Mutant hydroxyphenylpyruvate dioxygenase polypeptides, as well as genes encoding same and uses thereof - Patents.com

Abstract

The present invention relates to a mutated hydroxyphenylpyruvate dioxygenase (HPPD) polypeptide, as well as its encoding gene and its use. The mutated HPPD polypeptide retains the activity of catalyzing the conversion of 4-hydroxyphenylpyruvate to homogentisate or homogentisate, and is less sensitive to HPPD-inhibiting herbicides than wild-type HPPD. The amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO:1 contains amino acid mutations at the following sites: F372 site is replaced by A, G or V, and F383 site is replaced by W. The present invention is the first to disclose that the combined mutations at 372 and 383 sites of HPPD polypeptide from various species sources can confer synergistic resistance to HPPD-inhibiting herbicides to plants, and the prospects for its application in plants are broad.

Description

[Technical field]

[0001] The present invention relates to a mutant hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene and uses thereof, in particular to a mutant hydroxyphenylpyruvate dioxygenase polypeptide which is resistant to HPPD-inhibiting herbicides, its encoding gene and uses thereof. [Background technology]

[0002] Hydroxyphenylpyruvate dioxygenase (HPPD) is a enzyme that converts iron ions (Fe 2+ In the presence of acetylcholine and oxygen, 4-hydroxyphenylpyruvic acid (HPP), a tyrosine degradation product, is converted to homogentisic acid / homogentisate (HG), the in-plant precursor of tocopherol and plastoquinone (PQ). Tocopherol acts as a membrane-associated antioxidant. PQ acts as an electron carrier between PSII and the cytochrome b6 / f complex, as well as an essential cofactor for phytoene desaturase, involved in the biosynthesis of carotenoids.

[0003] Herbicides that act by inhibiting HPPD include three main chemical families: triketones, isoxazoles, and pyrazolinates. Inhibition of HPPD blocks the biosynthesis of PQ from tyrosine in plants, which results in PQ depletion and carotenoid deficiency. HPPD-inhibiting herbicides are plant phloem-mobile bleaching agents that cause new growing points and leaves exposed to light to appear white. Carotenoids are essential for photoprotection. In the absence of carotenoids, chlorophyll synthesis and function are disrupted by UV light and reactive oxygen intermediates, resulting in reduced plant growth and even death.

[0004] Methods for providing plants that are resistant to HPPD-inhibiting herbicides include: 1) overexpressing the HPPD enzyme so that a sufficient amount of the HPPD enzyme is produced in the plant in the context of the HPPD-inhibiting herbicide to make the functional enzyme available in the presence of an inhibitor of the HPPD enzyme; 2) mutating the target HPPD enzyme into a functional HPPD that is less sensitive to the herbicide or its active metabolite but retains the ability to convert to HG. Several mutant HPPD polypeptides have been reported in the prior art, which have amino acid mutations at one or more positions relative to the original wild-type sequence from which they are derived, and which show improved resistance to one or more HPPD-inhibiting herbicides. Furthermore, the prior art further reports that mutant HPPD polypeptides obtained by combining two amino acid mutations show higher resistance to HPPD-inhibiting herbicides than HPPD polypeptides having either of the two amino acid mutations alone. However, it has not yet been reported that HPPD polypeptides derived from various species and containing combinations of mutations at positions 372 and 383 of the Avena sativa wild-type HPPD polypeptide may confer synergistically improved resistance in plants to HPPD-inhibiting herbicides. Summary of the Invention

[0005] The object of the present invention is to provide a novel mutant hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene and its use. The mutant hydroxyphenylpyruvate dioxygenase polypeptide not only has HPPD enzyme activity but also enables plants transformed with the gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide to exhibit synergistically improved tolerance to HPPD-inhibiting herbicides.

[0006] In order to achieve the above-mentioned object, the present invention provides a mutant hydroxyphenylpyruvate dioxygenase polypeptide that retains the activity of catalyzing a reaction converting 4-hydroxyphenylpyruvic acid to homogentisic acid or homogentisate and has lower sensitivity to HPPD-inhibiting herbicides than wild-type HPPD, the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprising amino acid mutations at the following positions in the amino acid sequence set forth in SEQ ID NO:1, i.e., amino acid mutations in which F at position 372 is replaced with A, G, or V, and F at position 383 is replaced with W.

[0007] Preferably, the mutated hydroxyphenylpyruvate dioxygenase polypeptide comprises the following amino acid mutations in the amino acid sequence set forth in SEQ ID NO:1: an F to A substitution at position 372 and an F to W substitution at position 383.

[0008] Based on the above technical solution, the mutated hydroxyphenylpyruvate dioxygenase polypeptide can comprise a second mutation.

[0009] Preferably, the second mutation comprises at least one of the following amino acid mutations at a position corresponding to a position of the amino acid sequence set forth in SEQ ID NO:1: A106G, A107 deletion, A111T, or K351N.

[0010] In particular, mutant hydroxyphenylpyruvate dioxygenase polypeptides include polypeptides having the amino acid sequence set forth in SEQ ID NO:173, SEQ ID NO:182, SEQ ID NO:185, SEQ ID NO:188, SEQ ID NO:191, SEQ ID NO:194, SEQ ID NO:197, SEQ ID NO:200, or SEQ ID NO:203.

[0011] Additionally, the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from a wild-type HPPD from a plant or a microorganism.

[0012] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, the plant is selected from the group consisting of oats (Avena sativa), wheat (Triticum aestivum), barley (Hordeum vulgare), millet (Setaria italica), maize (Zea mays), sorghum (Sorghum bicolor), wheatgrass (Brachypodium distachyo), rice (Oryza sativa), tobacco (Nicotiana tabacum), sunflower (Helianthus annuus), alfalfa (Medicago sativa), soybean (Glycine max), chickpea (cicer arietinum), peanut (Arachis hypogaea), sugar beet (Beta vulgaris), cucumber (Cucumis sativus), cotton (Gossypium hirsutum), oilseed rape (Brassica napus), potato (Solanum tuberosum), tomato (Solanum lycopersicum, or Arabidopsis thaliana.

[0013] Preferably, the microorganism is Pseudomonas fluorescens.

[0014] To achieve the above objects, the present invention further provides polynucleotides encoding mutant hydroxyphenylpyruvate dioxygenase polypeptides.

[0015] To achieve the above object, the present invention further provides an expression cassette or recombinant vector comprising said polynucleotide under the control of an operatively linked regulatory sequence.

[0016] In order to achieve the above-mentioned object, the present invention further provides a method for expanding the range of herbicides to which a plant is tolerant, comprising expressing a mutant hydroxyphenylpyruvate dioxygenase polypeptide together with at least one herbicide resistance protein other than the mutant hydroxyphenylpyruvate dioxygenase polypeptide.

[0017] Further, the herbicide tolerance protein is 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome-like protein, and / or protoporphyrinogen oxidase.

[0018] In order to achieve the above object, the present invention further provides a method for selecting transformed plant cells, comprising transforming a plurality of plant cells with the polynucleotide and culturing the cells under a concentration of an HPPD-inhibiting herbicide that allows growth of transformed cells expressing the polynucleotide, while killing or inhibiting growth of non-transformed cells.

[0019] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, said plants are oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis.

[0020] Preferably, the HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles.More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione.Particularly preferably, the method for selecting transformed soybean plant cells comprises transforming a plurality of soybean plant cells with the polynucleotide and culturing the cells with a concentration of an HPPD-inhibiting herbicide that allows the growth of transformed cells expressing the polynucleotide and kills or inhibits the growth of non-transformed cells, the HPPD-inhibiting herbicide being topramezone, mesotrione, or isoxaflutole.

[0021] In order to achieve the above-mentioned object, the present invention further provides a method for controlling weeds, which comprises applying an effective amount of an HPPD-inhibiting herbicide to a field in which a target plant is planted, wherein the target plant contains the polynucleotide.

[0022] Preferably, the target plant includes monocotyledonous and dicotyledonous plants. More preferably, the target plant is oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis. More preferably, the target plant is a glyphosate-tolerant plant, and the weed is a glyphosate-resistant weed.

[0023] Preferably, the HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles.More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione.Particularly preferably, the method for controlling weeds comprises applying an effective amount of an HPPD-inhibiting herbicide to a field in which soybean plants are grown, the soybean plants comprising the polynucleotide, and the HPPD-inhibiting herbicide is topramezone, mesotrione, or isoxaflutole.

[0024] In order to achieve the above-mentioned object, the present invention further provides a method for protecting a plant from damage caused by an HPPD-inhibiting herbicide or conferring tolerance to an HPPD-inhibiting herbicide to a plant, the method comprising introducing the polynucleotide or expression cassette or recombinant vector into a plant and causing the plant to produce a sufficient amount of a mutant hydroxyphenylpyruvate dioxygenase polypeptide after the introduction, thereby protecting the plant from damage caused by the HPPD-inhibiting herbicide.

[0025] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, said plants are oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis.

[0026] Preferably, the HPPD-inhibiting herbicide comprises HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles.More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione.Particularly preferably, the method of protecting plants from damage caused by HPPD-inhibiting herbicides or conferring resistance to HPPD-inhibiting herbicides to soybean plants comprises introducing a polynucleotide or an expression cassette or a recombinant vector into soybean plants, resulting in a sufficient amount of mutant hydroxyphenylpyruvate dioxygenase polypeptide to protect the soybean plants into which the polynucleotide or the expression cassette or the recombinant vector is introduced from damage caused by HPPD-inhibiting herbicides, and the HPPD-inhibiting herbicide is topramezone, mesotrione, or isoxaflutole. In order to achieve the above object, the present invention further provides a method for producing a plant that is resistant to an HPPD-inhibiting herbicide, the method comprising introducing the polynucleotide into the genome of the plant.

[0027] Preferably, the method of introduction comprises genetic transformation, genome editing, or genetic mutation.

[0028] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, said plants are oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis.

[0029] Preferably, the HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles. More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione. Particularly preferably, the method for producing a soybean plant resistant to HPPD-inhibiting herbicide comprises introducing said polynucleotide into the genome of a soybean plant, and the HPPD-inhibiting herbicide is topramezone, mesotrione, or isoxaflutole.

[0030] In order to achieve the above object, the present invention further provides a method for cultivating a plant that is resistant to an HPPD inhibitor herbicide, comprising the steps of: planting at least one plant propagation material whose genome contains the polynucleotide; Growing the plant propagation material on a plant; applying an effective amount of an HPPD-inhibiting herbicide to a plant growing environment containing at least said plant, and harvesting said plant exhibiting reduced plant damage and / or increased plant yield compared to other plants not containing said polynucleotide. The present invention provides a cultivation method comprising the steps of:

[0031] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, said plants are oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis.

[0032] Preferably, the HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles. More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione. Particularly preferably, the method for cultivating a soybean plant resistant to an HPPD-inhibiting herbicide comprises planting at least one soybean plant seed comprising the polynucleotide in its genome, growing the soybean plant seed into a soybean plant, applying an effective amount of an HPPD-inhibiting herbicide to a plant growing environment comprising at least the soybean plant, and harvesting the soybean plant with reduced plant damage and / or increased plant yield compared to other soybean plants not comprising the polynucleotide, and the HPPD-inhibiting herbicide is topramezone, mesotrione, or isoxaflutole.

[0033] The present invention also provides a method for obtaining processed agricultural products, which comprises processing a harvest of an HPPD-inhibiting herbicide-tolerant plant obtained by the method described above to obtain the processed agricultural product.

[0034] In order to achieve the above-mentioned object, the present invention further provides a planting system for controlling the growth of weeds, comprising an HPPD-inhibiting herbicide and a plant growing environment in which at least one target plant is present, the target plant containing the polynucleotide.

[0035] Preferably, the target plant includes monocotyledonous and dicotyledonous plants. More preferably, the target plant is oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis. More preferably, the target plant is a glyphosate-tolerant plant, and the weed is a glyphosate-resistant weed.

[0036] Preferably, the HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes. More preferably, the HPPD-inhibiting herbicide of the pyrazolinates is topramezone, the HPPD-inhibiting herbicide of the isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of the triketones is mesotrione. Particularly preferably, the planting system for controlling the growth of weeds comprises an HPPD-inhibiting herbicide and a plant growing environment in which at least one soybean plant is present, the soybean plant contains the polynucleotide, and the HPPD-inhibiting herbicide is topramezone, isoxaflutole, or mesotrione. In order to achieve the above object, the present invention further provides the use of a mutant hydroxyphenylpyruvate dioxygenase polypeptide for conferring resistance to HPPD-inhibiting herbicides to plants.

[0037] Preferably, said plants include monocotyledonous and dicotyledonous plants. More preferably, said plants are oat, wheat, barley, millet, sorghum, wheatgrass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis.

[0038] Preferably, the HPPD-inhibiting herbicide comprises the HPPD-inhibiting herbicide of pyrazolinates, triketones and / or isoxazoles.More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione.Particularly preferably, in the use of mutant hydroxyphenylpyruvate dioxygenase polypeptide for conferring resistance to HPPD-inhibiting herbicides to soybean plants, the HPPD-inhibiting herbicide is topramezone, isoxaflutole, or mesotrione.

[0039] As used herein, the articles "a" and "an" refer to one or more than one (i.e., at least one). For example, "an element" means one or more elements (components). Furthermore, the term "comprise" or variations such as "comprises" or "comprising" should be understood to mean the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0040] In the context of the present invention, the terms "hydroxyphenylpyruvate dioxygenase (HPPD)", "4-hydroxyphenylpyruvate dioxygenase (4-HPPD)" and "p-hydroxyphenylpyruvate dioxygenase (p-HPPD)" are synonymous.

[0041] The term "HPPD-inhibiting herbicide" refers to a herbicide that acts directly or indirectly to inhibit HPPD, in this case the herbicide is a bleaching agent. Most HPPD-inhibiting herbicides available commercially belong to one of three chemical families: (1) triketones, such as sulcotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)benzoyl]-1,3-cyclohexane-dione), mesotrione (i.e., 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione), tembotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)-3-[(2,2,2-trifluoroethoxy)methyl]benzoyl]-1,3-cyclohexanedione); (2) isoxazoles, such as isoxaflutole (i.e., (5 -cyclopropyl-4-isoxazolyl)[2-(methylsulfonyl)-4-(trifluoromethyl)phenyl]methanone; (3) pyrazolinates, such as topramezone (i.e., [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methyl-pyrazol-4-yl)methanone), pyrasulfotole (i.e., (5-hydroxy-1,3-dimethylpyrazol-4-yl)(2-methyl-sulfonyl-4-(trifluoromethylphenyl)methanone).

[0042] As used herein, topramezone (also known as BAS-670H) refers to [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methyl-pyrazol-4-yl)methanone, a white crystalline solid. It is a systemic, conductive, HPPD-inhibiting herbicide of the pyrazolinate class for postemergence treatment of stems and leaves in a typical formulation of a 30% suspension concentrate. Commercial formulations of topramezone (e.g., topramezone SC) can be used at 5.6-6.7 g per acre for the control of grass and broadleaf weeds. Weeds that can be effectively controlled include, but are not limited to, Digitaria sanguinalis (Calathodes oxycarpa), Barnyard grass, Eleusine indica Gaertn, Eriochloa villosa, Setaria viridis (Giant foxtail), Chenopodium album, Polygonaceae, Abutilon avicennae, Abutilon theophrasti, Pigweed, Portulaca oleracea, Xanthium strumarium, and Solanum nigrum. Combining topramezone SC with atrazine can significantly improve the effect. Apart from its excellent efficacy against the aforementioned weeds, topramezone can also provide good control against highly harmful broadleaf weeds such as Cephalanoploides segetum Kitam (Cirsium segestum), Sonchus arvensis, Acalypha australis, and Commelina communis (Asiatic dayflower), and can effectively control green foxtail, large crabgrass, goosegrass, and narcograss, which are difficult to control with mesotrione.

[0043] As used herein, an "effective amount" of topramezone means used in an amount in the range of 25-200 g ai / ha, for example 25-50 g ai / ha, 50-100 g ai / ha, 100-150 g ai / ha or 150-200 g ai / ha.

[0044] As used herein, isoxaflutole refers to 5-cyclopropyl-4-isoxazolyl)[2-(methylsulfonyl)-4-(trifluoromethyl)phenyl]methanone, a white to pale yellow solid, which is a selective, systemic, preemergence HPPD inhibitor herbicide of the organic heterocyclic isoxazole class that acts primarily by absorption and translocation through the roots of young weeds. Isoxaflutole is primarily used to control a variety of annual broadleaf weeds, such as velvetleaf, lamb's quarter, broomcorn, Salsola arbuscula, nightshade, Amaranthus retroflexus, Polygonum bungeanum, Bidens pilosa, purslane, chickweed, Elsholtzia, cocklebur, hackberry, Amethystea caerulea, Polygonum Lapathifolium, and Veronica polita in fields of dryland crops and also has good control of several annual grass weeds such as large crabgrass, barnyard grass, goosegrass, Leptochloa chinensis, Setaria faberi, and foxtail grass.

[0045] As used herein, an "effective amount" of isoxaflutole means used in an amount in the range of 35-280 g ai / ha, for example 35-70 g ai / ha, 70-140 g ai / ha, 140-200 g ai / ha or 200-280 g ai / ha.

[0046] As used herein, "mesotrione" refers to 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione, a brown or light yellow solid. It is a selective, systemic, conductive HPPD-inhibiting herbicide of the triketone class that provides both pre-emergence and post-emergence weed control in plants. Mesotrione is absorbed into plants through the leaves and roots and translocates downward from top to bottom, resulting in symptoms of chlorosis (yellowing) of the growing point followed by necrosis (dead tissue) and even death of the entire plant 3-5 days after herbicide application. Mesotrione is useful for the pre-emergence and post-emergence control of annual broadleaf weeds and grass weeds in plants; the annual broadleaf weeds that can be controlled mainly include cocklebur, velvetleaf, lamb's quarter, amaranth, knotweed, nightshade, and Ambrosia trifida, and the grass weeds that can be controlled mainly include young barnyard grass, large crabgrass, foxtail grass, and Brachiaria decumbens.

[0047] As used herein, an "effective amount" of mesotrione means used in an amount in the range of 52.5-420 g ai / ha, for example 52.5-105 g ai / ha, 105-210 g ai / ha, 210-300 g ai / ha or 300-420 g ai / ha.

[0048] As used herein, the term "resistance" is hereditary and allows a given plant to grow and reproduce under conditions where a given plant is effectively treated with a normal herbicide. As will be recognized by those skilled in the art, even if a given plant treated with a herbicide has some damage (such as minor necrosis, lysis or chlorosis), the plant can still be considered to be "resistant" if at least the yield is not significantly impaired. In other words, a given plant has an increased ability to resist various degrees of damage induced by herbicides, and generally, the same dose of herbicide can cause damage to wild-type plants of the same genotype. The term "tolerant" or "tolerance" in the present invention is broader than the term "resistant" and includes "resistance".

[0049] As used herein, the term "imparting" refers to providing a characteristic or trait, such as herbicide tolerance and / or other desirable traits, to a plant.

[0050] As used herein, the term "heterologous" refers to something that originates from another source.In the context of DNA, "heterologous" refers to any foreign "non-self" DNA, including that originating from another plant of the same species.For example, in the present invention, the soybean HPPD gene that can be expressed in soybean plants by gene transfer method is also considered as "heterologous" DNA.

[0051] As used herein, the term "nucleic acid" includes deoxyribonucleotide or ribonucleotide polymers in either single-stranded or double-stranded form, and, unless otherwise specified, encompasses known analogues (e.g., peptide nucleic acids) that have essential properties of wild-type nucleotides and hybridize to single-stranded nucleic acids in a manner similar to wild-type nucleotides.

[0052] As used herein, the terms "encode" or "encoded," when used in the context of a particular nucleic acid, mean that the nucleic acid contains the necessary information to direct the translation of a nucleotide sequence into a particular protein. The protein-encoded information is specified by the use of codons. A nucleic acid that encodes a protein may contain untranslated sequences (e.g., introns) within the translated region of the nucleic acid, or may be free of such intervening untranslated sequences (e.g., as in cDNA).

[0053] The protein of the present invention may be altered in various ways, including amino acid substitution, deletion, truncation and insertion.For example, amino acid sequence variants and fragments of mutant HPPD protein can be prepared by mutation in DNA.Methods for inducing polynucleotide mutations are well known in the art.See, for example, Kunkel (1985) Proc.Natl.Acad.Sci.USA 82:488-492, Kunkel et al. (1987) Methods in Enzymol.154:367-382, U.S. Patent No. 4,873,192, Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York), and the references cited therein. Guidance regarding suitable amino acid substitutions, which often do not affect the biological activity of the protein of interest, can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC). Conservative substitutions, such as exchanging one amino acid for another with similar properties, may be optimal.

[0054] As described herein, the mutated HPPD polypeptides or variants thereof and fragments thereof have HPPD enzyme activity and confer resistance to a particular class of HPPD-inhibiting herbicides to plants. The mutated HPPD polypeptides have amino acid changes at one or more positions relative to the starting wild-type sequence from which they are derived, and exhibit improved resistance to one or more HPPD-inhibiting herbicides. The HPPD enzymes that exhibit improved resistance to at least one HPPD-inhibiting herbicide may exhibit such resistance by exhibiting certain characteristics relative to the similar unmutated starting enzyme.

[0055] DNA sequences encoding such mutant HPPD polypeptides are used in providing the plants, plant cells and seeds of the invention which confer improved tolerance to one or more HPPD-inhibiting herbicides compared to analogous plants also expressing the unmutated starting enzyme.

[0056] Plant HPPD genes encoding such mutant HPPD polypeptides are useful for generating plants that are resistant to HPPD-inhibiting herbicides. Plant HPPD genes modified as described above are particularly suitable for expression in plants to confer herbicide resistance to plants.

[0057] Many HPPD sequences are known in the art and can be used to generate mutant HPPD sequences by making substitutions, deletions and / or additions at the corresponding amino acids. Using amino acid positions 372 or 383 of the wild-type HPPD amino acid sequence of oats set forth in SEQ ID NO: 1 as a reference, positions 372 and 383 of the present invention are calculated. The mutant HPPD polypeptide according to the present invention comprises a combination mutation at the amino acid positions corresponding to positions 372 and 383 of SEQ ID NO: 1, the combination mutation comprising a substitution of F at position 372 with A, G or V, and a substitution of F at position 383 with W. Preferably, the mutation comprises a substitution of F at position 372 with A, and a substitution of F at position 383 with W. Thus, a known or suspected HPPD sequence can be aligned with the amino acid sequence set forth in SEQ ID NO: 1 using standard sequence alignment tools, and substitutions or deletions at the corresponding amino acids to the amino acid sequence set forth in SEQ ID NO: 1 set forth herein can be made in the known or suspected HPPD sequence.

[0058] The present invention includes a mutant HPPD polypeptide, derived from HPPD in a plant or microorganism, having HPPD enzyme activity, comprising a combined mutation at least at positions 372 and 383 of the amino acid sequence set forth in SEQ ID NO: 1, optionally further comprising said combined mutation in combination with a mutation at another position (corresponding position present in the HPPD polypeptide), for example in combination with one or more mutations at the following corresponding positions: A106G, A107 deletion, A111T or K351N in the amino acid sequence of HPPD from oat. In various embodiments of the above, the combined mutation at positions 372 and 383 may be F372A+F383W, F372G+F383W or F372V+F383W. Combination mutations at positions 372 and 383 with mutations at other positions include F372A+F383W+A107 deletion, F372A+F383W+A111T, F372A+F383W+A106G, F372A+F383W+A106G+K351N, F372A+F383W+A107 deletion+K351N, or F372A+F383W+A111T+K351N. Additionally, the present invention includes mutant HPPD polypeptides (by substitution, deletion and / or addition) derived from HPPDs of different species or different ecotypes of plants or microorganisms within the same species. Exemplary HPPDs from different ecotypes within the same species include, but are not limited to, HPPDs from the following ecotypes within species:HPPD from various ecotypes of alfalfa with accession numbers XP_003617391.2, AAX59006.1, XP_003617384.1, XP_013466115.1, AET00342.2, or A0A396HWH5; HPPD from various cotton ecotypes, N7F6; accession numbers VDC64417.1, CDY10210.1, AFB74208.1, XP_013695640.1, XP_013695641.1, RID40406.1, RID48932.1, XP_009118533.1, XP_009119049.1, XP_013723237.1, AFB HPPDs from various ecotypes of oilseed rape, with accession numbers AFB74218.1, or AFB74207.1; HPPDs from various ecotypes of soybean, with accession numbers A5Z1N7, I1M6Z4, A0A088MGH9, or I1M6Z5; HPPDs from various ecotypes of tobacco, with accession numbers XP_009770088.1 or XP_009587203.1; HPPDs from various ecotypes of rice, with accession numbers A3A3J1, B8AIH6, or A0A0E0G1W2; and HPPDs from various ecotypes of barley, with accession numbers BAJ86732.1, BAJ95714.1, or F2E412 (these accession numbers are available in the GenBank database or the UniProt Knowledgebase database).

[0059] The terms "position 372", "372nd position", or "372 single position" refer not only in the narrow sense to the amino acid at position 372 (phenylalanine) of the amino acid sequence set forth in SEQ ID NO:1, but also in the broad sense to a position corresponding to the amino acid at position 372 of the amino acid sequence set forth in SEQ ID NO:1 obtained in a known or suspected HPPD amino acid sequence that can be aligned with the amino acid sequence set forth in SEQ ID NO:1 using a standard sequence alignment tool (such as CLUSTAL software), which may not be position 372 of the amino acid sequence of that HPPD.

[0060] The terms "position 383", "383rd position", or "383 single position" refer not only in the narrow sense to the amino acid at position 383 (phenylalanine) of the amino acid sequence set forth in SEQ ID NO:1, but also in the broad sense to a position corresponding to the amino acid at position 383 of the amino acid sequence set forth in SEQ ID NO:1 obtained in a known or suspected HPPD amino acid sequence that can be aligned with the amino acid sequence set forth in SEQ ID NO:1 using a standard sequence alignment tool (such as CLUSTAL software), which may not be position 383 of the amino acid sequence of that HPPD.

[0061] The term "position 415", "415th position", or "415 single position" refers not only in the narrow sense to the amino acid at position 415 (phenylalanine) of the amino acid sequence set forth in SEQ ID NO:1, but also in the broad sense to a position corresponding to the amino acid at position 415 of the amino acid sequence set forth in SEQ ID NO:1 obtained in a known or suspected HPPD amino acid sequence that can be aligned with the amino acid sequence set forth in SEQ ID NO:1 using standard sequence alignment tools (such as CLUSTAL software), which may not be position 415 of the amino acid sequence of that HPPD.

[0062] Similarly, the above interpretations regarding "372nd position" or "372nd position" apply to other positions as well.

[0063] "Corresponding to" refers to a position corresponding to an amino acid at a particular position in the amino acid sequence set forth in SEQ ID NO:1, obtained by aligning the amino acid sequence set forth in SEQ ID NO:1 with HPPD amino acid sequences from different species or different ecotypes within the same species using standard sequence alignment tools, e.g., a position corresponding to amino acid 372 or 383 in the amino acid sequence set forth in SEQ ID NO:1.

[0064] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding wild-type amino acid, as well as to wild-type amino acid polymers. The polypeptides of the invention can be produced from the nucleic acids disclosed herein or by standard molecular biology techniques. For example, the truncated proteins of the invention can be produced by expression of the recombinant nucleic acids of the invention in a suitable host cell, or by combining ex vivo procedures such as protease digestion and purification.

[0065] Therefore, the present invention also provides a nucleic acid molecule comprising a polynucleotide sequence encoding a mutant HPPD polypeptide having the enzyme activity of HPPD, which confers resistance in plants to a certain class of herbicides that inhibit HPPD, and variants and fragments thereof.In general, the present invention includes any polynucleotide sequence encoding any of the mutant HPPD polypeptides described herein, as well as any polynucleotide sequence encoding an HPPD polypeptide having one or more conservative amino acid substitutions to the mutant HHPD polypeptides described herein.Conservative substitutions that provide functionally similar amino acids are well known in the art.The following five groups each contain amino acids that are conservative substitutions for each other. Aliphatic: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I); aromatic: phenylalanine (F), tyrosine (Y), tryptophan (W); sulfur-containing: methionine (M), cysteine ​​(C); basic: arginine (I), lysine (K), histidine (H); acidic: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q).

[0066] In one embodiment, the invention provides a polynucleotide sequence encoding an amino acid sequence derived from HPPD in a plant or microorganism, wherein the polypeptide has HPPD enzyme activity and comprises at least a combination mutation at positions corresponding to amino acids 372 and 383 of SEQ ID NO:1.

[0067] Therefore, sequences that hybridize to the gene encoding the mutant HPPD polypeptide of the present invention and have tolerance activity to HPPD-inhibiting herbicides are included in the present invention. Exemplary sequences are SEQ ID NOs: 11-12, 33-34, 45-46, 57-58, 69-70, 81-82, 93-94, 105-106, 117-118, 129-130, 141-142, 153-154, 159-160, 165-166, 174-178, 180-182, 183-184, 185-186, 187-188, 189-190, 191-192, 192-193, 193-194, 194-195, 195-196, 196-197, 197-198, 198-199, 199-200, 200-201, 201-202, 202-203, 202-203, 203-204, 204-205, 205-206, 206-207, 207-208, 209-300, 210-211, 211-212, 212-213, 213-214, 214-215, 215-216, 216-217, 218-220, 220-222, 224-225, 226-227, 228-229, 230-231, 231- 75, SEQ ID NOs: 183-184, 186-187, 189-190, 192-193, 195-196, 198-199, 201-202, and 204-205.

[0068] Any conventional nucleic acid hybridization or nucleic acid amplification method can be used to identify the presence of the mutant HPPD gene of the present invention. A nucleic acid molecule or a fragment thereof can specifically hybridize with another nucleic acid molecule under certain circumstances. In the present invention, two nucleic acid molecules can be considered to be able to specifically hybridize with each other if they can form an antiparallel double-stranded nucleic acid structure. If the two nucleic acid molecules show complete complementarity, one of the two nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present invention, two nucleic acid molecules are said to show "complete complementarity" if each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with each other with sufficient stability to anneal and bind to each other at least under conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with each other with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are acceptable as long as they do not completely prevent the two molecules from forming a double-stranded structure. To enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure that the molecule has sufficient complementarity in its sequence so that a stable double-stranded structure is formed under certain solvent and salt concentration conditions.

[0069] In the present invention, a substantially homologous sequence refers to a nucleic acid molecule that can specifically hybridize to a complementary strand of a matched nucleic acid molecule under high stringency conditions. Suitable stringent conditions that promote DNA hybridization are well known to those skilled in the art. For example, suitable stringent conditions can be achieved by treating with 6.0× sodium chloride / sodium citrate (SSC) at about 45° C., followed by washing with 2.0×SSC at 50° C. For example, the salt concentration in the washing step can be selected from a low stringency condition of about 2.0×SSC at 50° C. to a high stringency condition of about 0.2×SSC at 50° C. In addition, the temperature condition in the washing step can be increased from a low stringency condition of room temperature (about 22° C.) to a high stringency condition of about 65° C. Both the temperature condition and the salt concentration can be changed, and it is also possible to change one of the two without changing the other. Preferably, the stringent conditions in the present invention can be achieved by specifically hybridizing to the mutant HPPD gene of the present invention in a solution of 6xSSC, 0.5% SDS at 65°C, and then washing the membrane once with 2xSSC, 0.1% SDS, and once with 1xSSC, 0.1% SDS.

[0070] As used herein, the terms "hybridize" or "specifically hybridize" refer to the binding, duplexing, or hybridization of a molecule to a particular nucleotide sequence, when present in DNA or RNA of a complex mixture (e.g., whole cells), under stringent conditions, only to that sequence.

[0071] Due to the degeneracy of genetic codons, a variety of different DNA sequences may code for the same amino acid sequence. It is within the skill of a person skilled in the art to create these alternative DNA sequences that code for the same or substantially the same protein. These different DNA sequences are included in the scope of the present invention. "Substantially the same" sequence refers to a sequence that has amino acid substitutions, deletions, additions or insertions that do not substantially affect herbicide tolerance activity, including fragments that retain herbicide tolerance activity.

[0072] The term "functional activity" or "activity" in the present invention means that the protein / enzyme used in the present invention (alone or in combination with other proteins) has the ability to degrade herbicides or reduce herbicidal activity. Plants producing the proteins of the present invention preferably produce "effective amounts" of said proteins (in typical amounts, unless otherwise stated) such that when the plant is treated with a herbicide, the expression level of said protein is sufficient to confer full or partial resistance to the herbicide to the plant. The herbicide can be used in an amount that would normally kill the target plant, or in a typical field amount and concentration. Preferably, the plant cells and plants of the present invention are protected from growth inhibition or damage caused by treatment with a herbicide. The transformed plants and plant cells of the present invention are preferably resistant to HPPD-inhibiting herbicides, i.e., the transformed plants and plant cells can grow in the presence of an effective amount of HPPD-inhibiting herbicides.

[0073] The genes and proteins of the present invention include not only the specific exemplary sequences, but also portions and / or fragments (including internal and / or terminal deletions when compared to the full-length protein), variants, mutants, variant proteins, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that retain the HPPD-inhibiting herbicide tolerance activity characteristic of the specific exemplary proteins.

[0074] The term "variant" in the present invention is intended to mean a sequence that is substantially similar. In the case of polynucleotides, variants include deletions and / or additions of one or more nucleotides at one or more internal sites in the reference polynucleotide and / or substitutions of one or more nucleotides at one or more sites in the mutant HPPD polynucleotide. As used herein, the term "reference polynucleotide or polypeptide" includes the mutant HPPD nucleotide sequence or amino acid sequence, respectively. As used herein, the term "wild-type polynucleotide or polypeptide" includes the wild-type nucleotide sequence or amino acid sequence, respectively. In the case of polynucleotides, conservative variants include the above sequences that, due to the degeneracy of the genetic code, code for the amino acid sequence of one of the mutant HPPD polypeptides of the present invention. Such wild-type allelic variants can be identified using well-known molecular biology techniques, for example, using polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated using site-directed mutagenesis but still encoding the mutant HPPD protein of the present invention. Generally, a variant of a particular polynucleotide of the present invention will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters.

[0075] A "variant protein" in the present invention is intended to mean a protein derived from a reference protein by deletion or addition of one or more amino acids at one or more internal sites of the mutant HPPD protein and / or substitution of one or more amino acids at one or more sites of the mutant HPPD protein. The variant proteins encompassed by the present invention are biologically active, i.e., they still have the desired biological activity of the mutant HPPD protein, i.e., HPPD enzyme activity and / or herbicide resistance as described herein. Such variants may arise, for example, by genetic polymorphism or artificial manipulation. A biologically active variant of the mutant HPPD protein of the present invention has at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the entire amino acid sequence of the mutant HPPD protein as determined by sequence alignment programs and parameters. A biologically active variant of a protein of the invention may differ from the protein of the invention by as few as 1-15 amino acid residues, as few as 1-10 amino acid residues, for example by as few as 6-10, as few as 5, as few as 4, 3, 2 or even just 1 amino acid residue.

[0076] Methods for alignment of sequences are well known in the art and can be accomplished using mathematical algorithms such as the algorithm of Myers and Miller (1988) CABIOS 4:11-17, the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482, the global alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, and the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 872264 as modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Computer implementations of these mathematical algorithms can be used to compare sequences to determine sequence identity. Such implementations include, but are not limited to, CLUSTAL in the PC / Gene program (available from IntelliGenetics, Mountain View, CA); the ALIGN program (version 2.0) in the GCG Wisconsin Genetics software package, version 10, and GAP, BESTFIT, BLAST, FASTA and TFASTA (available from Accelrys, Inc., 9685 Scranton Road, San Diego, CA, USA).

[0077] In some embodiments, the amino acids encoding mutant HPPD polypeptides or variants thereof that retain HPPD enzyme activity can be stacked with any combination of polynucleotide sequences of interest to create plants with desired traits. The term "trait" refers to a phenotype derived from a particular sequence or group of sequences. For example, the amino acids / polynucleotides encoding mutant HPPD polypeptides or variants thereof that retain HPPD enzyme activity can be stacked with any other polynucleotides that encode polypeptides that confer desirable traits, including but not limited to disease, insect and herbicide resistance, heat and drought tolerance, reduced time to maturity of crops, improved industrial processing, for example when converting starch or biomass into fermentable sugars, and improved agronomic quality, such as high oil and protein content.

[0078] It is well known to those skilled in the art that the benefits of combining two or more modes of action in improving the spectrum of weeds controlled and / or controlling wild-type more tolerant or resistant weed species may be extended to HPPD-resistant crops as well as to chemicals that have enabled crops to tolerate herbicides through artificial means (either transgenic or non-transgenic). Indeed, the following resistance-encoding traits can be stacked alone or in combination to provide the ability to effectively control or prevent weeds from changing to herbicides: The above resistance factors include glyphosate resistance factors (EPSPS, GOX, and GAT derived from resistant plants or bacteria, etc.), glufosinate resistance factors (PAT and Bar, etc.), herbicide resistance factors against acetolactate synthase (ALS) inhibitors (resistance genes against chemicals such as imidazolinones, sulfonylureas, triazole pyrimidines, sulfonated anilines, and pyrimidinylthiobenzoates, e.g., AHAS, Csrl, and SurA), phenoxy auxin herbicide resistance factors (aryloxyalkanoate dioxygenase-12 (AAD-12)), dicamba herbicide resistance factors (dicamba monooxygenase (DMO)), bromoxynil resistance factors (bromoxynil: Bxn, etc.), phytoene desaturase (phytoene These include photosystem II inhibitor resistance factors (e.g., psbA), photosystem I inhibitor resistance factors (e.g., psbB), protoporphyrinogen oxidase (PPO) inhibitor resistance factors (e.g., PPO-1), phenylurea herbicide resistance factors (e.g., CYP76B1), and dichloromethoxybenzoate decomposition enzymes.

[0079] Glyphosate is widely used because it controls a very broad spectrum of broadleaf and grass weed species. However, repeated use of glyphosate in glyphosate-tolerant crop and non-crop applications has (and continues to) select for weed shifts to wild-type, more tolerant species and glyphosate-resistant biotypes. Most herbicide resistance management programs suggest the use of effective amounts of tank-mixed herbicide congeners, which control the same species but have different modes of action, as a means of delaying emergence of resistant weeds. By overlapping the gene encoding the mutant HPPD polypeptide of the present invention with a glyphosate tolerance trait (and / or other herbicide tolerance trait), control of glyphosate-resistant weed species (broadleaf weed species controlled by one or more HPPD inhibitor herbicides) can be achieved in glyphosate-tolerant crops by allowing the selective use of glyphosate herbicides and HPPD inhibitor herbicides (such as topramezone, mesotrione, or isoxaflutole) in the same crop. These herbicides can be applied simultaneously in a tank mix containing two or more herbicides with different modes of action, or can be applied in a single herbicide composition in a single sequential application (e.g., pre-plant, or pre- or post-emergence) (with application intervals ranging from 2 hours to 3 months). Alternatively, applications of these herbicides may be made using any number of herbicides representing each applicable compound category in combination, applied at any time from 7 months after the crop is planted to when the crop is harvested (or the shortest interval before harvest for a single herbicide).

[0080] In broadleaf weed control, flexibility is very important in terms of application timing, application rate of single herbicide, and ability to control stubborn or resistant weeds. Application ranges in crops for glyphosate stacked with glyphosate resistance genes / mutated HPPD genes can be 250-2500 g ae / ha. Application ranges for HPPD inhibitor herbicide(s) can be 25-500 g ai / ha. These optimal application combinations depend on the specific conditions, species, and environment.

[0081] Herbicide formulations (e.g., ester, acid or salt formulations, or soluble concentrates, emulsifiable concentrates or soluble liquids), and tank-mix additives (e.g., adjuvants or compatibilizers) can significantly affect the weed control of a given herbicide, or of one or more combined herbicides. Any chemical combination of any of the aforementioned herbicides is within the scope of the present invention.

[0082] Additionally, genes encoding the mutant HPPD polypeptides of the invention, alone or stacked with other properties of herbicide resistant crops, can be stacked with one or more other input traits (e.g., insect resistance, fungal resistance or stress tolerance, etc.) or output traits (e.g., increased yield, improved oil yield, improved fiber quality, etc.) Thus, the invention can be used to provide a complete agricultural solution for improving crop quality with the ability to flexibly and economically control any number of agricultural pests.

[0083] The stacked combinations can be made by any method, including but not limited to, any conventional or top-cross hybrid plants, or genetic transformation. When stacking sequences by genetically transforming plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant containing one or more desired traits can be used as a target to introduce additional traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotide of interest provided by any combination of transformation cassettes. For example, when two sequences are introduced, the two sequences can be included in separate transformation cassettes (trans) or in the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or different promoters. In some cases, it may be desirable to introduce a transformation cassette that suppresses the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or high expression cassettes to generate a combination of desired traits in the plant. It is further recognized that a site-specific recombination system can be used to stack polynucleotide sequences at a desired genomic location.

[0084] The genes encoding the mutant HPPD polypeptides according to the invention have higher tolerance to HPPD-inhibiting herbicides, which is an important basis for the potential of herbicide-tolerant crops and selectable marker traits.

[0085] The term "expression cassette" as used herein means a nucleic acid molecule capable of directing the expression of a particular nucleotide sequence in a suitable host cell, comprising a promoter operatively linked to a nucleotide sequence of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzymatic activity, either alone or in combination with one or more additional nucleic acid molecules that encode a polypeptide that confers a desired trait), which nucleotide sequence of interest is operatively linked to a termination signal. The coding region usually codes for a protein of interest, but may also code for a functional RNA of interest, such as an antisense RNA or a non-translated RNA, in either sense or antisense orientation. An expression cassette containing a nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous to at least one of the other components. An expression cassette may also be wild-type, but has been obtained in a recombinant form useful for heterologous expression. Usually, however, the expression cassette is heterologous to the host, i.e., the particular DNA sequence of the expression cassette does not occur wild-type in the host cell, but must have been introduced into the new host cell by a transformation event. Expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some specific external stimulus. Furthermore, the promoter may also be specific to a particular tissue or organ or developmental stage.

[0086] The present invention encompasses the transformation of plants with an expression cassette capable of expressing a polynucleotide of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzymatic activity, either alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide that confers a desired trait). The expression cassette comprises, in the 5'-3' direction of transcription, a region for initiation of transcription and translation (i.e., a promoter) and a polynucleotide open reading frame. The expression cassette may optionally comprise a region for termination of transcription and translation (i.e., a termination region) that is functional in the plant. In some embodiments, the expression cassette comprises a selectable marker gene that allows for the selection of stable transformants. The expression constructs of the present invention may also comprise a leader sequence and / or a sequence that allows for inducible expression of the polynucleotide of interest.

[0087] The control sequence of the expression construct is operatively linked to the polynucleotide of interest. The control sequence in the present invention includes, but is not limited to, a promoter, a transport peptide, a terminator, an enhancer, a leader sequence, an intron, and the like, which are operably linked to the herbicide resistance gene encoding the mutant HPPD polypeptide.

[0088] The promoter is a plant-expressible promoter. A "plant-expressible promoter" refers to a promoter that ensures the expression of a coding sequence linked to the promoter in plant cells. The plant-expressible promoter may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter from the cauliflower mosaic virus, the maize Ubi promoter, the rice GOS2 gene promoter, and the like. Alternatively, the plant-expressible promoter may be a tissue-specific promoter, i.e., a promoter that directs the expression of a coding sequence at a higher level (as can be measured by conventional RNA testing) in some tissues, such as green tissues, than in other tissues of the plant, such as the PEP carboxylase promoter. Alternatively, the plant-expressible promoter may be a wound-inducible promoter. A wound-inducible promoter, or a promoter that directs a wound-inducible expression pattern, means that when the plant suffers a wound caused by mechanical factors or by insect gnawing, the expression of the coding sequence under the control of the promoter is significantly enhanced compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the potato and tomato protease inhibitor genes (pin I and pin II) and the maize protease inhibitor gene (MPI).

[0089] Translocation peptides (also known as secretory signal sequences or targeting sequences) direct the transgenic product to a specific organelle or cellular compartment. In the case of receptor proteins, the transit peptide can be heterologous, for example, to target the chloroplast using a sequence encoding a chloroplast transit peptide, or to target the endoplasmic reticulum using the "KDEL" retention sequence, or to target the vacuole using the CTPP of the barley plant agglutinin gene.

[0090] Leader sequences include, but are not limited to, small RNA virus leader sequences such as the EMCV leader sequence (5' non-coding region of encephalomyocarditis virus), potato virus group Y leader sequences such as the MDMV (Maize Dwarf Mosaic Virus) leader sequence, human immunoglobulin heavy chain binding protein (BiP), the untranslated leader sequence of the coat protein mRNA of Alfalfa Mosaic Virus (AMV RNA4), and the Tobacco Mosaic Virus (TMV) leader sequence.

[0091] These include the Cauliflower Mosaic Virus (CaMV) enhancer, the Figwort Mosaic Virus (FMV) enhancer, the Carnation Etched Ring Virus (CERV) enhancer, the Cassava Vein Mosaic Virus (CsVMV) enhancer, the Mirabilis Mosaic Virus (MMV) enhancer, the Cestrum Yellow Leaf Curling Virus (CmYLCV) enhancer, the Cotton Leaf Curl Multan Virus (CLCuMV) enhancer, the Commelina Yellow Mottle Virus (CoYMV) enhancer, and the Peanut Chlorotic Streak Calimovirus (Peanut Chlorotic Examples of gene enhancers include, but are not limited to, Streak Caulimovirus (PCLSV) enhancer.

[0092] When used in monocotyledonous plants, introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron, or the rice Act1 intron.When used in dicotyledonous plants, introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

[0093] The terminator may be a suitable polyadenylation signal sequence functional in plants, including, but not limited to, the polyadenylation signal sequence derived from the Agrobacterium tumefaciens Nopaline Synthetase (NOS) gene, the polyadenylation signal sequence derived from the protease inhibitor II (pinII) gene, the polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and the polyadenylation signal sequence derived from the alpha-tubulin gene.

[0094] "Effectively linked" in the present invention refers to the linkage of nucleic acid sequences that allows one of the nucleic acid sequences to provide the necessary function for the sequence to which it is linked. "Effectively linked" in the present invention allows a promoter to be linked to a sequence of interest, so that the transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and expression of the protein is desired, "effectively linked" means that the promoter is linked to said sequence in such a manner that the resulting transcript is effectively translated. When the linkage of the promoter to the coding sequence is a transcriptional fusion and expression of the encoded protein is achieved, such linkage is made such that the first translation initiation codon of the resulting transcript is the initiation codon of the coding sequence. Alternatively, when the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is achieved, such linkage is made such that the first translation initiation codon contained in the 5' non-translated sequence is linked to the promoter in such a manner that the relationship between the resulting translation product and the translation open reading frame encoding the desired protein is in frame. Nucleic acid sequences that may be "operatively linked" include, but are not limited to, sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators), sequences that provide DNA transfer and / or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, and integrase recognition sites), sequences that provide selection functions (i.e., antibiotic resistance markers and biosynthetic genes), sequences that provide marker scoring functions, sequences that aid in sequence manipulation in vitro or in vivo (i.e., polylinker sequences and site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomously replicating sequences, and centromere sequences).

[0095] The genome of a plant, plant tissue or plant cell in the present invention refers to any genetic material in the plant, plant tissue or plant cell, including the genomes of the nucleus, plastids and mitochondria.

[0096] As used herein, the term "plant part" or "plant tissue" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants may be regenerated, plant callus, plant clumps, and intact plant cells in a plant or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, grains, ears, knobs, husks, stems, roots, root tips, anthers, etc.

[0097] The mutant HPPD polypeptide of the present invention can be applied to various kinds of plants.Dicotyledonous plants include, but are not limited to, alfalfa, bean, cauliflower, cabbage, carrot, celery, cotton, cucumber, eggplant, lettuce, melon, pea, pepper, zucchini, radish, rapeseed, spinach, soybean, pumpkin, tomato, Arabidopsis, peanut, or watermelon.Preferably, dicotyledonous plants refer to cucumber, soybean, Arabidopsis, tobacco, cotton, peanut, or rapeseed.Monocotyledonous plants include, but are not limited to, rice, sorghum, wheat, barley, rye, millet, sugarcane, oats, or grassweed.Preferably, monocotyledonous plants refer to, but are not limited to, rice, sorghum, wheat, barley, millet, sugarcane, or oats.

[0098] As used herein, the term "plant transformation" refers to cloning a herbicide-resistant or herbicide-tolerant mutant HPPD polynucleotide into an expression system, alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide that confers a desired trait, and then transforming the polynucleotide into a plant cell. The receptor and target expression cassettes of the present invention can be introduced into a plant cell in several ways recognized in the art. The term "introduction" in the context of a polynucleotide, e.g., a nucleotide construct of interest, is intended to mean presentation of the polynucleotide to a plant in such a way that the polynucleotide reaches the interior of a cell of the plant. When more than one polynucleotide is introduced, the polynucleotides can be assembled as part of a single nucleotide construct or as separate nucleotide constructs and can be placed in the same or different transformation vectors. Thus, the polynucleotides can be introduced into a host cell of interest in a single transformation event, in separate transformation events, or, for example, in plants, as part of a breeding protocol. The method of the present invention does not rely on a particular method of introducing one or more polynucleotides into a plant, but only on the polynucleotide(s) reaching the interior of at least one cell of the plant. Methods for introducing one or more polynucleotides into plants are known in the art and include, but are not limited to, transient transformation methods, stable transformation methods, and virus-mediated or genome editing techniques.

[0099] The term "stable transformation" means that a foreign gene has been introduced into the genome of a plant so that it is stably integrated into the genome of the plant or any successive generations of that plant, resulting in the stable inheritance of the foreign gene.

[0100] The term "transient transformation" means that a nucleic acid molecule or protein is introduced into a plant cell to perform a function, but is not integrated into the genome of the plant, such that the foreign gene is not stably inherited.

[0101] "Genome editing technology" refers to a technology used to modify genomes, which can precisely manipulate genome sequences to achieve site-specific gene mutation, insertion, deletion, and other manipulations. At present, genome editing technologies mainly include homing endonuclease (HE), zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeat) technology.

[0102] Many transformation vectors are known to those skilled in the art that can be used for plant transformation, and the genes related to the present invention can be used in combination with any such vector. The choice of vector depends on the preferred transformation technique and the target species for transformation. Depending on the target species, different antibiotic or herbicide selection markers may be preferred. Selectable markers routinely used in transformation include the nptII gene, which confers resistance to kanamycin and related antibiotics or herbicides (published by Bevan et al., Nature 304:184-187 (1983)); the pat and bar genes, which confer resistance to the herbicide glufosinate (also called phosphinothricin) (see White et al., Nucl. Acids Res 18:1062 (1990); Spencer et al. Theon. Appl. Genet. 79:625-631 (1990) and U.S. Pat. Nos. 5,561,236 and 5,276,268); the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell. Biol. 4:2929-2931); the dhfr gene, which confers resistance to methotrexate (Bourouis et al., EMBO J. 2(7):1099-1104 (1983); the EPSPS gene, which confers resistance to glyphosate (U.S. Pat. Nos. 4,940,935 and 5,188,642); the glyphosate N-acetyltransferase (GAT) gene, which also confers resistance to glyphosate (Castle et al. (2004) Science, 304:1151-1154; U.S. Patent Application Publication Nos. 20070004912, 20050246798, and 20050060767); and the mannose-6-phosphate isomerase gene, which provides the ability to metabolize mannose (U.S. Pat. Nos. 5,767,378 and 5,994,629).

[0103] Methods for regenerating plants are also well known in the art. For example, Ti plasmid vectors have been used to deliver foreign DNA, as well as direct uptake of DNA, liposomes, electroporation, microinjection, and biolistics.

[0104] The planting system of the present invention includes a combination of transgenic plants with tolerance to one or more herbicides and / or herbicide treatments available at various developmental stages of the plants, and when a herbicide is applied, the planting system can effectively control weed growth and produce higher yielding and / or less damaged plants.

[0105] In the present invention, weeds refer to plants that compete with the target plants cultivated in the plant growing environment.

[0106] The terms "control" and / or "prevention" in the present invention refer to at least direct (e.g., by spraying) application of an effective amount of an HPPD-inhibiting herbicide to the plant environment to minimize the emergence of weeds and / or stop the growth of weeds. At the same time, the cultivated target plant should be morphologically normal and can be cultivated in a conventional manner for consumption and / or production of products. Preferably, the cultivated plant has less plant damage and / or a higher plant yield compared to a non-transgenic wild-type plant. Reduction of plant damage includes, but is not limited to, improved stem resistance and / or increased grain weight. The effect of the mutant HPPD polypeptide on "control" and / or "prevention" of weeds can exist independently and is not reduced and / or eliminated by the presence of other substances that can "control" and / or "prevent" weeds. Specifically, if any tissue of a transgenic plant (containing a gene encoding a mutant HPPD polypeptide) simultaneously and / or separately has and / or produces the mutant HPPD polypeptide and / or another substance capable of controlling weeds, the presence of that other substance does not affect the "controlling" and / or "preventing" effect of the mutant HPPD polypeptide against weeds, nor does the "controlling" and / or "preventing" effect result in whole and / or partly being brought about by the other substance, regardless of the mutant HPPD polypeptide.

[0107] In the present invention, the term "plant propagule" includes, but is not limited to, sexual plant propagules and vegetative plant propagules. Sexual plant propagules include, but are not limited to, plant seeds, and vegetative plant propagules refer to vegetative organs or specific tissues of plants that can generate new plants under ex vivo conditions. Vegetative organs or specific tissues include, but are not limited to, roots, stems, and leaves, and for example, plants that use roots as vegetative propagules include strawberries, sweet potatoes, etc., plants that use stems as vegetative propagules include sugarcane, potatoes (tubers), etc., and plants that use leaves as vegetative propagules include aloe, begonia, etc.

[0108] The present invention can provide new herbicide resistance traits to plants, and no adverse effects on phenotypic traits (such as yield) are observed.The plants in the present invention can tolerate, for example, 0.5x, 1x, 2x, 3x, 4x, or 8x of the typical application level of at least one herbicide tested.The improvement of these tolerance levels is within the scope of the present invention.For example, various techniques known in the art can be foreseeably optimized and further developed to increase the expression of a given gene.

[0109] The present invention provides a mutant HPPD polypeptide, its encoding gene and use thereof, which have the following advantages:

[0110] 1. The present invention discloses for the first time that the combined mutations at positions 372+383 of hydroxyphenylpyruvate dioxygenase polypeptides from various species can confer synergistically improved resistance to pyrazolinates, triketones and isoxazoles HPPD inhibitor herbicides, and in particular, can confer resistance to four-fold field concentrations of topramezone, isoxaflutole and mesotrione to transgenic soybean plants. Thus, the present invention has the potential for broad-spectrum application in plants.

[0111] 2. In the hydroxyphenylpyruvate dioxygenase polypeptides of the present invention, the combination of the combined mutations at positions 372+383 with mutations at other positions does not affect the synergistically improved resistance to HPPD-inhibiting herbicides produced by the combined mutations at positions 372+383 alone, demonstrating the importance and stability of plant resistance to HPPD-inhibiting herbicides conferred by the combined mutations at positions 372+383 of the HPPD polypeptide.

[0112] 3. Based on the combined mutations at positions 372+383 of the hydroxyphenylpyruvate dioxygenase polypeptide of the present invention, optimizing the C-terminus of the HPPD amino acid sequence is beneficial for improving the tolerance of plants to isoxaflutole.

[0113] The technical solutions of the present invention are further illustrated in detail by the following figures and examples. [Brief description of the drawings]

[0114] [Figure 1] FIG. 1 is a schematic structural diagram of the recombinant expression vector DBN11726 for Arabidopsis thaliana, containing the AsHPPDm-F372A-F383W-02 nucleotide sequence according to the present invention. [Diagram 2] FIG. 1 is a schematic structural diagram of the control recombinant expression vector DBN11726N according to the present invention. [Diagram 3] FIG. 1 is a phylogenetic tree of HPPD from various species according to the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0115] Embodiments of the mutant hydroxyphenylpyruvate dioxygenase polypeptides, their encoding genes and uses thereof according to the invention are further illustrated in the specific examples.

[0116] Example 1: Selection of AsHPPD positions 372 and 383 for combined mutation (F372A+F383W) and verification of the mutation effect 1. Acquisition of AsHPPD and AsHPPDm-F372A-F383W genes The amino acid sequence of Avena sativa wild-type HPPD (AsHPPD) is set forth as SEQ ID NO:1 in the Sequence Listing, the AsHPPD-01 nucleotide sequence encoding AsHPPD is set forth as SEQ ID NO:2 in the Sequence Listing, and the AsHPPD-02 nucleotide sequence encoding AsHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO:3 in the Sequence Listing.

[0117] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-F372A amino acid sequence shown in SEQ ID NO: 4 of the Sequence Listing. The AsHPPDm-F372A-01 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 5 of the Sequence Listing. The AsHPPDm-F372A-02 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 6 of the Sequence Listing.

[0118] The amino acid at position 383 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F383W amino acid sequence shown in SEQ ID NO: 7 of the Sequence Listing. The AsHPPDm-F383W-01 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 8 of the Sequence Listing. The AsHPPDm-F383W-02 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 9 of the Sequence Listing.

[0119] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 10 of the Sequence Listing. The AsHPPDm-F372A-F383W-01 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 11 of the Sequence Listing. The AsHPPDm-F372A-F383W-02 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 12 of the Sequence Listing.

[0120] 2. Synthesis of the aforementioned nucleotide sequences The 5′ and 3′ ends of the synthesized AsHPPD-02 nucleotide sequence (sequence number 3), AsHPPDm-F372A-02 nucleotide sequence (sequence number 6), AsHPPDm-F383W-02 nucleotide sequence (sequence number 9), and AsHPPDm-F372A-F383W-02 nucleotide sequence (sequence number 12) were each ligated to the following universal adapter primer 1. Universal adapter primer 1 for 5′ end: 5′-agtttttctgattaacagactagt-3′ described in SEQ ID NO: 230 of the Sequence Listing. Universal adapter primer 1 for 3′ end: 5′-caaatgtttgaacgatcggcgcgcc-3′ described in SEQ ID NO: 231 of the Sequence Listing.

[0121] 3. Construction of a recombinant expression vector for Arabidopsis thaliana containing the oat HPPD gene (F372A-F383W) The plant expression vector DBNBC-01 was double-digested with restriction enzymes Spe I and Asc I to linearize the plant expression vector. The digestion product was purified to obtain the linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)), which was then recombined with the AsHPPDm-F372A-F383W-02 nucleotide sequence linked to the universal adaptor primer 1 according to the procedure in the Takara In-Fusion Products Seamless Connection Kit (Clontech, CA, USA, CAT: 121416) instruction manual to construct the recombinant expression vector DBN11726 with the schematic structure shown in Figure 1 (Spec: spectinomycin gene, RB: right border, eFMV: 34S enhancer of Scrophulariaceae mosaic virus (SEQ ID NO: 13), prBrCBP: promoter of Brassica napus eukaryotic elongation factor gene 1 alpha (Tsf1) (SEQ ID NO: 14), spAt CTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 15), EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 16), tPsE9: terminator of the pea RbcS gene (SEQ ID NO: 17), prAtUbi10: promoter of the Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 18), AsHPPDm-F372A-F383W-02: AsHPPDm-F372A-F383W-02 nucleotide sequence (SEQ ID NO: 12), tNos: terminator of the nopaline synthase gene (SEQ ID NO: 19), pr35S-01: cauliflower mosaic virus 35S promoter (SEQ ID NO: 20), PAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 21), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 22), LB: left border).

[0122] E. coli T1 competent cells were transformed with recombinant expression vector DBN11726 by using heat shock method under the following heat shock conditions. 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBN11726) were placed in a water bath at 42°C for 30 seconds, and then cultured at 37°C for 1 hour with shaking (shaking was performed using a shaker at 100 rpm), and then cultured on LB solid plates containing 50 mg / L of spectinomycin at 37°C for 12 hours. White bacterial colonies were picked up and cultured overnight at 37°C in LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, and spectinomycin 50 mg / L; pH adjusted to 7.5 with NaOH). The intracellular plasmid was extracted by the alkali method. The mycelium was centrifuged at 12,000 rpm for 1 min, the supernatant was removed, and the precipitated mycelium was suspended in 100 μL of ice-cooled solution I (25 mM Tris-HCl, 10 mM ethylenediaminetetraacetic acid (EDTA) and 50 mM glucose, pH 8.0). Freshly prepared solution II (0.2 M NaOH, 1% sodium dodecyl sulfate) was added. The tube was mixed by inverting four times and then placed on ice for 3-5 minutes. 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid) was added, mixed immediately and placed on ice for 5-10 minutes. The mixture was centrifuged at 4°C and 12,000 rpm for 5 minutes, and 2 volumes of absolute ethanol were added to the supernatant, mixed uniformly and placed at room temperature for 5 minutes. 4°C, 12,000 rpm The mixture was centrifuged for 5 min under the above conditions, the supernatant was discarded, and the precipitate was washed with 70% (V / V) ethanol and then air-dried. The precipitate was dissolved by adding 30 μL of TE (10 mM Tris-HCl and 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL). The resulting product was placed in a water bath at 37°C for 30 min to digest the RNA, and stored at -20°C for use. The extracted plasmid was identified by sequencing.As a result, it was shown that the nucleotide sequence between the Spe I site and the Asc I site of the recombinant expression vector DBN11726 was that set forth in SEQ ID NO: 12 of the Sequence Listing, that is, the AsHPPDm-F372A-F383W-02 nucleotide sequence.

[0123] According to the above-mentioned method for constructing the recombinant expression vector DBN11726, the AsHPPD-02 nucleotide sequence, AsHPPDm-F372A-02 nucleotide sequence, and AsHPPDm-F383W-02 nucleotide sequence linked to the universal adaptor primer 1 were each subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to construct the recombinant expression vectors DBN11727, DBN11728, and DBN11729 in sequence. By sequencing each of them, it was confirmed that the nucleotide sequences in the recombinant expression vectors DBN11727, DBN11728, and DBN11729 contained the nucleotide sequences set forth in SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9, respectively, in the sequence listing, that is, the AsHPPD-02 nucleotide sequence, AsHPPDm-F372A-02 nucleotide sequence, and AsHPPDm-F383W-02 nucleotide sequence were correctly inserted.

[0124] A control recombinant expression vector DBN11726N was constructed, and its structure is shown in FIG. 2 (Spec: spectinomycin gene, RB: right border, eFMV: 34S enhancer of Sciurus mosaic virus (SEQ ID NO: 13), prBrCBP: promoter of Brassica napus eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 14), spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 15), EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 16), tPsE9: terminator of pea RbcS gene (SEQ ID NO: 17), pr35S-01: cauliflower mosaic virus 35S promoter (SEQ ID NO: 20), PAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 21), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 22), LB: left border).

[0125] 4. Transformation of Agrobacterium with Recombinant Expression Vectors for Arabidopsis Correctly constructed recombinant expression vectors DBN11726, DBN11727, DBN11728, DBN11729 and DBN11726N were transformed into Agrobacterium GV3101 under the following transformation conditions using the liquid nitrogen method. 100 μL of Agrobacterium GV3101 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes and immersed in 37 °C warm water for 10 minutes. The transformed Agrobacterium GV3101 was inoculated into an LB tube and cultured for 2 hours under conditions of a temperature of 28 °C and a rotation speed of 200 rpm, and the positive single clone was grown by spreading it on an LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin, and the single clone was picked up and cultured, and its plasmid was extracted. The extracted plasmid was identified by sequencing. As a result, it was demonstrated that the structures of the recombinant expression vectors DBN11726 to DBN11729 and DBN11726N were completely correct.

[0126] 5. Obtaining transgenic Arabidopsis plants Wild-type Arabidopsis seeds were suspended in 0.1% (w / v) agarose solution. To ensure synchronous seed germination, the suspended seeds were stored at 4°C for 2 days to fulfill the dormancy requirement. Vermiculite was mixed with horse manure compost soil, the mixture was bottom irrigated to keep it moist, and the mixed soil was allowed to drain for 24 hours. The above pretreated seeds were sown in the mixed soil and covered with a moisture-retaining cover for 7 days. The seeds were allowed to germinate and maintained at constant temperature (22°C), humidity (40–50%), and light intensity of 120–150 μmol / m 2 s -1 Plants were grown in a greenhouse under long daylight conditions (16 h light / 8 h dark) for 24 h at 40 °C. Plants were irrigated initially with Hoagland nutrient solution and then with deionized water to keep the soil moist but not waterlogged.

[0127] Arabidopsis was transformed using the floral immersion method. One or more precultures of 15-30 mL of LB broth (tryptone 10 g / L, yeast extract 5 g / L, and NaCl 10 g / L; pH adjusted to 7.5 with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with the excised Agrobacterium colonies. The precultures were incubated overnight at 28 °C with constant shaking at 220 rpm. Each preculture was used to inoculate two 500 mL cultures of LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L), and the cultures were incubated overnight at 28 °C with continuous shaking. Cells were pelleted by centrifugation at approximately 4,000 rpm for 20 min at room temperature, and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic broth containing 1 / 2x MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (1 mg / mL stock solution in DMSO)) and 300 μL / L Silvet L-77. Approximately one-month-old Arabidopsis plants were dipped into the osmotic broth containing the resuspended cells for 15 seconds to ensure that the newest inflorescences were submerged. The Arabidopsis plants were then placed on their side, covered and kept moist in the dark for 24 hours. The Arabidopsis plants were grown normally at 22°C with a 16-hour light / 8-hour dark photoperiod. Seeds were harvested after approximately four weeks.

[0128] The freshly harvested (AsHPPD-02 nucleotide sequence, AsHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F383W-02 nucleotide sequence, AsHPPDm-F372A-F383W-02 nucleotide sequence, and control recombinant expression vector DBN11726N) T1 seeds were dried at room temperature for 7 days. The seeds were sown on 26.5 cm x 51 cm germination disks with 200 mg of T1 seeds (approximately 10,000 seeds) per disk. The seeds here were previously suspended in distilled water and stored at 4°C for 2 days to ensure synchronous seed germination and fulfill the dormancy requirement.

[0129] Vermiculite was mixed with horse manure compost, and the mixture was bottom-irrigated to keep it moist, allowing the water to drain by gravity. Using a pipette, the pretreated seeds were evenly sown into the mixed soil and covered with a moisturizing cover for 4–5 days. The cover was removed 1 day before postemergence application of glufosinate (used to select for the co-transformed PAT gene) to select for early transformants.

[0130] A 0.2% solution of Liberty herbicide (200 g ai / L of glufosinate) was sprayed on T1 plants 7 days after planting (DAP) and 11 DAP (at the cotyledon stage and 2–4 leaf stage, respectively) with a Devilbiss compressed air nozzle at a spray volume of 10 mL / disk (703 L / ha) to provide an effective dose of 280 g ai / ha of glufosinate per application. Surviving plants (actively growing plants) were identified 4–7 days after the final application and transplanted (3–5 plants / disk) into 7 cm × 7 cm square pots prepared with horse manure compost soil and vermiculite. The transplanted plants were covered with a moisturizing cover for 3–4 days and placed in a 22°C incubation cabinet or transferred directly to the greenhouse described above. The cover was then removed and the plants were placed in a greenhouse (22 ± 5 °C, 50 ± 30% RH, 14 h light:10 h dark, minimum 500 μE / m) for at least 1 day before testing the ability of the mutant HPPD gene to provide HPPD-inhibiting herbicide resistance. 2 s -1 The plants were planted in a control medium (wild type + supplemental light).

[0131] 6. Detection of herbicide resistance in transgenic Arabidopsis plants containing the AsHPPDm-F372A-F383W-02 nucleotide sequence T1 transformants were initially selected from non-transformed seeds using a glufosinate selection scheme. Arabidopsis thaliana T1 plants into which the AsHPPD-02 nucleotide sequence was introduced (AsHPPD-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced (AsHPPDm-F372A-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F383W-02 nucleotide sequence was introduced (AsHPPDm-F383W-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F372A-F383W-02 nucleotide sequence was introduced (AsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants into which the control recombinant expression vector DBN11726N was introduced (DBN11726N), and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with topramezone at three concentrations (100 g The tolerance of Arabidopsis to herbicides was determined by spraying isoxaflutole at three concentrations (140 g ai / ha (2x field concentration, 2x), 280 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)) and mesotrione at three concentrations (210 g ai / ha (2x field concentration, 2x), 420 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)). Seven days after application (7 DAT), the degree of damage caused by the herbicide was measured for each plant according to the percentage of bleached leaf area (percentage of bleached leaf area = bleached leaf area / total leaf area × 100%). Essentially no bleached phenotype was defined as grade 0, percentage of bleached leaf area less than 50% was defined as grade 1, percentage of bleached leaf area more than 50% was defined as grade 2, and percentage of bleached leaf area 100% was defined as grade 3.

[0132] The resistance performance of the transformation events of each recombinant expression vector was scored according to the formula X = [Σ(N × S) / (T × M)] × 100 (X-score of pesticide damage, N-number of plants with the same grade of damage, S-grade of pesticide damage, T-total number of plants, M-maximum grade of pesticide damage), and based on the score, the resistance was evaluated as high resistance plants (score 0-15), medium resistance plants (score 16-33), low resistance plants (score 34-67), and non-resistant plants (score 68-100). The results are shown in Table 1.

[0133] [Table 1]

[0134] The results in Table 1 show that compared with CK, Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 all showed high resistance tolerance to 4- or 8-fold field concentrations of topramezone, whereas both AsHPPD-02 and DBN11726N showed no resistance to topramezone.

[0135] [Table 2]

[0136] The results in Table 2 show that: (1) Compared with CK, Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed different degrees of tolerance to different concentrations of isoxaflutole, while both AsHPPD-02 and DBN11726N showed no tolerance to isoxaflutole. (2) Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed intermediate, intermediate and high resistance to twice the field concentration of isoxaflutole, respectively, indicating that the combined mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) had a better effect than the single-position mutations F372A or F383W. (3) Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed low resistance, low resistance and high resistance to four-fold field concentration of isoxaflutole, respectively, indicating that the combined mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) provided better efficacy than the single-position mutations F372A or F383W and further synergistically improved the efficacy of herbicide resistance.

[0137] [Table 3]

[0138] The results in Table 3 show that: (1) Compared with CK, Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed different degrees of resistance to different concentrations of mesotrione, while both AsHPPD-02 and DBN11726N showed no resistance to mesotrione. (2) The Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed intermediate, intermediate and high resistance to mesotrione at twice the field concentration, respectively, indicating that the combination of mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) provided better results than the single-position mutations F372A or F383W. (3) The Arabidopsis genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed better resistance to mesotrione at twice the field concentration, respectively, indicating that the combination of mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) provided better results than the single-position mutations F372A or F383W. The genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed low, low and high resistance to four-fold field concentrations of mesotrione, respectively, indicating that the combined mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) provided better efficacy than the single-position mutations F372A or F383W, and furthermore, synergistically improved the efficacy of herbicide resistance.

[0139] Tables 2 and 3 above clearly show that the combined mutations (F372A+F383W) at positions 372 and 383 of the wild-type HPPD amino acid sequence had a synergistically improved effect of HPPD-inhibiting herbicide resistance.

[0140] Example 2: Combination mutations at positions 372 and 383 (F372A+F383W) of the HPPD amino acid sequences from various species and verification of their mutation effects To further verify the synergistic effect of the combined mutations at positions 372 and 383 of the HPPD amino acid sequence, the phylogenetic tree of HPPD from various species (shown in Figure 3) was analyzed. To verify the mutation effect, HPPD from representative species on various branches was selected, and the amino acids at positions 372 and 383 of the amino acid sequence were mutated (F372A+F383W).

[0141] 1. Obtaining HPPD and mutant HPPD (F372A+F383W) from various species (1) Acquisition of the Arabidopsis-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type Arabidopsis thaliana HPPD (AtHPPD) is set forth in SEQ ID NO: 23 of the Sequence Listing, the AtHPPD-01 nucleotide sequence encoding AtHPPD is set forth in SEQ ID NO: 24 of the Sequence Listing, and the AtHPPD-02 nucleotide sequence encoding AtHPPD, obtained based on the common codon usage bias of Arabidopsis / soybean, is set forth in SEQ ID NO: 25 of the Sequence Listing.

[0142] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AtHPPDm-F372A amino acid sequence shown in SEQ ID NO: 26 of the Sequence Listing. The AtHPPDm-F372A-01 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 27 of the Sequence Listing. The AtHPPDm-F372A-02 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 28 of the Sequence Listing.

[0143] The amino acid at position 383 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F383W amino acid sequence shown in SEQ ID NO: 29 of the Sequence Listing. The AtHPPDm-F383W-01 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 30 of the Sequence Listing. The AtHPPDm-F383W-02 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 31 of the Sequence Listing.

[0144] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 32 of the Sequence Listing. The AtHPPDm-F372A-F383W-01 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 33 of the Sequence Listing. The AtHPPDm-F372A-F383W-02 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 34 of the Sequence Listing.

[0145] (2) Acquisition of mutant HPPD (F372A and F383W) from alfalfa The amino acid sequence of wild-type Medicago sativa HPPD (MsHPPD) is set forth as SEQ ID NO: 35 in the Sequence Listing, the MsHPPD-01 nucleotide sequence encoding MsHPPD is set forth as SEQ ID NO: 36 in the Sequence Listing, and the MsHPPD-02 nucleotide sequence encoding MsHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 37 in the Sequence Listing.

[0146] The amino acid at position 372 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the MsHPPDm-F372A amino acid sequence shown in SEQ ID NO: 38 of the Sequence Listing. The MsHPPDm-F372A-01 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 39 of the Sequence Listing. The MsHPPDm-F372A-02 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 40 of the Sequence Listing.

[0147] The amino acid at position 383 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F383W amino acid sequence shown in SEQ ID NO: 41 of the Sequence Listing. The MsHPPDm-F383W-01 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 42 of the Sequence Listing. The MsHPPDm-F383W-02 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 43 of the Sequence Listing.

[0148] The amino acid at position 372 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 44 of the Sequence Listing. The MsHPPDm-F372A-F383W-01 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 45 of the Sequence Listing. The MsHPPDm-F372A-F383W-02 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 46 of the Sequence Listing.

[0149] (3) Acquisition of mutant HPPD (F372A and F383W) from cotton The amino acid sequence of wild-type cotton (Gossypium hirsutum) HPPD (GsHPPD) is set forth as SEQ ID NO: 47 in the Sequence Listing, the nucleotide sequence of GsHPPD-01 encoding GsHPPD is set forth as SEQ ID NO: 48 in the Sequence Listing, and the nucleotide sequence of GsHPPD-02 encoding GsHPPD, obtained based on the common codon usage bias of Arabidopsis / soybean, is set forth as SEQ ID NO: 49 in the Sequence Listing.

[0150] The amino acid at position 372 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GsHPPDm-F372A amino acid sequence shown in SEQ ID NO: 50 of the Sequence Listing. The GsHPPDm-F372A-01 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 51 of the Sequence Listing. The GsHPPDm-F372A-02 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 52 of the Sequence Listing.

[0151] The amino acid at position 383 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F383W amino acid sequence shown in SEQ ID NO: 53 of the Sequence Listing. The GsHPPDm-F383W-01 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 54 of the Sequence Listing. The GsHPPDm-F383W-02 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 55 of the Sequence Listing.

[0152] The amino acid at position 372 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 56 of the Sequence Listing. The GsHPPDm-F372A-F383W-01 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 57 of the Sequence Listing. The GsHPPDm-F372A-F383W-02 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 58 of the Sequence Listing.

[0153] (4) Acquisition of the mutant HPPD (F372A and F383W) from Brassica napus The amino acid sequence of wild-type Brassica napus HPPD (BnHPPD) is set forth as SEQ ID NO:59 in the Sequence Listing, the BnHPPD-01 nucleotide sequence encoding BnHPPD is set forth as SEQ ID NO:60 in the Sequence Listing, and the BnHPPD-02 nucleotide sequence encoding BnHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO:61 in the Sequence Listing.

[0154] The amino acid at position 372 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the BnHPPDm-F372A amino acid sequence shown in SEQ ID NO: 62 of the Sequence Listing. The BnHPPDm-F372A-01 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 63 of the Sequence Listing. The BnHPPDm-F372A-02 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 64 of the Sequence Listing.

[0155] The amino acid at position 383 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F383W amino acid sequence shown in SEQ ID NO: 65 of the Sequence Listing. The BnHPPDm-F383W-01 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 66 of the Sequence Listing. The BnHPPDm-F383W-02 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 67 of the Sequence Listing.

[0156] The amino acid at position 372 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 68 of the Sequence Listing. The BnHPPDm-F372A-F383W-01 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 69 of the Sequence Listing. The BnHPPDm-F372A-F383W-02 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 70 of the Sequence Listing.

[0157] (5) Acquisition of soybean-derived mutant HPPD (F372A and F383W) The amino acid sequence of wild-type soybean (Glycine max) HPPD (GmHPPD) is shown as SEQ ID NO: 71 in the Sequence Listing, the GmHPPD-01 nucleotide sequence encoding GmHPPD is shown as SEQ ID NO: 72 in the Sequence Listing, and the GmHPPD-02 nucleotide sequence encoding GmHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is shown as SEQ ID NO: 73 in the Sequence Listing.

[0158] The amino acid at position 372 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GmHPPDm-F372A amino acid sequence shown in SEQ ID NO: 74 of the Sequence Listing. The GmHPPDm-F372A-01 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 75 of the Sequence Listing. The GmHPPDm-F372A-02 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 76 of the Sequence Listing.

[0159] The amino acid at position 383 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F383W amino acid sequence shown in SEQ ID NO: 77 of the Sequence Listing. The GmHPPDm-F383W-01 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 78 of the Sequence Listing. The GmHPPDm-F383W-02 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 79 of the Sequence Listing.

[0160] The amino acid at position 372 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 80 of the Sequence Listing. The GmHPPDm-F372A-F383W-01 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 81 of the Sequence Listing. The GmHPPDm-F372A-F383W-02 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 82 of the Sequence Listing.

[0161] (6) Acquisition of the tobacco-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type tobacco (Nicotiana tabacum) HPPD (NtHPPD) is set forth as SEQ ID NO: 83 in the Sequence Listing, the NtHPPD-01 nucleotide sequence encoding NtHPPD is set forth as SEQ ID NO: 84 in the Sequence Listing, and the NtHPPD-02 nucleotide sequence encoding NtHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 85 in the Sequence Listing.

[0162] The amino acid at position 372 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the NtHPPDm-F372A amino acid sequence shown in SEQ ID NO: 86 of the Sequence Listing. The NtHPPDm-F372A-01 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 87 of the Sequence Listing. The NtHPPDm-F372A-02 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 88 of the Sequence Listing.

[0163] The amino acid at position 383 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F383W amino acid sequence shown in SEQ ID NO: 89 of the Sequence Listing. The NtHPPDm-F383W-01 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 90 of the Sequence Listing. The NtHPPDm-F383W-02 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis thaliana / soybean, is shown in SEQ ID NO: 91 of the Sequence Listing.

[0164] The amino acid at position 372 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 92 of the Sequence Listing. The NtHPPDm-F372A-F383W-01 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 93 of the Sequence Listing. The NtHPPDm-F372A-F383W-02 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 94 of the Sequence Listing.

[0165] (7) Acquisition of the rice-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type rice (Oryza sativa) HPPD (OsHPPD) is set forth as SEQ ID NO: 95 in the Sequence Listing, the OsHPPD-01 nucleotide sequence encoding OsHPPD is set forth as SEQ ID NO: 96 in the Sequence Listing, and the OsHPPD-02 nucleotide sequence encoding OsHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 97 in the Sequence Listing.

[0166] The amino acid at position 372 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the OsHPPDm-F372A amino acid sequence shown in SEQ ID NO: 98 of the Sequence Listing. The OsHPPDm-F372A-01 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 99 of the Sequence Listing. The OsHPPDm-F372A-02 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 100 of the Sequence Listing.

[0167] The amino acid at position 383 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the OsHPPDm-F383W amino acid sequence shown in SEQ ID NO: 101 of the Sequence Listing. The OsHPPDm-F383W-01 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 102 of the Sequence Listing. The OsHPPDm-F383W-02 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 103 of the Sequence Listing.

[0168] The amino acid at position 372 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the OsHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 104 of the Sequence Listing. The OsHPPDm-F372A-F383W-01 nucleotide sequence encoding the OsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 105 of the Sequence Listing. The OsHPPDm-F372A-F383W-02 nucleotide sequence encoding the OsHPPDm-F372A-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 106 of the Sequence Listing.

[0169] (8) Acquisition of the sorghum-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type Sorghum bicolor HPPD (SbHPPD) is set forth as SEQ ID NO: 107 in the Sequence Listing, the SbHPPD-01 nucleotide sequence encoding SbHPPD is set forth as SEQ ID NO: 108 in the Sequence Listing, and the SbHPPD-02 nucleotide sequence encoding SbHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 109 in the Sequence Listing.

[0170] The amino acid at position 372 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the SbHPPDm-F372A amino acid sequence shown in SEQ ID NO: 110 of the Sequence Listing. The SbHPPDm-F372A-01 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 111 of the Sequence Listing. The SbHPPDm-F372A-02 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis thaliana / soybean, is shown in SEQ ID NO: 112 of the Sequence Listing.

[0171] The amino acid at position 383 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F383W amino acid sequence shown in SEQ ID NO: 113 of the Sequence Listing. The SbHPPDm-F383W-01 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 114 of the Sequence Listing. The SbHPPDm-F383W-02 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis / soybean, is shown in SEQ ID NO: 115 of the Sequence Listing.

[0172] The amino acid at position 372 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 116 of the Sequence Listing. The SbHPPDm-F372A-F383W-01 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 117 of the Sequence Listing. The SbHPPDm-F372A-F383W-02 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 118 of the Sequence Listing.

[0173] (9) Obtaining the barley-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type barley (Hordeum vulgare) HPPD (HvHPPD) is shown as SEQ ID NO: 119 in the Sequence Listing, the HvHPPD-01 nucleotide sequence encoding HvHPPD is shown as SEQ ID NO: 120 in the Sequence Listing, and the HvHPPD-02 nucleotide sequence encoding HvHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is shown as SEQ ID NO: 121 in the Sequence Listing.

[0174] The amino acid at position 372 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the HvHPPDm-F372A amino acid sequence shown in SEQ ID NO: 122 of the Sequence Listing. The HvHPPDm-F372A-01 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 123 of the Sequence Listing. The HvHPPDm-F372A-02 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence, obtained based on the common codon usage bias of Arabidopsis thaliana / soybean, is shown in SEQ ID NO: 124 of the Sequence Listing.

[0175] The amino acid at position 383 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F383W amino acid sequence shown in SEQ ID NO: 125 of the Sequence Listing. The HvHPPDm-F383W-01 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 126 of the Sequence Listing. The HvHPPDm-F383W-02 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence, obtained based on the common codon usage bias of Arabidopsis thaliana / soybean, is shown in SEQ ID NO: 127 of the Sequence Listing.

[0176] The amino acid at position 372 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 128 of the Sequence Listing. The HvHPPDm-F372A-F383W-01 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 129 of the Sequence Listing. The HvHPPDm-F372A-F383W-02 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 130 of the Sequence Listing.

[0177] (10) Acquisition of the maize-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type maize (Zea mays) HPPD (ZmHPPD) is set forth as SEQ ID NO: 131 in the Sequence Listing, the ZmHPPD-01 nucleotide sequence encoding ZmHPPD is set forth as SEQ ID NO: 132 in the Sequence Listing, and the ZmHPPD-02 nucleotide sequence encoding ZmHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 133 in the Sequence Listing.

[0178] The amino acid at position 372 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the ZmHPPDm-F372A amino acid sequence shown in SEQ ID NO: 134 of the Sequence Listing. The ZmHPPDm-F372A-01 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 135 of the Sequence Listing. The ZmHPPDm-F372A-02 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 136 of the Sequence Listing.

[0179] The amino acid at position 383 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F383W amino acid sequence shown in SEQ ID NO: 137 of the Sequence Listing. The ZmHPPDm-F383W-01 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 138 of the Sequence Listing. The ZmHPPDm-F383W-02 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 139 of the Sequence Listing.

[0180] The amino acid at position 372 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 140 of the Sequence Listing. The ZmHPPDm-F372A-F383W-01 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 141 of the Sequence Listing. The ZmHPPDm-F372A-F383W-02 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 142 of the Sequence Listing.

[0181] (11) Obtaining mutant HPPD (F372A+F383W) from Pseudomonas fluorescens The amino acid sequence of wild-type Pseudomonas fluorescens HPPD (PfHPPD) is set forth as SEQ ID NO: 143 in the Sequence Listing, the PfHPPD-01 nucleotide sequence encoding PfHPPD is set forth as SEQ ID NO: 144 in the Sequence Listing, and the PfHPPD-02 nucleotide sequence encoding PfHPPD, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth as SEQ ID NO: 145 in the Sequence Listing.

[0182] The amino acid at position 372 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the PfHPPDm-F372A amino acid sequence shown in SEQ ID NO: 146 of the Sequence Listing. The PfHPPDm-F372A-01 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 147 of the Sequence Listing. The PfHPPDm-F372A-02 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 148 of the Sequence Listing.

[0183] The amino acid at position 383 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F383W amino acid sequence shown in SEQ ID NO: 149 of the Sequence Listing. The PfHPPDm-F383W-01 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 150 of the Sequence Listing. The PfHPPDm-F383W-02 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 151 of the Sequence Listing.

[0184] The amino acid at position 372 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F372A-F383W amino acid sequence shown in SEQ ID NO: 152 of the Sequence Listing. The PfHPPDm-F372A-F383W-01 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 153 of the Sequence Listing. The PfHPPDm-F372A-F383W-02 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 154 of the Sequence Listing.

[0185] 2. Construction of recombinant expression vectors for Arabidopsis thaliana containing mutant HPPD from various species (containing the combined mutation of F372A+F383W, the single-position mutation F372A, or the single-position mutation F383W). According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AtHPPD-02 nucleotide sequence, the AtHPPDm-F372A-02 nucleotide sequence, the AtHPPDm-F383W-02 nucleotide sequence, the AtHPPDm-F372A-F383W-02 nucleotide sequence, the MsHPPD-02 nucleotide sequence, the MsHPPDm-F372A-02 nucleotide sequence, the MsHPPD Dm-F383W-02 nucleotide sequence, MsHPPDm-F372A-F383W-02 nucleotide sequence, GsHPPD-02 nucleotide sequence, GsHPPDm-F372A-02 nucleotide sequence, GsHPPDm-F383W-02 nucleotide sequence, GsHPPDm-F372A-F383W-02 nucleotide sequence, BnHPPD-02 nucleotide sequence, BnHPPDm-F372A-02 nucleotide sequence, BnHPPDm-F383W-02 nucleotide sequence, BnHPPDm-F372A-F383W-02 nucleotide sequence , GmHPPD-02 nucleotide sequence, GmHPPDm-F372A-02 nucleotide sequence, GmHPPDm-F383W-02 nucleotide sequence, GmHPPDm-F372A-F383W-02 nucleotide sequence, NtHPPD-02 nucleotide sequence, NtHPPDm-F372A-02 nucleotide sequence, NtHPPDm-F383W-02 nucleotide sequence, NtHPPDm-F372A-F383W-02 nucleotide sequence, OsHPPD-02 nucleotide sequence, OsHPPDm-F372A-02 nucleotide sequence, OsHPPD m-F383W-02 nucleotide sequence, OsHPPDm-F372A-F383W-02 nucleotide sequence, SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, HvHPPD-02 nucleotide sequence, HvHPPDm-F372A-02 nucleotide sequence, HvHPPDm-F383W-02 nucleotide sequence, HvHPPDm-F372A-F383W-02 nucleotide sequence,The ZmHPPD-02 nucleotide sequence, the ZmHPPDm-F372A-02 nucleotide sequence, the ZmHPPDm-F383W-02 nucleotide sequence, the ZmHPPDm-F372A-F383W-02 nucleotide sequence, the PfHPPD-02 nucleotide sequence, the PfHPPDm-F372A-02 nucleotide sequence, the PfHPPDm-F383W-02 nucleotide sequence, and the PfHPPDm-F372A-F383W-02 nucleotide sequence were each subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11730 to DBN11773 in order. By sequencing, it was confirmed that each of the aforementioned nucleotide sequences was correctly inserted into the recombinant expression vectors DBN11730 to DBN11773.

[0186] 3. Transformation of Agrobacterium with Arabidopsis Recombinant Expression Vectors According to the Agrobacterium transformation method using the recombinant expression vector for Arabidopsis thaliana described in Item 4 of Example 1 above, the correctly constructed recombinant expression vectors DBN11730 to DBN11773 and the control recombinant expression vector DBN11726N constructed in Item 3 of Example 1 were transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, and it was shown that the structures of the recombinant expression vectors DBN11730 to DBN11773 and DBN11726N were completely correct.

[0187] 4. Detection of herbicide resistance in Arabidopsis plants carrying HPPD mutants from various species (F372A+F383W combination mutations, single-site mutation F372A, or single-site mutation F383W) In order to introduce the T-DNA of the recombinant expression vectors DBN11730 to DBN11773 constructed in this Example 2 and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 into Arabidopsis chromosomes, the Arabidopsis inflorescence was immersed in a solution of Agrobacterium described in item 3 of this Example according to the method described in item 5 of Example 1 above, thereby obtaining the corresponding transgenic Arabidopsis plants. That is, the Arabidopsis T1 plant into which the AtHPPD-02 nucleotide sequence was introduced (AtHPPD-02), the Arabidopsis T1 plant into which the AtHPPDm-F372A-02 nucleotide sequence was introduced (AtHPPDm-F372A-02), the Arabidopsis T1 plant into which the AtHPPDm-F383W-02 nucleotide sequence was introduced (AtHPPDm-F383W-02), the AtHPPDm-F372A-F383W- Arabidopsis thaliana T1 plant into which the AtHPPDm-02 nucleotide sequence has been introduced (AtHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant into which the MsHPPD-02 nucleotide sequence has been introduced (MsHPPD-02), Arabidopsis thaliana T1 plant into which the MsHPPDm-F372A-02 nucleotide sequence has been introduced (MsHPPDm-F372A-02), Arabidopsis thaliana T1 plant into which the MsHPPDm-F383W-02 nucleotide sequence has been introduced (MsHPPDm-F372A-02), Shepherd's purse T1 plant (MsHPPDm-F383W-02), Arabidopsis thaliana T1 plant into which the MsHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (MsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant into which the GsHPPD-02 nucleotide sequence has been introduced (GsHPPD-02), Arabidopsis thaliana T1 plant into which the GsHPPDm-F372A-02 nucleotide sequence has been introduced (GsHPPD Arabidopsis T1 plants into which the GsHPPDm-F383W-02 nucleotide sequence has been introduced (GsHPPDm-F383W-02), Arabidopsis T1 plants into which the GsHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (GsHPPDm-F372A-F383W-02), Arabidopsis T1 plants into which the BnHPPD-02 nucleotide sequence has been introduced (BnHPPD-02),Arabidopsis thaliana T1 plants into which the BnHPPDm-F372A-02 nucleotide sequence has been introduced (BnHPPDm-F372A-02), Arabidopsis thaliana T1 plants into which the BnHPPDm-F383W-02 nucleotide sequence has been introduced (BnHPPDm-F383W-02), Arabidopsis thaliana T1 plants into which the BnHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (BnHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants into which the GmHPPD-02 nucleotide sequence has been introduced (GmHPPD-02), GmHPPDm-F372A- Arabidopsis thaliana T1 plants into which the GmHPPDm-F372A-02 nucleotide sequence was introduced (GmHPPDm-F383W-02), Arabidopsis thaliana T1 plants into which the GmHPPDm-F372A-F383W-02 nucleotide sequence was introduced (GmHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants into which the GmHPPDm-F372A-F383W-02 nucleotide sequence was introduced (GmHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants into which the NtHPPD-02 nucleotide sequence was introduced (NtHPPD-02), and Arabidopsis thaliana T1 plants into which the NtHPPDm-F372A-02 nucleotide sequence was introduced (NtHPPD-02). Arabidopsis thaliana T1 plant (NtHPPDm-F372A-02), Arabidopsis thaliana T1 plant into which the NtHPPDm-F383W-02 nucleotide sequence has been introduced (NtHPPDm-F383W-02), Arabidopsis thaliana T1 plant into which the NtHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (NtHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant into which the OsHPPD-02 nucleotide sequence has been introduced (OsHPPD-02), Arabidopsis thaliana T1 plant into which the OsHPPDm-F372A-02 nucleotide sequence has been introduced (OsHPPD PPDm-F372A-02), Arabidopsis T1 plant into which the OsHPPDm-F383W-02 nucleotide sequence has been introduced (OsHPPDm-F383W-02), Arabidopsis T1 plant into which the OsHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (OsHPPDm-F372A-F383W-02), Arabidopsis T1 plant into which the SbHPPD-02 nucleotide sequence has been introduced (SbHPPD-02), Arabidopsis T1 plant into which the SbHPPDm-F372A-02 nucleotide sequence has been introduced (SbHPPDm-F372A-02),Arabidopsis thaliana T1 plant into which the SbHPPDm-F383W-02 nucleotide sequence has been introduced (SbHPPDm-F383W-02), Arabidopsis thaliana T1 plant into which the SbHPPDm-F372A-F383W-02 nucleotide sequence has been introduced (SbHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant into which the HvHPPD-02 nucleotide sequence has been introduced (HvHPPD-02), Arabidopsis thaliana T1 plant into which the HvHPPDm-F372A-02 nucleotide sequence has been introduced (HvHPPD Arabidopsis thaliana T1 plants (HvHPPDm-F383W-02) into which the HvHPPDm-F372A-F383W-02 nucleotide sequence has been introduced, Arabidopsis thaliana T1 plants (HvHPPDm-F372A-F383W-02) into which the HvHPPDm-F372A-F383W-02 nucleotide sequence has been introduced, Arabidopsis thaliana T1 plants (HvHPPDm-F372A-F383W-02) into which the ZmHPPD-02 nucleotide sequence has been introduced, Arabidopsis thaliana T1 plants (ZmHPPD-02) into which the ZmHPPDm-F372A-02 nucleotide sequence has been introduced Arabidopsis T1 plant (ZmHPPDm-F372A-02), Arabidopsis T1 plant (ZmHPPDm-F383W-02) into which the ZmHPPDm-F383W-02 nucleotide sequence has been introduced, Arabidopsis T1 plant (ZmHPPDm-F372A-F383W-02) into which the ZmHPPDm-F372A-F383W-02 nucleotide sequence has been introduced, Arabidopsis T1 plant (ZmHPPDm-F372A-F383W-02) into which the PfHPPD-02 nucleotide sequence has been introduced, Arabidopsis T1 plant (PfHPPD-02) into which the PfHPPDm-F372A-02 nucleotide sequence has been introduced, Arabidopsis thaliana T1 plants into which the sequence was introduced (PfHPPDm-F372A-02), Arabidopsis thaliana T1 plants into which the PfHPPDm-F383W-02 nucleotide sequence was introduced (PfHPPDm-F383W-02), Arabidopsis thaliana T1 plants into which the PfHPPDm-F372A-F383W-02 nucleotide sequence was introduced (PfHPPDm-F372A-F383W-02), and Arabidopsis thaliana T1 plants into which the control recombinant expression vector DBN11726N was introduced (DBN11726N) were obtained.

[0188] According to the method described in item 6 of Example 1 above, the above-mentioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with three concentrations of topramezone (25 g ai / ha (1x field concentration, 1x), 100 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)), three concentrations of isoxaflutole (35 g ai / ha (half-field concentration, 0.5x), 70 g ai / ha (1x field concentration, 1x), and 0 g ai / ha (water, 0x)), and three concentrations of mesotrione (52.5 g ai / ha (half-field concentration, 0.5x), 105 g ai / ha (1x field concentration, 1x), and 0 g ai / ha (water, 0x). ai / ha (water, 0×)) to detect the resistance of Arabidopsis to the herbicides. The experimental results are shown in Tables 4 to 6.

[0189] [Table 4] [Table 5]

[0190] The results in Table 4 show that: (1) compared with Arabidopsis plants transfected with the unmutated HPPD gene, Arabidopsis plants transfected with HPPD genes from various species carrying combined mutations at positions 372 and 383 (F372A+F383W) and with a single mutation at position 372 (F372A) had different degrees of resistance to topramezone, and only the HPPD genes from some species (sorghum, barley, and maize) carrying a single mutation at position 383 (F383W) were able to confer resistance to topramezone to Arabidopsis plants, whereas CK plants and control vector DBN11726N plants had no resistance to topramezone.

[0191] (2) In terms of resistance evaluation, with respect to topramezone, Arabidopsis plants transfected with HPPD genes from various species (other than alfalfa) carrying combined mutations at positions 372 and 383 (F372A+F383W) showed better herbicide resistance than Arabidopsis plants transfected with HPPD genes carrying single-position mutations F372A or F383W, and furthermore, the effect of herbicide resistance was synergistically improved.

[0192] (3) In terms of the score, Arabidopsis plants transfected with the alfalfa-derived HPPD gene having a combination mutation at positions 372 and 383 (F372A+F383W) had a lower resistance score than Arabidopsis plants transfected with the HPPD gene having a single mutation at position F372A or F383W. Furthermore, when treated with 4-fold field concentration of topramezone, about 50% of Arabidopsis plants transfected with the alfalfa-derived HPPD gene having a combination mutation at positions 372 and 383 had injury levels of grade 0 or grade 1, 25% of Arabidopsis plants transfected with the alfalfa-derived HPPD gene having a single mutation at position 372 had injury levels of grade 0 or grade 1, and the number of Arabidopsis plants transfected with the alfalfa-derived HPPD gene having a single mutation at position 383 with injury levels of grade 0 or grade 1 was zero. This indicates that the HPPD gene from alfalfa carrying the combined mutations at positions 372 and 383 (F372A+F383W) could confer synergistically improved herbicide resistance to Arabidopsis plants.

[0193] [Table 6] [Table 7] [Table 8]

[0194] The results in Table 5 show that: (1) Compared with Arabidopsis plants transfected with the unmutated HPPD gene, Arabidopsis plants transfected with HPPD genes from various species having combined mutations at positions 372 and 383 (F372A+F383W) and with a single mutation at position 372 (F372A) have different degrees of resistance to isoxaflutole, and only the HPPD genes from some species (sorghum, barley, and maize) having a single mutation at position 383 (F383W) can confer resistance to isoxaflutole to Arabidopsis plants, while CK plants and control vector DBN11726N plants had no resistance to isoxaflutole.

[0195] (2) In terms of resistance evaluation, with respect to isoxaflutole, Arabidopsis plants transfected with HPPD genes from various species (other than maize) carrying combined mutations at positions 372 and 383 (F372A+F383W) showed better herbicide resistance than Arabidopsis plants transfected with HPPD genes carrying single-position mutations F372A or F383W, and furthermore, the effect of herbicide resistance was synergistically improved.

[0196] (3) In terms of the score, Arabidopsis plants transfected with the maize-derived HPPD gene having the combined mutations at positions 372 and 383 (F372A+F383W) had a lower resistance score than Arabidopsis plants transfected with the maize-derived HPPD gene having the single mutations F372A or F383W. Furthermore, when treated with 1x field concentration of isoxaflutole, about 69% of Arabidopsis plants transfected with the maize-derived HPPD gene having the combined mutations at positions 372 and 383 had injury levels of grade 0 or grade 1, 6% of Arabidopsis plants transfected with the maize-derived HPPD gene having a single mutation at position 372 had injury levels of grade 0 or grade 1, and the number of Arabidopsis plants transfected with the maize-derived HPPD gene having a single mutation at position 383 had injury levels of grade 0 or grade 1 was zero. This indicates that the HPPD gene from maize carrying the combined mutations at positions 372 and 383 (F372A+F383W) can confer synergistically improved herbicide resistance to Arabidopsis plants.

[0197] [Table 9] [Table 10] [Table 11]

[0198] The results in Table 6 show that: (1) Compared with Arabidopsis plants transfected with the unmutated HPPD gene, Arabidopsis plants transfected with HPPD genes from various species carrying combined mutations at positions 372 and 383 (F372A+F383W) and with a single mutation at position 372 (F372A) have different degrees of resistance to mesotrione, and only the HPPD genes from some species (barley and maize) carrying a single mutation at position 383 (F383W) can confer resistance to mesotrione to Arabidopsis plants, whereas CK plants and control vector DBN11726N plants had no resistance to mesotrione.

[0199] (2) In terms of resistance evaluation, with respect to mesotrione, Arabidopsis plants transfected with HPPD genes from various species (except tobacco) carrying combined mutations at positions 372 and 383 (F372A+F383W) showed better herbicide resistance than Arabidopsis plants transfected with HPPD genes carrying single-position mutations F372A or F383W, and furthermore, the effect of herbicide resistance was synergistically improved.

[0200] (3) In terms of the resistance score, when treated with half or 1x field concentrations of mesotrione, Arabidopsis plants transfected with the tobacco-derived HPPD gene carrying a combined mutation at positions 372 and 383 (F372A+F383W) had lower resistance scores than Arabidopsis plants carrying the single-position mutations F372A or F383W and further showed a synergistically enhanced herbicide resistance effect.

[0201] From the above, the results in Tables 4 to 6 show that all HPPD genes from various species having the combined mutation at positions 372 and 383 (F372A+F383W) can confer synergistically improved herbicide resistance to plants.

[0202] Example 3: Different mutations at positions 372 and 383 of the HPPD amino acid sequence (combined mutations F372G+F383W or F372V+F383W) and verification of the mutation effects 1. Acquisition of genes AsHPPDm-F372G-F383W and AsHPPDm-F372V-F383W (1) The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G) to obtain the AsHPPDm-F372G amino acid sequence shown in SEQ ID NO: 155 of the Sequence Listing. The AsHPPDm-F372G-01 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence is shown in SEQ ID NO: 156 of the Sequence Listing. The AsHPPDm-F372G-02 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence obtained based on the common codon usage bias of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 157 of the Sequence Listing.

[0203] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372G-F383W amino acid sequence shown in SEQ ID NO: 158 of the Sequence Listing. The AsHPPDm-F372G-F383W-01 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence is shown in SEQ ID NO: 159 of the Sequence Listing. The AsHPPDm-F372G-F383W-02 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 160 of the Sequence Listing.

[0204] (2) The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V) to obtain the AsHPPDm-F372V amino acid sequence shown in SEQ ID NO: 161 of the Sequence Listing. The AsHPPDm-F372V-01 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence is shown in SEQ ID NO: 162 of the Sequence Listing. The AsHPPDm-F372V-02 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence obtained based on the common codon usage bias of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 163 of the Sequence Listing.

[0205] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372V-F383W amino acid sequence shown in SEQ ID NO: 164 of the Sequence Listing. The AsHPPDm-F372V-F383W-01 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence is shown in SEQ ID NO: 165 of the Sequence Listing. The AsHPPDm-F372V-F383W-02 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 166 of the Sequence Listing.

[0206] 2. Construction of recombinant expression vectors for Arabidopsis thaliana containing the oat HPPD gene (F372G+F383W or F372V+F383W) According to the construction method of the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AsHPPDm-F372G-02 nucleotide sequence, the AsHPPDm-F372G-F383W-02 nucleotide sequence, the AsHPPDm-F372V-02 nucleotide sequence, and the AsHPPDm-F372V-F383W-02 nucleotide sequence linked to the universal adaptor primer 1 were respectively recombined with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11774 to DBN11777 in order. It was confirmed by sequencing that each of the aforementioned nucleotide sequences was correctly inserted into the recombinant expression vectors DBN11774 to DBN11777.

[0207] 3. Transformation of Agrobacterium with Arabidopsis Recombinant Expression Vectors According to the method of transforming Agrobacterium using the recombinant expression vector for Arabidopsis thaliana described in item 4 of Example 1 above, the correctly constructed recombinant expression vectors DBN11774 to DBN11777, as well as the recombinant expression vector DBN11727 of item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, the recombinant expression vector DBN11729 of item 3 of Example 1 containing the AsHPPDm-F383W-02 nucleotide sequence, and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 were transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, showing that the structures of the recombinant expression vectors DBN11774 to DBN11777, DBN11727, DBN11729, and DBN11726N were completely correct.

[0208] 4. Detection of herbicide resistance in transgenic Arabidopsis plants carrying the nucleotide sequence AsHPPDm-F372G-F383W-02 or AsHPPDm-F372V-F383W-02 In order to introduce the T-DNA of the recombinant expression vectors DBN11774 to DBN11777 constructed in item 2 of this Example, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in item 3 of Example 1, the recombinant expression vector DBN11729 containing the AsHPPDm-F383W-02 nucleotide sequence in item 3 of Example 1, and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 into Arabidopsis chromosomes, the Arabidopsis inflorescence was immersed in a solution of Agrobacterium described in item 3 of this Example according to the method described in item 5 of Example 1 above, thereby obtaining the corresponding transgenic Arabidopsis plants. That is, Arabidopsis thaliana T1 plants into which the AsHPPDm-F372G-02 nucleotide sequence was introduced (AsHPPDm-F372G-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F372G-F383W-02 nucleotide sequence was introduced (AsHPPDm-F372G-F383W-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F372V-02 nucleotide sequence was introduced (AsHPPDm-F372V-0 2), Arabidopsis T1 plants into which the AsHPPDm-F372V-F383W-02 nucleotide sequence had been introduced (AsHPPDm-F372V-F383W-02), Arabidopsis T1 plants into which the AsHPPD-02 nucleotide sequence had been introduced, Arabidopsis T1 plants into which the AsHPPDm-F383W-02 nucleotide sequence had been introduced, and Arabidopsis T1 plants into which the control recombinant expression vector DBN11726N had been introduced were obtained.

[0209] 5. Verification of synergistic effects of F372G+F383W or F372V+F383W According to the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with topramezone at three different concentrations (i.e., 100 g ai / ha (4x field concentration, 4x), 200 g ai / ha (8x field concentration, 8x), and 0 g ai / ha (water, 0x)), isoxaflutole at three different concentrations (i.e., 140 g ai / ha (2x field concentration, 2x), 280 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)), and mesotrione at three different concentrations (i.e., 210 g ai / ha (2x field concentration, 2x), 420 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)). ai / ha (water, 0x)) to detect herbicide resistance in Arabidopsis thaliana. The experimental results are shown in Tables 7 to 9.

[0210] [Table 12]

[0211] The results in Table 7 show that Arabidopsis genotypes AsHPPDm-F372G-02, AsHPPDm-F383W-02, AsHPPDm-F372G-F383W-02, AsHPPDm-F372V-02 and AsHPPDm-F372V-F383W-02 all showed high resistance when treated with 4-fold or 8-fold field concentration of topramezone compared to CK, whereas AsHPPD-02 and control vector DBN11726N plants showed no resistance to topramezone.

[0212] [Table 13]

[0213] [Table 14]

[0214] The results in Tables 8 and 9 show the following: (1) Compared with CK, Arabidopsis plants transfected with the oat-derived HPPD gene having a combination of mutations at positions 372 and 383 (F372G+F383W or F372V+F383W), the oat-derived HPPD gene having a single mutation at position 372 (F372G or F372V), and the oat-derived HPPD gene having a single mutation at position 383 (F383W) had different degrees of resistance to both isoxaflutole and mesotrione, whereas Arabidopsis plants transfected with the unmutated HPPD gene and the control vector DBN11726N were not resistant to either isoxaflutole or mesotrione.

[0215] (2) In terms of resistance evaluation, when treated with twice the field concentration of isoxaflutole or mesotrione, Arabidopsis plants transfected with the oat-derived HPPD gene carrying combined mutations at positions 372 and 383 (F372G+F383W or F372V+F383W) showed better herbicide tolerance (high resistance) than Arabidopsis plants transfected with the HPPD gene carrying a single mutation at position 372 (moderate resistance) or a single mutation at position 383 (moderate resistance). When treated with four-fold field concentrations of isoxaflutole or mesotrione, Arabidopsis plants transfected with the oat-derived HPPD gene carrying combined mutations at positions 372 and 383 (F372G+F383W or F372V+F383W) showed better herbicide tolerance (high resistance) than Arabidopsis plants transfected with the HPPD gene carrying a single mutation at position 372 (low resistance) or a single mutation at position 383 (low resistance), and the effect of herbicide tolerance was further improved synergistically.

[0216] Tables 8 and 9 above demonstrate that different combination mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (combination mutations F372G+F383W or F372V+F383W) also synergistically improved tolerance to HPPD-inhibiting herbicides.

[0217] Example 4: Combination of mutations at positions 372 and 383 of the HPPD amino acid sequence with mutations at other positions and their mutation effects 1. Obtaining sequences with combination mutations at multiple positions (1) Acquisition of HPPDm-1 amino acid sequence (AsHPPDm-A107-F372A-F383W amino acid sequence) The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, and the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A107-F372A amino acid sequence shown in SEQ ID NO: 167 of the Sequence Listing. The AsHPPDm-A107-F372A-01 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence is shown in SEQ ID NO: 168 of the Sequence Listing. The AsHPPDm-A107-F372A-02 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 169 of the Sequence Listing.

[0218] The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A107-F383W amino acid sequence shown in SEQ ID NO: 170 of the Sequence Listing. The AsHPPDm-A107-F383W-01 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence is shown in SEQ ID NO: 171 of the Sequence Listing. The AsHPPDm-A107-F383W-02 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 172 of the Sequence Listing.

[0219] The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-1 amino acid sequence (AsHPPDm-A107-F372A-F383W amino acid sequence) shown in SEQ ID NO: 173 of the Sequence Listing. The HPPDm-1-01 nucleotide sequence encoding the HPPDm-1 amino acid sequence is shown in SEQ ID NO: 174 of the Sequence Listing. The HPPDm-1-02 nucleotide sequence encoding the HPPDm-1 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 175 of the Sequence Listing.

[0220] (2) Acquisition of HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence) The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A111T-F372A amino acid sequence shown in SEQ ID NO: 176 of the Sequence Listing. The AsHPPDm-A111T-F372A-01 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence is shown in SEQ ID NO: 177 of the Sequence Listing. The AsHPPDm-A111T-F372A-02 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 178 of the Sequence Listing.

[0221] The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A111T-F383W amino acid sequence shown in SEQ ID NO: 179 of the Sequence Listing. The AsHPPDm-A111T-F383W-01 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence is shown in SEQ ID NO: 180 of the Sequence Listing. The AsHPPDm-A111T-F383W-02 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence obtained based on the common codon usage bias of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 181 of the Sequence Listing.

[0222] The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence) shown in SEQ ID NO: 182 of the Sequence Listing. The HPPDm-2-01 nucleotide sequence encoding the HPPDm-2 amino acid sequence is shown in SEQ ID NO: 183 of the Sequence Listing. The HPPDm-2-02 nucleotide sequence encoding the HPPDm-2 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 184 of the Sequence Listing.

[0223] (3) Acquisition of HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence) The amino acid at position 106 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to glycine (G), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence) shown in SEQ ID NO: 185 of the Sequence Listing. The HPPDm-3-01 nucleotide sequence encoding the HPPDm-3 amino acid sequence is shown in SEQ ID NO: 186 of the Sequence Listing. The HPPDm-3-02 nucleotide sequence encoding the HPPDm-3 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 187 of the Sequence Listing.

[0224] (4) Acquisition of HPPDm-4 amino acid sequence (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence) The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, the amino acid at position 351 was mutated from the original lysine (K) to asparagine (N), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-4 amino acid sequence (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence) shown in SEQ ID NO: 188 of the Sequence Listing. The HPPDm-4-01 nucleotide sequence encoding the HPPDm-4 amino acid sequence is shown in SEQ ID NO: 189 of the Sequence Listing. The HPPDm-4-02 nucleotide sequence encoding the HPPDm-4 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 190 of the Sequence Listing.

[0225] (5) Acquisition of HPPDm-5 amino acid sequence (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence) The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), the amino acid at position 351 was mutated from the original lysine (K) to asparagine (N), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-5 amino acid sequence (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence) shown in SEQ ID NO: 191 of the Sequence Listing. The HPPDm-5-01 nucleotide sequence encoding the HPPDm-5 amino acid sequence is shown in SEQ ID NO: 192 of the Sequence Listing. The HPPDm-5-02 nucleotide sequence encoding the HPPDm-5 amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 193 of the Sequence Listing.

[0226] (6) Acquisition of HPPDm-6 amino acid sequence (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence) The amino acid at position 106 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to glycine (G), the amino acid at position 351 was mutated from the original lysine (K) to asparagine (N), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-6 amino acid sequence (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence) shown in SEQ ID NO: 194 of the Sequence Listing. The HPPDm-6-01 nucleotide sequence encoding the HPPDm-6 amino acid sequence is shown in SEQ ID NO: 195 of the Sequence Listing. The HPPDm-6-02 nucleotide sequence encoding the HPPDm-6 amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 196 of the Sequence Listing.

[0227] (7) Acquisition of HPPDm-7 amino acid sequence The HPPDm-7 amino acid sequence was obtained by mutating the C-terminal amino acid of the HPPD amino acid sequence derived from oats based on the AsHPPDm-A107-K351N-F372A-F383W amino acid sequence, and the HPPDm-7 amino acid sequence is set forth in SEQ ID NO: 197 of the Sequence Listing. The HPPDm-7-01 nucleotide sequence encoding the HPPDm-7 amino acid sequence is set forth in SEQ ID NO: 198 of the Sequence Listing. The HPPDm-7-02 nucleotide sequence encoding the HPPDm-7 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth in SEQ ID NO: 199 of the Sequence Listing.

[0228] (8) Acquisition of HPPDm-8 amino acid sequence The HPPDm-8 amino acid sequence was obtained by mutating the C-terminal amino acid of the HPPD amino acid sequence derived from oat based on the AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence, and the HPPDm-8 amino acid sequence is set forth in SEQ ID NO: 200 in the Sequence Listing. The HPPDm-8-01 nucleotide sequence encoding the HPPDm-8 amino acid sequence is set forth in SEQ ID NO: 201 in the Sequence Listing. The PPDm-8-02 nucleotide sequence encoding the HPPDm-8 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth in SEQ ID NO: 202 in the Sequence Listing.

[0229] (9) Acquisition of HPPDm-9 amino acid sequence The HPPDm-9 amino acid sequence was obtained by mutating the C-terminal amino acid of the HPPD amino acid sequence derived from oats based on the AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence, and the HPPDm-9 amino acid sequence is set forth in SEQ ID NO: 203 in the Sequence Listing. The HPPDm-9-01 nucleotide sequence encoding the HPPDm-9 amino acid sequence is set forth in SEQ ID NO: 204 in the Sequence Listing. The HPPDm-9-02 nucleotide sequence encoding the HPPDm-9 amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is set forth in SEQ ID NO: 205 in the Sequence Listing.

[0230] 2. Construction of a recombinant expression vector for Arabidopsis thaliana containing HPPD with combination mutations at multiple positions According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AsHPPDm-A107-F372A-02 nucleotide sequence, the AsHPPDm-A107-F383W-02 nucleotide sequence, the HPPDm-1-02 nucleotide sequence, the AsHPPDm-A111T-F372A-02 nucleotide sequence, the AsHPPDm-A111T-F383W ... The nucleotide sequence, HPPDm-2-02 nucleotide sequence, HPPDm-3-02 nucleotide sequence, HPPDm-4-02 nucleotide sequence, HPPDm-5-02 nucleotide sequence, HPPDm-6-02 nucleotide sequence, HPPDm-7-02 nucleotide sequence, HPPDm-8-02 nucleotide sequence, and HPPDm-9-02 nucleotide sequence were each subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11778 to DBN11790 in order. Sequencing confirmed that each of the aforementioned nucleotide sequences was correctly inserted into the recombinant expression vectors DBN11778 to DBN11790.

[0231] 3. Transformation of Agrobacterium with Arabidopsis Recombinant Expression Vectors According to the method of transforming Agrobacterium using the recombinant expression vector for Arabidopsis thaliana described in item 4 of Example 1 above, the correctly constructed recombinant expression vectors DBN11778-DBN11790, the recombinant expression vector DBN11727 of item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, and the control recombinant expression vector DBN11726N of item 3 of Example 1 were transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, which showed that the structures of the recombinant expression vectors DBN11778-DBN11790, DBN11727, and DBN11726N were completely correct.

[0232] 4. Detection of herbicide resistance in Arabidopsis plants carrying HPPD with multiple combined mutations In order to introduce the T-DNA of the recombinant expression vectors DBN11778 to DBN11790 constructed in item 2 of this Example, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in item 3 of Example 1, and the control recombinant expression vector DBN11726N in item 3 of Example 1 into Arabidopsis chromosomes, the Arabidopsis inflorescences were immersed in a solution of Agrobacterium described in item 3 of this Example according to the method described in item 5 of Example 1 above, thereby obtaining the corresponding transgenic Arabidopsis plants.That is, Arabidopsis thaliana T1 plants into which the AsHPPDm-A107-F372A-02 nucleotide sequence was introduced (AsHPPDm-A107-F372A-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-A107-F383W-02 nucleotide sequence was introduced (AsHPPDm-A107-F383W-02), Arabidopsis thaliana T1 plants into which the HPPDm-1-02 nucleotide sequence was introduced (HPPDm-1-02), and AsHPPDm-A1 Arabidopsis thaliana T1 plants into which the AsHPPDm-A111T-F372A-02 nucleotide sequence was introduced (AsHPPDm-A111T-F372A-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-A111T-F383W-02 nucleotide sequence was introduced (AsHPPDm-A111T-F383W-02), Arabidopsis thaliana T1 plants into which the HPPDm-2-02 nucleotide sequence was introduced (HPPDm-2-02), and Arabidopsis thaliana T1 plants into which the HPPDm-3-02 nucleotide sequence was introduced (HPPDm-3-02). Arabidopsis thaliana T1 plants introduced with the HPPDm-4-02 nucleotide sequence (HPPDm-4-02), Arabidopsis thaliana T1 plants introduced with the HPPDm-5-02 nucleotide sequence (HPPDm-5-02), Arabidopsis thaliana T1 plants introduced with the HPPDm-6-02 nucleotide sequence (HPPDm-6-02), and Arabidopsis thaliana T1 plants introduced with the HPPDm-7-02 nucleotide sequence. (HPPDm-7-02), Arabidopsis T1 plants into which the HPPDm-8-02 nucleotide sequence had been introduced (HPPDm-8-02), Arabidopsis T1 plants into which the HPPDm-9-02 nucleotide sequence had been introduced (HPPDm-9-02), Arabidopsis T1 plants into which the AsHPPD-02 nucleotide sequence had been introduced (AsHPPD-02), and Arabidopsis T1 plants into which a control recombinant expression vector had been introduced (DBN11726N) were obtained.

[0233] According to the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with topramezone at three different concentrations (i.e., 100 g ai / ha (4x field concentration, 4x), 200 g ai / ha (8x field concentration, 8x), and 0 g ai / ha (water, 0x)), isoxaflutole at three different concentrations (i.e., 140 g ai / ha (2x field concentration, 2x), 280 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)), and mesotrione at three different concentrations (i.e., 210 g ai / ha (2x field concentration, 2x), 420 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)). ai / ha (water, 0x)) to detect herbicide resistance in Arabidopsis thaliana. The experimental results are shown in Tables 10 to 12.

[0234] [Table 15]

[0235] The results in Table 10 show that: (1) Compared with CK and unmutated HPPD transgenic Arabidopsis plants, when treated with 4-fold or 8-fold field concentration of topramezone, HPPD genes with combination mutations at positions 372 and 383 and mutations at other positions (such as A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation, A111T+K351N+C-terminal mutation, or A106G+K351N+C-terminal mutation) can all confer high resistance to topramezone to plants. This indicates that the combination of the combined mutations at positions 372+383 of the HPPD amino acid sequence with mutations at other positions did not affect the topramezone resistance of the combined mutations at positions 372+383 alone, and indicates the importance and stability of plant resistance to HPPD-inhibiting herbicides conferred by the combined mutations at positions 372 and 383 of the HPPD amino acid sequence. In contrast, Arabidopsis T1 plants transfected with the control recombinant expression vector DBN11726N were not resistant to topramezone.

[0236] [Table 16]

[0237] [Table 17]

[0238] The results in Tables 11 and 12 show the following: (1) Compared with Arabidopsis plants transfected with CK and unmutated HPPD genes, all of the HPPD genes with combinations of mutations at positions 372 and 383 and mutations at other positions (such as A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation, A111T+K351N+C-terminal mutation, or A106G+K351N+C-terminal mutation) could confer high resistance to isoxaflutole and mesotrione, whereas Arabidopsis T1 plants transfected with the control recombinant expression vector DBN11726N had no resistance to isoxaflutole and mesotrione when treated with two- or four-fold field concentrations of isoxaflutole and mesotrione.

[0239] (2) In terms of resistance evaluation, when treated with four-fold field concentrations of isoxaflutole or mesotrione, Arabidopsis plants transfected with the HPPDm-1-02 (AsHPPDm-A107-F372A-F383W-02) gene showed better herbicide tolerance (high resistance) than Arabidopsis plants transfected with the AsHPPDm-A107-F372A-02 gene (low resistance) or the AsHPPDm-A107-F383W-02 gene (low resistance), and further, the effect of herbicide tolerance was synergistically improved. Similarly, Arabidopsis plants into which the HPPDm-2-02 (AsHPPDm-A111T-F372A-F383W) gene was introduced showed better herbicide resistance (high resistance) than Arabidopsis plants into which the AsHPPDm-A111T-F372A-02 gene (low resistance) or the AsHPPDm-A111T-F383W-02 gene (low resistance) was introduced, and furthermore, the effect of herbicide resistance was synergistically improved. Thus, the combination of the combined mutations at positions 372+383 of the HPPD amino acid sequence with mutations at other positions did not affect the synergistically improved herbicide resistance to HPPD-inhibiting herbicides of the combined mutations at positions 372+383 alone. Furthermore, the importance and stability of plant resistance to HPPD-inhibiting herbicides conferred by the combined mutations at positions 372 and 383 of the HPPD amino acid sequence are shown.

[0240] (3) In terms of resistance score, when treated with four-fold field concentration of isoxaflutole, Arabidopsis T1 plants into which the HPPDm-7-02 to HPPDm-9-02 nucleotide sequences had been introduced had a higher resistance score (0) than Arabidopsis T1 plants into which the HPPDm-1-02 to HPPDm-6-02 nucleotide sequences had been introduced, indicating that optimization of the C-terminus of the HPPD amino acid sequence is advantageous in improving plant tolerance to isoxaflutole.

[0241] Example 5: Verification of the combination mutation of the HPPD amino acid sequence (not the combination mutation F372A (F372G / F372V) + F383W) and its mutation effect 1. Acquisition of mutant HPPD amino acid sequences from oat and Arabidopsis (not the combined mutation F372A (F372G / F372V) + F383W) (1) A combination of HPPD mutant genes (F372A+F415W) derived from oat The amino acid at position 415 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F415W amino acid sequence shown in SEQ ID NO: 206 of the Sequence Listing. The AsHPPDm-F415W-01 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence is shown in SEQ ID NO: 207 of the Sequence Listing. The AsHPPDm-F415W-02 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence, obtained based on the Arabidopsis / soybean common codon usage bias, is shown in SEQ ID NO: 208 of the Sequence Listing.

[0242] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 415 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F415W amino acid sequence shown in SEQ ID NO: 209 of the Sequence Listing. The AsHPPDm-F372A-F415W-01 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence is shown in SEQ ID NO: 210 of the Sequence Listing. The AsHPPDm-F372A-F415W-02 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 211 of the Sequence Listing.

[0243] (2) A combination mutant gene of HPPD from Arabidopsis thaliana (F372A+F415W) The amino acid at position 424 of the AtHPPD amino acid sequence (corresponding to position 415 of the amino acid sequence described in SEQ ID NO: 1, i.e., position 415) was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F415W amino acid sequence described in SEQ ID NO: 212 of the Sequence Listing. The AtHPPDm-F415W-01 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence is described in SEQ ID NO: 213 of the Sequence Listing. The AtHPPDm-F415W-02 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence obtained based on the common codon usage bias of Arabidopsis thaliana / soybean is described in SEQ ID NO: 214 of the Sequence Listing.

[0244] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 415 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F415W amino acid sequence shown in SEQ ID NO: 215 of the Sequence Listing. The AtHPPDm-F372A-F415W-01 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence is shown in SEQ ID NO: 216 of the Sequence Listing. The AtHPPDm-F372A-F415W-02 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence obtained based on the Arabidopsis / soybean common codon usage bias is shown in SEQ ID NO: 217 of the Sequence Listing.

[0245] (3) A combination mutant gene of HPPD from oat (F372A+F383Y) The amino acid at position 383 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F383Y amino acid sequence shown in SEQ ID NO: 218 of the Sequence Listing. The AsHPPDm-F383Y-01 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence is shown in SEQ ID NO: 219 of the Sequence Listing. The AsHPPDm-F383Y-02 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 220 of the Sequence Listing.

[0246] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F372A-F383Y amino acid sequence shown in SEQ ID NO: 221 of the Sequence Listing. The AsHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence is shown in SEQ ID NO: 222 of the Sequence Listing. The AsHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 223 of the Sequence Listing.

[0247] (4) A combination mutant gene of HPPD from Arabidopsis (F372A+F383Y) The amino acid at position 392 of the AtHPPD amino acid sequence (corresponding to position 383 of the amino acid sequence described in SEQ ID NO: 1, i.e., position 383) was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F383Y amino acid sequence described in SEQ ID NO: 224 of the Sequence Listing. The AtHPPDm-F383Y-01 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence is described in SEQ ID NO: 225 of the Sequence Listing. The AtHPPDm-F383Y-02 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence obtained based on the common codon usage bias of Arabidopsis thaliana / soybean is described in SEQ ID NO: 226 of the Sequence Listing.

[0248] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F372A-F383Y amino acid sequence shown in SEQ ID NO: 227 of the Sequence Listing. The AtHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence is shown in SEQ ID NO: 228 of the Sequence Listing. The AtHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence obtained based on the common codon usage bias of Arabidopsis / soybean is shown in SEQ ID NO: 229 of the Sequence Listing.

[0249] 2. Construction of a recombinant expression vector for Arabidopsis thaliana containing a mutant HPPD gene (not the combined mutation F372A (F372G / F372V) + F383W) According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AsHPPDm-F415W-02 nucleotide sequence linked to the universal adapter primer 1, the AsHPPDm-F372A-F415W-02 nucleotide sequence, the AtHPPDm-F415W-02 nucleotide sequence, the AtHPPDm-F372A-F415 W-02 nucleotide sequence, AsHPPDm-F383Y-02 nucleotide sequence, AsHPPDm-F372A-F383Y-02 nucleotide sequence, AtHPPDm-F383Y-02 nucleotide sequence, and AtHPPDm-F372A-F383Y-02 nucleotide sequence were each subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11791 to DBN11798 in order. By sequencing, it was confirmed that each of the aforementioned nucleotide sequences was correctly inserted into the recombinant expression vectors DBN11791 to DBN11798.

[0250] 3. Transformation of Agrobacterium with Arabidopsis Recombinant Expression Vectors According to the method of transforming Agrobacterium using the recombinant expression vector for Arabidopsis thaliana described in item 4 of Example 1 above, the correctly constructed recombinant expression vectors DBN11791 to DBN11798, the recombinant expression vector DBN11727 of item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, the recombinant expression vector DBN11728 of item 3 of Example 1 containing the AsHPPDm-F372A-02 nucleotide sequence, the recombinant expression vector DBN11730 of item 2 of Example 2 containing the AtHPPDm-02 nucleotide sequence, and the recombinant expression vector DBN11731 of item 2 of Example 2 containing the AtHPPDm-F372A-02 nucleotide sequence were transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, which showed that the structures of the recombinant expression vectors DBN11791 to DBN11798, DBN11727, DBN11728, DBN11730 and DBN11731 were completely correct.

[0251] 4. Detection of herbicide resistance in Arabidopsis plants carrying mutant HPPD genes (but not the combined mutation F372A (F372G / F372V) + F383W) In order to introduce the T-DNA in the recombinant expression vectors DBN11791 to DBN11798, DBN11727, DBN11728, DBN11730, and DBN11731 constructed in Example 2 into Arabidopsis chromosomes, the method described in item 5 of Example 1 above was followed, and Arabidopsis inflorescences were immersed in a solution of Agrobacterium described in item 3 of this Example, to obtain the corresponding transgenic Arabidopsis plants. That is, Arabidopsis thaliana T1 plants into which the AsHPPDm-F415W-02 nucleotide sequence was introduced (AsHPPDm-F415W-02), Arabidopsis thaliana T1 plants into which the AsHPPDm-F372A-F415W-02 nucleotide sequence was introduced (AsHPPDm-F372A-F415W-02), Arabidopsis thaliana T1 plants into which the AtHPPDm-F415W-02 nucleotide sequence was introduced (AtHPPDm-F 415W-02), Arabidopsis T1 plant into which the AtHPPDm-F372A-F415W-02 nucleotide sequence has been introduced (AtHPPDm-F372A-F415W-02), Arabidopsis T1 plant into which the AsHPPDm-F383Y-02 nucleotide sequence has been introduced (AsHPPDm-F383Y-02), Arabidopsis T1 plant into which the AsHPPDm-F372A-F383Y-02 nucleotide sequence has been introduced (AsHPPDm-F383Y-02), (AsHPPDm-F372A-F383Y-02), Arabidopsis T1 plants into which the AtHPPDm-F383Y-02 nucleotide sequence has been introduced (AtHPPDm-F383Y-02), Arabidopsis T1 plants into which the AtHPPDm-F372A-F383Y-02 nucleotide sequence has been introduced (AtHPPDm-F372A-F383Y-02), Arabidopsis T We obtained Arabidopsis T1 plants (AsHPPD-02), Arabidopsis T1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced (AsHPPDm-F372A-02), Arabidopsis T1 plants into which the AtHPPDm-02 nucleotide sequence was introduced (AtHPPDm-02), and Arabidopsis T1 plants into which the AtHPPDm-F372A-02 nucleotide sequence was introduced (AtHPPDm-F372A-02).According to the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with three different concentrations of topramezone (i.e., 25 g ai / ha (1x field concentration, 1x), 100 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)) and five different concentrations of isoxaflutole (i.e., 35 g ai / ha (half-field concentration, 0.5x), 70 g ai / ha (1x field concentration, 1x), 140 g ai / ha (2x field concentration, 2x), 280 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)). ai / ha (water, 0x)) (among them, isoxaflutole at concentrations of 0x, 0.5x and 1x was used for the Arabidopsis thaliana T1 plants into which the mutant HPPD derived from Arabidopsis was introduced, and isoxaflutole at concentrations of 0x, 2x and 4x was used for the Arabidopsis thaliana T1 plants into which the mutant HPPD derived from oat was introduced), and mesotrione at five different concentrations (i.e., 52.5 g ai / ha (half-field concentration, 0.5x), 105 g ai / ha (one-field concentration, 1x), 210 g ai / ha (two-field concentration, 2x), 420 g ai / ha (four-field concentration, 4x) and 0 g ai / ha (four-field concentration, 4x). ai / ha (water, 0x) (among these, 0x, 0.5x and 1x concentrations of mesotrione were used for spraying Arabidopsis thaliana T1 plants into which Arabidopsis-derived mutant HPPD was introduced, and 0x, 2x and 4x concentrations of mesotrione were used for spraying Arabidopsis thaliana T1 plants into which oat-derived mutant HPPD was introduced) to detect herbicide resistance in Arabidopsis thaliana. The experimental results are shown in Tables 13 to 15.

[0252] [Table 18]

[0253] [Table 19]

[0254] [Table 20]

[0255] The results of Tables 13 to 15 show that the Arabidopsis T1 plants into which the HPPD gene having the combination mutation F372A+F415W or F372A+F383Y has been introduced, and the Arabidopsis T1 plants into which the HPPD gene having the single-position mutation F372A has been introduced, did not show substantially different resistance to HPPD-inhibiting herbicides. Therefore, it is found that not all combination mutations at any two positions of the HPPD amino acid sequence can confer synergistically improved resistance to HPPD-inhibiting herbicides to plants, and it is also shown that the synergistically improved technical effect caused by the mutations at positions 372+383 of the HPPD amino acid sequence of the present invention is unexpected.

[0256] Example 6: Obtaining and validating transgenic soybean plants 1. Transformation of Agrobacterium with recombinant expression vector The recombinant expression vector DBN11758 containing the SbHPPD-02 nucleotide sequence, the recombinant expression vector DBN11759 containing the SbHPPDm-F372A-02 nucleotide sequence, the recombinant expression vector DBN11760 containing the SbHPPDm-F383W-02 nucleotide sequence, and the recombinant expression vector DBN11761 containing the SbHPPDm-F372A-F383W-02 nucleotide sequence in item 2 of Example 2, and the control recombinant expression vector DBN11726N in item 3 of Example 1 were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method, respectively. This transformation was performed under the following transformation conditions. 100 μL of Agrobacterium LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes and immersed in 37°C warm water for 10 minutes. The transformed Agrobacterium LBA4404 was inoculated into an LB tube and cultured at 28°C and 200 rpm for 2 hours, then spread onto an LB plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin to grow the positive single clones, and the single clones were picked out and cultured to extract their plasmids. The extracted plasmids were identified by sequencing. The results showed that the structures of the recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761 and DBN11726N were completely correct.

[0257] 2. Obtaining transgenic soybean plants The T-DNA of the recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761 and DBN11726N (Schizophrenia mosaic virus 34S enhancer sequence, Brassica napus eukaryotic elongation factor gene 1α (Tsf1) promoter sequence, Arabidopsis thaliana chloroplast transit peptide sequence, 5-enolpyruvylshikimate-3-phosphate synthase gene, pea RbcS gene terminator sequence, Arabidopsis thaliana ubiquitin 10 gene promoter sequence, SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, nopaline synthase gene terminator sequence, cauliflower ... In order to introduce the SbHPPD-02 nucleotide sequence (including the Ik virus 35S promoter sequence, the phosphinothricin-N-acetyltransferase gene, and the Cauliflower mosaic virus 35S terminator sequence) into soybean chromosomes, the cotyledonary node tissues of the aseptically cultured soybean variety Zhonghuang13 were co-cultured with the Agrobacterium described in item 1 of this example according to a conventional Agrobacterium infection method, thereby obtaining soybean plants introduced with the SbHPPD-02 nucleotide sequence, soybean plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, soybean plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, soybean plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and soybean plants introduced with the control vector DBN11726N.

[0258] Briefly, for Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (B5 salts 3.1 g / L, B5 vitamins, sucrose 20 g / L, and agar 8 g / L, pH 5.6) and then cultured at 25 ± 1 °C with a 16 h / 8 h photoperiod (light / dark). Four to six days after germination, swollen soybean sterile seedlings with light green cotyledonary nodes were harvested, the hypocotyls were cut 3 to 4 mm below the cotyledonary nodes, the hypocotyls were cut longitudinally, and the apical buds, lateral buds, and seminal roots were removed. A wound was made at the cotyledonary node using the back of a scalpel, and the wounded cotyledonary node tissue was contacted with the Agrobacterium suspension. Here, Agrobacterium can transfer the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence, the SbHPPDm-F383W-02 nucleotide sequence, or the SbHPPDm-F372A-F383W-02 nucleotide sequence to wounded cotyledonary node tissue (Step 1: Infection Step). In this step, an Agrobacterium suspension (OD 660=0.5-0.8, the cotyledonary node tissue was preferably immersed in an infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, and zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue was co-cultured with Agrobacterium for a certain period of time (3 days) (step 2: co-culture step). Preferably, after the infection step, the cotyledonary node tissue was cultured in a solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, and agar 8 g / L, pH 5.6). After this co-cultivation step, an optional "recovery" step was performed using a recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, and aspartic acid 100 mg / L, pH 5.6) containing at least one antibiotic (cephalosporin 150-250 mg / L) to inhibit the growth of Agrobacterium and no selective agent for plant transformants (step 3: recovery step). Preferably, the tissue mass regenerated from the cotyledonary node was cultured on a solid medium containing an antibiotic and no selective agent to eliminate Agrobacterium and provide a recovery step for infected cells. The tissue mass regenerated from the cotyledonary node was then cultured on a medium containing a selective agent (glyphosate) to select the growing transformed callus (step 4: selection step). Preferably, transformed cells were selectively grown by culturing tissue masses regenerated from cotyledonary nodes on a screening solid medium containing a selection agent (B5 salts 3.1 g / L, vitamin B5, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, and N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6).Plants were then regenerated from the transformed cells (step 5: regeneration step). Preferably, the tissue mass regenerated from the cotyledonary node grown on the medium containing the selection agent was cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0259] The screened resistant tissues were transferred to B5 differentiation medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, and N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to B5 rooting medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and grown at 25°C on the rooting medium to a height of about 10 cm, then transferred to a glasshouse for seeding. In the greenhouse, the plants were grown at 26°C for 16 hours, then grown at 20°C for 8 hours per day.

[0260] Soybean T0 plants introduced with the SbHPPD-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and soybean T0 plants introduced with the control vector DBN11726N were transplanted into a greenhouse for cultivation and propagation to obtain corresponding transgenic T1 plants.

[0261] 3. Validation of transgenic soybean plants using TaqMan 100 mg of leaves were collected as samples from soybean T1 plants introduced with the SbHPPD-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and soybean T1 plants introduced with the control vector DBN11726N, and their genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. To determine the copy number of the mutant HPPD gene, the copy number of the EPSPS gene was detected by TaqMan probe fluorescent quantitative PCR. At the same time, wild-type soybean plants were used as controls and detected and analyzed according to the above-mentioned method. Three repeats were set for the experiment and averaged.

[0262] The specific method for detecting the copy number of the EPSPS gene was as follows.

[0263] Step 11: 100 mg of leaves were collected from the soybean T1 plant into which the SbHPPD-02 nucleotide sequence had been introduced, the soybean T1 plant into which the SbHPPDm-F372A-02 nucleotide sequence had been introduced, the soybean T1 plant into which the SbHPPDm-F383W-02 nucleotide sequence had been introduced, the soybean T1 plant into which the SbHPPDm-F372A-F383W-02 nucleotide sequence had been introduced, the soybean T1 plant into which the control vector DBN11726N nucleotide sequence had been introduced, and the wild-type soybean plant, and ground into a homogenate in a mortar using liquid nitrogen. Three replicates were performed for each sample.

[0264] Step 12: Genomic DNA was extracted from the above samples using Qiagen's DNeasy Plant Mini Kit, using the specific method described in the product manual.

[0265] Step 13: The concentration of genomic DNA in the above samples was detected using NanoDrop 2000 (Thermo Scientific).

[0266] Step 14: The concentration of genomic DNA in each of the above samples was adjusted to the same value in the range of 80 to 100 ng / μL.

[0267] Step 15: The copy numbers of the samples were determined using Taqman probe fluorescent quantitative PCR, with samples of known and determined copy numbers as standards and samples of wild-type soybean plants as controls, and three replicates for each sample were averaged. The fluorescent quantitative PCR primer and probe sequences were as follows:

[0268] The following primers and probe were used to detect the EPSPS gene sequence. Primer 1: ctggaaggcgaggacgtcatcaata described in SEQ ID NO: 232 of the sequence listing Primer 2: tggcggcattgccgaaatcgag described in SEQ ID NO: 233 of the sequence listing Probe 1: atgcaggcgatgggcgcccgcatccgta described in SEQ ID NO: 234 of the sequence listing PCR reaction system: JumpStart(TM) Taq ReadyMix(TM)(Sigma) 10μL 50x primer / probe mix 1μL Genomic DNA 3 μL Water (ddH2O) 6μL The 50x primer / probe mix contained 45 μL of each primer at a concentration of 1 mM, 50 μL of probe at a concentration of 100 μM, and 860 μL of 1x TE buffer and was stored at 4°C in amber tubes. PCR reaction conditions: Process temperature time twenty one 95℃ 5 minutes twenty two 95℃ 30 seconds twenty three 60℃ 1 minute twenty four Return to step 22 and repeat 40 times. Data were analyzed using the software SDS2.3 (Applied Biosystems).

[0269] By analyzing the experimental results on the copy number of the EPSPS gene, it was further demonstrated that the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence, the SbHPPDm-F383W-02 nucleotide sequence, the SbHPPDm-F372A-F383W-02 nucleotide sequence, and the control vector DBN11726N were all integrated into the chromosomes of the detected soybean plants, and the soybean T1 plants introduced with the SbHPPD-02 nucleotide sequence, the soybean T1 plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, the soybean T1 plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, the soybean T1 plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and the soybean T1 plants introduced with the control vector DBN11726N nucleotide sequence were all single-copy transgenic soybean plants.

[0270] 4. Detection of herbicide tolerance to HPPD-inhibiting herbicides in transgenic soybean plants Soybean T1 plants introduced with the SbHPPD-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, soybean T1 plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, soybean T1 plants introduced with the control vector DBN11726N nucleotide sequence, and wild-type soybean plants (seedling stage V3 to V4) were treated with topramezone at three different concentrations (i.e., 25 g ai / ha (1x field concentration, 1x), 100 g ai / ha (4x field concentration, 4x), and 0 g ai / ha (water, 0x)) and isoxaflutole at three different concentrations (i.e., 70 g ai / ha (1x field concentration, 1x), 280 g ai / ha (water, 0x)). ai / ha (4x field concentration, 4x), and 0g ai / ha (water, 0x)), and mesotrione at three different concentrations, i.e., 105g ai / ha (1x field concentration, 1x), 420g ai / ha (4x field concentration, 4x), and 0g ai / ha (water, 0x), respectively, were sprayed to detect herbicide resistance in soybean plants. According to the method of item 6 of Example 1, 7 days after spraying (7 DAT), the damage degree of each plant caused by the herbicide was statistically analyzed, and the score and resistance evaluation were performed accordingly. The soybean plants into which the SbHPPD-02 nucleotide sequence was introduced consisted of a total of two lines (S1 and S2), the soybean plants into which the SbHPPDm-F372A-02 nucleotide sequence was introduced consisted of a total of two lines (S3 and S4), the soybean plants into which the SbHPPDm-F383W-02 nucleotide sequence was introduced consisted of a total of two lines (S5 and S6), the soybean plants into which the SbHPPDm-F372A-F383W-02 nucleotide sequence was introduced consisted of a total of two lines (S7 and S8), the soybean plants into which the control vector DBN11726N nucleotide sequence was introduced consisted of a total of one line (S9), and the wild-type soybean plants consisted of a total of one line (CK1). Eight plants from each line were selected and detected. The results are shown in Tables 16 to 18.

[0271] [Table 21]

[0272] [Table 22]

[0273] [Table 23]

[0274] The results of Tables 16 to 18 show the following. (1) Compared with soybean plants into which the unmutated HPPD gene was introduced and wild-type soybean plants, soybean plants SbHPPDm-F372A-02, SbHPPDm-F383W-02 and SbHPPDm-F372A-F383W-02 were able to produce different degrees of resistance to different concentrations of HPPD-inhibiting herbicides, while DBN11726N had no resistance to HPPD-inhibiting herbicides. (2) Soybean plants into which the HPPD gene (F372A+F383W) with combination mutations at positions 372 and 383 was introduced showed better herbicide resistance than soybean plants into which the HPPD gene with single-position mutations F372A or F383W was introduced, and furthermore, the effect of herbicide resistance was synergistically improved. This indicates that mutated HPPD (F372A+F383W) can confer synergistically improved resistance to HPPD-inhibiting herbicides to transgenic soybean plants, further demonstrating the importance and stability of the herbicide tolerance of plants to HPPD-inhibiting herbicides conferred by the combined mutations at positions 372 and 383 of the HPPD amino acid sequence.

[0275] In conclusion, the present invention discloses for the first time that combined mutations at positions 372 and 383 of hydroxyphenylpyruvate dioxygenase polypeptides from various species can confer synergistically improved resistance to HPPD inhibitor herbicides pyrazolinates, isoxazoles and triketones, and in particular, resistance to four-fold field concentrations of topramezone, isoxaflutole or mesotrione in transgenic soybean plants. Thus, the present invention has the potential for broad-spectrum application in plants.

[0276] Finally, please note that all the above examples are only used to explain the embodiments of the present invention, not to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the embodiments of the present invention can be equivalently modified or replaced without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A mutant hydroxyphenylpyruvate dioxygenase polypeptide that retains the activity of catalyzing the conversion of 4-hydroxyphenylpyruvate to homogentisic acid or homogentisate and has a lower sensitivity to HPPD-inhibiting herbicides than wild-type HPPD, characterized in that it contains the following amino acid mutations at positions corresponding to the positions of the amino acid sequence set forth in SEQ ID NO:1, namely, a substitution of F at position 372 with A, G or V and a substitution of F at position 383 with W; Preferably, the mutated hydroxyphenylpyruvate dioxygenase polypeptide comprises amino acid mutations at the following positions corresponding to those in the amino acid sequence set forth in SEQ ID NO:1: an F to A substitution at position 372 and an F to W substitution at position 383; A mutant hydroxyphenylpyruvate dioxygenase polypeptide.

2. the mutant hydroxyphenylpyruvate dioxygenase polypeptide further comprises a second mutation, Preferably, the second mutation comprises at least one of the following amino acid mutations at positions corresponding to the positions of the amino acid sequence set forth in SEQ ID NO:1: A106G, A107 deletion, A111T, or K351N; The mutant hydroxyphenylpyruvate dioxygenase polypeptide of claim 1.

3. The mutant hydroxyphenylpyruvate dioxygenase polypeptide of claim 1 or 2, characterized in that the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO:173, SEQ ID NO:182, SEQ ID NO:185, SEQ ID NO:188, SEQ ID NO:191, SEQ ID NO:194, SEQ ID NO:197, SEQ ID NO:200 or SEQ ID NO:

203.

4. 4. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1, wherein the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from wild-type HPPD of a plant or a microorganism.

5. A polynucleotide encoding a mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 4.

6. An expression cassette or recombinant vector, characterized in that it comprises a polynucleotide according to claim 5 under the control of an operatively linked regulatory sequence.

7. A method for expanding the range of herbicides to which a plant is tolerant, comprising expressing a mutant hydroxyphenylpyruvate dioxygenase polypeptide described in any one of claims 1 to 4 together with at least one herbicide resistance protein other than a mutant hydroxyphenylpyruvate dioxygenase polypeptide described in any one of claims 1 to 4.

8. 8. The method of claim 7, wherein the herbicide resistance protein is 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome-like protein, and / or protoporphyrinogen oxidase.

9. 10. A method for selecting transformed plant cells, comprising transforming a plurality of plant cells with a polynucleotide according to claim 5 and culturing said cells under a concentration of an HPPD-inhibiting herbicide that allows growth of the transformed cells expressing said polynucleotide while killing or inhibiting growth of non-transformed cells, Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. Methods for selecting transformed plant cells.

10. A method for controlling weeds, comprising applying an effective amount of an HPPD-inhibiting herbicide to a field in which a target plant is planted, the target plant containing the polynucleotide according to claim 5; Preferably, the target plant is a glyphosate tolerant plant and the weed is a glyphosate resistant weed; Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. How to control weeds.

11. 10. A method for protecting a plant from damage caused by an HPPD-inhibiting herbicide or for conferring tolerance to an HPPD-inhibiting herbicide to a plant, comprising introducing into a plant the polynucleotide of claim 5 or the expression cassette or recombinant vector of claim 6, and causing the plant to produce a sufficient amount of a mutant hydroxyphenylpyruvate dioxygenase polypeptide after introduction to protect the plant from damage caused by the HPPD-inhibiting herbicide, Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. method.

12. A method for producing a plant that is tolerant to an HPPD-inhibiting herbicide, comprising introducing the polynucleotide according to claim 5 into the genome of said plant, Preferably, the method of introduction comprises genetic transformation, genome editing, or genetic mutation; Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. How to make it.

13. 1. A method for cultivating a plant that is tolerant to an HPPD-inhibiting herbicide, comprising the steps of: Planting at least one plant propagation material whose genome contains the polynucleotide of claim 5; Growing the plant propagation material on a plant; applying an effective amount of said HPPD-inhibiting herbicide to a plant growing environment including at least said plant, and harvesting said plant exhibiting reduced plant damage and / or increased plant yield compared to other plants not having the polynucleotide of claim 5. The present invention is characterized in that it comprises Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. Cultivation method.

14. 14. A method for obtaining processed agricultural products, comprising processing a harvest of HPPD-inhibiting herbicide-tolerant plants obtained by the method of claim 13 to obtain processed agricultural products.

15. A planting system for controlling the growth of weeds, comprising an HPPD-inhibiting herbicide and a plant growing environment in which at least one target plant is present, the target plant containing the polynucleotide of claim 5; Preferably, the target plant is a glyphosate tolerant plant and the weed is a glyphosate resistant weed; Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. Planting system.

16. 5. Use of a mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 4 for conferring tolerance to HPPD-inhibiting herbicides to a plant, comprising: Preferably, said HPPD-inhibiting herbicide comprises an HPPD-inhibiting herbicide of the pyrazolinates, triketones and / or isoxazoles classes, more preferably said HPPD-inhibiting herbicide of the pyrazolinates is topramezone, said HPPD-inhibiting herbicide of the isoxazoles isoxaflutole and said HPPD-inhibiting herbicide of the triketones is mesotrione. use.

Images