA), low-density Lipoprotein (LDL: low-density lipoprotein), high density Lipoproteins (HDL: high-density lipoproteins), globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, dog Examples of suitable surfactants include hydroxypropyl phosphate, cyclodextrin, or hyaluronic acid; or lipids. Conjugates can be recombinant or synthetic molecules, e.g., synthetic polymers, e.g., synthetic polyamines. Examples of polyamino acids include α- and β-amino acids, α- and β-amino acids, and oligonucleotides (e.g., aptamers). Polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene Poly(L-lactide-co-glycolide) copolymer, Poly(L-lactide-co-glycolide) copolymer , divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)meth Acrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl Alcohol (PVA), polyurethane, poly(2-ethylacrylic yllic) acid), N-isopropylacrylamide polymer, or polyphosphazine Examples of polyamines include polyethyleneimine, polylysine (P LL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptides Tide-mimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, Thione lipids, cationic porphyrins, polyamine quaternary salts, or alpha-helical peptides Examples include:

[0226] In some embodiments, the conjugate may also include a targeting group. As used, the term "targeting group" refers to a group that targets a desired region, tissue, cell and / or protein. This refers to a functional group or moiety attached to a drug that facilitates localization of the drug to the target tissue. Suitable targeting groups include, but are not limited to, cell or tissue targeting agents or groups (e.g., For example, lectins, glycoproteins, lipids, proteins, specific cell types, e.g., kidney cells or In some embodiments, targeting can be used to target specific cells. The group includes thyrotropin, melanotropin, lectins, glycoproteins, surfactant proteins tein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactose tosamine, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, glycosylation Polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamate phosphate, polyaspartate, lipids, cholesterol, steroids, bile acids, phorate, bile Contains glutamin B12, biotin, RGD peptide, RGD peptidomimetic or aptamer It can be seen.

[0227] In some embodiments, the targeting group is a protein, e.g., a glycoprotein, or a peptide. peptide, e.g., a molecule having a specific affinity for a co-ligand or antibodies that bind to specific cell types, e.g., cancer cells, endothelial cells, or bone cells. It may be an antibody. The targeting group may also include a hormone and / or a hormone receptor.

[0228] In some embodiments, the targeting group is any ligand that can target a defined receptor. Examples include, but are not limited to, phorate, GalNAc, galactose, mannose, mannose, mannose-6-phosphate, apatamer, inte Glutamate receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin Tonin receptor ligand, PSMA, endothelin, GCPII, somatostatin, LDL In some embodiments, the targeting group includes an aptamer, Such aptamers can be unmodified or can contain any of the modifications disclosed herein. The term "combination" may include any combination of the terms "combination" and "combination".

[0229] In yet other embodiments, the compounds and / or compositions of the present invention comprise a cell-permeating polymer. It can be covalently conjugated to the peptide. In some embodiments, the cell-penetrating peptide may also include a signal sequence. Conjugates may exhibit increased stability, increased cell transfection and / or altered bioactivity. can be designed to have a specific distribution (e.g., targeted to a specific tissue or cell type) .

[0230] In some embodiments, the conjugated moieties are such that they are targeted for clearance. attached to the compounds and / or compositions of the invention to allow for attachment of a detectable label to the Such detectable labels include, but are not limited to: Biotinylated, ubiquitin, fluorescent molecule, human influenza hemagglutinin (HA), c -myc, histidine (His), flag, glutathione S-transferase (G ST), V5 (paramyxovirus simian virus 5 epitope), biotin, avidin dextrin, streptavidin, horseradish peroxidase (HRP), and digoxin Genin is an example.

[0231] In some embodiments, the compounds of the invention are conjugated to an antibody Fc domain. Fc fusion proteins can be created by combining any of the compounds described herein. Formation of the Fc fusion protein can be carried out by any method known in the art, for example, by No. 5,116,964, the contents of which are incorporated herein by reference in their entirety. No. 5,541,087 and U.S. Pat. No. 8,637,637 The Fc fusion protein of the present invention can be produced by the method described in the specification of the same application. c) The present invention binds to the hinge region of IgG Fc via a cysteine ​​residue in the hinge region. The resulting Fc fusion protein may contain antibody-like structures, but may also contain C H In some cases, the Fc fusion protein has neither a single domain nor a light chain. In some cases, the Fc fusion proteins of the present invention may have comparable pharmacokinetic profiles. The protein may have an extended half-life in circulation and / or an altered biological activity.

[0232] In some embodiments, the compounds and / or compositions of the present invention are useful in treating diseases and / or can be combined with each other or with other molecules in the treatment of disease conditions. nucleic acid In some embodiments, the compounds and / or compositions of the present invention are encoded by a nucleic acid molecule. Such nucleic acid molecules include, but are not limited to, D NA molecule, RNA molecule, polynucleotide, oligonucleotide, mRNA molecule, vector In some embodiments, the present invention provides a compound of the present invention. and / or programmed or generated to express a nucleic acid molecule encoding the composition. The cells may include cells that have been infected with the virus.

[0233] How to use The methods of the present invention include methods for modifying growth factor activity in one or more biological systems. Such methods include contacting one or more biological systems with the compounds and / or compositions of the invention. In some cases, these methods involve the detection of a cell in a biological system (e.g., a cellular niche or The compounds and methods of treating such conditions include modifying the levels of free growth factors in a subject. and / or compositions include, but are not limited to, biomolecules, for example, The recombinant proteins, protein complexes and / or Examples of such antibodies include antibodies and antibodies.

[0234] In some embodiments, the methods of the present invention comprise administering to a subject a therapeutic agent for initiating or increasing growth factor activity. This method is referred to herein as the "activation method." Such methods are useful for the release of growth factors from GPCs and / or the re-release of growth factors into latent GPCs. In some cases, activation methods may involve the inhibition of association with antibodies, recombinant proteins, and Some activation methods may involve the use of one or more In such a method, one or more growth factors are released, and In one non-limiting example, growth factors and Anti-LAP antibodies improve the dissociation between the IL-1 and GPC and / or prevent the reformation of GPC. can be provided.

[0235] Embodiments of the present invention involve growth using anti-LAP and / or anti-LAP-like domain antibodies. In some cases, such methods include methods of modifying TGF-β activity. This may involve the use of an anti-TGF-β-LAP antibody as an activating antibody. Methods for using and / or testing such antibodies are described in detail in the entirety of this specification, the contents of which are incorporated by reference. Tsang, M. et al., 1995, Cytokai, incorporated herein by reference. One of the methods taught in Cytokine, Vol. 7 (No. 5), pp. 389-97 may include:

[0236] In some embodiments, the methods of the present invention reduce or eliminate growth factor activity. This method is referred to herein as the "inhibition method." Such methods involve the retention of growth factors in GPCs and / or the transfer of growth factors to latent GPCs. In some cases, the inhibition method may involve the use of an antibody.

[0237] Treatment drugs In some embodiments, the compositions and methods of the present invention are directed to treating a wide range of diseases, disorders and / or conditions. In some cases, such diseases can be treated with The disorder and / or condition may be a TGF-β-associated condition. When used in combination, the term "TGF-β-associated symptoms" refers to the effects of TGF-β family member proteins. Any disease, disorder and / or condition associated with the expression, activity and / or metabolism of or the activity and / or level of one or more TGF-β family member proteins "Diseases" refers to any disease, disorder and / or condition that may benefit from modulation of a disease, disorder and / or condition. TGF-β-related indications include, but are not limited to, fibrosis, anemia of aging, and cancer (e.g., Cancers that are of particular interest include, but are not limited to, colon cancer, renal cancer, breast cancer, malignant melanoma, and glioblastoma. ), promoting rapid hematopoiesis after chemotherapy, bone healing, endothelial proliferation syndrome, asthma and allergies, Gastrointestinal disorders, aortic aneurysms, orphan signs (e.g., Marfan syndrome and Kamračić syndrome) Ingelman's disease), obesity, diabetes, arthritis, multiple sclerosis, muscular dystrophy, amyotrophic lateral sclerosis amyotrophic lateral sclerosis (ALS), Parkinson's disease, osteoporosis, osteoarthritis, osteopenia, metabolic syndrome, nutrition These include: disability, organ atrophy, chronic obstructive pulmonary disease (COPD), and loss of appetite. For additional information, see the following: U.S. Patent Application Publication No. 2013 / 0122007, U.S. Patent No. 8,415,459 No. 2011 / 151432 or any of those disclosed in WO 2011 / 151432. Examples include:

[0238] Efficacy of treating or ameliorating a disease can be measured, for example, by reducing disease progression, disease remission, symptom severity, or pain. reduction, quality of life, the dosage of medicine required to sustain therapeutic effect, disease markers or any other level appropriate for the given disease being targeted for treatment or prevention. It can be evaluated by measuring measurable parameters. Treatment or prognosis can be achieved by measuring any one or any combination of parameters. Monitoring the efficacy of the preventative measures is well within the capabilities of one skilled in the art. In the context of administering a substance, for example, "effective against" cancer may be defined as a substance that is administered in a clinically relevant manner. A beneficial effect on at least a statistically significant proportion of patients, e.g., improvement of symptoms, cure, or disease Reduced disease burden, reduced tumor burden or cell count, extended lifespan, improved quality of life, or other effects generally recognized as positive by physicians familiar with the treatment of a particular type of cancer. Show that it has an effect.

[0239] A therapeutic or prophylactic effect is defined as the presence of a statistically significant improvement in one or more parameters of the disease state. evidenced by a worsening of symptoms or arrest of development that may be present or otherwise expected By way of example, at least a 10% favorable change in a measurable parameter of the disease, preferably Preferably, a change of at least 20%, 30%, 40%, 50% or more is considered effective. The efficacy of a given compound or formulation of the present invention may be demonstrated by those skilled in the art. The efficacy of the present invention can also be assessed using known experimental animal models for a given disease. When using animal models, efficacy of a treatment is demonstrated when statistically significant changes are observed. will be done.

[0240] Therapeutic Agents for Fibrosis In some embodiments, the compounds and / or compositions of the present invention are effective in altering fibrosis. In some embodiments, such compounds and / or compositions may be used in TGF-β is a central orchestrator of the fibrotic response. Antibodies targeting TGF-β have been shown to reduce fibrosis in multiple preclinical models. Such antibodies and / or antibody-based compounds include LY238 2770 (Eli Lilly, Indianapolis, IN) NA). U.S. Patent No. 6,229,999, the contents of each of which are incorporated herein by reference in their entirety. Patent No. 6,492,497, U.S. Patent No. 7,151,169 and U.S. Patent No. 7,723,486 and U.S. Patent Application Publication No. 2011 / 000836 This also includes those described in Specification No. 4.

[0241] Fibrosis is a common sequela of many types of tissue-destructive diseases. When a new space is created by the destruction of differentiated cells, progenitor cells, or stem cells that occupy the niche The default pathway is the proliferation of connective tissue cells, e.g., fibroblasts, to fill the empty spaces. This is thought to be due to the proliferation of extracellular matrices that lead to scarring and permanent loss of tissue. This involves the production of inflammatory components such as collagen.

[0242] A distinct aspect of fibrosis is its chronicity, which means that the underlying destruction of parenchymal cells is terminated. Treatment continues until the cells are replaced by the stem cell pool or by transplantation. Fibrosis is thought to be much easier to halt than to reverse. The TGF-β family mediates fibroblast growth and extracellular matrix organization. Components such as integrin α are of central importance in regulating collagen production. v β6 and α v β8 (and possibly α v β1) activates TGF-β1 and 3 Integrin VLA-1 is a receptor for collagen and its It is expressed on lymphocytes only after activation and is potentially involved in the development of fibrotic disease.

[0243] In some embodiments, the compounds and / or compositions of the present invention inhibit fibrosis. TGF-β integrin α v β6, α v β8 and α v Blocking β1 activation In some embodiments, the compounds and / or compositions of the present invention are designed to It targets the interaction site between PC and LTBP, while targeting the interaction site between GPC and GARP. Such compounds of the present invention and / or The composition can act as an inhibitory antibody, preventing growth factor signaling and inhibiting fibrosis. In some embodiments, the compounds and / or compositions of the present invention inhibit TGF-β1, 2 and 3 or one or more of their chimeric antigens.

[0244] Fibrosis indications for which the compounds and / or compositions of the present invention may be used therapeutically include: These include, but are not limited to, pulmonary manifestations [e.g., idiopathic pulmonary fibrosis (IPF)] phatic Pulmonary Fibrosis), Chronic Obstructive Pulmonary Disease (COPD) ), allergic asthma, acute lung injury, eosinophilic esophagitis, pulmonary arterial hypertension and chemical gas injury scars], renal signs [e.g., diabetic glomerulosclerosis, focal segmental glomerulosclerosis (FSGS) Focal segmental glomeruloclerosis, chronic kidney disease , fibrosis associated with renal transplantation and chronic rejection, IgA nephropathy and hemolytic uremic syndrome], liver fibrosis Diseases [e.g., non-alcoholic steatohepatitis (NASH)] hepatitis), chronic viral hepatitis, parasitemia, inborn errors of metabolism, poison Protein-mediated fibrosis, e.g., alcoholic fibrosis, non-alcoholic steatohepatitis, hepatocellular carcinoma (N ASH-HCC:Non-alcoholic steatohepatitis-he patocellular carcinoma, primary biliary cirrhosis and cirrhotic biliary tract disease vascular inflammation], cardiovascular fibrosis (e.g., cardiomyopathy, hypertrophic cardiomyopathy, atherosclerosis and restenosis), systemic sclerosis, dermal fibrosis (e.g., dermal fibrosis in systemic sclerosis, diffuse Cancerous cutaneous systemic sclerosis, scleroderma, pathological skin scarring, keloids, postoperative scarring, scar formation surgical procedures, radiation-induced scarring and chronic wounds) and cancer or secondary fibrosis (e.g., bone marrow fibrosis, head and neck cancer, M7 acute megakaryoblastic leukemia and mucositis). Other diseases associated with fibrosis that can be treated using the compounds and / or compositions, Disorders or conditions include, but are not limited to, Marfan syndrome, stiff skin syndrome, scleroderma, rheumatoid arthritis, bone marrow fibrosis, Crohn's disease, ulcerative colitis, systemic erythematosus dysplasia, muscular dystrophy, Dupuytren's contracture, Kamuracchi-Engelmann disease, Nerve scarring, proliferative vitreoretinopathy, corneal damage, complications after glaucoma drainage surgery, and multiple Examples include idiopathic sclerosis.

[0245] Useful in determining the efficacy of compounds and / or compositions of the invention for altering fibrosis. Useful assays include, but are not limited to, histological assays to count fibroblasts. Assays and basic immunohistochemistry known in the art include:

[0246] Animal models also demonstrate the efficacy of compounds and / or compositions of the invention in altering fibrosis. Examples of animal fibrosis models useful for such analyses include, for example, Schae, DW (Schae), the contents of which are incorporated herein by reference in their entirety. fer, DW et al., 2011, European Respiratory Review (Eu Respir Rev), Vol. 20, No. 120, pp. 85-97 Such models include, but are not limited to: However, the models listed in Table 1 of that publication, such as lung model, kidney model, liver model, heart model, etc. Examples include vascular models and / or collagen induction models. Chaefer et al. also teach the use of pirfenidone in the treatment of fibrosis. In some cases, the compounds and / or compositions of the present invention may be administered in combination with pirfenidone. It can be used in.

[0247] In some instances, the compounds and / or compositions of the present invention may be used in the treatment of pulmonary fibrosis. A pulmonary fibrosis model can be used to demonstrate the efficacy of the compounds and / or compositions of the present invention. The pulmonary fibrosis model can be used in the development and / or testing of bleomycin-containing pulmonary fibrosis. bleomycin-induced lung injury model and / or chronic bleomycin-induced lung injury model. The bleomycin-induced lung injury model was developed by Schaefer et al. , and further Horan et al. (Horan, GS) , 2008, American Journal of Respiratory and Critical Care Am J Respir Crit Care Med, Vol. Vol. 177 (No. 1), pp. 56-65, Epub, October 4, 2007. (the contents of each of which are incorporated herein by reference in their entirety) According to Horan's study, SV12 9 Mice are exposed to bleomycin via the trachea, resulting in the development of pulmonary fibrosis. In this study, potential therapeutic agents were administered via intraperitoneal injection, while postmortem lung tissue or bronchoalveolar Lavage fluid collections were assayed for hydroxyproline levels as an indicator of fibrotic activity. Using the same technique, the collagen Iα2 gene promoter can be used to express Mice carrying an expressing luciferase reporter gene are used in the model. As a result, luciferase activity assays in response to collagen gene induction can be performed. Fibrotic activity can be determined by bleomycin-induced lung model. Thrall et al. (Thrall, RS et al., 1979) American Journal of Pathology (Am J Pathol), Vol. 95 , pp. 117-30, the contents of which are incorporated herein by reference in their entirety) Additional lung models can be performed using the mouse asthma model. Airway remodeling (pulmonary fibrosis) can be seen in subjects with chronic asthma. As an asthma model, the method described by Nials et al. Nials, AT et al., 2008, Disease Models and Disease Models and Mechanisms, Vol. 1, pp. 213-20, the contents of which are incorporated herein by reference in their entirety. Examples of the treatment for chronic obstructive pulmonary disease (COPD) include those described in Models such as Vlahos' Vlahos, R. et al., 2014, Clinical Science (Clin Sci), Vol. 126, pp. 253-65, the contents of which are incorporated by reference in their entirety. (the disclosure of which is incorporated herein by reference). A model of emphysema caused by pulmonary emphysema can be used. Such a model is fully disclosed in the literature, the contents of which are incorporated herein by reference. Ma et al., 2005, Journal of Clinical Chemistry, vol. 1, pp. 111-115, which is incorporated herein by reference. J Clin Invest, Vol. 115, p.3 460-72. Such rodent models can be used in a variety of applications, the contents of which are incorporated herein by reference in their entirety. Roberts, SN et al., 1995, incorporated into the book J Pathol, Vol. 176 (No. 3), p. 30 Intratracheal fluorescein isothiocyanate (FITC) injection according to the methods described in 9-18. This can be performed using the cein isothiocyanate infusion model. Models of sebaceous and silica-induced lung injury can also be used. , the contents of which are incorporated herein by reference in their entirety. .G. et al., 1996, American Journal of Respiratory and Am J Respir Crit Care Me d), Vol. 154 (No. 5), pp. 1511-1519. In some cases, models of lung irradiation can be used. Paulan, J., the contents of which are incorporated herein by reference in their entirety. n, J. et al., 2001, Toxicology, Vol. 161, In some cases, the method can be carried out as described on pages 153-63. A paramyristate acetate (PMA)-induced lung injury model can be used. Such a model is described in Taylor, R.G., the contents of which are incorporated herein by reference in their entirety. (Taylor, RG) et al., 1985, Laboratory Investigation (Lab Invest), Vol. 52 (Issue 1), pp. 61-70. It is possible.

[0248] To develop and / or test the compounds and / or compositions of the present invention, In some embodiments, well-established models of renal fibrosis can be utilized. Unilateral ureteral obstruction (UUO) model In this model, mice are subjected to proximal ureteral ligation. After a period of several days, fibrosis is examined in the area blocked by the ligature (Ma, LJ (M a,LJ) et al., 2003, American Journal of Pathology American Journal of Pathology, Vol. 163 (No. 4), p. 1261-73, the contents of which are incorporated herein by reference in their entirety. In this regard, this method is described by Meng, XM et al. Meng, XM et al., "Smad2 protects against TGF-β / Smad3-mediated renal fibrosis." Protects against TGF-beta / Smad2 3-Mediated Renal Fibrosis,” Journal of the American American Society of Nephrology (J Am Soc Nephrol), 2 September 2010, Vol. 21 (No. 9), pp. 1477-87, Epub 201 (July 1, 2010) to examine the role of SMAD-2 in renal fibrosis. MAD-2 is an intracellular member of the TGF-β cell signaling pathway. In this study, a cyclosporine A-induced nephropathy model can be used. Ling, H., the contents of which are incorporated herein by reference in their entirety. et al., 2003, Journal of the American Society of Nephrology As described in J Am Soc Nephrol, Vol. 14, pp. 377-378 In some cases, renal models of Alport syndrome can be used. In the Alport syndrome study, a transgenic mouse with a collagen III knockout was Transgenic mice can be used. These mice have a progressively increased risk of developing leukemia in their kidneys. The Alport syndrome model is incorporated herein by reference in its entirety. Koepke, ML et al., 200 7 years, Nephrol Dialysis Transplantation al Transplant), Vol. 22 (No. 4), pp. 1062-1069 and / or Hahm, K. et al., 2007, American Journal of Pain Research Am J Pathol, Vol. 170 (No. 1), pp. 110-115 It can be implemented as follows.

[0249] In some cases, the compounds of the present invention for the treatment of cardiovascular fibrosis indications and / or Models of cardiovascular fibrosis can be used to develop and / or test compositions. In some cases, vascular injury models can be used. Examples of such models include balloon injury models. Smith et al., 1999, the contents of which are incorporated herein by reference in their entirety. 1999, Circulation Research (Circ Res), Vol. 84 (No. 10), This model can be performed as described on pages 1212-22. Blockade of TGF-β has been shown to block neointima formation. Inhibitory antibodies can be used to reduce and / or block neointima formation.

[0250] In some embodiments, the compounds of the present invention for the treatment of liver fibrosis indications and / or Models of liver fibrosis can be used to develop and / or test compositions. The liver model is based on the Illedal method, the contents of which are incorporated herein by reference in their entirety. ,JP(Iredale,JP), 2007, Journal of Clinical J Clin Invest, Vol. 117 (No. 3), Examples of such a substance include those described on pages 539 to 48. The present invention is not limited to, but may include, any of the models listed in Tables 1 and / or 2. In some cases, the liver model may include a carbon tetrachloride-induced liver fibrosis model. Such a model is available from Fujitsu Limited, the contents of which are incorporated herein by reference in their entirety. Fujii, T. et al., 2010, BMC Gastroenterology (BM C Gastroenterology), Vol. 10, p. 79. It is possible.

[0251] In some embodiments, the compounds of the present invention for the treatment of fibrotic wound indications and / or can use models of wound healing to develop and / or test compositions. An example of a wound model is a chronic wound model.

[0252] In some cases, the compounds and / or compositions of the present invention for the treatment of GI-related fibrosis. The use of models of GI injury-associated fibrosis to develop and / or test compounds is also contemplated. Such damage models include, but are not limited to, 2,4,6- An example is the trinitrobenzene sulfonic acid (TNBS)-induced colitis model. Such models are described in Scheifel, et al., Scheiffele, F. et al., 2002, Current Protocols in Immunology (Curr Protoc Immunol), Chapter 15, Part 15.19 The method can be carried out as described in

[0253] In some embodiments, the compounds and / or compositions of the present invention are directed to treating bone marrow fibrosis. In some cases, the compounds can be used to treat diseases, disorders, and / or conditions associated with the compounds. In such cases, developing and / or testing such compounds and / or compositions For this purpose, a bone marrow fibrosis model can be used. Lacout, C. et al., 2006, Blood, Vol. 108 (No. 5) ), p. 1652-60, and the bone marrow cell adoptive transfer model and transgenic mouse Examples of models, including but not limited to, those described by Vannu, A.M. cchi, AM) et al., 2002, Blood, Volume 100 (No. 4) ), pp. 1123-32 (the contents of each of which are incorporated herein by reference in their entirety). Further models include the thrombolytic model described in Examples of such models include the model of poietin-induced myelofibrosis. Chagraoui, H., which is incorporated herein by reference in its entirety. H. et al., 2002, Blood, Vol. 100 (No. 10), p. 34 95-503.

[0254] In some embodiments, the compounds and / or compositions of the present invention are used to treat muscular dystrophy. (MD:muscular dystrophy), for example but not limited to However, diseases, disorders, and / or conditions associated with Duchenne MD and Becker MD In some cases, such compounds and and / or the MD model can be used to develop and / or test compositions. Such models include the following: Ceco, E. et al., 2013, Federation of Europe Journal of the Faculty of Biochemical Societies (FEBS J), Vol. 280 (No. 17 No.), pp. 4198-209.

[0255] The compounds and / or compositions of the present invention may, in some cases, be used to treat one or more fibrotic symptoms. The drug may be combined with one or more other therapeutic agents for the treatment of such other therapeutic agents. Examples of drugs include, but are not limited to, LPA1 receptor antagonists, lysine Oxidase 2 inhibitors, hedgehog inhibitors, IL-3 / IL-4 inhibitors, CTGF inhibitors , anti-α v Examples include β6 antibodies and anti-IL-13 antibodies.

[0256] In some cases, the compounds and / or compositions of the present invention inhibit TGF-β growth factor activity. and diseases, disorders and / or conditions in which fibrosis may be advantageous by increasing the activity of the Such compounds can include activating antibodies. Cut.

[0257] Therapeutic agents for myelofibrosis Myelofibrosis is a chronic blood cancer caused by mutations in bone marrow stem cells. is characterized by an impairment of the body's ability to make normal blood cells. Patients develop enlarged spleens and livers. Myeloproliferative neoplasms (MPNs) occur in the bone marrow, causing excessive fibrosis. ferative neoplasms are classified into three related types with different clinical characteristics. Primary myelofibrosis (PMF) s), essential thrombocythemia, and polycythemia vera. All three are classified under the JA It has hyperactive signaling of the K-STAT cell signaling pathway (contents of which are referenced). Klampfi et al., 2013, incorporated herein in its entirety. New England Journal of Medicine (NEJM), Vol. 369, p. 2379-90). Primary myelofibrosis (PMF) is characterized by angiogenesis, reticulin, and collagen synthesis. As the disease progresses, the number of osteoclasts increases and the bone marrow Some fibrosis in PMF can be treated with stem cell transplantation (SCT). Polycythemia vera can be reversed by transplantation. 98% of individuals with JA mutations result in hyperactive JAK-STAT signaling Has K2.

[0258] Current treatments for MPN include allogeneic hematopoietic cell transplantation (HCT). ietic cell transplantation) and Janus kinase (JA K: Janus kinase) inhibition. Allogeneic HCT has a mortality rate of up to 10%. and graft failure and significant side effects and toxicity. Ruxolitinib (Ru), a small molecule inhibitor of JAK2, was approved in 2011 to treat Rux is a drug developed by Incyte Pharmaceuticals. Pharmaceuticals (Wilmington, Delaware) and Novartis JAKAFI® and JAKAFI® are marketed by Novartis (Basel, Switzerland) It is marketed under the name KAVI®. Rux may improve splenomegaly and hepatomegaly. However, it is not curative and some studies have not shown significant benefit (contents are available in their entirety by reference). Odenike, O., 2013, incorporated herein by reference. Hematology, 2013 (Issue 1), pp. 545-52.

[0259] In some cases, the compounds and / or compositions of the present invention are useful in treating myeloproliferative disorders, e.g., These include, but are not limited to, primary myelofibrosis, secondary myelofibrosis, essential thrombocytopenia, Used to treat erythrocytosis, polycythemia vera, idiopathic myelofibrosis, and chronic myeloid leukemia. In some cases, the treatment may involve one or more known treatments for myelofibrosis. Therapies, including but not limited to, allogeneic HCT, JAK inhibition, TGF-β1, Fresolimumab (GC1008; Genzyme) for blocking 2 and 3 me), Cambridge, Massachusetts) Treatment (the contents of which are incorporated herein by reference in their entirety). Incorporated into Mascarenhas, J. et al., 2014 Leukemia and Lymphoma ), Vol. 55, p. 450-2), blocking lysyl oxidase activity and collagen cross-linking Simtuzumab (Gilead Biosciences) for ences), Foster City, California) Therapeutic and Regulatory Macrophages Pentraxin-2 (Promediocrin (P)) to stimulate and inhibit bone marrow fibroblasts Romedior, Lexington, Massachusetts) in combination with treatment In some cases, such compounds of the present invention for the treatment of myelofibrosis and and using models of myeloproliferative disorders to develop and / or test therapeutic agents and / or compositions. As a model, Lacout, C. et al., 2 2006, Blood, Vol. 108 (No. 5), pp. 1652-60 bone marrow cell adoptive transfer models and transgenic mouse models, as examples, Although not a comprehensive analysis, Vannucchi, AM et al., 2002 2002, Blood, Vol. 100 (No. 4), pp. 1123-32 (The (the contents of each of which are incorporated herein by reference in their entirety) Examples of myelofibrosis models include thrombopoietin-induced myelofibrosis. Such models may be used in conjunction with the methods described herein, the contents of which are incorporated by reference in their entirety. Chagraoui, H. et al., 2002, Blood ( Blood), Vol. 100 (No. 10), pp. 3495-503. TGF-β1 has been shown to be the primary agonist of fibrosis in this model. Additional myelofibrosis models are described in US Pat. No. 6,499,113, the contents of which are incorporated herein by reference in their entirety. Mullally, A. et al., 2010, Cancer Center This is carried out as described in Cancer Cell, Vol. 17, pp. 584-96. This can be done.

[0260] Scarring and wound healing treatments In some embodiments, the compounds and / or compositions of the present invention are useful for wound healing and / or or may be useful in altering scar formation. and / or the composition may be used to promote proper wound healing (for example, but not limited to, chronic wounds) In some cases, the compounds and / or compositions of the present invention may Such compounds and / or compounds can be used to reduce, treat and / or prevent the formation of Alternatively, the composition may include an anti-TGF-β antibody. In some cases, the composition may promote wound healing. TGF-β activating antibodies can be used to

[0261] Therapeutic agents for disorders of iron metabolism In some embodiments, the methods, compounds and / or compositions of the present invention are directed to treating disorders of iron metabolism. It can be used to treat disorders such as reduced iron levels Disorders involving elevated iron levels (e.g., anemia) or elevated iron levels (e.g., hemochromatosis) BMP-6 and hemojuvelin interact to promote hepatic inflammatory responses. Some methods, compounds and / or compositions disclosed herein modulate cytocidin expression. The composition can be used to alter hepcidin levels, thereby lowering body iron levels. Adjust the speed.

[0262] Some embodiments of the present invention comprise a hepcidin agonist or a hepcidin antagonist. Hepcidin agonists can be used to inhibit the expression and / or physiological actions of hepcidin. Such agonists may stimulate or promote low hepcidin levels and / or Due to its activity, it may be useful in the treatment or prevention of iron overload. Thus, agonists cannot reverse existing iron overload, but they do reduce iron damage in tissues. Some hepcidin agonists of the present invention may inhibit BMP-6 / hemojuvelin signaling. The production of hepcidin may be increased through activation and / or enhancement of the ring.

[0263] Hepcidin antagonists block the expression and / or physiological actions of hepcidin. Such antagonists may reduce or eliminate the effects of high hepcidin levels. In some embodiments, the hepcidin analogs of the present invention may be useful in cases of iron deficiency. Antagonists include antibodies that disrupt hemojuvelin-mediated BMP-6 signaling. obtain.

[0264] Anemia is a condition and / or disease associated with a decreased number of red blood cells and / or hemoglobin. The compounds and / or compositions of the present invention may be useful in treating anemia. Such anemia includes anemia of inflammation (AI). Anemia of chronic disease (ACD) is also known as anemia of chronic disease. Subjects with ACD include those with rheumatoid arthritis, cancer, Subjects with ACD may suffer from chronic renal failure or acute inflammation due to infection, etc. Typically, this includes elevated levels of hepcidin and decreased erythropoiesis. Sasu et al., 2010, Blood, Vol. 115 In a study by the Japanese Society for Hepcidin Research (No. 17, p. 3616-24), Antibodies with this property were effective in treating murine anemia in a mouse model of inflammation. This study found that the most effective treatment is combining antibodies with erythropoiesis-stimulating agents (ESAs). It has been found that some compounds and / or compositions of the present invention include It can be used in combination with ESAs to increase efficacy. Current anti-hepcidin antibodies include Ab12B9 (Amgen, Thousand Oaks, California) and LY2787106 (Eli Lilly ( Eli Lilly, Indianapolis, Indiana. FG459 2 (FibroGen, San Francisco, California) It is a small molecule inhibitor of hypoxia-inducible factor (HIF) that is still used to treat hematoma.

[0265] In some cases, the compounds and / or compositions of the present invention may be used to treat iron deficiency associated with gastric bypass surgery. iron deficiency anemia (IDA) and / or People with inflammatory bowel disease (IBD) Gastric bypass surgery can be used to treat subjects with a proximal gastric pouch. and the ability to metabolize iron remains reduced due to the duodenal bypass (Warsh (Warsh) et al., 2013, the contents of which are incorporated herein by reference in their entirety. IBD patients suffer from iron deficiency due to intestinal blood loss and reduced absorption due to inflammation. It is common to get sick.

[0266] Some compounds and / or compositions of the present invention are useful for treating iron-refractory iron deficiency anemia (IRIDA). IRIDA can be used to treat subjects suffering from rheumatoid arthritis. It is a genetic disease caused by a defect in α-glucose-2 (De Falco, L. alco, L. et al., 2013, the contents of which are incorporated herein by reference in their entirety. The transmembrane serine protease matriptase-2 is an important hepcidin regulator. Matriptase-2 can enzymatically cleave hemojuvelin. Subjects with hemojuvelinase-2 activity have elevated levels of hemojuvelin due to the lack of degradation. Thus, hepcidin expression remains elevated and iron levels are reduced. These include, but are not limited to, microcytic hypochromic anemia, low transferrin saturation, Some subjects with IRIDA have normal to elevated levels of hepcidin. Although it is diagnosed shortly after birth, many are not diagnosed until adulthood. The treatments described herein are may be used to modulate irregular hepcidin levels associated with IRIDA. can.

[0267] Iron overload anemia can occur as a result of blood transfusions. The excess iron associated with transfused blood is transferred to the bloodstream by the natural These cannot be secreted into the blood and require additional treatment for removal, such as chelation therapy. Such treatments are generally not well tolerated and can involve many side effects. There is a clinical need for better tolerated treatments. Additional treatments include transfusion-free X for the treatment of patients aged 10 years and older with NTDT syndrome EXJADE (registered trademark) is one example of a TGF-β superfamily member. It also contains the ligand trap ACE-536, which blocks the ATP receptor. Both JADE) and ACE-536 are known to increase erythropoiesis. In some embodiments, the compounds and / or compositions of the present invention are useful for regulating iron overload. Some such embodiments can be used to remove iron from the matrix, so that iron is more It may function to repopulate macrophages where it is well tolerated. This can be achieved through increased hepcidin levels. Gardenghi et al. (Gardenghi et al., 2010, Journal of Journal of Clinical Investigation (JCI), Vol. 120 (No. 12), p. 4 In studies by 466-77), overexpression of murine hepcidin was associated with the progression of β-thalassemia. Increased hemoglobin levels in mouse models of hemochromatosis and Adding iron to the diet could reduce iron overload (Viatte et al., 2006, Br. Ladd (Blood, Vol. 107, p. 2952).

[0268] Circulating GDF-15 levels were found to be negatively correlated with hepcidin levels. This suggests a role for GDF-15 in iron loading and / or metabolism ( Finkenstedt et al., 2008, British British Journal of Haematology 144, pp. 789-93, the contents of which are incorporated herein by reference in their entirety. Transcription of the gene encoding GDF-15 is upregulated by stress and / or In some cases, the compounds of the present invention can be upregulated under hypoxic or hypoxic conditions. and / or the composition modifies GDF-15 signaling activity to improve iron disorders and The compounds can be used to treat subjects suffering from anemia and / or anaemia. The compound and / or composition may stabilize or destabilize GDF-15GPC, and via modulation of one or more interactions between GDF-15 and one or more cofactors The antibody may include an antibody that can be stabilized or destabilized by the antibody.

[0269] Hemochromatosis is characterized by iron overload resulting from excessive absorption of dietary iron. Hereditary hemochromatosis (HH) is a disease caused by the In rhomatosis, this overload is due to the common autosomal dominant HFE gene from both parents. In these cases, iron is released from the plasma in the body and in organs and tissues, including, but not limited to, the pancreas, liver, and skin Iron can be overloaded in the skin, resulting in damage caused by iron deposition (Tussing-Han Tussing-Humphreys et al., 2013). Treatment for this may include multiple phlebotomies per year. In this regard, the compounds and / or compositions of the present invention may modulate iron levels in a subject. can be used to treat HH by

[0270] Mutations in the hepcidin (HAMP) and / or hemojuvelin (HFE2) genes is responsible for a severe form of hemochromatosis known as juvenile hemochromatosis (Rohler et al., 2004). Roetto et al., 2003; Papanikolauo u) et al., 2004). Some exons of hemojuvelin associated with juvenile hemochromatosis The mutations lead to protein misfolding and the loss of hemojuvelin from cells. This reduces secretion and therefore reduces total hemojuvelin signaling activity. The mutation affects hemojuvelin interactions with other signaling molecules. Mutation G99 Hemojuvelin containing R, for example, cannot bind to BMP-2. Hemojuvelin, which contains BMP-2, cannot associate with neogenin. Therapeutic embodiments may include modulation of hemojuvelin signaling.

[0271] During chemotherapy, cell division is temporarily stopped to prevent the growth and spread of cancerous cells. An undesirable side effect is the loss of red blood cells, which depend on active cell division of bone marrow cells. In some embodiments, the compounds and / or compositions of the present invention are administered in conjunction with chemotherapy. It can be used to treat anemia.

[0272] In some cases, the compounds and / or compositions of the invention may be used in combination with the treatments described herein. It can be combined with any of the drugs to increase efficacy. Treatment for anemia, thrombocytopenia, and neutropenia During chemotherapy, cell division is temporarily stopped to prevent the growth and spread of cancerous cells. Undesirable side effects include the production of red blood cells, platelets, and white blood cells, which depend on active cell division of bone marrow cells. In some embodiments, the compounds and / or compositions of the present invention blood clots (loss of red blood cells), thrombocytopenia (low platelet count) and / or neutropenia (low blood count) Therapeutic approaches can be designed to treat patients suffering from a low neutrophil count (decreased neutrophil count).

[0273] Cancer Treatment A variety of cancers can be treated with the compounds and / or compositions of the present invention. As used herein, the term "cancer" refers to a cancer that invades surrounding tissue and metastasizes to new internal sites. It refers to any of various malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to Cancer also refers to a pathological condition characterized by malignant neoplastic growth such as a tumor or hematological malignancy. The tumor may be any tumor, including but not limited to all types of lymphoma / leukemia Diseases, carcinomas and sarcomas, e.g., anal, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, uterine Endometrium, esophagus, eyes, gallbladder, head and neck, liver, kidneys, pharynx, lungs, mediastinum (chest), oral cavity, ovaries, Found in the pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, tailbone, testicles, thyroid gland, and uterus These include cancers or tumors that are

[0274] In cancer, TGF-β can be either growth promoting or growth inhibitory. In pancreatic cancer, SMAD4 wild-type tumors showed growth inhibition in response to TGF-β. However, as the disease progresses, constitutively activated type II receptors are typically present. Additionally, there are SMAD4-null pancreatic cancers. In some embodiments, the compounds of the present invention and / or compositions that inhibit TGF-β signaling that functions uniquely in one or more forms of cancer. These drugs are designed to selectively target components of the signaling pathway. Cancers of the blood or bone marrow, characterized by an abnormal proliferation of white blood cells, are classified into four major types: It can be divided into various categories, including acute lymphoblastic leukemia (ALL), chronic lymphoblastic leukemia (CLL), and lymphocytic leukemia (CLL), acute myeloid leukemia or acute myeloid leukemia (AML) (10 and chromosomes 11 [t(10,11)], 8 and 21 [t(8;21)], Translocation between chromosomes 15 and 17 [t(15;17)] and inversion in chromosome 16 AML with [inv(16)]; AML with multilineage dysplasia, as previously Patients with myeloproliferative disorders that transform into myelodysplastic syndromes (MDS) or AML were included. Therapy-related AML and myelodysplastic syndromes (MDS), as categories have had prior chemotherapy and / or radiation and subsequently developed AML or MDS d) AML not otherwise categorized, including those patients with and e) acute leukemia of unknown lineage. Leukemia cells cannot be classified as myeloid or lymphoma cells, or both occurs when a cell type is present); and chronic myeloid leukemia (CML) Myelogenous leukemia is one example.

[0275] Carcinomas of this type include, but are not limited to, papilloma / carcinoma, choriocarcinoma, and endothelial tumors. Lobar sinus tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma , hemangioma, osteoma, chondroma, glioma, lymphoma / leukemia, squamous cell carcinoma, small cell carcinoma, large cell These include undifferentiated carcinoma, basal cell carcinoma and sinonasal undifferentiated carcinoma.

[0276] Types of sarcoma include, but are not limited to, soft tissue sarcoma, e.g., alveolar soft tissue sarcoma Sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, angiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, Phangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and and Askin tumor, Ewing sarcoma (primary neuroectodermal tumor), malignant hemangioendothelioma, malignant These include schwannoma, osteosarcoma, and sarcoma of the ovaries.

[0277] In some embodiments, the compounds and / or methods of the present invention may be used to Cancers that are not common include, but are not limited to, colon cancer, renal cancer, breast cancer, malignant melanoma, and glioblastoma. One or more types of cancer or cancer-related conditions can be treated (Schlingensiepen Schlingensiepen et al., 2008; Ouhtit et al. , 2013).

[0278] High-grade gliomas (e.g., anaplastic astrocytoma and glioblastoma) are the most common type of malignant brain tumor. They comprise approximately 60% of the total gliomas. TGF-β2 is overexpressed in over 90% of such gliomas. It has been found that the expression level correlates with tumor progression. Studies using TGF-β2 reduction at the mRNA level have shown significant improvements in tumor outcomes. (Bogdahn et al., 2010). In light of these studies, Some compositions of the present invention can be used therapeutically to treat individuals with high-grade gliomas. Such compositions can be used to measure the levels of free TGF-β2 and / or TGF- It may act to reduce the level of β2 activity.

[0279] In some cases, TGF-β2 activity impairs immunological tumor surveillance and metastasis. contribute to tumorigenesis through modulation of angiogenesis, proliferation and / or immunosuppressive functions. (Schlingensiepen et al., 2008) A study by Reed et al. (Reed et al., 1994) found that a large proportion TGF-β in melanocytic lesions, e.g., primary invasive melanoma and metastatic melanoma 2 mRNA expression. Some compounds and / or compositions of the present invention may be used in combination with other compounds and / or compositions of the present invention. Modulating TGF-β2 activity and / or levels in lesions and / or lesion shape Melanoma cell growth in the brain parenchyma is inhibited by TGF-β2 It has also been shown to be affected by activity (Zhang et al., 2009). Some compounds and / or compositions of the present invention may enhance TGF-β2 activity and / or levels. can be used to prevent or control such cell growth through modulation of This can be done.

[0280] Among women worldwide, breast cancer is the most prevalent form of cancer. Breast cancer metastasis is, in part, Interactions between cancer cells and extracellular matrix components, such as hyaluronic acid (HA) CD44 is the major receptor for HA on cancer cells. have been shown (Ouhtit et al., 2013). CD44 and HA Interactions between TGs result in modulation of cell motility, survival, adhesion, and proliferation. F-β2 transcription is also upregulated by CD44 signaling activity, resulting in cell motility Unfortunately, current treatments have limited efficacy. In some cases, the present invention The compounds and / or compositions alter cellular activity induced by TGF-β2 upregulation. can be used to change

[0281] The present invention provides compounds and / or compositions of the invention for treating one or more forms of cancer. other medicines and / or other treatments of the product, e.g., known medicines and / or In combination with known therapeutic methods, such as those currently used to treat those disorders. For example, the compounds and / or compositions of the present invention may be used in combination with one or more additional It may also be administered concurrently with other anti-cancer treatments, such as biotherapy, chemotherapy, and radiotherapy. Therefore, treatments include, for example, imatinib (Gleevec) c), all-trans retinoic acid, monoclonal antibody therapy (gemtuzumab, ozoga) mycin), chemotherapy (e.g., chlorambucil, prednisone, prednisolone, vincristine, Cristine, cytarabine, clofarabine, farnesyltransferase inhibitors, Citabine, MDR1 inhibitor), rituximab, interferon-α, anthracycline phosphate drugs (e.g., daunorubicin or idarubicin), L-asparaginase, doxorubicin Rubicin, cyclophosphamide, doxorubicin, bleomycin, fludarabine, etoposide poside, pentostatin, or cladribine), bone marrow transplant, stem cell transplant, radiation therapy, Antimetabolites (methotrexate and 6-mercaptopurine), or any combination thereof A combination can be mentioned.

[0282] Radiation therapy (also called radiotherapy, X-ray therapy, or irradiation) is a method of treating cancer cells. Radiation therapy is the use of ionizing radiation to kill bacteria and shrink tumors. External beam radiotherapy (EBRT) Radiation therapy can be administered externally via radiation therapy or internally via brachytherapy. The effects of the method are localized and limited to the area being treated. solid tumors of various types, such as brain, breast, neck, pharynx, lung, pancreas, prostate, skin, stomach, It can be used to treat cancer of the uterus, or soft tissue sarcoma. Radiation can also be used to treat leukemia. and is also used to treat lymphoma.

[0283] Chemotherapy is the treatment of cancer with drugs that can destroy cancer cells. The term "chemotherapy" usually refers to treatments that affect rapidly dividing cells, as opposed to targeted therapies in general. Refers to cytotoxic drugs. Chemotherapeutic drugs attack cells in a variety of ways, for example, by altering DNA duplication or interferes with cell division by separating newly formed chromosomes. Most forms of chemotherapy targets all rapidly dividing cells and is not specific to cancer cells, although many cancer cells are D NA damage cannot be repaired, whereas normal cells generally can. A degree of specificity can occur.

[0284] Most chemotherapy regimens are given in combination. Exemplary chemotherapy agents include: including but not limited to 5-FU enhancer, 9-AC, AG2037, AG33 40, aggrecanase inhibitors, aminoglutethimide, amsacrine (m-AMSA), Sparginase, azacitidine, batimastat (BB94), BAY12-9566, BCH-4556, bis-naphthalimide, busulfan, capecitabine, carboplatin Carmustaine + Polyfeprosan Osan, cdk4 / cdk2 inhibitor, chlorambucil ), CI-994, cisplatin, cladribine, CS-682, cytarabine HCl, D 2163, dactinomycin, daunorubicin HCl, DepoCyt, Dexifosamide, Docetaxel, Dolastine lastain), doxifluridine, doxorubicin, DX8951f, E7070, EGFR, epirubicin, erythropoietin, estramustine phosphate sodium, eto poside (VP16-213), farnesyltransferase inhibitor, FK317, Lavopiridol, floxuridine, fludarabine, fluorouracil (5-FU), fluthamide, flagylin, gemcitabine, hexamethylmelamine HMM), hydroxyurea (hydroxycarbamide), ifosfamide, interferon interferon alpha-2a, interferon alpha-2b, interleukin-2, irinotecan, IS I641, Krestin, Lemonal DP2202 , leuprolide acetate (LHRH-releasing factor analog), levamisole, LiGLA (gamma -Lithium linoleate), Rosin Seed, Lometexol, Lomustine (CCNU), Marimistat, Mechlorethamine H Cl (nitrogen mustard), megestrol acetate, meglamine ne) GLA, mercaptopurine, mesna, mitoguazone (methyl-GAG; methylglycine Oxal bis-guanylhydrazone (MGBG), mitotane (o.p'-DDD), Toxantrone, Mitoxantrone HCl, MMI270, MMP, MTA / LY231 514, octreotide, ODN698, OK-432, oral platinum agents, oral toxoids, Paclitaxel (TAXOL®), PARP inhibitor, PD18 3805, pentostatin (2'-deoxycoformycin), PKC412, plicamycin Syn, procarbazine HCl, PSC833, ralitrexed, RAS farnesyltra Transferase inhibitors, RAS oncogene inhibitors, semustine (methyl-CCNU), streptavidin Leptozocin, suramin, tamoxifen citrate, taxane analogs, temozolomide, Teniposide (VM-26), thioguanine, thiotepa, topotecan, tyrosine kinase, UFT (tegafur / uracil), valrubicin, vinblastine sulfate, vindesine sulfate, VX-710, VX-853, YM116, ZD0101, ZD0473 / AnoMed (Anormed), ZD1839, and ZD9331.

[0285] Biotherapy uses the body's immune system directly or indirectly to eradicate or treat some cancers. In some embodiments, the compounds of the present invention may be used to treat or alleviate side effects that may be caused by the treatment. and / or compositions, e.g., that stimulate immune system action against one or more tumors. However, this approach is not as effective as other Such biological approaches, such as immune response modification therapies, e.g., interferon , interleukins, colony-stimulating factors, other monoclonal antibodies, vaccines, gene therapy The administration of the compounds of the present invention may also be considered biotherapeutics, and non-specific immunomodulators may also be used. and / or anti-cancer therapies that may be combined with the composition are envisioned.

[0286] Small molecule targeted therapy drugs generally target mutated, overexpressed, or otherwise targeted molecules in cancer cells. Inhibitors of enzymatic domains of important proteins, e.g., tyrosine kinase inhibitors Matinib (Gleevec / Glivec) and Gef and imipramine (Iressa). Examples of monoclonal antibody therapies that can be used include, but are not limited to: , the anti-HER2 / neu antibody trastuzumab (Herceptin (He rceptin), and the anti-CD20 antibody R1, which is used in various B-cell malignancies. Some cancers grow by providing or blocking certain hormones. Common examples of hormone-sensitive tumors include certain types of breast cancer and and prostate cancer. Removal or blockage of estrogen or testosterone can In some cancers, hormone agonists, e.g., progesterone, The administration of gestogens can be therapeutically beneficial.

[0287] Cancer immunotherapy is a diverse range of treatments designed to induce a patient's own immune system to eradicate tumors. This refers to a set of treatment strategies, including but not limited to, those for superficial bladder cancer. Intravesical BCG immunotherapy, for example, induces specific immune responses for malignant melanoma and renal cell carcinoma. and the administration of prostatic acid phosphatase peptides to dendritic cells from patients. Cyprinus grafti for prostate cancer, which induces specific immune responses against prostate-derived cells by loading with cyprinus grafti. Examples include the use of Eucel-T.

[0288] In some embodiments, the compounds and / or compositions of the present invention prevent T cell inhibition. Such compounds and / or compositions are designed to inhibit the prodomain formation of GPC. or extracellular matrix and / or cell matrix components, e.g. Growth from, but not limited to, GARP, fibrillin, or LTBP Dissociation of the factor may be prevented. Therapeutic agents for bone healing The compounds and / or compositions of the present invention are useful for treating bone disorders and / or promoting bone healing. Cellular remodeling of bone can be used to improve skeletal integrity. This process helps to prevent bone abnormalities and areas of weakness. The osteoclasts function to repair bone by cycles of bone resorption and new bone formation. The BMP-β family members, preferably BMPs, are involved in the processes of osteoclast resorption and formation. TGF-β family is thought to be an important factor in the coupling of Members are predominant in bone matrix and are upregulated by bone injury. Family members confer strength to the fully formed bone matrix and protect against fracture. TGF-β family members in bone remodeling The role of the bar makes them a valuable tool for potential therapeutic agents to treat bone disorders and diseases. It makes for an attractive target.

[0289] Many diseases and / or disorders affect bones and joints. Disorders can be congenital, genetic and / or acquired. or disorders include, but are not limited to, bone cysts, infectious arthritis, Paget's disease of bone, Osgood-Schlatter disease, Keller's bone disease, osteophytes, bone tumors, Craniosynostosis, fibrodysplasia ossificans progressiva, fibrous dysplasia of bone, giant cell tumor of bone, hypophosphatase Taseemia, Klippel-Feil syndrome, metabolic bone disease, osteoarthritis, osteitis deformans, cysts Osteitis fibrosa, osteitis pubis, sclerosing osteitis, sclerosing osteitis iliac, osteochondrosis dissecans, osteochondroma, bone Hypoplasia, osteomalacia, osteomyelitis, osteopenia, osteopetrosis, osteoporosis, osteosarcoma, porosity Hyperostosis, primary hyperparathyroidism, renal osteodystrophy and water retention in the knees Examples include:

[0290] Mouse models for evaluating the efficacy of therapeutic agents on bone development and repair are available. It is well known in the field. Mohammad et al. (Muhammad, KS ohammad, KS et al., "Pharmacological inhibition of TGF-β type I receptor kinase Pharmacologic in vivo studies have anabolic and anti-catabolic effects on bone. inhibition of the TGF-beta type I receptor Kinase has anabolic and anti-catabolic "Effects on bone," PLoS One, 2009 , Vol. 4 (No. 4), p. e5275, Epub, April 16, 2008) In one such model, demonstrated by in C57B1 / 6 mice via twice-daily oral gavage of the potent inhibitor SD-208 Subsequently, bone mineral density (BMD) was measured using the PIXImus mouse. densitometer (GE Lunar II, Faxitron Corporation) (Faxitron Corp., Wheeling, IL) Changes in BMD are expressed as percentage changes in the scanned area. After 6 weeks, male mice exhibited a 4.12% increase in bone formation, while female mice exhibited a 5.2% increase. It was found to exhibit additional

[0291] The compounds and / or compositions of the present invention are useful for simple or complex fracture and / or bone repair. In such treatment, the compounds of the present invention and and / or administering the composition directly to the injury site or to implanted devices and coating biomatrix. Furthermore, the compounds of the present invention and and / or the composition is provided in the treatment area together with one or more GPCs, and Treatments that facilitate the sustained release of one or more of these growth factors are contemplated.

[0292] Therapeutic Agents for Angiogenic and Endothelial Proliferative Conditions The compounds and / or compositions of the present invention are useful in treating angiogenesis and endothelial proliferation syndromes, diseases or The term "angiogenesis" is used herein to describe a method for treating angioplasty. When used in this context, it refers to the formation and / or reorganization of new blood vessels. In such cases, blood vessel growth, formation, or reorganization may occur. Hyperactivity (e.g., tumor growth and uncontrolled cell growth) can lead to increased blood supply. These conditions may include: , including but not limited to, hemangioma, angiosarcoma, telangiectasia, lymphangioma, congenital These include vascular abnormalities, tumor angiogenesis, and postoperative vasculature. Excessive angiogenesis can be It is found in cancer, macular degeneration, diabetic blindness, rheumatoid arthritis, psoriasis and many other conditions. Excessive angiogenesis is often driven by excessive expression of angiogenic growth factors. The compounds and / or compositions are designed to block growth factors involved in excessive angiogenesis. Alternatively, the compounds and / or compositions of the present invention may be used to inhibit growth factor signaling. This can promote vascularization and improve angiogenesis in conditions where angiogenesis is inhibited. Such conditions include, but are not limited to, coronary artery disease, stroke, diabetes, and Chronic wounds are included.

[0293] Therapeutics for Orphan Indications and Diseases The compounds and / or compositions of the present invention are useful for treating orphan indications and / or diseases. Such diseases include Marfan syndrome. This syndrome is a connective tissue disorder that affects physical growth and development. Tissues and organs at risk include the heart, blood vessels, bones, eyes, lungs, and the connective tissue surrounding the spinal cord. Unfortunately, this effect can be life-threatening. The syndrome is caused by a genetic mutation in the gene that produces fibrillin, a major component of the body's connective tissue. It is caused by a mutation in the latent TGF-β binding protein (LTBP). TGF-β signaling shows close identity to phosphoprotein family members Functional LTBP is required to control the release of active TGF-β. (Oklu, R. et al., "Latent Transforming Growth Factor-β Binding" The latent transforming protein (LTBP) family growth factor beta binding protein (LTBP) )family),” Biochem J, 2000 December 15, Vol. 352, Part 3, pp. 601-10). In some embodiments, The compounds and / or compositions of the invention may be used to modify the release profile of TGF-β. In such embodiments, the compounds and / or compositions are designed to bind to inhibitory antibodies. The antibody may include an antibody characterized as such.

[0294] In some embodiments, the compounds and / or compositions of the present invention comprise Kamurachi Enge This disease primarily affects the bones, causing increased The long bones of the legs and arms are particularly affected; however, the skin and buttocks The bones of the lower back may also be affected. The disease results in leg and arm pain and a variety of other symptoms. ED is extremely rare, reported in approximately 200 individuals worldwide, and It is caused by a mutation in the GF-β gene. TGF-β has an abnormal prodomain, leading to overactive TGF-β signaling (Ya Janssens, K. et al., "In Kamuraczi-Engelmann disease" Transforming growth factor-β1 mutations may result in activation or differentiation of the mutant protein. Any alteration in secretion leads to increased signaling (Transforming growth factor-beta 1 mutation in Camura ti-Engelmann disease lead to increased s ignaling by altering either activation o r secretion of the mutant protein), Journal J Biol Chem, February 2003 28th, Vol. 278 (No. 9), pp. 7718-7724, Epub, 2002 December 18, 2013). Shi et al. (Shi, M. et al., "Latent TG" Latent TGF-beta structure and activation d activation,” Nature, June 15, 2011, As described in Vol. 474 (No. 7351, pp. 343-349), CED Among the mutations, Y81H disrupts the α2-helix residue that harbors the TGF-β finger. The charge-reversal E169K and H222D mutations alter the dimerization interface of the prodomain. Disrupts the pH-regulating salt bridge between Glu169 and His222 in residue Arg218 is substantially buried: it is the cation π bond with Tyr171 and the growth factor prod The dimer interface with residue Asp226 in the "bowtie" region of the main complex (GPC) Furthermore, the CED mutations at Cys223 and Cys225 Demonstrating the importance of disulfide bonds in the bowtie region for maintaining GF-β in an inactive form In this embodiment, the compounds of the invention, including one or more inhibitory antibodies, and / or In some embodiments, the composition functions to alleviate symptoms. It is done to a subject.

[0295] Therapeutic Agents for Immune and Autoimmune Diseases and Disorders The compounds and / or compositions of the present invention are useful for treating immune and autoimmune disorders. Such disorders include, but are not limited to, acute respiratory distress syndrome (SARS-CoV-2), Acute Disseminated Encephalomyelitis (ADEM) gyelitis), acute necrotizing hemorrhagic leukoencephalitis, Addison's disease, agammaglobulinemia , alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM / anti-TBM nephritis, antiphospholipid Antiphospholipid syndrome (APS), autoimmune Hemangioendothelioma, autoimmune aplastic anemia, autoimmune autonomic neuropathy, autoimmune hepatitis, autoimmune Autoimmune dyslipidemia, autoimmune immunodeficiency, autoimmune inner ear disease (AIED: Auto immune inner ear disease), autoimmune myocarditis, autoimmune Pancreatitis, autoimmune retinopathy, autoimmune thrombocytopenic purpura (ATP) e thrombocytopenic purpura), autoimmune thyroid disease, Autoimmune urticaria, axonal and nerve neuropathy, Barrow's disease, Behçet's disease, bullous pemphigoid Acne, cardiomyopathy, Castleman's disease, celiac disease, Chagas disease, chronic fatigue syndrome, chronic inflammation Chronic inflammatory demyelinating polyneuropathy (CIDP) myelinating polyneuropathy), chronic relapsing multifocal osteomyelitis ( CRMO: Chronic recurrent multifocal ostomy elitis), Churg-Strauss syndrome, cicatricial pemphigoid / benign mucous membrane pemphigoid, Roan disease, Cogan syndrome, cold agglutinin disease, congenital heart block, Coxsackie myocarditis, Rest's disease, essential mixed cryoglobulinemia, demyelinating neuropathy, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), type 1 diabetes, discoid lupus, Dressler syndrome, intrauterine Eosinophilic esophagitis, eosinophilic fasciitis, erythema nodosum, experimental allergic encephalomyelitis, Vance syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), glomerulonephritis , Goodpasture's syndrome, Granulomatosis with Polyangiitis (GPA) Polyangiitis (Wegener's disease), Graves' disease, Guillain-Barré syndrome Barre syndrome, Hashimoto's encephalitis, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schönlein purpura Herpes gestationis, hypogammaglobulinemia, idiopathic thrombocytopenic purpura (ITP) opathic thrombocytopenic purpura), IgA nephropathy, IgG4-related sclerosis, immunoregulatory lipoproteins, inclusion body myositis, insulin-dependent diabetes mellitus (Type 1), interstitial cystitis, juvenile arthritis, juvenile diabetes, Kawasaki syndrome, Lambert-E. ton syndrome, macroangiopathy, leukocytoclastic vasculitis, lichen planus, lichen sclerosus atrophic, woody nodules. Meningitis, Linear IgA disease (LAD), lupus ( SLE), Lyme disease, chronic Meniere's disease, microscopic polyangiitis, mixed connective tissue disease (M CTD:Mixed connective tissue disease), Mole ulcer, Much-Habermann disease, multiple endocrine neoplasia syndrome, multiple sclerosis, myositis, severe Myasthenia, narcolepsy, neuromyelitis optica (Devic's disease), neutropenia, ocular cicatricialis Pemphigus, optic neuritis, relapsing rheumatoid arthritis, PANDAS (Streptococcus cus)-related pediatric autoimmune neuropsychiatric disorders), paraneoplastic cerebellar degeneration, paroxysmal nocturnal hemorrhage Paroxysmal nocturnal hemoglobinuria (PNH) binuria), Parry-Romberg syndrome, Parsonage-Turner syndrome, pars planitis (peripheral uveitis), pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia, POEM S syndrome, polyarteritis nodosa, polyglandular autoimmune syndrome types I, II and III, polyglandular Endocrinopathy, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, post-pericardiotomy syndrome, prostate cancer Rogesterone dermatitis, primary biliary cirrhosis, primary sclerosing cholangitis, psoriasis, psoriatic arthritis, Idiopathic pulmonary fibrosis; pyoderma gangrenosum, pure red cell aplasia, Raynaud's phenomenon, reactive arthritis, reflex sympathetic nervous system Transcranial dystrophy, Reiter's syndrome, relapsing polychondritis, restless legs syndrome, retroperitoneal Membrane fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schmidt's syndrome, scleritis, Scleroderma, Sjögren's syndrome, small vessel vasculitis, autoimmune diseases of the sperm and testes, stiff- Son's syndrome, subacute bacterial endocarditis (SBE) endocarditis), Suzack syndrome, sympathetic ophthalmitis, Takayasu arteritis, temporal arteritis / Giant cell arteritis, thrombocytopenic purpura (TTP) urpura), Tolosa-Hunt syndrome, transverse myelitis, tract autoimmune disorders, ulcerative colitis , undifferentiated connective tissue disease (UCTD) ive tissue disease), uveitis, vesicular bullous dermatosis, vasculitis, Vitiligo and Wegener's granulomatosis (also known as granulomatosis with polyangiitis (GPA)) are examples. It can be obtained.

[0296] TGF-β plays an active role in leukocyte differentiation, proliferation, and activation, thereby enhancing immunity. TGF-β is an important factor in the development of immune and autoimmune diseases. Promotes proliferation and influences adhesion molecule-mediated localization. TGF-β in cardiac, pulmonary, and gastric inflammation Furthermore, SMAD3-deficient mice show impaired T cell activation. and reduced mucosal immunity, resulting in increased susceptibility to chronic mucosal infections (Brobe, GC (Blobe, GC) et al., "Transforming Growth Factor-β in Human Diseases" Role of transforming growth factor be "Contain human disease," New England Journal of Medicine (N Engl J Med), May 4, 2000, Vol. 342 (No. 18 As an immunosuppressant, TGF-β inhibits the function of inflammatory cells. , which has been shown to improve the function of regulatory T cells. The β-growth factor prodomain complex (GPC) binds to glycoprotein A repeat anonymous protein (GA It has been shown that GARP binds to regulatory T cells through interactions with GARP. is required for TGF-β association with T cells (Tran,DQ) "GARP (LRRC32) regulates platelets and activated FOXP3 + on regulatory T cells GARP (LRRC32) is essential for the surface expression of latent TGF-β sential for the surface expression of la tent TGF-β on platelets and activated FO XP3 + regulatory T cells,” Proceedings of the National Academy of Sciences of the United States of America (PN AS), 2009, Vol. 106 (No. 32), pp. 13445-50. This interaction The platform required for the integrin-dependent release of active TGF-β from GPCs (Wang, R. et al., "GARP is a basal receptor for TGF-β" GARP regulates the availability and activation of bioavailability and activation of TGF-β ),” Molecular Biology of the Cell (Mol Biol Cell), March 2012, Vol. 23 (No. 6), pp. 1129-39, Epub 20 In some embodiments, the compounds and / or compositions of the present invention This modulates the interaction between GARP and TGF-β. The application involves selectively targeting T cell activity for the treatment of disease (e.g., autoimmune disease and / or cancer). In some embodiments, the compounds and / or compositions of the present invention may selectively modulate The composition can be used to treat immune and / or autoimmune disorders. In this embodiment, the compounds and / or compositions of the present invention comprise GARP-bound GPC, GARP or or may specifically target the interaction site between GARP and GPC. In the present invention, the compound and / or composition comprising an antibody is a compound and / or composition comprising an antibody comprising an antibody promotes the release of growth factors (for example, but not limited to, TGF-β), while The compounds of the present invention are designed not to affect the release of growth factors from LTBP-bound GPC. and / or compositions for the treatment of immune and autoimmune disorders are considered to be comparable to standard of care (SOC). or in synergistic combination with a concomitant diagnostic agent.

[0297] Therapeutic Agents for Infectious Agents In some embodiments, the compounds and / or compositions of the present invention may comprise, for example, one or more These compounds may be useful for treating infectious diseases and / or disorders in subjects with an infection of the In some embodiments, the subject has one or more infections or is at risk of developing one or more infections. As used herein, the term "infection" refers to an infection that is capable of multiplying within a host. It refers to a disease or condition in a host resulting from the presence of one or more foreign organisms or agents. Infection typically occurs in one or more normal mucous membranes or mucous membranes by one or more infectious organisms or agents. Infections include the breakdown of other tissue barriers. Subjects with one or more infections present in their body A subject that contains one or more objectively measurable infectious organisms or agents. A subject at risk of having an infection is a subject who is susceptible to developing one or more infections. Subjects may, for example, have a history of known or suspected exposure to one or more infectious organisms or agents. In some embodiments, subjects at risk of having an infection may include those with a These include those with impaired ability to mount an immune response to infectious organisms and / or agents. subjects with conditions associated with, for example, congenital and / or acquired immune deficiencies; subjects undergoing radiation therapy and / or chemotherapy, subjects with burn injuries, subjects with traumatic injuries and subjects undergoing surgery or other invasive medical or dental procedures. It can also be done as follows.

[0298] Infections are classified as bacterial, viral, or other infectious organisms based on the category of infectious organism and / or agent involved. Other less common types of infections are broadly classified as bacterial, fungal, and / or parasitic. For example, infections including rickettsia, mycoplasma, as well as scrapie, bovine Spongiform encephalopathies (BSE) hy), and prion diseases (e.g., kuru and Creutzfeldt-Jakob disease). Infection-causing agents are also known in the art. Examples of fungi and parasites are well known in the art. Infections can be acute, subacute, chronic, It may be active or subclinical, and it may be localized or systemic. As used, the term "chronic infection" refers to an infection that is cleared by the normal action of the innate or adaptive immune response. that persists in the subject for extended periods of time, on the order of weeks, months, and years. Chronic infection may reflect the latency of the infectious agent and the absence of infectious symptoms. Examples of chronic infections include, but are not limited to, Examples of infections include HIV infection and herpes virus infection. Predominantly intracellular or extracellular infection during at least one stage of the life cycle of the infectious organism or agent It could be.

[0299] The compounds and / or compositions of the present invention and the additional therapeutic agent may be combined in the same composition. (e.g., parenterally), as part of a separate composition, or in combination with another composition described herein. It can be administered by any method.

[0300] Therapeutic Agents for Eye-Related Diseases, Disorders and / or Conditions In some embodiments, the compounds and / or compositions of the present invention are useful in treating eye-related diseases. These may be useful in the treatment of disorders and / or conditions. Common side effects include, but are not limited to, glaucoma, dry eye, and / or corneal wound healing. In some embodiments, the compounds and / or compositions are useful in the treatment of glaucoma. Possibly. Evidence suggests that TGF-β2 is upregulated in glaucoma (Philips et al., 2011). Picht, G. et al., "Transformation of aqueous humor in different types of glaucoma." Association between filtering growth factor β2 levels and filtering bleb development (Transfor ming growth factor beta 2 levels in the aqueous humor in different types of glau coma and the relation to filtering bleb development”, Grefes Archive for Clinical Experience Remental Ophthalmology (Graefes Arch Clin Exp Oph thalmol), March 2001, Vol. 239 (No. 3), pp. 199-207; Tripathi, RC et al., "Increased aqueous humor in glaucoma Aqueous humor in glauco matous eyes contain an increased level of TGF-β2,” Experimental Eye Research s), December 1994, Vol. 59 (No. 6), pp. 723-7). These include primary open-angle glaucoma and juvenile glaucoma. TGF-β2 is a hormone that regulates intraocular pressure. induces senescence-like effects in human trabecular meshwork cells, which are often dysfunctional in glaucoma. There is also evidence that TGF-β2 is a marker of oxidative stress in humans (Yu, AL et al., "TGF-β2 is a marker of oxidative stress in humans"). TGF-β2 induces senescence-related changes in trabecular meshwork cells ence-associated changes in human trabecu lar meshwork cells), Investigative Ophthalmology Invest Ophthalmol Vis Sci), November 2010, Vol. 51 (No. 11), pp. 5718-23). In embodiments, the compounds and / or compositions of the present invention are used to treat glaucoma, Free TGF-β2 and GPC-bound (inactive) TG in or around the associated ocular tissues It can be used to reduce the ratio of TGF-β to TGF-β2. , which may also affect corneal wound healing (e.g., after surgical repair and / or LASIK treatment) Huh, MI et al., "Distribution and Characterization of TGF-β Isoforms" and signaling mediate corneal fibroblast wound repair (Distribution on of TGF-β isoforms and signaling inter mediates in corneal fibrotic wound repair r),” Journal of Cellular Biochemistry (J Cell Biochemistry) em), October 1, 2009, Vol. 108 (No. 2), pp. 476-88; Sumioka, T. (Sumioka, T.) et al., "TGF-β / Corneal Endothelial Injury-Induced Fibrosis" Inhibitory effect of blocking Smad signaling locking TGF-beta / Smad signal on injury-i fibrosis of corneal endothelium) , Molecular Vision (Mol Vis), 2008, Vol. 14, p. 2272~ 81, Epub 2008-12-11; Carrington, LM ington, LM et al., "TGF-β Isoforms and Their Inhibitors" Differential regulation of key steps in early corneal wound healing lation of key stages in early corneal wo und healing by TGF-beta isoforms and the ir inhibitors), Investigational Ophthalmology and Invest Ophthalmol Vis Sci, May 2006, Vol. 47 (No. 5), pp. 1886-94). Alternatively, the composition may modulate TGF-β-related proteins in the cornea to enable wound healing. Such compounds and and / or the composition finds acceptance in areas where previous attempts have been unsuccessful. Mead, AL et al., "New Developments in Glaucoma Surgery" Evaluation of anti-TGF-β2 antibody as a potential postoperative anti-scarring agent nti-TGF-beta 2 antibody as a new postope rative anti-scarring agent in glaucoma s "Investigative Ophthalmology and Visual Science (Invest Ophthalmol Vis Sci), August 2003 , Vol. 44 (No. 8), pp. 3394-401) describes a method for preventing scarring in ocular tissues. Anti-TGF-β2 antibodies have been developed; however, clinical trials have been inconclusive. In some embodiments, the compounds and / or compositions of the invention increase TGF-β2 levels ( can be used to modulate GPC binding (free vs. bound), thereby promoting anti-scarring Offers an alternative therapeutic approach.

[0301] Drugs for Cardiovascular Indications In some embodiments, the compounds and / or compositions of the present invention may be administered in combination with one or more cardiovascular Indications, including but not limited to, may be used to treat cardiac hypertrophy. Cardiac hypertrophy typically involves enlargement of the heart due to an increase in the cellular volume of cardiac cells. Aurigemma, 2006, New England Journal of Medicine Annual of Medicine (N Engl J Med), Vol. 355 (No. 3), p. Age-related cardiac hypertrophy is due, in part, to a decrease in circulating levels of GDF-11. This may be due to a decrease in (2013, Cell, Vol. 153, pp. 828-839) The study found that merging the circulatory systems of young and old mice has a protective effect on cardiac hypertrophy. This study found that the effects of steroids on cardiac function decreased with age and that treatment also reduced cardiac hypertrophy. Some compounds of the present invention and their combination have been shown to be effective in treating rheumatoid arthritis. The compositions and / or compositions can be used to treat and / or prevent cardiac hypertrophy. Such compounds and / or compositions may, in some cases, be used to treat latent GPC. Increases circulating GDF-11 levels via enhanced dissociation of GDF-11 growth factor It may contain a DF-11 agonist.

[0302] In some embodiments, the compositions and methods of the present invention provide for one or more types of arterial disorders. It can be used to treat disorders such as, but not limited to, Although the most common cause of aortic aneurysms is the aortic aneurysm, it can arise from a variety of causes. Most of these ultimately result in overexpression of TGF-β2. ) et al. (Boileau et al., Nature Genetics Letters ture Genetics Letters), 2012, Volume 44 (No. 8), p. 916-23, the contents of which are incorporated herein by reference in their entirety) The authors report that a causative mutation in TGF-β2 is associated with some genetic susceptibility to thoracic aortic disease. Interestingly, the mutation was not found in the haplotype for TGF-β2. Although it was predicted that such mutations would cause deficiency, arterial tissue from individuals with such mutations They contained increased levels of TGF-β2 as determined by immunostaining. , found in arterial tissue from individuals with Marfan syndrome (Nataatmaja (N In some cases, the compounds of the present invention and and / or the composition is used to reduce or prevent elevated TGF-β2 signaling. In such instances, this may prevent the development and / or progression of an aneurysm. Restrict.

[0303] In some embodiments, the present invention is used in the treatment of cardiovascular diseases, disorders and / or conditions. Animal models are used to develop and test compounds and / or compositions of the invention that In some cases, a vascular injury model can be used. Such models include the balloon injury model. These are incorporated herein by reference in their entirety. h) et al., 1999, Circ Res., Vol. 84 (No. 10), pp. 1212-22.

[0304] Medications related to muscle disorders and / or injuries In some embodiments, the compounds and / or compositions of the present invention are useful in treating one or more muscle disorders. and / or can be used to treat injuries. Such compounds and / or compositions include, but are not limited to, GDF-8, Antibodies that modulate GDF-11 and / or activin activity can also be included. Muscles make up approximately 40-50% of total body weight, making them the largest organ in the body. Examples of such conditions include cachexia (e.g., muscle wasting). Muscle wasting can occur in a variety of diseases and and catabolic disorders (e.g., HIV / AIDS, cancer, cancer cachexia, renal failure, congestive heart disease, muscular dystrophy) Trophy, disuse atrophy, chronic obstructive pulmonary disease, motor neuron disease, trauma, neurodegenerative diseases These disorders may be associated with: Therefore, GDF-8 and / or activin signaling activity may contribute to muscle catabolism (Hu et al., 2013). Han et al., 2013, International Journal of Biochemistry Tree and Cell Biology (Int J Biochem Cell Bio l.), Vol. 45 (No. 10), pp. 2333-47; Lee, 2010, Immunology · Endocrine · Metabolic · Agents · in Medicinal · Ke Mistry (Immunol Endocr Metab Agents Med Ch em.), Vol. 10, pp. 183-94, the contents of each of which are incorporated by reference in their entirety. Other muscle disorders may include sarcopenia, which is Sarcopenia is the progressive loss of muscle and function associated with aging. In older adults, sarcopenia can lead to frailty. , which can cause weakness, fatigue, and loss of mobility (Morely, 20 12, Family Practice, Vol. 29, p. As the number of elderly people increases, sarcopenia will become a more serious public health problem. It is gradually becoming a hygiene problem. Hamrick et al. A study by Amrick et al., 2010, Vol. 69 (No. 3), pp. 579-83 demonstrated that GDF-8 inhibition significantly improved muscle function in a mouse model of fibular osteotomy involving lateral compartment muscle injury. The study demonstrated that administration of GDF-8 propeptide can restore muscle mass by approximately 20%. Some compounds of the present invention and / or their derivatives were found to increase the saturation level of α-glucan in the sera of the affected area by 200 mg / kg / day and were sufficient to improve fracture healing. Alternatively, the composition may be used to treat muscle diseases, disorders and / or conditions by modulating GDF-8 activity. In some cases, the compounds of the present invention can be used to treat GDF-8 signaling inhibitors that prevent or reduce GDF-8 signaling activity The compound may be an antagonist.

[0305] Inclusion body myositis (IBM) is a typical It is a disease characterized by progressive muscle loss that occurs during middle age and old age. It results from an autoimmune response to autoantigens, which leads to T cell infiltration of muscle fibers. It is believed to cause muscle fiber destruction (Greenberg, , 2012, Current Opinion Neurology 1), Vol. 25 (No. 5), pp. 630-639. Therapeutic compounds, for example, GDF-8 and and / or disrupt activin signaling, thereby stimulating muscle production and strengthening , the antibody bimagrumab (BYM338; Novartis) targeting type II activin receptors (Novartis, Basel, Switzerland) is being investigated [clinical trial number NCT01 925209, Title: "52-week study of physical function, muscle strength, and mobility in patients with sIBM" Efficacy and safety of bimagrumab / BYM338 in Safety of Bimagrumab / BYM338 at 52 Weeks on Physical Function,Muscle Strength,Mob Resilience in IBM Patients Some compounds and / or compositions of the present invention are useful for treating subjects with IBM. In some cases, such compounds and / or Alternatively, the composition may block GDF-8 activity (e.g., via stabilization of GDF-8 GPC). In addition to IBM, BYM338 is being investigated for the treatment of chronic obstructive pulmonary disease (COPD). In some cases, the compounds of the present invention and / or their use in treating IBM The compositions may also be used to treat COPD. In this regard, the compounds and / or compositions of the present invention may be used in combination with BYM338 and / or It can be administered in conjunction with or in combination with other drugs.

[0306] Medications for diabetes Skeletal muscles use and store glucose for nutrition. Glucose uptake by muscle is a key regulator of circulating glucose levels. (The entire specification is incorporated herein by reference.) McPherron et al., 2013, Adipocytes (Adipocyte), Vol. 2 (No. 2), pp. 92-98. Guo et al. Guo et al., 2012, Diabetes, Vol. 61 (No. 10) Recent studies by (2014) and (2014) showed that GDF-8 receptor-deficient mice were They were crossed with IP / F1 mice (a lipodystrophic mouse strain used as a diabetes model). In this case, the hybrid offspring have reduced levels of blood glucose and improved insulin secretion. Hyperphagia (excessive eating) was also reduced in these mice. In some embodiments, the compounds and / or compositions of the present invention are useful for treating diabetes and / or or to treat binge eating. Some such treatments involve reducing blood glutamate levels. may be used to reduce glucose and / or improve insulin sensitivity In some cases, such treatment involves the use of GDF-8 signaling antagonists. For example, the antibody may comprise one or more antibodies that prevent dissociation of GDF-8 from its prodomain. obtain.

[0307] Therapeutic Agents for Gastrointestinal Diseases, Disorders and / or Conditions In some embodiments, the compounds and / or compositions of the present invention comprise one or more types These can be used to treat gastrointestinal (GI) disorders such as inflammatory bowel disease (IBD) (e.g., Crohn's disease and ulcers) Examples include idiopathic colitis.

[0308] TGF-β2 may play a role in intestinal homeostasis and may have an anti-inflammatory role, contributing to GI In one study, TG F-β2 suppresses macrophage inflammatory responses and protects against inflammatory mucosal injury in developing intestine It has been shown that this is the case (Maheshwari et al., 2011). Interestingly, levels of TGF-β2 are high in breast milk, which suggests that TGF-β2 may contribute to the development of inflammatory bowel disease in some cases. In fact, TGF-β2 in breast milk may function locally in the inflammatory process. Some compounds of the present invention may attenuate the response (Rautava et al., 2011). The products, compositions and / or methods are intended to maintain homeostasis and / or treat GI-related disorders. used to modulate TGF-β2 levels and / or activity in the management of GI It can be used.

[0309] In some cases, the methods of the present invention for treating GI-related diseases, disorders and / or conditions may be used. to develop and / or test compounds and / or compositions for GI-related diseases, disorders, Models of injury and / or pathology can be used. In some cases, GI injury Such damage models may include, but are not limited to: However, the 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis model is Such models may be used in conjunction with the methods described herein, the contents of which are incorporated by reference in their entirety. Scheiffele, F. et al., 2002, Current Protocols in Immunology (Curr Protoc Immunol.), Vol. It may be carried out as described in Chapter 15, Part 15.19.

[0310] Veterinary Use In some embodiments, the compositions and methods of the present invention are used in veterinary medicine, e.g., in non-human It is contemplated that the invention will be utilized in the field of vertebrate medicine and therapy. As used herein, the term "vertebrate" refers to all vertebrate animals, including but not limited to: Not limited to, fish, amphibians, birds, reptiles and mammals However, there are also alpacas, bantengs, bisons, camels, cats, cows, deer, dogs, donkeys, and gayas. Dogs, goats, guinea pigs, horses, llamas, mice, monkeys, mules, pigs, rabbits, rats, and tigers. As used herein, the term "animals" refers to animals, including cattle, sheep, buffalo, yaks, and humans. The term "non-human vertebrate" includes humans (i.e., Homo sapiens). Exemplary non-human vertebrates include wild and domestic species, e.g., Examples include pets and livestock. Livestock are those that provide resources such as food, labor, and are raised in agricultural environments to produce agricultural products and derivative products, such as fibers and chemicals. Generally, livestock includes all mammals of potential agricultural importance, Includes birds and fish. In particular, four-legged meat animals include steers, heifers, cows, calves, These include cows, bulls, cattle, pigs and sheep.

[0311] Bioprocess In some embodiments, the present invention provides a method for modulating the expression of a target gene in a host cell. or may alter the levels of growth factor signaling molecules, and such modulation or alterations that enhance production of biological products and / or compositions of the invention. and (c) providing a method for producing one or more biological products by contacting cells such as In accordance with the present invention, the use of one or more compounds and / or compositions of the present invention These can improve bioprocessing methods by incorporating one or more compounds and / or Alternatively, improvements can be achieved by supplementing, replacing or adding compositions.

[0312] Pharmaceutical Composition The pharmaceutical compositions described herein may be administered in a manner that is consistent with the bioavailability, therapeutic window, and / or distribution The particle may be characterized by one or more of its volume.

[0313] Bioavailability In some embodiments, the pharmaceutical composition comprises a compound and / or composition of the present invention and a GP. In such an embodiment, the complex comprises a complex with C. It can be implanted at the desired treatment site where constant release can occur over a desired period of time. In this embodiment, the implantation of the composite comprises associating it with a sponge and / or bone-like matrix. Such transplants include, but are not limited to, dental implants. These may include sites of bone grafting and / or sites of bone repair.

[0314] In some embodiments, the compounds and / or compositions of the present invention are administered to furin-deficient cells. The GPC produced in such cells is a product of in vivo furin cleavage of GP C. For therapeutic use in areas where release is slowed down due to the fact that it is rate-limiting during processing. In some embodiments, one or more toroids in the GPC and / or The furin site is mutated and the endogenous toroid and / or furin proteases In such embodiments, slowing down growth factor release may be achieved. can (e.g., at the site of implantation).

[0315] The antibodies of the invention can be formulated into compositions together with a delivery / formulation agent or vehicle described herein. When formulated, these compositions exhibit increased bioavailability compared to compositions lacking the delivery agents described herein. As used herein, the term "bioavailability" may refer to "Bioavailability" refers to the systemic availability of a given amount of a particular drug administered to a subject. Irritability is the area under the curve (AU) of a compound in its unchanged form following administration of the compound to a mammal. C: area under the curve) or maximum serum or plasma concentration (C max AUC can be evaluated by measuring the time along the horizontal axis (X-axis). Area under the curve, which plots the serum or plasma concentration of a compound along the vertical axis (Y-axis) against the mean Generally, the AUC for a particular compound can be determined using methods known to those skilled in the art. GS Banker, the contents of which are incorporated herein by reference in their entirety. ker, Modern Pharmacology, Drugs and Pharmaceutical Sciences cs,Drugs and the Pharmaceutical Sciences ), Vol. 72, Marcel Dekker, New York New York, 1996.

[0316] C max The compound concentration is the concentration of the compound that is achieved in the serum or plasma of a subject after administration of the compound to the subject. The maximum concentration of a particular compound is C max Values ​​are measured using methods known to those skilled in the art. As used herein, the phrase "increasing bioavailability" refers to "Adding" or "improving the pharmacokinetics" refers to the administration of a compound of the present invention and / or its derivatives in a subject. or refers to the effect of increasing the systemic availability of the composition (AUC, C max ,or C min In some embodiments, such effects are measured by the In some embodiments, the compound and / or the compound(s) may be co-administered with one or more of the delivery agents described above. Alternatively, the bioavailability of the composition is at least about 2%, at least about 5%, or less. at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least The increase may be at least about 90%, at least about 95%, or about 100%.

[0317] Treatment window The compounds and / or compositions of the invention may be formulated with one or more delivery agents described herein. If administered, the compound and / or compounds may be administered without one or more delivery agents described herein. may exhibit an increased therapeutic window of compound and / or composition administration compared to the therapeutic window of the compound and / or composition As used herein, the term "therapeutic window" refers to a period of time during which there is a high probability of inducing a therapeutic effect. It refers to the range of plasma concentrations, or levels, of a therapeutically active substance at the site of action. In certain embodiments, the therapeutic window of the compounds and / or compositions may be one or more of the therapeutic windows described herein. When co-administered with the above delivery agents, at least about 2%, at least about 5%, at least about 1 0%, at least about 15%, at least about 20%, at least about 25%, at least about 3 0%, at least about 35%, at least about 40%, at least about 45%, at least about 5 0%, at least about 55%, at least about 60%, at least about 65%, at least about 7 0%, at least about 75%, at least about 80%, at least about 85%, at least about 9 The increase may be 0%, at least about 95%, or about 100%.

[0318] Volume of distribution The compounds and / or compositions of the invention may be formulated with one or more delivery agents described herein. When present, the therapeutic effect is improved (e.g., compared to a formulation lacking one or more delivery agents described herein). Volume of distribution (V) dist ) can be shown. V dist The same As used herein, this refers to the amount of a drug in the body relative to the blood or plasma concentration of that drug. When used in a drug delivery system, the term "volume of distribution" refers to the total amount of drug in the body that is at the same concentration as in blood or plasma. V refers to the volume of fluid required to contain dist The amount of drug in the body / blood or is equal to the concentration of the drug in plasma. For example, for a 10 mg dose of a given drug and 10 mg / L For a plasma concentration of 1, the volume of distribution is 1 liter. The volume of distribution is the amount of time a drug is released into extravascular tissues. The large volume of distribution reflects the extent to which the drug is present in tissue components compared to plasma proteins. Reflects the tendency of a drug to bind. dist achieve a steady state concentration In some embodiments, the method can be used to determine a loading dose for administration of the compound. The volume of distribution of the compounds and / or compositions of the invention may be determined by one or more delivery agents described herein. When co-administered with at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least at least about 55%, at least about 60%, at least about 65%, at least about 70% obtain.

[0319] Formulation, Administration, Delivery and Dosage In some embodiments, the compounds and / or compositions of the invention are pharmaceutical compositions. As used herein, the term "pharmaceutical composition" refers to a composition containing one or more pharmaceutically acceptable carriers. In some embodiments, the compound and / or composition of the present invention is formulated with a suitable excipient. In the present invention, the pharmaceutical composition optionally contains one or more additional active substances, e.g., therapeutic and General considerations in the formulation and / or manufacture of pharmaceutical agents For example, see Remington's The Science and Practice of Pharmacy. Science and Practice of Pharmacy), 21st ed. Lippencott Williams & Wilkins Liams & Wilkins, 2005 (incorporated herein by reference). You can put it out.

[0320] In some embodiments, the composition can be administered to a human, human patient, or subject. For purposes of this disclosure, the phrase "active ingredient" generally refers to an active ingredient that is delivered as described herein. "Compounds and / or compositions of the invention" refers to compounds and / or compositions of the invention that are intended to be

[0321] The description of pharmaceutical compositions provided herein is in principle a pharmaceutical composition suitable for administration to humans. Although the present invention is directed to animals, such compositions may also be used in other subjects, e.g., non-human animals, e.g., mammals. It will be understood by those skilled in the art that the composition is suitable for administration to non-human mammals, for example. Modification of pharmaceutical compositions suitable for administration to humans to make them suitable for administration to animals is sufficient. It is understood that a veterinary pharmacologist of ordinary skill would be Administration of the pharmaceutical composition Contemplated subjects include, but are not limited to, humans and / or other primates. mammals, e.g., commercially relevant mammals, e.g., cattle, pigs, horses, sheep, cats; , dogs, mice, and / or rats; and / or birds, e.g., commercially birds, such as birds of prey, chickens, ducks, geese, and / or turkeys. It can be obtained. 【03...

Claims

1. A method for identifying a GDF-8 inhibitory antibody or its antigen-binding fragment, The GDF-8 inhibitory antibody or its antigen-binding fragment reduces GDF-8 signaling activity. The aforementioned method, (i) A step of performing an antibody binding assay to identify an antibody or antigen-binding fragment that binds to an antigen containing a growth factor prodomain complex (GPC), wherein the GPC comprises a GDF-8 prodomain and a GDF-8 growth factor domain; and (ii) From the antibody or antigen-binding fragment identified in (i) above, the step of selecting the antibody or antigen-binding fragment based on its ability to inhibit GDF-8 growth factor activity using a cell-based growth factor activity assay, This generates a GDF-8 inhibitory antibody or its antigen-binding fragment that reduces GDF-8 signaling activity. method.

2. The method according to Claim 1, The antibody or antigen-binding fragment of step (i) is prepared by a method comprising immunizing a host with a recombinant antigen. method.

3. The method according to Claim 2, The recombinant antigen is a cell-based antigen. method.

4. The method according to Claim 1, The antibody binding assay in step (i) is selected from enzyme-linked immunosorbent assay (ELISA)-based assays, surface plasmon resonance-based assays, and flow cytometry-based assays. method.

5. The method according to claim 4, Step (i) is an antibody binding assay, method.

6. The method according to Claim 1, Step (ii) of the cell-based growth factor activity assay includes responding cells containing the reporter gene, The reporter gene comprises a promoter and a protein-coding region encoding one or more detectable gene products, wherein the promoter of the reporter gene responds to GDF-8 signaling activity. method.

7. The method according to claim 6, The aforementioned response cells are HEK293 cells. method.

8. The method according to Claim 1, The further step includes humanizing the antibody or its antigen-binding fragment. method.

9. The method according to Claim 1, The step further comprises subjecting the antibody or its antigen-binding fragment to affinity maturation. method.

10. The method according to Claim 1, The GDF-8 inhibitory antibody or its antigen-binding fragment is an IgG1, IgG2, IgG3, IgG4, IgA, or IgA2 isotype. method.

11. The method according to claim 10, The GDF-8 inhibitory antibody or its antigen-binding fragment is of the IgG1 isotype. method.

12. The method according to Claim 1, The steps include cloning a gene encoding the variable region of the GDF-8 inhibitory antibody or its antigen-binding fragment into a mammalian expression vector encoding a human Fc region, and further expressing a recombinant GDF-8 inhibitory antibody or its antigen-binding fragment containing a human Fc region from the expression vector. method.

13. The method according to claim 12, The aforementioned human Fc region includes a human IgG1κ Fc region. method.

14. The method according to claim 13, The aforementioned human IgG1κFc region contains amino acid mutations that enhance Fc receptor binding. method.

15. The method according to claim 14, The recombinant GDF-8 inhibitory antibody or its antigen-binding fragment containing a human Fc region has an extended circulating half-life and / or altered biological activity. method.

16. The method according to Claim 1, The further step includes modifying the antibody structure to improve its efficacy as a therapeutic agent. method.

17. The method according to claim 16, The modifications include amino acid substitution, glycosylation, palmitoylation and / or protein conjugation. method.

18. The method according to Claim 1, A method further comprising: contacting an antibody or antigen-binding fragment obtained from step (i) or step (ii) with pro / latent GDF8 and BMP / toroid proteinase; and confirming that the antibody or antigen-binding fragment prevents the cleavage of the pro / latent GDF8 by the BMP / toroid proteinase.

19. The method according to claim 18, The BMP / toroid proteinase is selected from the group consisting of bone morphogenetic protein-1 (BMP-1), mammalian toroid protein (mTLD), mammalian toroid-like 1 (mTLL1), and mammalian toroid-like 2 (mTLL2). method.

20. A method according to any one of claims 1 to 19, The further step includes formulating the antibody or its antigen-binding fragment into a pharmaceutical composition together with at least one pharmaceutically acceptable excipient. method.

21. The method according to claim 20, The method further includes the step of formulating the antibody for intravenous, subcutaneous, intraperitoneal, intracerebral, intraocular, intrafocal, local, and intramuscular administration. method.

22. The method according to claim 21, The method further includes the step of formulating the antibody for subcutaneous administration. method.

Images